id
int64 7
5.24k
| url
stringlengths 48
63
| content
stringlengths 567
149k
|
|---|---|---|
1,951 | https://bio-protocol.org/exchange/protocoldetail?id=1951&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Organotypic Spinal Cord Slice Cultures and a Method to Detect Cell Proliferation in These Slices
Jillian M. Daniel
Jim Deuchars
Susan A. Deuchars
Published: Vol 6, Iss 19, Oct 5, 2016
DOI: 10.21769/BioProtoc.1951 Views: 11851
Reviewed by: Manuel D. GaheteKae-Jiun Chang
Original Research Article:
The authors used this protocol in Sep 2015
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Sep 2015
Abstract
In these culture models, the normal cytoarchitecture and local neuronal circuits of the spinal cord are preserved, offering a compromise between dissociated cell cultures and complete animal studies. The addition of 5-ethynyl-2’-deoxyuridine (EdU) to the culture medium allows for the detection of proliferating cells.
Keywords: Neurogenesis Spinal cord dissection Ependymal cell 5-ethynyl-2'-deoxyuridine
Materials and Reagents
Filter paper, 55 mm (Sigma-Aldrich, Whatman®, catalog number: WHA1441055 )
Millicell organotypic filter inserts 0.4 µm, 30 mm (EDM Millipore, catalog number: Picmorg50 )
6-well culture dishes (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 140675 )
24-well histology trays (Sigma-Aldrich, CELLSTAR®, catalog number: 662160 )
50 mm sterilin Petri dish (Camlab, catalog number: p17118 )
Note: This link leads to a range of Petri dishes.
Pipette tips, 1,000 µl (SARSTEDT, catalog number: 70.762.010 )
Pipette tips, 200 µl (SARSTEDT, catalog number: 70.760.012 )
Syringe
Glass microscope slides (Academy Science, catalog number: N/A143 )
Glass coverslips (VWR, catalog number: 631-0133 )
Tin foil
Mice (8-20 days old)
Ethanol (Sigma-Aldrich, catalog number: 32221 )
Acetone (Alfa Aesar, catalog number: L10407 )
Sodium pentobarbitone (Pentoject) (Animalcare, catalog number: XVD-132 )
5-ethynyl-2’-deoxyuridine (EdU) (Thermo Fisher Scientific, Molecular ProbesTM, catalog number: A10044 )
Paraformaldehyde (Sigma-Aldrich, catalog number: 158127 )
Phosphate buffered saline (Dulbecco A) (PBS) (Oxoid Limited, catalog number: BR0014 )
Triton X-100 (VWR, catalog number: 28817.295 )
Copper sulphate pentahydrate (CuSO4·5H2O) (VWR, catalog number: 84845.230 )
Biotin-azide (Kerafast, catalog number: EVU101 )
Ascorbic acid (Thermo Fisher Scientific, Fisher Scientific, catalog number: 12950364 )
Streptavidin Alexa555 conjugate (Thermo Fisher Scientific, Molecular ProbesTM, catalog number: S-32355 )
Vectashield mounting medium (Vecta Laboratories, catalog number: H-1000 and H-1200 )
DAPI (4’,6-diamidino-2-phenylindole)
Nail lacquer
Anti-PKD2L-1 (polycystic kidney disease 2-like 1 protein)
PBS tablets
Sodium phosphate monobasic monohydrate (NaH2PO4·H2O) (Thermo Fisher Scientific, Fisher Scientific, catalog number: 10667823 )
Sodium phosphate dibasic anhydrous (Na2HPO4) (Thermo Fisher Scientific, Fisher Scientific, catalog number: 10396313 )
Trizma base (Sigma-Aldrich, catalog number: T1503 )
Trizma hydrochloride (Sigma-Aldrich, catalog number: T3253 )
Sucrose (Thermo Fisher Scientific, Fisher Scientific, catalog number: 10386100 )
Sodium bicarbonate (NaHCO3) (Sigma-Aldrich, catalog number: 31437 )
Potassium chloride (KCl) (Sigma-Aldrich, catalog number: 746436 )
Magnesium sulphate (MgSO4·7H2O) (VWR, catalog number: 25165.260 )
Glucose (Thermo Fisher Scientific, Fisher Scientific, catalog number: 10539380 )
Calcium chloride (CaCl2) (Sigma-Aldrich, catalog number: 21114 )
Dulbecco’s modified Eagle’s medium (DMEM) (Sigma-Aldrich, catalog number: D6546 )
Penicillin and streptomycin (Sigma-Aldrich, catalog number: P4458 )
Neurobasal A medium (Thermo Fisher Scientific, GibcoTM, catalog number: 10888-022 )
L-glutamine (Sigma-Aldrich, catalog number: G7513 )
B-27 supplement (Thermo Fisher Scientific, GibcoTM, catalog number: 17504-044 )
Fetal bovine serum (FBS) (Sigma-Aldrich, catalog number: F6178 )
Phosphate buffered saline (PBS) (see Recipes)
0.2 M phosphate buffer (PB) (see Recipes)
0.1 M Tris buffer (see Recipes)
Sucrose artificial cerebrospinal fluid (see Recipes)
8% paraformaldehyde solution (PFA) (see Recipes)
4% paraformaldehyde solution in 0.1 M PB (see Recipes)
Dissection medium (see Recipes)
Culture medium with serum (see Recipes)
Culture medium serum free (see Recipes)
Equipment
Autoclave (Dixons Surgical Instrument, model: VARIO 1528 )
P1000 pipetman classic pipette (Gilson Scientific, catalog number: F123602 )
P20 pipetman classic pipette (Gilson Scientific, catalog number: F123600 )
Laminar flow hood (biological safety cabinet) (The Baker Company, model: Steril Gard class II type A )
CO2 incubator (Panasonic, model: MCO-18AC-PE )
Dissection microscope (Vickers, instruments)
Dissection equipment (Figure 1)
Dissection scissors
Spring scissors
Fine forceps x 2
Microspatula
Tissue chopper (McIlwain)
Razor blades (Wilkinson sword)
Shaker plate (IKA, model: Vibrax-vxr )
Fine paint brush
Figure 1. Equipment used for dissection
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Daniel, J. M., Deuchars, J. and Deuchars, S. A. (2016). Organotypic Spinal Cord Slice Cultures and a Method to Detect Cell Proliferation in These Slices . Bio-protocol 6(19): e1951. DOI: 10.21769/BioProtoc.1951.
Download Citation in RIS Format
Category
Neuroscience > Cellular mechanisms > Cell isolation and culture
Cell Biology > Cell isolation and culture > Cell growth
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,952 | https://bio-protocol.org/exchange/protocoldetail?id=1952&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
PNGase Sensitivity Assay to Study the Folding Status of Proteins
Satoshi Ninagawa
Kazutoshi Mori
Published: Vol 6, Iss 19, Oct 5, 2016
DOI: 10.21769/BioProtoc.1952 Views: 7253
Edited by: Ralph Bottcher
Reviewed by: Joëlle SchlapferGregory C. Finnigan
Original Research Article:
The authors used this protocol in Nov 2015
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Nov 2015
Abstract
This protocol aims to evaluate folding status of proteins, utilizing peptide:N-glycanase (PNGase) sensitivity. In the cytosol, PNGase works as a deglycosylation-enzyme. N-glycans on unfolded/misfolded proteins are more susceptible to PNGase than N-glycans on folded proteins because of the preference of PNGase to non-native proteins. PNGase is endogenously expressed in various cell types, including HCT116 cells, DT40 cells and mouse embryonic fibroblast cells. Partial deglycosylation by PNGase can be detected by faster migration of band in SDS-PAGE. You can compare tightness of the folding among wild-type and mutant proteins of interest. This method can be used with regular molecular and cell biology equipment, but applied only to glycoproteins.
Keywords: PNGase Protein folding Glycoproteins
Materials and Reagents
6 well dish (Corning, Falcon®, catalog number: 353046 ) (Stored at room temperature)
PVDF membrane (GE Healthcare, catalog number: 10600023 ) (Stored at room temperature)
DT40 cell line (DT40 is a B cell line derived from an avian leukosis virus induced bursal lymphoma in a white leghorn chicken) (ATCC, catalog number: CRL-2111 ) (Endogenous expression of cytosolic PNGase)
Homo sapiens colon colorectal carcinoma cell line (HCT116) (ATCC, catalog number: CCL-247 ), HCT116 cells (ATCC, catalog number: CCL-247) (Endogenous expression of cytosolic PNGase)
Opti-mem (Thermo Fisher Scientific, GibcoTM, catalog number: 31985-070 )
Lipofectamine 2000 (Thermo Fisher Scientific, InvitrogenTM, catalog number: 11668019 )
Dulbecco’s modified Eagle’s medium (DMEM) (NACALAI TESQUE, catalog number: 08458-45 ) (Stored at 4 °C)
Fetal bovine serum (FBS) (Thermo Fisher Scientific, GibcoTM, catalog number: 10270-106 )
100 U/ml penicillin and 100 μg/ml streptomycin (NACALAI TESQUE) (Stored at -20 °C)
RPMI (NACALAI TESQUE, catalog number: 30263-95 ) (Stored at 4 °C)
Chicken serum (Thermo Fisher Scientific, GibcoTM, catalog number: 16110-082 )
1 M dithiothreitol (DTT) (Wako Pure Chemical Industries, catalog number: 041-08976 ) (for reduction of proteins; in water; stored at -20 °C)
20 mM carbobenzoxy-valyl-alanyl-aspartyl-[O-methyl]-fluoromethylketone (Z-VAD-fmk) (Promega, catalog number: G7231 ) (for inhibition of PNGase activity; stored at -20 °C)
Nonidet P-40 (NACALAI TESQUE, catalog number: 23640-94 ) (for HCT116; stored at room temperature)
4% digitonin (Wako Pure Chemical Industries, catalog number: 043-21371 ) (for DT40; in water; stored at -80 °C)
Anti-myc antibody (MEDICAL & BIOLOGICAL LABORATORIES, catalog number: 562 ) (Stored at -20 °C)
Anti-β-actin antibody conjugated with HRP (Wako Pure Chemical Industries, catalog number: 017-24573 )
NaCl (Wako Pure Chemical Industries, catalog number: 191-01665 )
Na2HPO4
KCl
KH2PO4
Tris/HCl, pH 8.0 (Sigma-Aldrich, catalog number: T6791 ) (Stored at room temperature)
Glycerol
Bromophenol blue (BPB)
Sodium dodecyl sulfate
Protease inhibitor cocktail (100x) (NACALAI TESQUE, catalog number: 25955-11 ) (for inhibition of various proteases’ activity; in ddH2O; stored at -20 °C)
10 mM Z-Leu-Leu-Leu-CHO (MG132) (PEPTIDE INSTITUTE, catalog number: 3175-v ) (for inhibition of proteasomal activity; in DMSO; stored at -20 °C)
Phosphate buffered saline (PBS) (see Recipes)
2x sodium dodecyl sulfate (SDS) sample buffer (pH 6.8) (see Recipes)
Buffer A (Stored at 4 °C) (see Recipes)
Buffer B (see Recipes)
Equipment
High speed refrigerated micro centrifuge (Tomy, model: MX-301 )
mPAGE (ATTO, model: AE-6530 ) (Using hand-made 10% gel)
Transfer equipment (ATTO, model: WSE-4020 )
Heat block (TAITEC, model: DTU-1BN )
Micro porator (Digital Bio, model: MP-100 )
Software
ImageJ
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
How to cite： Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Ninagawa, S. and Mori, K. (2016). PNGase Sensitivity Assay to Study the Folding Status of Proteins. Bio-protocol 6(19): e1952. DOI: 10.21769/BioProtoc.1952.
Ninagawa, S., Okada, T., Sumitomo, Y., Horimoto, S., Sugimoto, T., Ishikawa, T., Takeda, S., Yamamoto, T., Suzuki, T., Kamiya, Y., Kato, K. and Mori, K. (2015). Forcible destruction of severely misfolded mammalian glycoproteins by the non-glycoprotein ERAD pathway. J Cell Biol 211(4): 775-784.
Download Citation in RIS Format
Category
Biochemistry > Protein > Modification
Biochemistry > Carbohydrate > Glycoprotein
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,953 | https://bio-protocol.org/exchange/protocoldetail?id=1953&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Trypsin Sensitivity Assay to Study the Folding Status of Proteins
Satoshi Ninagawa
Kazutoshi Mori
Published: Vol 6, Iss 19, Oct 5, 2016
DOI: 10.21769/BioProtoc.1953 Views: 10267
Edited by: Ralph Bottcher
Reviewed by: Melike ÇağlayanGregory C. Finnigan
Original Research Article:
The authors used this protocol in Nov 2015
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Nov 2015
Abstract
This protocol aims to evaluate folding status of proteins, utilizing trypsin sensitivity. Unfolded/misfolded proteins are more susceptible to trypsin than folded proteins, because trypsin easily accesses and cleaves loosely folded parts of proteins. This method is especially useful to compare tightness of the folding among wild-type and mutant proteins. As trypsin generally cleaves a peptide bond at the carboxyl-terminal side of the amino acids lysine or arginine, this method can be used to analyze the folding status of different types of proteins such as integral membrane or soluble proteins (Ninagawa et al., 2015) and is applicable to cell lysates of any species and tissues as well as to recombinant proteins. You can use this technique with regular molecular and cell biology equipment.
Keywords: Trypsin Protein folding Integral membrane and soluble proteins
Materials and Reagents
6 well dish (Corning, Falcon®, catalog number: 353046 )
PVDF membrane (GE Healthcare, catalog number: 10600023 )
DT40 cell line (DT40 is a B cell line derived from an avian leukosis virus induced bursal lymphoma in a white leghorn chicken) (ATCC, catalog number: CRL-2111 )
Homo sapiens colon colorectal carcinoma cell line (HCT116) (ATCC, catalog number: CCL-247 )
Dulbecco’s modified Eagle’s medium (DMEM) (NACALAI TESQUE, catalog number: 08458-45 )
Fetal bovine serum (FBS) (Thermo Fisher Scientific, GibcoTM, catalog number: 10270-106 )
100 U/ml penicillin and 100 μg/ml streptomycin (NACALAI TESQUE)
RPMI (NACALAI TESQUE, catalog number: 30263-95 )
Chicken serum (Thermo Fisher Scientific, GibcoTM, catalog number: 16110-082 )
Opti-mem (Thermo Fisher Scientific, GibcoTM, catalog number: 31985-070 )
Lipofectamine 2000 (Thermo Fisher Scientific, InvitrogenTM, catalog number: 11668019 )
2.5 g/L trypsin (NACALAI TESQUE, catalog number: 32777-44 )
Protease inhibitor cocktail (100x) (NACALAI TESQUE, catalog number: 25955-11 ) (for inhibition of various proteases’ activity such as trypsin, in ddH2O; stored at -20 °C)
NaCl (Wako Pure Chemical Industries, catalog number: 191-01665) (for DT40)
Na2HPO4
KCl
KH2PO4
Tris/HCl (pH 8.0) (Sigma-Aldrich, catalog number: T6791 ) (Stored at room temperature)
Glycerol
Bromophenol blue (BPB)
Sodium dodecyl sulfate
Nonidet P-40 (NACALAI TESQUE, catalog number: 23640-94 ) (for HCT116)
20 mM carbobenzoxy-valyl-alanyl-aspartyl-[O-methyl]-fluoromethylketone (Z-VAD-fmk) (Promega, catalog number: G7231 ) (for inhibition of PNGase activity)
10 mM Z-Leu-Leu-Leu-CHO (MG132) (PEPTIDE INSTITUTE, catalog number: 3175-v ) (in DMSO; inhibition of proteasomal activity, stored at -20 °C)
1 M dithiothreitol (DTT) (Wako Pure Chemical Industries, catalog number: 041-08976 ) (in water; for reduction of proteins)
Anti-β-actin antibody (Wako Pure Chemical Industries, catalog number: 017-24573 )
Anti-myc antibody (MEDICAL & BIOLOGICAL LABORATORIES, catalog number: 562 )
Phosphate buffered saline (PBS) (see Recipes)
2x sodium dodecyl sulfate (SDS) sample buffer (pH 6.8) (see Recipes)
Buffer A (see Recipes)
Buffer B (see Recipes)
Equipment
High speed refrigerated micro centrifuge (Tomy, model: MX-301 )
mPAGE (ATTO, model: AE-6530 ) (Using hand-made 10% gel)
Transfer equipment (ATTO, model: WSE-4020 )
Heat block (TAITEC, model: DTU-1BN )
Micro porator (Digital Bio, model: MP-100 )
Software
ImageJ
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
How to cite： Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Ninagawa, S. and Mori, K. (2016). Trypsin Sensitivity Assay to Study the Folding Status of Proteins. Bio-protocol 6(19): e1953. DOI: 10.21769/BioProtoc.1953.
Ninagawa, S., Okada, T., Sumitomo, Y., Horimoto, S., Sugimoto, T., Ishikawa, T., Takeda, S., Yamamoto, T., Suzuki, T., Kamiya, Y., Kato, K. and Mori, K. (2015). Forcible destruction of severely misfolded mammalian glycoproteins by the non-glycoprotein ERAD pathway. J Cell Biol 211(4): 775-784.
Download Citation in RIS Format
Category
Biochemistry > Protein > Modification
Biochemistry > Protein > Structure
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,954 | https://bio-protocol.org/exchange/protocoldetail?id=1954&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
PCR-based Assay for Genome Integrity after Methyl Methanesulfonate Damage in Physcomitrella patens
MO Masaki Odahara
TI Takayuki Inouye
YN Yoshiki Nishimura
YS Yasuhiko Sekine
Published: Vol 6, Iss 19, Oct 5, 2016
DOI: 10.21769/BioProtoc.1954 Views: 7782
Edited by: Marisa Rosa
Original Research Article:
The authors used this protocol in Nov 2015
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Nov 2015
Abstract
In plant cells, genomic DNA exists in three organelles: the nucleus, chloroplast, and mitochondrion. Genomic DNA can be damaged by endogenous and exogenous factors, but the damaged DNA can be repaired by DNA repair systems. To quantify the extent of their repair activity of on individual genomic DNA, a PCR-based assay utilizing long amplicons is valuable for evaluable. This assay is based on the inhibitory effects of methyl methanesulfonate (MMS)-induced DNA damage on the amplicons. This assay is useful for assessing DNA double-strand repair pathways, such as homologous recombination repair, as it detects DNA double-strand breaks produced by MMS in vivo.
Keywords: Chloroplast Genome stability PCR DNA damage Physcomitrella patens
Background
The quantification of genomic DNA damage is useful for analyzing DNA repair mechanisms. This assay utilizes real-time PCR to quantify the nuclear, chloroplast, and mitochondrial DNA copy number for the normalization of long PCR products, providing more accurate quantification compared with that by the previous protocol by Hunter et al. (2010).
Materials and Reagents
90 mm plastic Petri dish
50 ml tube
1.5 ml tube
Physcomitrella patens protonemal cells (cultivated for 4 days)
BCDAT medium (Nishiyama et al., 2000)
Methyl methanesulfonate (MMS) (Sigma-Aldrich, catalog number: 129925 )
Chloroform (Sigma-Aldrich, catalog number: V800117 )
Ethanol (Sigma-Aldrich, catalog number: 09-0770 )
RNase A
LA Taq (TAKARA BIO, catalog number: RR002A )
Agarose powder (Promega, catalog number: V3125 )
0.7% agarose gel
Ethidium bromide (EtBr)
Power SYBR® green PCR master mix (Thermo Fisher Scientific, Applied BiosystemsTM, catalog number: 4367659 )
Hexadecyltrimethylammonium bromide (CTAB) (Sigma-Aldrich, catalog number: H-5882 )
Sodium chloride (NaCl) (Sigma-Aldrich, catalog number: 28-2270 )
Tris-HCl, pH 8.0 (Wako Pure Chemical Industries, catalog number: 206-07884 )
Ethylenediamine-N,N,N’,N’-tetraacetic acid, disodium salt, dihydrate (EDTA) (DOJINDO, catalog number: 345-01865 )
PEG8000 (MP Biomedicals, catalog number: 02194839 )
Oligonucleotide DNA primers for long amplicon quantitative PCR:
Nuclear DNA (5′-GTGGAAGTGAGATGCAGTTTGG-3′ and 5'-GTGGCTCTGGACAGTGAAATTG-3′)
Chloroplast DNA (5′-AATTGGAGTCGGTCCTTCCATA-3′ and 5′-TGGCAAATACAATGGCAAAAAG-3′)
Mitochondrial DNA (5′-GACTGCCCTCACTAGGATGCTT-3′ and 5′-TGGGTGATTTACTCCATTGACG-3′)
Oligonucleotide DNA primers for short amplicon quantitative PCR:
Nuclear DNA (5′-CAACCGTCTTCTGTGTCTAGGTC-3′ and 5′-GAAACCGGCCTGCATTACATG-3′)
Chloroplast DNA (5′-AGTAATCCCATCGCGTGACAT-3′ and 5′-AGGTATGGAAAAAATCGCTGAAAA-3′)
Mitochondrial DNA (5′-CGTGCTAAAAATCCAGTCCATTC-3′ and 5′-AGCAAAGAAGTCAAGACCTAACAAAAC-3′)
2x CTAB buffer (see Recipes)
10% CTAB (see Recipes)
CTAB ppt buffer (see Recipes)
NaCl-TE (see Recipes)
TE buffer (see Recipes)
PEG solution (see Recipes)
Equipment
Forceps
Multi-beads shocker (Yasui Kikai)
Vacuum pump (Tokyo Rikakikai, catalog number: AS-3 )
Bench top centrifuge for 1.5 ml tubes
Heat block for 1.5 ml tubes (TAITEC, catalog number: DTU-2CN )
Standard thermal cycler (Bio-Rad Laboratories, catalog number: 170-8720JA )
Real-time PCR thermal cycler (Thermo Fisher Scientific, Applied BiosystemsTM, model: Applied Biosystems® 7500 Fast Real-Time PCR Systems )
Software
ImageJ (https://imagej.nih.gov/ij/)
Excel (Microsoft)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Odahara, M., Inouye, T., Nishimura, Y. and Sekine, Y. (2016). PCR-based Assay for Genome Integrity after Methyl Methanesulfonate Damage in Physcomitrella patens. Bio-protocol 6(19): e1954. DOI: 10.21769/BioProtoc.1954.
Download Citation in RIS Format
Category
Molecular Biology > DNA > DNA damage and repair
Plant Science > Plant molecular biology > DNA
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,955 | https://bio-protocol.org/exchange/protocoldetail?id=1955&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Cell Wall-bound p-Coumaric and Ferulic Acid Analysis
NA Nickolas Anderson
Published: Vol 6, Iss 19, Oct 5, 2016
DOI: 10.21769/BioProtoc.1955 Views: 7319
Edited by: Marisa Rosa
Original Research Article:
The authors used this protocol in Nov 2015
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Nov 2015
Abstract
Hydroxycinnamic acids, such as p-coumaric acid and ferulic acid, are a major class of compounds derived from the phenylpropanoid pathway. These compounds are widely conserved in plants and primarily accumulate in the secondary cell wall. They serve as important structural components that contribute to the overall strength and rigidity of plant cell walls and are also potent antioxidants valued for nutritional consumption. This protocol describes a method for analyzing hydroxycinnamic acids that are released after incubation under alkaline conditions.
Keywords: Cell wall P-coumaric acid Ferulic acid
Materials and Reagents
50 ml conical tubes (MIDSCI, catalog number: C50B )
2 ml microfuge tubes (MIDSCI, catalog number: AVX-T-20-C )
Arabidopsis inflorescence tissue
Liquid nitrogen
Ethanol, pure (Sigma-Aldrich, catalog number: E7023 )
Acetone (Sigma-Aldrich, catalog number: 320110 )
1 N NaOH (Sigma-Aldrich, catalog number: S8045 )
3,4,5-trimethoxycinnamic acid (Sigma-Aldrich, catalog number: T70408 )
HCl (concentrated hydrochloric acid) (36-38%) (Sigma-Aldrich, catalog number: H1758 )
Ethyl acetate (Sigma-Aldrich, catalog number: 270989 )
Acetonitrile (Sigma-Aldrich, catalog number: 271004 )
0.1% formic acid (Sigma-Aldrich, catalog number: 94318 )
p-coumaric acid (Sigma-Aldrich, catalog number: C9008 )
Ferulic acid (Sigma-Aldrich, catalog number: 128708 )
50% methanol (Sigma-Aldrich, catalog number: 34860 )
Equipment
Mortar and pestle
Plastic spoon (appropriate for handling small volumes)
Shaking incubator, 37 °C
Centrifuge with a rotor that can accommodate 50 ml conical tubes and can reach 10,000 x g
Microcentrifuge
Vortex
Drying oven, 70 °C
Water bath, 65 °C
Chemical scoop (appropriate for handling small volumes)
Micropipette and tips (Mettler-Toledo, catalog number: L-STARTXLS+ )
Repeating pipettor with adaptor syringe for dispensing 200 µl (Mettler-Toledo, model: AR-E1 )
Speed Vac
Analytical balance
HPLC system with UV detector and autosampler (Shimadzu prominence modular HPLC: system controller CBM-20A, solvent delivery unit LC-20A, auto-sampler SIL-20A, column oven CTO-20A, UV-VIS detector SPD-20A)
HPLC glass vials (VWR, catalog number: 89220-128 )
Shim-pack XR-ODS column (column dimensions 3.0 x 75 mm, bead size 2.2 µm) (Shimadzu, model: Shim-pack XR-ODS )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
How to cite： Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Anderson, N. (2016). Cell Wall-bound p-Coumaric and Ferulic Acid Analysis. Bio-protocol 6(19): e1955. DOI: 10.21769/BioProtoc.1955.
Anderson, N. A., Bonawitz, N. D., Nyffeler, K. and Chapple, C. (2015). Loss of FERULATE 5-HYDROXYLASE leads to mediator-dependent inhibition of soluble phenylpropanoid biosynthesis in Arabidopsis. Plant Physiol 169(3): 1557-1567.
Download Citation in RIS Format
Category
Biochemistry > Other compound > Acid
Plant Science > Plant biochemistry > Other compound
Plant Science > Plant cell biology > Tissue analysis
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,956 | https://bio-protocol.org/exchange/protocoldetail?id=1956&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Isolation of Primary Breast Cancer Cells from HER2 Transgenic Mice
SL Shou Liu
HC Hexin Chen
Published: Vol 6, Iss 19, Oct 5, 2016
DOI: 10.21769/BioProtoc.1956 Views: 13614
Edited by: HongLok Lung
Reviewed by: Shravani Mukherjee
Original Research Article:
The authors used this protocol in Feb 2015
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Feb 2015
Abstract
HER2 is a tyrosine kinase receptor, which is overexpressed in about 30% of breast cancer patients. Its overexpression leads to mammary tumorigenesis and increased invasion and metastasis (Slamon et al., 1987). HER2 transgenic mouse (FVB/N-MMTVneu mouse) is a well-established model of mammary tumor in human (Fantozzi and Christofori, 2006). Although in vivo models are excellent for assessing the influence of various factors, especially microenvironment, on development of breast cancer, a convenient and less costly way to study the underlying molecular events is utilizing cells derived from the model under evaluation. In order to explore the molecular mechanism by which HOXB7 inhibits initiation, but promotes metastasis of breast tumors, we generated mouse breast cancer cell line from HER2 transgenic mouse (Liu et al., 2015). This protocol may be useful for the generation of breast cancer cell line from mice with other genetic backgrounds.
Keywords: HER2 Transgenic mice Primary breast cancer cells Mouse breast cancer cell line
Materials and Reagents
Cell strainer, sterile (100 μm) (Corning, Falcon®, catalog number: 352360 )
10 cm standard tissue culture dish (Corning, catalog number: 430293 )
50 ml conical tubes, sterile (Corning, Falcon®, catalog number: 352070 )
Disposable scalpels, forceps and scissors (VWR International)
HER2 transgenic mice (THE JACKSON LABORATORY, catalog number: 002376 )
0.25% trypsin-EDTA (1x) (Thermo Fisher Scientific, GibcoTM, catalog number: 25200-056 )
Phosphate-buffered saline (PBS), sterile (self-preparation)
HEPES (Sigma-Aldrich, catalog number: H3375 )
DMEM/F12-with L-glutamine (Thermo Fisher Scientific, GibcoTM, catalog number: 11875-093 )
Bovine serum albumin solution (BSA) (Sigma-Aldrich, catalog number: A9576 )
Hydrocortisone (Sigma-Aldrich, catalog number: H0888 )
Type IV collagenase (Sigma-Aldrich, catalog number: C5138 )
Hyaluronidase (Sigma-Aldrich, catalog number: H3884 )
Pen-Strep (GE Healthcare, HyCloneTM, catalog number: SV30010 )
Ammonium chloride (NH4Cl) (Sigma-Aldrich, catalog number: A9434 )
Tris (Sigma-Aldrich, catalog number: 93362 )
Fetal bovine serum (FBS), heat inactivated (GE Healthcare, HyCloneTM, catalog number: SH30071.03 )
Insulin (with transferrin/selenium) (Thermo Fisher Scientific, GibcoTM, catalog number: 51500-056 )
Digestion buffer (see Recipes)
Tris-buffered ammonium chloride (TAC buffer) (see Recipes)
Complete media (see Recipes)
Equipment
Shaking incubator (Thermo Fisher Scientific, Thermo Scientific, model: SHKA5000 )
37 °C, 5% CO2 cell culture incubator (VWR, symphonyTM, model: 5.3A )
Pipette
Refrigerated centrifuge (Eppendorf, model: 5418R )
Water bath
Hemocytometer
Inverted microscope (Olympus Corporation, model: CKX41 )
Tissue culture hood equipped with UV light source (Labconco, model: Purifier Logic+ Class II , Type A2 Biosafety Cabinet)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Liu, S. and Chen, H. (2016). Isolation of Primary Breast Cancer Cells from HER2 Transgenic Mice. Bio-protocol 6(19): e1956. DOI: 10.21769/BioProtoc.1956.
Download Citation in RIS Format
Category
Cancer Biology > Cancer stem cell > Cell biology assays
Cell Biology > Cell isolation and culture > Cell isolation
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,957 | https://bio-protocol.org/exchange/protocoldetail?id=1957&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Light/Dark Transition Test to Assess Anxiety-like Behavior in Mice
Tsvetan Serchov
DC Dietrich van Calker
KB Knut Biber
Published: Vol 6, Iss 19, Oct 5, 2016
DOI: 10.21769/BioProtoc.1957 Views: 22338
Edited by: Soyun Kim
Reviewed by: Xi Feng
Original Research Article:
The authors used this protocol in Aug 2015
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Aug 2015
Abstract
The light/dark transition test (LDT) is one of the most widely used tests to measure anxiety-like behavior in mice. The test is based on the natural aversion of mice to brightly illuminated areas and on their spontaneous exploratory behavior in response to mild stressors, such as novel environment and light. This test is also sensitive to anxiolytic drugs treatment. The test apparatus consists of a box divided into a small (one third) dark chamber and a large (two thirds) brightly illuminated chamber. Mice are placed into the lit compartment and allowed to move freely between the two chambers. The first latency to enter the dark compartment and the total time spent in lit compartment are indices for bright-space anxiety in mice. Transitions are index of activity-exploration, because of habituation over time. LDT is quick and easy to use, without requiring prior training of animals. Here, we present our protocol that has been able to detect both anxiolytic-like (reduced anxiety) and anxiogenic-like (increased anxiety) behavior in mice.
Keywords: Anxiety Light dark transition test Behaviour Mouse
Materials and Reagents
Paper towels
Laboratory-bred mice
Note: Mice housed in groups 3-5 per cage, kept in a room with controlled temperature (~23 °C) and humidity under 12 h light/dark cycle (lights on at 7:00 AM) with ad libitum access to food and water.
70% ethanol
Equipment
The apparatus for the light/dark transition test consists of a box (42 x 21 x 25 cm) divided into a small (one third) dark compartment and a large (two thirds) illuminated compartment (Crawley and Goodwin, 1980). A restricted opening 3 cm high by 4 cm wide connects the two chambers (Figure 1).
Indirect white light source
Digital lux meter
Video camera (placed directly above the apparatus)
Digital chronometers for manual analysis or computer for automated analysis
Figure 1. Light-dark transition test apparatus
Software
TSE-Systems, model: VideoMot2 (computer software for automated analysis)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Serchov, T., van Calker, D. and Biber, K. (2016). Light/Dark Transition Test to Assess Anxiety-like Behavior in Mice. Bio-protocol 6(19): e1957. DOI: 10.21769/BioProtoc.1957.
Download Citation in RIS Format
Category
Neuroscience > Behavioral neuroscience > Cognition
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,958 | https://bio-protocol.org/exchange/protocoldetail?id=1958&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Sucrose Preference Test to Measure Anhedonic Behaviour in Mice
Tsvetan Serchov
DC Dietrich van Calker
KB Knut Biber
Published: Vol 6, Iss 19, Oct 5, 2016
DOI: 10.21769/BioProtoc.1958 Views: 34313
Edited by: Soyun Kim
Reviewed by: Xi Feng
Original Research Article:
The authors used this protocol in Aug 2015
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Aug 2015
Abstract
The sucrose preference test (SPT) is a reward-based test, used as in indicator of anhedonia. Anhedonia, or the decreased ability to experience pleasure, represents one of the core symptoms of depression. Rodents are born with an interest in sweet foods or solutions. Reduced preference for sweet solution in SPT represents anhedonia, while this reduction can be reversed by treatment with antidepressants. SPT is carried out in the animal’s home cage. For the SPT, mice are presented with 2 dual bearing sipper tubes. One tube contains plain drinking water, and the second contains a sucrose solution. Water and sucrose solution intake is measured daily, and the positions of two bottles is switched daily to reduce any confound produced by a side bias. Sucrose preference is calculated as a percentage of the volume of sucrose intake over the total volume of fluid intake and averaged over the testing period. Here, we present our protocol that has been able to detect anhedonia in mice subjected to a chronic depression model.
Keywords: Anhedonia Sucrose preference Chronic despair model Depression
Materials and Reagents
Bearing sipper bottles
Drinking bottles
Laboratory-bred mice
Note: Mice housed in groups 3-5 per cage, kept in a room with controlled temperature (~23 °C) and humidity under 12 h light/dark cycle (lights on at 7:00 AM) with ad libitum access to food and water.
Sucrose (EMD Millipore, catalog number: 573113 )
Plain tap water
Equipment
Mouse cage without lid, which allows positioning of two bearing sipper water bottles (Figure 1)
Digital balance
Figure 1. Mouse cage with two bearing sipper bottles
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Serchov, T., van Calker, D. and Biber, K. (2016). Sucrose Preference Test to Measure Anhedonic Behaviour in Mice. Bio-protocol 6(19): e1958. DOI: 10.21769/BioProtoc.1958.
Download Citation in RIS Format
Category
Neuroscience > Behavioral neuroscience > Cognition
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,959 | https://bio-protocol.org/exchange/protocoldetail?id=1959&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Spectrophotometric Determination of Glutamine Synthetase Activity in Cultured Cells
IP I-Chen Peng
AB Alex J. Bott
Z Wei-Xing Zong
Published: Vol 6, Iss 19, Oct 5, 2016
DOI: 10.21769/BioProtoc.1959 Views: 12737
Edited by: Masahiro Morita
Reviewed by: Raghuveer Kavarthapu
Original Research Article:
The authors used this protocol in Dec 2015
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Dec 2015
Abstract
Glutamine synthetase (GS), which catalyzes the conversion of glutamate and ammonia to glutamine, is widely distributed in animal tissues and cell culture lines. The importance of this enzyme is suggested by the fact that glutamine, the product of GS-catalyzed de novo synthesis reaction, is the most abundant free amino acid in blood (Smith and Wilmore, 1990). Glutamine is involved in many biological processes including serving as the nitrogen donor for biosynthesis, as an exchanger for the import of essential amino acids, as a means to detoxifying intracellular ammonia and glutamate, and as a bioenergetics nutrient to fuel the tricarboxylic acid (TCA) cycle (Bott et al., 2015). The method for the assay of GS enzymatic activity relies on its γ-glutamyl transferase reaction by measuring γ-glutamylhydroxamate synthesized from glutamine and hydroxylamine, and the chromatographic separation of the reaction product from the reactants (Deuel et al., 1978). An overview of the GS glutamyl transferase reaction can be found in Figure 1. GS activity was measured by a spectrophotometric assay at a specific wavelength of 560 nm using a microplate reader. The method is simple, and has a comparable sensitivity with those methods applying radioactively labelled substrates. This modified procedure has been applied to assay/determine GS activity in cultured cell lines including the human mammary epithelial MCF10A cells and the murine pre-B FL5.12 cells, and could be used to measure GS activity in other cell lines.
Figure 1. An overview of the GS glutamyl transferase reaction
Keywords: Glutamine synthetase Activity assay Glutamate ammonia ligase GLUL GS
Materials and Reagents
0.05% trypsin-EDTA (1x) (Thermo Fisher Scientific, GibcoTM, catalog number: 25300-054 )
PBS (1x) (Corning, catalog number: 21-031-CV )
Imidazole (Sigma-Aldrich, catalog number: I0250 )
L-glutamine (Sigma-Aldrich, catalog number: G3126 )
Hydroxylamine hydrochloride (Sigma-Aldrich, catalog number: 55459 )
Sodium arsenate dibasic heptahydrate (Sigma-Aldrich, catalog number: S9663 )
Manganese(II) chloride tetrahydrate (MnCl2·4H2O) (Sigma-Aldrich, catalog number: 221279 )
Adenosine 5’-diphosphate sodium salt (ADP) (Sigma-Aldrich, catalog number: A2754 )
Iron(III) chloride hexahydrate (FeCl3) (Sigma-Aldrich, catalog number: 31232 )
Trichloroacetic acid (Sigma-Aldrich, catalog number: 522082 )
Note: This product has been discontinued.
Hydrochloric acid (HCl) (Sigma-Aldrich, catalog number: 258148 )
L-glutamic acid γ-monohydroxamate (γ-glutamylhydroxamate) (Sigma-Aldrich, catalog number: G2253 )
Lysis buffer (see Recipes)
1x assay buffer (see Recipes)
1x stop buffer (see Recipes)
γ-glutamylhydroxamate standard stock (see Recipes)
Equipment
AccumetTM AB15 Basic and BioBasicTM pH/mV/°C Meters (Thermo Fisher Scientific, Fisher Scientific, catalog number: 13-636-AB15B )
Sonicator (model: CL-18/120 ) (Thermo Fisher Scientific, Fisher ScientificTM, catalog number: FB120110 )
-80 °C freezer
37 °C incubator
Microcentrifuge (Eppendorf, model: 5418 )
Microplate (96-well plate clear bottom) reader (Molecular Devices, model: SpectraMax M5 )
Software
SoftMaxPro software
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Peng, I., Bott, A. J. and Zong, W. (2016). Spectrophotometric Determination of Glutamine Synthetase Activity in Cultured Cells. Bio-protocol 6(19): e1959. DOI: 10.21769/BioProtoc.1959.
Download Citation in RIS Format
Category
Biochemistry > Protein > Activity
Cancer Biology > Cellular energetics > Biochemical assays
Molecular Biology > Protein > Detection
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
196 | https://bio-protocol.org/exchange/protocoldetail?id=196&type=1 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Protocol to Determine Mitotic Index by FACS
Hui Zhu
Published: Mar 20, 2012
DOI: 10.21769/BioProtoc.196 Views: 19207
Download PDF
Ask a question
Favorite
Cited by
Abstract
Fluorescence Activated Cell Sorting (FACS) is a sensitive method to count mitotic cells. Cells are stained with an antibody that recognizes an antigen present only in mitotic cells, combined with propidium iodide (PI) to stain DNA. Two-dimensional FACS scanning allows the differential quantitation of G2 and mitotic cells. Several antibodies to different mitotic markers have been used in the community, including antibodies to MPM-2 antigens present in mitotic cells. MPM-2 recognizes a phosphorylated epitope (LTPLK or YWFSPL) 6, 7 in a distinct class of phosphoproteins including MAP2, HSP70, cdc25, and DNA topoisomerase IIα, most of which are phosphorylated at the onset of mitosis. The commercial availability and specificity of antibodies to histone H3 phosphorylated at threonine 11, which is present only in mitotic cells, has also been widely used to detect mitosis cells.
Keywords: Mitotic cells FACS MPM-2 antigens
Materials and Reagents
Phosphate buffered saline (PBS)
Ethanol
Triton X-100 (Sigma-Aldrich, catalog number: T9284 )
BSA (Sigma-Aldrich, catalog number: A3803 )
MPM-2 monoclonal antibody
Anti-phospho-Histone H3 (Thr11) (EMD Millipore, catalog number: 06-570 )
Anti-phospho-Ser/Thr-Pro, MPM-2 (EMD Millipore, catalog number: 05-368 )
Alexa 488-conjugated goat anti-mouse immunoglobulin G antibody (Life Technologies, Molecular Probes®/Alexa Fluor® 488, catalog number: A-11008 or A-11034 )
RNase A (Sigma-Aldrich, catalog number: R4642 )
PI (Sigma-Aldrich, catalog number: P-4170 )
Equipment
Centrifuges (Beckman Falcon, TLS-55 )
Incubator
FACS machine
FACS tubes (BD Biosciences, Falcon®, catalog number: 352054 )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2012 The Authors; exclusive licensee Bio-protocol LLC.
Category
Cancer Biology > Proliferative signaling > Cell biology assays
Cell Biology > Cell-based analysis > Flow cytometry
Cell Biology > Cell signaling > Phosphorylation
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,960 | https://bio-protocol.org/exchange/protocoldetail?id=1960&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Mouse Corneal Stroma Fibroblast Primary Cell Culture
YZ Yujin Zhang
YW Yen-Chiao Wang
OY Okada Yuka
LZ Lingling Zhang
Chia-Yang Liu
Published: Vol 6, Iss 19, Oct 5, 2016
DOI: 10.21769/BioProtoc.1960 Views: 8924
Reviewed by: Jingli Cao
Original Research Article:
The authors used this protocol in Oct 2015
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Oct 2015
Abstract
This protocol is developed for primary cell culture of cornea stromal keratocytes isolated from neonatal mouse eyeballs. It provides an optimal condition to isolate stromal keratocytes which maintain high viability for cell culture.
Keywords: Mouse Corneal stroma Primary culture
Materials and Reagents
15 ml Falcon tube (Corning, Falcon®, catalog number: 352095 )
Petri dish (Thermo Fisher Scientific, Fisher Scientific, catalog number: FB0875713 )
NunclonTM tissue culture dish (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 172931 )
New born mice (postnatal day 0)
70% sterile ethanol (prepared from ethanol 190 proof) (Decon Labs, catalog number: 2801 )
Distilled water (Thermo Fisher Scientific, GibcoTM, catalog number: 15230162 )
PBS without Ca2+ Mg2+ (Thermo Fisher Scientific, GibcoTM, catalog number: 20012050 )
Trypsin-EDTA (Thermo Fisher Scientific, GibcoTM, catalog number: 25200072 )
DMEM (Thermo Fisher Scientific, GibcoTM, catalog number: 11995-065 )
Fetal bovine serum (GE Healthcare, HycloneTM, catalog number: SH30396.03 )
Penicillin-streptomycin (Thermo Fisher Scientific, GibcoTM, catalog number: 15140122 )
DMSO (Sigma-Aldrich, catalog number: D2650 )
Liquid nitrogen
Dispase II (Roche Diagnostics, catalog number: 04942078001 )
Sorbitol
Collagenase (Type L) (Sigma-Aldrich, catalog number: C8170 ), sterile-filtered, dissolved in PBS and stored at -20 °C.
Hyaluronidase
Disapse solution (see Recipes)
Digestion buffer (see Recipes)
Equipment
CO2 cabinet
Chemical hood
Tissue culture hood
Phase-contrast inverted microscope (Electron Microscopy Sciences)
Spring scissor (Fine Science Tools, catalog number: 15009-08 )
Forceps (Fine Science Tools, catalog number: 00108-11 )
Benchtop centrifuge (Hettich Lab Technology, model: Rotina 380 )
Pipettes
Hemocytometer (Hausser Scientific)
CO2 incubator
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Zhang, Y., Wang, Y., Yuka, O., Zhang, L. and Liu, C. (2016). Mouse Corneal Stroma Fibroblast Primary Cell Culture. Bio-protocol 6(19): e1960. DOI: 10.21769/BioProtoc.1960.
Download Citation in RIS Format
Category
Cell Biology > Cell isolation and culture > Cell growth
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,961 | https://bio-protocol.org/exchange/protocoldetail?id=1961&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Mungbean Yellow Mosaic India Virus (MYMIV)-infection, Small RNA Library Construction and Deep Sequencing for MicroRNA Identification in Vigna mungo
Anirban Kundu
Sujay Paul
Amita Pal
GT Genotypic Technology
Published: Vol 6, Iss 20, Oct 20, 2016
DOI: 10.21769/BioProtoc.1961 Views: 10175
Edited by: Samik Bhattacharya
Reviewed by: Tohir BozorovTarakaramji Moturu
Original Research Article:
The authors used this protocol in Jan 2014
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jan 2014
Abstract
This protocol describes small RNA library preparation from Vigna mungo total RNA followed by deep sequencing and analysis for microRNA identification.
Keywords: MYMIV Vigna mungo MicroRNA Deep sequencing Regards
Materials and Reagents
Filter papers
Plastic pots
Young Vigna mungo plants
Whiteflies (Bemisia tabaci)
HgCl2
TruSeq small RNA Library Preparation Kit (Illumina, catalog number: RS-200-0012 )
Trizol reagent (Invitrogen, USA)
Isopropanol
Acrylamide/bisacrylamide (Merck Millipore, catalog number: 623100281001730 )
T4 RNA ligase 2, truncated (New England Biolabs, catalog number: M0242 )
Tris-HCl pH 7.5
MgCl2
DTT
ATP
PEG8000
SuperScript® II reverse transcriptase (Thermo Fisher Scientific, InvitrogenTM, catalog number: 18064014 )
TEMED (Merck Millipore, catalog number: 623171280051730 )
Ammonium persulphate (Merck Millipore, catalog number: 623171100101730 )
10x TBE buffer (Thermo Fisher Scientific, AmbionTM, catalog number: AM9865 )
UltraPureTM glycogen (Thermo Fisher Scientific, InvitrogenTM, catalog number: 10814-010 )
3 M sodium acetate (Sigma-Aldrich, catalog number: S7899-100ml )
Absolute ethanol (EMD Millipore, catalog number: 100983 )
Qubit® dsDNA HS Assay Kit (Thermo Fisher Scientific, InvitrogenTM, catalog number: Q32854 )
High Sensitivity DNA Kit (Agilent Technologies, catalog number: 5067-4626 )
T4 RNA Ligase 2 buffer (see Recipes)
Equipment
Electrophoresis apparatus (Bio-Rad Laboratories, model: Mini-Sub® GT Cell )
Bioanalyzer (Agilent Technologies, model: Agilent 2100 )
Thermocycler, DNA engine cycler (Bio-Rad Laboratories, model: PTC-0200G )
Qubit 3.0 fluorometer (Life Technologies)
Illumina genome analyzer IIx (Illumina)
Software
Cutadapt-0.9.3
Bowtie-0.12.7
SeqQCv2.1
BLAST (Rfam and miRBase)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Kundu, A., Paul, S., Pal, A. and Technology, G. (2016). Mungbean Yellow Mosaic India Virus (MYMIV)-infection, Small RNA Library Construction and Deep Sequencing for MicroRNA Identification in Vigna mungo. Bio-protocol 6(20): e1961. DOI: 10.21769/BioProtoc.1961.
Download Citation in RIS Format
Category
Plant Science > Plant molecular biology > RNA
Molecular Biology > RNA > RNA interference
Microbiology > Microbe-host interactions > Virus
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,962 | https://bio-protocol.org/exchange/protocoldetail?id=1962&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
The Chick Embryo Chorioallantoic Membrane as an in vivo Model to Study Metastasis
Piero Crespo
Berta Casar
Published: Vol 6, Iss 20, Oct 20, 2016
DOI: 10.21769/BioProtoc.1962 Views: 21081
Edited by: HongLok Lung
Reviewed by: Anita Umesh
Original Research Article:
The authors used this protocol in Aug 2015
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Aug 2015
Abstract
Metastasis is a complex process that includes several steps: neoplastic progression, angiogenesis, cell migration and invasion, intravasation into nearby blood vessels, survival in the circulatory system, extravasation followed by homing into distant tissues, the formation of micrometastases, and finally the growth into macroscopic secondary tumors. This complexity makes metastases difficult to investigate and quantify in animal models. The chick embryo is a unique in vivo model that overcomes many limitations for studying the metastatic process, due to the accessibility of the chorioallantoic membrane (CAM), a well-vascularized extra-embryonic tissue located under the eggshell, that is receptive to the xenografting of mammalian tumor cells, including human. Since the chick embryo is naturally immunodeficient at this stage, the CAM can support the engraftment of tumor cells, and their growth therein can faithfully recapitulate most of the characteristics of the carcinogenic process including: growth, invasion, angiogenesis and colonization of distant tissues (Deryugina and Quigley, 2008; Zijlstra et al., 2002). The CAM sustains rapid tumor formation within 5-7 days after cancer cell grafting. This feature provides a unique experimental model for a rapid study of the intravasation and colonization steps of the metastatic cascade. Furthermore, using quantitative PCR to detect species-specific sequences, such as Alu, the chick embryo CAM model can be used to monitor and quantify the presence of the xenografted, ectopic tumor cells in distant tissues. Thus, the chick embryo model has proved a valuable tool for cancer research, in particular for the investigation of molecules and pathways involved in cancer metastasis and to analyze the response of metastatic cancer to potential therapies (Herrero et al., 2015; Casar et al., 2014). In this respect, the use of the rapid and quantitative spontaneous metastasis chick embryo model can provide an alternative approach to conventional mouse model systems for screening anti-cancer agents.
Keywords: Metastasis model CAM Tumor growth Cancer
Materials and Reagents
20 G needles (BD, PrecisionGlideTM, catalog number: 305175 )
30 G needles (BD, PrecisionGlideTM, catalog number: 305128 )
MicroAmp® optical 96 well PCR plate (Thermo Fisher Scientific, Applied BiosystemsTM, catalog number: N8010560 )
MicroAmp® optical adhesive film (Thermo Fisher Scientific, Applied BiosystemsTM, catalog number: 4311971 )
Cotton tipped applicators, cotton swab, Iodine liquid (Thermo Fisher Scientific)
Laboratory tape 1/2" x 500" (VWR, catalog number: 470144-262 )
Fertilized chicken eggs (Gilbert farm, Tarragona, Spain)
A375 melanoma cell line (ATCC, catalog number: CRL-1619 )
SKMEL2 (ATCC, catalog number: HTB68 )
RKO colorectal cancer cell line (ATCC, catalog number: CRL-2577 )
HCT116 (ATCC, catalog number: CCL-247 )
DEL 22379 (Vichem Chemie, Budapest)
Trypsin 0.05% with EDTA (1 mM), liquid (Thermo Fisher Scientific, GibcoTM, catalog number: 25300-054 )
Phosphate-buffered saline (PBS) (1x, pH 7.4), liquid (Thermo Fisher Scientific, GibcoTM, catalog number: 10010023 )
Penicillin-streptomycin (10,000 U/ml) (Thermo Fisher Scientific, GibcoTM, catalog number: 15140122 )
Dulbecco’s modified Eagle medium (DMEM) (Thermo Fisher Scientific, catalog number: 41965062 )
Fetal bovine serum (Thermo Fisher Scientific, GibcoTM, catalog number: 10270-106 )
QIA amp genomic DNA purification kit (QIAGEN, catalog number: 158906 ; 158910 ; 158914 )
Primers (HPLC purification, IDT DNA technologies)
Alu (human) sense: 5’ ACGCCTGTAATCCCAGGACTT 3’
Alu (human) antisense: 5’ TCGCCCAGGCTGGCTGGGTGCA 3’
Chicken GAPDH sense: 5’ GAGGAAAGGTCGCCTGGTGGATCG 3’
Chicken GAPDH antisense: 5’ GGTGAGGACAAGCAGTGAGGA ACG 3’
SYBR® green mix real time PCR (Thermo Fisher Scientific, Applied BiosystemsTM, catalog number: 4472908 )
Equipment
Incubator 37 °C, 60% humidity (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 51028117 )
Rotating eggs trays (automatic eggs turner) (GQF, catalog number: 1611 )
Tugon tube (Drifton, model: Tygon LMT )
Egg candler (Lyon, model: 950-170 )
Microsurgical kits, sterile forceps, push pin, dissection scissors, needle nose forceps (VWR, IntegraTM Miltex®, catalog number: 95042-542 )
Dremel 100 rotary tool (Dremel, model: 100N/7 )
Dremel cut off wheels number 36 (Dremel)
Hemocytometer, Neubauer chamber (EMD Millipore)
2-20 µl pipette (Eppendorf, Eppendorf Research®, catalog number: 3120000038 )
20-200 µl pipette (Eppendorf, Eppendorf Research®, catalog number: 3120000054 )
Automatic pipette (Eppendorf, Eppendorf Easypet® 3, catalog number: 4430000018 )
Real time PCR instrument (Thermo Fisher Scientific, Applied BiosystemsTM, model: StepOne plus RT PCR )
Software
Graph Pad Prism software
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Crespo, P. and Casar, B. (2016). The Chick Embryo Chorioallantoic Membrane as an in vivo Model to Study Metastasis. Bio-protocol 6(20): e1962. DOI: 10.21769/BioProtoc.1962.
Download Citation in RIS Format
Category
Cancer Biology > Invasion & metastasis > Cell biology assays
Cell Biology > Cell movement > Cell migration
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,963 | https://bio-protocol.org/exchange/protocoldetail?id=1963&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Lipid Extraction from HeLa Cells, Quantification of Lipids, Formation of Large Unilamellar Vesicles (LUVs) by Extrusion and in vitro Protein-lipid Binding Assays, Analysis of the Incubation Product by Transmission Electron Microscopy (TEM) and by Flotation across a Discontinuous Sucrose Gradient
AB Amina Bittame
JL Jodie Lopez
GE Gregory Effantin
Nicolas Blanchard
Marie-France Cesbron-Delauw
Jean Gagnon
CM Corinne Mercier
Published: Vol 6, Iss 20, Oct 20, 2016
DOI: 10.21769/BioProtoc.1963 Views: 15561
Edited by: Ivan Zanoni
Original Research Article:
The authors used this protocol in Dec 2015
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Dec 2015
Abstract
Dissecting the interactions established between proteins and membranes in a given type of cells is not an easy task. Using a cell-free system of large unilamellar vesicles (LUVs) to analyze these interactions may help decipher these interactions and identify potential membrane deformations induced by the proteins incubated with these LUVs. This article describes the protocols for 1) extraction of total lipids from eukaryotic cells using the method developed by Bligh and Dyer (1959), 2) the quantification of glycerophospholipids by gas chromatography after methanolysis, followed by 3) the formation of LUVs by extrusion, 4) protein-lipid binding assay, 5) analysis of the incubation product by transmission electron microscopy (TEM) and by flotation across a discontinuous sucrose gradient and finally, 6) analysis of the proteins by immunoblot and revelation of the glycerophospholipids by iodin fumigation.
Keywords: Large Unilamellar Vesicles (LUVs) Liposomes Protein-Lipid Binding Assay Discontinuous Sucrose Gradients Transmission Electron Microscopy
Background
Cell-free systems consisting in giant unilamellar vesicles (GUVs; vesicles composed of a single bilayer of phospholipids and with a diameter greater than 1 μm) or liposomes incubated with recombinant proteins may help understand these interactions. Depending on their diameter and number of lamellae, liposomes are classified into small unilamellar vesicles (SUVs; vesicles constituted of a single bilayer of phospholipids and with a diameter comprised between 20 and 100 nm), large unilamellar vesicles (LUVs; vesicles constituted of a single bilayer of phospholipids and with a diameter comprised between 100 and 400 nm), large multilamellar vesicles (MLVs; vesicles constituted of multiple phospholipid bilayers and with a diameter comprised between 200 nm and 3 μm) and multivesicular vesicles (MVVs; large vesicles composed of a single bilayer of phospholipids and containing several smaller vesicles, each composed of a single bilayer of phospholipids).
When a dried mix of lipids is dispersed in an aqueous solvent, large multilamellar vesicles (LMVs) form spontaneously. Smaller liposomes (SUVs or LUVs) may then be formed by sonication or extrusion. Here we report the formation of LUVs by extrusion of LMVs formed from complex lipids extracted from HeLa cells and their use to investigate Toxoplasma proteins/membrane interactions by flotation across a sucrose gradient and by TEM.
Materials and Reagents
PYREX® disposable glass conical centrifuge tubes without cap (capacity: 50 ml) (Sigma-Aldrich, catalog number: CLS9950250-72EA )
Disposable screw thread culture tubes with marking spot (ø13 mm) (KIMAX test tubes with Teflon liner caps) (Thomas Scientific, catalog number: 9210J23 )
Pasteur pipettes (non-plugged, L 5 ¾ in.) (Sigma-Aldrich, catalog number: S6018 )
Polycarbonate membranes (Avanti Polar Lipids)
Note: The diameter of their pores is defined by the manipulator (Example: 100 nm, Avanti Polar Lipids, catalog number: 610005 ).
Grids for transmission electron microscopy (grid size 400 mesh x 62 μm pitch, copper) (Sigma-Aldrich, catalog number: G5026 )
0.80 ml open ultra-clear centrifuge tubes (size 5 x 41 mm) (Beckman Coulter; catalog number: 344090 ) and split adaptors (Beckman Coulter; catalog number: 356860 )
Nitrocellulose membranes for protein transfer as for example: nitrocellulose membranes, 0.2 µm, 8 x 12 cm (Thermo Fisher Scientific, catalog number: 77012 )
HeLa cells (ATTC, catalog number: CCL-2 )
Dulbecco’s modified Eagle’s medium (DMEM) (Thermo Fisher Scientific, catalog number: 41966-029/052 )
Fetal bovine serum (FBS) (Eurobio, catalog number: CVFSVF0001 )
Penicillin/streptomycin (PAN-Biotech, catalog number: P06-07100 )
L-glutamine (200 mM) (Thermo Fisher Scientific, catalog number: 25030-024 )
Dulbecco’s phosphate-buffered saline (DPBS) (Thermo Fisher Scientific, GibcoTM, catalog number: 14190-094/069 )
Chloroform (for HPLC, ≥ 99.8%, amylene stabilized) (Sigma-Aldrich, catalog number: 34854 )
Methanol (for HPLC, ≥ 99.9%) (Sigma-Aldrich, catalog number: 34860 )
Water sterile-filtered (BioReagent, suitable for cell culture) (Sigma-Aldrich, catalog number: W3500 )
C21:0 fatty acid (Heneicosanoic acid) (Matreya, catalog number: 1241 )
Hexane (anhydrous, 95%) (Sigma-Aldrich, catalog number: 296090 )
Sulfuric acid (99.999%) (Sigma-Aldrich, catalog number: 339741 )
HEPES free acid [N-(2-hydroxyethyl)piperazine-N’-(2-ethanesulfonic acid); 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid)] (Sigma-Aldrich, catalog number: H3375 )
Sodium chloride (NaCl) (ACS reagent, ≥ 99.0%) (Sigma-Aldrich, catalog number: S9888 )
Liquid N2
Uranyl acetate (Electron Microscopy Sciences, catalog number: 22400 )
Sucrose (≥ 99.5%) [α-D-Glucopyranosyl, β-D-fructofuranoside, D(+)-Saccharose] (Sigma-Aldrich, catalog number: S8501 )
Iodine (ACS reagent, ≥ 99.8%, solid) (Sigma-Aldrich, catalog number: 207772 )
Complete DMEM medium (see Recipes)
Protein-lipid binding buffer (see Recipes)
Equipment
Flasks (150 cm2) (Dominique Dutscher, catalog number: 190150 )
37 °C/5% CO2 cell culture incubator (Dominique Dutscher, catalog number: 911378M )
Refrigerated bench centrifuge (Dominique Dutscher, catalog number: 472456 )
Fume hood (standard equipment of any lab)
Vortex (Dominique Dutscher, catalog number: 079030 )
Bottle of nitrogen gas
Freezer (-20 °C) (Dominique Dutscher, catalog number: 099288B )
10 μl positive displacement pipet such as microman Gilson model M10 (Gilson, catalog number: F148501 )
Oven (for dry heat: 100 °C) (Dominique Dutscher, catalog number: 780405 )
BPX70 gas chromatography column (30 m x 0.25 mm ID BPX70 0.25 μm) (Trajan Scientific, catalog number: 0 54622 )
Gas chromatography apparatus (Shimadzu, ref GC-2010 Plus High-end GC)
Water bath (37 °C) (Dominique Dutscher, catalog number: 910648 )
Extruder set with holder/heating block (Avanti Polar Lipids, catalog number: 610000 )
2 x 250 μl Hamilton® GASTIGHT® syringes, 1800 series (1825N, volume 250 μl, needle size 22s ga [bevel tip], needles L51 mm [2 in.]) (Sigma-Aldrich, catalog number: 21394 )
Fridge (4 °C) (Dominique Dutscher, catalog number: 670251B )
Rotating agitator (Dominique Dutscher, catalog number: 062646 )
Carbon evaporator (Q150T Turbo-Pumped sputter coater/carbon coater) (Quorum Technologies, model: Q150T )
Electron transmission microscope such as JEOL-1400 plus (MET 120 kV) (JEOL, model: 1400 Plus )
Ultracentrifuge type TL100 labtop equipped with an MLS-50 Swinging-Bucket rotor (Beckman Coulter, catalog number: 367280 )
12% Mini-PROTEAN® TGXTM precast protein gels (10-well, 30 µl) (Bio-Rad Laboratories, catalog number: 4561043 )
Power supplier (Dominique Dutscher, catalog number: 049192 )
SDS-PAGE apparatus (SDS-PAGE), as for example Mini-PROTEAN® Tetra vertical electrophoresis cell for mini precast gels, 2-gels (Bio-Rad Laboratories, catalog number: 1658005 )
Protein transfer apparatus, as for example Trans-Blot® TurboTM transfer system (Bio-Rad Laboratories, catalog number: 1704150 )
Thin layer chromatography plates: silica gel on TLC aluminium foils (silica gel matrix, L x W = 20 x 20 cm) (Sigma-Aldrich, catalog number: 60805 )
Hermetic glass tank such as Aldrich® rectangular TLC developing tanks, complete (L x H x W = 27.0 x 26.5 x 7.0 cm) (Sigma-Aldrich, catalog number: Z126195 )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Bittame, A., Lopez, J., Effantin, G., Blanchard, N., Cesbron-Delauw, M., Gagnon, J. and Mercier, C. (2016). Lipid Extraction from HeLa Cells, Quantification of Lipids, Formation of Large Unilamellar Vesicles (LUVs) by Extrusion and in vitro Protein-lipid Binding Assays, Analysis of the Incubation Product by Transmission Electron Microscopy (TEM) and by Flotation across a Discontinuous Sucrose Gradient. Bio-protocol 6(20): e1963. DOI: 10.21769/BioProtoc.1963.
Download Citation in RIS Format
Category
Immunology > Immune cell function > General
Biochemistry > Lipid > Lipid isolation
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,964 | https://bio-protocol.org/exchange/protocoldetail?id=1964&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Evaluation of Burkholderia cepacia Complex Bacteria Pathogenicity Using Caenorhabditis elegans
Pietro Tedesco
Elia Di Schiavi
Fortunato Palma Esposito
Donatella de Pascale
Published: Vol 6, Iss 20, Oct 20, 2016
DOI: 10.21769/BioProtoc.1964 Views: 6859
Edited by: Peichuan Zhang
Original Research Article:
The authors used this protocol in Nov 2015
Download PDF
Ask a question
Favorite
Cited by
Original research article
The authors used this protocol in:
Nov 2015
Abstract
This protocol describes two biological assays to evaluate pathogenicity of Burkholderia cepacia complex (Bcc) strains against the nematode Caenorhabditis elegans. Specifically, these two assays allow one to identify if the under-investigated Bcc strains are able to kill the nematodes by intestinal colonization (slow killing assay, SKA) or by toxins production (fast killing assay, FKA). The principal differences between the two assays rely on the different killing kinetics for worms.
Keywords: Burkholderia cepacia complex strains Caenorhabditis elegans Animal model
Background
The Burkholderia cepacia complex (Bcc) occupies a critical position among Gram-negative multi-drug resistant bacteria. It consists of at least 20 closely related species. Many Bcc strains are multi drug and pandrug-resistant opportunistic human pathogens caused problematic lung infections in immune-compromised individuals, including cystic fibrosis (CF) patients. The use of non-vertebrate host model can be useful for dissecting virulence and pathogenicity determinants as well as identifying novel therapeutic targets (Kothe et al., 2003).
There are a good number of assays for detecting Bcc virulence against a large panel of host models, in liquid or in solid surface. However, some of those are mostly focused on phenotypic observations, which are difficult to detect and have a low reproducibility (Cardona et al., 2005). Herein, we developed two assays based on the analysis of surviving worms, which is a more reproducible and allows easy and fast comparison among the Bcc strains tested. In addition, these assays permit the detection of death mechanisms of Bcc towards nematode.
These killing assays allow us to identify bacterial strains that are able to colonize the nematode intestine and produce diffusible toxins capable of killing the host.
Materials and Reagents
15 ml Falcon tubes (Corning, Falcon®, catalog number: 352095 )
3.5 cm diameter agar plates (Corning, catalog number: 430165 )
Caenorhabditis elegans
Burkholderia cepacia complex (Bcc) strains
E. coli OP50
NaOH
Bleach (Aurora)
NGM agar
PGS agar
Sodium chloride (NaCl) (Sigma-Aldrich, catalog number: S9888 )
Tryptone (Conda, catalog number: 1612 )
Yeast extract (Conda, catalog number: 1702 )
Peptone (Conda, catalog number: 1602 )
European agar (Conda, catalog number: 1800 )
Magnesium sulfate (MgSO4) (Sigma-Aldrich, catalog number: M7506 )
Calcium chloride (CaCl2) (Sigma-Aldrich, catalog number: C1016 )
Cholesterol (Sigma-Aldrich, catalog number: C3045 )
Glucose (Conda, catalog number: 1900 )
Sorbitol (Sigma-Aldrich, catalog number: S1876 )
Potassium phosphate monobasic (KH2PO4) (Sigma-Aldrich, catalog number: P5655 )
Sodium phosphate dibasic (Na2HPO4) (Sigma-Aldrich, catalog number: S5136 )
LB broth (see Recipes)
NGM agar medium (see Recipes)
PGS agar medium (see Recipes)
M9 buffer (see Recipes)
Equipment
Centrifuge
20 °C chamber
37 °C shaking incubator
Dissecting microscope
Platinum loop
Software
Graph-pad Prism 5 software
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
Category
Neuroscience > Behavioral neuroscience > Animal model
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,965 | https://bio-protocol.org/exchange/protocoldetail?id=1965&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Heterologous Expression and Purification of Catalytic Domain of CESA1 from Arabidopsis thaliana
VV Venu Gopal Vandavasi
HN Hugh O’ Neill
Published: Vol 6, Iss 20, Oct 20, 2016
DOI: 10.21769/BioProtoc.1965 Views: 6698
Edited by: Arsalan Daudi
Reviewed by: Sibongile Mafu
Original Research Article:
The authors used this protocol in Jan 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jan 2016
Abstract
Heterologous expression of plant cellulose synthase (CESA) and its purification has remained a challenge for decades impeding detailed biophysical, biochemical and structural characterization of this key enzyme. An in-depth knowledge of structure and function of CESA proteins would enable us to better understand the hierarchical structure of the plant cell wall. Here, we report a detailed, and reproducible method of purification of catalytic domain of CESA1 from Arabidopsis thaliana that was recombinantly expressed in Escherichia coli. The method relies on a two stage purification procedure to obtain the catalytic domain in monomer and trimer forms. The biochemical and biophysical data including low resolution structures of the protein have been published (Vandavasi et al., 2016). Currently the crystallization studies of this protein are underway.
[Background] Cellulose is the most important structural component of plant cell walls and constitutes the Earth’s largest source of biorenewable material, yet the mechanism of its synthesis by plants is poorly understood. The plant cellulose synthesis complex (CSC), also called a ‘rosette’ because of its hexameric appearance in electron microscope images, is a large multi-subunit transmembrane protein complex responsible for synthesis of cellulose chains and their assembly into microfibrils. The number of cellulose synthase (CESA) proteins in the CSC and the number of cellulose chains in a microfibril have been debated for many years. Structural information about CESA proteins from plants is crucial to provide answers to some of the basic questions regarding the mechanism of cellulose synthesis. However, elucidation of the structure of CESA proteins has proved difficult because they are multi-domain proteins comprised of disordered, globular, and membrane associated domains. As an alternative to pursuing structural studies of CESA holoproteins, we are developing approaches for recombinant expression of individual CESA domains (e.g., N-terminal domain, central-cytosolic domain, C-terminal transmembrane domain) in large quantities suitable for structural studies. The current protocol has been optimized for isolation of the catalytic domain of A. thaliana CESA1 as reported (Vandavasi et al., 2016). Using this protocol, it is possible to control the oligomerization state of the protein enabling structural studies of the monomer and the trimeric form of the protein. The approach described may be broadly applicable to other systems.
Keywords: Cellulose synthesis CESA protein Heterologous expression N-Lauroylsarcosine
Materials and Reagents
0.2 µm filter (VWR, catalog number: 28145-501 )
E. coli BL21-RIL (Agilent Technologies, catalog number: 230280 )
Deionized water
Ampicillin (VWR, catalog number: 97061-442 )
Chloramphenicol (VWR, catalog number: EM-3130 )
Glycerol (Sigma-Aldrich, catalog number: G5516 )
Luria broth (EMD Millipore, catalog number: 71751 )
Sorbitol (Sigma-Aldrich, catalog number: S1876 )
IPTG (Teknova, catalog number: I3325 )
Tris buffer (Sigma-Aldrich, catalog number: 252859 )
Sodium deoxycholic acid (Geno Technology, catalog number: DG090 )
Nonidet (Sigma-Aldrich, catalog number: I8896 )
Sodium chloride (NaCl) (Sigma-Aldrich, catalog number: S9888 )
Lysozyme (VWR, catalog number: CA-EM5960 )
β-mercaptoethanol (BME) (Sigma-Aldrich, catalog number: M6250 )
Triton X-100 (Sigma-Aldrich, catalog number: T8787 )
CAPS buffer (Sigma-Aldrich, catalog number: C2632 )
Sodium lauroyl sarcosine (Sigma-Aldrich, catalog number: L9150 )
Glucose (Sigma-Aldrich, catalog number: G5767 )
Dithiothreitol (DTT) (Sigma-Aldrich, catalog number: D0632 )
HEPES buffer (Sigma-Aldrich, catalog number: H3375 )
LB media supplemented with 0.25 M sorbitol (see Recipes)
Lysis buffer (see Recipes)
Wash buffer-1 (see Recipes)
Wash buffer-2 (see Recipes)
Solubilization buffer (see Recipes)
Dialysis buffer-1 (see Recipes)
Dialysis buffer-2 (see Recipes)
Equipment
Glassware
Autoclave (Panasonic, model: MLS-3781L )
Filtering devices for sterilization (Thermo Fisher Scientific, Fisher Scientific, catalog number: 596-4520 )
Bio hood (Labconco, model: 3440009 )
Note: This product has been discontinued.
Refrigerator or cold room
Temperature controlled shaker incubator (Thermo Fisher Scientific, Thermo ScientificTM, model: MxQTM 6000 )
Magnetic stirring plate (VWR, catalog number: 97042-626 )
UV/Vis spectrophotometer (Thermo Fisher Scientific, Thermo Scientific, model: NanoDrop-2000 )
Apparatus for SDS-PAGE (Mini-PROTEAN® Tetra vertical electrophoresis cell) (Bio-Rad Laboratories, catalog number: 1658004 )
400 Watt sonicator (All-Spec, BRANSON, model: S450D )
Refrigerated centrifuge (Thermo Fisher Scientific, Thermo ScientificTM, model: RC 6 Plus )
10 kDa MWCO PES concentrators (Vivaproducts, model: Vivaspin® 20 )
Superdex 200 size exclusion chromatographic column, 120 ml capacity (GE Healthcare, catalog number: 17-1069-01 )
Note: This product has been discontinued.
Akta FPLC system (or similar liquid chromatography system)
Dialysis cassettes (Slide-A-LyzerTM dialysis cassette G2, 10 kDa MWCO) (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 87730 )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
How to cite： Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Vandavasi, V. G. and O’ Neill, H. (2016). Heterologous Expression and Purification of Catalytic Domain of CESA1 from Arabidopsis thaliana. Bio-protocol 6(20): e1965. DOI: 10.21769/BioProtoc.1965.
Vandavasi, V. G., Putnam, D. K., Zhang, Q., Petridis, L., Heller, W. T., Nixon, B. T., Haigler, C. H., Kalluri, U., Coates, L., Langan, P., Smith, J. C., Meiler, J. and O'Neill, H. (2016). A structural study of CESA1 catalytic domain of Arabidopsis cellulose synthesis complex: evidence for CESA trimers. Plant Physiol 170(1): 123-135.
Download Citation in RIS Format
Category
Plant Science > Plant biochemistry > Protein
Plant Science > Plant biochemistry > Protein
Biochemistry > Protein > Structure
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,966 | https://bio-protocol.org/exchange/protocoldetail?id=1966&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Artificial Optogenetic TRN Stimulation of C. elegans
Ithai Rabinowitch
Millet Treinin
Jihong Bai
Published: Vol 6, Iss 20, Oct 20, 2016
DOI: 10.21769/BioProtoc.1966 Views: 7660
Edited by: Peichuan Zhang
Reviewed by: Pengpeng Li
Original Research Article:
The authors used this protocol in Jan 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jan 2016
Abstract
Optogenetics is a powerful tool for manipulating neuronal activity with high temporal and spatial precision. In the nematode C. elegans optogentics is especially useful and easy to apply. This is because C. elegans is translucent, so its neurons are highly accessible to optic stimulation. In addition, many of its neurons can be exclusively targeted using cell-specific promoters. We have recently taken advantage of optogenetics to deliver artificial patterns of prolonged activation to a class of mechanosensory neurons, called touch receptor neurons (TRNs) in worms that lack touch sensation due to a genetic mutation. Our aim was to examine whether we can counteract the effects of sensory loss by artificially activating the sensory neurons. Here we describe in detail the various components of the protocol that we used. This consists of exposing worms expressing the light-sensitive ion channel Channelrohdopsin 2 (ChR2) in TRNs to long-term random flashes of light.
Keywords: Optogenetics C. elegans Mechanosensation Locomotion Cross-modal plasticity
Background
Artificial optogenetic stimulation (or silencing) of neurons has become of broad use in neuroscientific research. The powerful model organism, C. elegans, is particularly amenable to optogenetic manipulation (Nagel et al., 2005), and multiple groups have developed a range of techniques for delivering artificial brief patterns of stimulation with high temporal and spatial precision (Leifer et al., 2011; Stirman et al., 2011) and in combination with behavioral (Kocabas et al., 2012) and calcium imaging (Guo et al., 2009) or electrophysiological (Lindsay et al., 2011) readouts. We were interested in establishing a long-term stimulation protocol that would substitute natural ongoing activity in mechanosensory neurons deprived of sensory input (Rabinowitch et al., 2016). Our protocol integrates previous C. elegans optogenetic protocols, but focuses on chronic rather than transient stimulation.
Materials and Reagents
1.7 ml microtubes (Genesee Scientific, catalog number: 24-282 )
Aluminum foil
60 x 15 mm cultivation/test plates (Genesee Scientific, catalog number: 32-105G )
35 x 10 mm stimulation plates (Genesee Scientific, catalog number: 32-103 )
C. elegans strains
TU253 mec-4(u253) X (a mutant strain deficient in TRN mechanosensation). mec-4 encodes an amiloride-sensitive Na+ channel protein (degenerin) expressed exclusively in the TRNs and required to sense gentle mechanical stimuli (e.g., touch) along the body wall (www.wormbase.org)
BJH255 mec-4(u253) X; ljIs111[Pmec-4::ChR2]
Notes:
The second strain combines both defective TRN mechanosensation and ChannelRhodopsin 2 (ChR2) expressed exclusively in the TRNs. Importantly, while examining several TRN-specific ChR2 strains (all using the mec-4 promoter), we observed in some of them abnormal mechanosensation and locomotion even in a wild-type background. In contrast, ljIs111 exhibited normal behavior and mechanosensory responses.
Strains are grown and maintained under standard conditions (http://www.wormbook.org/chapters/www_strainmaintain/strainmaintain.html) at 20 °C on nematode growth medium (NGM) 2% agar cultivation plates seeded with Escherichia coli strain OP50. All experiments are conducted at 18-22 °C. We found that higher temperatures considerably alter the results. Tested worms are adults around 24 h after the L4 stage.
C. elegans does not produce the co-factor all-trans retinal (ATR), necessary for ChR2 function. However, ATR can be incorporated through feeding (Nagel et al., 2005). ATR is first diluted in ethanol to 100 mM in a 1.7 ml tube. The tube is wrapped with aluminum foil to avoid light exposure and is stored at -20 °C. Prior to seeding the ATR plates, 5 μl of the 100 mM ATR stock solution is added to 1 ml OP50 bacteria suspended in LB and the tube is gently vortexed. Then 100 μl of the ATR OP50 mix is applied to 6-cm cultivation plates and to 3-cm stimulation plates, each containing nematode growth medium (NGM). Once seeded, the plates are kept in the dark. The plates can be used the next day.
ChR2-expressing worms are grown in the dark on the 6-cm ATR cultivation plates. As a control, a second cohort of worms can be grown under similar conditions, but without the ATR.
Lysogeny broth medium (LB) (RPI, catalog number: L24045-5000.0 )
Bacto agar (BD, catalog number: 214040 )
Bacto peptone (BD, catalog number: 211820 )
Sodium chloride (NaCl)
Magnesium sulfate (MgSO4)
Cholesterol
Calcium chloride (CaCl2)
All-trans retinal (ATR) (Sigma-Aldrich, catalog number: R2500-25MG )
Ethanol (Decon Labs, catalog number: 2701 )
Escherichia coli strain OP50 (see Recipes)
Nematode growth medium (NGM) (see Recipes)
Equipment
4 L glass flask
Incubator
Royal-Blue (447.5 nm) LUXEON Rebel LED assembly (of 3 LEDs) (Luxeon Star LEDs, model: SR-03-R0500 )
Carclo 27° frosted 20 mm circular beam optic (Luxeon Star LEDs, catalog number: 10508 )
Arduino Uno R3 microcontroller (Adafruit, model: Arduino Uno R3 )
Personal computer (PC or Mac)
USB 2.0 cable (SparkFun Electronics, model: CAB-00512 )
Hook-up wire (Alpha Wire, catalog number: 2842/19 )
Solder station (Apex Tool, Weller®, model: WLC100 )
Figure 1. Optical stimulation apparatus. A. LED assembly and beam optic. White arrows point towards soldering points. B. LED assembly mounted to the top of an opaque cardboard box. C. Hook-up wires from the LED assembly (black arrowhead) connected to the digital output of an Arduino Uno microcontroller board. In the picture the Arduino board is not connected to the computer.
Rosin core solder (Alpha Fry 31604 60/40)
Opaque cardboard box (9 x 4.5 x 6 cm, length x width x height)
Note: Two pieces of hook-up wire are soldered to the LED assembly to drive current through it. The LED assembly is attached to the circular beam optic and together they are mounted to the top of the opaque cardboard box. The LED is connected to an Arduino Uno R3 microcontroller. One wire is attached to the ground and the other to digital output number 12. Figure 1 illustrates the apparatus. The Arduino microcontroller is connected to the computer via USB cable.
Software
Arduino software (https://www.arduino.cc)
Note: Available for free online.
Matlab support package for Arduino (Mathworks, http://www.mathworks.com/hardware-support/arduino-matlab.html)
Note: Available for free online.
Matlab 2014R (Mathworks, http://www.mathworks.com/products/matlab/)
Custom written Matlab script called Led3.m, provided as an appendix.
Notes:
In the Led3.m script, configuration ‘Poisson4’ is used to deliver random flashes of blue light for approximately 80 min each session, producing prolonged stimulation.
The interval between flashes is drawn from an exponential random distribution with a 10 sec mean. The duration of each flash is drawn from a uniform distribution with a 3 sec mean.
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Rabinowitch, I., Treinin, M. and Bai, J. (2016). Artificial Optogenetic TRN Stimulation of C. elegans. Bio-protocol 6(20): e1966. DOI: 10.21769/BioProtoc.1966.
Download Citation in RIS Format
Category
Neuroscience > Behavioral neuroscience > Animal model
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,967 | https://bio-protocol.org/exchange/protocoldetail?id=1967&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Ear Inflammation and Whole-mount Ear Staining
Jia Tong Loh
MG Merry Gunawan
I-hsin Su
Published: Vol 6, Iss 20, Oct 20, 2016
DOI: 10.21769/BioProtoc.1967 Views: 10276
Edited by: Ivan Zanoni
Reviewed by: Griselda Zuccarino-CataniaBenoit Stijlemans
Original Research Article:
The authors used this protocol in Apr 2015
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Apr 2015
Abstract
The recruitment of circulating neutrophils from the bloodstream to the site of inflammation represents one of the earliest events during an innate immune response. During this response, neutrophils tether and roll along the vessel walls before transmigrating across the endothelium into the interstitial space to exert their functions. Here, we describe a protocol for the staining of intravascular and tissue-localized neutrophils following contact sensitization of the skin with croton oil. Visualization of the neutrophilic distribution in skin provides for a better interpretation of the local immune response.
Keywords: Neutrophils Ear inflammation Skin inflammation
Background
Characterisation of neutrophil distribution within the skin following inflammation represents an important avenue for the understanding of their specialized functions. Even though the recruitment of neutrophils to the inflamed skin has been widely characterized by flow cytometry (Hampton et al., 2015; Stock et al., 2014), such technique provides limited insight on the intravascular versus interstitial localization of neutrophils. Recirculating and tissue-localized neutrophils exhibit different phenotypes and functions, which necessitates their discrimination to identify key players of the local immune response. With the development of intravital microscopy (IVM), the direct visualization of fluorescently tagged immune cells in vivo is made possible. However, due to the high cost of IVM, the accessibility of this powerful imaging tool to researchers is limited. Here, we present an alternative protocol for the high resolution static imaging of neutrophils in skin by making use of cost-effective reagents and commonly available confocal laser-scanning microscopy.
Materials and Reagents
Cotton swabs
SterilinTM Petri dish (90 mm) (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 101IRR )
24-well cell culture plates (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 142475 )
Glass slides (Biomedical Sciences Institutes, catalog number: BMH.880103 )
FisherbrandTM cover glass (Thermo Fisher Scientific, Fisher Scientific, catalog number: 12-545-81 )
Clear nail polish
Mice
Croton oil (Sigma-Aldrich, catalog number: C6719 )
Veet hair removal cream
Phosphate buffered saline (PBS) (Thermo Fisher Scientific, GibcoTM, catalog number: 10010023 )
Acetone (Thermo Fisher Scientific, Fisher Scientific, catalog number: 67-64-1 )
Bovine serum albumin (BSA) (Sigma-Aldrich, catalog number: 10735108001 )
Sodium azide (Sigma-Aldrich, catalog number: S2002 )
Antibodies
PE anti-mouse Ly-6G antibody (clone 1A8) (BioLegend, catalog number: 127607 )
PE rat IgG2a, κ Isotype control antibody (clone RTK2758) (BioLegend, catalog number: 400507 )
APC anti-mouse CD31 (clone MEC 13.3) (BD, PharmingenTM, catalog number: 561814 )
Mounting medium (ibidi, catalog number: 50001 )
DAPI (Sigma-Aldrich, catalog number: D9564 )
Stain and wash buffer (1% BSA in PBS) (see Recipes)
Equipment
Pipette (Eppendorf, model: Eppendorf Research plus )
Dissection scissors (Roboz Surgical Instrument, catalog number: RS-6702 )
Forceps (Roboz Surgical Instrument, catalog number: RS-5240 ; RS-5135 )
Shaker (Labnet)
Zeiss LSM 510 Meta confocal microscope (Zeiss)
Software
ImageJ software (National Institutes of Health) (https://imagej.nih.gov/ij/index.html)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Loh, J. T., Gunawan, M. and Su, I. (2016). Ear Inflammation and Whole-mount Ear Staining. Bio-protocol 6(20): e1967. DOI: 10.21769/BioProtoc.1967.
Download Citation in RIS Format
Category
Immunology > Immune cell imaging > Confocal microscopy
Cell Biology > Cell imaging > Confocal microscopy
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,968 | https://bio-protocol.org/exchange/protocoldetail?id=1968&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Cell Surface Protein Detection to Assess Receptor Internalization
Magdalena Czarnecka
Joanna Kitlinska
Published: Vol 6, Iss 20, Oct 20, 2016
DOI: 10.21769/BioProtoc.1968 Views: 9654
Edited by: HongLok Lung
Reviewed by: Hsin-Yi Chang
Original Research Article:
The authors used this protocol in Jun 2015
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jun 2015
Abstract
The migration of membrane receptors upon exposure to different stimulants/inhibitors is of great importance. Among others, the internalization of membrane receptors affects their accessibility to ligands and cell responsiveness to environmental cues. Experimentally, receptor internalization can be used as a measure of their activation. In our studies, we employed this approach to explore cross-talk between a seven transmembrane domain receptor for neuropeptide Y (NPY), Y5R, and a tyrosine kinase receptor for brain-derived neurotrophic factor (BDNF), TrkB. To this end, we measured the internalization of Y5R upon stimulation with the TrkB ligand, BDNF. Upon treatment with BDNF, the cells were exposed to a membrane impermeable, biotinylation reagent that selectively labels surface proteins. Subsequently, the biotinylated membrane proteins were affinity-purified on columns with avidin resins and analyzed by Western blot. Differences in the fraction of receptors present on the cell surface of control and ligand-treated cells served as a measure of their internalization and response to particular stimuli.
Keywords: Membrane receptors Receptor internalization Cell surface proteins
Background
Cell membrane receptor internalization in response to external stimuli can be measured using two major strategies – microscopic and biochemical. The most common approach is the use of microscopy – either in real-time or on fixed cells. In the first approach, the cells expressing receptors labelled with fluorescent tags (e.g., fused to the fluorescent proteins) are examined in live cells by time-lapse confocal microscopy. Alternatively, cells expressing fluorescently labeled receptors can be exposed to the desired stimuli and then fixed at a pre-defined time. Subsequently, sub-cellular localization of these receptors (i.e., membrane vs. intracellular fraction) is examined by fluorescence microscopy and compared with the untreated control. The advantage of time-lapse microscopy is the ability to examine the same cells at different time points and directly assess changes in the receptor distribution upon stimulation (Czarnecka et al., 2015). However, since this assessment has to be performed under high magnification, the number of cells that can be analyzed is limited and the response is not always uniform among the cells. On the other hand, fixing the cells upon stimulation allows for examining a larger cell population and for analysis of the native, not-labeled receptors, if combined with fluorescently labeled ligands or immunocytochemistry (Bohme et al., 2008; Fabry et al., 2000). However, in this case, the analysis of the receptor sub-cellular localization is usually qualitative and the time of exposure may not be optimal, as the changes are not examined in real time.
The biochemical approach takes advantage of cell-impermeable biotinylation reagents that selectively cross-link extracellular domains of cell surface receptors. The biotin-labeled cell membrane proteins are then affinity-purified and the receptor of interest can be selectively detected by Western blot (Czarnecka et al., 2015). This approach allows for quantitative analysis of the cells as a whole population and does not require fusion with a fluorescent protein that may potentially change the behavior of the tested receptors. However, as with microscopic analysis of fixed cells upon treatment, the time of exposure to the ligand remains to be determined. Therefore, in our study, we combined time-lapse confocal microscopy, which allowed us to perform the initial assessment of the internalization rate and determine the time of ligand exposure allowing for detecting maximal changes in receptor sub-cellular localization, and the subsequent selective isolation of cell surface receptors at this time point to achieve quantitative results and confirm microscopic observations (Czarnecka et al., 2015). This strategy was successful in demonstrating neuropeptide Y (NPY) Y5R receptor internalization upon stimulation with non-cognate ligand, brain-derived neurotrophic factor (BDNF), and therefore proving the interactions between NPY and BDNF systems.
Materials and Reagents
Cell scrapers (Corning, Falcon®, catalog number: 353085 )
150 mm tissue culture-treated dishes (Corning, catalog number: 430599 )
50 ml centrifuge conical tubes (Corning, catalog number: 430829 )
15 ml centrifuge conical tubes (Corning, catalog number: 430791 )
1.5 ml centrifuge tube
Nitrocellulose membrane (GE Healthcare, catalog number: 10600011 )
SH-SY5Y neuroblastoma cells
Puncture foil
RPMI media (ATCC, catalog number: 30-2001 )
Fetal bovine serum (FBS) (Thermo Fisher Scientific, GibcoTM, catalog number: 10437-028 )
Geneticin (G 418 disulfate salt) (Sigma-Aldrich, catalog number: A1720 )
Fungizone (Amphotericin B) (Thermo Fisher Scientific, GibcoTM, catalog number: 15290018 )
Penicillin-streptomycin (Thermo Fisher Scientific, GibcoTM, catalog number: 15140122 )
Protease inhibitor cocktail (Sigma-Aldrich, catalog number: P8340-1 ml )
Bio-Rad protein assay dye reagent concentrate (Bio-Rad Laboratories, catalog number: 5000006 )
Cell surface protein isolation kit (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 89881 ) containing the following reagents
Sulfo-NHS-SS-biotin
Phosphate buffered saline (PBS) pack to be reconstituted in ultrapure water
Quenching solution
Tris buffered saline (TBS) pack to be reconstituted in ultrapure water
Lysis buffer
Immobilized NeutrAvidin gel
Wash buffer
Columns and caps
No-weigh bithiothreitol (DTT)
Ultra-pure water (Sigma-Aldrich, catalog number: W4502 )
SDS-PAGE sample buffer (PierceTM lane marker non-reducing) (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 39001 )
4-20% Tris-glycine gels (Thermo Fisher Scientific, InvitrogenTM, catalog number: EC60252BOX )
Note: This product has been discontinued.
Blotting-grade blocker (nonfat dry milk) (Bio-Rad Laboratories, catalog number: 1706404 )
TweenTM 20, Fisher BioReagentsTM (Thermo Fisher Scientific, Fisher Scientific, catalog number: BP337-100 )
Goat polyclonal anti Y5R antibody (Everest Biotech, catalog number: EB06769 )
Donkey anti-goat antibody, horseradish peroxidase conjugated (Santa Cruz Biotechnology, catalog number: sc-2020 )
SuperSignalTM West Pico chemiluminescent substrate (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 34080 )
Equipment
Centrifuge for 15 ml tubes (BD, AdamsTM, model: DYNACTM Centrifuge 0101 )
Note: Equipment discontinued. Can be replaced by any centrifuge holding 15 ml tubes.
Centrifuge for Eppendorf tubes (Eppendorf, model: Centrifuge 5417 C )
Note: Equipment discontinued. Can be replaced by any centrifuge holding 1.5 ml tubes.
Rocking platform (Boekel Scientific, catalog number: 260350 )
Sonicator (Thermo Fisher Scientific, model: Sonic Dismembrator 550 )
Note: Equipment discontinued. Can be replaced by any other sonicator.
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Czarnecka, M. and Kitlinska, J. (2016). Cell Surface Protein Detection to Assess Receptor Internalization. Bio-protocol 6(20): e1968. DOI: 10.21769/BioProtoc.1968.
Download Citation in RIS Format
Category
Cancer Biology > General technique > Biochemical assays
Biochemistry > Protein > Interaction
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,969 | https://bio-protocol.org/exchange/protocoldetail?id=1969&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Aniline Blue and Calcofluor White Staining of Callose and Cellulose in the Streptophyte Green Algae Zygnema and Klebsormidium
KH Klaus Herburger
AH Andreas Holzinger
Published: Vol 6, Iss 20, Oct 20, 2016
DOI: 10.21769/BioProtoc.1969 Views: 13401
Edited by: Maria Sinetova
Reviewed by: Rumen Ivanov
Original Research Article:
The authors used this protocol in Nov 2015
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Nov 2015
Abstract
Plant including green algal cells are surrounded by a cell wall, which is a diverse composite of complex polysaccharides and crucial for their function and survival. Here we describe two simple protocols to visualize callose (1→3-β-D-glucose) and cellulose (1→4-β-D-glucose) and related polysaccharides in the cell walls of streptophyte green algae. Untreated or algal cells heated in NaOH are incubated in Calcofluor white (binding to β-glucans including cellulose) or Aniline blue (binding to callose), respectively. Both dyes can be visualized by epifluorescence microscopy.
Background
Due to its easy and quick applicability, Aniline blue was used to visualize callose in various strains of Klebsormidium sp. and Zygnema sp., before more laborious fixation and immunolocalisation protocols were applied (Herburger and Holzinger, 2015). Applying Aniline blue staining and monoclonal antibodies against callose brought similar results (Herburger and Holzinger, 2015). Calcofluor white staining is the fastest way to visualize the 1→4-β-glucan fraction including cellulose of the cell wall, since no pre-treatments are required.
Materials and Reagents
2 ml Eppendorf tubes
Epoxy coated microscopic slides with 8-12 wells (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 1014326410EPOXY ) and cover slips
Algal cells or filaments (Figure 1A)
Note: In principle, this protocol is not restricted to green algae and can be applied to all plant cells surrounded by a cell wall, including cell cultures.
Sodium hydroxide pellets (NaOH) (EMD Millipore, catalog number: 106469 )
A. bidest. (double distilled water)
Sodium phosphate monobasic dihydrate (NaH2PO4·2H2O) (EMD Millipore, catalog number: 1063420250 )
Sodium phosphate dibasic dihydrate (Na2HPO4·2H2O) (EMD Millipore, catalog number: 1065800500 )
Culture medium (BBM [Bischoff and Bold, 1963], MBBM [Starr and Zeikus, 1993])
Aniline blue diammonium salt (Sigma-Aldrich, catalog number: 415049 )
Calcofluor white (Sigma-Aldrich, catalog number: 18909 )
Note: Adding Evans blue as a counterstain to diminish background fluorescence is not obligatory, since background fluorescence in the algae investigated is very low.
0.2 M NaH2PO4·2H2O stock solution (see Recipes)
0.2 M Na2HPO4·2H2O stock solution (see Recipes)
50 ml of Sørensen’s phosphate buffer (see Recipes)
Equipment
Glass Pasteur pipettes
25 ml beaker
1,000 ml and 500 ml volumetric flask
100 ml Schott flask
Balance
Pair of fine-pointed tweezers
Metal rack (1.5 ml microfuge rack) (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 3166185 )
Water bath or heat plate and beaker
Tabletop centrifuge (Sigma Laborzentrifugen, model: Sigma 1-14 )
Shaker (Thermo Fisher Scientific, Thermo ScientificTM, model: Compact Digital Microplate Shaker)
Epifluorescence microscope capable of UV excitation and long pass detection, with high numerical aperture lens, connected to a camera for documentation (e.g., We used a ZEISS Axiovert 200M equipped with a 63 x 1.4 NA objective, a OSRAM HBO 50 Q/AC L1 CZ Mercury short ARC Photo optic lamp, Zeiss Filter Set 01 (excitation: band pass [BP] 365/12 nm; emission: long pass [LP] 397 nm and connected to a Axiocam MRc5 camera) (Carl Zeiss, model: Axiovert 200M )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Herburger, K. and Holzinger, A. (2016). Aniline Blue and Calcofluor White Staining of Callose and Cellulose in the Streptophyte Green Algae Zygnema and Klebsormidium. Bio-protocol 6(20): e1969. DOI: 10.21769/BioProtoc.1969.
Download Citation in RIS Format
Category
Plant Science > Phycology > Cell analysis
Plant Science > Plant cell biology > Cell imaging
Cell Biology > Cell imaging > Fluorescence
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
197 | https://bio-protocol.org/exchange/protocoldetail?id=197&type=1 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Immunofluorescence Assay for S Phase Entry Using BrdU Incorporation
Hui Zhu
Published: Feb 5, 2012
DOI: 10.21769/BioProtoc.197 Views: 19264
Download PDF
Ask a question
How to cite
Favorite
Cited by
Abstract
Bromodeoxyuridine (BrdU) is thymidine analogue and can incorporated into the newly synthezised DNA of S-phase cells, the antibody specific for BrdU can then be used to detect the incorporated BrdU, thus indicating cells that were actively replicating their DNA and estimating for the percentage of cells in S-phase. The immunocytochemical detection of BrdU incorporated into DNA is a powerful tool to study the cytokinetics of normal and tumor cells. In vitro or in vivo labeling of tumor cells with BrdU and the subsequent detection of incorporated BrdU with specific anti-BrdU monoclonal antibodies is an accurate and comprehensive method to quantitate the degree of DNA-synthesis.
Keywords: Bromodeoxyuridine(BrdU) S-phase Immunofluorescence
Materials and Reagents
BrdU (Sigma-Aldrich, catalog number: B5002 )
Phosphate buffered saline (PBS)
Methanol (Thermo Fisher Scientific, catalog number: BP1105-4 )
BSA (Sigma-Aldrich, catalog number: A3803 )
HCl
NaN3
Triton X-100
Monoclonal anti-BrdU (Sigma-Aldrich, catalog number: B2531 )
Alexa 488-conjugated goat anti-mouse immunoglobulin G antibody (Life Technologies, Molecular Probes®/Alexa Fluor® 488, catalog number: A-11008 or A-11034 )
DAPI (make 1 mg ml-1 stock, 1,000x) (Boeringer Manheim 236 276 )
Coverglasses (12 mm) (Thermo Fisher Scientific, catalog number: 12-545-82 )
Fluormount-GTM Mounting solution (SouthernBiotech, catalog number: 0100-01 )
PBS-BT solution (see Recipes)
Equipment
Centrifuges (Beckman Falcon, model: TLS-55 )
Parafilm
6-well plate
24-well plate
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2012 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Zhu, H. (2012). Immunofluorescence Assay for S Phase Entry Using BrdU Incorporation. Bio-101: e197. DOI: 10.21769/BioProtoc.197.
Download Citation in RIS Format
Category
Cancer Biology > General technique > Cell biology assays > Proliferation analysis
Cancer Biology > Proliferative signaling > Cell biology assays > Proliferation analysis
Cell Biology > Cell imaging > Fluorescence
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,970 | https://bio-protocol.org/exchange/protocoldetail?id=1970&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
A 3D Culture System of Human Immortalized Myometrial Cells
Minnie Malik
Joy Britten
William H. Catherino
Published: Vol 6, Iss 20, Oct 20, 2016
DOI: 10.21769/BioProtoc.1970 Views: 8115
Edited by: Andrea Introini
Reviewed by: Jalaj Gupta
Original Research Article:
The authors used this protocol in Jun 2012
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jun 2012
Abstract
Myometrium forms the middle layer of the uterus and is mainly composed of the smooth muscle cells. The cells in vitro are usually grown in a single layer (2-dimensional; 2D) format, whereas in vivo cells are structured in an extracellular matrix scaffolding that allows the cells to communicate and respond to environmental cues. We have developed human myometrium and leiomyoma 3-dimensional (3D) culture, wherein the cells retain their molecular characteristics and respond to environmental cues (Malik and Catherino, 2012; Malik et al., 2014).
Keywords: Myometrium Uterine smooth muscle Cell culture 3-dimensional
Background
In the last decade a certain shift is observed as more laboratories move from using the artificial 2D format of cell culture into 3D cell culture model system, where the cells are grown in a matrix that allows them to attach and attain a more physiologic configuration. This model system provides the cells with a more natural state of differentiation and the cultured cells develop an in vivo tissue-like environment. This is a detailed protocol for myometrium 3D cell culture growth in a collagen-I matrix, modified from Malik and Catherino (2012).
Materials and Reagents
8 chamber glass slides (8 well culture slides) (Corning, Falcon®, catalog number: 354108 )
5 ml, 10 ml and 25 ml serological pipettes, sterile, individually wrapped (Thermo Fisher Scientific)
15 ml and 50 ml conical sterile polypropylene centrifuge tubes (Thermo Fisher Scientific)
Microscope slides (Thermo Fisher Scientific, Fisher Scientific, catalog number: 12-5446 )
Coverslips (22 x 60 mm) (Thermo Fisher Scientific, Fisher Scientific, catalog number: 12-544G )
6-well culture plate
12-well cell culture plate
T75 flask
Aerosol barrier pipette tips (10 µl to 1,000 µl) (Thermo Fisher Scientific)
Unfiltered 1 ml pipette tips (Thermo Fisher Scientific, Fisher Scientific, catalog number: 13-611-101 )
0.45 µm millex syringe filter unit (EMD Millipore, catalog number: SLHA02510 )
Millex vented 0.22 µm syringe filter unit (EMD Millipore, catalog number: SLGSV255F )
Kimberly-ClarkTM Kimwipes (Thermo Fisher Scientific, Fisher Scientific, catalog number: 06-666A )
Myometrial cells
Rat tail collagen-I
*Cultrex® 3-D culture matrix rat collagen I: 4 mg/ml (Trevigen, Cultrex®, catalog number: 3447-020-01 )
Collagen type I: 4.48 mg/ml (EMD Millipore, catalog number: 08-115 )
Collagen I, high concentration: 8-11 mg/ml (Corning, catalog number: 354249 )
*Note: Rat tail collagen-I from Trevigen is the most commonly used matrix in the lab but depending on the concentration of the gel to be made, we routinely use collagen-I from other vendors as listed. Follow the manufacturer’s conditions on storage as improper storage can lead to increased viscosity of the collagen and difficult to handle.
10x PBS (filtered through 0.2 µm filter) (Thermo Fisher Scientific, GibcoTM, catalog number: 70011044 )
Sodium hydroxide (NaOH, 6 N) (VWR, catalog number: JT5672-2 )
Double distilled water (DD water; Filtered through 0.2 µm filter)
Trypsin-EDTA (0.05%) (Thermo Fisher Scientific, GibcoTM, catalog number: 25300054 )
Dulbecco’s modified Eagle’s medium/F12 (DMEM/F12, with phenol red) (Thermo Fisher Scientific, GibcoTM, catalog number: 11320-033 )
Fetal bovine serum (FBS) (Defined) (GE Healthcare, HycloneTM, catalog number: SH30070.03 )
Glutamax (Thermo Fisher Scientific, GibcoTM, catalog number: 35050061 )
Penicillin-streptomycin (Thermo Fisher Scientific, GibcoTM, catalog number: 15140122 )
Fungizone (Thermo Fisher Scientific, GibcoTM, catalog number: 15290018 )
Paraformaldehyde (Sigma-Aldrich, catalog number: P6148 )
Or 16% paraformaldehyde solution (Electron Microscopy Sciences, catalog number: 15710 )
Glycine (Sigma-Aldrich, catalog number: G5417-100G )
Triton X-100 (Sigma-Aldrich, catalog number: 93443 )
Normal goat serum (NGS) (Abcam, catalog number: ab156046 ) (Dilution in 1x PBS)
Secondary antibody: Alexa 488 (follow manufacturers dilution instructions) (Thermo Fisher Scientific, InvitrogenTM, catalog number: A11008 )
Primary antibody to smooth muscle alpha actin (0.2 mg/ml) (Abcam, catalog number: ab5694 )
Prolong® Gold antifade mountant with DAPI (Thermo Fisher Scientific, Molecular ProbesTM, catalog number: P36931 )
DPBS (no magnesium or calcium) (Thermo Fisher Scientific, GibcoTM, catalog number: 14190144 )
Bovine serum albumin (BSA) (35% solution in DPBS) (Sigma-Aldrich, catalog number: A7979 ), Dilution in 1x PBS
10% growth media (see Recipes)
5% growth media (see Recipes)
1 N NaOH (see Recipes)
3 mg/ml collagen gels (see Recipes)
0.15 M glycine/PBS (see Recipes)
4% paraformaldehyde/PBS (see Recipes)
Blocking buffer in PBS (see Recipes)
Primary ab dilution buffer in PBS (see Recipes)
Notes:
a.Keep #1-3 at -20 °C if possible or 4 °C overnight (I have a small -20 °C freezer right next to my culture hood).
b.Keep #15-18 on ice before the start of experiment.
Equipment
Microscope (Nikon, model: Eclipse TS100 )
Centrifuge (Eppendorf, model: 5804R )
Automated cell counter (Bio-Rad Laboratories, model: TC 20TM )
Hemocytometer (if automated cell counter not available)
Metal 50ml holder (e.g., Blue anodized aluminum [Thomas Scientific, catalog number: 1225W71 ])
Note: In -20 °C if possible or 4 °C overnight.
95% air/5% CO2 incubator at 37 °C and 95% relative humidity
Shaker at 4 °C and one at room temperature
Vacuum aspirator
Hot plate/stirrer (Fisher Scientific)
Pyrex beaker (100 ml) (Fisher Scientific)
Flat tip forceps (Thermo Fisher Scientific, Fisher Scientific, catalog number: 16-100-111 )
Microscope: confocal laser microscope: (e.g., Carl Zeiss, model: ZEISS LSM 800 )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Malik, M., Britten, J. and Catherino, W. H. (2016). A 3D Culture System of Human Immortalized Myometrial Cells. Bio-protocol 6(20): e1970. DOI: 10.21769/BioProtoc.1970.
Download Citation in RIS Format
Category
Cell Biology > Cell isolation and culture > 3D cell culture
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,971 | https://bio-protocol.org/exchange/protocoldetail?id=1971&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Detection of Wnt5 in Media Conditioned by Mouse Embryonic Fibroblast
JF Juan Flores
Nan Gao
Published: Vol 6, Iss 20, Oct 20, 2016
DOI: 10.21769/BioProtoc.1971 Views: 8202
Original Research Article:
The authors used this protocol in Jun 2015
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jun 2015
Abstract
This protocol describes the procedure of visualizing secreted Wnt5 protein in serum free media via western blotting. This procedure can also be used to visualize other secreted proteins larger than 10,000 daltons. The work presented in this paper visualizes Wnt5 secreted by mouse embryonic fibroblast (MEF), but can be adapted to other cell lines including those transiently transfected by plasmids.
Keywords: Wnt5 Detection Conditioned Media
Materials and Reagents
10 cm Petri dishes
50 ml Beckel centrifuge tubes
1.5 ml microcentrifuge tubes
Amicon Ultra-15 centrifugal filter
0.45 µm immobilon-FL PVDF (EMD Millipore, catalog number: IPFL00010 )
Wild type MEF and Rab8a-/- MEF cell lines
MEF isolation and phenotypic analysis was previously described (Das et al., 2015)
DEME with glucose, L-glutamine and sodium pyruvate (Mediatech, catalog number: 10-013 )
Fetal bovine serum (FBS) (Sigma-Aldrich, catalog number: F2442-500ML )
Pen-strep (Thermo Fisher Scientific, GibcoTM, catalog number: 15140-122 )
Lactalbumin hydrolysate solution (50x) (Sigma-Aldrich, catalog number: 58901C-100ML )
NaN3
NaF
Na3VO4
PMSF
DTT
Nonidet® P40 substitute (Sigma-Aldrich, catalog number: 74385-1L )
Bio-Rad protein assay dye reagent concentrate (Bio-Rad Laboratories, catalog number: 500-0006 )
Tween® 20 (Thermo Fisher Scientific, Fisher Scientific, catalog number: BP337-500 )
Sodium chloride (NaCl)
Potassium chloride (KCl)
Disodium hydrogen phosphate (Na2HPO4)
Potassium dihydrogen phosphate (KH2PO4)
Protease inhibitor cocktail tablets (Sigma Aldrich, catalog number: 11873580001 )
Skim milk powder (EMD Millipore, catalog number: 1.15363.0500 )
Amersham ECL Western blotting detection reagents (GE Healthcare, catalog number: RPN2209 )
Amersham ECL Rabbit IgG, HRP-linked whole Ab (from donkey) (GE Healthcare, catalog number: NA934V-1ML )
Wnt5a/b (C27E8) Rabbit mAB (Cell Signaling Technology, catalog number: 2530S )
Histone H3 (D1H2) XP® Rabbit mAb (Cell Signaling Technology, catalog number: 4499S )
10% FBS DMEM (see Recipes)
1x LAH DMEM (see Recipes)
Non-denaturing lysis buffer (see Recipes)
1% Tween 20 in PBS (PBST) (see Recipes)
5% skim milk in PBST (see Recipes)
1x running buffer (see Recipes)
1x transfer buffer (see Recipes)
Equipment
Thermo IEC Centra CL3R Bench-model, Refrigerated centrifuge
Avanti J-26 XP centrifuge (Beckman Coulter, model: Avanti J-26XP )
Beckman JA-25.50 rotor (Beckman Coulter, model: JA-25.50 )
Bio-Rad Mini-PROTEAN Tetra Cell (Bio-Rad Laboratories, model: 1658005EDU )
XCell SureLock® Mini-Cell and XCell II blot module (Thermo Fisher Scientific, NovexTM, catalog number: EI0002 )
QSonica XL-2000 (Qsonica, model: XL-2000 )
Ultrospec 2100® UV-Visible spectrophotometer (Biochrom, model: 80-2112-21 )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Flores, J. and Gao, N. (2016). Detection of Wnt5 in Media Conditioned by Mouse Embryonic Fibroblast. Bio-protocol 6(20): e1971. DOI: 10.21769/BioProtoc.1971.
Download Citation in RIS Format
Category
Biochemistry > Protein > Immunodetection
Cell Biology > Cell signaling > Development
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,972 | https://bio-protocol.org/exchange/protocoldetail?id=1972&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Experimental Liver Fibrosis and Intrasplenic Transplantation of CD45+ Bone Marrow Cells
Prakash Baligar
Sebanta Pokhrel
AM Asok Mukhopadhyay
Published: Vol 6, Iss 20, Oct 20, 2016
DOI: 10.21769/BioProtoc.1972 Views: 13325
Original Research Article:
The authors used this protocol in Jan 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jan 2016
Abstract
Liver fibrosis results from the excessive collagen deposition (collagen scar) by activated hepatic stellate cells (HpSCs), leading to the inhibition of normal liver regeneration and function. Fibrogenesis is a complex mechanism involving both the synthesis and degradation of matrix proteins by different cell types, mainly macrophages in the liver. Carbon tetrachloride-induced fibrosis (CCl4) and cirrhosis is one of the oldest, simplest and probably the most widely used toxin-based experimental model for the induction of fibrosis. Here we have explained experimental animal model of liver fibrosis using CCl4, injecting twice a week for a period of 8 weeks. In these fibrotic mice, bone marrow (BM) derived CD45+ cells were transplanted via intrasplenic route after 8 weeks of CCl4 injection, and half of the CCl4 dose was continued till the end of the experiment to know the effect of transplanted cells on liver fibrosis and regeneration. So far, crude bone marrow (BM) cells or mesenchymal stem cells (MSCs) have been used for the treatment of liver fibrosis. Low survival rate, less fibrolytic and profibrogenic properties of MSCs remain the major concerns for inadequate recovery of liver from fibrosis. This led us to investigate BM cells devoid of mesenchymal lineage that is CD45+ cells for the antifibrotic effect as this population consisting of mononuclear cells which are the precursor of macrophages and may involve in the scar degradation process. Cells transplantation can be followed in different ways like intrasplenic infusion, tail vein injection and ectopic cell transplantation in experimental animal models. The survival of the cells after ectopic transplantation is less when compared to tail vein and intrasplenic infusion. Intrasplenic route of transplantation is effective in engraftment and long term survival of the donor cells especially in case of liver disease models. This protocol describes fibrosis mouse model development, intrasplenic route of cell transplantation and tracking of the donor cells after transplantation.
Keywords: Bone Marrow Cells Intrasplenic Transplantation Liver Fibrosis Liver regeneneration Hepatocytes
Materials and Reagents
Falcon tubes
15 ml (Corning, Falcon®, catalog number: 352097 )
50 ml (Corning, Falcon®, catalog number: 352070 )
Culture discs (Corning, catalog number: 430167 )
Pipettes tips (Eppendorf, catalog number: 022491954 )
Surgical glass slides (Thickness: 1.45 mm; 75 x 25 mm & 76 x 26 mm) (Polar Industrial, catalog number: Blue Star PIC 2 )
BD tuberculin syringe 1 ml (BD, catalog number: 309623 )
Cell strainer (40 μm) (Corning, Falcon®, catalog number: 352340 )
Petri plates (30 mm, 100 mm)
Six- to eight-week-old male C57BL/6J (THE JACKSON LABORATORY, catalog number: 000664-C57BL/6J )
Enhanced green fluorescence protein (eGFP) transgenic mice [C57BL/6-Tg(UBC-GFP)30Scha/J] (THE JACKSON LABORATORY, catalog number: 004353 )
Carbon tetrachloride (CCl4) (Sigma-Aldrich, catalog number: 319961 )
Mineral oil (Sigma-Aldrich, catalog number: M8410 )
CO2 gas
Formalin (Thermo Fisher Scientific, catalog number: SF98-4 )
Iso-propyl alcohol (Thermo Fisher Scintific, catalog number: A416S-4 )
Xylene (Thermo Fisher Scintific, catalog number: X3S )
Paraffin wax (EMD Millipore, catalog number: 107151 )
Picrosirus Red Staining Kit (Polysciences, catalog number: 24901-250 )
Dulbecco’s modified Eagle’s medium (DMEM) (Thermo Fisher Scientific, GibcoTM, catalog number: 12100-046 )
FCS
Phosphate buffer saline (PBS) (HiMedia Laboratories, catalog number: TS1099 )
Anti-CD45 APC (affymetrix, eBioscience, catalog number: 17-0451 )
70% ethanol
Ketamin (nirlife healthcare, catalog number: Ketamin )
Xylazine (INDIAN IMMUNOLOGICALS, catalog number: 21 )
10% formalin saline solution
PBS
Sucrose (Thermo Fisher Scintific, catalog number: S5 )
Poly-L-lysine (Sigma-Aldrich, catalog number: P4707 )
Nail polish
Ketamine
Xylazine
Triton X-100 (HiMedia Laboratories, catalog number: 9002-93-1 )
Bovine serum albumin (BSA) (Sigma-Aldrich, catalog number: A9418 )
Fetal bovine serum (FBS) (Biological Industries, catalog number: 04121-1A)
DAPI
Isotype mouse IgG (Jackson ImmunoResearch, catalog number: 015-000-003 )
Isotype goat IgG (Jackson ImmunoResearch, catalog number: 005-000-003 )
Anti-GFP antibody (Takara Bio, catalog number: 632381 )
Anti-Albumin antibody (Bethyl Laboratories, catalog number: A90-134B )
Alexa Fluor donkey anti-mouse 488 (Thermo Fisher Scientific, Invitrogen, catalog number: A-21202 )
Alexa Fluor donkey anti-goat 594 (Thermo Fisher Scientific, Invitrogen, catalog number: 11058 )
Antifade (Thermo Fisher Scientific, Molecular probesTM,catalog number: P36961 )
Ammonium chloride (NH4Cl) (HiMedia Laboratories, catalog number: TC092 )
Potassium chloride (KCl) (Thermo Fisher Scintific, catalog number: 13305 )
Potassium dihydrogen ortho phosphate (KH2PO4) (Central Drug House, catalog number: 029608 )
Disodium hydrogen phosphate (Na2HPO4) (Thermo Fisher Scintific, catalog number: S379 )
Glocose (Thermo Fisher Scintific, catalog number: D16 )
Gelatin (Sigma-Aldrich, catalog number: G9664 )
Phenol red (Thermo Fisher Scintific, catalog number: P7410 )
Magnesium chloride hexahydrate (MgCl2·6H2O) (Sigma-aldrich, catalog number: M2670 )
Magnesium sulfate heptahydrate (MgSO4·7H2O) (Sigma-aldrich, catalog number: 230391 )
Calcium chloride (CaCl2) (Sigma-Aldrich, catalog number: C5670 )
Sodium bicarbonate (NaHCO3) (Sigma-Aldrich, catalog number: S5761 )
Tissue freezing media (Leica Biosystems Nussloch, catalog number: 14020108926 )
CCl4 dose preparation (see Recipes)
Gey’s solution (see Recipes)
Equipment
Tissue processing cassettes
Oven (Scientific Systems Company)
Pure paraffin wax container
Embedding machine
Laminar flow (Esco Micro Pte, model: AC2-2E9 )
Scissors (2)
Blunt forceps (2)
Surgical blades with scalpel
Hemostatic forceps
Suture threads
Suture needle
Dissecting board
FACS AriaTM III (BD, model: BD FACSARIA III )
Incubator (SHEL LAB, model: SCO5A )
Pipets (Eppendorf)
Glows (SAFEMAX)
Centrifuge (Eppendorf, model: 5810R )
Cryotome (Thermo Fisher Scientific, model: CryoStar NX50 Cryostat )
Ultra-Thin semiautomatic microtome (Histo Line Laboratories, model: MRS 3500 )
Software
Adobe Photoshop
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Baligar, P., Pokhrel, S. and Mukhopadhyay, A. (2016). Experimental Liver Fibrosis and Intrasplenic Transplantation of CD45+ Bone Marrow Cells. Bio-protocol 6(20): e1972. DOI: 10.21769/BioProtoc.1972.
Download Citation in RIS Format
Category
Stem Cell > Adult stem cell > Cell transplantation
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,973 | https://bio-protocol.org/exchange/protocoldetail?id=1973&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
In vivo Imaging of Tumor and Immune Cell Interactions in the Lung
Richard N. Hanna
GC Grzegorz Chodaczek
CH Catherine C. Hedrick
Published: Vol 6, Iss 20, Oct 20, 2016
DOI: 10.21769/BioProtoc.1973 Views: 9151
Edited by: Kristopher Marjon
Reviewed by: Alka MehraElizabeth V. Clarke
Original Research Article:
The authors used this protocol in Nov 2015
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Nov 2015
Abstract
Immunotherapy has demonstrated great therapeutic potential by activating the immune system to fight cancer. However, little is known about the specific dynamics of interactions that occur between tumor and immune cells. In this protocol we describe a novel method to visualize the interaction of tumor and immune cells in the lung of live mice, which can be applied to other organs. In this protocol fluorescent-labeled tumor cells are transferred to recipient mice expressing fluorescently tagged immune cells. Tumor-immune cell interactions in the lung are then imaged by confocal or two photon microscopy. Analysis of tumor interactions with immune cells using this protocol should aid in a better understanding of the importance of these interactions and their role in developing immunotherapies.
Keywords: In vivo imaging Cancer Immunology Lung Phagocytosis
Background
A number of immunotherapies have demonstrated great promise in treating cancer. Understanding the spatial temporal resolution of how these tumor-immune interactions occur is important for enhancing and developing new immunotherapies. In this protocol we describe a novel method to directly visualize tumor-immune cell interactions in vivo in mouse lung. This protocol is initially described in our work examining the interactions of patrolling monocytes and tumor cells in the mouse lung (Hanna et al., 2015). This fluorescent microscopy protocol uses the vacuum imaging ring to stabilize and image the lung, which was initially described by Looney and colleagues (Thornton et al., 2012). In this protocol fluorescent-labeled tumor cells are transferred to recipient mice expressing fluorescently tagged immune cells. Tumor-immune cell interactions in the lung are then imaged by confocal or two photon fluorescent microscopy using the vacuum imaging ring. This protocol allows for the addition of other immune cell markers by intravenous (IV) injection of fluorescently labeled antibodies, and is adaptable to image tumor-immune cell interactions in other organs. Quantitative information such as the localization, engulfment of tumor material, timing, speed and frequency of these immune cell interactions can be collected using this protocol. This protocol should aid in helping to better understand the specific immune-tumor cell interactions that are important to developing better immunotherapies in the future.
Materials and Reagents
Cell culture flask
30 gauge insulin syringe (BD, catalog number: 328431 ) Nr4a1-GFP (The Jackson Laboratory, catalog number: 018974 ), CX3CR1-GFP (The Jackson Laboratory, catalog number: 005582 ) or other fluorescent reporter mouse for visualizing immune cells.
½ micro-cover glass (12 mm diameter) (Electron Microscope Sciences, catalog number: 72230-01 )
PE-90 tubing (BD, IntramedicTM, catalog number: 427420 )
Mice
Lewis lung carcinoma cells expressing red fluorescent protein (LLC-RFP) or other fluorescent-tagged tumor cell line (AntiCancer.com)
TrypLETM Express enzyme(Thermo Fisher Scientific, GibcoTM, catalog number: 12604013 )
Dulbecco's phosphate-buffered saline (DPBS) (GE Healthcare, HycloneTM, catalog number: SH30038.02 )
Ketamine hydrochloride
Xylazine hydrochloride
Vetbond glue (3M, catalog number: 1469SB )
Oxygen
Ethanol
Dow Corning® high vacuum grease (Sigma-Aldrich, catalog number: Z273554 )
Equipment
Centrifuge
Mechanical mouse ventilator (Harvard Apparatus, model: 845 )
Fine dissecting tweezers and scissors (Fine Scientific Tools)
Suction ring for imaging (Mekilect, catalog number: Suction Ring )
Vacuum line with pressure regulator and pressure gauge
Upright confocal or 2photon microscope with resonance scanner (we use a Leica SP5), heated stage and long distance 20-25x water immersion objective suitable for live imaging.
Software
Imaris software (version 7.1.1 x 64) (Bitplane, http://www.bitplane.com/download/manuals/ReferenceManual6_1_0.pdf)
Prism software (GraphPad Software)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Hanna, R. N., Chodaczek, G. and Hedrick, C. C. (2016). In vivo Imaging of Tumor and Immune Cell Interactions in the Lung. Bio-protocol 6(20): e1973. DOI: 10.21769/BioProtoc.1973.
Download Citation in RIS Format
Category
Cancer Biology > Tumor immunology > Tumor microenvironment
Immunology > Immune cell function > General
Cell Biology > Cell imaging > Live-cell imaging
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,974 | https://bio-protocol.org/exchange/protocoldetail?id=1974&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Quantification of Tumor Material Uptake
Richard N. Hanna
CH Catherine C. Hedrick
Published: Vol 6, Iss 20, Oct 20, 2016
DOI: 10.21769/BioProtoc.1974 Views: 8246
Edited by: Kristopher Marjon
Reviewed by: Martin V KolevElizabeth V. Clarke
Original Research Article:
The authors used this protocol in Nov 2015
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Nov 2015
Abstract
Extracellular tumor material including exosomes, microvesicles and apoptotic tumor debris may help cancers invade new organs. Enhancing the removal of extracellular tumor material by immune cells represents a novel immunotherapy approach for preventing cancer metastasis. This protocol quantifies the uptake and removal of extracellular tumor material from circulation and tissues by immune cells. In this assay fluorescent tumor cells are transferred into mice, and then immune cells are quantified by either flow cytometry or imaging cytometry for their uptake of tumor material.
Keywords: Cancer Phagocytosis Imaging Immunology Lung
Background
Recent studies have demonstrated that extracellular tumor material including exosomes, microvesicles and apoptotic tumor debris shed from tumors are important mediators of tumor metastasis, growth and evasion of the immune response (Vader et al., 2014; Pucci and Pittet, 2013; Pucci et al., 2016). Immune cells have the ability to remove, respond and transport this circulating tumor material (Hanna et al., 2015; Pucci et al., 2016; Headley et al., 2016). This protocol offers a novel approach to quantify tumor material uptake by specific immune cell populations, and may be adapted to test immune targets that regulate tumor material uptake. This protocol may assist in better understanding the immune response to extracellular tumor material, with the hope of eventually developing novel therapies targeting extracellular tumor material in cancer development.
Materials and Reagents
30 gauge insulin syringe (BD, Ultra-FineTM, catalog number: 328431 )
15 ml tubes
70 μm cell strainers (Thermo Fisher Scientific, Fisher Scientific, catalog number: 22363548 )
15 mm Petri dish
5 ml syringe (BD, Luer-LokTM, catalog number: 309646 )
96-well v-bottom plate
Lewis lung carcinoma cells expressing red fluorescent protein (LLC-RFP), B16F10 green fluorescent protein (B16F10-GFP) or other fluorescent-tagged tumor cell line (AntiCancer.com, http://www.anticancer.com/Fluorescent_protein_cell_lines_April_2010.pdf)
Syngeneic recipient mice. C57BL/6J mice (The Jackson Laboratory, catalog number: 000664 ) for LLC and B16F10 tumors.
TrypLE (Thermo Fisher Scientific, GibcoTM, catalog number: 12604013 )
Dulbecco's phosphate-buffered saline (DPBS) (GE Healthcare, HycloneTM, catalog number: SH30013.02 )
UltraPureTM 0.5 M EDTA, pH 8.0 (Thermo Fisher Scientific, InvitrogenTM, catalog number: 15575020 )
Red blood cell (RBC) lysis buffer (10x) (BioLegend, catalog number: 420301 )
Fc Block (CD16/32) (BD, PharmingenTM, catalog number: 553141 )
Fluorochrome conjugated antibodies:
CD11b-FITC (BioLegend, catalog number: 101206 )
CD115-APC (BioLegend, catalog number: 135510 )
Ly6C-APC-Cy7 (BioLegend, catalog number: 128026 )
CD45-BV421 (BioLegend, catalog number: 103134 )
Bovine serum albumin (BSA) (Sigma-Aldrich, catalog number: A9418 )
Live/Dead Fixable Blue (Thermo Fisher Scientific, Molecular ProbesTM, catalog number: L34962 )
Sodium azide (Sigma-Aldrich, catalog number: S2002 )
Flow buffer (FB) (see Recipes)
RBC lysis buffer (see Recipes)
Equipment
Cell culture flask
Centrifuge
Multiparameter flow cytometer with optimal excitation and detectors for tumor fluorophore (BD, LSRII or similar) or Amnis imaging cytometer (ImageStream X Mark II)
Software
ImageJ software (ImageJ)
FlowJo software (version 9.2)
Prism software (GraphPad Software)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Hanna, R. N. and Hedrick, C. C. (2016). Quantification of Tumor Material Uptake. Bio-protocol 6(20): e1974. DOI: 10.21769/BioProtoc.1974.
Download Citation in RIS Format
Category
Cancer Biology > Tumor immunology > Immunological assays
Immunology > Immune cell function > General
Cell Biology > Cell-based analysis > Flow cytometry
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,975 | https://bio-protocol.org/exchange/protocoldetail?id=1975&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Determination of Molecular Structures of Condensed Tannins from Plant Tissues Using HPLC-UV Combined with Thiolysis and MALDI-TOF Mass Spectrometry
Sauro Bianchi
IK Ivana Kroslakova
Ingo Mayer
Published: Vol 6, Iss 20, Oct 20, 2016
DOI: 10.21769/BioProtoc.1975 Views: 11193
Edited by: Arsalan Daudi
Reviewed by: Elizabeth LibbyRebecca Van Acker
Original Research Article:
The authors used this protocol in Dec 2015
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Dec 2015
Abstract
Condensed tannins extracted from plant tissues are suitable substitutes for phenolic resins. Their molecular structure, which might influence their chemical reactivity, can be assessed by the use of both HPLC-UV after acid thiolysis and MALDI-TOF mass spectrometry. Thiolysis of plant extracts in acidic methanol with cysteamine hydrochloride results in the release of the monomeric units of the condensed tannin oligomers that can be further quantified by reversed-phase HPLC-UV by comparison with analytical standards. MALDI-TOF mass spectrometry using 2,5-dihydroxybenzoic acid as matrix and K+ as cationization agent highlights the molecular structural characteristics (e.g., monomeric unit sequence) of the tannin oligomers. The methodologies permit the estimation of the mean and the maximum (observable) degree of polymerization, the type of monomeric units and the presence of glycosylation and/or esterification of the tannin oligomers.
Keywords: Condensed tannins Thiolysis HPLC-UV MALDI-TOF Plant extracts
Background
Condensed tannins are polyphenolic oligomers made of flavan-3-ol monomeric units that could be extracted from several plant tissues (e.g., softwood barks). They have been recognized as suitable alternatives to synthetic phenolics in resin formulations such as wood adhesives and foamed materials. The most common flavan-3-ol monomers detected in condensed tannins, which differ in the hydroxylation pattern and stereochemistry, are shown in Figure 1.
Figure 1. Most common monomers identified in the structure of condensed tannins
The specific structure of monomeric units in the oligomer and the polymerization degree strongly influence the chemical reactivity and physical properties of the tannins, e.g., condensation reaction rate with aldehydes, heavy metal chelation ability, and viscosity of aqueous solutions (Pizzi and Stephanou, 1994; Yoneda and Nakatsubo, 1998; Garnier et al., 2001). Identification of the molecular structure of the tannins is therefore important to better determine their possible exploitation.
The analysis of the structure of condensed tannins monomers has been performed with different methodologies, e.g., size exclusion chromatography (SEC), normal and reversed-phase high-performance liquid chromatography (HPLC), matrix assisted laser desorption ionization time of flight mass spectrometry (MALDI-TOF MS) and nuclear magnetic resonance (NMR) (Hümmer and Schreier, 2008).
Depolymerisation of tannins in acidic methanol and in the presence of toluene-α-thiol or cysteamine hydrochloride (thiolysis) followed by reversed-phase HPLC-UV was recognised as a suitable method for the estimation of the mean degree of polymerization of condensed tannins and the configuration of their building units (Matthews et al., 1997; Cheynier et al., 2001; Jerez et al., 2007; Bianchi et al., 2015). As well, MALDI-TOF MS has been shown to be successful in the determination of the structure of condensed tannins (Pasch et al., 2001; Monagas et al., 2010; Bianchi et al., 2014).
The proposed method for the analysis of condensed tannins extracted from plant tissues represents an optimization of the previously published procedures for HPLC-UV after acid thiolysis and MALDI-TOF MS. A careful tuning of the mobile phase gradient in the HPLC analysis was performed in order to reach a sufficient separation between the released flavanols and their corresponding thioethers. The choice of the cationization agent in the preparation of the sample for MALDI-TOF MS was also carefully gauged, especially in consideration of samples containing a relatively high amount of inorganic compounds like bark extracts.
The method was successfully used in the characterization of condensed tannins extracted from the bark of softwood species, e.g., Silver fir, European larch, Norway spruce, Douglas fir and Scots pine (Bianchi et al., 2015).
Materials and Reagents
1 ml Eppendorf tubes
2 ml Eppendorf tubes
HPLC-filters 17 mm, PTFE, 0.45 µm (infochroma, catalog number: 8817-P-4 )
Cosmosil Protein-R ø4.6 x 250 mm HPLC column (NACALAI TESQUE, catalog number: 06527-11 )
Dry extracts from plant tissues (e.g., softwood bark)
The dry plant extracts could be obtained through different processes. For the extraction of tannins, the maceration of fine milled tissue (< 1 mm in size) in solvents like methanol, acetone or water is suggested. The extraction temperature should be between 30 and 90 °C, and the extraction time between 10 and 60 min. The drying of the extract has to be performed avoiding as much as possible post-modification (e.g., oxidation) of the extracts. Vacuum drying and/or freeze-drying are therefore recommended. After drying the extracts should be stored in a refrigerator (3-8 °C), protected from light and air.
Deionized water (18.2 MΩ-cm)
2,5-dihydroxybenzoic acid (matrix substance for MALDI MS, HPLC grade) (Sigma-Aldrich, catalog number: 85707 )
Potassium chloride (KCl) (Sigma-Aldrich, catalog number: P9541 )
Cysteamine hydrochloride (HPLC grade) (Sigma-Aldrich, catalog number: 49705 )
Hydrochloric acid (HCl) (37%) (Sigma-Aldrich, catalog number: 320331 )
Methanol (for HPLC) (Sigma-Aldrich, catalog number: 34860 )
Acetone (for HPLC) (Sigma-Aldrich, catalog number: 270725 )
Trifluoracetic acid (TFA) (Sigma-Aldrich, catalog number: 302031 )
Acetonitrile (ACN) (Sigma-Aldrich, catalog number: 34998 )
Flavan-3-ol analytical standards:
(+)-Catechin (Sigma-Aldrich, catalog number: 43412 )
(-)-Epicatechin (Sigma-Aldrich, catalog number: 68097 )
(-)-Gallocatechin (Sigma-Aldrich, catalog number: 01338 )
(-)-Epigallocatechin (Sigma-Aldrich, catalog number: 08108 )
Mass spectra calibration standard covering a range from about 750 to 4000 m/z (e.g., Peptide calibration standard II, Bruker Daltonics, Germany)
Thiolysis media (see Recipes)
HPLC mobile phases (see Recipes)
Equipment
Eppendorf pipette 1-10 µl
Eppendorf pipette 100-1,000 µl
HPLC system equipped with a UV-photodiode array detector. In our study an Agilent 1100 LC system was used (Agilent, Waldbronn).
Water bath (Polyscience, UK)
Ultrasonic bath (BANDELIN electronic, model: Sonorex RK510 )
MALDI-TOF mass spectrometer equipped with laser emitting in UV wavelength. In our study a MALDI-TOF mass spectrometer Reflex III was used (Bruker Daltonics, Germany).
Analytical balance
Refrigerator
HPLC vials (1 ml)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Bianchi, S., Kroslakova, I. and Mayer, I. (2016). Determination of Molecular Structures of Condensed Tannins from Plant Tissues Using HPLC-UV Combined with Thiolysis and MALDI-TOF Mass Spectrometry. Bio-protocol 6(20): e1975. DOI: 10.21769/BioProtoc.1975.
Download Citation in RIS Format
Category
Plant Science > Plant biochemistry > Other compound
Plant Science > Plant physiology > Plant growth
Biochemistry > Other compound > Tannin
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,976 | https://bio-protocol.org/exchange/protocoldetail?id=1976&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Generation of Mitochondrial-nuclear eXchange Mice via Pronuclear Transfer
Robert A. Kesterson
LJ Larry W. Johnson
LL Laura J. Lambert
JV Jay L. Vivian
DW Danny R. Welch
Scott W. Ballinger
Published: Vol 6, Iss 20, Oct 20, 2016
DOI: 10.21769/BioProtoc.1976 Views: 11132
Edited by: Masahiro Morita
Original Research Article:
The authors used this protocol in Oct 2015
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Oct 2015
Abstract
The mitochondrial paradigm for common disease proposes that mitochondrial DNA (mtDNA) sequence variation can contribute to disease susceptibility and progression. To test this concept, we developed the Mitochondrial-nuclear eXchange (MNX) model, in which isolated embryonic pronuclei from one strain of species are implanted into an enucleated embryo of a different strain of the same species (e.g., C57BL/6 and C3H/HeN, Mus musculus), generating a re-constructed zygote harboring nuclear and mitochondrial genomes from different strains. Two-cell embryos are transferred to the ostia of oviducts in CD-1 pseudopregnant mice and developed to term. Nuclear genotype and mtDNA haplotype are verified in offspring, and females selected as founders for desired MNX colonies. By utilizing MNX models, many new avenues for the in vivo study for mitochondrial and nuclear genetics, or mito-Mendelian genetics, are now possible.
Keywords: Mitochondria Mitochondrial DNA Polymorphism Crosstalk
Background
The isolation of nuclear and mitochondrial genomes in MNX mice strains allows examination of pathomechanisms of dysfunctional bioenergetics such as cardiovascular disease (Fetterman et al., 2013; Grimsditch et al., 2000; Paigen et al., 1990; Wang et al., 2005), glucose tolerance (Freeman et al., 2006; Kaku et al., 1988) and fatty liver disease (Betancourt et al., 2014). This approach is distinct from conplastic (Yu et al., 2009) and xenomitochondrial (McKenzie et al., 2004) approaches in that MNX mice are generated directly with 100% of the desired nuclear and mtDNA complements from respective donor strains through nuclear transfer and thus do not require repeated back-crossings (as do conplastics) to generate animals having the desired genotype (Figure 1). Furthermore, MNX mice allow direct, unambiguous assessment of mtDNA contributions to disease since there is no complexity introduced by potential nuclear cross-over and combinational effects in the filial generations associated with standard backcrossing methods used to generate conplastic mice.
Materials and Reagents
26 gauge needle
1 or 3 ml syringe
Microscope slides
CellTram vario syringe
10 centimeter tissue culture dishes
Female donor mice (3-4 weeks of age) of desired nuclear or mitochondrial genetic backgrounds
Male breeders (proven) of matching nuclear background as donor females
Female recipient mice (8-10 weeks of age)
Vasectomized male mice (proven)
Gonadotropin from pregnant mare serum (PMS) (Sigma-Aldrich, catalog number: G4877 )
Note: This product has been discontinued.
Human chorionic gonadotropin (HCG) (Sigma-Aldrich, catalog number: CG10 )
M2 medium (Sigma-Aldrich, catalog number: M7167 )
Cytochalasin B from Drechslera dematioidea (Sigma-Aldrich, catalog number: C6762 )
Colcemid (Sigma-Aldrich, catalog number: D1925 )
Embryo tested mineral oil (Sigma-Aldrich, catalog number: M8410 )
Water for embryo transfer (Sigma-Aldrich, catalog number: W1503 )
Restriction enzyme:
BclI (New England Biolabs)
PflFI/AspI (New England Biolabs)
Dilution of PMS (see Recipes)
Dilution of HCG (see Recipes)
Dilution of cytochalasin B (see Recipes)
Dilution of colcemid (see Recipes)
Equipment
Piezoelectric drill (piezo drill) (Sutter Instrument, model: PrimeTech PMM-150FU )
Electroporator (BTX The Electroporation Experts, model: ECM 630 )
Micropipette puller (horizontal pipette puller) (Sutter Instrument, model: P-87 )
The product P-87 has been discontinued and the available one is P-97 .
Micropipette microforge (Defonbrune microforge with microscope head) (Leitz)
Holding pipette puller (vertical pipette puller) (David Kopf Instrument, model: 720 )
Microscope (Laborlux S Nomarski DIC) (Leica Microsystems)
CellTram Vario syringe (Eppendorf)
Benchtop incubator (Cook, model: MINC G20079 )
45 degree angled forceps (Fine Science Tools, catalog number: 11251-35 )
Straight forceps (Fine Science Tools, catalog number: 11251-10 )
Microdissecting spring scissors (Roboz Surgical Instrument, catalog number: RS-5650 )
Mouth pipette
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Kesterson, R. A., Johnson, L. W., Lambert, L. J., Vivian, J. L., Welch, D. R. and Ballinger, S. W. (2016). Generation of Mitochondrial-nuclear eXchange Mice via Pronuclear Transfer. Bio-protocol 6(20): e1976. DOI: 10.21769/BioProtoc.1976.
Download Citation in RIS Format
Category
Molecular Biology > DNA > Mutagenesis
Molecular Biology > DNA > Genotyping
Molecular Biology > DNA > DNA cloning
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,977 | https://bio-protocol.org/exchange/protocoldetail?id=1977&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Detection of Anaphase Bridge Formation by Immunofluorescence Microscopy in Mammalian Cells
Thomas Aschacher
Florian Enzmann
Published: Vol 6, Iss 20, Oct 20, 2016
DOI: 10.21769/BioProtoc.1977 Views: 11807
Edited by: HongLok Lung
Original Research Article:
The authors used this protocol in Jan 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jan 2016
Abstract
The aim of this protocol is to provide a comprehensive description of the materials, equipment and reproducible methods to detect and analyze anaphase bridges in immunofluorescence microscopy using DAPI to detect cells that failed to completely segregate during mitosis. It describes the process of cell preparation, staining and microscopic settings for detection of anaphase bridges. The protocol has been adapted from our previous publication (Aschacher et al., 2016).
Keywords: Anaphase bridges Cancer DNA Damage
Background
During cell division it is vital for the maintenance of genome integrity that the genetic material is fully separated. For various reasons this process can be dysfunctional and as a result the sister chromatids are connected by DNA bridges, which most frequently happens during anaphase. Especially chromosomal fragile sites are associated with anaphase bridges (e.g., unprotected and unstable telomeres). Breakage, deletion, translocation non-disjunction and changes in chromosome number at these sites are often linked with cancer and other genetic diseases. Two types of anaphase bridges are described, the ultrafine DNA bridges, that cannot be detected by DAPI staining and the chromatin bridges, which are visualized by DAPI (Germann et al., 2014). The latter is described subsequently.
This protocol describes a fast and simple method for the detection and calculation of anaphase bridges to provide an additional assay for telomere attrition in any publications.
Materials and Reagents
8-chamber slides (e.g., NuncTM Lab-TekTM II chamber SlideTM system, Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 154534 )
Nail polish (colourless, commercial available)
Coverslips (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: Q10143263NR1 )
Tumour cell line
Note: HCT-116 p53/wt was used in this protocol (ATCC, Germany).
Fetal bovine serum (FBS) (Thermo Fisher Scientific, GibcoTM, catalog number: 26140079 )
Dulbecco’s phosphate-buffered saline (PBS) (Sigma-Aldrich, catalog number: D8662 )
Trypsin-EDTA solution, 0.25%, sterile-filtered (Sigma-Aldrich, catalog number: T4049 )
McCoy’s 5A medium modified with sodium bicarbonate, without L-glutamine (Sigma-Aldrich, catalog number: M8403 )
Formaldehyde solution (37%) (Sigma-Aldrich, catalog number: 252549 )
Nuclear staining reagent (colour depends on secondary staining)
4’,6-diamidino-2-phenylindole (DAPI), colour blue (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 62247 )
Hoechst 33342, trihydrochloride, trihydrate, colour blue (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: H3570 )
DRAQ5TM fluorescent probe solution (5 mM), colour red (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 62251 )
Propidium iodide (PI), colour red (Thermo Fisher Scientific, Molecular ProbesTM, catalog number: P21493 )
Vectashield mounting medium (Vector Laboratories, USA)
Triton X-100 (Sigma-Aldrich, catalog number: X100 )
Growth medium (see Recipes)
3.7% formaldehyde solution (see Recipes)
Permeabilization solution (see Recipes)
Equipment
Cell culture microscope (e.g., Carl Zeiss, Vienna, Austria)
Pipettes
Hemocytometer (e.g., Bürker-Türk) (BRAND, catalog number: 719505 )
Centrifuge (e.g., Eppendorf, Germany)
37 °C, 5% CO2 incubator
Confocal laser scanning microscope (Carl Zeiss, model: LSM 800 )
Software
Software for LSM800: ZEN lite (for free download find 'www.zeiss.com/microscopy/en_de/products/microscope-software/zen-lite.html')
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Aschacher, T. and Enzmann, F. (2016). Detection of Anaphase Bridge Formation by Immunofluorescence Microscopy in Mammalian Cells. Bio-protocol 6(20): e1977. DOI: 10.21769/BioProtoc.1977.
Download Citation in RIS Format
Category
Cancer Biology > Genome instability & mutation > Cell biology assays
Cell Biology > Cell imaging > Fluorescence
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,978 | https://bio-protocol.org/exchange/protocoldetail?id=1978&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Rapid Determination of Cellulose, Neutral Sugars, and Uronic Acids from Plant Cell Walls by One-step Two-step Hydrolysis and HPAEC-PAD
TY Trevor Yeats*
TV Tamara Vellosillo*
NS Nadav Sorek
AI Ana B. Ibáñez
SB Stefan Bauer
*Contributed equally to this work
Published: Vol 6, Iss 20, Oct 20, 2016
DOI: 10.21769/BioProtoc.1978 Views: 16883
Edited by: Renate Weizbauer
Reviewed by: Yingnan Hou
Original Research Article:
The authors used this protocol in Mar 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Mar 2016
Abstract
The plant cell wall is primarily composed of the polysaccharides cellulose, hemicellulose and pectin. The structural and compositional complexity of these components are important for determining cell wall function during plant growth. Moreover, cell wall structure defines a number of functional properties of plant-derived biomass, such as rheological properties of foods and feedstock suitability for the production of cellulosic biofuels. A typical characterization of cell wall chemistry in the molecular biology lab consists of a mild acid hydrolysis for the quantification of hemicellulose and pectin-derived monomers and a separate analysis of cellulose by the Updegraff method. We have adopted a streamlined ‘one-step two-step’ hydrolysis protocol that allows for the simultaneous determination of cellulose content, neutral sugars, and uronic acids by high-performance anion-exchange chromatography with pulsed amperometric detection (HPAEC-PAD) of paired samples. In our work, this protocol has largely replaced Updegraff cellulose quantification and hydrolysis with 2 M TFA for the determination of matrix polysaccharide composition at the micro scale.
Keywords: Cellulose Cell Wall Hemicellulose HPAEC-PAD
Background
The protocol is based on paired analysis of samples hydrolyzed in 4% (w/v) sulfuric acid at 121 °C. One set of samples is first pretreated with 72% (w/w) sulfuric acid to swell cellulose and make it susceptible to dilute acid hydrolysis (Saeman hydrolysis in Figure 1; Saeman et al., 1945). The other set of samples are not subjected to this pretreatment, resulting in hydrolysis of non-crystalline matrix polysaccharides (Matrix hydrolysis in Figure 1). Comparison of the glucose recovered from each hydrolysis regime allows calculation of cellulose amount that is in good agreement with the more labor-intensive Updegraff (1969) protocol (Bauer and Ibáñez, 2014). In addition to glucose (Glc), other sugars derived from matrix polysaccharides can be quantified from the matrix hydrolysis samples (Gao et al., 2014). Thus, with relatively few manual manipulations, matrix monosaccharides and cellulose can be quantified from two hydrolysis samples and a total of four HPAEC-PAD experiments. Despite the number of chromatographic separations required by the protocol, the great reduction in ‘hands-on’ time required to prepare samples makes this technique well-suited to high throughput analyses. Although we have found that robust and reproducible analysis of rhamnose (Rha), arabinose (Ara), mannose (Man), and xylose (Xyl) requires multiple HPAEC-PAD runs, reports describing simultaneous quantification of all neutral and acidic sugars in a single run may allow further improvement of this protocol’s throughput (Zhang et al., 2012; Voiniciuc and Grünl, 2016). The steps of the protocol described here are outlined in Figure 1.
Figure 1. Protocol Overview. AIR = Alcohol insoluble residue.
Materials and Reagents
2 ml safe-lock microcentrifuge tubes (Eppendorf, catalog number: 022363352 )
Aluminum foil
2 ml Sarstedt tubes with screw caps (SARSTEDT, catalog number: 72.694.007 )
2 ml screw cap autosampler vials (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: C4000-1W )*
Autosampler vial caps with pre-slit septa (Phenomenex, catalog number: AR0-8977-13-B )*
5/32” Grinding Balls, 440C Stainless Steel, Treated (OPS Diagnostics, catalog number: GBSS 156-5000-01 )*
Disposable anti-static polypropylene powder scoops (Cole-Parmer Instrument, catalog number: 06277-60 )
Note: This product has been discontinued.
Ethanol (Decon Labs, catalog number: V1016 )*
Chloroform (Thermo Fisher Scientific, Fisher Scientific, catalog number: C607-4 )*
Methanol (Thermo Fisher Scientific, Fisher Scientific, catalog number: A412P4 )*
Acetone (Thermo Fisher Scientific, Fisher Scientific, catalog number: A184 )*
72% (w/w) sulfuric acid solution (RICCA Chemical, catalog number: R81916001A )*
Ultrapure water (Milli-Q or equivalent)*
9 sugars:
L-fucose (Fuc) (Sigma-Aldrich, catalog number: F2252 )*
D-glucose (Glc) (Sigma-Aldrich, catalog number: G8270 )*
D-galactose (Gal) (Sigma-Aldrich, catalog number: G0750 )*
D-xylose (Xyl) (Sigma-Aldrich, catalog number: X1500 )*
D-mannose (Man) (Sigma-Aldrich, catalog number: M8574 )*
L-arabinose (Ara) (Sigma-Aldrich, catalog number: A3256 )*
L-rhamnose (Rha) (Sigma-Aldrich, catalog number: W373011 )*
D-galacturonic acid monohydrate (GalA) (Sigma-Aldrich, catalog number: 48280 )*
D-glucuronic acid (GluA) (Sigma-Aldrich, catalog number: G5269 )*
Sodium hydroxide solution (50%, w/w) (Thermo Fisher Scientific, Fisher Scientific, catalog number: SS254 )
Sodium acetate, anhydrous (Sigma-Aldrich, catalog number: 71183 )
Liquid nitrogen
*Note: These items can reliably be substituted with laboratory-grade equivalents from different vendors.
Equipment
Freeze-dryer (Labconco, model: FreeZone 12 )* (optional)
Magnet
Aspirator
Metal spatula
Microcentrifuge (Eppendorf, model: 5417R )*
Autoclave-compatible rack
Autosampler
Microbalance (Mettler Toledo, model: XS105 )*
Ball mill (Retsch, model: MM 400 )*
Dionex ICS-5000 HPAEC-PAD system, optionally equipped with an eluent generator (Thermo Fisher Scientific, Fisher Scientific, model: ICS-5000+ SYSTEM )
CarboPac PA-20 Analytical column, 3 x 150 mm (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 060142 )
CarboPac PA-20 Guard column, 3 x 30 mm (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 060144 )
CarboPac PA-200 Analytical column, 3 x 250 mm (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 062896 )
CarboPac PA-200 Guard column, 3 x 50 mm (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 062895 )
*Note: These items can reliably be substituted with laboratory-grade equivalents from different vendors.
Software
Chromeleon 7 (Thermo Fisher Scientific)
Microsoft Excel
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
How to cite： Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Yeats, T., Vellosillo, T., Sorek, N., Ibáñez, A. B. and Bauer, S. (2016). Rapid Determination of Cellulose, Neutral Sugars, and Uronic Acids from Plant Cell Walls by One-step Two-step Hydrolysis and HPAEC-PAD. Bio-protocol 6(20): e1978. DOI: 10.21769/BioProtoc.1978.
Yeats, T. H., Sorek, H., Wemmer, D. E. and Somerville, C. R. (2016). Cellulose deficiency is enhanced on hyper accumulation of sucrose by a H+-coupled sucrose symporter. Plant Physiol 171(1): 110-124.
Download Citation in RIS Format
Category
Plant Science > Plant biochemistry > Carbohydrate
Biochemistry > Carbohydrate > Cellulose
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,979 | https://bio-protocol.org/exchange/protocoldetail?id=1979&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Assessment of TCR-induced Sumoylation of PKC-θ
Xudong Wang
ZC Zhilong Chen
QW Qilong Wang
YL Yingqiu Li
Published: Vol 6, Iss 20, Oct 20, 2016
DOI: 10.21769/BioProtoc.1979 Views: 6486
Edited by: Ivan Zanoni
Reviewed by: Michael EnosMareta Ruseva
Original Research Article:
The authors used this protocol in Oct 2015
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Oct 2015
Abstract
Sumoylation controls many cellular processes. Protein kinase C-θ (PKC-θ), a member of the Ca2+-independent PKC subfamily of kinases, serves as a regulator of T cell activation by mediating the T cell antigen receptor (TCR)- and coreceptor CD28-induced activation of the transcription factors NF-κB and AP-1 and, to a lesser extent, NFAT, and, subsequently, interleukin 2 (IL-2) production and T cell proliferation. We recently proved that TCR-induced sumoylation of PKC-θ is required for its function in T cells (Wang et al., 2015). Here we describe the method to analyze TCR-induced sumoylation of overexpressed or endogenous PKC-θ, which is carried out by immunoprecipitation of PKC-θ followed by immunoblotting with anti-SUMO1 antibody.
Keywords: TCR Sumoylation PKC-θ T cell activation
Background
Like ubiquitination, sumoylation is the process of covalently modifying a target protein with SUMO. To disrupt the non-covalent interactions and to detect sumoylation specifically on the protein of interest, a stringent condition for cell lysis, immunoprecipitation and washing should be used. However, lysing cells with lysis buffer containing 1% or more SDS yields highly viscous cell lysates, making it difficult to proceed to the immunoprecipitation and immunoblotting steps. Here we describe an alternative lysing-denaturing procedure. Firstly, cells were lysed in lysis buffer supplemented with the SUMO specific proteases inhibitor N-ethylmaleimide. After centrifugation, 1% SDS was added into the supernatant of the cell lysates. The lysates were diluted 10-folds with lysis buffer supplemented with N-ethylmaleimide and subjected to immunoprecipitation. This protocol could also be adopted to detect other ubiquitin-like modification such as neddylation.
Materials and Reagents
Corning 50 ml conical tube (Corning, catalog number: 430829 )
1.5 ml microcentrifuge tube (Corning, Axygen®, catalog number: MCT-150-C )
MACS columns (Miltenyi Biotec, catalog number: 130-042-401 )
MACS separators (Miltenyi Biotec, catalog number: 130-042-501 )
Raji B cells (ATCC, catalog number: CCL86 )
Jurkat T cells, Clone E6.1 (ATCC, catalog number: TIB-152 )
Hanks’ balanced salt solution (HBSS) (Thermo Fisher Scientific, GibcoTM, catalog number: 14175095 )
Ficoll (Tbdscience, catalog number: HY2015 )
Phosphate-buffered saline (PBS) (Thermo Fisher Scientific, GibcoTM, catalog number: 10010023 )
Ethylenediaminetetraacetate acid disodium salt (EDTA) (Sangon Biotech, catalog number: A610185 )
Bovine serum albumin (BSA)
CD4 microbeads (Miltenyi Biotec, catalog number: 130-045-101 )
Superantigen SEE (Toxin Technology, catalog number: ET404 )
RPMI-1640 medium (GE Healthcare, HyCloneTM, catalog number: SH30027.01 )
Heat-inactivated fetal bovine serum (FBS) (Thermo Fisher Scientific, GibcoTM, catalog number: 10270-106 )
Antibiotic-antimycotic solution 100x (Thermo Fisher Scientific, GibcoTM, catalog number: 15240062 )
N-ethylmaleimide (Sigma-Aldrich, catalog number: E1271-5G )
Sodium dodecyl sulfate (SDS) (Sangon Biotech, catalog number: A600485 )
Antibodies
Anti-CD3 (affymetrix, eBioscience, catalog number: 16-0037-85 )
Anti-CD28 (affymetrix, eBioscience, catalog number: 16-0289-85 )
Goat anti-mouse IgG (Jackson ImmunoResearch, catalog number: 115-001-003 )
Anti-Flag (Sigma-Aldrich, catalog number: F3165 )
Anti-PKC-θ (Santa Cruz Biotechnology, catalog number: sc-1875 ; BD, Transduction LaboratoriesTM, catalog number: 610089 )
Anti-SUMO1 (Santa Cruz Biotechnology, catalog number: sc-9060 )
Tris (Sangon Biotech, catalog number: A600194 )
Sodium chloride (NaCl) (Sigma-Aldrich, catalog number: S3014 )
Nonidet P40 (Sangon Biotech, catalog number: A600385 )
Aprotinin (EMD Millipore, catalog number: 616370 )
Leupeptin (Calbiochem, catalog number: 108976 )
Phenylmethanesulfonyl fluoride (PMSF) (Sigma-Aldrich, catalog number: P7626 )
Sodium pyrophosphate tetrabasic decahydrate (NaPPi) (Sigma-Aldrich, catalog number: S6422 )
Sodium orthovanadate (Na3VO4) (Sigma-Aldrich, catalog number: 567540 )
Protein G sepharose (GE Healthcare, catalog number: 17-0618-01 )
Lysis buffer (see Recipes)
Equipment
Haemocytometer (Beckman Coulter, model: Z1 COULTER COUNTER )
Humidified CO2 incubator (Thermo Fisher Scientific, Thermo ScientificTM, model: FormaTM 3111 )
Laminar air flow bio-safety cabinet (ESCO Micro, model: Airstream class II )
Centrifuge (Eppendorf, model: 5417R )
Software
ImageJ software
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Wang, X., Chen, Z., Wang, Q. and Li, Y. (2016). Assessment of TCR-induced Sumoylation of PKC-θ. Bio-protocol 6(20): e1979. DOI: 10.21769/BioProtoc.1979.
Download Citation in RIS Format
Category
Immunology > Immune cell function > Antigen-specific response
Biochemistry > Protein > Activity
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
1 Q&A
Hello, why do I use serum-free culture medium when Jurkat cells are activated with antibodies?
1 Answer
53 Views
May 4, 2023
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
198 | https://bio-protocol.org/exchange/protocoldetail?id=198&type=1 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Cell Proliferation Assay by Flow Cytometry (BrdU and PI Staining)
Hui Zhu
Published: Apr 5, 2012
DOI: 10.21769/BioProtoc.198 Views: 68914
Download PDF
Ask a question
How to cite
Favorite
Cited by
Abstract
Cell Proliferation assays include an important set of fluorescence-based tests that can monitor cell health and cell division by evaluating DNA synthesis through thymidine incorporation. Bromodeoxyuridine (5-bromo-2'-deoxyuridine, BrdU) is a synthetic nucleoside that is an analogue of thymidine. BrdU is commonly used in the detection of proliferating cells in living tissues. BrdU can be incorporated into the newly synthesized DNA of replicating cells (during the S phase of the cell cycle), substituting for thymidine during DNA replication. Antibodies specific for BrdU can then be used to detect the incorporated chemical, thus indicating cells that were actively replicating their DNA. Binding of the antibody requires denaturation of the DNA, usually by exposing the cells to acid or heat. The incorporation of BrdU is normally analyzed in flow cytometry by labelling with a conjugate anti-BrdU antibody and DNA dyes Propidium Iodide (PI) to perform cell cycle analysis.
Keywords: BrdU Propidium Iodide Cell cycle
Materials and Reagents
BrdU (Sigma-Aldrich, catalog number: B5002 )
RNase A (Sigma-Aldrich, catalog number: R4642 )
Tween 20 (Thermo Fisher Scientific, catalog number: BP337-500 )
Triton X-100 (Sigma-Aldrich, catalog number: T9284 )
BSA (Sigma-Aldrich, catalog number: A3803 )
Propidium iodide (PI) (Sigma-Aldrich, catalog number: P4170 )
Monoclonal anti-BrdU (Sigma-Aldrich, catalog number: B2531 )
Goat-anti-Mouse IgG (Whole molecule) FITC conjugate (Sigma-Aldrich, catalog number: F0257 )
Sodium Tetraborate (Na2B4O7•10H2O) (Sigma-Aldrich, catalog number: B9876 )
0.05% Trypsin-EDTA (Life Technologies, Gibco®, catalog number: 25300-062 )
Phosphate buffered saline (PBS)
EtOH
HCl
Sodium tetraborate (see Recipes)
PBS/ 1% BSA (see Recipes)
PI stock solution (see Recipes)
Equipment
Centrifuges (Beckman Falcon, TLS-55 )
Fluorescence Activated Cell Sorting (FACS) machine
FACS tubes (BD Biosciences, Falcon®, catalog number: 352054 )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2012 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Zhu, H. (2012). Cell Proliferation Assay by Flow Cytometry (BrdU and PI Staining). Bio-101: e198. DOI: 10.21769/BioProtoc.198.
Download Citation in RIS Format
Category
Cancer Biology > Proliferative signaling > Cell biology assays > Cell cycle
Cell Biology > Cell-based analysis > Flow cytometry
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
1 Q&A
1. How to prepare 0.1M Sodium Tetraborate (pH 8.5)? 2. Explain this 0.5 ml 2 N HCl/0.5% Triton X-100 either to use 2N HCL or 0.5% Triton X-100?
1 Answer
30 Views
Oct 16, 2023
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,980 | https://bio-protocol.org/exchange/protocoldetail?id=1980&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
PKC-θ in vitro Kinase Activity Assay
Xudong Wang
YL Yingqiu Li
Published: Vol 6, Iss 20, Oct 20, 2016
DOI: 10.21769/BioProtoc.1980 Views: 8889
Edited by: Ivan Zanoni
Reviewed by: Michael EnosMareta Ruseva
Original Research Article:
The authors used this protocol in Oct 2015
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Oct 2015
Abstract
Protein kinase C-θ (PKC-θ), a member of the Ca2+-independent PKC subfamily of kinases, serves as a regulator of T cell activation by mediating the T cell antigen receptor (TCR)- and coreceptor CD28-induced activation of the transcription factors NF-κB and AP-1 and, to a lesser extent, NFAT, and, subsequently, interleukin 2 (IL-2) production and T cell proliferation. In T cells, TCR and CD28 stimulation-induced activation of PKC-θ is the integrated result of diacylglycerol-mediated membrane recruitment, GLK-mediated phosphorylation at activation loop, CD28, Lck, and sumoylation-mediated central immunological synapse localization (Wang et al., 2015; Monks et al., 1997; Kong et al., 2011; Isakov and Altman, 2012; Chuang et al., 2011). Phosphatidylserine (PtdSer) and the phorbol ester Phorbol 12-myristate 13-acetate (PMA, a surrogate of diacylglycerol [DAG]) are the cofactors for the Ca2+-independent PKC subfamily that bind to PKC directly and activate it by changing its conformation (Nishizuka, 1995). A protocol to analyze the PKC-θ kinase activity in vitro is described here. Myelin basic protein is used as the substrate and its phosphorylation is detected by the incorporation of radioactive phosphate into the substrate, which is analyzed by a laser scanner.
Keywords: In vitro kinase assay PKC-θ Radiolabeled ATP
Background
Specified by their divergent regulatory domains, the PKC family can be divided into distinct subgroups: the conventional PKCs (cPKCs, comprising PKC-α, β and γ), the novel PKCs (nPKCs, including PKC-δ, ε, θ and η) and the atypical PKCs (aPKCs, PKCι and ζ). The cPKCs are activated by a combination of diacylglycerol, phospholipid and Ca2+. The nPKCs are activated by diacylglycerol and phorbol esters but do not require Ca2+. In contrast, the aPKCs do not depend on Ca2+ or diacylglycerol for activation (Rosse et al., 2010). Here we used anti-Myc or anti-PKC-θ to isolate PKC-θ from the cell lysates, then performed the radiolabeled ATP based kinase assay in the Reaction buffer containing PMA, PtdSer and EGTA (a selective chelator for Ca2+). The assay protocol described here is quick, sensitive and specific, provides a direct measurement of PKC-θ activity. This protocol could be modified to analyze the activity of other nPKC isoforms.
Materials and Reagents
Jurkat E6.1 cells or HEK293T cells
Phosphate-buffered saline (PBS) (Thermo Fisher Scientific, GibcoTM, catalog number: 10010023 )
RPMI-1640 medium (GE Healthcare, HyCloneTM, catalog number: SH30027.01 )
Heat-inactivated fetal bovine serum (FBS) (Thermo Fisher Scientific, GibcoTM, catalog number: 10270-106 )
Anti-PKC-θ (Santa Cruz Biotechnology, catalog number: sc-1875 )
Anti-Myc (9E10) (Santa Cruz Biotechnology, catalog number: sc-40 )
Protein G sepharose (GE Healthcare, catalog number: 17-0618-01 )
Phosphatidylserine from PepTag® Non-Radioactive PKC assay kit (Promega, catalog number: V5330 )
Tris (Sangon Biotech, catalog number: A600194 )
Sodium chloride (NaCl) (Sigma-Aldrich, catalog number: S3014 )
Ethylenediaminetetraacetate (EDTA) (Sangon Biotech, catalog number: A610185 )
Nonidet P40 (Sangon Biotech, catalog number: A600385 )
Aprotinin (EMD Millipore, catalog number: 616370 )
Leupeptin (Calbiochem, catalog number: 108976 )
Phenylmethanesulfonyl fluoride (PMSF) (Sigma-Aldrich, catalog number: P7626 )
Sodium pyrophosphate tetrabasic decahydrate (NaPPi) (Sigma-Aldrich, catalog number: S6422 )
Sodium orthovanadate (Na3VO4) (Sigma-Aldrich, catalog number: 567540 )
HEPES (Thermo Fisher Scientific, GibcoTM, catalog number: 11344041 )
Magnesium chloride (MgCl2) (Sigma-Aldrich, catalog number: M4880 )
EGTA (Sigma-Aldrich, catalog number: E3889 )
ATP (Sigma-Aldrich, catalog number: A2383 )
[γ-32P]ATP (PerkinElmer, catalog number: NEG002Z001MC )
Myelin basic protein (MBP) (Sigma-Aldrich, catalog number: M1891 )
PMA (Sigma-Aldrich, catalog number: P1585 )
Bromophenol blue (Bio-Rad Laboratories, catalog number: 1610404 )
DL-dithiothreitol (DTT) (Sigma-Aldrich, catalog number: D9779 )
Sodium dodecyl sulfate (SDS) (Sigma-Aldrich, catalog number: L3771 )
Glycerol (Sangon Biotech, catalog number: A100854 )
ATP-competitive PKC-θ inhibitor rottlerin (EMD Millipore, catalog number: 557370 )
DMSO
Lysis buffer (see Recipes)
PKC-θ kinase buffer (see Recipes)
Reaction buffer (see Recipes)
5x SDS-PAGE loading buffer (see Recipes)
Equipment
Typhoon Trio+ system (GE Healthcare)
Humidified CO2 incubator
Laminar air flow bio-safety cabinet
Centrifuge (Eppendorf, model: 5417R )
Phosphor-storage screen (GE Healthcare)
Sonicator (Sonics, model: VCX-130 )
Thermomixer (Eppendorf)
Exposure cassettes (GE Healthcare)
Software
Typhoon Scanner Control software
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Wang, X. and Li, Y. (2016). PKC-θ in vitro Kinase Activity Assay. Bio-protocol 6(20): e1980. DOI: 10.21769/BioProtoc.1980.
Download Citation in RIS Format
Category
Immunology > Immune cell function > Antigen-specific response
Biochemistry > Protein > Activity
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,981 | https://bio-protocol.org/exchange/protocoldetail?id=1981&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Metabolite Profiling of Mature Arabidopsis thaliana Seeds Using Gas Chromatography-Mass Spectrometry (GC-MS)
Hagai Cohen
IM Ifat Matityahu
Rachel Amir
Published: Vol 6, Iss 21, Nov 5, 2016
DOI: 10.21769/BioProtoc.1981 Views: 11212
Edited by: Tie Liu
Reviewed by: Arsalan Daudi
Original Research Article:
The authors used this protocol in Nov 2014
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Nov 2014
Abstract
Metabolite profiling using gas chromatography-mass spectrometry (GC-MS) permits the annotation and quantification of a relatively wide variety of metabolites, covering a wide range of biochemical groups of metabolites. Lisec et al. (2006) established a method for GC-MS profiling in plants. Based on this protocol, we provide here a detailed GC-MS-based metabolite profiling protocol to identify compounds belonging to several biochemical groups in the primary metabolism of mature Arabidopsis thaliana seeds (Cohen et al., 2014). The protocol uses methoxyamine hydrochloride and N-methyl-N-trimethylsilyltriflouroacetamide (MSTFA) as derivatization reagents, as previous studies indicated these are the most appropriate compounds for profiling of plant metabolites. The protocol is relatively rapid, delivers reproducible results, and can be employed to profile metabolites of many other types of plant tissues with only minor modifications. In this context, developing seeds can serve as an excellent system for studying metabolic regulation, since during their development, a massive synthesis of reserve compounds occurs controlled under tight transcriptional regulation and associated with temporally distinct metabolic switches.
Materials and Reagents
2 ml microfuge safe seal lock-cap tubes (SARSTEDT, catalog number: 72-695-500 )
1.5 ml microfuge safe seal lock-cap tubes (SARSTEDT, catalog number: 72-690-001 )
Mature dry Arabidopsis thaliana (ecotype Colombia-0) seeds
Liquid nitrogen
HPLC-grade methanol (Merck Millipore, catalog number: 67-56-1 )
HPLC-grade chloroform (Merck Millipore, catalog number: 67-66-3 )
HPLC-grade water (Avantor Performance Materials, J.T. Baker, catalog number: 7732-18-5 )
Pyridine (Merck Millipore, catalog number: 110-86-1 )
DL-norleucine internal standard (Sigma-Aldrich, catalog number: N1398 )
Methoxyamine hydrochloride (Sigma-Aldrich, catalog number: 226904 )
N-methyl-N-trimethylsilyltriflouroacetamide (MSTFA) (Sigma-Aldrich, catalog number: 24589-78-4 )
n-alkanes mixture (see Recipes)
n-Dodecane (C12) (Sigma-Aldrich, catalog number: 44010 )
n-Pentadecane (C15) (Sigma-Aldrich, catalog number: 76509 )
n-Octadecane (C18) (Sigma-Aldrich, catalog number: 74691 )
n-Nonadecane (C19) (Sigma-Aldrich, catalog number: 74158 )
n-Docosane (C22) (Sigma-Aldrich, catalog number: 43942 )
n-Octacosane (C28) (Sigma-Aldrich, catalog number: 74684 )
n-Dotriacontane (C32) (Sigma-Aldrich, catalog number: 44253 )
n-Hexatriacontane (C36) (Sigma-Aldrich, catalog number: 52919 )
Pre-cooled (4 °C) extraction buffer containing DL-norleucine internal standard solution (see Recipes)
Methoxyamine hydrochloride derivatization reagent (see Recipes)
n-alkanes time standards mix solution (see Recipes)
N-methyl-N-trimethylsilyltriflouroacetamide (MSTFA) derivatization reagent + pre-mixed n-alkanes time standards (see Recipes)
Equipment
Vacuum desiccator
Liquid nitrogen dewar
Table-top centrifuge (able to reach 20,817 x g at 4 °C) (Eppendorf)
Table-top vortex (Benchmark Scientific Inc.)
CentriVap benchtop centrifugal vacuum concentrator (Labconco)
Benchtop multi-Therm heat-shaker (Benchmark Scientific Inc.)
GC-MS system (Agilent Technologies, model: 7890A ) coupled with a mass selective detector and a Gerstel multipurpose sampler MPS2S (or any other GC-MS system)
DB-5ms capillary column (30 m, 0.25 mm i.d., and 0.25 μm thickness) (or any other column suitable for primary metabolic profiles) (Agilent Technologies, catalog number: 122-5532G )
VF-5ms capillary column (30 m + 10 m EZ-guard, 0.25 mm i.d., and 0.25 μm thicknesses) or any other column suitable for primary metabolic profiles (Agilent Technologies, catalog number: CP9013 )
10 mm Certified Clear Screw Thread Kit: 2 ml Thermo ScientificTM NationalTM 10 mm wide opening screw thread vials and inserts manufactured from clear glass + PTFE/silicone septa (Thermo Fisher Scientific, catalog number: CERT4010-91 ).
200 μl MicroSert glass inset (31 x 5 mm) (Thermo Fisher Scientific, catalog number: C4012-465 )
1 ml clear glass high recovery reaction vials with attached 13-425 open top phenolic screw-cap + PTFE/silicone septa (WHEATON, catalog number: W986294NG )
20 ml pre-assembled EPA vials + PTFE screw-caps (Thermo Fisher Scientific, catalog number: B7800-20 )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
How to cite： Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Cohen, H., Matityahu, I. and Amir, R. (2016). Metabolite Profiling of Mature Arabidopsis thaliana Seeds Using Gas Chromatography-Mass Spectrometry (GC-MS). Bio-protocol 6(21): e1981. DOI: 10.21769/BioProtoc.1981.
Cohen, H., Israeli, H., Matityahu, I. and Amir, R. (2014). Seed-specific expression of a feedback-insensitive form of CYSTATHIONINE-γ-SYNTHASE in Arabidopsis stimulates metabolic and transcriptomic responses associated with desiccation stress. Plant Physiol 166(3): 1575-1592.
Download Citation in RIS Format
Category
Plant Science > Plant metabolism > Metabolite profiling
Systems Biology > Metabolomics > Seed
Plant Science > Plant biochemistry > Other compound
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,982 | https://bio-protocol.org/exchange/protocoldetail?id=1982&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Determination of Recombinant Mannitol-1-phosphate Dehydrogenase Activity from Ectocarpus sp.
Agnès Groisillier
Thierry Tonon
Published: Vol 6, Iss 21, Nov 5, 2016
DOI: 10.21769/BioProtoc.1982 Views: 8218
Edited by: Valentine V Trotter
Reviewed by: Yanjie Li
Original Research Article:
The authors used this protocol in Feb 2014
Download PDF
Ask a question
Favorite
Cited by
Original research article
The authors used this protocol in:
Feb 2014
Abstract
Brown algae belong to a phylogenetic lineage distantly related to green plants and animals, and are found predominantly, but not exclusively, in the intertidal zone, a harsh and frequently changing environment. Because of their unique evolutionary history and of their habitat, brown algae feature several peculiarities in their metabolism. One of these is the mannitol cycle, which plays a central role in their physiology, as mannitol acts as carbon storage, osmoprotectant, and antioxidant. This polyol is derived directly from the photoassimilate fructose-6-phosphate via the action of a mannitol-1-phosphate dehydrogenase (M1PDH, EC 1.1.1.17) and a mannitol-1-phosphatase (M1Pase, EC 3.1.3.22). This protocol describes the biochemical characterization of the recombinant catalytic domain of one of the three M1PDHs identified in Ectocarpus sp. This recombinant catalytic domain, named hereafter M1PDHcat, catalyzes the reversible conversion of fructose-6-phosphate (F6P) to mannitol-1-phosphate (M1P) using NAD(H) as a cofactor. M1PDHcat activity was assayed in both directions i.e., F6P reduction and M1P oxidation (Figure 1).
Figure 1. Reversible reaction of mannitol-1-phosphate dehydrogenase
Materials and Reagents
UV-Star® PS microplate (96 well) (Greiner Bio One International, catalog number: 655801 )
0.22 µm filter
Purified recombinant His-tagged M1PDHcat
Note: This protein was produced in Escherichia coli BL21 (DE3) containing the recombinant pFO4_M1PDHcat vector, as described by Groisillier et al. (2010). This recombinant protein was purified by affinity chromatography using a HisPrep FF 16/10 column (GE Healthcare) and then by gel filtration using a Superdex 200 (GE Healthcare) onto an Äkta avant system (GE Healthcare). The complete purification protocol is described in details in Bonin et al. (2015).
MilliQ water
Trizma® base (Sigma-Aldrich, catalog number: T1503 )
4-morpholineethane-sulfonic acid (MES) (Sigma-Aldrich, catalog number: M2933 )
HEPES (Sigma-Aldrich, catalog number: H3375 )
Bis-Tris propane (Sigma-Aldrich, catalog number: B6755 )
Sodium chloride (NaCl) (Sigma-Aldrich, catalog number: 71380 )
Examples of chemicals to be tested to assess substrate and co-factor specificity:
D-mannitol-1-phosphate (Sigma-Aldrich, catalog number: 92416 )
D-fructose-1-phosphate (Sigma-Aldrich, catalog number: F1127 )
α-D-glucose-1-phosphate disodium salt hydrate (Sigma-Aldrich, catalog number: G9380 )
D-mannose-6-phosphate sodium salt (Sigma-Aldrich, catalog number: M3655 )
D-glucose-6-phosphate sodium salt (Sigma-Aldrich, catalog number: G7879 )
D-fructose-6-phosphate disodium salt hydrate (Sigma-Aldrich, catalog number: F3627 )
β-NAD (Sigma-Aldrich, catalog number: N1636 )
β-NADP (Sigma-Aldrich, catalog number: N5755 )
β-NADH (Sigma-Aldrich, catalog number: N8129 )
β-NADPH (Sigma-Aldrich, catalog number: N5130 )
1 M Tris-HCl (see Recipes)
5 M NaCl (see Recipes)
10 mM NADH (see Recipes)
10 mM NAD+ (see Recipes)
Equipment
NanoDrop 2000 spectrophotometer (Thermo Fisher Scientific, model: NanoDrop 2000 )
Safire2 UV spectrophotometer microplate reader (Tecan Trading)
Software
Hyper 32 (Informer Technologies, model: hyper32)
Microsoft Excel
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
Category
Plant Science > Phycology > Protein
Biochemistry > Protein > Activity
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,983 | https://bio-protocol.org/exchange/protocoldetail?id=1983&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Cytohistological Analyses of Mega-sporogenesis and Gametogenesis in Ovules of Limonium spp.
AR Ana S. Róis
Ana D. Caperta
Published: Vol 6, Iss 21, Nov 5, 2016
DOI: 10.21769/BioProtoc.1983 Views: 6663
Edited by: Marisa Rosa
Reviewed by: Aleksandr Gavrin
Original Research Article:
The authors used this protocol in Jan 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jan 2016
Abstract
Limonium spp. are known to have sexual and apomixis (asexual reproduction through seeds) reproductive modes. Here, we present dissection protocol developed for ovules of Limonium spp. using differential interference contrast (DIC) microscopy. This protocol permits better handling of ovules and offers certain advantages over earlier techniques particularly in larger ovules. This method also enables observation of meiosis and embryo sac development in intact ovules, and the ready detection of events distinguishing sexual and apomictic development.
Background
To describe the events that occur during ovule development it is necessary to cytologically examine ovules. This study can involve microscopic observation of paraffin- or resin-embedded, sectioned material, or cleared organs. The first cytological investigations into ovule and embryo sac development in sexual and apomictic Limonium species were published in the pioneer works of D’Amato (1940; 1949). In these works, flowers were fixed using the Karpechenko’s method, embedded in paraffin, sectioned and stained with Heidenhain’s iron haematoxylin, which stains chromatin and chromosomes in the cell nuclei. Flower buds sectioning using these methods can result in preparations with poor quality, due to partial disruption structural integrity of individual cells. A more facile alternative is clearing formalin:acetic acid:ethyl alcohol fixed organs and staining with pure Mayer’s hemalum (Wallis, 1957; Stelly et al., 1984). This technique requires much less time and labor, particularly for species which usually only form a small ovule within the ovary, which is the case of Limonium spp. However, in both small and large ovules chloral hydrate worked better than methyl salicylate as a clearing solution, because in this latter fluid ovules become quite fragile and difficult to handle during experiments. Our approach with an enzymatic digestion of ovules helps to reveal the central mass of tissue, the nucellus and the two integuments it covers, particularly in large ovules. Examples of meiotic and ameiotic ovules and embryo sacs cleared in chloral hydrate were observed under differential interference contrast optics.
Materials and Reagents
Glass microscope slides (Belden, Hirschmann, catalog number: 8210101 )
Diagnostic microscope multiwell slides (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 101432648 EPOXY )
Glass coverslips (24 x 50 mm) (Belden, Hirschmann, catalog number: 8000119 )
Teasing needle (BioQuip Products, catalog number: 4751 )
Micropipette tips (2-20 μl, 20-200 μl, 100-1,000 μl) (Eppendorf)
Six to eight months old Limonium plants in the flowering period
Formaldehyde (36% aqueous solution) (VWR, catalog number: 20909.290 )
Glacial acetic acid (Thermo Fisher Scientific, Fisher Scientific, catalog number: 10304980 )
Distilled H2O
Ethanol (absolute 99.5%) (Thermo Fisher Scientific, Fisher Scientific, catalog number: BP2818500 )
Hematoxylin solution, Mayer’s (Sigma-Aldrich, catalog number: MHS16 )
Chloral hydrate (Sigma-Aldrich, catalog number: 15307 )
Cellulase (Sigma-Aldrich, catalog number: C1184 )
Cellulase ‘Onozuka R-10’ (Serva, catalog number: 16419 )
Pectinase (Sigma-Aldrich, catalog number: 6287 )
Citric acid-1-hydrate (Sigma-Aldrich , catalog number: 33114 )
Sodium citrate dihydrate (AppliChem, catalog number: 131655 )
FAA solution (see Recipes)
Dehydration solutions (see Recipes)
Hydration solutions(see Recipes)
0.1% chloral hydrate (see Recipes)
Enzymatic mixture (see Recipes)
1x EB (Enzyme buffer) (see Recipes)
Equipment
Forceps with extra fine tips (Rubis forceps [BioQuip Products, catalog number: 4524 ])
Glass watch glasses (O.D. 25 mm and 40 mm) (Sigma-Aldrich)
Stereo microscope (Leica, model: WILD M3Z LEITZ )
Fluorescence microscope (Carl Zeiss, model: Axioskop 2 )
Differential interference contrast (DIC) optics
Micropipettes (2-20 μl, 20-200 μl, 100-1,000 μl) (Eppendorf)
AxioCam 289 MRc5 digital camera (Carl Zeiss)
Software
Adobe Photoshop 5.0
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Róis, A. S. and Caperta, A. D. (2016). Cytohistological Analyses of Mega-sporogenesis and Gametogenesis in Ovules of Limonium spp.. Bio-protocol 6(21): e1983. DOI: 10.21769/BioProtoc.1983.
Download Citation in RIS Format
Category
Plant Science > Plant cell biology > Cell imaging
Cell Biology > Cell imaging > Fixed-cell imaging
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,984 | https://bio-protocol.org/exchange/protocoldetail?id=1984&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Sulforhodamine B (SRB) Assay in Cell Culture to Investigate Cell Proliferation
EO Esteban A. Orellana
AK Andrea L. Kasinski
Published: Vol 6, Iss 21, Nov 5, 2016
DOI: 10.21769/BioProtoc.1984 Views: 46442
Edited by: HongLok Lung
Reviewed by: Chunjing Qu
Original Research Article:
The authors used this protocol in Jul 2015
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jul 2015
Abstract
The SRB assay has been used since its development in 1990 (Skehan et al., 1990) to inexpensively conduct various screening assays to investigate cytotoxicity in cell based studies (Vichai and Kirtikara, 2006). This method relies on the property of SRB, which binds stoichiometrically to proteins under mild acidic conditions and then can be extracted using basic conditions; thus, the amount of bound dye can be used as a proxy for cell mass, which can then be extrapolated to measure cell proliferation.
The protocol can be divided into four main steps: preparation of treatment, incubation of cells with treatment of choice, cell fixation and SRB staining, and absorbance measurement. This assay is limited to manual or semiautomatic screening, and can be used in an efficient and sensitive manner to test chemotherapeutic drugs or small molecules in adherent cells. It also has applications in evaluating the effects of gene expression modulation (knockdown, gene expression upregulation), as well as to study the effects of miRNA replacement on cell proliferation (Kasinski et al., 2015).
Background
The SRB assay has been widely used to investigate cytotoxicity in cell based studies and it is the method of choice for high cost-effective screenings (Vichai and Kirtikara, 2006). Since this method does not rely on measuring metabolic activity [e.g., 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide, MTT], the steps required to optimize the protocol for a specific cell line are substantially simplified.
The protocol described here has been optimized for medium throughput screening of miRNAs with tumor suppressive properties in adherent lung cancer cells in 96-well format and 384-well format (Kasinski et al., 2015). Particularly the SRB assay in 384-well format offers the advantage of screening a large number of miRNA mimics or compounds in a single plate (> 60 per plate, 6 replicates) using inexpensive equipment and reagents.
Materials and Reagents
96-well clear flat-bottom polystyrene tissue-culture plates (Corning, catalog number: 3596 )
384-well clear flat-bottom polystyrene tissue-culture plates (Corning, catalog number: 3701 )
96-well PCR plates (Corning, Axygen®, catalog number: PCR-96-FS-C )
100 mm tissue-culture plates (Corning, catalog number: 430167 )
1.5 ml Eppendorf tubes (VWR, catalog number: 89000-028 )
15 ml Falcon tubes (Corning, Falcon®, catalog number: 352097 )
Pipette tips (Mettler-Toledo International, catalog numbers: RT-L10FLR )
Pipette tips (Mettler-Toledo International, catalog numbers: RT-L200F )
Pipette tips (Mettler-Toledo International, catalog numbers: RT-L1000F )
MatrixTM pipette tips (1,250 μl) (Thermo Fisher Scientific, Thermo ScientificTM, catalog numbers: 8245 )
MatrixTM pipette tips (125 μl) (Thermo Fisher Scientific, Thermo ScientificTM, catalog numbers: 7445 )
Adherent cell line of interest
Appropriate culture medium
Reagent reservoir sterile (Corning, Costar®, catalog number: 4870 )
Reagent reservoir non sterile (VWR, catalog number: 89094-684 )
Opti-MEM® (Thermo Fisher Scientific, GibcoTM, catalog number: 31985070 ) or serum free medium (SFM, appropriate culture medium before adding fetal bovine serum)
Phosphate buffered saline (PBS) (GE Healthcare, catalog number: SH30256 )
Trypsin solution (2.5%, wt/vol) (GE Healthcare, catalog number: SH30042.01 )
Fatal bovine serum (FBS) (Sigma-Aldrich, catalog number: F2442 )
Trypan blue (Sigma-Aldrich, catalog number: T9154 )
Trichloroacetic acid (TCA) (Sigma-Aldrich, catalog number: 91228 )
Sulforhodamine B sodium salt (SRB) (Sigma-Aldrich, catalog number: S1402 ) in 1% (vol/vol) acetic acid
Acetic acid (Thermo Fisher Scientific, Fisher Scientific, catalog number: S25118 )
10 mM unbuffered Tris base solution (Sigma-Aldrich)
DNAse/RNase free water (Thermo Fisher Scientific, AmbionTM, catalog number: AM9932 )
Lipofectamine RNAimax (Thermo Fisher Scientific, InvitrogenTM, catalog number: 13778150 )
Mirvana miRNA mimics (Thermo Fisher Scientific, AmbionTM)
miRNA precursor molecules - negative control #2 (non-targeting scramble miRNA) (Thermo Fisher Scientific, AmbionTM, catalog number: AM17111 )
Equipment
Pipettes (Mettler-Toledo International, catalog numbers: L-1000XLS )
Pipettes (Mettler-Toledo International, catalog numbers: L200-XLS )
Pipettes (Mettler-Toledo International, catalog numbers: L20-XLS )
Pipettes (Mettler-Toledo International, catalog numbers: L2-XLS )
Multichannel pipettes (Mettler-Toledo International, catalog numbers: L12-200XLS )
Multichannel pipettes (Mettler-Toledo International, catalog numbers: L12-20XLS )
MatrixTM multichannel electronic pipette (384-well format) (Thermo Fisher Scientific, Thermo ScientificTM, catalog numbers: 2011 )
MatrixTM multichannel electronic pipette (96-well format) (Thermo Fisher Scientific, Thermo ScientificTM, catalog numbers: 2004 )
CO2 incubator (Panasonic Biomedical Sales Europe, model: MCO-230AIC-UV )
Inverted microscope (Nikon, model: TS100 )
Multiwell microplate reader (Glomax, Promega)
Hematocytometer (Hausser Scientific, Bright-LineTM, catalog number: 1492 )
Software
Statistical analysis software (GraphPad Prism, SPSS)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Orellana, E. A. and Kasinski, A. L. (2016). Sulforhodamine B (SRB) Assay in Cell Culture to Investigate Cell Proliferation. Bio-protocol 6(21): e1984. DOI: 10.21769/BioProtoc.1984.
Download Citation in RIS Format
Category
Cancer Biology > General technique > Cell biology assays
Cell Biology > Cell viability > Cell proliferation
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,985 | https://bio-protocol.org/exchange/protocoldetail?id=1985&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
A Ribosome Footprinting Protocol for Plants
Catharina Merchante
Qiwen Hu
SH Steffen Heber
Jose Alonso
Anna N. Stepanova
Published: Vol 6, Iss 21, Nov 5, 2016
DOI: 10.21769/BioProtoc.1985 Views: 13713
Edited by: Samik Bhattacharya
Reviewed by: Renate WeizbauerBaohua Li
Original Research Article:
The authors used this protocol in Oct 2015
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Oct 2015
Abstract
Ribosome footprinting, or Ribo-seq, has revolutionized the studies of translation. It was originally developed for yeast and mammalian cells in culture (Ingolia et al., 2009). Herein, we describe a plant-optimized hands-on ribosome footprinting protocol derived from previously published procedures of polysome isolation (Ingolia et al., 2009; Mustroph et al., 2009) and ribosome footprinting (Ingolia et al., 2009; Ingolia et al., 2013). With this protocol, we have been able to successfully isolate and analyze high-quality ribosomal footprints from different stages of in vitro grown Arabidopsis thaliana plants (dark-grown seedlings [Merchante et al., 2015] and 13-day-old plantlets in plates and plants grown in liquid culture [unpublished results]).
Background
The central role of translation in modulating gene activity has long been recognized, yet the systematic exploration of quantitative changes in translation at a genome-wide scale in response to a specific stimulus has only recently become technically feasible. The ribosome footprinting technology (often known as the Ribo-seq), developed originally for yeast and mammalian cells in culture, has revolutionized the studies of translation regulation and gene expression, as it allows to determine the exact positions of the ribosomes at a genome-wide scale and at a single-codon resolution (Ingolia et al., 2009).
Prior to the development of Ribo-seq, the most common methods employed to study translation regulation in plants were the isolation of polysomal RNA via sucrose gradient centrifugation or translating ribosome affinity purification (TRAP) followed by Northern blotting, qRT-PCR, microarrays, or RNA-seq. The first method, known as polysome profiling, relies on resolving distinct polysomal fractions on a sucrose gradient via ultracentrifugation (Branco-Price et al., 2008; Missra and von Arnim, 2014; Li et al., 2015). By comparing different plant growth conditions or mutants, one could infer the changes in the rates of translation from observing a shift in the distribution of mRNAs between polysomal fractions. For example, if a transcript becomes more abundant in the monosomal fraction with the concomitant decrease in the higher order polysomes, the translation of this mRNA is considered as down-regulated. The key limitation of this technique, however, is its low resolution of higher-order polysomes (and thus mild quantitative changes in translation are often missed) and the inability to differentiate between polysomal RNAs that undergo active translation versus are loaded with arrested ribosomes (for example, those ‘stuck’ in the upstream open reading frames of a transcript). The second polysomal RNA isolation technique, TRAP, is based on the stable expression of an epitope-tagged ribosomal protein followed by the immunoprecipitation of entire ribosomes along with their associated mRNAs (Zanneti et al., 2005; Reynoso et al., 2015). While this latter method accommodates both global and tissue-specific studies of translation (achieved by driving the expression of a tagged ribosomal protein in a ubiquitous versus tissue-specific manner), its use is limited to transformable species where transgenic lines can be generated. Furthermore, transcriptomic analysis of TRAP samples per se does not provide a quantitative measure of translation (unless coupled with Ribo-seq [Juntawong et al., 2014]), as any mRNA with one or more ribosomes bound to it will be purified by TRAP. Also, since TRAP relies on epitope-tagging and the tag may interfere with the function of the ribosome, the regulation of translation of some mRNAs may be disrupted in the TRAP transgenic lines, e.g., due to a reduced ability of the tagged ribosome to associate with specific proteins at certain stages of translation. Another limitation of TRAP is that it typically uses a specific redundant isoform of a ribosomal protein for tagging, such as RPL18, and thus likely purifies only a subset of ribosomes that carry just that RPL18 variant. Given that there are multiple RPL18-like proteins in plant genomes, using one specific ribosomal protein isoform for tagging misses the ribosomes that utilize an alternative RPL18 isoform.
The method of choice for our studies, the Ribo-seq, does not involve transgenic line generation nor affinity purification, thus avoiding many of the limitations of the aforementioned earlier techniques. Most importantly, the single-codon resolution of the ribosome footprinting technology allows researchers to map the ribosomes on the mRNAs and thus clearly distinguish between the transcripts harboring productive ribosomes translating the main genic open reading frames versus transcripts associated with non-productive ribosomes arrested in the 5’UTRs. Not only does this method offer a snapshot of a whole-genome view of ribosomal distribution at an unprecedented resolution, it also enables the true quantitative measure of translational efficiency of every expressed gene in the genome by correlating the Ribo-seq data with the transcriptional information obtained via RNA-seq. Nonetheless, even the Ribo-Seq has its own drawbacks, as it cannot discriminate between mRNA subpopulations with different translation efficiencies, giving an average translation efficiency readout for each expressed gene.
Herein, we provide a plant-optimized Ribo-seq protocol that enables the study of translation regulation through the isolation of high-quality ribosomal footprints from different developmental stages of in vitro grown Arabidopsis thaliana seedlings. It describes step by step how to pellet and digest polysomes, isolate monosomes, extract the mRNA footprints, and generate sequencing libraries for the Illumina platform. The protocol also describes the preparation of parallel RNA-seq libraries to account for transcriptional regulation. We conclude the description of our method with a brief summary of how to analyze the sequencing results.
Materials and Reagents
Materials
Miracloth
30 ml NalgeneTM High-Speed polycarbonate centrifuge tubes (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 3118-0030 ) (or equivalent) to centrifuge the plant extracts
5 ml polypropylene thin-wall ultracentrifuge tubes (Beckman Coulter, catalog number: 326819 )
10 ml ultracentrifuge 14 x 89 mm tubes with isopycnic caps (BioComp Instruments, catalog number: 105-914A )
Fine scale
10 ml syringe
Cannula to be attached to the syringe (Thomas Scientific, catalog number: 1193G13 )
Pre-sterilized, RNase-free 5 ml, 1 ml, 200 µl and 10 µl micropipette tips
Pre-sterilized, RNase-free 2 ml and 1.5 ml microcentrifuge tubes
15 and 50 ml Falcon tubes
Stoppers to secure the lids of 1.5 ml tubes
Razor blades
Dynabeads mRNA Purification Kit (Thermo Fisher Scientific, AmbionTM, catalog number: 610-06 )
2 ml microcentrifuge tubes
1.5 ml non-stick, RNase-free microtubes (Thermo Fisher Scientific, Applied BiosystemsTM, catalog number: AM12450 )
MyOneTM Streptavidin C1 DynaBeads® (Thermo Fisher Scientific, InvitrogenTM, catalog number: 65601 )
200 μl PCR strip tubes
Reagents
Liquid nitrogen
RNase-free, sterile, MilliQ water
Tris base
Sucrose
Potassium chloride (KCl)
Sodium chloride (NaCl)
Magnesium chloride (MgCl2)
Ethyleneglycol-bis(2-aminoethylether)-N,N,N’,N-tetraacetic acid (EGTA)
Ethylene diamintetracetic acid (EDTA)
Dithiothreitol (DTT)
Brij-35 [Polyoxyethylene(23)lauryl ether]
Triton X-100
Igepal CA 630 (Octylphenyl-polyethylene glycol)
Tween 20 (Polyoxyethylene sorbitan monolaurate 20)
Cycloheximide (see Note 1)
Chloramphenicol (see Note 1)
Lithium chloride (LiCl)
Sodium acetate (NaOAc)
Sodium bicarbonate (NaHCO3)
Sodium carbonate (Na2CO3)
Sodium dodecyl sulfate (SDS)
Sodium hydroxide (NaOH)
Trisodium citrate (Na3C6H5O7)
Dimethylsulfoxide (DMSO), PCR grade
Ethanol, molecular biology grade
Water-saturated, acid phenol, molecular biology grade (see Note 2)
Chloroform, molecular biology grade (see Note 2)
Isoamyalcohol
Isopropanol, molecular biology grade
PEG8000
15 mg/ml GlycoBlueTM (Thermo Fisher Scientific, InvitrogenTM, catalog number: AM9515 )
10 bp DNA ladder (Thermo Fisher Scientific, InvitrogenTM, catalog number: 10821015 )
2x denaturing sample buffer with dye (Thermo Fisher Scientific, InvitrogenTM, catalog number: LC6876 ) (see Note 3)
SYBR® Gold, 10,000x in DMSO (Thermo Fisher Scientific, InvitrogenTM, catalog number: S11494 ) (see Note 4)
dNTP mix, 10 mM (Thermo Fisher Scientific, InvitrogenTM, catalog number: 18427-013 )
OmniPur® polyethylene glycol 8000 (EMD Millipore, Calbiochem®, catalog number: 6510 )
Universal miRNA cloning linker (New England Biolabs, catalog number: S1315S )
Boric acid
Acetic acid
12-well 15% polyacrylamide TBE-Urea gels (Bio-Rad Laboratories, catalog number: 4566055 ) (see Note 5)
30% acrylamide/bisacrylamide (29:1) (Bio-Rad Laboratories, catalog number: 161-0156 ) (see Note 5)
Ammonium persulfate (APS)
TEMED (N,N,N’,N’-Tetramethylethane-1,2-diamine) (Sigma-Aldrich, catalog number: T7024 )
Glycerol
Bromophenol blue
Enzymes
SUPERase-InTM RNase inhibitor (Thermo Fisher Scientific, AmbionTM, catalog number: AM2694 )
TURBOTM DNase (2 U/μl) (Thermo Fisher Scientific, AmbionTM, catalog number: AM2238 )
RNase I (100 U/μl) (Thermo Fisher Scientific, InvitrogenTM, catalog number: AM2294 )
SuperScript® III reverse transcriptase (Thermo Fisher Scientific, InvitrogenTM, catalog number: 18080-093 )
T4 polynucleotide kinase, T4 PNK4 (New England Biolabs, catalog number: M0201 ), supplied with 10x T4 PNK buffer (New England Biolabs, catalog number: B0201 ) (see Note 6)
T4 RNA ligase 2, truncated (New England Biolabs, catalog number: M0242 ), supplied with PEG 8000 50% and 10x T4 Rnl2 buffer
Phusion high-fidelity DNA polymerase (2 U/μl) (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: F-530S )
CircLigaseTM ssDNA ligase (100 U/μl) (Epicentre, catalog number: CL4115K )
Oligonucleotides
Reverse transcription primer for split-adapter circularization (see Note 7)
NI-NI-9: [P]AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGC[SC18]CACTCA[SC18]TTCAGACGTGTGCTCTTCCGATCTATTGATGGTGCCTACAG (Ingolia et al., 2009)
Size marker oligos (Ingolia et al., 2009) (see Note 8)
oNTI265: rArUrGrUrArCrArCrGrGrArGrUrCrGrArGrCrUrCrArArCrCrCrGrCrArArCrGrCrGrA
oNTI268: rArUrGrUrArCrArCrGrGrArGrArCrCrCrGrCrArArCrGrCrGrA
rRNA subtraction oligos (all the oligos here have a 5’ TEG-linked biotin and were obtained from IDT),These oligos are based on the most abundant rRNA sequences and transposons that were found using 3-day-old Arabidopsis seedlings and the ribosome footprinting protocol described herein (see Note 9)
rRNABio1: 5’-gataaccgtagtaattctagag-3’
rRNABio2&4: 5’-TGATTCATGATAACTCGACGGACGACGCGGATTACGGTGGCGGC-3’
rRNABio5&3: 5’-GTCGCTGCCGTGATCGTGGTCTCCATCGAGTCTTTGAACGCAAG-3’
Bio-Tranpos: 5’-GAGGGATGCAACACGAGGAGTTCCCGGGAGGTCA-3’
Bio-5S: 5’-AAGCCTTCTGGCCGAGGGCACGTCTGCCTGGGTGTCACAA-3’
Bio-18S: 5’-AAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTG-3’
Amplification primers
NI-NI-2: 5’-AATGATACGGCGACCACCGAGATCTACAC-3’ (Ingolia et al., 2009)
NI-NI-3: 5’-CAAGCAGAAGACGGCATACGAGATAGTCGTGTGACTGGAGTTCAGACGTGTGCTCTTCCG-3’ (Ingolia et al., 2009)
Alternative indexed primers
Index 1:
5’-CAAGCAGAAGACGGCATACGAGATCGTGATGTGACTGGAGTTCAGACGTGTGCTCTTCCG-3’
Index 2:
5’-CAAGCAGAAGACGGCATACGAGATACATCGGTGACTGGAGTTCAGACGTGTGCTCTTCCG-3’
Index 3:
5’-CAAGCAGAAGACGGCATACGAGATGCCTAAGTGACTGGAGTTCAGACGTGTGCTCTTCCG-3’
Index 4:
5’-CAAGCAGAAGACGGCATACGAGATTGGTCAGTGACTGGAGTTCAGACGTGTGCTCTTCCG-3’
Index 5:
5’-CAAGCAGAAGACGGCATACGAGATCACTGTGTGACTGGAGTTCAGACGTGTGCTCTTCCG-3’
Index 6:
5’-CAAGCAGAAGACGGCATACGAGATATTGGCGTGACTGGAGTTCAGACGTGTGCTCTTCCG-3’
Index 7:
5’-CAAGCAGAAGACGGCATACGAGATGATCTGGTGACTGGAGTTCAGACGTGTGCTCTTCCG-3’
Solutions
All solutions should be prepared with RNase-free, MilliQ water. Unless otherwise stated, all of them must be sterilized by autoclaving for at least 20 min and stored at room temperature.
1 M Tris-HCl, pH 7.0 (see Note 10)
1 M Tris-HCl, pH 8.0 (see Note 10)
1 M Tris-HCl, pH 9.0 (see Note 10)
1 M sucrose, prepared from Molecular Biology grade sucrose (autoclave for 10 min)
1 M KCl
5 M NaCl
1 M MgCl2
0.5 M EGTA, pH 8.0 (see Note 11)
0.5 M EDTA, pH 8.0 (see Note 11)
2 mM EDTA, 100 mM Na2CO3
2 mM EDTA, 100 mM NaHCO3
3 M NaOAc, pH 5.5
10% SDS (w/v)
1 M NaOH (no sterilization required)
4 M LiCl (filter-sterilize, do not autoclave)
1 M DTT (do not autoclave; aliquot and store at -20 °C)
100 mg/ml cycloheximide, prepared in DMSO (filter-sterilize; aliquot and store at -20 °C)
50 mg/ml chloramphenicol, prepared in ethanol (filter-sterilize; aliquot and store at -20 °C)
Detergent mix 20% (w/v or v/v) of each of four detergents in water (Brij-35, Triton X-100, Igepal CA 630 and Tween 20)
50% PEG8000 (w/v), prepared by combining dry PEG with water in a 50 ml conical and mixing with gentle shaking overnight. No sterilization is required. PEG is very hygroscopic; so start adding PEG to less than half of the final volume of MilliQ water. Then, after it is dissolved, add more water if needed. PEG used for ligation (step C3) should not be more than 1 month old.
10% APS (w/v), Filter-sterilize and aliquot in small volumes (e.g., 500 µl). Store at -20 °C. Aliquots can be thawed and re-frozen several times.
Buffers (see Recipes)
Polysome extraction buffer (PEB)
Sucrose cushion A (SCA)
Sucrose gradients solutions
Polysome digestion buffer (PDB)
Sucrose cushion B (SCB)
Polysome resuspension buffer (PRB)
Total RNA extraction buffer (TREB)
Alkaline fragmentation buffer (2x)
Alkaline fragmentation stop/precipitation solution
TAE (Tris/acetate/EDTA buffer) (50x)
TBE (Tris/borate/EDTA buffer) buffer (5x)
RNA gel extraction buffer (GEB)
DNA gel extraction buffer (STE)
SSC (20x)
Subtraction bind/wash buffer (2x)
8% non-denaturing polyacrylamide gel (12 ml)
Non-denaturing loading dye (6x)
Equipment
7-9 cm diameter porcelain mortar and pestle
Small (30-50 ml) glass beakers
Refrigerated Beckman Avanti J-25 centrifuge and Beckman JA17 rotor (or equivalent)
Ultracentrifuge Beckman L8-70M (or equivalent) with swinging bucket rotors for polysome pelleting (Beckman Coulter, model: SW55Ti ) and sucrose gradient centrifugation (Beckman Coulter, model: SW41Ti or Thermo Fisher Scientific, Thermo ScientificTM, model: TH-641 ).
Automatic P1000, P200 and P10 micropipettes
Refrigerated tabletop microcentrifuge
Orbital shaker
Gradient Master Station, with both the gradient maker and the fractionation station (BioComp Instruments)
Continuous UV light monitor (Bio-Rad Laboratories, model: EM-1 Econo UV Monitor )
Fractionator (Gilson, model: FC203B )
Nanodrop (or another spectrophotometer to quantify nucleic acid concentrations in small volumes of RNA)
Nutator shaker
Thermoblock
Fume hood
Mini-PROTEAN tetra cell polyacrylamide gel box (Bio-Rad Laboratories, catalog number: 165-8004 ) or equivalent and electrophoresis power supply
UV transilluminator
Vortex
DynaMagTM-2 magnetic separation rack (Thermo Fisher Scientific, catalog number: 12321D )
Thermocycler
2100 BioAnalyzer (Agilent Technologies, catalog number: G2940CA )
HiSeq2000 (Illumina)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Merchante, C., Hu, Q., Heber, S., Alonso, J. and Stepanova, A. N. (2016). A Ribosome Footprinting Protocol for Plants. Bio-protocol 6(21): e1985. DOI: 10.21769/BioProtoc.1985.
Download Citation in RIS Format
Category
Plant Science > Plant cell biology > Organelle isolation
Plant Science > Plant cell biology > Cell isolation
Cell Biology > Organelle isolation > Polyribosome
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,986 | https://bio-protocol.org/exchange/protocoldetail?id=1986&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Reconstruction of the Mouse Inflammasome System in HEK293T Cells
Hexin Shi
A Anne Murray
BB Bruce Beutler
Published: Vol 6, Iss 21, Nov 5, 2016
DOI: 10.21769/BioProtoc.1986 Views: 10868
Edited by: Ivan Zanoni
Reviewed by: Meenal Sinha
Original Research Article:
The authors used this protocol in Feb 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Feb 2016
Abstract
The NLRP3 (NLR family, Pyrin domain containing 3) inflammasome is a multiprotein complex comprised of NLRP3, pro-caspase-1, the adaptor protein apoptosis-associated speck-like protein containing a CARD (ASC), and the protein kinase NIMA related kinase 7 (NEK7) (Shi et al., 2016; He et al., 2016; Schmid-Burgk et al., 2016). When cells are exposed to microbes and/or danger signals, the inflammasome assembles and serves as a platform for the activation of caspase-1. Caspase-1 activation promotes the processing and secretion of the pro-inflammatory cytokines interleukin-1β (IL-1β), IL-18, and IL-33 as well as pyroptosis induction (Gross et al., 2011; Arend et al., 2008), which elicit inflammatory responses. Here, we describe how to co-transfect the NLRP3 inflammasome components into HEK293T cells, which enables inflammasome activation and the production of IL-1β upon stimulation with nigericin.
Background
Inflammasomes are multiprotein complexes that control inflammatory responses and coordinate immune responses against invading microbes. Reconstitution of the NLRP3 inflammasome in vitro provides an easy and efficient way to study the regulation of inflammasome activation. In this protocol, NEK7 was introduced into the in vitro NLRP3 inflammasome system and the ratio among the NLRP3 inflammasome components was optimized, making the reconstituted NLRP3 inflammasome more similar to the physiological inflammasome in vivo. Nigericin was used to activate the inflammasome as we have observed that it induces a rapid rate of IL-1β secretion compared to other inflammasome activators. Using this protocol, the levels of IL-1β can be assayed to determine NLRP3 inflammasome function under physiological conditions as well as after gene knockdown or overexpression.
Materials and Reagents
Costar 24 well clear TC-treated multiple well plate (Corning, Costar®, catalog number: 3527 )
1.5 ml Eppendorf tubes
HEK293T cells (ATCC, catalog number: CRL-11268 )
Dulbecco’s modified Eagle medium (DMEM) (Thermo Fisher Scientific, GibcoTM, catalog number: 10569-044 )
Fetal bovine serum (FBS) (Gemini Bio-Products, catalog number: 100-106 )
Penicillin-streptomycin (10,000 U/ml; 10,000 μg/ml) (Thermo Fisher Scientific, GibcoTM, catalog number: 15140-163 )
Pro-IL-1β-Flag, NLRP3-Flag, ASC1-Flag, pro-caspase-1-Flag and NEK7-HA plasmids
Note: Pro-IL-1β, NLRP3, ASC1, pro-caspase-1, and NEK7 were amplified by standard PCR techniques and were subsequently inserted into mammalian expression vectors using the In-Fusion® HD cloning kit per manufacturer’s instructions (click here for a detailed protocol and Shi et al., 2016). All plasmids were submitted to Addgene.
pCMV-pro-IL1β-C-Flag (Addgene, catalog number: 75131 )
pcDNA3-N-Flag-NLRP3 (Addgene, catalog number: 75127 )
pcDNA3-N-Flag-ASC1 (Addgene, catalog number: 75134 )
pcDNA3-N-Flag-Caspase-1 (Addgene, catalog number: 75128 )
pcDNA3-N-HA-NEK7 (Addgene, catalog number: 75142 )
IL-1β ELISA Kit (affymetrix ,eBioscience, catalog number: 88-7013-76 )
Plasmid Plus Midi Kit (QIAGEN, catalog number: 12943 )
LB medium (MP Bio, catalog number: 3002-31 )
Opti-MEM® (Thermo Fisher Scientific, GibcoTM, catalog number: 51985-034 )
Lipofectamine® 2000 transfection reagent (Thermo Fisher Scientific, InvitrogenTM, catalog number: 11668-019 )
Nigericin (Sigma-Aldrich, catalog number: N7143-10MG )
Ethanol
SuperSignalTM West Pico chemiluminescent substrate (Thermo Fisher Scientific)
DMEM cell culture medium (see Recipes)
Nigericin stock solution (see Recipes)
Equipment
37 °C, 5% CO2 forced-air incubator (Thermo Fisher Scientific, Fisher Scientific, model: Sanyo Incubator Panasonic MCO-19AIC(UV) CO2 )
Shaker incubator (Eppendorf, model: New Brunswick I24 )
Pipettes (Mettler-Toledo, ShopRainin)
Microcentrifuge (Eppendorf, model: Centrifuge 5424 )
ELISA plate reader (Bio Tek Instruments, model: Synergy Neo2 Multi-Mode Reader )
Spectrophotometer (Thermo Fisher Scientific, Thermo ScientificTM, model: NanoDrop 2000c Spectrophotometer )
Software
GraphPad Prism 6 software (http://www.graphpad.com/scientific-software/prism/)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Shi, H., Murray, A. and Beutler, B. (2016). Reconstruction of the Mouse Inflammasome System in HEK293T Cells. Bio-protocol 6(21): e1986. DOI: 10.21769/BioProtoc.1986.
Download Citation in RIS Format
Category
Immunology > Immune cell function > General
Molecular Biology > DNA > Transfection
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,987 | https://bio-protocol.org/exchange/protocoldetail?id=1987&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Putrescine Biosynthesis Inhibition in Tomato by DFMA and DFMO Treatment
EF Emma Fernández-Crespo
AG Ana Isabel González-Hernández
Loredana Scalschi
Eugenio Llorens
PG Pilar García-Agustín
GC Gemma Camañes
Published: Vol 6, Iss 21, Nov 5, 2016
DOI: 10.21769/BioProtoc.1987 Views: 8281
Edited by: Arsalan Daudi
Reviewed by: Wenrong He
Original Research Article:
The authors used this protocol in Nov 2015
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Nov 2015
Abstract
This protocol can be used to inhibit the biosynthesis of polyamines, specifically putrescine, in tomato plants grown with NH4+ as a solely N source. In general, polyamines are positively charged small metabolites implicated in physiological processes, including organogenesis, embryogenesis, floral initiation and development, leaf senescence, pollen tube growth, fruit development and ripening and participate in the response to abiotic and biotic stresses (Tiburcio et al., 2014). Polyamines are synthesized from amino acids by decarboxylation of ornithine or arginine by ornithine decarboxylase (ODC) or arginine decarboxylase (ADC), respectively (Walters, 2003). Tomato plants grown with NH4+ as the sole N source presented an increase of putrescine content in leaves (Fernández-Crespo et al., 2015). To assess the importance of putrescine accumulation, DL-α-(Difluoromethyl)arginine (DFMA) and DL-α-(Difluoromethyl)ornithine (DFMO), inhibitors of putrescine synthesis, were used as irreversible inhibitors of ADC and ODC enzymes, respectively (Fallon and Phillips, 1988), with the purpose of reducing cellular putrescine accumulation induced by NH4+ nutrition.
The inhibitor solution containing 2 mM DFMA and 5 mM DFMO was applied directly to each pot during the week prior to sample collection. Putrescine content was reduced by 35.3% in tomato plants grown with NH4+.
Background
The application of the inhibitors DFMA and DFMO was normally performed in MS medium and in vitro assays (Perez-Amador et al., 2002; Stes et al., 2011). However, we needed to test effectiveness of these inhibitors in vivo with the purpose to maintain natural growth conditions. Moschou et al. (2008) demonstrated the inhibition effect of DFMA and DFMO when applied in hydroponic cultures at 0.1 mM and 1 mM respectively. In this work, we used similar approaches with some modifications: the hydroponic culture was changed by vermiculite growing medium and the concentration applied for the inhibitors was modified.
Materials and Reagents
Tomato seeds (Solanum lycopersicum Mill. cv. Ailsa Craig)
Vermiculite (Asfaltex SA, TERMITA®)
Potassium hydroxide (KOH) (Scharlab, catalog number: PO0275 )
Potassium sulfate (K2SO4) (Scharlab, catalog number: PO0365 )
Ortho-Phosphoric acid (H3PO4) (Scharlab, catalog number: AC1100 )
Ammonium sulfate [(NH4)2SO4] (Avantor Performance Materials, J.T.Baker, catalog number: 4628 )
Calcium sulfate dihydrate (CaSO4·2H2O) (Scharlab, catalog number: CA0285 )
Magnesium sulfate heptahydrate (MgSO4·7H2O) (Scharlab, catalog number: MA0085 )
Boric acid (H3BO3) (AppliChem, catalog number: 131015 )
Manganese(II) sulfate monohydrate (MnSO4) (Scharlab, catalog number: MA0131 )
Zinc sulfate heptahydrate (ZnSO4·7H2O) (Scharlab, catalog number: CI0207 )
Copper(II) sulfate pentahydrate (CuSO4·5H2O) (Scharlab, catalog number: CO0101 )
Molybdenum trioxide (MoO3) (Panreac, Vidrafoc, catalog number: 142791 )
Sequestrene (Fe 6%) (Syngenta)
2-(N-Morpholino) ethanesulfonic acid sodium salt (MES sodium salt) (Sigma-Aldrich, catalog number: M3885 )
DL-α-(Difluoromethyl)arginine (DFMA) (Santa Cruz Biotechnology, catalog number: sc-211368 )
DL-α-(Difluoromethyl)ornithine hydrochloride (DFMO) (Santa Cruz Biotechnology, catalog number: sc-252762 )
Distilled water
Nutrient solution (see Recipes)
Inhibitors mix (see Recipes)
Equipment
Plant growth room (A.S.L Snijders)
Pots (50 ml) (Pöppelmann, model: Serie TO )
pH meter (HACH LANGE SPAIN, CRISON, model: GLP21 )
Software
Statgraphics-plus software of Windows V.5 (Statistical Graphics Corp., Rockville, MD, USA)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Fernández-Crespo, E., González-Hernández, A. I., Scalschi, L., Llorens, E., García-Agustín, P. and Camañes, G. (2016). Putrescine Biosynthesis Inhibition in Tomato by DFMA and DFMO Treatment. Bio-protocol 6(21): e1987. DOI: 10.21769/BioProtoc.1987.
Download Citation in RIS Format
Category
Plant Science > Plant biochemistry > Other compound
Biochemistry > Protein > Activity
Biochemistry > Other compound > Ion
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,988 | https://bio-protocol.org/exchange/protocoldetail?id=1988&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Microglial Phagocytosis Assay
HL Hong Lian
ER Ethan Roy
HZ Hui Zheng
Published: Vol 6, Iss 21, Nov 5, 2016
DOI: 10.21769/BioProtoc.1988 Views: 17460
Edited by: Soyun Kim
Reviewed by: Pengpeng Li
Original Research Article:
The authors used this protocol in Jan 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jan 2016
Abstract
Phagocytosis is essential for microglial clearance of apoptotic cells, extracellular protein aggregates, and infectious bacteria in the central nervous system (CNS). While the preparation of primary microglial culture has been described elsewhere, this protocol describes the microglial phagocytosis experimental procedure and the subsequent measurement of microglial phagocytic ability using fluorescent latex beads or fluorescent amyloid beta 42 (Aβ42) peptides.
Background
Microglia play multiple roles in the central nervous system (CNS). Upon stimulation, microglia present complicated inflammatory responses including altered gene expression and morphological changes (Heneka et al., 2014; Cunningham, 2013). Cytokines are a critical cluster of proteins among the list of altered expression molecules by activated microglia. Through the potent signaling-capable cytokine receptors expressed on astrocytes, neurons, and other brain cell types, microglia communicate, recruit, and coordinate inflammatory events (Smith et al., 2012). Besides cytokine secretion, phagocytosis, which involves morphological changes in microglia, also adds to their role as guardians of environmental homeostasis within the CNS milieu. Microglial phagocytosis of pathogens, extracellular protein aggregates, and apoptotic cell debris dampens inflammation and protects neurons (Fu et al., 2014). Apart from pathogenic conditions, microglial phagocytosis is also involved in CNS development and synaptogenesis through eliminating nonfunctional synapses. Deficient or excess microglial phagocytic ability could lead to abnormal synaptic connections and deposits of aggregated proteins (Schafer et al., 2012; Lian et al., 2016). Here we describe a protocol for measuring microglial phagocytic ability using in vitro cultured primary microglia. To mimic exogenous particles and protein aggregates, we used latex beads and amyloid β protein as the substrates for microglia to engulf.
Materials and Reagents
24-well plates (Corning, Costar®, catalog number: 3527 )
12 mm glass coverslips (Thermo Fisher Scientific, Fisher Scientific, catalog number: 12-545-81 )
1.5 ml centrifuge tubes (Corning, Axygen®, catalog number: MCT-150-R )
Fluorescent latex beads of 1 μm diameter (Sigma-Aldrich, catalog number: L1030 )
Poly-D-lysine (PDL) (Sigma-Aldrich, catalog number: P6407-5MG )
Distilled water (Thermo Fisher Scientific, GibcoTM, catalog number: 15230147 )
Dulbecco’s modified Eagle medium (DMEM) (Thermo Fisher Scientific, GibcoTM, catalog number: 11995065 )
Fetal bovine serum (FBS) (GE Healthcare, HycloneTM, catalog number: SH30088.03 )
FAM-labelled Aβ42 peptides (AnaSpec, catalog number: AS-23526-01 )
Dimethyl sulfoxide (DMSO) (Sigma-Aldrich, catalog number: 472301 )
Phosphate buffered salt (PBS)
4% PFA (Santa Cruz Biotechnology, catalog number: sc-281692 )
Mounting medium with DAPI (Vector Laboratories, catalog number: H-1200 )
Microglial culture media (500 ml) (see Recipes)
Equipment
Ventilation hood (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 1323 )
CO2 cell culture incubator (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 50144906 )
37 °C water bath (Thermo Fisher Scientific, Thermo ScientificTM, model: TSGP02 )
Cell counter
Software
ImageJ (http://fiji.sc/)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
How to cite： Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Lian, H., Roy, E. and Zheng, H. (2016). Microglial Phagocytosis Assay. Bio-protocol 6(21): e1988. DOI: 10.21769/BioProtoc.1988.
Lian, H., Litvinchuk, A., Chiang, A. C., Aithmitti, N., Jankowsky, J. L. and Zheng, H. (2016). Astrocyte-microglia cross talk through complement activation modulates amyloid pathology in mouse models of Alzheimer's disease. J Neurosci 36(2): 577-589.
Download Citation in RIS Format
Category
Neuroscience > Cellular mechanisms > Cell isolation and culture
Cell Biology > Cell isolation and culture > Cell isolation
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,989 | https://bio-protocol.org/exchange/protocoldetail?id=1989&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Protocol for Primary Microglial Culture Preparation
HL Hong Lian
ER Ethan Roy
HZ Hui Zheng
Published: Vol 6, Iss 21, Nov 5, 2016
DOI: 10.21769/BioProtoc.1989 Views: 23670
Edited by: Soyun Kim
Reviewed by: Pengpeng Li
Original Research Article:
The authors used this protocol in Jan 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jan 2016
Abstract
Primary microglia, in either mono-culture or co-culture with neurons or astrocytes, are a powerful tool for studying mechanisms underlying microglial inflammatory responses and cell type-specific interactions in the central nervous system (CNS). This protocol provides the details of how to prepare high purity primary microglia from newborn mouse pups. The overall steps include brain cell dissociation, mixed glial cell culture, and microglia isolation.
Background
In recent years, neuroinflammation has become a hotspot area in neuroscience studies. Inflammatory responses, such as glial activation and cytokine upregulation, were observed in brains of patients with various neurological diseases (Fan et al., 2015; Koshimori et al., 2015; Garden and Campbell, 2016). Neuroinflammation is considered not only a consequence of pathological changes in the brain but also a contributor to disease progression (Schwartz et al., 2013). In addition, the physiological functions of inflammatory pathways, the importance of which were previously underestimated, are being revealed as surprisingly versatile. For instance, activation of the complement signaling pathway is commonly observed in the central nervous system (CNS) in neurological diseases and is suspected to be involved in disease pathophysiology (Michailidou et al., 2015; Loeffler et al., 2008). Now we know that it also plays essential function in the developmental regulation of synaptic refinement (Stevens et al., 2007). Along with the increasing attention on inflammation, interest in microglial function during development, neuroprotection, and pathogenesis continues growing. Microglia are resident innate immune cells of myeloid lineage located in the brain and are critical components of the immune system in the CNS. The activation of microglia in some neurological diseases may directly participate in pathogenic processes. For instance, TREM2 mutations, which affects only microglia, are a genetic risk factor for Alzheimer’s disease (Yuan et al., 2016; Wang et al., 2015). At the same time, developmental roles of microglia are being revealed. For example, synaptic maturation during early development requires microglia and this regulation may underline the pathogenesis of developmental diseases such as autism (Edmonson et al., 2016; Stephan et al., 2012). Tools for studying microglia include in vivo models (e.g., microglia-deficient PU.1 knockout mice [McKercher et al., 1996]) and in vitro systems such as immortalized microglial cell lines and primary microglial culture. While in vivo tools are powerful for demonstrating systematic microglial function, in vitro tools are ideal for mechanistic characterization due to the easy manipulation of experimental factors. Compared to immortalized microglial cell lines, primary microglia better mimic in vivo microglial properties (Stansley et al., 2012). The altered gene expression upon stimulation may be better presented in primary microglia than in microglial cell lines (Stansley et al., 2012; Henn et al., 2009). Here we described a protocol for establishing high purity primary microglial culture derived from neonatal mice and the method has yielded robust results in our work (Lian et al., 2016). Dissociated cells are collected through enzymatic digestion of collected brains and seeded to grow mixed glial culture. Microglia growing on top of a confluent astrocyte layer are purified through mechanical tapping of mixed glial culture.
Materials and Reagents
15 ml centrifuge tubes (Corning, catalog number: 430052 )
50 ml centrifuge tubes (Corning, catalog number: 430290 )
12-well plates (Corning, Costar®, catalog number: 3737 )
New born pups (mouse, P0-P2)
Poly-D-lysine (PDL) (Sigma-Aldrich, catalog number: P6407-5MG )
Ethanol
Dulbecco’s modified Eagle medium (DMEM) (Thermo Fisher Scientific, GibcoTM, catalog number: 11995065 )
Fetal bovine serum (FBS) (GE Healthcare, HycloneTM, catalog number: SH30088.03 )
10,000 U/ml penicillin-streptomycin (Pen/Strep) (Thermo Fisher Scientific, GibcoTM, catalog number: 15140122 )
Hanks’ balanced salt solution (HBSS) (Thermo Fisher Scientific, GibcoTM, catalog number: 24020117 )
1 M HEPES buffer solution (Thermo Fisher Scientific, GibcoTM, catalog number: 15630080 )
Glucose (Thermo Fisher Scientific, Fisher Scientific, catalog number: D16-3 )
Trypsin, powder (Thermo Fisher Scientific, GibcoTM, catalog number: 27250018 )
Trypsin inhibitor (Sigma-Aldrich, catalog number: T6522-100MG )
Deoxyribonuclease I (DNase I) (Sigma-Aldrich, catalog number: DN25-100MG )
Culture medium (500 ml) (see Recipes)
Dissection medium (500 ml) (see Recipes)
2.5% trypsin (20 ml) (see Recipes)
1 mg/ml trypsin inhibitor (20 ml) (see Recipes)
10 mg/ml DNase (20 ml) (see Recipes)
Equipment
Vented cap T-75 culture flask (Corning, catalog number: 3276 )
Dissection tools
Fine scissors (Fine Science Tools, catalog number: 14060-09 )
Spring scissors (Fine Science Tools, catalog number: 15009-08 )
Curved standard forceps (Fine Science Tools, catalog number: 11052-10 )
Fine forceps (Fine Science Tools, catalog number: 11370-40 )
Centrifuge machine (Eppendorf, model: 5702 )
Hemocytometer
Ventilation hood (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 1323 )
CO2 cell culture incubator (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 50144906 )
37 °C water bath (Thermo Fisher Scientific, Thermo ScientificTM, model: TSGP02 )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
How to cite： Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Lian, H., Roy, E. and Zheng, H. (2016). Protocol for Primary Microglial Culture Preparation. Bio-protocol 6(21): e1989. DOI: 10.21769/BioProtoc.1989.
Lian, H., Litvinchuk, A., Chiang, A. C., Aithmitti, N., Jankowsky, J. L. and Zheng, H. (2016). Astrocyte-microglia cross talk through complement activation modulates amyloid pathology in mouse models of Alzheimer’s disease. J Neurosci 36(2): 577-589.
Download Citation in RIS Format
Category
Neuroscience > Cellular mechanisms > Cell isolation and culture
Cell Biology > Cell isolation and culture > Cell isolation
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
199 | https://bio-protocol.org/exchange/protocoldetail?id=199&type=1 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Cell Cycle Analysis Using Propidium Iodide Staining with GFP Detection
Hui Zhu
Published: Apr 5, 2012
DOI: 10.21769/BioProtoc.199 Views: 24318
Download PDF
Ask a question
Favorite
Cited by
Abstract
Infecting mammalian cells with a GFP construct to overexpress or knockdown target genes is one of the most commonly used methods to study and manipulate gene expression. To determine the target gene function on the cell cycle, analyzing the cell cycle (propidium iodide, PI staining) of GFP positive cells vs GFP negative cells is needed. Usually simple fixation of cells with 70% EtOH for PI staining tends to quench GFP signal; paraformaldehyde (PFA) fixation before ETOH fixation could help to sustain the GFP signal.
Keywords: Cell cycle GFP FACS Propidium iodide
Materials and Reagents
Phosphate buffered saline (PBS)
Glucose (Sigma-Aldrich, catalog number: G8270 )
Paraformaldehyde (Electron Microscopy Sciences, catalog number: 15170 )
70% EtOH
Hepes (Sigma-Aldrich, catalog number: H3375 )
NP-40 (MBL International, catalog number: JM-2111-100 )
BSA (Sigma-Aldrich, catalog number: A3803 )
RNase A (Sigma-Aldrich, catalog number: R4642 )
Fix solution (see Recipes)
Wash solution (see Recipes)
Equipment
Centrifuges (Beckman Falcon, TLS-55 )
15 ml polypropylene falcon tubes (BD Biosciences, Falcon®, catalog number: 352097 )
FACS machine
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2012 The Authors; exclusive licensee Bio-protocol LLC.
Category
Cell Biology > Cell imaging > Fluorescence
Biochemistry > Protein > Fluorescence
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,990 | https://bio-protocol.org/exchange/protocoldetail?id=1990&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Identification of Methylated Deoxyadenosines in Genomic DNA by dA6m DNA Immunoprecipitation
Magdalena J. Koziol
CB Charles R. Bradshaw
GA George E. Allen
Ana S. H. Costa
Christian Frezza
Published: Vol 6, Iss 21, Nov 5, 2016
DOI: 10.21769/BioProtoc.1990 Views: 9075
Edited by: Gal Haimovich
Reviewed by: Zhen ShiBenoit Chassaing
Original Research Article:
The authors used this protocol in Jan 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jan 2016
Abstract
dA6m DNA immunoprecipitation followed by deep sequencing (DIP-Seq) is a key tool in identifying and studying the genome-wide distribution of N6-methyldeoxyadenosine (dA6m). The precise function of this novel DNA modification remains to be fully elucidated, but it is known to be absent from transcriptional start sites and excluded from exons, suggesting a role in transcriptional regulation (Koziol et al., 2015). Importantly, its existence suggests that DNA might be more diverse than previously believed, as further DNA modifications might exist in eukaryotic DNA (Koziol et al., 2015). This protocol describes the method to perform dA6m DNA immunoprecipitation (DIP), as was applied to characterize the first dA6m methylome analysis in higher eukaryotes (Koziol et al., 2015). In this protocol, we describe how genomic DNA is isolated, fragmented and then DNA containing dA6m is pulled down with an antibody that recognizes dA6m in genomic DNA. After subsequent washes, DNA fragments that do not contain dA6m are eliminated, and the dA6m containing fragments are eluted from the antibody in order to be processed further for subsequent analyses.
Background
This protocol was developed in order to identify regions in the genome that contain dA6m. It can be used to detect dA6m in different genomes. As a guideline, this protocol was established from existing approaches used to detect adenosine methylation in RNA (Dominissini et al., 2013). We developed this protocol and adapted it for the detection of dA6m in DNA, rather than detecting adenosine methylation RNA. This was required, as no protocol was available at that time to allow the genome-wide identification of dA6m in eukaryotic DNA.
Materials and Reagents
Microcentrifuge tubes, 1.7 ml (Coring, Axygen®, catalog number: MCT-175-C )
1.5 ml Bioruptor Pico microtubes with caps (Diagenode, catalog number: C30010016 )
Optional: D1000 tape and reagents (Agilent Technologies, catalog numbers: 5067-5582 ; 5067-5583 )
DNeasy Blood & Tissue Kit (QIAGEN, catalog number: 69506 )
Phosphate-buffered saline (PBS)
CutSmart® buffer (New England Biolabs, catalog number: B7204S )
RNase (DNase-free) (Roche Diagnostics, catalog number: 11119915001 )
Water (double deionized water that has been autoclaved)
Note: All water used in this protocol refers to double deionized water, which has been subsequently autoclaved. As an alternative, purchased DNAse free water could be used.
Qubit® dsDNA HS Assay Kit (Thermo Fisher Scientific, InvitrogenTM, catalog number: Q32854 )
Bovine serum albumin (BSA) (Sigma-Aldrich, catalog number: A3059 )
dA6m antibodies (Synaptic Systems, catalog numbers: 202011 / 202111 / 202003 )
Dynabeads® protein A (Thermo Fisher Scientific, NovexTM, catalog number: 10008D )
Glycogen (Roche Diagnostics, catalog number: 10901393001 )
NaOAc (Thermo Fisher Scientific, Fisher Scientific, catalog number: 10010500 )
Isopropanol (Thermo Fisher Scientific, Fisher Scientific, catalog number: 10315720 )
Ethanol absolute (VWR, catalog number: 20821330 )
TruSeq Nano DNA LT Library Preparation Kit (set A or B) (Illumina, catalog number: FC-121-4001 or FC-121-4002 )
Tris-HCl (Melford Laboratories, catalog number: B2005 )
Sodium chloride (NaCl) (Thermo Fisher Scientific, Fisher Scientific, catalog number: 10428420 )
Igepal CA-630 (Sigma-Aldrich, catalog number: I8896 )
N6-methyladenosine 5’-monophosphate sodium salt (Sigma-Aldrich, catalog number: M2780 )
EDTA (Thermo Fisher Scientific, Fisher Scientific, catalog number: 10213570 )
Dry ice
5x DIP IP buffer (see Recipes)
1x DIP IP buffer (see Recipes)
DIP elution buffer (see Recipes)
Equipment
Incubator (Grant, dry block heating system)
Rotating wheel (Bibby Scientific, Stuart, model: rotator SB3 )
Thermomixer (Eppendorf, model: Thermomixer compact )
Qubit fluorometer (Thermo Fisher Scientific, InvitrogenTM, catalog number: Q32857 )
Note: This product has been discontinued.
Water bath sonicator (Diagenode, Bioruptor Pico, catalog number: B01060001 )
Microcentrifuge (Eppendorf, model: Centrifuge 5424 )
Vortex (Scientific Industries, model: Vortex-Genie 2 )
Magnet (Thermo Fisher Scientific, DynaMagTM, catalog number: 12321D )
Optional: 2200 Tapestation (Agilent Technologies, catalog number: G2965A )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Koziol, M. J., Bradshaw, C. R., Allen, G. E., Costa, A. S. H. and Frezza, C. (2016). Identification of Methylated Deoxyadenosines in Genomic DNA by dA6m DNA Immunoprecipitation. Bio-protocol 6(21): e1990. DOI: 10.21769/BioProtoc.1990.
Download Citation in RIS Format
Category
Molecular Biology > DNA > DNA extraction
Molecular Biology > DNA > DNA modification
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,991 | https://bio-protocol.org/exchange/protocoldetail?id=1991&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Quantitation of Cytochromes b559, b6, and f, and the Core Component of Photosystem I P700 in Cyanobacterial Cells
Motohide Aoki
Mikio Tsuzuki
Norihiro Sato
Published: Vol 6, Iss 21, Nov 5, 2016
DOI: 10.21769/BioProtoc.1991 Views: 7785
Edited by: Maria Sinetova
Reviewed by: lina YinFanglian He
Original Research Article:
The authors used this protocol in Aug 2015
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Aug 2015
Abstract
Cytochrome (Cyt) b559, an important and essential core component of photosystem II in the photosynthetic electron transport system, is a heme-bridged heterodimer protein composed of an alpha subunit (PsbE) and a beta subunit (PsbE), and its reduced form has an absorption maximum in the α-band at 559 nm. The amounts of Cyt b559 can be determined by spectrophotometrical measurement of reduced minus oxidized difference spectra that are normalized with absorbance of isosbestic point at 580 nm. The authors use differential extinction coefficients of Cyt b559 [Δε(559-580 nm) = 15.5 mM-1·cm-1], which have been reported by Garewal and Wasserman (1974). In addition to the Cyt b559, this procedure can be used for quantitation of Cyt b6 and Cyt f, the subunits of the Cyt b6/f complex, and P700, one of the core components of photosystem I. This protocol, which is adapted from Fujita and Murakami (1987), is used in a cyanobacterium, Synechococcus elongatus PCC 7942, and also in other cyanobacterial strains including Synechocystis sp. PCC 6803.
Materials and Reagents
50 ml polypropylene centrifuge tubes with conical bottom (Corning, Falcon®, catalog number: 352070 )
20 ml standard glass test tubes (Thermo Fisher Scientific, Fisher Scientific, catalog number: S63289 )
10 ml Oak Ridge high-speed PPCO centrifuge tubes (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 3119-0010 )
1.5 ml polypropylene microcentrifuge tubes (Eppendorf, catalog number: 0030125150 )
0.20 µm cellulose acetate membrane filter, sterile (Toyo Roshi Kaisha, catalog number: 25CS020AS )
Micro spatula
Synechococcus elongatus PCC 7942 (http://cyanobacteria.web.pasteur.fr/)
BG11 as a culture medium (Rippka et al., 1979)
0.1 mm diameter Zirconia/Silica beads (BioSpec, catalog number: 11079101z )
Sodium ascorbate (Sigma-Aldrich, catalog number: A7631 )
Sodium hydrosulfite (Sigma-Aldrich, catalog number: 157953 )
Methanol (Wako Pure Chemical Industries, catalog number: 139-13995 )
HEPES (Dojindo Molecular Technologies, catalog number: GB10 )
Sodium hydroxide (NaOH) (Wako Pure Chemical Industries, catalog number: 198-13765 )
Sodium chloride (NaCl) (Wako Pure Chemical Industries, catalog number: 191-01665 )
Tricine (Dojindo Molecular Technologies, catalog number: GB19 )
Hydrochloric acid (HCl) (Wako Pure Chemical Industries, catalog number: 080-01066 )
Potassium ferricyanide (III) (Sigma-Aldrich, catalog number: 702587 )
Hydroquinone (Sigma-Aldrich, catalog number: H9003 )
HN buffer (see Recipes)
50 mM tricine buffer (pH 7.5) (see Recipes)
100 mM potassium ferricyanide solution (see Recipes)
Equipment
Vortex mixer (Scientific Industries, model: Vortex-Genie 2 )
Tabletop centrifuge (KUBOTA, model: 5220 ) equipped with ST-720M swing rotor (16 x 50 ml)
High speed refrigerated centrifuge (KUBOTA, model: 7700 ) equipped with RA-150 rotor (12 x 12 ml)
High speed refrigerated micro centrifuge (Tomy, model: MX-301 ) equipped with 1.5 ml/2.0 ml rotor
Ultrasonic cell disruptor (Branson, model: Sonifier SFX250 ) equipped with tapered microtip
Spectrophotometer (Beckman Coulter, model: DU 640 )
300 µl micro cuvette, 10 mm optical pathlength (Hellma, catalog number: 105-QS )
PTFE coated nickel stainless steel micro spatula (Kokugo, catalog number: 101-378-51 )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Aoki, M., Tsuzuki, M. and Sato, N. (2016). Quantitation of Cytochromes b559, b6, and f, and the Core Component of Photosystem I P700 in Cyanobacterial Cells. Bio-protocol 6(21): e1991. DOI: 10.21769/BioProtoc.1991.
Download Citation in RIS Format
Category
Biochemistry > Protein > Quantification
Microbiology > Microbial biochemistry > Protein
Microbiology > Microbial physiology > Photosynthesis
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,992 | https://bio-protocol.org/exchange/protocoldetail?id=1992&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Allogeneic Transplantation of Testicular Hyperplasia in rag1 Mutant Zebrafish
T Toshihiro Kawasaki
NS Noriyoshi Sakai
Published: Vol 6, Iss 21, Nov 5, 2016
DOI: 10.21769/BioProtoc.1992 Views: 7323
Reviewed by: Raghuveer Kavarthapu
Original Research Article:
The authors used this protocol in Feb 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Feb 2016
Abstract
Allogeneic organ transplantation is a powerful tool for clinical and basic research studies. However, the graft is often rejected by the host organism. Here, we describe a protocol that uses immunodeficient rag1 mutant zebrafish. These zebrafish escaped rejection, which made it possible to successfully transplant fragments of an allogeneic testis and testicular hyperplasia. This protocol can be used to amplify and maintain testicular hyperplasia grafts for several years (Kawasaki et al., 2016). The amplified hyperplasias are likely to be a good source of somatic and germ cells such as Sertoli cells and spermatogonial stem cells.
Background
Zebrafish have emerged as a tractable teleost genetic model for the study of vertebrate biology because several thousand mutants have been isolated by various genetic methods (Granato and Nüsslein-Volhard, 1996). Recently, this organism was used to study human diseases such as cancer (White et al., 2013). Although the incidence of spontaneous cancers is low, with many zebrafish eventually surviving cancer, allogeneic organ transplantation is a powerful tool, because many of the cancers are not syngeneic. Unfortunately, this method is not well developed. A previous study reported that zebrafish embryos accept cell grafts prior to the development of a mature immune system (Nicoli et al., 2007). However, it is difficult to successfully transplant grafts into embryos due to their minute size. For transplantation into adult zebrafish, sublethal γ-irradiation or immunosuppression with dexamethasone can block the rejection of the graft (Stoletov et al., 2007; White et al., 2008). However, it can be difficult to maintain cell grafts for long periods of time due to the short lifespans of recipients and the recovery of the immune response by 20 days after irradiation (Smith et al., 2010; Eguiara et al., 2011). Tissue grafts between identical clonal or inbred lines can survive without rejection (Kawasaki et al., 2010; Mizgirev and Revskoy, 2010; Shinya and Sakai, 2011).
T lymphocytes are central to the allograft response (Ingulli, 2010). The Recombination activating gene 1, 2 (rag1, Rag2) are important for immune function, because it creates double-stranded DNA breaks and is essential for V(D)J recombination, as well as for T and B cell function. rag1 mutant mice lack mature T and B cells, and they maintain allogeneic heart grafts for long periods of time (Zhang et al., 2006). By contrast, allogeneic transplantation has failed in rag1 mutant rats, probably due to the insufficient depletion of T and B cells (Ménoret et al., 2013). Hypomorphic rag2E450fs mutant zebrafish has been created, which have reduced V(D)J rearrangement and lymphocytes, and maintains various allogeneic cancer cells (Tang et al., 2014). Although rag1t26683 mutant zebrafish (hereafter rag1 mutant) have been isolated and they lack functional T and B cells (Wienholds et al., 2002; Petrie-Hanson et al., 2009), they were not used for transplantation. Our recent study reported that rag1 mutant zebrafish accept and maintain allogeneic testis organ and testicular hyperplasia grafts for long periods of time (Kawasaki et al., 2016). Here, we describe a protocol that uses immunodeficient rag1 mutant zebrafish for the subcutaneous transplantation of testis and testicular hyperplasia grafts.
Materials and Reagents
100 mm dish (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 263991 )
Paper towels
Surgical blades (FEATHER Safety Razor, catalog number: No. 25 )
Aluminum foil
rag1 mutant adult male zebrafish (Wienholds et al., 2002)
L-15 medium (Sigma-Aldrich, catalog number: L5520-500ML )
25x phosphate-buffered saline (PBS)
Ethyl p-aminobenzoate (Wako Pure Chemical Industries, catalog number: 057-03832 )
Gentamicin (10 mg/ml) (Thermo Fisher Scientific, GibcoTM, catalog number: 15710064 )
Ethanol
10% ethyl p-aminobenzoate stock solution (see Recipes)
0.01% ethyl p-aminobenzoate working solution (see Recipes)
0.4x PBS containing 10 μg/ml gentamicin (see Recipes)
Equipment
Stereoscopic microscope (OLYMPUS, model: SZ61 )
Forceps (Style 5) (Dumont, catalog number: 0108-5-PO )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Kawasaki, T. and Sakai, N. (2016). Allogeneic Transplantation of Testicular Hyperplasia in rag1 Mutant Zebrafish. Bio-protocol 6(21): e1992. DOI: 10.21769/BioProtoc.1992.
Download Citation in RIS Format
Category
Stem Cell > Germ cell > Spermatogonial Stem Cell
Cell Biology > Cell Transplantation > Allogenic Transplantation
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,993 | https://bio-protocol.org/exchange/protocoldetail?id=1993&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Determination of the Glycolysis and Lipogenesis in Culture of Hepatocytes
Pierre-Damien Denechaud
LF Luis Fajas
Published: Vol 6, Iss 21, Nov 5, 2016
DOI: 10.21769/BioProtoc.1993 Views: 11649
Edited by: Jia Li
Reviewed by: Xuecai GeXiujun Fan
Original Research Article:
The authors used this protocol in Jan 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jan 2016
Abstract
Metabolic flux analyses are needed to provide insights into metabolic regulation that occurs in cells. The current protocol describes fast and reproducible methods for determining glycolysis and de novo lipogenesis of hepatocytes. Primary culture of hepatocytes is an ‘in vitro’ model useful to study liver glucose and lipid metabolism (Denechaud et al., 2016). The protocol is divided in 2 parts. Part I: Glycolysis experiment is assessed using the Seahorse extracellular flux (XF) analyser. Glycolysis is determined via the measurement of the extracellular acidification rate (ECAR) of the media, which come predominately from the cellular excretion of lactic acid after the conversion of glucose in pyruvate. Part II: De novo lipogenesis experiment determines the radioactive C14 incorporation in triglycerides (TG) from acetate C14 precursor. After 2 h acetate supplementation to the media lipids are extracted and separated by TLC (Thin Layer Chromatography) prior quantification of newly synthetized TG labelled.
Background
There are different approaches for evaluating glucose and lipid metabolism: metabolite quantification, enzyme activity, and metabolomics... Our protocols focus on metabolic flux analyses of live cells and do not need a metabolomic facility. The Seahorse extracellular flux (XF) analyzer, which is now present in a lot of institution, is a powerful tool for measuring indirectly glycolysis in live cells by determining media pH. Lipogenesis protocol does not need a big investment and is highly reproducible. It could also be determined using tritiated water, which is incorporated by the Fatty Acid Synthase in de novo synthetized lipids.
Part I. Analysis of glycolysis
Materials and Reagents
60 mm tissue culture dishes (TPP, catalog number: 93060 )
XF assay 24 well cartridge and cell culture microplate V7 (Agilent Technologies, Seahorse Bioscience, catalog number: 100850-001 )
8-15 weeks old C57BL/6 mouse (Janvier lab)
Collagen type I, rat tail (EMD Millipore, catalog number: 08-115 )
M199 medium (Thermo Fisher Scientific, GibcoTM, catalog number: 41150020 )
Trypsin (2.5%), no phenol red (Thermo Fisher Scientific, GibcoTM, catalog number: 15090046 )
Fetal bovine serum (FBS)
DMEM without glucose, L-glutamine, phenol red, sodium pyruvate and sodium bicarbonate, powder, suitable for cell culture (Sigma-Aldrich, catalog number: D5030-10X1L )
D-(+)-glucose solution (Sigma-Aldrich, catalog number: G8769 )
L-glutamine, 200 mM (Thermo Fisher Scientific, GibcoTM, catalog number: 25030081 )
XF calibrant solution (Agilent Technologies, Seahorse Bioscience, catalog number: 100840-000 )
PierceTM BCA Protein Assay Kit (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 23225 )
Sodium chloride (NaCl) (AppliChem, catalog number: A3597 )
Phenol red sodium salt (Sigma-Aldrich, catalog number: P5530 )
Tris, pH 7.5 (Applichem, catalog number: A1379 )
EDTA (Sigma-Aldrich, catalog number: E6758 )
Triton X-100 (Sigma-Aldrich, catalog number: X100 )
Protease inhibitor (Sigma-Aldrich, catalog number: P8340 )
Glycolysis media (see Recipes)
9x glucose solution (see Recipes)
Lysis Buffer (see Recipes)
Equipment
CO2-free incubator set to 37 °C (Memmert or other suppliers)
5% CO2 incubator set to 37 °C (SalvisLab or other suppliers)
Centrifuge
XF 24 extracellular flux analyser (Seahorse Bioscience)
Cell culture hood (Vitaris or other suppliers)
pH meter (Mettler Toledo or other suppliers)
Cell counter (Thermo Fisher Scientific or other suppliers)
Software
Seahorse software (XFReader 24 version 1.6 supply with the XF 24 extracellular flux analyser)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Denechaud, P. and Fajas, L. (2016). Determination of the Glycolysis and Lipogenesis in Culture of Hepatocytes. Bio-protocol 6(21): e1993. DOI: 10.21769/BioProtoc.1993.
Download Citation in RIS Format
Category
Cell Biology > Cell metabolism > Lipid
Cell Biology > Cell metabolism > Carbohydrate
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,994 | https://bio-protocol.org/exchange/protocoldetail?id=1994&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Apparatus and General Methods for Exposing Rats to Audiogenic Stress
Serge Campeau
Published: Vol 6, Iss 21, Nov 5, 2016
DOI: 10.21769/BioProtoc.1994 Views: 6127
Edited by: Soyun Kim
Reviewed by: Manuel Sarmiento
Original Research Article:
The authors used this protocol in Jan 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jan 2016
Abstract
Most organisms react innately to the sudden onset of environmental stimulation. Audiogenic or loud noise in rodents provides an effective threatening signal to study the central nervous circuits responsible for the elaboration of various responses typically elicited by threatening/stressful environmental stimulation. Audiogenic stress offers many advantages over other environmental stimulation, including exquisite control over timing, intensity, and frequency, using off-the-shelf components that produce easily reproducible results. This protocol provides blueprints for the construction of sound attenuation chambers, the associated sound generation, amplification, and delivery equipment, and general procedures sufficient to elicit multimodal responses to loud noises in rodents.
Background
For many years, audiogenic stress (loud noise) has been employed as an effective stimulus to activate multimodal responses traditionally associated with threatening situations and stressor exposures, including the neuroendocrine hypothalamo-pituitary-adrenocortical (HPA) axis (as indexed by the release of glucocorticoids and adrenocorticotropin hormone - ACTH; [Borrell et al., 1980; Campeau and Watson, 1997; Henkin and Knigge, 1963; Segal et al., 1989]), the autonomic system (as measured by peripheral catecholamine release, heart rate, blood pressure, or core body temperature measurements; [Bao et al., 1999; De Boer et al., 1989; Gamallo et al., 1992; Masini et al., 2008; Overton et al., 1991; Saha et al., 1996]), and a multiphase behavioral reaction which initially elicits forceful, quick evasive locomotor responses, followed within a few minutes by significant reduction or inhibition of locomotor activity, feeding, and drinking (Britton et al.,1992; Campeau and Watson, 1997; Irwin et al., 1989; Masini et al., 2008; Segal et al., 1989). These powerful effects of loud sounds likely arise from the fact that such high intensity auditory stimulation are frequently associated with environmental events occurring very close to the listener that require immediate, life-saving attention (predator pouncing, objects falling or traveling at a high rate of speed, etc.). The importance of these emergency responses is further suggested by their similarities across a wide array of species and environments (aquatic, terrestrial, airborne).
Compared to many stress protocols, audiogenic stress has a number of advantageous characteristics, and the current protocol has some advantages compared to previous audiogenic stress protocols (Siegel et al., 1983; Boadle-Biber et al., 1989). Perhaps the single most important advantage of audiogenic stress is its exquisite control over the amplitude of acoustic stimulation, providing one of the few procedures for which the intensity of the stressor can be controlled along a continuum of innocuous auditory intensities to increasingly stressful exposures (Boadle-Biber et al., 1989; Campeau and Watson, 1997; Burow et al., 2005), as compared to other popular stressor protocols such as restraint, immobilization, tail suspension, social stress, and others. And whereas several previous loud noise protocols exposed multiple rats to loud noise in the same enclosure (Boadle-Biber et al., 1989) or individually but in large rooms (Siegel et al., 1983), the current protocol was developed to expose animals to noise independently, increasing the likelihood for reproducibility in exposed and control rats simultaneously. As described below, the procedures developed in our laboratory for exposure of rats to audiogenic stress allows the simultaneous measurement of multiple responses, which is necessary to study the integrated mechanisms necessary to understand the elaboration of multimodal responses to stress.
Materials and Reagents
Sprague-Dawley rats (6-12 weeks of age) from Envigo (Enrigo, catalog number: Sprague-Dawley® outbred rats )
Rat chow (Enrigo, catalog number: Teklad global 14% protein #2014 )
Equipment
The sound attenuating enclosures (constructed from double wooden [2 cm plywood board] boxes)
Outer box [external dimensions: 85 (w) x 60 (d) x 72 (h) cm] lined internally with 2.5 cm insulation (CelotexTM) (Figures 1A to 1D)
Inner box [internal dimensions: 60 (w) x 38 (d) x 38 (h) cm] (allows placement of a polycarbonate rat home cage inside, including food and water for overnight housing – Figures 1C, 1E, 1H, and 1I)
All these general construction materials can be procured in local hardware stores.
Cooling fans, 105 cm (General Wireless Operation, RadioShack, model: 2730241 ) (Figures 1A and 1B)
Car speakers, 15.25 x 22.85 cm (RadioShack Corporation, model: 12-1769 – 120 W RMS ) (Figures 1E and 1H)
Fluorescent lamps (n: VISION, model: EDX0-14, 14 W, soft white; EcoSmart, catalog number: 423-599 ) (Figures 1E and 1H)
Noise generator (General Radio, model: 1381 ) (Figure 1F)
Band-pass filter (Krohn-Hite, model: 3100R )
Power amplifiers (PropertyRoom, model: Pyramid Studio Pro PA-600X ) (Figure 1G)
Sound level meter (RadioShack, model: 33-2050 – A scale) (Figures 1I and 1J)
Notes:
Some of the equipment discussed above can only be obtained from secondary sources. When possible, links to specifications sheets are provided to help in obtaining more recent equipment with similar characteristics.
Animals are exposed to loud noise within individual sound attenuating chambers in an independent room, away from the general vivarium to ensure that only experimental animals experience the loud acoustic stimulation.
The internal dimensions of individual sound attenuating chamber allows placement of a polycarbonate rat home cage inside, including food and water for overnight housing (see Figures 1E, 1H, and 1I).
Each box is fitted with two 105 cm cooling fans, located in the lower back left (push air in), and upper front right side (draw air out) of the external box, respectively, to provide a constant flow of fresh air (65 CFM) inside each box (see Figures 1A and 1B).
Each enclosure provides approximately 30 dBA (sound pressure level – SPL, A scale) of sound attenuation, which allows the testing of both loud noise and no noise experimental subjects simultaneously in adjacent enclosures.
Each enclosure is fitted with a single Optimus speaker fixed in the middle of the ceiling of the internal enclosure (see Figures 1E and 1H). Speaker characteristics permit sound delivery between 20 and 27,000 Hz, with the intensity rolling off quickly (20 dB octave) at both ends of the frequency spectrum.
Lighting is provided by a fluorescent lamp located in the upper left corner of the internal enclosure (see Figures 1E and 1H), which are kept on the same day-night cycle as the lighting of the main colony room.
Noise is produced by a General Radio solid-state random-noise generator with the bandwidth set at 2-50,000 Hz for most of the experiments (see Figure 1F). Frequencies can be filtered through a Krohn-Hite filter to achieve different band-pass settings when necessary. The output of the noise generator is generally fed to power amplifiers (Pyramid Studio Pro [see Figure 1G]), the outputs of which are connected to the Optimus speakers.
Noise intensity is measured by placing a Sound Level Meter in an empty rat’s home cage at several locations and taking an average of the different readings (see Figure 1I). The noise level provided by the ventilating fans is approximately 57 dBA, which is defined as the ‘no noise’ or ‘background/ambient noise’ level. The noise level in the quiet animal colony averages approximately 55 dBA.
Figure 1. Representative images of equipment. Views of the external enclosure from the left angle (A) and right angle (B), showing the location of the fans (white arrows) to provide continuous fresh air internally. C. View of the open external enclosure and the internal closed enclosure. D. Detailed view of the external enclosure construction, with the 2-cm plywood panel (black arrows) lined internally with 2.5-cm celotex material, which also covers the hinged door (gray arrows). E. View of the open internal enclosure (white arrow) fitted with an empty home cage for demonstration purposes, and the location of the light and speaker (see also H below). The home cage sits directly under the speaker (see also H below). F. Front view of the General Radio #1381 noise generator employed to generate sound. G. Front view of the Pyramid Studio Pro PA-600X amplifier employed to amplify the sound from the noise generator. H. Additional view of the open internal enclosure fitted with Starr Life Sciences’ ER4000 Receiver antenna (white arrow). A rat’s home cage sits directly on top of the ER4000 to telemetrically provide heart rate, core body temperature, and general locomotor activity information when rats are implanted with PDT 4000 HR Emitters. I. View of the RadioShack sound level meter (white arrow) employed to measure sound pressure levels inside a rat’s home cage during sound delivery. The meter is moved in different home cage locations to verify the desired averaged SPL. J. Larger view of the sound pressure level display (95 dBA) during a sound test.
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Campeau, S. (2016). Apparatus and General Methods for Exposing Rats to Audiogenic Stress. Bio-protocol 6(21): e1994. DOI: 10.21769/BioProtoc.1994.
Download Citation in RIS Format
Category
Neuroscience > Behavioral neuroscience > Cognition
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,995 | https://bio-protocol.org/exchange/protocoldetail?id=1995&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Determination of (p)ppGpp Levels During Stringent Response in Streptomyces coelicolor by Thin Layer Chromatography
Smitha Sivapragasam
Anne Grove
Published: Vol 6, Iss 21, Nov 5, 2016
DOI: 10.21769/BioProtoc.1995 Views: 10322
Edited by: Valentine V Trotter
Reviewed by: Daan C. SwartsModesto Redrejo-Rodriguez
Original Research Article:
The authors used this protocol in May 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
May 2016
Abstract
The stringent response in bacteria is a stress response that is mediated by the signaling molecules guanosine tetraphosphate and pentaphosphate [(p)ppGpp], alarmones that are also directly related to virulence. Therefore, determination of (p)ppGpp levels is crucial for studying the stringent response. The protocol here outlines in a step-wise manner the detection of (p)ppGpp in the bacterium Streptomyces coelicolor during stringent response (Strauch et al., 1991) by thin layer chromatography (TLC). In the example shown here, stringent response is induced by addition of serine hydroxamate, an inhibitor of seryl tRNA synthetase. This protocol was first published in Molecular Microbiology (Sivapragasam and Grove, 2016).
Background
Thin layer chromatography has been used for analyzing (p)ppGpp levels during stringent response in various bacterial species for a long time, and it is a generally accepted method for this purpose. However, previously published protocols only summarized the main concepts, and it was challenging to identify a comprehensive protocol that comprised every step of the procedure. We present here a detailed protocol that has been optimized for studying stringent response in S. coelicolor. Steps unique to handling of S. coelicolor cultures have been identified, and the protocol can therefore be readily adapted to other bacterial species. The method relies on the use of TLC plates that incorporate polyethyleneimine (PEI), which is a strong basic anion exchanger. PEI is therefore the matrix of choice for separation of ionic compounds such as phosphorylated nucleosides (Calderón-Flores et al., 2005; Mechold et al., 2013; Strauch et al., 1991).
Materials and Reagents
Polyethyleneimine (PEI)-cellulose TLC plates (Sigma-Aldrich, catalog number: Z122882 )
1.5 ml sterile microcentrifuge tubes with cap
Aluminium foil
Streptomyces coelicolor
32P-labelled orthophosphate (PerkinElmer, catalog number: NEX053H001MC )
Note: Use of radioactive materials requires institutional authorization.
Serine hydroxamate (Sigma-Aldrich, catalog number: S4503 )
MilliQ quality water (dH2O)
Formic acid (Thermo Fisher Scientific, Fisher Scientific, catalog number: A118P100 )
100% ethanol at room temperature
Potassium phosphate monobasic (KH2PO4) (Sigma-Aldrich, catalog number: 60218 )
3-morpholinopropane-1-sulfonic acid (MOPS) (AMRESCO, catalog number: 0670 )
Sucrose (Thermo Fisher Scientific, Fisher Scientific, catalog number: BP220-1 )
Magnesium sulfate heptahydrate (AMRESCO, catalog number: 0662 )
Dextrose/glucose (VWR, catalog number: BDH9230 )
BactoTM yeast extract (BD, catalog number: 212750 )
BactoTM peptone (BD, catalog number: 211677 )
BactoTM tryptone (BD, catalog number: 211705 )
Potassium phosphate dibasic (K2HPO4) (Sigma-Aldrich, catalog number: P3786 )
Casamino acids (BD, catalog number: 228830 )
L-histidine monohydrochloride monohydrate (Sigma-Aldrich, catalog number: H8125 )
L-tryptophan (Sigma-Aldrich, catalog number: T0254 )
L-tyrosine (Sigma-Aldrich, catalog number: T3754 )
L-proline (Sigma-Aldrich, catalog number: P0380 )
Springs (stainless) for dispersing the mycelia (e.g., Grainger, catalog number: 1NCH7 ) (specific to dispersal of S. coelicolor)
Dry ice
Guanosine monophosphate (Sigma-Aldrich, catalog number: G8377 ) (optional)
Guanosine triphosphate (Sigma-Aldrich, catalog number: G8877 ) (optional)
Modified MOPS minimal media (for growing S. coelicolor, see Recipes)
1.5 M KH2PO4 (pH 3.4) (see Recipes)
13 M formic acid (see Recipes)
100 mM serine hydroxamate (see Recipes)
ISP1 medium (for growing S. coelicolor, see Recipes)
Equipment
50 ml glass Erlenmeyer flasks
TLC chamber with lid (Sigma-Aldrich, catalog number: Z126195 )
Phosphorimager (GE Healthcare)
Phosphor screens with storage cassettes (GE Healthcare)
Refrigerated microcentrifuge with speed up to 16,000 x g and rotor that fits 1.5 ml centrifuge tubes
Shaker-incubator with temperature control
Software
ImageQuant software
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Sivapragasam, S. and Grove, A. (2016). Determination of (p)ppGpp Levels During Stringent Response in Streptomyces coelicolor by Thin Layer Chromatography. Bio-protocol 6(21): e1995. DOI: 10.21769/BioProtoc.1995.
Download Citation in RIS Format
Category
Microbiology > Microbial biochemistry > Other compound
Microbiology > Microbial physiology > Stress response
Biochemistry > Other compound > (p)ppGpp
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,996 | https://bio-protocol.org/exchange/protocoldetail?id=1996&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Fat Turnover Assay in Drosophila
SK Subhash D. Katewa
Pankaj Kapahi
Published: Vol 6, Iss 21, Nov 5, 2016
DOI: 10.21769/BioProtoc.1996 Views: 11541
Edited by: Masahiro Morita
Reviewed by: Leonardo G. Guilgur
Original Research Article:
The authors used this protocol in Jan 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jan 2016
Abstract
Like all animals, Drosophila shows robust fat (triglyceride) turnover, i.e., they synthesize, store and utilize triglyceride for their daily metabolic needs. The protocol describes a simple assay to measure this turnover of triglycerides in Drosophila.
Background
Almost all animals store energy reserves in the form of glycogen and triglycerides. Many physiological, pathological and environmental conditions cause changes in the total level of these energy reserves, especially triglycerides. However, it’s not always clear whether the resulting changes in triglycerides are due to reduced breakdown, increased synthesis or vice versa. With this protocol, it is possible to determine both the rate of synthesis and degradation of the newly synthesized triglycerides in flies.
Materials and Reagents
1.5 ml Eppendorf tubes
Hamilton glass syringes (Hamilton, catalog number: Gastight 1700 )
Metallic needle
Razor blades (VWR, catalog number: 55411 )
TLC silica gel 60 plates (Figure S1) (EMD Millipore, catalog number: 105626 )
Drosophila vial (Genesee Scientific, Flystuff, catalog number: 32-109 )
Whatman® chromatography paper (Sigma-Aldrich, catalog number: WHA3030861 )
Drosophila melanogaster
D-[14C(U)]-glucose (PerkinElmer, catalog number: NEC042V250UC )
Yeast extract
Sugar
Liquid nitrogen and nitrogen gas
Chloroform (Sigma-Aldrich, catalog number: 366927 )
Methanol (EMD Millipore, catalog number: MX0475-1 )
Cupric sulfate acid (EMD Millipore, catalog number: 102790 )
O-phosphoric acid (85%) (Thermo Fisher Scientific, Fisher Scientific, catalog number: A242-212 )
Lipid standards:
Triolein (Sigma-Aldrich, catalog number: T7140 )
Phosphatidylcholine (Sigma-Aldrich, catalog number: P3556 )
Phosphatidylinositol (Sigma-Aldrich, catalog number: P6636 )
Cholesterol (Sigma-Aldrich, catalog number: C8667 )
Lauric acid (Sigma-Aldrich, catalog number: L556 )
Myristic acid (Sigma-Aldrich, catalog number: M3128 )
Palmitic acid (Sigma-Aldrich, catalog number: P0500 )
Hexane (Sigma-Aldrich, catalog number: 32293 )
Diethyl ether (Sigma-Aldrich, catalog number: 309966 )
Acetic acid (AMRESCO, catalog number: 0714 )
Sodium chloride (NaCl) (Sigma-Aldrich, catalog number: S9888 )
Scintillation fluid (PerkinElmer, catalog number: Ultima GoldTM/6013329 )
Drosophila food recipes (see Recipes)
Solvent mixture (see Recipes)
Cupric sulfate/phosphoric acid solution (see Recipes)
0.9% NaCl solution (see Recipes)
Equipment
TLC chamber (Clarkson Laboratory and Supply, model: Latch-Lid ChromatoTank 80-30 )
Kontes microcentrifuge motor and pestles (Sigma-Aldrich, catalog number: Z359971-1EA )
Centrifuge (Eppendorf, model: Centrifuge 5810R )
Benchtop vacuum oven (VWR, model: 97027 )
Scintillation counter (Beckman Coulter, model: LS6500 )
Scintillation vials (PerkinElmer, catalog number: 6000292 )
Nalgene PPCO wash bottles (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 2405-0500 )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Katewa, S. D. and Kapahi, P. (2016). Fat Turnover Assay in Drosophila. Bio-protocol 6(21): e1996. DOI: 10.21769/BioProtoc.1996.
Download Citation in RIS Format
Category
Cancer Biology > Cellular energetics > Biochemical assays
Biochemistry > Lipid > Lipid measurement
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,997 | https://bio-protocol.org/exchange/protocoldetail?id=1997&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Phagocytosis Assay to Measure Uptake of Necroptotic Cancer Cells by BMDCs
Tania Løve Aaes
DK Dmitri V. Krysko
PV Peter Vandenabeele
Published: Vol 6, Iss 21, Nov 5, 2016
DOI: 10.21769/BioProtoc.1997 Views: 12118
Edited by: Xi Feng
Reviewed by: Jalaj GuptaRuth A. Franklin
Original Research Article:
The authors used this protocol in Apr 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Apr 2016
Abstract
This protocol is a flow cytometry-based method to measure the phagocytosis efficiency of necroptotic target cells by bone marrow-derived dendritic cells (BMDCs) in vitro (Aaes et al., 2016). The method is a slightly modified and updated version of the protocols used in previously published papers (Krysko et al., 2006; Brouckaert et al., 2004). In brief, the target cells are labeled with a CellTrackerTM dye before they are induced to undergo cell death. After a co-culture period of 2 h with BMDCs, the cells are immunostained with a dendritic cell marker and dead cell marker, and the phagocytic efficiency is quantified using a flow cytometer. This protocol can readily be used for target cells undergoing cell death modalities other than necroptosis.
Background
Studying the phagocytic uptake of necroptotic cells by BMDCs in vitro, is a preliminary step in the examination of immunogenic cell death models (Obeid et al., 2007). Efficient uptake will allow the phagocyte to cross-present antigens to leukocytes and thereby create an immune reaction towards the dead target cells. In this protocol we make use of a CellTrackerTM dye. This type of dye may be toxic in certain concentrations, which may vary depending on which cell type is used. Thus, we recommend users to first find the optimal concentration of the dye for the target cell in use. Optimally, the CellTrackerTM dye itself should not induce any cell death, but should label the target cells so that they become easily separable from the CD11c-positive BMDCs.
Materials and Reagents
Delta treated 10 cm Petri dishes (Thermo Fisher Scientific, NuncTM, catalog number: 153066 )
15 ml polystyrene centrifuge tubes (Corning, Falcon®, catalog number: 352095 )
6-well suspension plates (SARSTEDT, catalog number: 83.3920.500 )
96 V well, 2.0 ml polypropylene plate (Greiner Bio One, MASTERBLOCK®, catalog number: 780285 )
5 ml round-bottom polystyrene tubes (Corning, Falcon®, catalog number: 352054 )
Bone marrow-derived dendritic cells (BMDCs) isolated from BALB/c WT mice (see Procedure)
CT26 Necroptosis-inducible cells (DD_RIPK3) (Aaes et al., 2016)
Dulbecco’s modified Eagle medium (DMEM), high glucose (Thermo Fisher Scientific, GibcoTM, catalog number: 41965062 )
Fetal bovine serum (FBS) (Thermo Fisher Scientific, GibcoTM, catalog number: 10270106 )
Sodium pyruvate (Sigma-Aldrich, catalog number: S8636 )
L-glutamine (Lonza, catalog number: BE17-605F )
Roswell park memorial institute (RPMI) 1640 medium (Thermo Fisher Scientific, GibcoTM, catalog number: 52400025 )
2-mercaptoethanol (50 mM) (Thermo Fisher Scientific, GibcoTM, catalog number: 31350010 )
Murine GM-CSF (VIB Protein Service Facility, UGent-VIB Inflammation Research Center)
ACK lysing buffer (Lonza, catalog number: 10-548E )
Dulbecco’s phosphate-buffered saline (DPBS) (Thermo Fisher Scientific, GibcoTM, catalog number: 14190094 )
CellTrackerTM green CMFDA dye (Thermo Fisher Scientific, Molecular ProbesTM, catalog number: C7025 )
Doxycycline (Sigma-Aldrich, catalog number: D9891 )
B/B homodimerizer (Takara Bio, catalog number: 635059 )
Purified rat anti-mouse CD16/CD32 (Mouse BD Fc BlockTM) (BD, PharmingenTM, catalog number: 553142 )
APC hamster anti-mouse CD11c (BD, PharmingenTM, catalog number: 550261 )
SYTOX® blue nucleic acid stain (Thermo Fisher Scientific, Molecular ProbesTM, catalog number: S11348 )
BD FACSuite CS&T Research Beads Kit (BD, FACSuiteTM, catalog number: 650621 )
DMEM CT26 culture medium (see Recipes)
RPMI BMDC/Co-culture medium (see Recipes)
FACS buffer (see Recipes)
Staining solution (see Recipes)
Equipment
Table top centrifuge
BD FACSVerseTM flow cytometer (BD, model: BD FACSVERSE )
Software
BD FACSuiteTM software (BD)
FlowJo software version 10.0.8 or newer (FlowJo)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Aaes, T. L., Krysko, D. V. and Vandenabeele, P. (2016). Phagocytosis Assay to Measure Uptake of Necroptotic Cancer Cells by BMDCs. Bio-protocol 6(21): e1997. DOI: 10.21769/BioProtoc.1997.
Download Citation in RIS Format
Category
Cancer Biology > Cell death > Cell biology assays
Immunology > Immune cell function > Dendritic cell
Cell Biology > Cell viability > Cell death
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,998 | https://bio-protocol.org/exchange/protocoldetail?id=1998&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Sequencing of Ebola Virus Genomes Using Nanopore Technology
Thomas Hoenen
Published: Vol 6, Iss 21, Nov 5, 2016
DOI: 10.21769/BioProtoc.1998 Views: 10497
Edited by: Yannick Debing
Reviewed by: Emily CopeEmilie Battivelli
Original Research Article:
The authors used this protocol in Feb 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Feb 2016
Abstract
Sequencing of virus genomes during disease outbreaks can provide valuable information for diagnostics, epidemiology, and evaluation of potential countermeasures. However, particularly in remote areas logistical and technical challenges can be significant. Nanopore sequencing provides an alternative to classical Sanger and next-generation sequencing methods, and was successfully used under outbreak conditions (Hoenen et al., 2016; Quick et al., 2016). Here we describe a protocol used for sequencing of Ebola virus under outbreak conditions using Nanopore technology, which we successfully implemented at the CDC/NIH diagnostic laboratory (de Wit et al., 2016) located at the ELWA-3 Ebola virus Treatment Unit in Monrovia, Liberia, during the recent Ebola virus outbreak in West Africa.
Background
Determining the full-length sequence of virus genomes is an essential procedure in virology. While the classical approach to this involved Sanger sequencing following a primer-walking strategy, newer approaches involve the use of next-generation sequencing methods such as 454, Illumina or Ion Torrent technologies. A common problem with all these technologies, despite their many advantages, is that the required instrumentation is large, expensive, fragile, and therefore difficult to transport. Also, library preparation procedures are often involved. While under usual circumstances these issues are of little consequence, as these machines are run in specialized laboratories with excellent infrastructure, during virus outbreaks in remote areas (for example in case of ebolavirus outbreaks) this can pose significant problems, particularly since the export of samples from affected areas to these specialized laboratories is often politically and logistically challenging. Under these circumstances, the availability of a sequencing technology that can be easily and quickly deployed into remote areas, and allows sequencing to be done directly in an outbreak area, can be invaluable. Therefore, we have tested the MinION sequencing device, which at that time was under development by Oxford Nanopore Technologies (ONT), at the field diagnostic laboratory at the ELWA-3 Ebola virus Treatment Unit in Monrovia (de Wit et al., 2016) during the recent Ebola virus outbreak in West Africa, and developed a protocol for the rapid generation of full-length sequences of Ebola viruses under these conditions. This device employs nanopores, through which nucleotide-strands are transported in a controlled fashion. The nucleotides block and thus modulate an ion-current flowing through those pores, depending on the physical properties of the nucleotides passing through the nanopores, and these current modulations are measured by the device and translated into nucleotide sequences. Results of this test, which indicated that this technology indeed shows great promise as a rapidly deployable and highly usable sequencing platform, are available elsewhere (Hoenen et al., 2016), as are the results of a similar test using the same sequencing platform performed independently of our own efforts by Quick et al. (2016).
Materials and Reagents
Note: This protocol was established and tested during the Ebola virus outbreak in West Africa in January 2015, using materials and reagents available at that time. As the development of the MinION platform progresses rapidly, some modifications might be necessary to adopt the protocol to the materials and reagents available now. Particularly, while at the time the technology was only available to members of the MinION access program, it is now commercially available.
0.2 ml PCR-tubes (ideally in strips of 8) (e.g., Thermo Fisher Scientific, Thermo ScientificTM, catalog number: AB0490 )
1.5 ml tubes (e.g., Thermo Fisher Scientific, Fisher Scientific, catalog number: S348903 )
Eppendorf protein LoBind tubes, 1.5 ml, PCR clean (Eppendorf, catalog number: 0030108116 )
Gloves
MinION flowcell, revision 7.3 (Oxford Nanopore Technologies [ONT])
RNA freshly purified (or stored at -80 °C) from patient blood samples following appropriate safety protocols
SuperScript III First-Strand-Synthesis System (Thermo Fisher Scientific, InvitrogenTM, catalog number: 18080051 )
DEPC-treated nuclease-free water (e.g., Thermo Fisher Scientific, AmbionTM, catalog number: AM9906 )
Primer, 10 μM (see Table 1 for sequences); primer CGGACACACAAAAAGAAAGAAG at a concentration of 2 μM and 10 μM
dNTP mix, 10 mM each (e.g., New England Biolabs, catalog number: N0447S )
iProofTM high-fidelity polymerase (Bio-Rad Laboratories, catalog number: 1725301 )
Agencourt AMPure XP beads (Beckman Coulter, catalog number: A63881 )
His-Tag dynabeads (Thermo Fisher Scientific, NovexTM, catalog number: 10103D )
Magnetic stand for PCR-purification with Agencourt AMPure XP beads in 1.5 ml tubes (e.g., Beckman Coulter, catalog number: A29182 )
70% ethanol
Qiagen elution buffer (QIAGEN, catalog number: 19086 )
50x TAE buffer (ideally in 10.2 ml aliquots) (e.g., Thermo Fisher Scientific, Thermo ScientificTM, catalog number: B49 )*
Agarose (ideally in pre-weighed aliquots of 0.5 g) (e.g., Thermo Fisher Scientific, InvitrogenTM, catalog number: 16500100 )*
DNA standard (e.g., New England Biolabs, catalog number: N3200S )*
6x gel loading dye (e.g., New England Biolabs, catalog number: B7022S )*
Fast Blast DNA stain (Bio-Rad Laboratories, catalog number: 1660420 )*
NEBNext dA-tailing module (New England Biolabs, catalog number: E6053S )
NEBNext end repair module (New England Biolabs, catalog number: E6050S )
Blunt/TA ligase master mix (New England Biolabs, catalog number: M0367L )
Genomic DNA Sequencing Kit SQK-MAP004 (ONT): contains DNA CS, 2x wash buffer, elution buffer, EP buffer, HP adapter, Adapter mix and Fuel mix
*Note: Optional materials and reagents.
Equipment
MinION sequencing device (ONT)
PCR cycler (e.g., Thermo Fisher Scientific, Applied BiosystemsTM, catalog number: A24811 )
Vortexer (e.g., Thermo Fisher Scientific, Fisher Scientific, catalog number: S96461A )
Mini centrifuges for 1.5 and 0.2 ml tubes (e.g., VWR, catalog number: 93000-204 )
Pipettes: 10 μl, 20 μl, 100 μl, 1,000 μl, 8 x 20 μl multichannel with filter tips (e.g., Mettler-Toledo, catalog numbers: PR-10 , PR-20 , PR-100 , PR-1000 , L8-20XLS+ )
Racks for 0.2 ml PCR tubes and 1.5 ml tubes (e.g., Thermo Fisher Scientific, Fisher Scientific, catalog numbers: 05-541-85 , 05-541-2 )
PCR cooler rack, 0.2 ml, 4 °C (e.g., Eppendorf, catalog number: 3881000031 )
Styrofoam box with lid and cold packs (frozen cold pack at bottom, 4 °C cold pack on top, then sample rack on top of that) as cooler box (or alternatively ice box, when ice is available)
Electrophoresis chamber with power supply (e.g., Mupid-exU, Takara Clontech)*
Microwave oven*
Agarose gel casting stand, or alternatively laboratory tape*
250-300 ml glass flask for preparing agarose*
Box for agarose gel staining*
Additional infrastructure when sequencing under outbreak conditions
Note: This infrastructure is a given in any Western laboratory, but should be considered when establishing the method under field conditions in outbreak areas. While this topic cannot be exhaustively covered in this protocol, the following points should be carefully considered.
Power generator, uninterruptable power supplies, voltage regulators (all depending on the quality of the electricity supply).
Air conditioning if possible, alternatively external heatsink (e.g., a ~30 x 30 cm metal plate) for MinION sequencing device.
Clean water for preparation of 1x TAE, and for DNA staining and destaining - bottled drinking water (ideally in 500 ml bottles) can be used for this purpose if no other source of clean water is available.
Equipment for safe sample inactivation and RNA extraction.
4 °C fridge, -20 °C freezer, optionally -80 °C freezer for storage of RNA.
Personal protective equipment as deemed necessary.
*Note: Optional equipment.
Software
Laptop running MinKNOW software v 0.48.2.12 (ONT) with internet connection (e.g., via 3G wireless router); for current IT requirements please check the ONT internet site (https://nanoporetech.com/community/faqs).
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Hoenen, T. (2016). Sequencing of Ebola Virus Genomes Using Nanopore Technology. Bio-protocol 6(21): e1998. DOI: 10.21769/BioProtoc.1998.
Download Citation in RIS Format
Category
Microbiology > Microbial genetics > RNA
Molecular Biology > RNA > RNA sequencing
Systems Biology > Genomics > Sequencing
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,999 | https://bio-protocol.org/exchange/protocoldetail?id=1999&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Hydrogen Peroxide Measurement in Arabidopsis Root Tissue Using Amplex Red
Tzvetina Brumbarova
Cham Thi Tuyet Le
Petra Bauer
Published: Vol 6, Iss 21, Nov 5, 2016
DOI: 10.21769/BioProtoc.1999 Views: 14757
Edited by: Arsalan Daudi
Original Research Article:
The authors used this protocol in Jan 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jan 2016
Abstract
This protocol describes the measurement of hydrogen peroxide (H2O2) content in Arabidopsis root tissue by using the Amplex® Red Hydrogen Peroxide/Peroxidase Assay Kit. When root tissue is disrupted and resuspended in phosphate buffer, H2O2 is released from the cells. The obtained root extracts containing H2O2 can be mixed with a solution containing Amplex® Red reagent (10-acetyl-3,7-dihydrophenoxazine). In the presence of horseradish peroxidase, the Amplex® Red reagent reacts with H2O2 in a 1:1 stoichiometry. The resulting product is the red-fluorescent compound resorufin which can be detected fluorometrically or spectrophotometrically. Our protocol is based on the manual of the Amplex® Red Hydrogen Peroxide/Peroxidase Assay Kit and describes a step-by-step procedure with a detailed description of the necessary controls and data analysis. We have also included modifications of the protocol, notes and examples that intend to aid the user in easily reproducing the assay with their own samples.
Background
Reactive oxygen species (ROS), such as H2O2, can be generated in the cell as a result of a developmental cue or a stress condition. In high amounts, ROS accumulation can be detrimental by causing cellular damage. However, increased ROS production can also have a signaling role and serve as a secondary messenger in controlling downstream cellular responses. In plants, a signaling role for ROS has been shown for many abiotic stresses, such as drought, salinity, temperature stress, and nutrient deprivation (Mittler, 2002; Mittler and Blumwald, 2015; Xia et al., 2015). In our recent publication Le et al. (2016), we have investigated the connection between ROS production and iron (Fe) deficiency response regulation by investigating the H2O2 content of roots from wild type and mutant Arabidopsis plant lines grown under sufficient and deficient Fe supply conditions.
Materials and Reagents
Kimtech® science precision tissues (Carl Roth, catalog number: AA63.1 )
2 ml microcentrifuge tubes, safe-seal (SARSTEDT, catalog number: 72.695.500 )
Pipet tips
Aluminium foil
96-well microtiter plates for absorbance measurement (e.g., UV-Star® microplate, 96 well, half area, µClear® [Greiner Bio-One, catalog number: 675801 ])
96-well microtiter plates for fluorescence measurement (e.g., 96 well, half area, black [Greiner Bio-One, catalog number: 675076 ])
Arabidopsis seeds
Sterile distilled water
Plant agar (Duchefa Biochemie, catalog number: P1001.1000 )
Liquid nitrogen
Amplex® Red Hydrogen Peroxide/Peroxidase Assay Kit (Thermo Fisher Scientific, Molecular ProbesTM, catalog number: A22188 )
H2O2 working solution
HRP enzyme
Horseradish peroxidase
Sodium hypochlorite (NaOCl) (Carl Roth, catalog number: 9062.3 )
Triton X-100 (SERVA Electrophoresis, catalog number: 37238 or Sigma-Aldrich, catalog number: X-100 )
Magnesium sulfate heptahydrate (MgSO4·7H2O) (Sigma-Aldrich, catalog number: M9397 )
Note: This product has been discontinued. Alternatively, MgSO4·7H2O from Carl Roth can be used (Carl Roth, catalog number: T888 )
Potassium dihydrogen phosphate (KH2PO4) (Sigma-Aldrich, catalog number: P0662 ; or Carl Roth, catalog number: 3904 )
Potassium nitrate (KNO3) (Carl Roth, catalog number: P021.2 )
Calcium nitrate tetrahydrate [Ca(NO3)2·4H2O] (Carl Roth, catalog number: P740.2 )
Potassium chloride (KCl) (Carl Roth, catalog number: 6781.1 )
Boric acid (H3BO3) (Carl Roth, catalog number: 6943.1 )
Manganese sulfate (MnSO4) (AppliChem, catalog number: A1038 ; or Carl Roth, catalog number: X890.1 )
Zinc sulfate heptahydrate (ZnSO4·7H2O) (VWR, catalog number: VWRC29253.236 )
Copper sulfate pentahydrate (CuSO4·5H2O) (Thermo Fisher Scientific, Fisher Scientific, catalog number: AC197720050 )
Ammonium heptamolybdate tetrahydrate [(NH4)6Mo7O24·4H2O] (Sigma-Aldrich, catalog number: 431346 ; or Carl Roth, catalog number: 7311 )
D(+)-sucrose (Carl Roth, catalog number: 4621.1 )
Ferric sodium ethylenediaminetetraacetic acid (FeNaEDTA) (Carl Roth, catalog number: 8043.1 )
3-(2-Pyridyl)-5,6-diphenyl-1,2,4-triazine-4’,4’’-disulfonic acid sodium salt (Ferrozine) (Sigma-Aldrich, catalog number: 82950 )
Sterilization solution (see Recipes)
Hoagland medium (see Recipes)
Phosphate buffer (see Recipes)
Equipment
Tube rotator (e.g., VWR, catalog number: 10136-084 )
Mortars and pestles (e.g., MTC Haldenwanger)
Centrifuge
Multi-channel pipet
Analytical scales, e.g., ALJ160_4NM (Kern)
Benchtop centrifuge with cooling (e.g., Thermo Fisher Scientific, Thermo ScientificTM, model: Heraeus Fresco 21 Centrifuge )
Plate reader (e.g., Tecan Trading, model: Infinite® M200 Pro )
Note: The plate reader should be able to excite in the range of 530-560 nm and detect fluorescence at approx. 590 nm, or detect absorbance at approx. 560 nm.
Homogenizer (e.g., such as Precellys® 24 homogenizer) (VWR, catalog number: 432-3750 )
Software
Microsoft Excel
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
How to cite： Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Brumbarova, T., Le, C. T. T. and Bauer, P. (2016). Hydrogen Peroxide Measurement in Arabidopsis Root Tissue Using Amplex Red. Bio-protocol 6(21): e1999. DOI: 10.21769/BioProtoc.1999.
Le, C. T., Brumbarova, T., Ivanov, R., Stoof, C., Weber, E., Mohrbacher, J., Fink-Straube, C. and Bauer, P. (2016). ZINC FINGER OF ARABIDOPSIS THALIANA12 (ZAT12) interacts with FER-LIKE IRON DEFICIENCY-INDUCED TRANSCRIPTION FACTOR (FIT) linking iron deficiency and oxidative stress responses. Plant Physiol 170(1): 540-557.
Download Citation in RIS Format
Category
Plant Science > Plant biochemistry > Other compound
Plant Science > Plant metabolism > Other compound
Biochemistry > Other compound > Reactive oxygen species
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
20 | https://bio-protocol.org/exchange/protocoldetail?id=20&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Subcellular Fractionation Using Accudenz Gradient to Separate ER/Golgi in Yeast
Bio-protocol Editor
Published: Vol 2, Iss 2, Jan 20, 2012
DOI: 10.21769/BioProtoc.20 Views: 15738
Download PDF
Ask a question
How to cite
Favorite
Cited by
Abstract
This protocol describes how to separate the endoplasmic reticulum (ER) and Golgi apparatus in yeast cells using a subcellular fractionation approach with an Accudenz gradient.
Materials and Reagents
Accudenz (Accurate Chemical & Scientific Corporation)
Protease inhibitors
Phenylmethylsulfonyl fluoride (PMSF) (Sigma-Aldrich, catalog number: 78830-5G )
Aprotinin (Sigma-Aldrich, catalog number: A3428-10MG )
Pepstatin A (Sigma-Aldrich, catalog number: P5318-5MG )
NaN3
Sodium fluoride (NaF)
Tris-HCl
Beta-mercaptoethanol
TCA
Sorbitol
HEPES-KOH
Spheroplasting buffer (see Recipes)
Lysis buffer (see Recipes)
Equipment
Dounce homogenizer (Cole-Parmer)
Refractometer (Bausch & Lomb Incorporated)
Beckman rotor
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2012 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Editor, B. (2012). Subcellular Fractionation Using Accudenz Gradient to Separate ER/Golgi in Yeast. Bio-protocol 2(2): e20. DOI: 10.21769/BioProtoc.20.
Download Citation in RIS Format
Category
Microbiology > Microbial cell biology > Organelle isolation
Cell Biology > Organelle isolation > Golgi
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
200 | https://bio-protocol.org/exchange/protocoldetail?id=200&type=1 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Calcium Imaging
Mingye Feng
Published: Apr 5, 2012
DOI: 10.21769/BioProtoc.200 Views: 35751
Download PDF
Ask a question
Favorite
Cited by
Abstract
This is a protocol of Ca2+ imaging experiment using Ca2+ indicator Fura-2. Ca2+ imaging is an efficient and quantitative method for measuring cytosolic and internal store Ca2+ levels, as well as their dynamic changes.
Materials and Reagents
HEK293 cells
Phosphate buffered saline (PBS)
Fura-2-AM (Life Technologies, Invitrogen™, catalog number: F1221 )
Poly-L-lysine (Sigma-Aldrich, catalog number: P8920 )
Fura-2 calcium imaging calibration kit (Life Technologies, Invitrogen™, catalog number: F6774 )
NaCl
MgCl2
KCl
Glucose
HEPES
CaCl2
DMSO
GFP reporter
Lonomycin
Ca2+ recording buffer (see Recipes)
Equipment
Zeiss inverted microscopy with perfusion system and “IPlab” software.
Centrifuges
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2012 The Authors; exclusive licensee Bio-protocol LLC.
Category
Cell Biology > Cell-based analysis > Ion analysis
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,000 | https://bio-protocol.org/exchange/protocoldetail?id=2000&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
PEA-CLARITY: Three Dimensional (3D) Molecular Imaging of Whole Plant Organs
WP William M. Palmer
AM Antony P. Martin
JF Jamie R. Flynn
SR Stephanie Reed
RW Rosemary White
RF Robert T. Furbank
CG Christopher P. L Grof
Published: Vol 6, Iss 21, Nov 5, 2016
DOI: 10.21769/BioProtoc.2000 Views: 7816
Edited by: Arsalan Daudi
Reviewed by: Teresa Lenser
Original Research Article:
The authors used this protocol in Sep 2015
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Sep 2015
Abstract
Here we report the adaptation of the CLARITY technique to plant tissues with addition of enzymatic degradation to improve optical clearing and facilitate antibody probe penetration. Plant-Enzyme-Assisted (PEA)-CLARITY, has allowed deep optical visualisation of stains, expressed fluorescent proteins and IgG-antibodies in tobacco and Arabidopsis leaves. Enzyme treatment enabled penetration of antibodies into whole tissues without the need for any sectioning of the material. Therefore, this protocol facilitates protein localisation of intact tissue in 3D whilst retaining cellular structure.
Background
Fixation and embedding of plant tissue for molecular interrogation using techniques such as histological staining, immunohistochemistry or in situ hybridisation has been the foundation of cell biology studies for decades. Applying these techniques for 3D tissue analysis is seriously limited by the need to section the tissue, image each section, and then reassemble the images into a 3D representation of the structures of interest. Here we present a fundamental shift from the two dimensional plane to that of three dimensions whilst retaining molecular structures of interest without the need to section the plant tissue. Recent advances in fixation and ‘clearing’ techniques such as SeeDB, ScaleA2, 3DISCO, CLARITY and its recent variant PACT enabled intact imaging of whole embryos, brains and other organs in mouse and rat models. The new CLARITY system fixes and binds tissues within an acrylamide mesh structure. Proteins and nucleic acids are covalently linked to the acrylamide mesh by formaldehyde, then optically interfering lipid structures of animal cell membranes are removed using detergent (SDS). This renders such tissue optically transparent and suitable for deep imaging of up to ~5 mm using confocal microscopy.
Materials and Reagents
50 ml conical tube
1.5 ml microfuge tubes
Aluminum foil
Parafilm (Sigma-Aldrich, catalog number: P-7793 )
Lint free paper
1.5 ml Protein LoBind tubes (Eppendorf, catalog number: 0030108116 )
Glass microscope slide
Glass microscope coverslip
Nicotiana tabacum (Hanson and Köhler, 2001)
16% paraformaldehyde (Electron Microscopy Sciences, catalog number: 15710 )
Sodium azide (NaN3) (Sigma-Aldrich, catalog number: S-2002 )
0.005% NaN3 in PBS (N3PBS)
Triton X-100 (Sigma-Aldrich, catalog number: T-9284 )
Dulbecco's phosphate buffered saline (DPBS, autoclaved) (Thermo Fisher Scientific, GibcoTM, 21600-010 )
0.1% Triton X-100 in PBS (PBST)
Vaseline (Unilever, VASELINE®)
BluTack (Bostic)
Rubisco antibody (rabbit) (Gift - Spencer Whitney, Whitney and Andrews, 2001)
Cy5 secondary AB (anti-rab) (Abcam, catalog number: Ab6564 )
Propidium iodide (Sigma-Aldrich, catalog number: P-4864 )
Calcofluor white (Sigma-Aldrich, catalog number: F-3543 )
40% acrylamide (Bio-Rad Laboratories, catalog number: 161-0140 )
2% bis acrylamide (Bio-Rad Laboratories, catalog number: 161-0142 )
VA-044 initiator (Wako Pure Chemical Industries, catalog number: 017-19362 )
Deionized and distilled water (ddH2O)
Sodium dodecyl sulfate (SDS) (Sigma-Aldrich, catalog number: L-3771 )
Boric acid (H3BO3) (Sigma-Aldrich, catalog number: B-6768 )
Sodium hydroxide (NaOH) (Sigma-Aldrich, catalog number: S-8045 )
α-amylase (Megazyme, catalog number: E-ANAAM )
α-L-arabinofuranosidase (Megazyme, catalog number: E-ABFCJ )
β-mannanase (Megazyme, catalog number: E-BMACJ )
Cellulase (Megazyme, catalog number: E-CELBA )
Pectate lyase (Megazyme, catalog number: E-PLYCJ )
Xyloglucanase (Megazyme, catalog number: E-XEGP )
Calcium chloride (CaCl2) (Sigma-Aldrich, catalog number: C-5670 )
Hydrogel solution (200 ml) (see Recipes)
SDS clearing solution (1 L) (see Recipes)
Enzyme treatment solution (10 ml) (see Recipes)
Notes:
Please refer to MSDS before conducting protocol as paraformaldehyde (PFA), acrylamide, sodium dodecyl sulfate (SDS) and sodium azide (NaN3) are known irritants, sensitizers, carcinogens and neurotoxins. The use of personal protective equipment (PPE) is imperative whilst undertaking this protocol.
Any specific IgG primary antibody and respective secondary antibody can be used with this protocol.
Protocol can be paused and samples stored at any stage from step D onwards in either SDS clearing solution or N3PBS.
Equipment
Vacuum pump at -100 kPa
Fume hood
4 °C fridge
37 °C water bath
Weigh balance
37 °C incubator shaker
Leica SP8 confocal microscope/lightsheet microscope or equivalent
Long working distance objectives greater than 2 mm
Software
Leica Applications Suite - Fluorescence (LAS-AF) software
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Palmer, W. M., Martin, A. P., Flynn, J. R., Reed, S., White, R., Furbank, R. T. and Grof, C. P. L. (2016). PEA-CLARITY: Three Dimensional (3D) Molecular Imaging of Whole Plant Organs. Bio-protocol 6(21): e2000. DOI: 10.21769/BioProtoc.2000.
Download Citation in RIS Format
Category
Plant Science > Plant cell biology > Cell imaging
Plant Science > Plant physiology > Phenotyping
Cell Biology > Cell imaging > Live-cell imaging
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,001 | https://bio-protocol.org/exchange/protocoldetail?id=2001&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Heterologous Expression and Purification of the Magnesium Transporter A (MgtA) in Escherichia coli
SS Saranya Subramani
JM Jens Preben Morth
Published: Vol 6, Iss 22, Nov 20, 2016
DOI: 10.21769/BioProtoc.2001 Views: 9990
Edited by: Arsalan Daudi
Reviewed by: Kanika GeraChijioke Joshua
Original Research Article:
The authors used this protocol in Feb 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Feb 2016
Abstract
The magnesium transporter A (MgtA) is a magnesium transporting P-type ATPase present in prokaryotes and plants (Subramani et al., 2016). In Salmonella typhimurium and Escherichia coli (E. coli), MgtA is expressed only in magnesium limiting conditions and plays an important role in Mg2+ homeostasis (Groisman et al., 2013). The transcription of mgtA is regulated by the two-component system PhoP/PhoQ (Soncini et al., 1996; Kato et al., 1999). The membrane bound histidine kinase, PhoQ, senses low Mg2+ concentration in the periplasmic space and phosphorylates its cognate response regulator, PhoP, which initiates mgtA transcription (Groisman et al., 2013). MgtA is targeted to the plasma membrane and facilitate the bacterial survival under low Mg2+ condition, by importing Mg2+ into the cytoplasm. The MgtA homolog in petunia (PH1) is found in the vacuolar membrane and involved with the coloration of the flower petals (Faraco et al., 2014). As a first step towards understanding the molecular details of MgtA Mg2+ transport, we describe a detailed protocol for the purification of E. coli MgtA that can be used for biochemical and biophysical studies. Recombinant E. coli MgtA with hexa histidine tag at the N-terminus was cloned from E. coli DH5α and over expressed in the E. coli C43(DE3) by fermentation to an OD > 6. Cell lysis was performed in a high pressure homogenizer and the membranes were isolated by ultracentrifugation. Membrane proteins were solubilized with the detergent dodecyl-β-D maltoside. MgtA was purified by affinity and size exclusion chromatography. Final yields of purified MgtA reach ~1 mg MgtA per 3 g of wet cell pellet.
Background
Recently we have reported that the purified MgtA from E. coli is highly dependent on lipids for its function and studied the enzyme kinetics in vitro (Subramani et al., 2016). The protocol described here is the detailed description going through every single step of the purification that should yield monodisperse detergent solubilized MgtA, earlier described in Subramani et al. (2016). The protocol will in addition present notes that describe critical points and observations made in the process.
Materials and Reagents
Disposable cup, 100 ml, PP (polypropylene) (SARSTEDT, catalog number: 75.562.105 )
Note: It is used to store cell pellet.
70 ml polycarbonate ultracentrifugation tube
C43(DE3) (Lucigen, catalog number: 60446 )
PfuUltra II Fusion HS DNA polymerase (Agilent Technologies, catalog number: 600670 )
LB broth powder (Sigma-Aldrich, catalog number: L3022 )
Kanamycin (Sigma-Aldrich, catalog number: K1377 )
Polypropylene glycol P2000 (Sigma-Aldrich, catalog number: 81380 )
Gistex® LS Ferm - yeast extract (Fermia AB, Sweden)
Glycerol (VWR, catalog number: 24388.295 )
Isopropyl β-D-thiogalactopyranoside (IPTG) (Biosynth, catalog number: I-8000 )
Sodium dodecyl sulfate (SDS) (Sigma-Aldrich, Catalog number: L4509 )
β-mercaptoethanol (Sigma-Aldrich, catalog number: M3148 )
Bromophenol blue (Thermo Fisher Scientific, Fisher Scientific, catalog number: BP115-25 )
Penta·His HRP Conjugate Kit (QIAGEN, catalog number: 34460 )
Note: This is antibody against the His-tag and we used it for Western-blot analysis of 6x His-tagged MgtA. This antibody is conjugated to horseradish peroxidase (HRP), so there is no requirement for the use of secondary antibody.
HEPES (Sigma-Aldrich, catalog number: H3375 )
Potassium sulfate (K2SO4) (Sigma-Aldrich, catalog number: P9458 )
Deoxyribonuclease I (Sigma-Aldrich, catalog number: DN25 )
Phenylmethylsulfonyl fluoride (Sigma-Aldrich, catalog number: P7626 )
Dodecyl-β-D maltoside (Chemical point, catalog number: CP69227-93-6-BULK )
Imidazole (Sigma-Aldrich, catalog number: 56750 )
Dithiothreitol (Biosynth, catalog number: D-8200 )
Potassium hydroxide (KOH) (Sigma-Aldrich, catalog number: 221473 )
Trizma® base (biotechnology performance certified) (Sigma-Aldrich, catalog number: T6066 )
PageRulerTM prestained protein ladder (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 26616 )
LB broth (see Recipes)
LB kanamycin plate (see Recipes)
Growth media (see Recipes)
1x SDS-PAGE loading buffer (see Recipes)
Buffer A (see Recipes)
Buffer B (see Recipes)
Buffer C (see Recipes)
Buffer D (see Recipes)
Buffer E (see Recipes)
Equipment
Incubator
Baffled bottom Erlenmeyer flask (500 ml) (Saveen & Werner, catalog number: 00125-54 )
Note: These flasks have four baffles (flow directing ridges). It interrupts the circular flow of media and increases its gas exchange surface, thereby increasing the oxygenation of culture media when compared to a normal Erlenmeyer flask.
Bottle with screw caps, used for fermentation (Saveen & Werner, catalog number: 88-2L )
LEX (Large-scale Expression) 48 bioreactor system (Epiphyte Three, Harbinger Biotechnology and engineering, model: LEX-48 Bioreactor )
High pressure homogenizer (used to lyse cells) (Avestin, model: EmulsiFlex C3 )
Potter-Elvehjem-type tissue homogenizer (30 ml) (WHEATON, catalog number: 358049 )
70 ml polycarbonate ultracentrifugation tube assembly (Beckman Coulter, catalog number: 355622 )
45 Ti rotor (Beckman Coulter, catalog number: 339160 )
OptimaTMXE (Beckman Coulter, catalog number: A99833 )
Column HP Histrap, 5 ml (GE Healthcare, catalog number: 17-5248-02 )
HiLoad 16/600 Superdex 200 pg column (GE Healthcare, catalog number: 28-9893-35 )
Vivaspin 20 MWCO 50,00 PES (Saveen & Werner, catalog number: VS2032 )
Software
Image LabTM software
UNICORN software associated with ÄKTA purifier
Procedure
Overexpression of MgtA
The mgtA gene was amplified from E. coli DH5α genomic DNA using PfuUltra II Fusion HS DNA polymerase with the primers described earlier (Subramani et al., 2016). The reaction mixture and PCR conditions were made as suggested by the PfuUltra II Fusion HS DNA polymerase manual. The amplified gene was inserted between NcoI and XhoI restriction sites in pETM11 vector (EMBL). Thus the expressed MgtA will include 6x His tag followed by a tobacco etch virus (TEV) protease site at the N-terminus.
Transform the pETM11(mgtA) plasmid into C43(DE3) competent cells and plate on LB kanamycin plate and incubate at 37 °C for 16 h.
Select 5 colonies at random and inoculate in a 500 ml baffled bottom Erlenmeyer flask containing 200 ml LB media with 50 µg/ml of kanamycin. Incubate the flask at 37 °C with 150 rpm for 16 h.
For large scale over expression of MgtA in C43(DE3) cells, we used the LEX 48 bioreactor system (Harbinger Technology LEXTM).
Note: The LEX system delivers filtered compressed air through a sparger that passes through the screw cap. It provides both aeration and mixing of bacterial culture in the screw cap bottle. The culture flasks are placed in a temperature controlled water bath and the LEX 48 can accommodate 24 x 2 L standard screw cap bottles. Normally only 75% of the bottle capacity is used to avoid overflow of media during aeration.
Inoculate 1% of overnight culture into 2 L screw cap bottles containing 1.5 L of growth media, 50 µg/ml of kanamycin and 1.5 ml of polypropylene glycol (PPG) P2000 (antifoaming agent).
Place the bottles in the Lex 48 bioreactor water bath. Set the temperature of the water bath at 37 °C and initiate airflow through the spargers.
Measure the optical density at 600 nm (OD600) every hour. The antifoaming agent PPG P2000 can become cloudy under these conditions and can be cleared upon incubation in ice for 5 min. Therefore, prior to the measurement at OD600, withdraw 1 ml of culture from the 2 L bottles and incubate on ice for 5 min.
When the OD600 is ~0.6-2, stop the airflow and cool the water bath to 17 °C by adding ice. Leave the culture bottles at 17 °C for 30 min to ensure an equivalent temperature of the bacterial culture. In order to check the level overexpression by Western blot (see step 12), pellet 1 ml of bacterial culture at 12,000 x g, 4 °C and mark as SUI (uninduced).
Add 1 mM of IPTG and an additional 1.5 ml of PPG P2000 to each bottle. Begin the airflow and leave the bottles at 17 °C for 16 h with continuous airflow.
To terminate the induction, transfer the culture bottles to ice. Pellet 1 ml of bacterial culture from each bottle at 12,000 x g, 4 °C and mark as SI (induced) for Western blot analysis.
Centrifuge rest of the bacterial culture at 7,000 x g for 20 min at 4 °C and divide the resulting cell pellet into 50 g aliquots in 100 ml disposable cups and store at -20 °C until further use.
Suspend the SUI and SI sample pellets in 1x SDS-PAGE loading buffer to normalize the OD600 to 10 and incubate at RT for 5 min. Centrifuge the lysed cells at 20,000 x g for 20 min at 4 °C. For Western blot analysis use 10 µl of the supernatant and blot against Penta·His HRP conjugated antibody to check MgtA overexpression.
Note: Confirmation of MgtA overexpression by Western blot against Penta·His HRP antibodies is highly recommended before beginning protein purification process as the detergents used during purification process are expensive and any problem associated with overexpression can be identified at this stage. Do not boil the samples used for SDS-PAGE and Western blot analysis.
Cell lysis and solubilisation
Thaw the frozen cell pellet on ice and suspend in buffer A at 1:10 (wt/vol) ratio.
Lyse the cells using EmulsiFlex-C3, a high pressure homogenizer (HPH) by passing the cell suspension three times at 11,000 psi. Always store the samples on ice unless otherwise stated.
Note: We did not test the other lysis methods like sonication and bead beater. But we believe, that they could also be used. The protein yield should be expected to vary depending on the lysis method.
Centrifuge the cell lysate at 20,000 x g for 20 min at 4 °C to remove unlysed cells and inclusion bodies.
Collect the supernatant and centrifuge at 100,000 x g for 2 h at 4 °C to pellet both the inner and outer membrane (mixed membranes).
Note: This step requires ultracentrifuge with the rotors and tubes selected according to the volume of the sample. For example, if the sample size is 70 ml, then 45 Ti rotor and 70 ml polycarbonate ultracentrifugation tube can be used with ultracentrifuge OptimaTMXE. It is important to fill the tubes used for ultracentrifugation until the neck of the tube with possibly no gap between the liquid and cap of the tube to avoid the implosion of tubes during centrifugation.
Suspend the resulting mixed membrane pellet in buffer B using Potter-Elvehjem-type tissue homogenizer with 10 strokes. Use 1:10 (wt/vol) mixed membrane to buffer B ratio. Before adding the required amount of buffer B to membrane pellet, remove 10 ml to dissolve the detergent.
Note: The membrane suspension can be flash frozen with liquid nitrogen and stored at -80 °C if not used immediately.
We used 1% β-dodecyl maltoside (β-DDM) to solubilize the membrane proteins. Weigh the required amount of detergent powder and dissolve in the reserved 10 ml of buffer B.
Add the dissolved β-DDM drop wise into the mixed membrane suspension while stirring at 150 rpm, 4 °C. The suspension is left to stir for another 60 min at 4 °C.
Purification of MgtA
Prior to use, wash the Histrap HP 5 ml column with 5 column volume (CV) of degassed MQ water and equilibrate with 10 CV of buffer C.
Add 20 mM imidazole (pH 7.6) to the sample prepared in step B7 and load on the Histrap column at 2 ml/min.
After loading solubilized membrane sample, wash the Histrap column with 10 CV of buffer C and 3 CV of 15% buffer D at 3 ml/min. We observed a small peak (Figure 1A, peak 1) while washing with 15% buffer D.
Elute MgtA from the Histrap column by passing 50% buffer D at 3 ml/min. We observed a relatively large peak (Figure 1A, peak 2) while washing with buffer D.
Take 5 µl sample from each fraction and perform SDS-PAGE electrophoresis with 12% polyacrylamide gels.
We observed that Peak 1 contained a small proportion of MgtA along with other impurities, whereas peak 2 contained > 80% pure MgtA, as assessed by SDS-PAGE (Figure 1A).
Pool the fractions corresponding to peak 2 and concentrate to 6 mg/ml using a vivaspin 20 (protein concentrator with 50 kDa cutoff).
While concentrating the fractions, prepare a HiLoad 16/600 Superdex 200 pg column connected to the ÄKTA purifier by washing with 1.5 CV of degassed MQ and 1.5 CV of buffer E at 0.5 ml/min.
Load 1 ml of concentrated MgtA (6 mg/ml) on the HiLoad 16/600 Superdex 200 pg column at 0.5 ml/min and pass 1.5 CV of buffer E.
We observed a small peak at the void volume (44 ml), followed by a major monodisperse peak (Figure 1B, peak S1) at ~55 ml.
For SDS-PAGE analysis, load 5 µl of fractions corresponding to the observed peaks on 12% polyacrylamide gels. We observed that the void peak contained mostly impurities, whereas peak S1 contained MgtA at > 95% purity as analyzed by SDS-PAGE (Figure 1B).
Pool the fractions from peak S1 and concentrate to 3 mg/ml using vivaspin 20.
Divide the concentrated MgtA as 50 µl aliquots and flash freeze with liquid nitrogen and store at -80 °C.
In our experience, the protein was stable under these conditions for more than 1 year.
Figure 1. Representative figures of MgtA purification profile. A. Chromatogram of Histrap FF affinity column (left). The fractions from Peak 1 (lanes 1-4) and Peak 2 (lanes 6-11) were analyzed using SDS-PAGE and the Coomassie stained gel (right) shows the purity of the respective peaks. B. Chromatogram of size exclusion chromatography (left). The fractions from void (lanes 1-5) and Peak S1 (lanes 7-14) were analyzed using SDS-PAGE and the Coomassie stained gel (right) shows the purity of the respective peaks. In both SDS-PAGE gel pictures, MgtA runs at 100 kDa.
Data analysis
The data for chromatograms in Figure 1 were obtained from UNICORN software associated with ÄKTA purifier and the graphs were plotted using GraphPad Prism6. All the SDS-PAGE gels were scanned using Bio-Rad ChemiDoc XRS+ system and analyzed using Image LabTM software.
Recipes
LB broth
Mix 40 g of LB broth powder in 1 L of MQ and autoclave
LB kanamycin plate
Mix 40 g of LB broth powder and 7.5 g of LB agar and autoclave
Prepare LB plate with 50 µg/ml kanamycin
Growth media
40 g of LB broth powder from Sigma-Aldrich (see Materials and Reagents)
10 g of Fistex LS Ferm yeast extract
Add 1 L of MQ and autoclave. Before inoculation, add 10 ml of 1 M Tris-Hcl pH 7.4 and 5 ml of glycerol
1x SDS-PAGE loading buffer
2% SDS
10% glycerol
5% β-mercaptoethanol
0.002% bromophenol blue
63 mM Tris-HCl, pH 6.8
Buffer A
50 mM HEPES, pH 7.0 (KOH)
100 mM K2SO4
10% glycerol
1 mM PMSF
5 mM β-mercaptoethanol
1 μg/ml DNase
Buffer B
25 mM HEPES, pH 7.0 (KOH)
100 mM K2SO4
5% glycerol
1 mM PMSF
5 mM β-mercaptoethanol
Buffer C
25 mM HEPE, pH 7.0 (KOH)
100 mM K2SO4
5% glycerol
1 mM PMSF
5 mM β-mercaptoethanol
20 mM Imidazole, pH 7.6
3 CMC β-DDM
Buffer D
25 mM HEPES, pH 7.0 (KOH)
100 mM K2SO4
5% glycerol
1 mM PMSF
5 mM β-mercaptoethanol
300 mM Imidazole pH 7.6
3 CMC β-DDM
Buffer E
25 mM HEPES, pH 7.0 (KOH)
100 mM K2SO4
5% glycerol
1 mM dithiothreitol
3 CMC β-DDM
Note: The buffers used for chromatography were always filtered using the NalgeneTM reusable bottle top filter connected to vacuum pump. Buffers were degassed with the same set up, but by closing the filter chamber while the vacuum still on and with constant stirring. Buffers were degassed until no bubbles were observed in the solution.
Acknowledgments
The Norwegian Research Council Funding (F-RIMEDBIO) #ES486454 and NCMM core Funding supported this study.
References
Faraco, M., Spelt, C., Bliek, M., Verweij, W., Hoshino, A., Espen, L., Prinsi, B., Jaarsma, R., Tarhan, E., de Boer, A. H., Di Sansebastiano, G. P., Koes, R. and Quattrocchio, F. M. (2014). Hyperacidification of vacuoles by the combined action of two different P-ATPases in the tonoplast determines flower color. Cell Rep 6(1): 32-43.
Groisman, E. A., Hollands, K., Kriner, M. A., Lee, E. J., Park, S. Y. and Pontes, M. H. (2013). Bacterial Mg2+ homeostasis, transport, and virulence. Annu Rev Genet 47: 625-646.
Kato, A., Tanabe, H. and Utsumi, R. (1999). Molecular characterization of the PhoP-PhoQ two-component system in Escherichia coli K-12: identification of extracellular Mg2+-responsive promoters. J Bacteriol 181(17): 5516-5520.
Soncini, F. C., Garcia Vescovi, E., Solomon, F. and Groisman, E. A. (1996). Molecular basis of the magnesium deprivation response in Salmonella typhimurium: identification of PhoP-regulated genes. J Bacteriol 178(17): 5092-5099.
Subramani, S., Perdreau-Dahl, H. and Morth, J. P. (2016). The magnesium transporter A is activated by cardiolipin and is highly sensitive to free magnesium in vitro. Elife 5.
Copyright: Subramani and Morth. This article is distributed under the terms of the Creative Commons Attribution License (CC BY 4.0).
How to cite： Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Subramani, S. and Morth, J. P. (2016). Heterologous Expression and Purification of the Magnesium Transporter A (MgtA) in Escherichia coli. Bio-protocol 6(22): e2001. DOI: 10.21769/BioProtoc.2001.
Subramani, S., Perdreau-Dahl, H. and Morth, J. P. (2016). The magnesium transporter A is activated by cardiolipin and is highly sensitive to free magnesium in vitro. Elife 5.e11407.
Download Citation in RIS Format
Category
Microbiology > Microbial biochemistry > Protein
Biochemistry > Protein > Expression
Biochemistry > Protein > Isolation and purification
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,002 | https://bio-protocol.org/exchange/protocoldetail?id=2002&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Transfer of Large Contiguous DNA Fragments onto a Low Copy Plasmid or into the Bacterial Chromosome
AR Analise Z Reeves
CL Cammie F Lesser
Published: Vol 6, Iss 22, Nov 20, 2016
DOI: 10.21769/BioProtoc.2002 Views: 10404
Reviewed by: Lionel SchiavolinKanika Gera
Original Research Article:
The authors used this protocol in May 2015
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
May 2015
Abstract
Bacterial pathogenicity islands and other contiguous operons can be difficult to clone using conventional methods due to their large size. Here we describe a robust 3-step method to transfer large defined fragments of DNA from virulence plasmids or cosmids onto smaller autonomously replicating plasmids or directly into defined sites in the bacterial chromosome that incorporates endogenous yeast and λ Red homologous recombination systems. This methodology has been successfully used to isolate and integrate at least 31 kb of contiguous DNA and can be readily adapted for the recombineering of E. coli and its close relatives.
Background
The ability to isolate and propagate large pieces of DNA has vastly expanded the study of gene networks and operons. However, the traditionally used engineered plasmids for this purpose, such as bacterial artificial chromosomes (BACs), while extremely useful, are limited by problems with DNA stability, copy number, and complex assembly requirements. Alternatively, incorporating constructs directly into the bacterial chromosome provides advantages by both reducing variations in gene expression arising from the presence of multiple gene copies and ensuring stable maintenance of genes, while also avoiding the need for antibiotic selection.
The methodologies described here were originally designed to capture and transfer the 31 kb of DNA operons that encode the Shigella flexneri type 3 secretion system onto the Escherichia coli chromosome (Reeves et al., 2015). The procedure utilizes yeast homologous recombination to generate a capture vector, a plasmid that contains regions of DNA that flank the fragment to be transferred, followed by using the λ Red recombination system to transfer the region of DNA of interest from a large virulence plasmid or cosmid onto the capture vector. The introduction of unique ‘Landing Pad’ sequences flanking the target sequence can be used to transfer via site-specific recombination the region of DNA present on the capture vector to an experimentally defined location on the bacterial chromosome using a protocol previously established by Kuhlman and Cox (2010). The inclusion of flanking landing pad sequences does not preclude the propagation of the DNA of interest on an autonomously replicating plasmid, but rather affords the opportunity to subsequently introduce the captured DNA onto a defined site on the bacterial chromosome. While we favor the use of an engineered landing pad sequence, one could adapt the approach described below to target the insertion of the captured DNA to a specifically defined locus on the bacterial chromosome.
Materials and Reagents
1.7 ml microcentrifuge tubes
Acid-washed, small glass beads, 425-600 μm (30-40 U.S. sieve) (Sigma-Aldrich, catalog number: G8772 )
Large glass beads, 5 mm (Corning, catalog number: 7268-5 )
Cell scrapers (Corning, Falcon®, catalog number: 353085 )
Electroporation cuvettes (Thermo Fisher Scientific, Fisher Scientific, catalog number: FB101 )
Petri dishes (100 x 15 mm) (VWR, catalog number: 89038-968 )
ElectroMAXTM DH10β cells (Thermo Fisher Scientific, InvitrogenTM, catalog number: 18290015 )
Saccharomyces cerevisiae yeast strain (BY4741) (GE Healthcare Dharmacon, catalog number: YS1048 or other ura3 minus strain)
E. coli DH10β atp/gidB::Landing pad cassette. Tetracycline resistant strain harboring an integrated landing pad cassette (for use if transferring captured DNA into the chromosome) (Addgene, catalog number: 83036 )
pLLX13 plasmid, or another suitable yeast/bacteria shuttle vector (Addgene, catalog number: 79825 )
pLLX8 plasmid, or another suitable vector that encodes the desired antibiotic resistance cassette (Addgene, catalog number: 79838 )
pKD46, temperature sensitive, λ red recombinase expression plasmid, or similar (Datsenko and Wanner, 2000)
pTKred plasmid, temperature sensitive, bacterial expression vector for λ Red recombinase and I-SceI (Addgene, catalog number: 41062 )
Gene specific primers (see Table 1)
Yeast nitrogen base with ammonium sulfate (MP Biomedicals, catalog number: 114027-532 )
CSM-URA, uracil dropout supplement (MP Biomedicals, catalog number: 4511-222 )
D-glucose (Thermo Fisher Scientific, Fisher Scientific, catalog number: D16-10 )
Agar (Thermo Fisher Scientific, Fisher Scientific, catalog number: BP1423-2 )
L-(+)-arabinose (Sigma-Aldrich, catalog number: A3256-100 )
Ampicillin sodium salt (Sigma-Aldrich, catalog number: A9518-25G )
Kanamycin monosulfate (MP Biomedicals, catalog number: 02150029 )
Tetracycline hydrochloride (Sigma-Aldrich, catalog number: T7660 )
Spectinomycin dihydrochloride pentahydrate (Sigma-Aldrich, catalog number: S9007-5G )
Distilled, deionized water
Magnesium sulfate (MgSO4) (Sigma-Aldrich, catalog number: M2643-500G )
KOD hot start DNA polymerase (EMD Millipore, catalog number: 71-086-3 )
QIAquick Gel Extraction Kit (QIAGEN, catalog number: 28704 )
NheI-HF® restriction enzyme (New England Biolabs, catalog number: R3131S )
PmeI restriction enzyme (New England Biolabs, catalog number: R0560S )
MluI-HF® restriction enzyme (New England Biolabs, catalog number: R3198S )
Yeast extract (Thermo Fisher Scientific, Fisher Scientific, catalog number: BP1422-2 )
Peptone (Thermo Fisher Scientific, Fisher Scientific, catalog number: BP1420-2 )
Glycerol (Thermo Fisher Scientific, Fisher Scientific, catalog number: BP229-4 )
Polyethylene glycol 3350 (PEG 3350) (Sigma-Aldrich, catalog number: 202444 )
Lithium acetate (LiOAc) (Sigma-Aldrich, catalog number: 517992 )
DNA sodium salt from salmon testes (Sigma-Aldrich, catalog number: D1626 ), resuspended in TE buffer (2 mg/ml)
Tris-HCl, pH 8.0 (Promega, catalog number: H5123 )
EDTA (Sigma-Aldrich, catalog number: E5134-500G )
QIAprep Spin Miniprep Kit (QIAGEN, catalog number: 27104 )
Sodium chloride (NaCl) (Sigma-Aldrich, catalog number: S3014-500G )
Potassium chloride (KCl) (Sigma-Aldrich, catalog number: P5405-250G )
Sodium acetate (NaOAc) (Sigma-Aldrich, catalog number: S2889 )
Selective antibiotics
Kanamycin monosulfate (1,000x stock) (see Recipes)
Ampicillin sodium salt (1,000x stock) (see Recipes)
Tetracycline hydrochloride (1,000x stock) (see Recipes)
Spectinomycin dihydrochloride pentahydrate (1,000x stock) (see Recipes)
CSM-Ura selective media (see Recipes)
YEPD media (see Recipes)
TE buffer (see Recipes)
SOB broth (see Recipes)
SOC broth (see Recipes)
Equipment
100-150 ml Erlenmeyer flask
Vortex (Scientific Industries, catalog number: SI-0136 )
Incubators, set to 37 °C and 30 °C
Water baths or heat blocks, set to 42 °C, 37 °C and 30 °C
Microcentrifuge (Eppendorf, model: 5424 )
Large centrifuge, able to handle up to 50 ml (for making competent yeast and bacteria)
Electrophoresis system
UV transilluminator
Thermocycler (Bio-Rad Laboratories, model: PTC 200 ) or any other conventional thermocycler
GenePulser II electroporation system (Bio-Rad Laboratories) or other electroporation device
Nanodrop Lite spectrophotometer (Thermo Fisher Scientific, model: NanoDrop Lite ), or any other equipment/method suitable for quantifying DNA concentration
Roller drum or shaker
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Reeves, A. Z. and Lesser, C. F. (2016). Transfer of Large Contiguous DNA Fragments onto a Low Copy Plasmid or into the Bacterial Chromosome. Bio-protocol 6(22): e2002. DOI: 10.21769/BioProtoc.2002.
Download Citation in RIS Format
Category
Microbiology > Microbial genetics > Gene mapping and cloning
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,003 | https://bio-protocol.org/exchange/protocoldetail?id=2003&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
In vitro Brainstem-spinal Cord Preparation from Newborn Rat
Jean-Patrick Le Gal
Angelo Nicolosi
Laurent Juvin
Didier Morin
Published: Vol 6, Iss 22, Nov 20, 2016
DOI: 10.21769/BioProtoc.2003 Views: 8473
Edited by: Soyun Kim
Reviewed by: Shai Berlin
Original Research Article:
The authors used this protocol in Jan 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jan 2016
Abstract
The brainstem-spinal cord preparation of newborn rat contains neural networks able to produce motor output in absence of sensory feedback. These neural structures, commonly called central pattern generators (CPGs), are involved in many vital functions such as respiration (Morin and Viala, 2002; Giraudin et al., 2008) or locomotion (Juvin et al., 2005). Here we describe a procedure for the isolation of the brainstem-spinal cord tissue of neonatal rat (0-2 days old). A surgical method under binocular microscope allows the brainstem and the spinal cord to be isolated in vitro and the motor outputs to be recorded. This preparation can then be used for diverse experimental approaches, such as electrophysiology, pharmacology or anatomical studies, and constitutes a useful model to study the interaction between CPGs (Juvin et al., 2007; 2012; Giraudin et al., 2012; Le Gal et al., 2014; 2016).
Background
Historically, the in vitro spinal cord of neonatal rodent was developed to study the spinal reflexes (Otsuka and Konishi, 1974). In 1984, Suzue was the first to develop the in vitro brainstem-spinal cord preparation of newborn rat. Thus, it was possible to demonstrate that an isolated central nervous system was able to generate spontaneously what is referred as fictive respiratory activity. Later, it was then possible to determine the location of the CPGs underlying the locomotor rhythm generation (Cazalets et al., 1995; Kjaerulff and Kiehn, 1996; Ballion et al., 2001) and those engaged in respiratory rhythm generation (Smith et al., 1991; Onimaru and Homma, 2003). In our research team, this preparation has been mainly used to study the neural mechanisms underlying the interaction between CPGs. For instance, in a context of interaction between CPGs involved in the same function, our results have contributed to characterize the role played by the sensory afferents and the spinal thoracic segments in the coordination between the cervical and the lumbar locomotor CPGs (Juvin et al., 2005; 2012). Similarly, this preparation allows studies on the neural mechanisms involved in coordination between CPGs engaged in different functions. Based on electrical stimulation of dorsal roots, it was shown that the proprioceptive inputs originating from both hindlimb and forelimb are involved in the respiratory rhythm entrainment observed during locomotion (Morin and Viala, 2002; Giraudin et al., 2012). These ascending entraining signals from the cervical and lumbar afferents are conveyed to the brainstem respiratory centers via a brainstem pontine relay located in the parabrachial/Kölliker-Fuse complex (Giraudin et al., 2012). Using pharmacological and intracellular (patch-clamp recording) approaches on the same preparation, recent results have demonstrated for the first time the existence of an ascending pathway from the lumbar locomotor CPGs to the respiratory CPGs. This central neurogenic mechanism, involving a substance P-dependent modulating mechanism, could play a crucial role in the increased respiratory frequency observed during locomotion (Le Gal et al., 2014). In addition, it was also demonstrated that the locomotor related signal from the lumbar locomotor CPGs selectively modulates the intracellular activity of spinal expiratory neurons (Le Gal et al., 2016). Altogether, our results obtained on the in vitro brainstem spinal cord preparation of new born rat have contributed to increase our understanding of the cellular bases engaged in the coordination of rhythmic neural circuitry responsible for different functions.
Materials and Reagents
Needles (25 G) (Henke-Sass Wolf, catalog number: 4710005016 )
Neonatal rat (0-2 days old)
Sodium chloride (NaCl) (Sigma-Aldrich, catalog number: S3014 )
Potassium chloride (KCl) (Sigma-Aldrich, catalog number: P3911 )
Sodium phosphate monobasic (NaH2PO4) (Sigma-Aldrich, catalog number: S0751 )
Calcium chloride dihydrate (CaCl2·2H2O) (Sigma-Aldrich, catalog number: C5080 )
Magnesium chloride hexahydrate (MgCl2·6H2O) (Sigma-Aldrich, catalog number: M2670 )
Sodium bicarbonate (NaHCO3) (Sigma-Aldrich, catalog number: S8875 )
D-glucose (Thermo Fisher Scientific, Fisher Scientific, catalog number: AC410950010 )
Sodium hydroxide (NaOH) (1 N) (Sigma-Aldrich, catalog number: 795429 )
Hydrochloric acid (HCl) (37%) (Sigma-Aldrich, catalog number: 258148 )
Isoflurane (Piramal Enterprises, Piramal HealthCare, catalog number: Isoflurane )
Vaseline (Sigma-Aldrich, catalog number: 16415 )
Artificial cerebro-spinal fluid (aCSF) solution (see Recipes)
Equipment
FisherbrandTM beaker (1 L) (Thermo Fisher Scientific, Fisher Scientific, catalog number: 15449083 )
Ice bucket (SP Scienceware - Bel-Art Products - H-B Instrument, catalog number: M18848-2001 )
Induction chamber for inhalational anesthesia (TemSega, catalog number: chamber )
Isoflurane vaporizer (TemSega, model: Isoflurane vaporizer )
Carbogen, 95% O2, 5% CO2 (The Linde Group, Linde Gaz, model: Carbogen B50 )
Scalpel blade (LCH MEDICAL PRODUCTS, catalog number: SCX23 ) (Figure 1a)
Small scissors (Moria, model: MC26B ) (Figure 1a)
Fine forceps (Fine Science Tools, Dumont, model: 55 ) (Figure 1a)
Dissection chamber (plastic box, 100 ml) with 2 mm layer of silicone elastomer
Binocular microscope (Olympus, model: SZX7 )
Recording chamber (10 ml) composed by a standard petri dish (60 mm) with 2 mm layer of silicone elastomer
Peristaltic pump (Gilson, model: Minipuls® 3 )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
How to cite： Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Le Gal, J., Nicolosi, A., Juvin, L. and Morin, D. (2016). In vitro Brainstem-spinal Cord Preparation from Newborn Rat. Bio-protocol 6(22): e2003. DOI: 10.21769/BioProtoc.2003.
Le Gal, J. P., Juvin, L., Cardoit, L. and Morin, D. (2016). Bimodal respiratory-locomotor neurons in the neonatal rat spinal cord. J Neurosci 36(3): 926-937.
Download Citation in RIS Format
Category
Neuroscience > Sensory and motor systems > Spinal cord
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,004 | https://bio-protocol.org/exchange/protocoldetail?id=2004&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Quantitative Measurements of HIV-1 and Dextran Capture by Human Monocyte-derived Dendritic Cells (MDDCs)
Mickaël M. Ménager
DL Dan R. Littman
Published: Vol 6, Iss 22, Nov 20, 2016
DOI: 10.21769/BioProtoc.2004 Views: 9852
Edited by: Kristopher Marjon
Reviewed by: Vaibhav B ShahValeria Lulla
Original Research Article:
The authors used this protocol in Feb 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Feb 2016
Abstract
The aim of this protocol is to describe how to measure and quantify the amount of HIV-1 particles and dextran molecules internalized in human monocyte derived dendritic cells (MDDCs), using three different techniques: flow cytometry, quantitative PCR and confocal microscopy.
Background
This protocol was developed in order to assess the changes of HIV-1 internalization upon disruption of actin nucleation in human monocyte derived dendritic cells. Following a shRNA screen to identify genes important for HIV-1 transfer from dendritic cells to T cells, we observed that a disruption of actin nucleation leads to a switch from actin rich dendrites to blebs, due to an excess of actomyosin contraction. As a consequence, a decrease of HIV-1 transfer and an increase of HIV-1 internalization due to bleb retraction-driven macropinocytosis were observed. We concluded that effectors of actin nucleation and stabilization were key to maintain HIV-1 on actin-rich dendrites and to limit its endocytosis, for efficient transfer to T lymphocytes (Menager and Littman, 2016).
Materials and Reagents
Production of HIV-1 particles
10 cm plate (100 x 20 mm) (Corning, Falcon®, catalog number: 353003 )
15 cm plate (150 x 20 mm) (Corning, Falcon®, catalog number: 353025 )
15 ml conical tube
33 mm Millex-HV syringe filter, PVDF, 0.45 μm (EMD Millipore, catalog number: SLHV033RS )
60 ml syringe with BD Luer-LokTM tip (BD, Luer-LokTM, catalog number: 309653 )
50 ml high clarity PP centrifuge tube, conical bottom, sterile, 25/bag, 500/case (Corning, Falcon®, catalog number: 352070 )
293FT cells (Thermo Fisher Scientific, InvitrogenTM, catalog number: R700-07 )
X4-HIV-Gag-iGFP plasmid
Note: Derived from HIV-1 molecular clone NL4-3 modified to insert the GFP protein in between the MA and CA domains of Gag as previously described (Hubner et al., 2007).
Dulbecco’s modification of Eagles medium (DMEM) (Mediatech, catalog number: 10-017-CV )
Fetal bovine serum (FBS)
MEM amino acid solution (GE Healthcare, HyCloneTM, catalog number: SH30598.01 )
HyCloneTM L-glutamine (GE Healthcare, HyCloneTM, catalog number: SH3003401 )
HyCloneTM penicillin streptomycin 100x solution (GE Healthcare, HyCloneTM, catalog number: SV30010 )
Gentamicin (50 mg/ml) (Thermo Fisher Scientific, GibcoTM, catalog number: 15750060 )
Geneticin® selective antibiotic (G418 sulfate) (powder) (Thermo Fisher Scientific, GibcoTM, catalog number: 11811023 )
Trypsin 0.05% protease solution with porcine trypsin, HBSS, EDTA; without calcium, magnesium (GE Healthcare, HyCloneTM, catalog number: SH30236.01 )
ProFection® mammalian transfection system-calcium phosphate (Promega, catalog number: E1200 )
Calcium chloride (CaCl2)
100 mM sodium pyruvate solution (GE Healthcare, HyCloneTM, catalog number: SH30239.01 )
1 M HEPES solution (GE Healthcare, HyCloneTM, catalog number: SH30237.01 )
D10 medium (see Recipes)
Differentiation of monocyte derived dendritic cells (MDDCs)
60 ml syringe with BD Luer-LokTM tip (BD, Luer-LokTM, catalog number: 309653 )
Needle (50/sp, 500/ca), 18 G x 1 ½ in. (BD, SafetyGlideTM, catalog number: 305918 )
3 ml plastic disposable transfer (Pasteur) pipettes, sterile in 20s (Elkay Laboratory Products, Liquipette®, catalog number: 127-P503-20S )
40 μm nylon cell strainer
LS columns (Miltenyi Biotec, catalog number: 130-042-401 )
10 cm plate (100 x 20 mm) (Corning, Falcon®, catalog number: 353003 )
50 ml buffy coat from New York Blood Center (leukapharesis)
Ficoll-Paque PLUS (GE Healthcare, HyCloneTM, catalog number: 17-1440-02 )
Dulbecco’s phosphate buffered saline (DPBS), without calcium, magnesium, phenol red (GE Healthcare, HyCloneTM, catalog number: SH30028.02 )
Bovine serum albumin (BSA), fraction V, heat shock (Roche Diagnostics, catalog number: 03116956001 )
EDTA
RPMI 1640 media (GE Healthcare, HyCloneTM, catalog number: SH30096.01 )
Fetal bovine serum (FBS)
1 M HEPES solution (GE Healthcare, HyCloneTM, catalog number: SH30237.01 )
2-mercaptoethanol (55 mM) (1,000x) (Thermo Fisher Scientific, GibcoTM, catalog number: 21985-023 )
HyCloneTM L-glutamine (GE Healthcare, HyCloneTM, catalog number: SH3003401 )
HyCloneTM penicillin streptomycin 100x solution (GE Healthcare, HyCloneTM, catalog number: SV30010 )
Geneticin® selective antibiotic (G418 sulfate) (powder) (Thermo Fisher Scientific, GibcoTM, catalog number: 11811023)
Anti-human CD14 microbeads
20.Human GM-CSF (Affymetrix, eBioscience, catalog number: 34-8339-82 )
Human IL-4 (Affymetrix, eBioscience, catalog number: 34-8049-82 )
Anti-hDC-SIGN PE (Clone: 120507), mouse IgG2B (R&D Systems, catalog number: FAB161P )
Anti-hCD14 APC (Clone: 61D3) (Affymetrix, eBioscience, catalog number: 17-0149-42 )
MACS buffer (see Recipes)
DC medium (see Recipes)
MDDC loading with HIV-1 or dextran
96 well clear round bottom TC-treated cell culture microplate, with lid, individually wrapped, sterile (Corning, Falcon®, catalog number: 353077 )
X4-HIV-Gag-iGFP plasmid
Note: Derived from HIV-1 molecular clone NL4-3 modified to insert the GFP protein in between the MA and CA domains of Gag as previously described (Hubner et al., 2007)
Dextran, fluorescein (10,000 MW, anionic, lysine fixable) (Thermo Fisher Scientific, Molecular ProbesTM, catalog number: D-1820 )
Dextran, fluorescein (70,000 MW, anionic, lysine fixable) (Thermo Fisher Scientific, Molecular ProbesTM, catalog number: D-1822 )
Dextran, fluorescein (500,000 MW, anionic, lysine fixable) (Thermo Fisher Scientific, Molecular ProbesTM, catalog number: D-7136 )
Dextran, fluorescein (2,000,000 MW, anionic, lysine fixable) (Thermo Fisher Scientific, Molecular ProbesTM, catalog number: D-7137 )
Dulbecco’s phosphate buffered saline (DPBS), without calcium, magnesium, phenol red (GE Healthcare, HyCloneTM, catalog number: SH30028.02 )
MACS buffer (see Recipes)
Analysis of HIV-1 or dextran capture by flow cytometry
Hanks’ balanced salt solution (HBSS) (1x) (Mediatech, catalog number: 21-023-CV )
LIVE/DEAD® Fixable Blue Dead Cell Stain Kit (for UV excitation) (Thermo Fisher Scientific, Molecular ProbesTM, catalog number: L23105 )
Anti-hDC-SIGN PE (Clone: 120507), mouse IgG2B (R&D Systems, catalog number: FAB161P )
Anti-hCD14 APC (Clone: 61D3) (Affymetrix, eBioscience, catalog number: 17-0149-42 )
Fixation/Permeabilization Solution Kit (RUO) (Fixation/Permeabilization solution 125 ml and BD Perm/WashTM buffer 100 ml) (BD, Cytofix/CytopermTM, catalog number: 554714 )
Anti-P24 KC57-RD1 (Beckman Coulter, catalog number: 6604667 )
Analysis of HIV-1 capture by Quantitative PCR (QPCR)
LightCycler® 480 multiwell plate 96, white (Roche Diagnostics, catalog number: 04729692001 )
LightCycler® 480 SYBR Green I Master (Roche Diagnostics, catalog number: 04887352001 )
TRIzol® reagent (Thermo Fisher Scientific, AmbionTM, catalog number: 15596-018 )
SuperScript® III first-strand synthesis system (Thermo Fisher Scientific, InvitrogenTM, catalog number: 18080-051 )
primers:
GFP forward: 5’-ACGTAAACGGCCACAAGTTC-3’
GFP Reverse: 5’-AAGTCGTGCTGCTTCATGTG-3’
GAPDH forward: 5’-CCCATCACCATCTTCCAGGAGCG-3’
GAPDH Reverse: 5’-GAGATGATGACCCTTTTGGCTCC-3’
Analysis of HIV-1 or dextran capture by confocal microscopy
FisherbrandTM microscope slides (25 x 75 x 1.0 mm, double frosted precleaned) (Thermo Fisher Scientific, Fisher Scientific, catalog number: 12-552-5 )
Cover slip, round, 5 mm diameter, #1 0211 glass (Corning, Falcon®, catalog number: CLS-1763-005 )
Poly-L-lysine solution (Sigma-Aldrich, catalog number: P8920-100ML )
Paraformaldehyde, 16% solution, EM grade (Electron Microscopy Sciences, catalog number: 15710 )
PIPES (1,4-piperazinediethanesulfonic acid) (Sigma-Aldrich, catalog number: P6757-100G )
EGTA [Ethylene glycol-bis(β-aminoethyl ether)-N,N,N’,N’-tetraacetic acid tetrasodium salt, ≥ 97%] (Sigma-Aldrich, catalog number: E8145-10G )
Magnesium sulfate (MgSO4)
Potassium hydroxide (KOH)
TritonTM X-100 (Sigma-Aldrich, catalog number: X100-100ML )
5% casein solution as described and prepared in Dustin et al. (2007)
4’,6-Diamidino-2-Phenylindole, Dihydrochloride (DAPI) (Thermo Fisher Scientific, Molecular ProbesTM, catalog number: D1306 )
1,4-diazabicyclo[2.2.2]octane (DABCO) (Sigma-Aldrich, catalog number: D27802-25G )
Poly(vinyl alcohol) (PVA) (Sigma-Aldrich, catalog number: 341584-25G )
Glycerol (Sigma-Aldrich, catalog number: G5516-100ML )
Tris buffer, pH 8.7 (1.5 M) (Bio-Rad Laboratories, catalog number: 1610798 )
2x PHEM buffer (see Recipes)
DABCO-PVA (see Recipes)
Equipment
Centrifuge (Eppendorf, model: 5810 )
Vortex
CO2 incubator (Thermo Fisher Scientific, Thermo ScientificTM, model: HeracellTM 240 )
Flow cytometer (BD, model: LSRII )
High throughput sampler (HTS) (BD)
QPCR system (Roche Diagnostics, model: LightCycler 480 )
Confocal microscope (Zeiss, model: LSM 710 )
Software
ImageJ software
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Ménager, M. M. and Littman, D. R. (2016). Quantitative Measurements of HIV-1 and Dextran Capture by Human Monocyte-derived Dendritic Cells (MDDCs). Bio-protocol 6(22): e2004. DOI: 10.21769/BioProtoc.2004.
Download Citation in RIS Format
Category
Cell Biology > Cell imaging > Fluorescence
Immunology > Host defense > Human
Cell Biology > Cell-based analysis > Flow cytometry
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,005 | https://bio-protocol.org/exchange/protocoldetail?id=2005&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Arabidopsis Seed Germination Assay with Gibberellic Acid
Chunmei Zhong
HX Hao Xu
SY Siting Ye
SZ Shengchun Zhang
XW Xiaojing Wang
Published: Vol 6, Iss 22, Nov 20, 2016
DOI: 10.21769/BioProtoc.2005 Views: 18446
Edited by: Arsalan Daudi
Reviewed by: Yuan Chen
Original Research Article:
The authors used this protocol in Nov 2015
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Nov 2015
Abstract
This assay analyzes Arabidopsis seed germination in response to gibberellic acid (GA). During seed imbibition, visible physiological changes allow precise determination of germination rate. This protocol utilizes a stereoscopic microscope to improve characterization of seed germination process.
Background
Seed germination is a critical process of the plant life cycle controlled by phytohormones, such as GA and abscisic acid (ABA), and environmental factors. Seed germination comprises two physiological processes, including seed coat (testa) and endosperm ruptures. Usually, penetration of endosperm by the radicle indicates that germination is complete. Previous studies generally use endosperm rupture to calculate germination rate. However, seed coat rupture also measures the progression of seed germination. This protocol utilizes a stereoscopic microscope to provide a visible and precise calculation of seed germination, including the rates of both seed coat and endosperm rupture (Zhong et al., 2015).
Materials and Reagents
1.5 ml Eppendorf tubes (Eppendorf)
950 x 150 mm Petri dish (Shanghai Wuyi Glass Factory, catalog number: 1771 )
Sterile pipette tips (Corning, Axygen®)
Parafilm (Bemis, catalog number: PM-996 )
Aluminum foil (GLAD, catalog number: F5M )
0.2 µm syringe filters (Pall, Acrodisc®, catalog number: 4554 )
Arabidopsis seeds
Murashige and Skoog basal medium (Sigma-Aldrich, catalog number: M5519 )
Agar (MBCHEM, catalog number: 170837 , agented by WHIGA in China)
Sucrose, purity: AR (Tianjin Damao Chemical Reagent Factory, catalog number: 57-50-1 )
Gibberellic acid (GA3) (Sigma-Aldrich, catalog number: G7645 )
Ethanol, purity: AR (Tianjin Damao Chemical Reagent Factory, catalog number: 64-17-5 )
Potassium hydroxide (KOH), purity: AR (Chengdu Institute of Chemical Reagents, catalog number: 1310-73-2 )
MS solid medium (see Recipes)
10 mM GA3 stock (see Recipes)
70% ethanol (see Recipes)
1% sodium hypochlorite (see Recipes)
Autoclaved distilled water (see Recipes)
Equipment
Aquapro water purification system (Aquapro, model: AQ06062001 )
Note: This product has been discontinued.
Refrigerator (Haier, model: BCD-648WDBE )
Autoclave (HIRAYAMA, model: HVE-50 )
1 ml pipette (Eppendorf, catalog number: 3120620.001 )
Drying oven (ZenithLabo, model: DHG 9070A )
100 ml flasks
Microwave oven (Galanz, model: G70F20N2L-DG )
Benchtop (Suzhou Antai Air-tech, model: SW-CJ-1FD )
Stereoscopic microscope (Nikon, model: SMZ1500 )
Digital camera (10 megapixels) (Nikon, model: COOLPIX4500 )
Thermometer (WUqiang, China)
Software
Photoshop CS5 software
IBM SPSS Statistics 22 software
Origin8.0 software or Microsoft Excel
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
How to cite： Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Zhong, C., Xu, H., Ye, S., Zhang, S. and Wang, X. (2016). Arabidopsis Seed Germination Assay with Gibberellic Acid. Bio-protocol 6(22): e2005. DOI: 10.21769/BioProtoc.2005.
Zhong, C., Xu, H., Ye, S., Wang, S., Li, L., Zhang, S. and Wang, X. (2015). Gibberellic acid-stimulated Arabidopsis6 serves as an integrator of gibberellin, abscisic acid, and glucose signaling during seed germination in Arabidopsis. Plant Physiol 169(3): 2288-2303.
Download Citation in RIS Format
Category
Plant Science > Plant biochemistry > Plant hormone
Plant Science > Plant physiology > Plant growth
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,006 | https://bio-protocol.org/exchange/protocoldetail?id=2006&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Cell-to-cell DNA Transfer among Thermus Species
Alba Blesa
JB José Berenguer
Published: Vol 6, Iss 22, Nov 20, 2016
DOI: 10.21769/BioProtoc.2006 Views: 8943
Edited by: Daan C. Swarts
Reviewed by: Maria Sinetova
Original Research Article:
The authors used this protocol in Jan 2015
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jan 2015
Abstract
The ability to transfer DNA via direct cell-to-cell contact-dependent process similar to conjugation has been described in Thermus thermophilus (Tth). Here, we detail the mating experiment protocol involving the lateral transfer of thermostable antibiotic resistance markers (i.e., kanamycin: KmR; hygromycin: HygR) between Thermus cells, enabling the selection and quantification of the transfer frequencies. Briefly, liquid cultures of both mates are mixed and laid onto a nitrocellulose filter on a TB plate. After incubation at 60 °C, filters are resuspended upon selective plating. The contribution of DNA uptake by transformation is abolished by the addition of DNase I to the mix. This protocol can be used for the transfer of large DNA fragments (> 10 kb) to Thermus species.
Background
Conjugation, as the chief mechanism for horizontal gene transfer for most bacteria, is a highly specialized process by which DNA is transferred between two cells which are in direct contact (Lederberg and Tatum, 1946). Classical conjugation involves the unidirectional transfer of a DNA molecule, generally plasmid-encoded, from a donor to a recipient cell, which remains passive. However, alternative models have been described for a wide variety of bacteria. In the laboratory, conjugation experiments are fruitful for marker-exchange mutagenesis, among others. Over other methods of genetic transfer, conjugation is advantageous in terms of minimal disruption of the bacterial envelope and the feasibility to transfer large DNA fragments, including large chromosomal regions (> 10 kb).
A conjugation-like process among T. thermophilus cells was reported a decade ago, where chromosomal markers were transferred following a high frequency of recombinants Hfr-like process, as evidenced by interrupted mating assays employing liquid mixes of different strains (Ramírez-Arcos et al., 1998). Recently, the model proposed for Thermus thermophilus describes the transfer as a two-step bidirectional process where a functional competence apparatus is required in the recipient cell but not in the donor, bestowing this phenomenon the name of ‘transjugation’ (Blesa et al., 2015). Compared to liquid mating assays aforementioned, transfer frequencies obtained with the protocol described here are higher and more robust. Higher reproducibility of the assays is reached with this protocol compared to mating tests in liquid. Besides, validation of the conjugative transfer is ensured by the addition of DNase.
Materials and Reagents
Sterile plastic Petri dish plates (standard size; 100 x 15 mm)
Sterile 1.5 ml microcentrifuge tubes (STARSTEDT, catalog number: 72.690.001 )
Sterile tips for micropippettes
Nitrocellulose filters, 0.22 μm (EMD Millipore, catalog number: GSWP02500 )
Donor and recipient Thermus strains, containing selectable markers (i.e., Thermus sp geneA::kat and Thermus sp geneB::hyg)*
Tryptone (Conda, catalog number: 1612 )
Yeast extract (Conda, catalog number: 1702 )
Sodium chloride (NaCl) (EMD Millipore, catalog number: 1.06404.1000 )
Agar (grade A) (Conda, catalog number: 1800 )
Thermus water (carbonate-rich mineral water)
Appropriate thermostable selectable markers (i.e., kanamycin: KmR; Hygromycin: HygR)**
Kanamycin sulphate (Sigma-Aldrich, catalog number: K1377-5G )
Hygromycin B (Sigma-Aldrich, catalog number: BH7772-1G )
DNase I, grade II from bovine pancreas (1 mg/ml) and its buffer solution (Roche Diagnostics, catalog number: 10104159001 )
TB liquid medium (see Recipes)
TB agar plates (see Recipes)
Notes:
*Several Thermus thermophilus strains such as HB27, NAR1 and HB8, have been successfully employed in mating assays (Ramírez-Arcos et al., 1998; César et al., 2011; Blesa et al., 2015). All parental Thermus strains can be acquired at the DSMZ ollection.
**Vectors containing thermostable selectable markers are available at RIKEN repository
Equipment
50 ml Erlenmeyer flask
Rotary shaker incubator reaching 70 °C (150 rpm) (Thermo Scientific, Thermo ScientificTM, catalog number: SHKE 420HP )
Glass plating beads or a spreader
Autoclave device (CertoClav, model: EL 18L )
Tweezers (EMD Millipore, catalog number: XX6200006P )
Vortex Minishaker MS2 (IKA, model: MS2 )
Spectrophotometer (Hitachi, model: U-2000 )
Pipette P2, 0.2-2 μl (Gilson, Pipetman classicTM, catalog number: F144801 )
Pipette P20, 2-20 μl (Gilson, Pipetman classicTM, catalog number: F123600 )
Pipette P100, 20-100 μl (Gilson, Pipetman classicTM, catalog number: F123615 )
Pipette P200, 50-200 μl (Gilson, Pipetman classicTM, catalog number: F123601 )
70 °C heater (Gemini, model: Memmert UE400 )
Bench-top microcentrifuge with rotor for 1.5 ml microcentrifuge tubes (Eppendorf, model: Mini Spin® plus )
Humid chambers
Notes:
Tupperware devices are preferentially used. Humidified plastic bags are also valid.
Addition of a paper towel, soaked on Thermus water and laid on the bottom of the chamber would enhance humidity maintenance. Ventilation should be avoided in order to conserve humidity. An example is provided in the photographs beneath (Figure 1).
Figure 1. Humid chambers. Descriptive photographs of the humid chambers used to incubate Thermus plates. Place a piece of paper soaked with Thermus water and a bottle cap filled with the same water on the bottom of the chambers to maintain high humidity.
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Blesa, A. and Berenguer, J. (2016). Cell-to-cell DNA Transfer among Thermus Species. Bio-protocol 6(22): e2006. DOI: 10.21769/BioProtoc.2006.
Download Citation in RIS Format
Category
Microbiology > Microbial genetics > Transformation
Molecular Biology > DNA > Transformation
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,007 | https://bio-protocol.org/exchange/protocoldetail?id=2007&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Transformation of Thermus Species by Natural Competence
Alba Blesa
JB José Berenguer
Published: Vol 6, Iss 22, Nov 20, 2016
DOI: 10.21769/BioProtoc.2007 Views: 9978
Edited by: Daan C. Swarts
Reviewed by: Maria Sinetova
Original Research Article:
The authors used this protocol in Jan 2015
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jan 2015
Abstract
Many Thermus species harbour genomes scourged with horizontally transferred signatures. Thermus thermophilus (Tth) has been characterized as naturally competent. The transformation protocol described here is based on the maximum DNA uptake rates registered at mid-exponential phase (OD600 0.3-0.4). Here we describe the stepwise protocol followed for transformation of both plasmids and linearized genomic DNA, of which the latter can be employed as an alternative method to electroporation to introduce mutations or to generate gene deletions in Thermus isolates, for instance.
Background
Thermus thermophilus (Tth) is an extreme thermophilic species extensively used as laboratory model, due to its ancient phylogenetic origin, the comparative ease of crystallisation of its proteins and macromolecular complexes, and the fast growth and good yields under laboratory growth conditions of several of its isolates. Among the most commonly employed isolates, the strains T. thermophilus HB27 and HB8 constitute the most frequently used models due to the high rates by which they can be transformed by natural competence. DNA of any source and topology can be easily taken up by growing cells of these isolates at rates of around 40 kb/s/cell (Schwarzenlander and Averhoff, 2006) showing yields of around 10-2 transformants/viable cell. For this, a polar located natural competence apparatus (Gold et al., 2015) involving at least 16 proteins encoded in five loci in the chromosome (Averhoff, 2009) of both strains is expressed essentially in a constitutive way, although the transformation efficiency is higher at exponential phase. Variants of antibiotic resistance genes encoding thermostable variants have been developed by directed evolution as gene markers, in such a way that selection can be performed in plates with kanamycin (Lasa et al., 1992), hygromycin B (Nakamura et al., 2005), or bleomycin (Brouns et al., 2005). Streptomycin resistance can be also employed to check natural competence with isogenic DNA (Koyama et al., 1986). This protocol describes the highly efficient transformation of cultures at exponential growth phase, providing reproducible data of maximized transformation efficiency.
Materials and Reagents
12 ml sterile plastic tubes
15 ml sterile plastic tubes
Sterile plastic Petri dish plates (standard size; 100 x15 mm)
Sterile tips for micropippettes, 5-200 µl (for instance, Daslab, catalog number: 162001 )
Sterile tips for micropippettes, 100-1,000 µl (for instance, Daslab, catalog number: 162222 )
Sterile tips for micropippettes, 10 µl (for instance, Metler Toledo, catalog number: 17004280 )
Recipient Thermus strain, for instance, HB27 wild type (HB27/ATCC BAA-163 /DSM 7039)#
#Note: Other Thermus thermophilus strains such as NAR1 and HB8, have been defined as naturally competent, thus, harboring the competence proteins required for transformation (César et al., 2011). All Thermus spp. strains referred here are available at the DSMZ collection.
Kanamycin sulphate (Sigma-Aldrich, catalog number: K1377-5G )
Tryptone (Conda, catalog number: 1612 )
Yeast extract (Conda, catalog number: 1702 )
Sodium chloride (NaCl) (EMD Millipore, catalog number: 1.06404.1000 )
Agar (grade A) (Conda, catalog number: 1800 )
Thermus water (carbonated-rich mineral water)
DNA template: purified plasmids or genomic DNA** (harbouring the thermostable kat cassette)
**Note: DNA quantity depends on the topology of the DNA to be transformed and the competence of the recipient strain.
TB liquid medium (see Recipes)
TB agar plates (see Recipes)
Equipment
50 ml Erlenmeyer flask
Rotary shaker incubator reaching 70 °C (150 rpm) (Thermo Scientific, Thermo ScientificTM, catalog number: SHKE 420HP )
Glass beads or a spreader
Autoclave device (CertoClav, model: EL 18L )
Spectrophotometer (Hitachi, model: U-2000 )
Pipette P2, 0.2-2 μl (Gilson, Pipetman classicTM, catalog number: F144801 )
Pipette P20, 2-20 μl (Gilson, Pipetman classicTM, catalog number: F123600 )
Pipette P100, 20-100 μl (Gilson, Pipetman classicTM, catalog number: F123615 )
Pipette P200, 50-200 μl (Gilson, Pipetman classicTM, catalog number: F123601 )
70 °C heater (Gemini, model: Memmert UE400 )
Humid chambers
Note: Tupperware devices are preferentially used. Humidified plastic bags are also valid. Addition of a paper towel, soaked on Thermus water and laid on the bottom of the chamber would enhance humidity maintenance. Ventilation should be avoided in order to conserve humidity. An example is provided in the photographs beneath (Figure 1).
Figure 1. Humid chambers. Descriptive photographs of the humid chambers used to incubate Thermus plates. Place a piece of paper soaked with Thermus water and a bottle cap filled with the same water on the bottom of the chambers to maintain high humidity.
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Blesa, A. and Berenguer, J. (2016). Transformation of Thermus Species by Natural Competence. Bio-protocol 6(22): e2007. DOI: 10.21769/BioProtoc.2007.
Download Citation in RIS Format
Category
Microbiology > Microbial genetics > Transformation
Molecular Biology > DNA > Transformation
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,008 | https://bio-protocol.org/exchange/protocoldetail?id=2008&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Establishment of Patient-Derived Xenografts in Mice
Dongkyoo Park
Dongsheng Wang
Guo Chen
Xingming Deng
Published: Vol 6, Iss 22, Nov 20, 2016
DOI: 10.21769/BioProtoc.2008 Views: 14119
Reviewed by: Clara Lubeseder-Martellato
Original Research Article:
The authors used this protocol in Jun 2015
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jun 2015
Abstract
Patient-derived xenograft (PDX) models for cancer research have recently attracted considerable attention in both the academy and industry (Hidalgo et al., 2014; Wilding and Bodmer, 2014). PDX models have been developed from different tumor types including lung cancer to improve the drug development process. These models are used for pre-clinical drug evaluation and can be used for the predictive results of clinical outcomes because they conserve original tumor characteristics such as heterogeneity, complexity and molecular diversity (Kopetz et al., 2012). Additionally, PDX model provides the potential tool for the personalized drug therapy. In this protocol, we present methods for the establishment of PDX in mice using primary tumor tissues from patients with small cell lung cancer (SCLC).
Materials and Reagents
Sterile alcohol prep pads (Covidien, catalog number: 6818 )
Petri dishes (Corning, Falcon®, catalog number: 353003 )
Tissue adhesive (3M, catalog number: 1469SB )
6 weeks old SCID mice (Charles River Laboratories International, catalog number: 236 ) or athymic nude mice (Envigo, catalog number: 069 )
Ketamine hydrochloride/xylazine hydrochloride solution (Sigma-Aldrich, catalog number: K113 )
Phosphate-buffered saline (PBS) (Mediatech, catalog number: 21-040-CV )
70% ethanol (Decon Labs, catalog number: 2401 )
Equipment
Stainless steel sterile scalpels (Integra LifeSciences, Miltex®, catalog number: 4-423 )
Operating scissors (Sklar Surgical Instruments, catalog number: 13-1045 )
Micro dissecting forceps (Roboz Surgical Instrument, catalog number: RS-5135 )
Biological safety cabinet (Labconco, catalog number: 3460001 )
CO2 chamber in animal facility
Heating pad (Sunbeam Products, catalog number: 000765-500-000 )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Park, D., Wang, D., Chen, G. and Deng, X. (2016). Establishment of Patient-Derived Xenografts in Mice. Bio-protocol 6(22): e2008. DOI: 10.21769/BioProtoc.2008.
Download Citation in RIS Format
Category
Cancer Biology > Invasion & metastasis > Animal models
Cancer Biology > General technique > Tumor formation
Immunology > Animal model > Mouse
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,009 | https://bio-protocol.org/exchange/protocoldetail?id=2009&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Assay to Evaluate BAL Fluid Regulation of Fibroblast α-SMA Expression
Jennifer L. Larson-Casey
AC A. Brent Carter
Published: Vol 6, Iss 22, Nov 20, 2016
DOI: 10.21769/BioProtoc.2009 Views: 8054
Edited by: Ivan Zanoni
Reviewed by: Achille BroggiBenoit Stijlemans
Original Research Article:
The authors used this protocol in Mar 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Mar 2016
Abstract
Because transforming growth factor-β (TGF-β1) induces differentiation of fibroblasts to myofibroblasts, we developed a protocol to evaluate alveolar macrophage-derived TGF-β1 regulation of lung fibroblast differentiation (Larson-Casey et al., 2016). The protocol evaluates the ability of mouse bronchoalveolar lavage (BAL) fluid to alter fibroblast differentiation. Fibroblast differentiation was measured by the expression of α-smooth muscle actin (α-SMA).
Background
Alveolar macrophages play an integral role in pulmonary fibrosis development by increasing the expression of TGF-β1 (He et al., 2011). Our prior data demonstrate that alveolar macrophages are a critical source of TGF-β1 as mice harboring a conditional deletion of TGF-β1 in macrophages were protected from pulmonary fibrosis (Larson-Casey et al., 2016). The expression of α-SMA is a defining feature of myofibroblasts, and TGF-β1 is a well-characterized pro-fibrotic mediator that induces transformation of fibroblasts to myofibroblasts both in vitro (Desmoulière et al., 1993) and in vivo (Sime et al., 1997). Prior studies exposed fibroblasts to recombinant TGF-β1 to show its effect on differentiation and function (Horowitz et al., 2007). Here we have developed a protocol for determining the ability of mouse BAL fluid to alter the differentiation of human lung fibroblasts to myofibroblasts, the cells that produce extracellular matrix proteins.
Materials and Reagents
6-well cell culture plates (Corning, Costar®, catalog number: 3516 )
Normal human fibroblasts (IMR-90) (ATCC, catalog number: CCL-186 )
DMEM
Fetal bovine serum (FBS) (Thermo Fisher Scientific, GibcoTM, catalog number: 26140095 )
Penicillin-streptomycin (10,000 U/ml, 10,000 µg/ml) (Thermo Fisher Scientific, GibcoTM, catalog number: 15140122 )
Amphotericin B (Thermo Fisher Scientific, GibcoTM, catalog number: 15290018 )
RPMI 1640 medium, no phenol red (Thermo Fisher Scientific, GibcoTM, catalog number: 11835030 )
DPBS (Thermo Fisher Scientific, GibcoTM, catalog number: 14190144 )
NP-40
Sodium chloride (NaCl)
Protease inhibitor tablets (Sigma-Aldrich, catalog number: 11836170001 )
Phosphatase inhibitor (EMD Millipore, catalog number: 524625 )
α-SMA antibody (American Research Products, catalog number: 03-61001 )
β-actin antibody (Sigma-Aldrich, catalog number: A5441 )
Tween 20
Fibroblast culture media (see Recipes)
Lysis buffer (see Recipes)
Equipment
Cell culture incubator, 37 °C, 5% CO2: 95% air atmosphere (Thermo Fisher Scientific, FormaTM, model: Direct Heat CO2 Incubator )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Larson-Casey, J. L. and Carter, A. B. (2016). Assay to Evaluate BAL Fluid Regulation of Fibroblast α-SMA Expression. Bio-protocol 6(22): e2009. DOI: 10.21769/BioProtoc.2009.
Download Citation in RIS Format
Category
Immunology > Immune cell function > Macrophage
Biochemistry > Protein > Activity
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
201 | https://bio-protocol.org/exchange/protocoldetail?id=201&type=1 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Purification of Adenovirus by Cesium Chloride Density Gradients
HP Huan Pang
Published: Apr 5, 2012
DOI: 10.21769/BioProtoc.201 Views: 34161
Download PDF
Ask a question
Favorite
Cited by
Abstract
Adenovirus are efficient gene delivery systems. The standard method for purification of adenoviral vectors is based on using a cesium chloride (CsCl) density gradient combined with ultracentrifugation. This method is suitable for small-scale purification and is less expensive than column chromatography or commercial purification kits.
Materials and Reagents
HEK293 cell
Glycerol
Liquid nitrogen
70% ethanol
Distilled water
SDS
CaCl2
MgCl2
CsCl2 (Thermo Fisher Scientific, catalog number: BP1595-500 )
Tris-HCl (pH 8.0)
TE
EDTA
SDS
Sucrose
5% deoxycholate (see Recipes)
Dialysis buffer (see Recipes)
Balance buffer (see Recipes)
Saturated CsCl2 (see Recipes)
Equipment
Centrifuges
Ultracentrifuge
Laminar flow hood
Syringe
Water bath
Slide-A-Lyzer 10 K dialysis cassette (Thermo Fisher Scientific, catalog number: 66203 )
Spectrometer
Ti50.2 tube
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2012 The Authors; exclusive licensee Bio-protocol LLC.
Category
Microbiology > Microbial cell biology > Cell isolation and culture
Microbiology > Microbe-host interactions > Virus
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,010 | https://bio-protocol.org/exchange/protocoldetail?id=2010&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Determination of H2O2 Generation by pHPA Assay
Jennifer L. Larson-Casey
AC A. Brent Carter
Published: Vol 6, Iss 22, Nov 20, 2016
DOI: 10.21769/BioProtoc.2010 Views: 8291
Edited by: Ivan Zanoni
Reviewed by: Achille BroggiPinchas Tsukerman
Original Research Article:
The authors used this protocol in Mar 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Mar 2016
Abstract
The production of reactive oxygen species, including H2O2, is a process that can be used in signaling, cell death, or immune response. To quantify oxidative stress in cells, a fluorescence technique has been modified from a previously described method to measure H2O2 release from cells (Panus et al., 1993; Murthy et al., 2010; Larson-Casey et al., 2016; Larson-Casey et al., 2014; He et al., 2011). This assay takes advantage of H2O2-mediated oxidation of horseradish peroxidase (HRP) to Complex I, which, in turn, oxidizes p-hydroxyphenylacetic acid (pHPA) to a stable, fluorescent pHPA dimer (2,2'-dihydroxy-biphenyl-5,5’ diacetate [(pHPA)2]). The H2O2-dependent HRP-mediated oxidation of pHPA is a sensitive and specific assay for quantifying H2O2 release from cells. This assay can measure H2O2 release from whole cells, mitochondria, or the NADPH oxidase.
Background
H2O2 generation primarily results from dismutation of superoxide anion (O2-), which occurs at a rapid rate (105-106 M-1 s-1) non-enzymatically. Unlike O2-, H2O2 can traverse membranes easily, so it is able to oxidize multiple molecules. ROS can be toxic to cells by oxidizing proteins, lipids, and nucleic acids and are associated with many human diseases. This protocol allows for detection of H2O2 release from NADPH oxidase or mitochondria in various cell types.
Materials and Reagents
NuncTM 96-well black bottom plate (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 137101 )
Eppendorf tubes
15 and 50 ml conical tubes
Glucose (Sigma-Aldrich, catalog number: G7528 )
HEPES (1 M) (Thermo Fisher Scientific, GibcoTM, catalog number: 15630-080 )
Sodium bicarbonate (NaHCO3) (Thermo Fisher Scientific, Fisher Scientific, catalog number: S233-500 )
4-hydroxyphenylacetic acid (pHPA) (Sigma-Aldrich, catalog number: H50004 )
HRP (Sigma-Aldrich, catalog number: P8125 )
Ca2+/Mg2+/phenol red-free HBSS (Thermo Fisher Scientific, GibcoTM, catalog number: 14175-095 )
α-Ketoglutaric acid (Sigma-Aldrich, catalog number: K2000 )
Hydrogen peroxide solution (H2O2) (30%, w/w) (Sigma-Aldrich, catalog number: H1009 )
Tris
EDTA
Sucrose
Protease inhibitor tablets (Sigma-Aldrich, catalog number: 11836170001 )
Phosphatase inhibitors (EMD Millipore, catalog number: 524625 )
Antimycin A (optional)
MitoTempo (optional)
pHPA buffer (see Recipes)
1 mM H2O2 working stock solution (see Recipes)
Mitochondrial buffer (see Recipes)
Equipment
Kontes pellet pestle motor
Centrifuge
Plate reader (Molecular Devices, model: M2 SpectraMax )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Larson-Casey, J. L. and Carter, A. B. (2016). Determination of H2O2 Generation by pHPA Assay. Bio-protocol 6(22): e2010. DOI: 10.21769/BioProtoc.2010.
Download Citation in RIS Format
Category
Immunology > Immune cell function > General
Cell Biology > Cell-based analysis
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,011 | https://bio-protocol.org/exchange/protocoldetail?id=2011&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
This protocol has been corrected. See the correction notice.
Peer-reviewed
In vitro Dephosphorylation Assay of c-Myc
Peng Liao
WW Weichao Wang
XG Xin Ge
Published: Vol 7, Iss 2, Jan 20, 2017
DOI: 10.21769/BioProtoc.2011 Views: 8068
Edited by: HongLok Lung
Reviewed by: Gabriel O. FerreroJianwei Sun
Original Research Article:
The authors used this protocol in Jan 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jan 2016
Abstract
This protocol describes experimental procedures for in vitro dephosphorylation assay of human protein c-Myc. This protocol can be adapted to detect phosphatase activity of other Ser/Thr phosphatases.
Keywords: Dephosphorylation c-Myc SCP1
Background
Carboxy-terminal domain RNA polymerase II polypeptide A small phosphatase 1 (SCP1, also known as CTDSP1 or NLI-IF) belongs to the FCP/SCP phosphatase family and was originally reported to dephosphorylate the C-terminal domain (CTD) of RNA polymerase II (Yeo et al., 2003). Smad2, 3 (Wrighton et al., 2006), Snail (Wu et al., 2009), PML (Lin et al., 2014), and c-Myc (Wang et al., 2016) have also been identified as substrates of SCP1.
Materials and Reagents
1.5 ml Eppendorf tubes
50 ml tube
100 mm dish
E. coli cells
HKE293T cell
HA-c-Myc plasmid
LB medium
IPTG
Glutathione sepharose 4B (GE Healthcare, catalog number: 17075601 )
Glycerol (Sigma-Aldrich, catalog number: G5516 )
PierceTM BCA Protein Assay Kit (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 23225 )
Lipofectamine 2000
c-Myc antibody (Abcam, catalog number: ab32072 )
Protein A/G beads (Santa Cruz Biotechnology, catalog number: sc-2003 )
BSA
Coomassie blue R250 (Sigma-Aldrich, catalog number: 27816 )
c-Myc Ser62 phosphorylation antibody ([Abnova, catalog number: MAB6763 ] or [Abcam, catalog number: ab78318 ])
Sodium hydroxide (NaOH) (Sigma-Aldrich, catalog number: 221465 )
Sodium chloride (NaCl) (Sigma-Aldrich, catalog number: S7653 )
Potassium chloride (KCl)
Disodium hydrogen phosphate (Na2HPO4)
Potassium phosphate monobasic (KH2PO4)
Tris base (C4H11NO3) (Sigma-Aldrich, catalog number: T1503 )
EDTA (Sigma-Aldrich, catalog number: E5134 )
Triton X-100 (Sigma-Aldrich, catalog number: X100 )
Phenylmethanesμlfonyl fluoride (PMSF) (C7H7FO2S) (Sigma-Aldrich, catalog number: P7626 )
cOmplete protease inhibitor cocktail (Roche Diagnostics, catalog number: 04693116001 )
Dithiothreitol (DTT) (Sigma-Aldrich, catalog number: D0632 )
PhosSTOP tablet (Roche Diagnostics, catalog number: 04906845001 )
β-mercaptoethanol
Bromophenol blue
Sodium dodecyl sulfate (SDS)
Magnesium chloride (MgCl2) (Sigma-Aldrich, catalog number: 449172 )
L-Glutathione reduced (Sigma-Aldrich, catalog number: G4251 )
Phosphate-buffered saline (PBS) (see Recipes)
IP lysis buffer (see Recipes)
Phosphatase reaction buffer (see Recipes)
5x SDS loading dye (see Recipes)
GST elution buffer (see Recipes)
Equipment
250 ml flask
Shaker
Cell scraper
Incubator
Centrifuges
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Liao, P., Wang, W. and Ge, X. (2017). In vitro Dephosphorylation Assay of c-Myc. Bio-protocol 7(2): e2011. DOI: 10.21769/BioProtoc.2011.
Download Citation in RIS Format
Category
Cancer Biology > Cancer biochemistry > Protein
Biochemistry > Protein > Activity
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,012 | https://bio-protocol.org/exchange/protocoldetail?id=2012&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
An in vitro Model of Neuron-macrophage Interaction to Generate Macrophages with Neurite Outgrowth Properties
HY Hyeok Jun Yun
BK Byung S. Kim
Published: Vol 6, Iss 22, Nov 20, 2016
DOI: 10.21769/BioProtoc.2012 Views: 8006
Edited by: Soyun Kim
Original Research Article:
The authors used this protocol in Dec 2015
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Dec 2015
Abstract
Macrophages are known to play beneficial roles in axon regeneration after nerve injury. To develop an in vitro model in which injury signals can elicit pro-regenerative macrophage activation, we established co-cultures consisting of adult dorsal root ganglia sensory neurons and peritoneal macrophages and added cAMP analogue dibutyryl cAMP. The conditioned medium collected from the co-cultures exhibited robust neurite outgrowth activities. The neurite outgrowth activities were almost completely abrogated by addition of minocycline, a macrophage deactivator, indicating that factors responsible for neurite outgrowth are produced by activated macrophages.
Background
CNS neurons of adult mammals do not spontaneously regenerate axons after injury. Preconditioning peripheral nerve injury allows the dorsal root ganglia (DRG) sensory axons to regenerate central branches by promoting expression of regeneration-associated genes. We have previously showed that activated macrophages in the DRG following preconditioning injury critically contribute to enhancement intrinsic regeneration capacity of the DRG sensory neuron (Kwon et al., 2013). To identify molecular factors involved in the activation of macrophages following nerve injury, we have developed an in vitro model in which neuron-macrophages interactions are elicited by cAMP, a well-known reagent to enhance regenerative capacity of neurons. Compared to the previous model to activate macrophages using zymosan, our model utilizes a more physiologic stimulus resembling molecular events in the preconditioning peripheral injury model.
Materials and Reagents
1.5 ml Eppendorf tubes
15 ml conical tube
Cell culture insert with 0.4 μm transparent PET membrane (Corning, Falcon®, catalog number: 353090 )
70 μm nylon cell strainer (Corning, Falcon®, catalog number: 352350 )
50 ml conical tube
6 well plate
0.2 μm filter (BD)
8-well culture slide (Corning, BiocoatTM, catalog number: 354632 )
Dulbecco’s modified Eagle medium (DMEM) (GE Healthcare, HycloneTM, catalog number: SH30243.01 )
Collagenase from Clostridium histolyticum (Sigma-Aldrich, catalog number: C9407-100MG )
Neurobasal® medium (Thermo Fisher Scientific, GibcoTM, catalog number: 21103-049 )
B-27® supplement (50x), serum free (Thermo Fisher Scientific, GibcoTM, catalog number: 17504-044 )
GlutaMaxTM (Thermo Fisher Scientific, GibcoTM, catalog number: 35050-061 )
Penicillin-streptomycin (10,000 U/ml, 10,000 µg/ml) (Thermo Fisher Scientific, GibcoTM, catalog number: 15140-122 )
Poly-D-lysine hydrobromide (Sigma-Aldrich, catalog number: P6407-5MG )
Laminin (Thermo Fisher Scientific, GibcoTM, catalog number: 23017-015 )
Phosphate-buffered saline (PBS) (GE Healthcare, HycloneTM, catalog number: SH30256.01 )
Red blood cell lysis buffer (QIAGEN, catalog number: 158904 )
10% FBS (GE Healthcare, HycloneTM, catalog number: SH30919.03 )
Adenosine 3’,5’-cyclic monophosphate, N6,O2’-dibutyryl-, sodium salt (db-cAMP; 100 μM) (EMD Millipore, Calbiochem®, catalog number: 28745 )
Minocycline (Sigma-Aldrich, catalog number: M9511 )
Paraformaldehyde-13C (Sigma-Aldrich, catalog number: 604380 )
Normal goat serum (Thermo Fisher Scientific, GibcoTM, catalog number: 16210072 )
Triton X-100 (DAEJUNG CHEMICAL & MITALS, catalog number: 8566-4405 )
Goat anti-mouse IgG (H + L) secondary antibody, Alexa Fluor® 594 conjugate (Thermo Fisher Scientific, InvitrogenTM, catalog number: A11005 )
Anti β III tubulin (Tuj-1) (Promega, catalog number: G7121 )
Neuron culture medium (see Recipes)
Macrophage culture medium (see Recipes)
Equipment
Fine scissors
Fine forceps
Hemacytometer (Marienfeld-Superior)
Dissecting stereomicroscope (Carl Zeiss, model: Stemi DV4 )
Cell culture CO2 incubator (Panasonic)
Twist shaker (FINEPCR, model: Twist shaker Tw3t )
Tabletop centrifuge (Sorvall)
Pipette-aid
Confocal microscope (Olympus, model: IX71 )
Software
ImageJ (http://rsbweb.nih.gov/ij/index.html)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
How to cite： Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Yun, H. J. and Kim, B. S. (2016). An in vitro Model of Neuron-macrophage Interaction to Generate Macrophages with Neurite Outgrowth Properties. Bio-protocol 6(22): e2012. DOI: 10.21769/BioProtoc.2012.
Kwon, M. J., Shin, H. Y., Cui, Y., Kim, H., Thi, A. H., Choi, J. Y., Kim, E. Y., Hwang, D. H. and Kim, B. G. (2015). CCL2 mediumtes neuron-macrophage interactions to drive proregenerative macrophage activation following preconditioning injury. J Neurosci 35(48): 15934-15947.
Download Citation in RIS Format
Category
Neuroscience > Cellular mechanisms > Cell isolation and culture
Cell Biology > Cell isolation and culture
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,013 | https://bio-protocol.org/exchange/protocoldetail?id=2013&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Isolation of Highly Pure Primary Mouse Alveolar Epithelial Type II Cells by Flow Cytometric Cell Sorting
Meenal Sinha
Clifford A. Lowell
Published: Vol 6, Iss 22, Nov 20, 2016
DOI: 10.21769/BioProtoc.2013 Views: 25616
Edited by: Fanglian He
Reviewed by: Hongwei Han
Original Research Article:
The authors used this protocol in Jun 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jun 2016
Abstract
In this protocol, we describe the method for isolating highly pure primary alveolar epithelial type II (ATII) cells from lungs of naïve mice. The method combines negative selection for a variety of lineage markers along with positive selection for EpCAM, a pan-epithelial cell marker. This method yields 2-3 x 106 ATII cells per mouse lung. The cell preps are highly pure and viable and can be used for genomic or proteomic analyses or cultured ex vivo to understand their roles in various biological processes.
Background
The internal surfaces of lungs are lined by epithelial cells, the type of epithelial cell varying morphologically and functionally with the location within the lung. ATII cells are one of the two types of epithelial cells that line the alveolar walls and have been described to play critical roles in surfactant synthesis and secretion. They are also part of the first line of defense within the lung and are involved in initiating and modulating immune responses during pulmonary infection or allergy. They are also thought to act as progenitor cells in the distal lung with proliferative capacity and the ability to repair the epithelium after injury. Available methods of ATII isolation did not yield cell preps that were more than 80-85% pure, making them unsuitable for reliable analyses of mRNA and protein expression. The method described here is an improvement over prior methods and yields mouse primary ATII cell preps with the highest purity that can thus be reliably used for expression analyses. For further discussion on the method, we refer the reader to the original publication from where this protocol originates (Sinha et al., 2016).
Materials and Reagents
C57BL/6 mice (Charles River Laboratories, strain code: 027)
2,2,2-tribromoethanol (Avertin) (Sigma-Aldrich, catalog number: T48402 )
tert-Amyl alcohol (Sigma-Aldrich, catalog number: 240486 )
70% ethanol (Decon Labs, catalog number: V1401 )
1 ml slip-tip syringe (important to not use a Luer-LokTM tip syringe) (BD, catalog number: 309659 )
10 ml syringe (BD, Luer-LokTM, catalog number: 309604 )
25 G x 5/8 inch needle (BD, catalog number: 305122 )
20 G x 1.16 inch angiocatheter (BD, AngiocathTM, catalog number: 381134 )
Surgical silk suture 3-0 (Henry Schein, catalog number: 100-7842 )
70 μm cell strainer (Corning, catalog number: 431751 )
40 μm cell strainer (Corning, catalog number: 352340 )
20 μm nylon mesh (Spectrum, catalog number: 146510 )
Kimwipes (Thermo Fisher Scientific, Fisher Scientific, catalog number: 06-666A )
5 ml polypropylene tubes (Corning, Falcon®, catalog number: 352063 )
15 ml tubes (Corning, catalog number: 430052 )
50 ml conical tube (Corning, catalog number: 430290 )
Non TC-treated 10 cm Petri dish (Corning, catalog number: 430591 )
D-PBS (without Ca2+ and Mg2+, no phenol) (Thermo Fisher Scientific, catalog number: 14190250 )
0.5 M EDTA, pH 8.0 (Thermo Fisher Scientific, InvitrogenTM, catalog number: 15575020 )
Dispase II (neutral protease, grade II) (Sigma-Aldrich, catalog number: 4942078001 )
Low melting point agarose (Sigma-Aldrich, catalog number: A9419 )
DMEM (Thermo Fisher Scientific, GibcoTM, catalog number: 11965-092 )
Penicillin-streptomycin (10,000 U/ml) (Thermo Fisher Scientific, GibcoTM, catalog number: 15140122 )
1 M HEPES (Thermo Fisher Scientific, GibcoTM, catalog number: 15630080 )
ACK lysis buffer (Lonza, catalog number: 10-548E )
Biotinylated anti-mouse CD45, clone 30-F11, 0.5 mg/ml (Affymetrix, eBioscience, catalog number: 13-0451-85 )
Biotinylated anti-mouse CD16/32, clone 2.4G2, 0.5 mg/ml (BD, PharmingenTM, catalog number: 553143 )
Biotinylated anti-mouse CD31, clone MEC13.3, 0.5 mg/ml (Biolegend, catalog number: 102504 )
Biotinylated anti-mouse TER119, clone TER119, 0.5 mg/ml (Affymetrix, eBioscience, catalog number: 13-5921-85 )
Biotinylated anti-mouse Integrin β4, clone 346-11A, 0.5 mg/ml (Biolegend, catalog number: 12603 )
Anti-mouse EpCAM-APC, clone G8.8, 0.2 mg/ml (Affymetrix, eBioscience, catalog number: 17-5791-82 )
Dynabeads® MyOneTM streptavidin T1 magnetic beads (Thermo Fisher Scientific, InvitrogenTM, catalog number: 65601 )
Streptavidin-PE, 0.5 mg/ml (BD, PharmingenTM, catalog number: 554061 )
Rabbit anti-pro-SP-C, polyclonal serum (EMD Millipore, catalog number: AB3786 )
DNase I (Sigma-Aldrich, catalog number: D5025 )
Fetal bovine serum (FBS) (Thermo Fisher Scientific, GibcoTM, catalog number: 26140 )
DAPI (Thermo Fisher Scientific, Molecular ProbesTM, catalog number: D1306 )
Avertin solution (100% stock working solution) (see Recipes)
Avertin solution (2.5% stock working solution) (see Recipes)
Dispase solution (see Recipes)
1% Low melting agarose (see Recipes)
Complete DMEM (see Recipes)
DNase I solution (see Recipes)
Sort buffer (see Recipes)
Equipment
Fine-tipped small scissors (Roboz surgical instrument company, catalog number: RS-5910 )
Fine forceps (Roboz surgical instrument company, catalog number: RS-5211 )
Horizontal platform orbital rocker (VWR, catalog number: 40000-300 )
Tube rotator (Thermo Fisher Scientific, catalog number: 400110Q )
Orbital incubator-shaker (VWR, catalog number: 10027-214 )
Biosafety cabinet (VWR, catalog number: 89413-126 )
Stratalinker (Stratagene, model: 1800 )
DynaMagTM-2 magnetic separator (Thermo Fisher Scientific, catalog number: 12321D )
FACS Aria cell sorter (BD, model: BD FACSARIA III )
Software
FACS Diva (BD Biosciences)
FlowJo (TreeStar)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Sinha, M. and Lowell, C. A. (2016). Isolation of Highly Pure Primary Mouse Alveolar Epithelial Type II Cells by Flow Cytometric Cell Sorting. Bio-protocol 6(22): e2013. DOI: 10.21769/BioProtoc.2013.
Download Citation in RIS Format
Category
Immunology > Immune cell isolation > Maintenance and differentiation
Immunology > Immune cell staining > Flow cytometry
Cell Biology > Cell isolation and culture > Cell isolation
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,014 | https://bio-protocol.org/exchange/protocoldetail?id=2014&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Analysis of Phagosomal Antigen Degradation by Flow Organellocytometry
Eik Hoffmann
Anne-Marie Pauwels
Andrés Alloatti
FK Fiorella Kotsias
SA Sebastian Amigorena
Published: Vol 6, Iss 22, Nov 20, 2016
DOI: 10.21769/BioProtoc.2014 Views: 8035
Original Research Article:
The authors used this protocol in Dec 2015
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Dec 2015
Abstract
Professional phagocytes internalize self and non-self particles by phagocytosis to initiate innate immune responses. After internalization, the formed phagosome matures through fusion and fission events with endosomes and lysosomes to obtain a more acidic, oxidative and hydrolytic environment for the degradation of its cargo. Interestingly, phagosome maturation kinetics differ between cell types and cell activation states. This protocol allows to quantify phagosome maturation kinetics on a single organelle level in different types of phagocytes using flow cytometry. Here, ovalbumin (OVA)-coupled particles are used as phagocytosis model system in dendritic cells (DC), which are internalized by phagocytosis. After different time points, phagosome maturation parameters, such as phagosomal degradation of OVA and acquisition of lysosomal proteins (like LAMP-1), can be measured simultaneously in a highly quantitative manner by flow organellocytometry. These read-outs can be correlated to other phagosomal functions, for example antigen degradation, processing and loading in DC.
Background
In innate immunity, professional phagocytes such as dendritic cells (DC), macrophages and neutrophils recognize and internalize different types of particles by phagocytosis including pathogens and dead cells (Flannagan et al., 2012). Intra-phagosomal degradation of these particles by fission and fusion events with endosomal and lysosomal compartments allow either clearance and complete destruction of phagosomal cargo or partial degradation and processing of phagosomal antigens for presentation to T lymphocytes. Different parameters of phagosome maturation, such as acidification, oxidation and proteolysis, dictate phagosomal fate and influence the initiation of different immune responses (Kinchen and Ravichandran, 2008). In particular, the type of involved phagocytes, specific recognition of pathogen-associated molecular patterns (such as LPS) or danger-associated molecular patterns (such as HMGB1) on the surface of the particle as well as the influence of cellular and phagosomal signal transduction determine strength and duration of phagosomal antigen degradation (Savina and Amigorena, 2007).
This protocol was developed to follow antigen degradation kinetics on the single phagosome level in a highly quantitative fashion by flow organellocytometry. It is based on a method previously published by our lab using antigen-coupled polystyrene beads as phagocytosis model system (Savina et al., 2010). Due to their physical properties, bead-containing phagosomes can be distinguished from other cell organelles of similar size during flow cytometry. Therefore, phagosomal antigen degradation can be measured directly without previous organelle fractionation and purification methods. Another major advantage of this protocol over many other protocols is the fact that it allows to distinguish between internalized beads within phagosomes and particles bound on the outside of the cell, which were not phagocytosed. This protocol was used previously for the characterization of phagosomal antigen degradation in bone marrow-derived DC (BMDC) (Hoffmann et al., 2012; Alloatti et al., 2015) as well as in splenic DC (Alloatti et al., 2015). However, other phagocyte types and different antigen sources can be used as well for the investigation of antigen degradation kinetics in phagosomes. The approach described below is adapted to BMDC and ovalbumin (OVA)-coupled particles as phagosomal cargo.
Materials and Reagents
Note: The entire method is performed with sterile pyrogen-free dishes and plates, pipettes, tips, microfuge and conical tubes. All media and buffers need to be filtered through 0.22 μm filters.
Petri dish, 145 x 20 mm (Greiner Bio One, catalog number: 639161 )
2 ml tubes
15 ml centrifuge tube
U-bottom 96-well storage plate (Corning, Falcon®, catalog number: 353077 )
V-bottom 96-well storage plate (Corning, Falcon®, catalog number: 353263 )
2 ml sterile syringe (Henke Sass Wolf, catalog number: 4020.000V0 )
22 G sterile needle, 0.7 x 40 mm (Terumo Europe, catalog number: NN-2238R )
Mice: C57BL/6J (Janvier Labs)
Particles: amine-modified polystyrene microspheres, 3 μm diameter (Polysciences, catalog number: 17145-5 )
Dulbecco’s phosphate-buffered saline, no calcium, no magnesium (DPBS) (Thermo Fisher Scientific, GibicoTM, catalog number: 14190094 )
Glutaraldehyde, 25% (vol/vol), EM grade (Electron Microscopy Sciences, catalog number: 16220 )
Low endotoxin ovalbumin (OVA) (Worthington Biochemical, catalog number: LS003062 )
Glycine, 0.5 M in PBS (Biosolve, catalog number: 07132391 )
CO2-independent medium (Thermo Fisher Scientific, GibcoTM, catalog number: 18045088 )
Glutamax supplement (100x) (Thermo Fisher Scientific, GibcoTM, catalog number: 35050061 )
Iscove’s modified Dulbecco’s medium (IMDM) (Thermo Fisher Scientific, GibcoTM, catalog number: 31980030 )
Low endotoxin fetal bovine serum (FBS, heat-inactivated for 20 min at 56 °C) (Biowest, catalog number: S1860 )
β-mercaptoethanol (50 mM) (Thermo Fisher Scientific, GibcoTM, catalog number: 31350010 )
Penicillin-streptomycin (10,000 U/ml) (Thermo Fisher Scientific, GibcoTM, catalog number: 15140122 )
Bovine serum albumin (BSA) (Sigma-Aldrich, catalog number: A4503 )
Anti-chicken egg albumin (OVA antibody) (Sigma-Aldrich, catalog number: C6534 )
Purified rat anti-mouse CD16/CD32 monoclonal antibody (Fc block) (BD, PharmingenTM, catalog number: 553142 )
Anti-mouse LAMP-1 antibody, biotin conjugate (Affymetrix, eBioscience, catalog number: 13-1071-82 )
Goat anti-rabbit IgG (H+L) antibody, DyLight 633 conjugate (Thermo Fisher Scientific, InvitrogenTM, catalog number: 35562 )
Goat anti-rabbit IgG (H+L) antibody, Alexa Fluor 568 conjugate (Thermo Fisher Scientific, InvitrogenTM, catalog number: A11036 )
Streptavidin, Alexa Fluor® 488 conjugate (Thermo Fisher Scientific, Molecular ProbesTM, catalog number: S11223 )
Imidazole (Sigma-Aldrich, catalog number: I-0250 )
Sucrose (EMD Millipore, catalog number: 107651 )
Phenylmethanesulfonyl fluoride (PMSF) (Sigma-Aldrich, catalog number: P-7626 )
EDTA-free protease inhibitor cocktail (Sigma-Aldrich, catalog number: 11873580001 )
Dithiothreitol (DTT) (EMD Millipore, catalog number: 233155 )
Trypan blue solution, 0.4% (wt/vol) (MP Biomedicals, catalog number: 0916910 )
Internalization medium (see Recipes)
BMDC culture medium (see Recipes)
Homogenization buffer (see Recipes)
Equipment
Vortex
Refrigerated centrifuge for tubes of 2 ml, 15 ml and 50 ml size as well as 96-well plates
Tissue culture incubator adjusted to 37 °C and 5% CO2
Stuart test tube rotator wheel tolerating 4 °C (Bibby Scientific, model: SB3 )
Temperature-controlled water bath
Pipets
Tissue culture light microscope equipped with bright field and 20x objective
Multi-channel pipet
LSR II flow cytometer (BD) or any other multicolour flow cytometer
Software
FlowJo software (FlowJo, LLC.)
Prism 6 software (GraphPad Software, Inc.)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Hoffmann, E., Pauwels, A., Alloatti, A., Kotsias, F. and Amigorena, S. (2016). Analysis of Phagosomal Antigen Degradation by Flow Organellocytometry. Bio-protocol 6(22): e2014. DOI: 10.21769/BioProtoc.2014.
Download Citation in RIS Format
Category
Immunology > Immune cell function > Dendritic cell
Cell Biology > Cell-based analysis > Flow cytometry
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,015 | https://bio-protocol.org/exchange/protocoldetail?id=2015&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Evaluation of Cross-presentation in Bone Marrow-derived Dendritic Cells in vitro and Splenic Dendritic Cells ex vivo Using Antigen-coated Beads
Andrés Alloatti
FK Fiorella Kotsias
Eik Hoffmann
SA Sebastian Amigorena
Published: Vol 6, Iss 22, Nov 20, 2016
DOI: 10.21769/BioProtoc.2015 Views: 11093
Edited by: Ivan Zanoni
Reviewed by: Per AndersonShanie Saghafian-Hedengren
Original Research Article:
The authors used this protocol in Dec 2015
Download PDF
Ask a question
Favorite
Cited by
Original research article
The authors used this protocol in:
Dec 2015
Abstract
Antigen presentation by MHC class I molecules, also referred to as cross-presentation, elicits cytotoxic immune responses. In particular, dendritic cells (DC) are the most proficient cross-presenting cells, since they have developed unique means to control phagocytic and degradative pathways.
This protocol allows the evaluation of antigen cross-presentation both in vitro (by using bone marrow-derived DC) and ex vivo (by purifying CD8+ DC from spleen after incorporation of particulate antigen) using ovalbumin (OVA)-coupled particles. Cross-presentation efficiency is measured by three different readouts: the B3Z hybridoma T cell line (Karttunen et al., 1992) and stimulation of antigen-specific CD8+ T cells (OT-I) (Kurts et al., 1996), either analyzing OT-I activation by CD69 expression or OT-I proliferation after labeling them with carboxyfluorescein succinimidyl ester (CFSE). By using this approach, we could show recently that DCs are able to increase cross-presentation efficiency transiently upon engagement of TLR4 (Alloatti et al., 2015).
Background
In mouse, antigen-presenting cells (APC) are able to take up exogenous antigens to process them and to load peptides derived from such exogenous antigens onto major histocompatibility complex (MHC) class I molecules. Peptide-MHC I complexes are subsequently transported to the plasma membrane, where they might be presented to CD8+ T cells thereby promoting T cell activation, a process referred to as cross-presentation (Joffre et al., 2012). Among the different APC, dendritic cells (DC) excel at cross-presentation and comprise of different subpopulations expressing the XCR1 marker, which have been shown to cross-present antigens very efficiently (i.e., CD8+ resident DC from spleen and CD103+ migratory DC from skin and lung) (Dorner et al., 2009; Crozat et al., 2011). While the purification of DC residing in spleen or migratory DC is feasible, it is laborious and expensive. In order to study the cell biology of DC, primary cultures of bone marrow-derived DC (BMDC) can be easily differentiated from myeloid progenitors by culturing them with GM-CSF. Even though BMDC cannot be associated with any particular DC subtype (perhaps inflammatory DC), they constitute a valuable tool to study the main characteristics of DC cell biology. Herein, we introduce a detailed protocol to analyze cross-presentation of particulate antigen by BMDC, but also by CD8+ splenic DC. Although previous protocols included different antigen forms and read-outs, the protocol described here aims to analyze cross-presentation in a comprehensive and concise way in different DC types.
Materials and Reagents
2 ml Eppendorf tubes
15 ml centrifuge tubes
50 ml centrifuge tubes
14 ml tubes
FisherbrandTM cell strainer (Thermo Fisher Scientific, Fisher Scientific, catalog number: 22-363-548 )
Pre-separation filters (30 μm) (Miltenyi Biotec, catalog number: 130-041-407 )
1 ml insulin syringes (Terumo Medical, catalog number: SS+01H1 )
2.5 ml syringes
25 G needles (Terumo, catalog number: AN*2516R1 )
Non-treated 96-well plates (Coring, Falcon®, round bottom, catalog number: 351177 )
Non-treated 6-well plates (Sigma-Aldrich, catalog number: M8562-100EA )
Non-treated Petri dish, 145 x 20 mm (Greiner Bio One, catalog number: 639161 )
Mice: C57BL/6 and C57BL/6 recombination activating gene 1-deficient OT-I TCR (Vα2, Vβ5) transgenic mice were obtained from Charles River Laboratories (CDTA, Orleans, France)
B3Z T cell line (a Kb-restricted, OVA-specific CD8+ T cell hybridoma) (Kurts et al., 1996)
Low endotoxin OVA (50 mg/ml stock) (Worthington Biochemical, catalog number: LS003062 )
OVA peptide 257-264 (SIINFEKL) (Polypeptide, catalog number: SC1302 )
Polybead® polystyrene 3.0 micron microspheres (Polysciences, catalog number: 17134 )
Polybead® dyed blue 1.0 micron microspheres (Polysciences, catalog number: 15712 )
PBS (1x, pH 7.4) (Thermo Fisher Scientific, GibcoTM, catalog number: 10010-023 )
Glycine (Sigma-Aldrich, catalog number: 50046 )
Glutaraldehyde (25%) (Sigma-Aldrich, catalog number: G5882 )
Iscove’s modified Dulbecco’s medium (IMDM) (Sigma-Aldrich, catalog number: I3390-500ML )
Penicillin-streptomycin (10,000 U/ml) (Thermo Fisher Scientific, GibcoTM, catalog number: 15140122 )
RPMI with GlutaMAXTM (Thermo Fisher Scientific, catalog number: 61870-010 )
GlutaMAXTM supplement (100x) (Thermo Fisher Scientific, GibcoTM, catalog number: 35050061 )
β-mercaptoethanol (Thermo Fisher Scientific, GibcoTM, catalog number: 21985-023 )
MEM non-essential amino acids solution (100x) (Thermo Fisher Scientific, GibcoTM, catalog number: 11140050 )
Sodium pyruvate (100 mM) (Thermo Fisher Scientific, GibcoTM, catalog number: 11360070 )
CPRG (Roche Diagnostics, catalog number: 10884308001 )
Fixable viability dye eFluor 780 (dilution 1/10,000) (Affymetrix, eBioscience, catalog number: 65-0865-14 )
Low endotoxin fetal bovine serum (FBS, heat-inactivated for 20 min at 56 °C) (Biowest, catalog number: S1860 )
Low endotoxin BSA (fraction V) (Euromedex, catalog number: UA1315 )
CFSE (Thermo Fisher Scientific, Molecular ProbesTM, catalog number: C34554 )
Liberase TM (Roche Diagnostics, catalog number: 05401119001 )
DNase I (Roche Diagnostic, catalog number: 04536282001 )
Red blood cell lysis buffer (Sigma-Aldrich, catalog number: R7757 )
EasySepTM Mouse Pan-DC Enrichment Kit (STEMCELL Technologies, catalog number: 19763 )
EasySepTM Mouse Naïve CD8+ T Cell Isolation Kit (STEMCELL Technologies, catalog number: 19858 )
FACS antibodies (all anti-mouse):
CD69-eFluor® 450 (clone H1.2F3, dilution 1/300) (Affymetrix, eBioscience, catalog number: 48-0691-82 )
CD8a-PerCP-Cy5.5 (clone 53-6.7, dilution 1/300) (Affymetrix, eBioscience, catalog number: 45-0081-82 )
TCR vβ 5.1-PE (clone MR9-4, dilution 1/500) (BD, PharmingenTM, catalog number: 553190 )
CD25-FITC (clone 7D4, dilution 1/200) (BD, PharmingenTM, catalog number: 553072 )
CD4-PE-Cy7 (clone RM4-5, dilution 1/300) (BD, PharmingenTM, catalog number: 552775 )
CD25-APC (clone PC61.5, dilution 1/300) (Affymetrix, eBioscience, catalog number: 17-0251-81 )
CD19 eFluor® 450 (clone 1D3, dilution 1/500) (Affymetrix, eBioscience, catalog number: 48-0193 )
CD3 eFluor® 450 (clone 17A2, dilution 1/500) (Affymetrix, eBioscience, catalog number: 48-0032-80 )
CD11c-FITC (clone HL3, dilution 1/500) (BD, PharmingenTM, catalog number: 553801 )
CD11c-APC (clone N418, dilution 1/400) (Affymetrix, eBioscience, catalog number: 17-0114 )
CD8-PE (clone 53-6.7, dilution 1/500) (BD, PharmingenTM, catalog number: 553032 )
CD11b-PE (clone M1/70, dilution 1/300) (Affymetrix, eBioscience, catalog number: 12-0112 )
CD40-PE (clone 3/23, dilution 1/150) (BD, PharmingenTM, catalog number: 553791 )
CD86-PE (clone GL1, dilution 1/300) (Affymetrix, eBioscience, catalog number: 12-0862 )
MHC Class II I-Ab-PE (clone AF6-120.1, dilution 1/300) (Affymetrix, eBioscience, catalog number: 12-5320 )
BMDC culture medium (see Recipes)
B3Z and T cell culture (see Recipes)
Digestion medium for spleens (see Recipes)
MACS buffer (see Recipes)
Equipment
Incubator (37 °C and 5% CO2)
Refrigerated centrifuge for tubes of 2 ml, 15 ml and 50 ml size as well as 96-well plates
Stuart test tube rotator wheel tolerating 4 °C (Bibby Scientific, model: SB3 )
Multicolor flow cytometer (MAQSquant, Miltenyi; FACSverse, Becton Dickinson or similar)
Multicolor FACS sorter (for example, BD, model: FACSAria III )
Fluorometric plate reader (OD: 590 nm)
Software
FlowJo 10 software (FlowJo, LLC.)
Prism 6 software (GraphPad Software, Inc.)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
Category
Immunology > Immune cell function > Dendritic cell
Cell Biology > Cell-based analysis > Flow cytometry
Cell Biology > Cell-based analysis
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,016 | https://bio-protocol.org/exchange/protocoldetail?id=2016&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Determining Efficiency and Selectivity of Lipid Extraction by Perturbing Agents from Model Membranes
Michel Lafleur
Alexandre Therrien
Published: Vol 6, Iss 22, Nov 20, 2016
DOI: 10.21769/BioProtoc.2016 Views: 7156
Edited by: Marc-Antoine Sani
Reviewed by: Venkatasalam ShanmugabalajiDaniel Kraus
Original Research Article:
The authors used this protocol in May 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
May 2016
Abstract
Several membrane-perturbing agents extract lipids from membranes and, in some cases, this lipid efflux is lipid specific. In order to gain a better description of this phenomenon and to detail the intermolecular interactions that are involved, a method has been developed to characterize the extent and the specificity of membrane-lipid extraction by perturbing agents. A perturbing agent is incubated with model membranes existing as multilamellar vesicles (MLVs) and subsequently, the remaining MLVs and the small lipid/perturbing agent complexes resulting from the extraction are isolated and analysed to assess the extent and the specificity of the lipid extraction.
Background
Several membrane-perturbing agents extract lipids from membranes; these include proteins, peptides, and detergents. Several of these lipid extractions are fundamental processes in biology. In some cases, the process is lethal; this is the case for some antibacterials that extract lipids from bacterial membranes leading to the death of the cells (Bechinger, 2014; Schaefer et al., 2014). In other systems, this process is vital. For example, ApoA1 is a protein that binds to cells and extracts phospholipids and cholesterol to form nascent high density lipoproteins (HDL), a process critical for the reverse cholesterol transport and therefore playing a pivotal role in the control of atherosclerosis (Strömstedt et al., 2010). It has been shown that some of these lipid extractions are lipid specific; in other words, the lipid composition of the extracted fraction is different than that of the original membranes. It is expected that such specificity will be reported more often considering the recent progress of lipidomics. In general, the lipid specificity of the induced lipid efflux is poorly characterized despite the pivotal role it plays in biological processes. We have recently shown that selective lipid efflux depends on specific interactions with membranes (Therrien et al., 2013; 2016). In order to gain a better description of this emerging phenomenon and to detail the intermolecular interactions that are involved, a method has been developed to characterize the extent and the specificity of membrane-lipid extraction by perturbing agents using model membranes. A perturbing agent is incubated with model membranes existing as multilamellar vesicles (MLVs). The classes of perturbing agents include proteins (e.g., binder-of-sperm proteins BSPA1, ApoA1), peptides (e.g., melittin, antibacterial peptides), and detergents (e.g., Triton X-100). The use of model membranes allows a complete control of the lipid composition, modulating in a precise manner molecular features such as the charge and the H-bond capacity, and defining how these factors contribute to the lipid specificity of the extraction. Subsequently, the remaining MLVs, which may include some perturbing agent, are separated by centrifugation from the small lipid/perturbing agent complexes resulting from the lipid extraction. The lipid compositions of the pellet (representative of intact membranes) and of the supernatant (representative of the lipid efflux) are analysed in order to assess the extent and the specificity of the lipid extraction.
Materials and Reagents
Progene® 1.5-ml microcentrifuge tubes
V-Vial screw-thread sample vials, 5 ml, with PTFE-lined caps
Pyrex Brand 9800 test tubes, 20 ml
Syringe
Glass test tube
Marbles
YMC diol column
Lipids (high purity) (Avanti Polar Lipids) (ex. 1-palmitoyl-2-oleoyl-sn-glycero-phosphocholine [POPC]; 1-palmitoyl-2-oleoyl-sn-glycero-phosphoethanolamine [POPE])
Membrane perturbing agent of interest
Benzene (ACS grade)
Methanol (HPLC grade)
Milli-Q water
3-[N-morpholino]propanesulfonic acid (MOPS) (> 95%)
Sodium chloride (NaCl, high-purity grade)
Ethylenediamine tetraacetic acid (EDTA) (99.4-100.6%)
Potassium phosphate, monobasic (KH2PO4) (dried at 105 °C under vacuum for at least 4 h prior to its use to ensure it is dry)
Concentrated sulphuric acid (H2SO4) (ACS reagent, 95.0-98.0%)
Peroxide (H2O2) (30%) (ACS reagent)
Sodium metabisulfite (Na2S2O5) (ACS reagent, >97%)
Ammonium molybdate tetrahydrate [(NH4)6Mo7O24·4H2O] (ACS reagent, 81.0-83.0%)
Ascorbic acid (99%)
Acetonitrile (HPLC grade)
Ammonium acetate (CH3CO2NH4) (≥ 98%)
Nitrogen
Equipment
Microcentrifuge (Eppendorf, model: 5417 R ) equipped with a rotor (Eppendorf, model: f45-30-11 )
UV-Vis spectrometer (Agilent Technologies, model: Cary 6000i )
LC/MS system (Agilent Technologies, model: 1100 series system ) with a 1100 MSD mass spectrometer (Agilent Technologies, model: 1100 MSD )
Water bath
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Lafleur, M. and Therrien, A. (2016). Determining Efficiency and Selectivity of Lipid Extraction by Perturbing Agents from Model Membranes. Bio-protocol 6(22): e2016. DOI: 10.21769/BioProtoc.2016.
Download Citation in RIS Format
Category
Biochemistry > Lipid > Lipid isolation
Biochemistry > Lipid > Lipid-protein interaction
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,017 | https://bio-protocol.org/exchange/protocoldetail?id=2017&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Determining the Influence of Small Molecules on Hypoxic Prostate Cancer Cell (DU-145) Viability Using Automated Cell Counting and a Cell Harvesting Protocol
John P Phelan
FR F Jerry Reen
FO Fergal O’Gara
Published: Vol 6, Iss 22, Nov 20, 2016
DOI: 10.21769/BioProtoc.2017 Views: 7062
Edited by: Antoine de Morree
Reviewed by: Xiaoyi ZhengPooja Mehta
Original Research Article:
The authors used this protocol in Jul 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jul 2016
Abstract
Cell viability assays are an essential aspect of most cancer studies, however they usually require a considerable labor and time input. Here, instead of using the conventional microscopy and hemocytometer cell counting approach, we developed a cell harvesting protocol and combined it with the automated Countess Automated Cell Counter to generate cell viability data. We investigated the effects of dihydroxylated bile acids on the cell viability of prostate cancer cells grown under hypoxic conditions. We observed that for all conditions, cell viability was relatively unchanged, suggesting these molecules had little or no impact on cell viability. The combination of the automated approach and the cell harvesting protocol means this assay is i) easy to perform, ii) extremely reproducible and iii) it complements more conventional cancer assay data such as invasion, migration and adhesion.
Background
Determining the therapeutic utility of any biological molecule is a critical step in the development of novel molecular therapeutics to combat cancer progression and development. As a preliminary step in in vitro characterization, molecules must be assessed for their suitability as anti-cancer therapeutics. As part of this assessment, cell viability is a critical determinant of the cellular response to small molecules as it reflects the ability of a molecule to sustain a threshold cell viability, whilst simultaneously targeting key cancer progression mechanisms e.g., clonogenicity, invasion and adhesion. Conventional viability assays require an intensive labor input comprising microscopy, hemocytometers and manual cell counters. Here we developed a protocol for the rapid and accurate generation of cell viability data that will complement cancer research studies (Phelan et al., 2016).
Materials and Reagents
15 ml tubes (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 339650 )
Blue 1 ml pipet tips (Greiner Bio One, catalog number: 686295 )
Yellow 200 µl pipet tips (Greiner Bio One, catalog number: 739290 )
Sterile Eppendorf tubes (Eppendorf, catalog number: 0030119401 )
Disposable chamber slide
DU-145 prostate cancer cells (ATCC, catalog number: HTB-81 )
Dulbecco’s modified Eagle’s medium (DMEM) low glucose media (Sigma-Aldrich, catalog number: D5921-500ML )
Deoxycholic acid (Sigma-Aldrich, catalog number: D2510-10G )
250 mM dimethyloxalylglycine (DMOG) in sterile PBS (EMD Millipore, Calbiochem, catalog number: 400091-50MG )
Chenodeoxycholic acid (Sigma-Aldrich, catalog number: C9377-5G )
Phosphate buffered saline (PBS) tablets (Sigma-Aldrich, catalog number: P4417-100TAB )
Trypan blue (Thermo Fisher Scientific, GibcoTM, catalog number: 15250061 )
Fetal bovine serum (FBS) (Sigma-Aldrich, catalog number: F6178-500ML )
Penicillin-streptomycin (Sigma-Aldrich, catalog number: P4333-20ML )
Glutamine (Sigma-Aldrich, catalog number: G7513-20ML )
PBS solution (see Recipes)
Complete Dulbecco’s media (see Recipes)
200 µM DMOG (see Recipes)
CDCA and DCA bile acids (see Recipes)
Equipment
T25 flasks (SARSTEDT, catalog number: 83.3910 )
Cell scrapers (SARSTEDT, catalog number: 83.1831 )
DM0412 centrifuge to accommodate 15 ml tubes (Scilogex, model: DM0412 )
Water jacketed CO2 incubator (Thermo Fisher Scientific, Thermo ScientificTM, model: Series II )
Automated pipette filler (Gilson, catalog number: F110753 )
Countess automated cell counter (Thermo Fisher Scientific, InvitrogenTM, catalog number: C10227 )
Inverted microscope (OLYMPUS, model: CKX31 )
Disposable cell chamber slides (Thermo Fisher Scientific, InvitrogenTM, catalog number: C10228 )
Hemocytometer (Thermo Fisher Scientific, Fisher Scientific, catalog number: 10350141 )
Software
Excel
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Phelan, J. P., Reen, F. J. and O’Gara, F. (2016). Determining the Influence of Small Molecules on Hypoxic Prostate Cancer Cell (DU-145) Viability Using Automated Cell Counting and a Cell Harvesting Protocol. Bio-protocol 6(22): e2017. DOI: 10.21769/BioProtoc.2017.
Download Citation in RIS Format
Category
Cancer Biology > Cell death > Biochemical assays
Cell Biology > Cell viability > Cell death
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,018 | https://bio-protocol.org/exchange/protocoldetail?id=2018&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Biochemical Analysis of Caspase-8-dependent Proteolysis of IRF3 in Virus-infected Cells
Gayatri Subramanian
KP Karen Pan
Ritu Chakravarti
Saurabh Chattopadhyay
Published: Vol 6, Iss 22, Nov 20, 2016
DOI: 10.21769/BioProtoc.2018 Views: 8759
Edited by: Yannick Debing
Reviewed by: Angela CoronaRosario Gomez-Garcia
Original Research Article:
The authors used this protocol in Sept 2011
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Sept 2011
Abstract
Interferon regulatory factor 3 (IRF3) is a transcription factor, which is critical for the antiviral response against a wide range of viruses (Hiscott, 2007; Ikushima et al., 2013). It gets activated in virus-infected cells via Toll like receptors (TLRs), RIG-I (retinoic acid inducible gene 1) like receptors (RLRs), cyclic GMP-AMP synthase (cGAS) – stimulator of interferon genes (STING), which are sensors of viral components in the cells (Chattopadhyay and Sen, 2014a; 2014b; Hiscott, 2007). IRF3 is a cytoplasmic protein, upon activation by virally activated sensors it gets phosphorylated, translocated to the nucleus and binds to the interferon-sensitive response element (ISRE) of the gene promoters to induce their transcription (Hiscott, 2007). IRF3 has other functions, including direct stimulation of apoptosis in virus-infected cells. In this pathway, the transcriptional activity of IRF3 is not required (Chattopadhyay et al., 2013b; Chattopadhyay et al., 2016; Chattopadhyay et al., 2010; Chattopadhyay and Sen, 2010; Chattopadhyay et al., 2011). These pathways are negatively regulated by host factors as well as by viruses. Our studies indicate that IRF3 can be proteolytically processed by caspase-8-dependent cleavage (Sears et al., 2011). A specific site in IRF3 is targeted by caspase-8, activated in RNA or DNA virus-infected and dsRNA-stimulated cells (Sears et al., 2011). The direct involvement of caspase-8 was confirmed by in vitro cleavage assay using recombinant proteins and in vivo by virus activated caspase-8. The proteolytic cleavage of IRF3 can be inhibited by chemical inhibition or genetic ablation of caspase-8. The cleavage of IRF3 removes the activated pool of IRF3 and thus can be used as a pro-viral mechanism (Figure 1). Using a C-terminally epitope-tagged human IRF3, we analyzed the cleavage of IRF3 in virus-infected cells. Moreover, we used recombinant proteins in vitro to conclude that IRF3 is a substrate of caspase-8 (Sears et al., 2011). In the current protocol, we have outlined a simple and detailed procedure to biochemically analyze the proteolysis of IRF3 in virus-infected cells and the specific role of caspase-8 in this process.
Figure 1. Model for virus-induced caspase-8-dependent proteolysis of IRF3. In virus-infected cells, IRF3 can be proteolytically cleaved by caspase-8, which gets activated during infection. The cleaved IRF3 is subjected to poly-ubiquitination (Ub) and degradation by proteasome machinery. The degradation of IRF3 inhibits dsRNA-induced antiviral gene induction.
Background
IRF3 functions as a transcription factor as well as a pro-apoptotic factor in virus-infected cells. The two properties of IRF3 determine its overall antiviral functions. Our studies have revealed a number of additional regulatory mechanisms of IRF3 for both of its functions. Using genetically modified cells and mice, we have shown how the two functional branches of IRF3 protect against virus infections (Chattopadhyay et al., 2013a; Chattopadhyay et al., 2016; Chattopadhyay et al., 2011). Dysregulated IRF3 activation is undesirable for normal physiological functions and, therefore, negative regulatory mechanisms are in place to control continuous activation of IRF3. In virus-infected cells, IRF3 can be proteolytically cleaved at a specific site by caspase-8, which gets activated by TLR or RLR signaling. The proteolytic cleavage of IRF3 prevents unregulated expression of dsRNA-dependent genes (Sears et al., 2011). We speculate that such mechanisms are used by viruses to promote their replication and to downregulate IRF3 responses. Therefore, the proteolysis of IRF3 represents a critical step, which both the viruses and the host can regulate to their favorable outcomes. This protocol provides a method to biochemically analyze the proteolysis of IRF3 in virus-infected cells.
Materials and Reagents
Materials
Autoradiography film (Denville Scientific, catalog number: E3012 )
Tissue culture plates (Corning)
1.5 ml Eppendorf tubes (USA Scientific)
Centrifuge tubes (Thermo Fisher Scientific)
26-gauge needle
PVDF membranes
Cells
HT1080 fibrosarcoma cells
Note: These cells are maintained in DMEM containing 10% FBS, 100 international units of penicillin, 100 µg/ml streptomycin (complete DMEM).
1080.10 cells (IRF3 overexpressing HT1080 cells [Elco et al., 2005])
Note: These cells are maintained in complete DMEM containing 1 µg/ml puromycin.
P2.1/IRF3 cells (P2.1 cells expressing C-terminally Flag-tagged human IRF3, Figure 2A)
Notes:
These cells were generated by lentiviral transduction of the P2.1 cells with cDNA of Flag-tagged human IRF3. After lentiviral transduction, the cells were selected in puromycin (1 µg/ml)-containing complete medium. Use the selected pool of cells for the experiments.
HT1080 cells were described previously (Chattopadhyay et al., 2016) and the other cell lines (1080.10 and P2.1/IRF3) were generated in the authors’ laboratory.
Viruses
Sendai virus (SeV) Cantell strain (Charles River laboratories) – this strain was originally obtained from ATCC (ATCC, catalog number: VR-907TM )
Adenovirus Ad5 strain (a kind gift from Thomas Shenk, Princeton University, New Jersey)
Reagents
DMEM (Lerner Research Institute Central Cell Services, catalog number: 11-500p )
PolyI:polyC (Poly [I:C]) (GE Healthcare, catalog number: 27-4732-01 )
Lipofectamine 2000 transfection reagent (Thermo Fisher Scientific, InvitrogenTM, catalog number: 11668030 )
Opti-MEM I reduced serum medium (Thermo Fisher Scientific, InvitrogenTM, catalog number: 31985070 )
Phosphate-buffered saline (PBS) (Lerner Research Institute Central Cell Services, catalog number: 123-1000p )
Recombinant caspase-8 (EMD Millipore, catalog number: CC123 )
Protein assay dye (Bio-Rad Laboratories, catalog number: 5000006 )
10x SDS-PAGE running buffer (AMRESCO, catalog number: 0783 )
Antibodies:
anti-Flag (used at 1:2,500) (Sigma-Aldrich, catalog number: F3290 )
anti-IRF3 (dilution used at 1:10,000) (Active Motif, catalog number: 39033 )
anti-actin (used at 1:10,000 ) (Sigma-Aldrich, catalog number: A5441 )
HRP-conjugated secondary antibodies (used at 1:5,000) (Rockland Immunochemicals, catalog numbers: 611-103-121 , 611-103-122 )
Fetal bovine serum (FBS) (Atlanta Biologicals, catalog number: S11550 )
Proteasome inhibitor MG132 (EMD Millipore, catalog number: 474790 )
Phosphatase inhibitor (PhosSTOP) (Roche Diagnostics, catalog number: 04906837001 )
cOmplete EDTA-free protease inhibitor (Roche Diagnostics, catalog number: 11873580001 )
Caspase inhibitors:
z-VAD (MBL, catalog number: 4800-520 )
z-WEHD (MBL, catalog number: BV-1100-3 )
z-IETD (MBL, catalog number: 4805-510 )
Anti-Flag-agarose beads (Sigma-Aldrich, catalog number: A2220 )
FLAG peptide (Sigma-Aldrich, catalog number: F3290 )
SDS-PAGE loading buffer (Laemelli) (Bio-Rad Laboratories, catalog number: 161-0737 )
Tris buffered saline with Tween-20 (TBS-T) (AMRESCO, catalog number: K873 )
Nonfat dry milk (Bio-Rad Laboratories, catalog number: 1706404XTU )
PierceTM ECL2 (Thermo Fisher Scientific, Fisher Scientific, catalog number: PI80196 )
Tris buffer (pH 7.4) (Affymetrix, catalog number: 22639 )
Sodium chloride (NaCl) (Affymetrix, catalog number: 75888 )
Triton X-100 (Sigma-Aldrich, catalog number: T9284 )
Sodium orthovanadate (NaVO4) (Sigma-Aldrich, catalog number: S6508 )
Sodium fluoride (NaF) (Sigma-Aldrich, catalog number: S7920 )
β-glycerophosphate (Sigma-Aldrich, catalog number: G9422 )
Sodium pyrophosphate (Na2H2P2O7) (Sigma-Aldrich, catalog number: P8135 )
HEPES (Sigma-Aldrich, catalog number: H3375 )
CHAPS hydrate (Sigma-Aldrich, catalog number: C3023 )
EDTA (Affymetrix, catalog number: 15694 )
Glycerol (Affymetrix, catalog number: 16374 )
1,4-dithiothreitol (DTT) (Sigma-Aldrich, catalog number: 10197777001 )
10x transfer buffer (AMRESCO, catalog number: 0307 )
Cell lysis buffer (see Recipes)
Caspase-8 in vitro cleavage assay buffer (see Recipes)
Equipment
Tissue culture incubator (at 37 °C with 5% CO2) (Thermo Fisher Scientific)
Biosafety cabinet
Table top centrifuge (Eppendorf)
Water bath (Benchmark)
Heating block (at 95 °C) (Benchmark)
SDS-PAGE and transfer apparatus (Bio-Rad Laboratories, model: Mini PROTEAN-II Cell )
Note: This equipment is no longer available at manufacturer.
Rocker (Benchmark)
Rotator (Labnet)
Refrigerator
Autoradiography film processor (Kodak)
Spectrophotometer
Vortex (Thermo Fisher Scientific)
Software
ImageJ (freely available from National Institutes of Health, https://imagej.nih.gov/ij/)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
How to cite： Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Subramanian, G., Pan, K., Chakravarti, R. and Chattopadhyay, S. (2016). Biochemical Analysis of Caspase-8-dependent Proteolysis of IRF3 in Virus-infected Cells. Bio-protocol 6(22): e2018. DOI: 10.21769/BioProtoc.2018.
Sears, N., Sen, G. C., Stark, G. R. and Chattopadhyay, S. (2011). Caspase-8-mediated cleavage inhibits IRF-3 protein by facilitating its proteasome-mediated degradation. J Biol Chem 286(38): 33037-33044.
Download Citation in RIS Format
Category
Microbiology > Microbe-host interactions > Virus
Molecular Biology > Protein > Protein-protein interaction
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,019 | https://bio-protocol.org/exchange/protocoldetail?id=2019&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Determination of Rate of [3H-methyl]-choline Incorporation into Cellular Lipids and Non-lipid Metabolites
TS Tim Andrew Davies Smith
SP Su Myat Phyu
Published: Vol 6, Iss 22, Nov 20, 2016
DOI: 10.21769/BioProtoc.2019 Views: 7050
Edited by: Neelanjan Bose
Reviewed by: Yong TengCarsten Ade
Original Research Article:
The authors used this protocol in Mar 2016
Download PDF
Ask a question
Favorite
Cited by
Original research article
The authors used this protocol in:
Mar 2016
Abstract
The choline-containing phospholipid, phosphatidylcholine (PtdCho) is the most common mammalian phospholipid found in cell membrane (Ide et al., 2013). It is also a component of intracellular signalling pathways (Cui and Houweling, 2002). Herein is described a measure of the rate of accumulation of choline by lipid soluble PtdCho and lyso-Ptdcho which can further be discriminated by chromatographic analysis (Smith and Phyu, 2016). Determination of the accumulation of [3H-methyl]-choline into water-soluble components is also described. The procedure could be used to measure the effect of drugs and other factors on choline incorporation into phospholipids. After exposure of cells to test conditions (e.g., drugs) adherent cells in tissue culture flasks are incubated with radiolabelled [3H-methyl]-choline in medium for 15 min (pulse). The [3H-methyl]-choline is then rapidly removed and incubation continued in the presence of non-radioactive medium (chase). Cellular distribution of [3H-methyl] is then determined by cell fractionation and measurement of radioactivity in the lipid and non-lipid cellular components.
Background
Phospholipid metabolism is essential in formation of cell membranes (Ide et al., 2013) and cell signalling (Cui and Houweling, 2002). Both the formation of choline-containing metabolites and the accumulation of choline into lipids are pivotal processes during cellular proliferation. Perturbations in phospholipid metabolisms are associated with cancer and other disorders (Gibellini and Smith, 2010). Measurement of these processes is central to understanding medical imaging modalities that detect choline incorporation by tumour tissue using [11C]-choline-PET (positron emission tomography) (Podo et al., 2007) and choline metabolite content using 31P or 1H (proton) magnetic resonance spectroscopy (Saeedi et al., 2005).
Here is described a method of quantitating the incorporation of choline into aqueous and lipid components. The method is straightforward, relatively inexpensive and easy to set up. It is also quantitative. Alternative methods include NMR spectroscopy (Mori et al., 2015) which can be used to measure the content of phospholipids in tissues and tissue extracts but requires very expensive equipment and specialist knowledge and thin layer chromatography which is inexpensive but is considered to be a qualitative technique.
Materials and Reagents
Reaction tubes 1.5 ml (Greiner Bio one, catalog number: 616201 )
Scintillation vials 20 ml (PerkinElmer, catalog number: 6000477 )
200 µl pipette tips
1 ml pipette tips
Microfuge tubes
Trypsin/EDTA, 0.05% trypsin/0.53 mM EDTA in HBSS (w/o) calcium and magnesium (Mediatech, catalog number: 25-051-CI )
Fetal bovine serum (FBS) (Thermo Fisher Scientific, GibcoTM, catalog number: 10270106 )
Penicillin-streptomycin (10,000 U/ml) (Thermo Fisher Scientific, GibcoTM, catalog number: 15140122 )
[3H-methyl]-choline (specific activity 2.22-3.33 TBq/mmol) (American Radiolabelled Chemicals, catalog number: ART 0197-1 mCi )
Phosphate-buffered saline (PBS, 10x) diluted 10x with water (Thermo Fisher Scientific, Fisher Scientific, catalog number: 12579099 )
Tissue culture medium Dulbecco’s modified Eagle’s medium (DMEM) with glutamax (Thermo Fisher Scientific, GibcoTM, catalog number: 31966021 )
Methanol (Sigma-Aldrich, catalog number: 34860 )
Chloroform (Sigma-Aldrich, catalog number: C2432 )
Trizma-hydrochloride buffer solution pH 7.4 (Sigma-Aldrich, catalog number: T2194 )
Scintillation fluid Ultima Gold XR (PerkinElmer, catalog number: 6013329 )
Bicinchoninic Acid Kit (Sigma-Aldrich, catalog number: BCA1 )
Zinc sulfate monohydrate (ZnSO4·H2O) (Sigma-Aldrich, catalog number: 96495 )
Barium hydroxide octahydrate [Ba(OH)2·8H2O] (Sigma-Aldrich, catalog number: B2507 )
[3H-methyl]-choline in medium (see Recipes)
5% ZnSO4 (w/v) (see Recipes)
Ba(OH)2 solution (see Recipes)
HCl (1 N) (see Recipes)
NaOH (1 N) (see Recipes)
Equipment
Tissue culture flasks 80 cm2 growth surface (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 178905 )
Tissue culture flasks 25 cm2 growth surface (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 136196 )
Incubator (CO2) (Thermo Fisher Scientific, Fisher Scientific, catalog number: 15311035 )
Centrifuge (Thermo Fisher Scientific, Thermo ScientificTM, model: Heraeus Fresco 21 )
Scintillation counter (PerkinElmer, model: tricarb 4910 )
Pipettes P1000 (Gilson, catalog number: F123602 )
Pipettes P200 (Gilson, catalog number: F132601 )
Pipettes P20 (Gilson, catalog number: F132600 )
Vortex mixer (Whirlimix) (Cole-Parmer Instrument, catalog number: UY-04726-01 )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
Category
Biochemistry > Lipid > Lipid measurement
Cell Biology > Cell signaling > Intracellular Signaling
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
202 | https://bio-protocol.org/exchange/protocoldetail?id=202&type=1 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Protein Extraction from Mice Xenograft Tumor
HP Huan Pang
Published: Apr 5, 2012
DOI: 10.21769/BioProtoc.202 Views: 24068
Download PDF
Ask a question
How to cite
Favorite
Cited by
Abstract
Proteins from frozen tissue such as xenograft tumor need to be extracted efficiently without being degraded to make the best use of a limited resource and to ensure that an accurate representation of proteins in selected tumor tissue can be obtained. This protocol describes how to extract proteins from xenograft tumors in mice.
Materials and Reagents
NaCl
Tris
EDTA
NP-40
EGTA
NaF
Beta-glycerophosphate
Sodium pyrophosphate
Sodium vanadate
Isoflurane
PMSF
Laemmli buffer
Liquid nitrogen
Phosphatase inhibitor 1/2 (Sigma-Aldrich, catalog number: P2850 , P5726 )
BCA kit (Thermo Fisher Scientific, catalog number: 23227 )
Lysis buffer(see Recipes)
Equipment
Centrifuges
Sonicator
Western blotting equipment
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2012 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Pang, H. (2012). Protein Extraction from Mice Xenograft Tumor. Bio-101: e202. DOI: 10.21769/BioProtoc.202.
Download Citation in RIS Format
Category
Cancer Biology > General technique > Biochemical assays > Protein analysis
Biochemistry > Protein > Isolation and purification
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,020 | https://bio-protocol.org/exchange/protocoldetail?id=2020&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Microinjection of Virus into Lumbar Enlargement of Spinal Dorsal Horn in Mice
ZZ Zhi-Jun Zhang*
PJ Peng-Bo Jing*
YG Yong-Jing Gao
*Contributed equally to this work
Published: Vol 6, Iss 22, Nov 20, 2016
DOI: 10.21769/BioProtoc.2020 Views: 15025
Edited by: Jia Li
Reviewed by: Zhen Shi
Original Research Article:
The authors used this protocol in Feb 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Feb 2016
Abstract
In order to explore the role of a specific gene/protein in the specific segment of the spinal cord, the technique of intraspinal injection is particularly used to deliver viral vectors targeting the specific gene/protein. These viral vectors can knockdown or overexpress the specific gene/protein in specific cells (glial cells or neurons). In this protocol, lentivirus containing shRNA for CXCL13 were injected into the dorsal horn of the spinal lumbar enlargement segment (Jiang et al., 2016). This technique allows the study of the role of CXCL13 in the ipsilateral dorsal horn in neuropathic pain without affecting DRG or contralateral dorsal horn.
Background
The dorsal horn of spinal cord is a well-organized and stratified neuronal complex, which transmits the sensory information from the body surface and deep tissues to the brain. The activity of neurons in the spinal dorsal horn can be regulated by primary afferents, descending fibers, as well as spinal glial cells such as astrocytes and microglia. Understanding how the specific protein and gene in spinal neurons or glial cells contribute to the mechanism of physiological and pathological pain is of increasing interest. In order to explore the role of a specific gene/protein in the spinal cord, the technique of intrathecal injection is commonly used to deliver agonist, antagonist, siRNA, or miRNA into the subarachnoid space. The knockout and conditional deletion of a specific gene is another exhaustive and expensive approach. However, the limitation of these methods is lack of spinal segment- and cell type-specific deletion or overexpression. This protocol shows that intraspinal injection can deliver specific viral vectors into specific segmental spinal dorsal horn to investigate the function of a gene in a region- and cell type-specific manner.
Materials and Reagents
0.2 ml sterile centrifuge tubes (Corning, Axygen®, catalog number: PCR-02-C )
10 μl sterile tips (Corning, Axygen®, catalog number: T-300L )
Glass capillary (World Precision Instruments, catalog number: TW150F-4 )
10 μl microsyringe (Shanghai Gaoge Industrial and Trading)
Insulin syringe, 30 G (BD, catalog number: 1312073 )
4-0 silk (Ethicon)
Aseptic gauze
Cotton swabs
Hot glue (Shanghai Santo, catalog number: 1625 )
ICR mice, male, 8 weeks old
LV-CXCL13 shRNA
Note: The recombinant lentivirus containing CXCL13 shRNA was packaged using pGCSIL-GFP vector by Shanghai GeneChem Lentiviral vector. (CXCL13, GenBank Accession number: NM_018866).
Liquid paraffin (EMD Millipore, catalog number: 107162 )
Enhanced infection solution (Shanghai GeneChem, catalog number: REVG0002 )
Note: This is a gift product with lentivirus. The website does not show it as a product that can be purchased
Pentobarbital sodium (Sigma-Aldrich, catalog number: P3761 )
Ethanol, pure (Sigma-Aldrich, catalog number: E7023 )
1% povidone iodine (Shanghai Bangshili disinfectant)
Phosphate buffered saline (1x PBS) (Thermo Fisher Scientific, GibcoTM, catalog number: 10010023 )
4% paraformaldehyde
Picric acid
Equipment
Model P-97 flaming micropipette puller (Sutter instrument, model: P-97 )
Microscissors (Fine Science Tools, catalog number: 91500-09 )
Microforceps (Fine Science Tools, catalog number: 91150-20 )
Surgery microscope (RWD Life Science, catalog number: 77019 )
Heating pad (Yiwu pet, Small size)
Biological safety cabinet (Thermo Fisher Scientific, mode: 1388 )
Pet trimmer (Wahl Home, catalog number: 58563 )
Desktop digital stereotaxic instruments (RWD Life Science, catalog number: 68025 )
Spinal clamp apparatus (RWD Life Science, catalog number: 68091 )
Hot glue gun (Shanghai Santo, catalog number: 1628 )
A set of surgery instruments for mouse (RWD Life Science, catalog number: SP0010-B )
Skull drill (RWD Life Science, catalog number: 78001 )
Legato syringe pumps (KD Scientific, catalog number: 788130 )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Zhang, Z., Jing, P. and Gao, Y. (2016). Microinjection of Virus into Lumbar Enlargement of Spinal Dorsal Horn in Mice. Bio-protocol 6(22): e2020. DOI: 10.21769/BioProtoc.2020.
Download Citation in RIS Format
Category
Neuroscience > Development > Neuron
Cell Biology > Cell-based analysis > Gene expression
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,021 | https://bio-protocol.org/exchange/protocoldetail?id=2021&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Documentation of Floral Secretory Glands in Pleurothallidinae (Orchidaceae) Using Scanning Electron Microscopy (SEM)
AK Adam P. Karremans
BH Bertie Joan van Heuven
RL Rob Langelaan
BG Barbara Gravendeel
Published: Vol 6, Iss 22, Nov 20, 2016
DOI: 10.21769/BioProtoc.2021 Views: 9468
Edited by: Samik Bhattacharya
Reviewed by: Ning Liu
Original Research Article:
The authors used this protocol in Sep 2015
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Sep 2015
Abstract
A clear, step by step description of the treatment of orchid flowers, subtribe Pleurothallidinae, with Critical Point Drying for SEM is presented. It shows that a simple, short fixation and dehydration method prior to Critical Point Drying is sufficient to obtain good results.
Background
Pleurothallidinae (Orchidaceae) have relatively small flowers that exhibit a wide variety of ornaments on the perianth parts, especially on the sepals and lip. It is clear that most of those play an important role in attracting and arresting pollinators, which in most cases are known to be small flies. However, it is difficult to judge just from looking at photographs from the stereoscopic microscope if the observable thickenings, papillae or hairs are actually secretory glands. Scanning Electron Microscopy (SEM) can be a powerful tool to explore these flowers in greater detail, aiding to locate, compare and identify those glands (Karremans et al., 2015).
Materials and Reagents
Snap cap vials (10 ml) (VWR, catalog number: 548-0621 )
Gloves (nitrile, powder free)
Petri dish
Double sided ultra-smooth carbon adhesive tape, 12 mm diameter (Electron Microscopy Sciences, catalog number: 77827-12 )
Plastic box or desiccator with dry silica gel
Ethanol
Note: For steps using diluted ethanol use a 96% non denatured ethanol with distilled water, for steps using pure ethanol use a min. of 99.9%, water free ethanol.
Acetone, HPLC Plus, for HPLC, ≥ 99.9% (Sigma-Aldrich, catalog number: 650501-1L )
Carbon dioxide, technical grade (in gas cylinder with feed pipe)
Argon gas 4.6, technical quality
Equipment
Aluminium specimen mount, JEOL(Ted Pella, catalog number: 16231 )
Soft pincet (e.g., light forceps, [VWR, catalog number: 232-2119 ])
SEM specimen mount tweezers (Electron Microscopy Sciences, catalog number: 76800 )
Platina/palladium (Pt/Pd) target, 57 x 0.1 mm (Pt/Pd ratio, 80:20)
Automated critical point dryer (Leica Microsystems, model: EM CPD300 )
Rotary mixer (Ted Pella, Pelco®, model: R1 )
Holders and baskets for Leica critical point dryer (e.g., Fine mesh specimen holder with mesh specimen baskets or filter disc holder with 4 wells)
Sputter coater (Quorum Technologies, model: Q150T S ) with rotating holder for 6 SEM stubs (Q150T S/E/ES Sample Preparation System Instruction Manual), film thickness monitor and RV3 Rotary Vane pump (Edwards, model: A65201903 )
Field emission scanning electron microscope (JEOL, model: JSM-7600F ) (Figure 1)
Note: This product is discontinued, but any standard scanning electron microscope will do (for example JEOL, model: JSM-IT100 InTouchScopeTM)
Figure 1. Field emission scanning electron microscope in place and ready for use
Software
Jeol PC-SEM version 2.1.0.3
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Karremans, A. P., van Heuven, B. J., Langelaan, R. and Gravendeel, B. (2016). Documentation of Floral Secretory Glands in Pleurothallidinae (Orchidaceae) Using Scanning Electron Microscopy (SEM). Bio-protocol 6(22): e2021. DOI: 10.21769/BioProtoc.2021.
Download Citation in RIS Format
Category
Plant Science > Plant cell biology > Cell imaging
Plant Science > Plant cell biology > Tissue analysis
Cell Biology > Cell imaging > Electron microscopy
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,022 | https://bio-protocol.org/exchange/protocoldetail?id=2022&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Visualising Differential Growth of Arabidopsis Epidermal Pavement Cells Using Thin Plate Spline Analysis
William Jonathan Armour
Deborah Anne Barton
Robyn Lynette Overall
Published: Vol 6, Iss 22, Nov 20, 2016
DOI: 10.21769/BioProtoc.2022 Views: 7769
Edited by: Renate Weizbauer
Reviewed by: Harrie van ErpPengpeng Li
Original Research Article:
The authors used this protocol in Sep 2015
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Sep 2015
Abstract
Epidermal pavement cells in Arabidopsis leaves and cotyledons develop from relatively simple shapes to form complex cells that have multiple undulations of varying sizes. Analyzing the growth of individual parts of the cell wall boundaries over time is essential to understanding how pavement cells develop their complex shapes. Thin plate spline analysis is a method for visualizing the change of size and shape of objects through warping or deformation of a regular mesh and can be applied to understand cell wall growth. This protocol describes the application of thin plate spline analysis to visualize the development of individual pavement cells over time.
Background
Understanding the spatial pattern of growth of a cell provides insight into how plant cells form different shapes. Epidermal pavement cells of Arabidopsis thaliana cotyledons and leaves are a good model system for investigating how complex cells grow as their cell wall boundaries develop multiple undulations of different size from boundaries that were initially simple arcs (Armour et al., 2015; Fu et al., 2005). Growth of plant cells has been measured by fixing externally applied markers to cells such as algal Nitella internodes (Green et al., 1970), root cells (Shaw et al., 2000), and trichomes (Schwab et al., 2003). However measurement of cell growth from externally applied landmarks is sometimes not feasible such as when the strong fluorescence of externally applied fluorescent markers would obscure fluorescently labeled cytoskeletal elements within cells (Armour et al., 2015). Thin plate spline analysis which visualizes the changing positions of a defined number of homologous landmarks over time or between different objects has previously been used to analyze changes in the three dimensional size and shape of objects such as hominid skulls (Rosas and Bastir, 2002; Gunz et al., 2009), or the two dimensional shapes of insect wings (Börstler et al., 2014) and leaves (Polder et al., 2007). This protocol describes how to use thin plate spline analysis to visualize size and shape changes of individual cells. This technique is relatively easy to utilize on a range of cell images as it uses the input of the outline of a cell at sequential times to approximate the relative growth rate and growth direction of different areas of the cell wall.
Materials and Reagents
Petri dish (35 x 10 mm) (SARSTEDT, catalog number: 82.1135.500 )
3M Micropore surgical tape 1.25 cm (3M, catalog number: 1530-0 )
Wildtype Arabidopsis thaliana (Col-0) seeds
Sodium hypochlorite solution (White King Premium Bleach, Woolworths, catalog number: 10006062A )
Sterile distilled water
Murashige and Skoog salts (Sigma-Aldrich, catalog number: M5519 )
Sucrose (Sigma-Aldrich, catalog number: S8501 )
OxoidTM bacteriological agar (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: LP0011 )
1 µM solution of 3 kDa fluorescein conjugated dextran (Thermo Fisher Scientific, Molecular ProbesTM, catalog number: D3305 )
Equipment
Sterile laminar flow hood
Zeiss Axiophot photomicroscope (D-7082) with filter set (BP 450-490 FT 510 BP 515-565, Carl Zeiss, catalog number: 487910 )
A 20x LD Achroplan lens with a N.A. of 0.4 (Carl Zeiss, catalog number: 421350-9970-000 [current version]; 440845-0000-000 [old version])
an Olympus microscope digital camera (OLYMPUS, model: DP71 )
Plant growth chamber, set at 22 °C, on a 16-h-day:8-h-night cycle
P10, 0.5-10 μl pipette (Eppendorf, catalog number: 4920000024 )
Software
ImageJ (available at http://imagej.nih.gov.ij)
ImageJ macros and lookup tables (https://en-cdn.bio-protocol.org/attached/file/20161017/20161017210148_3943.rar)
0WillRainbow.lut
Add-Points-From-TPSlist-To-ROImanager_.ijm
BranchInfo-to-ROI-lines-overlay_.ijm
Formatted-Points-List-To-ROImanager_.ijm
TPS-rel-expansion-prepare_.ijm
TPS-rel-expansion-format_.ijm
ImageJ plugins
Stack Focuser (available at http://imagej.nih.gov/ij/plugins/stack-focuser.html)
tpsDig2 (available at http://life.bio.sunysb.edu/morph/)
PAST (available at http://folk.uio.no/ohammer/past/)
Plaintext editor (e.g., Notepad++ on Windows, TextEdit on Mac OSX or gedit on Linux)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Armour, W. J., Barton, D. A. and Overall, R. L. (2016). Visualising Differential Growth of Arabidopsis Epidermal Pavement Cells Using Thin Plate Spline Analysis. Bio-protocol 6(22): e2022. DOI: 10.21769/BioProtoc.2022.
Download Citation in RIS Format
Category
Plant Science > Plant cell biology > Cell imaging
Developmental Biology > Cell growth and fate
Cell Biology > Cell imaging
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,023 | https://bio-protocol.org/exchange/protocoldetail?id=2023&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Acid Extraction of Total Histone from Colon Cancer HCT116 Cells
LC Lin-Lin Cao
WZ Wei-Guo Zhu
Published: Vol 6, Iss 22, Nov 20, 2016
DOI: 10.21769/BioProtoc.2023 Views: 10332
Edited by: HongLok Lung
Reviewed by: Xiaoyi ZhengJustine Marsolier
Original Research Article:
The authors used this protocol in Jan 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jan 2016
Abstract
Histone acid extraction assay is a popular method to determine histone modification levels in mammalian cells. It includes three steps: first, histones are released from chromatin by sulfuric acid; trichloroacetate (TCA) is then added to precipitate histones; and finally, histones are dissolved in double-distilled H2O (ddH2O). Here we present a detailed histone acid extraction assay in our laboratory using a colon cancer cell line, HCT116, as a model.
Background
The nucleosome is the fundamental unit of eukaryotic chromatin, which is composed of a histone octamer (2 copies of H3, H4, H2A, H2B, respectively) wrapping by DNA (Strahl and Allis, 2000). The amino terminal of histone is subjected to a variety of post-translational modifications, such as methylation, acetylation, phosphorylation, ubiquitylation and sumoylation (Kouzarides, 2007). Although the function of these modifications has remained elusive, there is ever-growing studies suggest that histone modifications play vital roles in intracellular processes (Bannister and Kouzarides, 2011). Therefore, it is important to extract histones efficiently to detect histone modifications.
Histones can be extracted via different methods, in which histone acid extraction assay is one of the most popular procedures. It does not interrupt post-translational modifications of histones, and so it is very good for histone modification analysis. It has been tested that the extracted histones can be used in Western blot, and maybe other assays (not fully tested). However, immunoprecipitation is not recommended. In this protocol, we will present a detailed histone acid extraction assay, and describe how to release histones from chromatin, how to precipitate histones, and how to wash and dissolve histones in ddH2O.
Materials and Reagents
6 cm plate
1.5 ml tubes (Corning, Axygen®, catalog number: MCT-150-C )
Human colon cancer cell line HCT116 (ATCC)
Phosphate-buffered saline (PBS) (Thermo Fisher Scientific, GibcoTM)
Acetone
Double-distilled H2O (ddH2O)
2x SDS loading buffer (containing 200 mmol/L DTT)
Tris-HCl (pH = 8.0)
Potassium chloride (KCl)
Magnesium chloride (MgCl2)
Dithiothreitol (DTT)
Protease inhibitor cocktail (Sigma-Aldrich, catalog number: P8340 )
Sulfuric acid
Trichloroacetate (TCA) (Sigma-Aldrich, catalog number: T6399 )
Trichloroacetic acid (TCA) solution (see Recipes)
Lysis buffer(see Recipes)
Equipment
Pipettor (Eppendorf)
Centrifuge (cooled and room-temperature)(Eppendorf)
Rotator
Spectrophotometer (Bio-Rad Laboratories)
Metal bath
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Cao, L. and Zhu, W. (2016). Acid Extraction of Total Histone from Colon Cancer HCT116 Cells. Bio-protocol 6(22): e2023. DOI: 10.21769/BioProtoc.2023.
Download Citation in RIS Format
Category
Cancer Biology > General technique > Biochemical assays
Biochemistry > Protein > Isolation and purification
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,024 | https://bio-protocol.org/exchange/protocoldetail?id=2024&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Cryopreservation Protocol for Chlamydomonas reinhardtii
Duanpeng Yang
WL Weiqi Li
Published: Vol 6, Iss 22, Nov 20, 2016
DOI: 10.21769/BioProtoc.2024 Views: 8708
Edited by: Maria Sinetova
Reviewed by: Agnieszka Zienkiewicz
Original Research Article:
The authors used this protocol in Jan 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jan 2016
Abstract
Cryopreservation is commonly used for storing viable cells, tissues, organs or organisms at ultralow temperatures, and usually involves immersion in liquid nitrogen at -196 °C. Here we provide a detailed cryopreservation protocol for C. reinhardtii based on Crutchfield’s work (Crutchfield et al., 1999), with minor changes (Yang and Li, 2016). In this study, we compared the cryoprotection effect of two common cryopreservation agents (CPAs), methanol and DMSO. Furthermore, the two-step cryopreservation process was divided into five stages to study the factors affecting the survival rate at each stage. We found that the use of methanol as the CPA, combined with the cooling process outlined here (cooling from 25 °C to -55 °C at a rate of 1 °C/min), were indispensable for cell survival after cryopreservation. The thawing process described here (thawing at 35 °C for 5 min) was also important for increasing the survival rate.
Background
Nowadays, cryopreservation is used frequently for the storage of transgenic lines or mutation lines of C. reinhardtii, and for experimental needs involving this organism. Morris et al. (1979) discussed the effects of different CPAs in cooling, the relationships between temperature and survival rate with or without the CPAs, and the cooling rate. They found that with the addition of methanol the half-lethal temperature was the lowest of all the CPAs tested (-14.4 °C), while that of DMSO was -4.9 °C (Morris et al., 1979).
Through storage in 7% (v/v) DMSO overnight at room temperature, followed by storage at -70 °C, Johnson and Dutcher (1993) gained the highest viabilities, nearly 10% in C. reinhardtii cultures. However, the survival rate may be restricted in C. reinhardtii cell lines, especially in the cell line CC-125 we used, with viabilities of only 0.34%, although the authors claim was caused by liquid culturing. Nevertheless, this method was time consuming and resulted in low cell viabilities. Crutchfield et al. (1999) reported a two-step cooling procedure for the cryopreservation of C. reinhardtii using 5% methanol as the CPA, which retained relatively high viability (> 40%).
Three different methods for improving survival rate were compared in this study. We followed the protocols mentioned above, and made detailed analyses at each stage of the cryopreservation process. The different effects of methanol and DMSO are also discussed, the results agreeing with the work of previous authors.
Materials and Reagents
1.5 ml and 4 ml Eppendorf tubes
50 ml flask
Cryovials (VWR, Nalgene®, catalog number: 5000 )
Filter membrane (Filter pore size: 0.2-0.3 μm) for tissue culture
0.22 μm membrane filters (EMD Millipore, model: SLGV033RB )
Chlamydomonas reinhardtii CC125 was purchased from the Chlamydomonas Resource Center at the University of Minnesota (http://www.chlamycollection.org/cart/)
TAP medium (Gorman and Levine, 1965, http://www.chlamycollection.org/methods/media-recipes/tap-and-tris-minimal/)
Isopropanol, purity ≥ 99.5% (Sangon Biotech, catalog number: A507048 )
Liquid nitrogen
Trypan blue (Sigma-Aldrich, catalog number: T6146 )
Methanol (MeOH) (AR), purity ≥ 99% (Chongqing Chuandong Chemical, catalog number: methanol)
Dimethyl sulfoxide (DMSO) (Sangon Biotech, catalog number: A503039 )
Iodine (AR) (Sangon Biotech, catalog number: A500538 )
Potassium iodide (AR) (Sangon Biotech, catalog number: A100512 )
Lugol’s iodine solution (see Recipes)
CPA stock solution (see Recipes)
Equipment
Thermostatic rocking incubator (Shanghai Shipping, model: SPH-211B )
Hemocytometer (Qiujing)
Freezing container (Cryo 1 °C freezing container) (VWR, Nalgene®, model: 5100 )
Autoclave
Laminar flow hood
Microscope (OLYMPUS, model: CX31 )
Water bath (Amersham Bioscience)
Portable liquid nitrogen tank
Centrifuge (Hettich, model: D-78532 Tuttlingen)
Note: This equipment has been discontinued, other types with the same centrifugal force can be used as substitutions.
-80 °C freezer (Thermo Fisher Scientific, model: 8607 )
Software
Microsoft Office Excel
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
How to cite： Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Yang, D. and Li, W. (2016). Cryopreservation Protocol for Chlamydomonas reinhardtii. Bio-protocol 6(22): e2024. DOI: 10.21769/BioProtoc.2024.
Yang, D. and Li, W. (2016). Methanol-promoted lipid remodelling during cooling sustains cryopreservation survival of Chlamydomonas reinhardtii. PLoS One 11(1): e0146255.
Download Citation in RIS Format
Category
Plant Science > Phycology > Physiology
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,025 | https://bio-protocol.org/exchange/protocoldetail?id=2025&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Halo Assay for Toxic Peptides and Other Compounds in Microorganisms
Houjian Cai
Melinda Hauser
Fred Naider
Jeffrey M. Becker
Published: Vol 6, Iss 22, Nov 20, 2016
DOI: 10.21769/BioProtoc.2025 Views: 8463
Edited by: Yanjie Li
Reviewed by: Chong He
Original Research Article:
The authors used this protocol in Oct 2007
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Oct 2007
Abstract
We describe an assay for determination of toxicity in S. cerevisiae involving spotting of a toxic peptide on a lawn of yeast cells. This assay may be generalized to determine toxicity of a variety of compounds by substituting a putative toxic compound in place of the peptide. The general protocol may also be used to determine toxicity of any small compound toward another microorganism by replacing S. cerevisiae with the target microbe and modifying growth conditions accordingly.
Background
Di-/tripeptides are one of the major sources of nitrogen, carbon, and amino acids for all organisms. Synthetic peptides containing a toxic amino acid residue provide an experimental approach to measure peptide transport and/or utilization in Saccharomyces cerevisiae. Hydrolysis of internalized peptides by intracellular peptidases or proteases releases the toxic residue leading to an easily detectable zone (halo) of growth arrest on a lawn of cells plated in a Petri plate. For example, upon intracellular hydrolysis the toxic peptide Ala-Eth releases ethionine (Eth), a methionine antagonist which interferes with the incorporation of amino acids into proteins and with the normal methylation of DNA and other methylation pathways, thereby leading to cell death. When spotted onto a lawn of yeast cells, the transported dipeptide Ala-Eth will inhibit growth, and a clear ‘halo’ will form in the lawn of cells around the region where the Eth-containing toxic peptide is spotted (Figure 1A). The assay described here for determination of peptide toxicity in S. cerevisiae may be generalized as follows: (1) it may be modified to determine toxicity of any substrate by simply using a putative toxic compound in place of a peptide containing a toxic amino acid, or (2) it may be modified to determine toxicity of a substrate toward any microorganism by replacing S. cerevisiae in the assay with the target organism. It is a simple, inexpensive and relatively rapid method for determining substrate toxicities as modified for the specific organism and toxic moiety assayed.
Materials and Reagents
16 x 125 mm glass screw cap tubes (Thermo Fisher Scientific, Fisher Scientific, catalog number: 14-959-25C )
6-mm sterile blank paper discs (BD, catalog number: 231039 )
Culture tube (Thermo Fisher Scientific, Fisher Scientific, catalog number: 14-956-6B )
Sterile Petri plate (Thermo Fisher Scientific, Fisher Scientific, catalog number: FB0875713 )
Saccharomyces cerevisiae (S. cerevisiae): such as W303 strain (MATa or MATα leu2-3,112 trp1-1 can1-100 ura3-1 ade2-1 his3-11, 15) (ATCC, catalog number: 208352 )
Note: Other strains can be used, although the growth medium will have to be adjusted to meet specific auxotrophic requirements.
Toxic peptides, such as Ala-Eth or Leu-Eth (Custom synthesized)
Proline (Sigma-Aldrich, catalog number: P5607 )
Agar (Sigma-Aldrich, catalog number: A1296 )
Yeast nitrogen base without (NH4)2SO4 and amino acids (BD, DifcoTM, catalog number: 233510 )
Dextrose (Sigma-Aldrich, catalog number: G7021 )
Uracil (Sigma-Aldrich, catalog number: U1128 )
Adenine hemisulfate salt (Sigma-Aldrich, catalog number: A9126 )
Histidine-HCl (Sigma-Aldrich, catalog number: H-8000 )
Leucine (Sigma-Aldrich, catalog number: L8000 )
Tryptophan (Sigma-Aldrich, catalog number: T0254 )
Noble agar (Sigma-Aldrich, catalog number: A5431 )
Minimal proline (MP) broth (see Recipes)
MP+ broth (see Recipes)
MP+ growth plate (see Recipes)
1.1% Noble agar blanks (see Recipes)
Equipment
Ruler
Filter forceps (EMD Millipore, catalog number: XX6200006P )
Vortex mixer (VWR, catalog number: 97043-562 )
General purpose water bath (VWR, catalog number: 89501-476 )
Microscope
Note: Any standard lab microscope can be used.
Incubator (set up at 30 °C) containing a rotator mixer (Thermo Fisher Scientific, Thermo ScientificTM, model: 1640Q )
Hemocytometer (Thermo Fisher Scientific, Fisher Scientific, catalog number: 0267151B )
Tabletop centrifuge (Eppendorf, model: 5810R )
Software
ImageJ (www.imagej.net)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Cai, H., Hauser, M., Naider, F. and Becker, J. M. (2016). Halo Assay for Toxic Peptides and Other Compounds in Microorganisms. Bio-protocol 6(22): e2025. DOI: 10.21769/BioProtoc.2025.
Download Citation in RIS Format
Category
Microbiology > Microbial cell biology > Cell-based analysis
Cell Biology > Cell-based analysis > Transport
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,026 | https://bio-protocol.org/exchange/protocoldetail?id=2026&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Uptake Assay for Radiolabeled Peptides in Yeast
Melinda Hauser
Houjian Cai
Fred Naider
Jeffrey M. Becker
Published: Vol 6, Iss 22, Nov 20, 2016
DOI: 10.21769/BioProtoc.2026 Views: 7950
Edited by: Yanjie Li
Reviewed by: Chong HeMelike Çağlayan
Original Research Article:
The authors used this protocol in Oct 2007
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Oct 2007
Abstract
We describe an assay for measuring the uptake of radioactive peptides into the yeast Saccharomyces cerevisiae. The methods presented here can be adapted to measure a variety of substrates transported into any bacterial or fungal cell via specific carrier-mediated systems.
Background
Di/tripeptides and larger oligopeptides are sources of amino acids for protein synthesis, or may serve as carbon and nitrogen precursors for energy production and biosynthesis of metabolites in all organisms. Uptake of di/tripeptides and oligopeptides across the cell membrane is facilitated by peptide transporters. Measuring the accumulation of radiolabeled peptide provides an experimental approach to determine uptake across a specific peptide transport protein in a variety of cell types, including the yeast Saccharomyces cerevisiae. Appropriate experimental design allows for the determination of kinetic parameters such as the affinity and capacity of system under investigation. Dipeptides, such as radiolabeled Leu-Leu, can be used to measure transport across the di/tripeptide transporter Ptr2p of S. cerevisiae. We use the transport of dipeptides across Ptr2p in yeast as an example.
Materials and Reagents
Culture tube, up to 17 x 100 mm (Thermo Fisher Scientific, Fisher Scientific, catalog number: 14-956-6B )
1.5 ml microfuge tubes
HAWP membrane filter (EMD Millipore, catalog number: HAWP02400 )
Saccharomyces cerevisiae (S. cerevisiae): such as W303 strain (MATa or MATα leu2-3,112 trp1-1 can1-100 ura3-1 ade2-1 his3-11,15) (ATCC, catalog number: 208352 )
Note: Other strains can be used, although the growth medium will have to be adjusted if specific auxotrophic requirements are needed.
Proline (Sigma-Aldrich, catalog number: P5607 )
Yeast nitrogen base without (NH4)2SO4 and amino acids (BD, catalog number: 233510 )
D-glucose (Sigma-Aldrich, catalog number: G7021 )
Uracil (Sigma-Aldrich, catalog number: U1128 )
Adenine hemisulfate salt (Sigma-Aldrich, catalog number: A9126 )
Histidine-HCl (Sigma-Aldrich, catalog number: H-8000 )
Leucine (Sigma-Aldrich, catalog number: L8000 )
Tryptophan (Sigma-Aldrich, catalog number: T0254 )
Radiolabeled dipeptide [3H]Leu-Leu (Custom synthesized)
Leu-Leu (Sigma-Aldrich, catalog number: L-2752 )
Minimal Proline (MP) broth (see Recipes)
MP+ broth (see Recipes)
20% glucose (see Recipes)
2% glucose (see Recipes)
2x uptake medium (see Recipes)
Equipment
250 ml flask
Vortex mixer (VWR, catalog number: 97043-562 )
Water bath (VWR, catalog number: 89501-476 )
Microscope
Incubator (set up at 30 °C) containing a rotator mixer (Thermo Fisher ScientificTM, Thermo Scientific model: 1640Q )
Shaker incubator, 30 °C (Eppendorf, New Brunswick Scientific, model: C-25 )
Hemocytometer
Dry bath, 30 °C with blocks to hold microfuge 1.5 ml tubes (Thermo Fisher Scientific, catalog number: 88870002 )
Manifold vacuum filtration cell harvester (EMD Millipore, catalog number: xx2702550 )
Filter forceps (EMD Millipore, catalog number: XX6200006P )
Liquid Scintillation vial, 6 ml Omni-vial with cap (Wheaton, catalog number: 225414 )
Liquid Scintillation Cocktail (MP Biomedical CytoScint, catalog number: 882453 )
Liquid Scintillation Counter, TRI-CARB 2000TR (PerkinElmer, catalog number: B291000 )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Hauser, M., Cai, H., Naider, F. and Becker, J. M. (2016). Uptake Assay for Radiolabeled Peptides in Yeast. Bio-protocol 6(22): e2026. DOI: 10.21769/BioProtoc.2026.
Download Citation in RIS Format
Category
Microbiology > Microbial cell biology > Cell-based analysis
Cell Biology > Cell-based analysis > Transport
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,027 | https://bio-protocol.org/exchange/protocoldetail?id=2027&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Isolation and Culture of Human Adipose-derived Stem Cells from Subcutaneous and Visceral White Adipose Tissue Compartments
Xiaojia Ge
Shi Chi Leow
Durgalakshmi Sathiakumar
Walter Stünkel
Asim Shabbir
Jimmy Bok Yan So
Davide Lomanto
Craig McFarlane
Published: Vol 6, Iss 22, Nov 20, 2016
DOI: 10.21769/BioProtoc.2027 Views: 14408
Reviewed by: Salma HasanAgnieszka Pastula
Original Research Article:
The authors used this protocol in Mar 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Mar 2016
Abstract
Human Adipose-derived Stem/Stromal Cells (ASCs) have been widely used in stem cell and obesity research, as well as clinical applications including cell-based therapies, tissue engineering and reconstruction. Compared with mesenchymal stem cells (MSCs) derived from other tissues such as umbilical cord and bone marrow, isolation of ASCs from human white adipose tissue (WAT) has great advantages due to its rich tissue source and simple surgical procedure. In this detailed protocol we describe a protocol to isolate and characterize ASCs from human WAT. Molecular characterization of isolated ASCs was performed through surface marker expression profiling using flow cytometry. Adipogenic capacity of the isolated ASCs was confirmed through inducing adipogenic differentiation and Oil Red O staining of lipid. This protocol provides researchers with the tools to culture and assess purity and adipogenic differentiation capacity of human ASCs, which can then be utilized for required downstream in vitro applications.
This protocol has been modified from Baglioni et al. (2009), Baglioni et al. (2012), and van Harmelen et al. (2005) to describe in detail a complete technique to isolate and subsequently characterize human ASCs from human WAT biopsies. This protocol has been utilized to isolate and characterize human ASCs from both subcutaneous and visceral WAT. The isolated human ASCs show high purity and demonstrate adipogenic differentiation capacity in vitro.
Background
Human ASCs are an invaluable in vitro cell model to study molecular pathways important for the etiology of metabolic diseases, including obesity and type 2 diabetes. Human ASC cultures derived from different WAT sources, including subcutaneous and visceral compartments, can also help us to understand functional differences between different WAT compartments. Short protocols have been published previously to describe the isolation of human ASCs from a maximum of two different WAT compartments (Baglioni et al., 2009; 2012; van Harmelen et al., 2005). Here we describe a detailed protocol for both, isolation and characterization of human ASCs from human WAT biopsies collected from several WAT compartments. This protocol has been used to reliably derive human ASCs from four different WAT compartments, including superficial subcutaneous, deep subcutaneous, omental and mesenteric WAT. The isolated primary cultures display homogeneous morphology and are pure, with a high percentage of cells displaying typical MSC marker expression. The isolated human ASCs also have the ability to differentiate into mature adipocytes, with accumulation of intracellular triglyceride droplets. In summary, this protocol reliably results in the isolation of pure human primary ASCs that maintain robust adipogenic differentiation capacity in vitro.
Materials and Reagents
15 ml centrifugation tube (Corning, Falcon®, catalog number: 352099 )
50 ml centrifugation tube (Corning, Falcon®, catalog number: 352070 )
10 cm cell culture dish (Greiner Bio One, CellStar®, catalog number: 664160 )
0.2 μm 25 mm syringe filter (Pall, Acrodisc®, catalog number: 4612 )
30 ml syringe (BD, Luer-LokTM, catalog number: 302832 )
5 ml polystyrene fluorescence activated cell sorting (FACS) tubes (Corning, Falcon®, catalog number: 352054 )
100 μm nylon mesh cell strainer (Corning, Falcon®, catalog number: 352360 )
6-well-plates (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 140675 )
Human WAT from patients
OXOIDTM Phosphate buffered saline (PBS) tablets (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: BR0014G )
Dimethyl sulfoxide (DMSO) (Sigma-Aldrich, catalog number: D2650 )
Fetal bovine serum (FBS), heat inactivated (Thermo Fisher Scientific, GibcoTM, catalog number: 16140071 )
Bovine serum albumin (BSA) (Sigma-Aldrich, catalog number: A7906 )
Antibodies (see Table 1)
Isopropanol (EMD Millipore, catalog number: 109634 )
Collagenase type IA (Sigma-Aldrich, catalog number: C9891-1G )
Ammonium chloride (NH4Cl) (Sigma-Aldrich, catalog number: A0171 )
Note: This product has been discontinued.
Potassium bicarbonate (KHCO3) (Sigma-Aldrich, catalog number: P7682 )
Note: This product has been discontinued.
0.25% trypsin-EDTA (Thermo Fisher Scientific, GibcoTM, catalog number: 25200056 )
Dulbecco’s modified Eagle medium: nutrient mixture F-12 (DMEM/F-12) (1:1) (Thermo Fisher Scientific, GibcoTM, catalog number: 11330032 )
Penicillin-streptomycin (P/S) (Thermo Fisher Scientific, GibcoTM, catalog number: 15140122 )
Dexamethasone (Sigma-Aldrich, catalog number: D4902 )
10 mg/ml insulin solution from bovine pancreas (Sigma-Aldrich, catalog number: I0516 )
3-isobutyl-1-methylxanthine (IBMX) (Sigma-Aldrich, catalog number: I5879 )
Indomethacin (Sigma-Aldrich, catalog number: 17378 )
100% ethanol (EMD Millipore, catalog number: 100983 )
Table 1. Antibody information
Antigen
Antibody
Manufacturer
Dilution
Host/Isotype
CD34
hematopoietic cells
Anti-Human CD34 APC
Affymetrix, eBioscience,
catalog number: 17-0349
1:100
Mouse IgG1, kappa
CD31
Endothelial cells
Anti-Human CD31 APC
Affymetrix, eBioscience,
catalog number: 17-0319
1:100
Mouse IgG1, kappa
CD14
(Macrophages) hematopoietic cells
Anti-Human CD14 APC
Affymetrix, eBioscience,
catalog number: 17-0149
1:100
Mouse IgG1, kappa
CD11b
(Leukocytes) Monocytes
Anti-Human CD11b APC
Affymetrix, eBioscience,
catalog number: 17-0113
1:100
Mouse IgG1, kappa
CD45
(Nucleated cells of hematopoietic origin) lymphocytes
Anti-Human CD45 APC
Affymetrix, eBioscience,
catalog number: 17-9459
1:100
Mouse IgG1, kappa
CD106
(Activated) endothelial cells
Anti-Human CD106 PE
Affymetrix, eBioscience,
catalog number: 12-1069
1:100
Mouse IgG1, kappa
CD90
MSCs
Anti-Human CD90 APC
Affymetrix, eBioscience,
catalog number: 17-0909
1:100
Mouse IgG1, kappa
CD44
MSCs
Anti-Human CD44 APC
Affymetrix, eBioscience,
catalog number: 17-0441
1:100
Rat IgG2b, kappa
CD29
MSCs
Anti-Human CD29 APC
Affymetrix, eBioscience,
catalog number: 17-0299
1:100
Mouse IgG1, kappa
CD73
MSCs
Anti-Human CD73 APC
Affymetrix, eBioscience,
catalog number: 17-0739
1:100
Mouse IgG1, kappa
CD105
MSCs
Anti-Human CD105 APC
Affymetrix, eBioscience,
catalog number: 17-1057
1:100
Mouse IgG1
Paraformaldehyde (Sigma-Aldrich, catalog number: P6148 )
Oil Red O powder (Sigma-Aldrich, catalog number: O0625 )
Sodium hydroxide (NaOH) (Sigma-Aldrich, catalog number: 221465 )
Collagenase solution (1 mg/ml) (see Recipes)
Red blood cell (RBC) lysis buffer (10x) (see Recipes)
Proliferation medium (see Recipes)
Differentiation medium (see Recipes)
Induction medium (see Recipes)
Insulin medium (see Recipes)
10 mM dexamethasone stock solution (see Recipes)
1 mM dexamethasone working solution (see Recipes)
0.5 M IBMX stock solution (1,000x) (see Recipes)
200 mM indomethacin stock solution (1,600x) (see Recipes)
4% paraformaldehyde (PFA) (pH = 7.4) (see Recipes)
Oil Red O working solution (see Recipes)
Equipment
Cryogenic vials (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 366656 )
Laminar flow tissue culture hood
Sterilized surgical tools including forceps and scalpel or scissors
Mr. FrostyTM freezing container (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 5100-0001 )
Locator 6 Plus Rack and Box Systems, liquid nitrogen Dewar (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: CY50985-70 )
BD FACSCanto II flow cytometer (BD, model: BD FACSCanto II ) or similar equipment
Analytical balance (Sartorius, model: CPA124S )
MaxQTM 37 °C orbital shaker (Thermo Fisher Scientific, Thermo ScientificTM, model: 4450 )
Centrifuge with swinging bucket rotor (KUBOTA, model: 2800 )
Automated cell counter (Thermo Fisher Scientific, Countess®, catalog number: AMQAF1000 )
Software
FACSDiva software (BD)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Ge, X., Leow, S. C., Sathiakumar, D., Stünkel, W., Shabbir, A., So, J. B. Y., Lomanto, D. and McFarlane, C. (2016). Isolation and Culture of Human Adipose-derived Stem Cells from Subcutaneous and Visceral White Adipose Tissue Compartments. Bio-protocol 6(22): e2027. DOI: 10.21769/BioProtoc.2027.
Download Citation in RIS Format
Category
Stem Cell > Adult stem cell > Stromal cell
Cell Biology > Cell isolation and culture > Cell isolation
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,028 | https://bio-protocol.org/exchange/protocoldetail?id=2028&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Isolation and Primary Culture of Various Cell Types from Whole Human Endometrial Biopsies
Flavio Santos Vasconcelos Barros
Jan Joris Brosens
Paul John Brighton
Published: Vol 6, Iss 22, Nov 20, 2016
DOI: 10.21769/BioProtoc.2028 Views: 19202
Original Research Article:
The authors used this protocol in Feb 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Feb 2016
Abstract
The isolation and primary culture of cells from human endometrial biopsies provides valuable experimental material for reproductive and gynaecological research. Whole endometrial biopsies are collected from consenting women and digested with collagenase and DNase I to dissociate cells from the extracellular matrix. Cell populations are then isolated through culturing, filtering and magnetic separation using cell-surface antigen markers. Here we provide a comprehensive protocol on how to isolate and culture individual cell types from whole endometrial tissues for use in in vitro experiments.
Background
The human endometrium is the inner most mucosal layer of the uterus. It consists of a columnar epithelium and basal stromal layer that undergoes cyclical regeneration, growth and transformation in response to circulating hormones. The differentiation of the endometrial lining into a glandular secretory phenotype provides a hospitable environment for blastocyst implantation and successful pregnancy. In the absence of pregnancy this layer is shed, leading to menstruation. The isolation and culture of cells from human endometrial biopsies allows for in vitro functional assessment and the study of cell characteristics in relation to patient outcomes. The isolation and culture of endometrial cells is an invaluable research model to investigate many aspects of gynaecological and obstetrical medicine including infertility, implantation failure, recurrent miscarriage and menstrual disorders. Whole human endometrial biopsies contain human endometrial stromal cells (HESCs), luminal and glandular endometrial epithelial cells (HEECs), red blood cells and a mixed population of immune cells. HESCs can be easily and inexpensively isolated from whole biopsies and actively proliferate in culture for up to 5 passages without significant change in their growth dynamics. This provides a large window of opportunity for experimental analysis. Furthermore, within dissociated HESCs there is a sub-population of perivascular progenitor mesenchymal stem-like cells that can be isolated using the perivascular-specific antigen SUSD2 and its cognate antibody W5C5. Here we provide in detail an updated and expanded protocol from those published previously (Masuda et al., 2012; Chen and Roan, 2015) to describe steps in isolating and culturing different cell types from whole human endometrium. We provide further information on biopsy collection, detailed protocols for isolation of progenitor cells and additional procedures to increase epithelial cell yield and culturing efficiency.
Materials and Reagents
Petri-dish 92 x 16 mm (SARSTEDT, catalog number: 82.1473 )
Disposable scalpels (Swann Morton, catalog number: 0501 )
15 ml CELLSTAR® tubes (Greiner Bio One, catalog number: 188261 )
50 ml CELLSTAR® tubes (Greiner Bio One, catalog number: 227270 )
7 ml Bijoux tubes (Greiner Bio One, catalog number: 189176 )
FisherBrandTM Nylon mesh cell strainer, 40 µm (Thermo Fisher Scientific, Fisher Scientific, catalog number: 11587522 )
0.2 µm Minisart® NML syringe filter (Sartorius Stedim Biotech, catalog number: 16534-K )
20 ml syringes (BD, catalog number: 300613 )
60 ml syringes (BD, catalog number: 309653 )
Sterile pipette filter-tips 1,000 µl (Alpha Laboratories, catalog number: ZP1250S )
Sterile pipette filter-tips 100 µl (Alpha Laboratories, catalog number: ZP1200S )
FisherbrandTM glass Pasteur pipettes (Thermo Fisher Scientific, Fisher Scientific, catalog number: 1156-6963 )
MS columns (Miltenyi Biotec, catalog number: 130-042-201 )
Wallach Endocell® disposable endometrial cell sampler (Wallach Surgical Devices, catalog number: 908014A )
Human endometrial biopsies (see step A)
Cell culture media
DMEM/F12 (1:1) with phenol red (Thermo Fisher Scientific, GibcoTM, catalog number: 31330-038 )
L-glutamine (Thermo Fisher Scientific, GibcoTM, catalog number: 25030-081 )
Antibiotic/antimycotic (Thermo Fisher Scientific, GibcoTM, catalog number: 15240-062 )
β-estradiol (Sigma-Aldrich, catalog number: E2758 )
Recombinant human insulin (Sigma-Aldrich, catalog number: 91077C )
Acetic acid, glacial ≥ 99.7% (Sigma-Aldrich, catalog number: 695092 )
Tissue digestion media
DMEM/F12, phenol-free media (Thermo Fisher Scientific, GibcoTM, catalog number: 11039-021 )
Collagenase from Clostridium histolyticum (Sigma-Aldrich, catalog number: C9891-500MG )
DNase I from bovine pancreas (Roche Diagnostics, catalog number: 11284932001 )
Trypsin-EDTA, 0.25% (Thermo Fisher Scientific, GibcoTM, catalog number: 25200-056 )
Ficoll-paque plus medium (GE Healthcare, catalog number: 17-1440-02 )
Separation buffer (see Recipes)
Bovine serum albumin (BSA) (Sigma-Aldrich, catalog number: A2153 )
Phosphate-buffered saline (PBS) (Dulbecco A) OxoidTM (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: BR0014G )
PE anti-human SUSD2, clone: W5C5 antibody (Biolegend, catalog number: 327406 )
Anti-PE microbeads (Miltenyi Biotec, catalog number: 130-048-801 )
Ethanol, absolute (Thermo Fisher Scientific, Fisher Scientific, catalog number: 10437341 )
Sterile distilled water
Dextran-coated charcoal (DCC)-treated FBS (see Recipes)
Charcoal (Sigma-Aldrich, catalog number: C9157 )
Dextran 70 (Sigma-Aldrich, catalog number: 1179741 )
Fetal bovine serum (FBS) (Thermo Fisher Scientific, GibcoTM, catalog number: 10500-064 )
Digestion media (see Recipes)
Culture media (see Recipes)
Equipment
25 cm2 CELLSTAR® culture flasks (Greiner Bio One, catalog number: 690175 )
75 cm2 CELLSTAR® culture flasks (Greiner Bio One, catalog number: 658175 )
5 ml serological pipettes (Greiner Bio One, catalog number: 606180 )
10 ml serological pipettes (Greiner Bio One, catalog number: 607180 )
Pipette controller/pipette aid (e.g., STARLABS, catalog number: S7166-0010 )
Vacuum-driven 0.22 μm filtration system (EMD Millipore, catalog number: SCGPT05RE )
LUNATM BF automated cell counter (Logos Biosystems, catalog number: L10001 )
LUNATM cell counting slides (Logos Biosystems, catalog number: L12001 )
miniMACS separator (Miltenyi Biotec, catalog number: 130-042-102 )
MACS multistand (Miltenyi Biotec, catalog number: 130-042-303 )
Walker Class II cell culture microbiological safety cabinet (Walkers Safety Cabinets, model: Class II MSC )
FisherbrandTM FB 70155 aspirator (Thermo Fisher Scientific, Fisher Scientific, catalog number: 11533485 )
Grant Instruments water bath (Grant Instruments, model: OLS200 )
Thermo Scientific HeracellTM 150i humidified tissue culture incubator (set at 37 °C and 5% CO2) (Thermo Fisher Scientific, catalog number: 51026280 )
Sigma 3-16KL bench-top centrifuge (Sigma Laborzentrifugen, model: 3-16KL )
Bright-field Leica DMIL microscope (Leica Microsystems, model: Leica DMIL )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Barros, F. S. V., Brosens, J. J. and Brighton, P. J. (2016). Isolation and Primary Culture of Various Cell Types from Whole Human Endometrial Biopsies. Bio-protocol 6(22): e2028. DOI: 10.21769/BioProtoc.2028.
Download Citation in RIS Format
Category
Stem Cell > Adult stem cell > Stromal cell
Cell Biology > Cell isolation and culture > Cell isolation
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,029 | https://bio-protocol.org/exchange/protocoldetail?id=2029&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Nitrate Assay for Plant Tissues
Lufei Zhao
Yong Wang
Published: Vol 7, Iss 2, Jan 20, 2017
DOI: 10.21769/BioProtoc.2029 Views: 16763
Edited by: Marisa Rosa
Reviewed by: Laura Zanin
Original Research Article:
The authors used this protocol in Feb 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Feb 2016
Abstract
Nitrogen is an essential macronutrient for plant growth and nitrate content in plants can reflect the nitrogen supply of soil. Here, we provide the salicylic acid method to evaluate the nitrate content in plant tissues. The method is reliable and stable, thus it can be a good choice for measurement of nitrate in plant tissues.
Keywords: Nitrate content Plant Salicylic acid-sulphuric acid NaOH Standard curve Boil OD410
Background
Nitrogen is an important macronutrient required by plants for normal growth and development. Usually most plants absorb nitrogen mainly in the form of nitrate grown under aerobic conditions (Xu et al., 2016). To determine the nitrate accumulation in plants, we need to test the nitrate content in different tissues of plants. There are some methods for determination of nitrate, for example, potentiometric method (Carlson and Keeney, 1971), phenoldisulfonic acid method (Bremner, 1965), Cadium reduction (Huffman and Barbarick, 1981) and other methods. These methods have some disadvantages, such as lower sensitivity, interferences, technician exposure to carcinogenic chemicals (Cataldo et al., 1975; Vendrell and Zupancic, 1990)
Here, we provide the salicylic acid method that is free of interferences, reliable and stable. Nitrosalicylic acid is formed by the reaction of nitrate and salicylic acid under highly acidic conditions. The complex is yellow under basic (pH > 12) condition with maximal absorption at 410 nm. The absorbance is directly proportional to nitrate content. Therefore the nitrate content in tissues can be calculated based on their absorbances. This method is suitable for determination of nitrate concentration in plants.
Materials and Reagents
1.5 ml Eppendorf tubes
12-ml plastic culture tube (Greiner Bio One, catalog number: 184261 )
Quartz cuvettes
Arabidopsis thaliana roots and/or shoots (7-day-old seedlings)
Potassium nitrate (KNO3) (Sinopharm Chemical Reagent, catalog number: 10017218 )
Deionized water
MS medium
Liquid nitrogen
Salicylic acid (Sinopharm Chemical Reagent, catalog number: 30163517 )
Sulphuric acid (98%) (Sinopharm Chemical Reagent, catalog number: 100216008 )
Sodium hydroxide (NaOH) (Sinopharm Chemical Reagent, catalog number: 10019718 )
500 mg/L (0.0357 mol/L) KNO3 standard solution (see Recipes)
5% (w/v) salicylic acid-sulphuric acid (see Recipes)
8% (w/v) NaOH solution (see Recipes)
Equipment
50 ml flask
Frozen mixed ball grinding machine (RETCH, model: MM400 )
Visible light spectrophotometer (PGENERAL, catalog number: T6 )
Centrifuge (Eppendorf, model: 5424 )
Software
Excel
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Zhao, L. and Wang, Y. (2017). Nitrate Assay for Plant Tissues. Bio-protocol 7(2): e2029. DOI: 10.21769/BioProtoc.2029.
Download Citation in RIS Format
Category
Plant Science > Plant biochemistry > Other compound
Plant Science > Plant physiology > Nutrition
Biochemistry > Other compound > Nitrate
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
203 | https://bio-protocol.org/exchange/protocoldetail?id=203&type=1 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
PI (phosphoinositide)-3 Kinase Assay
HP Huan Pang
Published: Apr 20, 2012
DOI: 10.21769/BioProtoc.203 Views: 10631
Download PDF
Ask a question
Favorite
Cited by
Abstract
PI3-kinases regulate a wide range of cellular responses through the production of phosphatidylinositol 3, 4, 5-trisphosphate [PI (3, 4, 5) P (3)] in cellular membranes. This protocol provides a highly efficient and easy-to-handle method for sensitive detection and quantification of PI 3-kinase activity.
Materials and Reagents
Tris
NaCl
EDTA
Triton-X100
Glycerol
NaF
PMSF
Aprotinin
Leupeptin
Sepharose
NP-40
Tris-LiCl
TNE
P32 hot ATP (PerkinElmer, catalog number: NEG502A )
MgCl2
MnCl2
EGTA
Methanol
Chloroform
Acetic acid
Isopropanol
Lysis buffer
Pre-washed sepharose
ATP mix (see Recipes)
Phosphoinositol lipid (Avanti Polar Lipid, catalog number: 190082 ) (see Recipes)
Equipment
Centrifuges
Sonicator
Radiation hood
Silica gel TLC plate
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2012 The Authors; exclusive licensee Bio-protocol LLC.
Category
Biochemistry > Protein > Activity
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,030 | https://bio-protocol.org/exchange/protocoldetail?id=2030&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Ionization Properties of Phospholipids Determined by Zeta Potential Measurements
Murugappan Sathappa
Nathan N. Alder
Published: Vol 6, Iss 22, Nov 20, 2016
DOI: 10.21769/BioProtoc.2030 Views: 13471
Edited by: Marc-Antoine Sani
Reviewed by: Fernanda Salvato
Original Research Article:
The authors used this protocol in Jun 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jun 2016
Abstract
Biological membranes are vital for diverse cellular functions such as maintaining cell and organelle structure, selective permeability, active transport, and signaling. The surface charge of the membrane bilayer plays a critical role in these myriad processes. For most biomembranes, the surface charge of anionic phospholipids contributes to the negative surface charge density within the interfacial region of the bilayer. To quantify surface charge, it is essential to understand the proton dissociation behavior of the titratable headgroups within such lipids. We describe a protocol that uses model membranes for electrokinetic zeta potential measurements coupled with data analysis using Gouy-Chapman-Stern formalism to determine the pKa value of the component lipids. A detailed example is provided for homogeneous bilayers composed of the monoanionic lipid phosphatidylglycerol. This approach can be adapted for the measurement of bilayers with a heterogeneous lipid combination, as well as for lipids with multiple titratable sites in the headgroup (e.g., cardiolipin).
Background
Phospholipids are central building blocks of biological membranes (Figure 1). As amphipathic molecules, each contains a hydrophobic region consisting of acyl chains and a hydrophilic region consisting of a polar headgroup (Figure 1A). Some phospholipid headgroups are zwitterionic, containing both positively and negatively charged functional groups at physiological pH (Figure 1B), whereas others are acidic, bearing an overall formal negative charge (Figure 1C). Lipids within biomembranes exist stably as a lamellar assembly, forming bilayers in which the acyl chains of two leaflets interact to form a hydrophobic core and two interfacial regions consisting of the polar headgroups (Figure 1D). Most naturally occurring biomembranes contain a certain percentage of acidic phospholipids; therefore, their lipid composition imparts a net negative charge to the interfacial region (Gennis, 1989; Marsh, 2013). Bilayer surface charge is a key factor in many membrane-level processes including interactions with proteins and solution ions as well as membrane morphology, fusion and phase changes. Because the formal charge of lipid headgroups is a primary determinant of this surface charge, it is critical to have accurate measurements of the proton dissociation behavior (quantified as pKa values) of the constituent functional groups.
Figure 1. Phospholipid structure and the lamellar lipid bilayer. A. General structure of a glycerophospholipid. A common phospholipid is based on a scaffold of a central glycerol molecule (thickened line), with the constituent carbons designated by stereospecific numbering (sn-1, sn-2 and sn-3, as indicated). The hydrophobic domain consists of hydrocarbon tails esterified at the sn-1 and sn-2 positions. The polar headgroup contains a negatively charged phosphate group attached to the sn-3 position, which may be modified by an R group to render specific headgroup identity. B. Structure of phosphatidylcholine (R = choline) with a saturated 16 carbon aliphatic tail at the sn-1 position and an unsaturated 18 carbon tail at the sn-2 position. The zwitterionic nature of the headgroup is shown as the negative phosphate and the positive tertiary amine. C. Structure of phosphatidylglycerol (R = glycerol) with acyl chains identical to those shown above. The anionic nature of the headgroup is shown by the uncompensated negative charge on the phosphate. D. The lamellar lipid bilayer, showing the hydrocarbon core composed of the aliphatic lipid tails and the solvent-exposed interfacial regions.
The electric field that is established by charged headgroups results in a complex profile of electric potential in the aqueous region (Figure 2) (McLaughlin, 1977). Models for the electric potential profile are based on the physical chemistry of phase boundary interfaces, here representing a solid surface in contact with an aqueous phase (Oshima, 2010). Membrane surface electrostatics can be quantitatively modeled using Gouy-Chapman-Stern theory, which relates the density of charges on the membrane surface (σ, C m-2) and the electric potential (ψ, V), as described in the data analysis section. In a simplified model, the surface charge is comprised of charges that are fixed to the solid body as well as solution ions that are adsorbed tightly to the surface by chemical interactions. For lipid bilayers, the fixed charges can be considered to be the titratable acidic (phosphate) and basic (primary anime) functional groups of lipid headgroups, whereas the adsorbed ions are solution electrolytes that specifically bind headgroup sites with nonzero association constants (Tocanne and Teissie, 1990). This layer of charges is collectively defined as the Stern layer, but may be subdivided into other layers with increasing complexity. Adjacent to this region is a layer in which solvated solution ions are more diffusely distributed. In this region, termed the Gouy-Chapman layer, the distribution of counterions (those with charges opposite to the dominant surface charge) and coions (those with charges identical to the surface charge) arises from electrostatic attraction (counterions) or repulsion (coions) balanced with the entropic tendency of ions to diffuse away from the surface. Because counterions are highly enriched in this region due to electrostatic attraction to the surface, they act to screen the surface charge, thereby attenuating the electric field. Taken as a whole, this distribution of charges sets up the ‘diffuse electrical double layer’ of biomembranes.
Here we describe a methodology to determine the pKa of lipid headgroups using measurements of the electrostatic potentials of model membranes. This approach is based on the electrophoresis of lipid bilayer vesicles (liposomes), which we used in a recent publication to measure the proton dissociation behavior of the dimeric phospholipid cardiolipin (Sathappa and Alder, 2016). In the presence of an applied electric field, charged colloidal particles will migrate relative to the suspending liquid toward the electrode of opposing charge (Delgado et al., 2007). As the charged particle surface flows tangentially along the bulk fluid, there exists a thin layer of solution, termed the hydrodynamically stagnant layer, which moves with the particle. This layer extends into the diffuse region to a so-called slipping plane or shear plane. The electric potential at this layer that separates the hydrodynamically immobile layer from the bulk is termed the zeta potential (ζ) (Figure 2). The speed of migration depends on the electrophoretic mobility (μ, m2 V-1 s-1) of the particle, defined by the Helmholtz-Smoluchowski equation as the particle velocity per unit electric field:
Where, εr is the relative permittivity, ε0 is the permittivity of free space, and η is the viscosity of the solution (Aveyard and Haydon, 1973). As Eq. 1 shows, the mobility of charged particles in an external electric field is directly related to the magnitude of ζ. Hence, in an electrolyte solution of a given pH, liposomes with greater surface charge will have a higher ζ and therefore move with higher velocity in a given electric field.
Whereas optical electrophoresis measurements provide an unambiguous measure of electrokinetic mobility and zeta potential, translating these measurements into information on proton dissociation characteristics of titratable groups requires more detailed evaluation. This protocol explains the preparation of suitable model membranes, measurements of zeta potential using optical electrophoresis, and data analysis using Gouy-Chapman-Stern formalism to obtain lipid pKa values.
Figure 2. The electrostatic profile of the diffuse double layer. A liposome is a model membrane that consists of a vesicular lipid bilayer (left), whose surface and interfacial region in the aqueous phase can be modeled as an electrical double layer (right). In this model, a bilayer surface containing anionic phospholipids is modeled as a planar surface (gray) with uniformly distributed negative charges, from which an electric field originates (red shading). The distribution of solution electrolytes is shown for counterions (in this case, cations shown in blue) and coions (in this case, anions shown in red). Within the Stern layer, counterions are firmly bound to the bilayer surface. Within the Gouy-Chapman layer, solution ions are more disperse, reflecting a balance between Coulombic attraction (cations) or repulsion (anions) and thermal motion. The titratable charged lipid headgroups and adsorbed counterions together define the surface charge density (σ). The electric potential (ψ) assumes a maximum magnitude at the interface surface (ψ0) and attenuates toward the bulk solution (ψbulk) in a manner that is dependent on the ionic characteristics of the bathing solution. The electric potential at the slip plane, termed the zeta potential (ζ) is the measured parameter in this protocol.
Materials and Reagents
Kimble Corex tubes (30 ml) (Thermo Fisher Scientific, Fisher Scientific, catalog number: 0950037 )
Hamilton gas-tight syringe (Avanti Lipids Polar, catalog number: 610017 )
Polycarbonate membrane filters, 0.4 µm (Avanti Lipids Polar, catalog number: 610007 )
Wide-range pH test paper (Thermo Fisher Scientific, Fisher Scientific, catalog number: 14-850-1 )
Glass tube
4 ml semi-micro cuvettes (SARSTEDT, catalog number: 67.745 )
Hellma Suprasil quartz cuvette (Sigma-Aldrich, catalog number: Z802433 )
Glass vials
N2
1-palmitoyl-2-oleoyl-sn-glycero-3-phospho-(1’-rac-glycerol) (POPG) (Avanti Lipids Polar, catalog number: 840457C ) (Note 1)
Chloroform (Thermo Fisher Scientific, Fisher Scientific, catalog number: C298 )
Sodium chloride (NaCl) (Sigma-Aldrich, catalog number: S9888 )
Teflon-lined closures (Avanti Lipids Polar, catalog number: 600460 )
1-palmitoyl-2-oleoyl-sn-glycero-3-phosphocholine (POPC) (Avanti Lipids Polar, catalog number: 850457C )
1-palmitoyl-2-oleoyl-sn-glycero-3-phosphethanolamine (POPE) (Avanti Lipids Polar, catalog number: 850757C )
Ethanol
Potassium chloride (KCl)
Citric acid monohydrate (C6H8O7·H2O) (Sigma-Aldrich, catalog number: C1909 )
Sodium phosphate dibasic (Na2HPO4) (Sigma-Aldrich, catalog number: S7907 )
2-amino-2-methyl-1,3-propanediol (AMPD) (Sigma-Aldrich, catalog number: A9754 )
Iron (III) chloride hexahydrate (FeCl3·6H2O) (Sigma-Aldrich, catalog number: 236489 )
Millipore filter sterilized water (ddH2O) (EMD Millipore, catalog number: Milli-Q Advantage A10 water purification system )
Ammonium thiocyanate (NH4SCN) (Sigma-Aldrich, catalog number: 221988 )
Citrate-phosphate buffers (see Recipes)
AMPD buffer (see Recipes)
Ammonium ferrothiocyanate solution (see Recipes)
Equipment
Nitrogen tank
Fume hood
Vacuum desiccator (Eppendorf, model: Vacufuge Plus )
Nanoparticle size analyzer (Malvern Instruments, model: Zetasizer Nano S90 ) (Zetasizer Nano Series Technical Note, Malvern Instruments: https://caliscc.org/images/presentations/Morante_Zeta_Potential.pdf)
NanosphereTM polymer microsphere size standards, size 60 ± 2.7 nm (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 3060A )
Pasteur pipette
Vortexer (Bio-Rad Laboratories, model: BR 2000 )
Filter supports (Avanti Lipids Polar, catalog number: 610014 )
AccumetTM pH meter (Thermo Fisher Scientific, Fisher ScientificTM, catalog number: AB15 Plus )
Avanti Mini Extruder Kit (Avanti Lipids Polar, catalog number: 610023 )
Spectrophotometer (Thermo Fisher Scientific, Fisher Scientific, model: Ultrospec 2100 Pro )
Zeta potential analyzer (Brookhaven Instruments, model: ZetaPlus Zeta Potential Analyzer )
Zeta potential reference material (Brookhaven Instruments, catalog number: BI-ZR5 )
Software
Zetasizer software
Microsoft Excel
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Sathappa, M. and Alder, N. N. (2016). Ionization Properties of Phospholipids Determined by Zeta Potential Measurements. Bio-protocol 6(22): e2030. DOI: 10.21769/BioProtoc.2030.
Download Citation in RIS Format
Category
Biochemistry > Lipid > Lipid measurement
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,031 | https://bio-protocol.org/exchange/protocoldetail?id=2031&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Isolating and Measuring the Growth and Morphology of Pro-embryogenic Masses in Araucaria angustifolia (Bertol.) Kuntze (Araucariaceae)
Jackellinne Caetano Douétts-Peres
Vanildo Silveira
Marco Antonio Lopes Cruz
Claudete Santa-Catarina
Published: Vol 6, Iss 23, Dec 5, 2016
DOI: 10.21769/BioProtoc.2031 Views: 8889
Edited by: Scott A M McAdam
Original Research Article:
The authors used this protocol in Apr 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Apr 2016
Abstract
Embryogenic suspension cultures of Araucaria angustifolia (Bertol.) Kuntze (Araucariaceae) can be used as a model to test the effects of compounds added to the culture medium on the cellular growth and morphology of Pro-Embryogenic Masses (PEMs). PEMs are formed by embryogenic and suspensor-type cells. To measure changes in the cellular growth of embryogenic cultures, we performed sedimented cell volume (SCV) quantification, which is a non-destructive method. Morphological analysis by microscopy allowed for the observation of growth and development of PEMs and the alterations in embryogenic and suspensor-type cells. The methods used here provide an efficient means for monitoring the cellular growth of PEMs and identifying morphological changes during the development of embryogenic cultures. These studies can also be combined with biochemical and molecular analyses, such as proteomics, to further investigate embryo growth and morphology.
Keywords: Somatic embryogenesis Size Sedimented cell volume
Background
Silveira et al. (2006) used SCV measurements to analyze the effects of exogenous polyamines on the morphological changes of A. angustifolia PEMs and Osti et al. (2010) tested the effect of different nitric oxide donors on cellular growth and PEM morphology. Recently, Douétts-Peres et al. (2016) studied the effect of a cellular growth inhibitor on cellular growth and PEM morphology using SCV, fresh and dry weight, PEM area, and individual diameters of embryogenic-type cells, including the length and width of the suspensor-type cells. In addition, alterations to cellular growth and morphology in response to endogenous compounds, such as polyamines, nitric oxide and specific proteins have been evaluated using this method (Silveira et al., 2006; Osti et al., 2010; Douétts-Peres et al., 2016).
Materials and Reagents
Falcon tube rack (Kasvi, catalog number: K30-1552 )
12-well cell culture plates - disposable (TPP, catalog number: 92012 )
Manual pipette 200 µl tips (Corning, Axygen®, catalog number: T-200-Y )
Manual pipette 1,000 µl tips (Corning, Axygen®, catalog number: T-1000-B )
Aluminum foil
Glass slides (Kasvi, catalog number: K5-7101 )
Cover slips (Kasvi, catalog number: K5-2450 )
Falcon tubes, 50 ml (Kasvi, catalog number: K19-0050 )
Embryogenic suspension cultures of A. angustifolia, induced according to the methodology established by Steiner et al. (2005)
Cellulase (Sigma-Aldrich, catalog number: 22178 )
Potassium nitrate (KNO3) (Sigma-Aldrich, catalog number: V000944 )
Calcium chloride dihydrate (CaCl2·2H2O) (Sigma-Aldrich, catalog number: V000199 )
Magnesium sulfate heptahydrate (MgSO4·7H2O) (Sigma-Aldrich, catalog number: V001861 )
Potassium chloride (KCl) (Sigma-Aldrich, catalog number: V000104 )
Potassium dihydrogen phosphate (KH2PO4) (EMD Millipore, catalog number: 104873 )
MnSO4·H2O (Labsynth, catalog number: S2036 )
ZnSO4·7H2O (Labsynth, catalog number: S1072 )
Boric acid (H3BO3) (Sigma-Aldrich, catalog number: 31146 )
Potassium iodide (Kl) (Sigma-Aldrich, catalog number: V000130 )
Cobalt(II) chloride hexahydrate (CoCl2·6H2O) (Sigma-Aldrich, catalog number: V000213 )
CuSO4·5H2O (Labsynth, catalog number: S1054 )
Sodium molybdate dihydrate (Na2MoO4·2H2O) (Sigma-Aldrich, catalog number: M1651 )
FeSO4·7H2O (Labsynth, catalog number: S1057 )
Na2EDTA (Labsynth, catalog number: E2005 )
Myo-inositol (Sigma-Aldrich, catalog number: I17508 )
Nicotinic acid (Labsynth, catalog number: A1043 )
Pyridoxine (Sigma-Aldrich, catalog number: P9755 )
Thiamine (Sigma-Aldrich, catalog number: T4625 )
L-glutamine (Labsynth, catalog number: G1011 )
Sucrose (Labsynth, catalog number: 2731 )
MSG culture medium (see Recipes)
Equipment
Cell dissociation sieve-screens, 150 mesh (Sigma-Aldrich, catalog number: CD1-1KT ) sterilized by autoclave (121 °C, 30 min)
Chamber flow (or its equivalent) (Pachame, model: PA 220 )
Adapted glass Erlenmeyer flasks (custom-made) (Figure 1), sterilized by autoclave (121 °C, 30 min). This adjustment to the flask can be performed by a company that produces laboratory glassware, fusing a glass tube to an Erlenmeyer flask
Ruler
Orbital shaker (or its equivalent) (Cientec Equipamentos para Laboratório, model: CT-165 )
Analytical balance (or its equivalent) (Shimadzu, model: BL3200H )
Spatula sterilized by autoclave (121 °C, 30 min) (VWR, catalog number: 231-2233 )
AxioPlan light microscope (Carl Zeiss, model: AxioPlan )
Manual pipettes (or their equivalent) (Eppendorf, catalog numbers: 3120000062 and 3120000054 )
Forced air circulation drying oven (or its equivalent) (Ethik Technology, model: 420-6D )
AxioCam MRC5 digital camera (Carl Zeiss, model: AxioCam )
Desktop computer
Figure 1. Adapted Erlenmeyer flasks (100 and 50 ml) used in SCV analyses. For an adapted Erlenmeyer flask of 100 ml capacity, we used 25 ml of culture medium and 500 mg of fresh cells. For an adapted Erlenmeyer flask with 50 ml capacity, we used 10 ml of culture medium and 200 mg of fresh cells, with a ratio of 20 mg fresh cells to 1 ml of culture medium.
Software
AxioVision Rel. 4.8 software (Carl Zeiss, AxioVision)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
How to cite： Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Douétts-Peres, J. C., Silveira, V., Cruz, M. A. L. and Santa-Catarina, C. (2016). Isolating and Measuring the Growth and Morphology of Pro-embryogenic Masses in Araucaria angustifolia (Bertol.) Kuntze (Araucariaceae). Bio-protocol 6(23): e2031. DOI: 10.21769/BioProtoc.2031.
Douétts-Peres, J. C., Cruz, M. A., Reis, R. S., Heringer, A. S., de Oliveira, E. A., Elbl, P. M., Floh, E. I., Silveira, V. and Santa-Catarina, C. (2016). Mps1 (Monopolar Spindle 1) protein inhibition affects cellular growth and pro-embryogenic masses morphology in embryogenic cultures of Araucaria angustifolia (Araucariaceae). PLoS One 11(4): e0153528.
Download Citation in RIS Format
Category
Plant Science > Plant developmental biology > Morphogenesis
Cell Biology > Cell isolation and culture > Cell growth
Cell Biology > Tissue analysis > Tissue isolation
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,032 | https://bio-protocol.org/exchange/protocoldetail?id=2032&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Microplate Assay to Study Carboxypeptidase A Inhibition in Andean Potatoes
Mariana Edith Tellechea*
Javier Garcia-Pardo*
JC Juliana Cotabarren
DL Daniela Lufrano
LB Laura Bakas
Francesc Xavier Avilés
WO Walter David Obregon
Julia Lorenzo
Sebastián Tanco
*Contributed equally to this work
Published: Vol 6, Iss 23, Dec 5, 2016
DOI: 10.21769/BioProtoc.2032 Views: 9292
Edited by: Arsalan Daudi
Reviewed by: Manjula MummadisettiDaniel F. Caddell
Original Research Article:
The authors used this protocol in Dec 2015
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Dec 2015
Abstract
Metallocarboxypeptidases (MCP) are zinc-dependent exopeptidases that catalyze the hydrolysis of C-terminal amide bonds in proteins and peptides. They are involved in a wide range of physiological processes and have recently emerged as relevant drug targets in biomedicine (Arolas et al., 2007). In this context, the study and discovery of new MCP inhibitors from plants constitute a valuable approach for the development of new therapeutic strategies. Herein we describe a simple and accessible microplate method for the study of the specific and dose-response carboxypeptidase A inhibitory activities present in Andean potato tubers. Our protocol combines an extraction method optimized for small protein inhibitors in plant tissues, with the measurement of enzyme kinetics using a microplate reader. These instruments are capable of reading small sample volumes, for many samples in a very short time-frame, therefore reducing the time and costs of high-throughput screening experiments. Although this protocol describes the study of Andean potatoes, our approach is also applicable to the analysis other plant samples.
Keywords: Metallocarboxypeptidase Carboxypeptidase A Inhibitor Inhibitory activity Microplate assay Potatoes
Background
In higher plants, small proteinaceous protease inhibitors are wound-induced molecules produced as a part of its defense system against insect attack (Graham et al., 1981; Villanueva et al., 1998). Among the studied inhibitors, only two are specific for MCP, i.e., the potato carboxypeptidase inhibitor (PCI) and its close homolog found in tomato plants (TCI). Over the last few decades, the presence of MCP inhibitors in Solanaceae has been extensively reported, revealing potato (Solanum tuberosum) as one of the most important sources of MCP inhibitors (Hass et al., 1979; Obregón et al., 2012; Lufrano et al., 2015). In humans, MCP action is exquisitely regulated and dysregulation of its function might lead to disease or even to cell death (Arolas et al., 2007). In fact, MCP have been associated with human pathologies such as acute pancreatitis (Appelros et al., 1998), diabetes (Cool et al., 1997), several types of cancer (Ross et al., 2009; Sun et al., 2016; Abdelmagid et al., 2008; Tsakiris et al., 2008), fibrinolysis (Valnickova et al., 2007), inflammation (Deiteren et al., 2009) or neurodegeneration (Rogowski et al., 2010). In this context, there is an interest in the discovery of new MCP inhibitors, and thus we focus our studies in potatoes that are native from the Andean region of South America. In this region, thousands of different potato varieties coexist, constituting a natural reservoir for the discovery of novel MCP inhibitors (Figure 1).
Figure 1. Andean potatoes and potato extract CPA inhibitory activity. A. Picture displaying the large number of potato varieties found within the Andean region. Currently in this region coexist thousands of Andean varieties of Solanum tuberosum (Machida-Hirano, 2015; Clausen et al., 2010). B. Effects of potato extracts on bCPA activity. The activity of bovine CPA (bCPA) was measured using the substrate N-(4-methoxyphenylazoformyl)-Phe-OH determining the decrease in absorbance at 340 nm in function of the time. Due to its high content in MCP inhibitors, the addition of potato extract to the reaction decreases the rate of substrate hydrolysis in a dose-response manner.
Here, we describe a simple protocol to determine the specific and dose-response carboxypeptidase A inhibitory activity present in Andean potatoes and in other biological extracts using microplates. The major advantage of this protocol over other available approaches (Yanes et al., 2007) is that the use of microplates allows multiple enzymatic measurements to be done in a single experiment, therefore reducing the time and costs.
Materials and Reagents
50 ml tubes
96-well microplates, clear flat bottom (Corning, catalog number: 3364 )
Syringe filters, 0.45 μm pore size (EMD Millipore, catalog number: SLHP033RS )
Potato tubers
General laboratory materials and instrumentation (e.g., micropipettes, microtubes, tips)
Bradford assay kit, e.g., Coomassie Plus Assay Kit (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 23236 )
Bovine serum albumin (BSA)
N-(4-methoxyphenylazoformyl)-Phe-OH·potassium salt (Bachem, catalog number: M-2245 )
Trizma® base (Sigma-Aldrich, catalog number: T1503 )
Sodium chloride (NaCl) (Sigma-Aldrich, catalog number: S7653 )
Hydrochloric acid (HCl) (Sigma-Aldrich, catalog number: 258148 )
Dimethyl sulfoxide (DMSO) (Sigma-Aldrich, catalog number: D4540 )
Bovine carboxypeptidase A (bCPA) (Sigma-Aldrich, catalog number: C9268 )
Carboxypeptidase A reaction buffer/Extraction buffer (see Recipes)
2 mg/ml bCPA stock solution (see Recipes)
10x bCPA working solution (see Recipes)
1,000x substrate stock solution (see Recipes)
10x substrate working solution (see Recipes)
Equipment
Laboratory blender or equivalent (Oster, catalog number: 004093-008-NP0 )
Refrigerated centrifuge (suitable for volumes of 50 ml) (Beckman Coulter, model: Avanti J-26 XPI )
UV-Vis microplate spectrophotometer system capable of operating at 340 and 595 nm (e.g., PerkinElmer, model: Victor X 2030-0050 or other equivalent spectrophotometer)
pH meter (HACH LANGE SPAIN, Crison, model: GLP 21 )
37 °C oven (e.g., Thermo Fisher Scientific, Thermo ScientificTM, model: Heratherm Compact Microbiological Incubator )
Multichannel pipette (e.g., Technology Networks, model: CappAero Multichannel Pippete 25-200 μl )
Software
GraphPad Prism 5 software (GraphPad Software, Ing USA)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Tellechea, M. E., Garcia-Pardo, J., Cotabarren, J., Lufrano, D., Bakas, L., Avilés, F. X., Obregon, W. D., Lorenzo, J. and Tanco, S. (2016). Microplate Assay to Study Carboxypeptidase A Inhibition in Andean Potatoes. Bio-protocol 6(23): e2032. DOI: 10.21769/BioProtoc.2032.
Download Citation in RIS Format
Category
Plant Science > Plant biochemistry > Protein
Plant Science > Plant molecular biology > Protein
Biochemistry > Protein > Activity
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,033 | https://bio-protocol.org/exchange/protocoldetail?id=2033&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Extraction and Measurement of Abscisic Acid in a Unicellular Red Alga Cyanidioschyzon merolae
Yuki Kobayashi
Kan Tanaka
Published: Vol 6, Iss 23, Dec 5, 2016
DOI: 10.21769/BioProtoc.2033 Views: 10917
Edited by: Maria Sinetova
Reviewed by: Sriema L. WalawageScott A M McAdam
Original Research Article:
The authors used this protocol in May 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
May 2016
Abstract
Abscisic acid (ABA) has been known as a phytohormone of land plants, which is synthesized in response to abiotic stresses and induces various physiological responses, but is also found from eukaryotic algae. Recently, we reported that a unicellular red alga Cyanidioschyzon merolae produced ABA, which prevented cell growth and enhanced salt stress tolerance (Kobayashi et al., 2016). This report describes the detailed method for the extraction and quantification of ABA in the model red alga C. merolae.
Keywords: Abscisic acid Cyanidioschyzon merolae Algae HPLC Phytohormone
Background
The phytohormone ABA has been found in divergent photosynthetic eukaryotes, but the function in unicellular algae remained unclear. In a recent study, we showed that a unicellular red alga C. melorae accumulates ABA in response to salt stress by the present protocol. This is the detail of the first published protocol for the extraction and quantification of ABA from C. merolae. This protocol is optimized for C. merolae based on the land plant protocol.
Materials and Reagents
500 ml centrifuge bottle (Hitachi, model: S305830A )
Membrane filters Millex-GV syringe filter unit 0.22 μm (EMD Millipore, catalog number: SLGV033RS )
Wild type C. merolae 10D cells (National Institute for Environmental Studies, Japan)
Abscisic acid (Sigma-Aldrich, catalog number: A4906-250UG )
NaCl (Wako Pure Chemical Industries, catalog number: 195-15975 )
Liquid nitrogen
Acetic acid (Wako Pure Chemical Industries, catalog number: 017-00256 )
Diethyl ether (Wako Pure Chemical Industries, catalog number: 052-01165 )
Methanol (HPLC grade) (Wako Pure Chemical Industries, catalog number: 132-06471 )
Boric acid (H3BO3) (Wako Pure Chemical Industries, catalog number: 021-15645 )
Manganese(II) chloride tetrahydrate (MnCl2·4H2O) (Wako Pure Chemical Industries, catalog number: 133-00725 )
Zinc sulfate heptahydrate (ZnSO4) (Wako Pure Chemical Industries, catalog number: 265-00415 )
Sodium molybdate dehydrate (Na2MoO4·2H2O) (Wako Pure Chemical Industries, catalog number: 514-30001 )
Copper(II) sulfate pentahydrate (CuSO4) (Wako Pure Chemical Industries, catalog number: 034-20065 )
Cobalt(II) nitrate hexahydrate (Co[NO3]2·6H2O) (Wako Pure Chemical Industries, catalog number: 031-03752 )
Ammonium sulfate ([NH4]2SO4) (Wako Pure Chemical Industries, catalog number: 016-03445 )
Magnesium sulfate heptahydrate (MgSO4·7H2O) (Wako Pure Chemical Industries, catalog number: 138-00415 )
Sulfuric acid (H2SO4) (Wako Pure Chemical Industries, catalog number: 195-04706 )
Potassium dihydrogen phosphate (KH2PO4) (Wako Pure Chemical Industries, catalog number: 166-04255 )
Calcium chloride (CaCl2) (Wako Pure Chemical Industries, catalog number: 036-00485 )
Iron(III) chloride hexahydrate (FeCl3) (Wako Pure Chemical Industries, catalog number: 090-02802 )
Na2EDTA (Wako Pure Chemical Industries, catalog number: 345-01865 )
Polyvinylpyrrolidone K-30 (Nacalai tesque, catalog number: 28314-82 )
2,6-di-tert-butyl-p-cresol (Tokyo chemical industry, catalog number: D0228 )
MA2 medium (see Recipes)
Extraction solution (see Recipes)
Equipment
Spectrophotometer (Beckman Coulter, model: DU730 )
Refrigerated centrifuge (Hitachi, model: CF16RXII )
Angle rotor (Hitachi, model: R10A3 )
Mortar and pestle
Vortex mixer (M & S Instruments, model: VORTEX-GENIE 2 Mixer )
Microcentrifuge (TOMY DIGITAL BIOLOGY, model: MX150 )
Vacuum centrifugal evaporator with low temperature trapper (TOMY DIGITAL BIOLOGY, model: CC-105 system )
pH meter (As One, model: KR5E )
HPLC system (Shimadzu, model: X2 HPLC system ) equipped with a photodiode array detector (PDA) and column (5 μm, 4.6 x 250 mm) (Senshu Scientific, model: ODS SP100 )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Kobayashi, Y. and Tanaka, K. (2016). Extraction and Measurement of Abscisic Acid in a Unicellular Red Alga Cyanidioschyzon merolae. Bio-protocol 6(23): e2033. DOI: 10.21769/BioProtoc.2033.
Download Citation in RIS Format
Category
Plant Science > Plant biochemistry > Plant hormone
Biochemistry > Other compound > Plant hormone
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,034 | https://bio-protocol.org/exchange/protocoldetail?id=2034&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Fusarium graminearum Maize Stalk Infection Assay and Associated Microscopic Observation Protocol
Juan He
Tinglu Yuan
Wei-Hua Tang
Published: Vol 6, Iss 23, Dec 5, 2016
DOI: 10.21769/BioProtoc.2034 Views: 11013
Edited by: Arsalan Daudi
Reviewed by: Baohua LiKumiko Okazaki
Original Research Article:
The authors used this protocol in Mar 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Mar 2016
Abstract
The ascomycete fungus Fusarium graminearum (previously also called Gibberella zeae) causes Gibberella stalk rot in maize (Zea mays) and results in lodging and serious yield reduction. To develop methods to assess the fungal growth and symptom development in maize stalks, we present here a protocol of maize stalk inoculation with conidiospores of fluorescent protein-tagged F. graminearumand microscopic observation of the stalk infection process. The inoculation protocol provides repeatable results in stalk rot symptom development, and allows tracking of fungal hyphal growth inside maize stalks at cellular scale.
Keywords: Fusarium graminearum Maize stalk rot Intercellular invasion Plant fungal pathogen Inoculation
Background
Maize (Zea mays) is one of the most important crops across the world. The stalk is the main stem of a maize plant. It is composed of nodes and internodes (Figure 1). The internodes comprise rind and pith, and vascular tissues are scattered in the pith. Figure 1 shows the microscopic images of maize stalk sections under bright field or GFP fluorescence channel. This provides context for maize stalk inoculation and observation.
The ascomycete fungus Fusarium graminearum (previously also called Gibberella zeae) causes Gibberella stalk rot in maize (Zea mays) and results in lodging and yield loss (Jackson et al., 2009; Santiago et al., 2007). F. graminearumcan also cause seedling blight and ear rot of maize, and Fusarium head blight of wheat and barley (Jackson et al., 2009). In the field, ascospores of F. graminearumoverwinter on infected crop residues such as maize stalks and wheat straw, and may infect other plants through wounds (e.g., caused by hail or pests), or may enter through young roots, and start a new infection cycle (Jackson et al., 2009). Although the entering routes and disease development time course may differ, the final symptom for maize Gibberella stalk rot is in the stalk of adult maize plant, which directly leads to lodging and yield loss.
Figure 1. Anatomy of maize stalk. Uninfected internodes of maize stalk at V11 stage shown as reference for understanding F. graminearumprogression. V: vascular bundle. P: parenchyma cells. Green bar = 5 cm; White bars = 100 μm.
Compared to the inoculation method for assessing wheat head blight development (Pritsch et al., 2000 and 2001; Proctor et al., 1995), the inoculation method for maize stalk rot is less well established. To assess plant resistance or fungal virulence regarding maize stalk rot, two major types of inoculation methods have been reported. One is inoculation of young roots (Yang et al., 2010), which mimics the route of one type of natural infection, but has great variance in the time before stalk symptoms develop among individual maize plants, which makes follow-up microscopic observations difficult. The other is inoculation of mature stalk by wounding, usually at the internode immediately below the tassel (Zhou et al., 2010; Zheng et al., 2012) or at the internode immediately above aerial root node (Reid et al., 1996; Santiago et al., 2007) and then assessing lesions after 14 days. Recently we reported a method of wounding inoculation of maize stalks at lower internodes in combination with fluorescent protein-expressing fungi, which provided more synchronic symptom development for microscopic tracking of the infection process at the cellular scale (Zhang et al., 2016).
Materials and Reagents
Sterile gauzes (regular cotton yarn 21s, 100% absorbent cotton, for medical use, many brands will work, we used 500 g pack from Shanghai HongLong Medical Material Company)
Sterile 250 ml-centrifuge bottles (Beckman Coulter, catalog number: 356011 )
1.5 ml sterile centrifuge tube (Corning, Axygen®, catalog number: MCT-150-C )
500 ml flasks
Single-side razor blades (CLOUD, YIZUN BRAND, catalog number: DD75 )
Microscope slides (Grale Scientific, Sail Brand, catalog number: 7103 )
Microscope cover slides (CITOTEST LABWARE MANUFACTURING, catalog number: 80330-2810 )
Fungal strains: The F. graminearum strain PH-1 expressing fluorescent protein AmCyan under the promoter of VM3 from Neurospora crassa (AmCyanPH-1) (Yuan et al., 2008; Zhang et al., 2012).
Plant material: Maize (Zea mays ssp. mays L.) cultivar B73 plants (Schnable et al., 2009) were cultivated in a phytotron at 22-26 °C with 65% relative humidity and a 14 h photoperiod for 8 weeks until the tenth leaf appeared.
Glycerol (Sinopharm Chemical Reagent, catalog number: 10010618 )
V8 vegetable juice (Campbell Soup Company, catalog number: V8® ORIGINAL )
CaCO3
1.5% agar powder
Mung bean
V8 juice agar medium (see Recipes)
Mung bean liquid medium (see Recipes)
Equipment
Growth chamber (Jiangnan, model: RXZ-1000 )
Incubator (Yiheng, model: MJ-150I )
Biological safety cabinet (ESCO Micro, model: FHC1200A )
Sterile tweezers (Stainless Steel Tweezers)
Constant temperature shaker (Taicang, model: DHZ-DA )
Haemocytometer (0.10 mm, 1/400 mm2 ) (QIUJING, model: XB-K-25 )
Fluorescent microscope (Olympus, model: BX51 )
Confocal microscope (Olympus, models: Fv10i and Fluoview FV1000 )
Centrifuge (Beckman Coulter, model: Avanti J-E )
Software
ImageJ software (http://rsbweb.nih.gov/ij/index.html)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
How to cite： Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
He, J., Yuan, T. and Tang, W. (2016). Fusarium graminearum Maize Stalk Infection Assay and Associated Microscopic Observation Protocol. Bio-protocol 6(23): e2034. DOI: 10.21769/BioProtoc.2034.
Zhang, Y., He, J., Jia, L. J., Yuan, T. L., Zhang, D., Guo, Y., Wang, Y. and Tang, W. H. (2016). Cellular tracking and gene profiling of Fusarium graminearum during maize stalk rot disease development elucidates its strategies in confronting phosphorus limitation in the host apoplast. PLoS Pathog 12(3): e1005485.
Download Citation in RIS Format
Category
Plant Science > Plant immunity > Disease bioassay
Plant Science > Plant physiology > Phenotyping
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,035 | https://bio-protocol.org/exchange/protocoldetail?id=2035&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Murine Leukemia Virus (MLV)-based Coronavirus Spike-pseudotyped Particle Production and Infection
Jean Kaoru Millet
GW Gary R. Whittaker
Published: Vol 6, Iss 23, Dec 5, 2016
DOI: 10.21769/BioProtoc.2035 Views: 13326
Edited by: Longping Victor Tse
Reviewed by: Smita Nair
Original Research Article:
The authors used this protocol in Oct 2014
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Oct 2014
Abstract
Viral pseudotyped particles (pp) are enveloped virus particles, typically derived from retroviruses or rhabdoviruses, that harbor heterologous envelope glycoproteins on their surface and a genome lacking essential genes. These synthetic viral particles are safer surrogates of native viruses and acquire the tropism and host entry pathway characteristics governed by the heterologous envelope glycoprotein used. They have proven to be very useful tools used in research with many applications, such as enabling the study of entry pathways of enveloped viruses and to generate effective gene-delivery vectors. The basis for their generation lies in the capacity of some viruses, such as murine leukemia virus (MLV), to incorporate envelope glycoproteins of other viruses into a pseudotyped virus particle. These can be engineered to contain reporter genes such as luciferase, enabling quantification of virus entry events upon pseudotyped particle infection with susceptible cells. Here, we detail a protocol enabling generation of MLV-based pseudotyped particles, using the Middle East respiratory syndrome coronavirus (MERS-CoV) spike (S) as an example of a heterologous envelope glycoprotein to be incorporated. We also describe how these particles are used to infect susceptible cells and to perform a quantitative infectivity readout by a luciferase assay.
Keywords: Pseudotyped particle Murine leukemia virus Envelope glycoprotein Coronavirus Spike
Background
Viral pseudotyped particles are very useful tools for studying the entry pathways that enveloped viruses use and for generating novel gene-delivery vectors. These synthetic enveloped viruses are derived from a parental virus, usually a rhabdovirus or a retrovirus, which forms the core of the particle that can incorporate in its membrane a wide range of viral envelope glycoproteins from heterologous viruses. Several model viruses such as the retroviral murine leukemia virus (MLV) and human immunodeficiency virus-1 (HIV-1) or the rhabdoviral vesicular stomatitis virus (VSV) have been successfully used to generate viral pseudotyped particles (also named pseudoviruses or pseudovirions). Virus pseudotyping is particularly useful for the following scenarios: (i) to quantify the viral entry process of enveloped viruses using reporter genes like green fluorescent protein (GFP) or luciferase, (ii) to study host cell entry of enveloped viruses that cannot be cultivated in cell culture, (iii) to study entry pathways of risk group (RG) 3 or 4 viral pathogens when biosafety level (BSL) 3 or 4 facilities are not available, (iv) to generate cells stably expressing a specific gene of interest or for specific gene silencing, (v) to produce vectors for gene delivery allowing control over cell tropism. Pseudotyped particles can be used to complement native virus infection assays, especially regarding study of virus entry events.
The protocol described here is highly adaptable both in terms of scale of production and type of envelope glycoprotein that can be incorporated. It has been extensively used in our research on viral entry of various enveloped viruses, including VSV (Sun et al., 2008), influenza virus (Tse et al., 2014) and coronaviruses (Belouzard et al., 2009; Millet and Whittaker 2014; Millet et al., 2016). We have successfully used this method to pseudotype viral envelope glycoproteins from all three classes of viral fusion proteins: influenza hemagglutinin (HA, class I), coronavirus spike (S, class I), Ebola glycoprotein (GP, class I), Semliki forest virus (SFV) E1 (class II), and vesicular stomatitis virus (VSV) G glycoprotein (class III). The technique described here is based on work performed by Bartosch and colleagues (Bartosch et al., 2003), and employs the so-called ‘three-plasmid’ co-transfection strategy in which producer HEK-293T/17 cells are co-transfected with the following plasmids: a plasmid allowing expression of MLV retroviral core genes gag and pol but lacking the MLV envelope glycoprotein-encoding env gene, a transfer vector containing a luciferase reporter gene flanked by retroviral regulatory LTR regions and a packaging signal, along with a plasmid allowing expression of the desired envelope glycoprotein. The co-expression of these three plasmids allows synthesis of LTR-flanked reporter gene-containing RNA, MLV-derived proteins and heterologous envelope glycoprotein. During pseudotyped particle formation, which occurs at the plasma membrane, the RNAs containing the LTR-flanked luciferase gene get incorporated into nascent particles formed by assembly and budding of MLV capsid proteins that also recruit heterologous viral envelope glycoproteins. Upon infection in susceptible cells, the pseudotyped virus entry pathway is solely governed by the heterologous virus envelope glycoprotein used. As such, pseudovirions are excellent surrogates to study the entry pathway of enveloped viruses. Once virus entry has occurred, the pseudotyped virus RNAs are released in the cell and the retroviral reverse transcriptase and integrase then reverse transcribe the molecules into double stranded DNA and integrate them into the genome of target cells. Because the sequence that gets integrated only contains the gene encoding the luciferase reporter but none of the MLV genes, the pseudotyped particles are inherently safer as they only allow for one round of infection. After infection, a simple luciferase assay allows quantification of infectivity of the pseudotyped particle studied.
The following protocol can form the basis of useful experiments for the study of the heterologous envelope glycoprotein function during virus entry, for example by performing the infection assay using different infection conditions such as receptor/co-receptor expression in target cells, virus binding time and temperature, pH, endocytosis inhibitors, protease inhibitors, neutralizing antibodies, etc.
Materials and Reagents
Cell culture vessels, plates and tubes
50 ml Falcon tubes (TrueLine, catalog number: TR2004 )
Cell counting slides with grids (KOVA, catalog number: 87144 )
T75 75 cm2 cell culture flasks (TrueLine, catalog number: TR6002 )
6-well cell culture plates (TrueLine, catalog number: TR5000 )
24-well cell culture plates (TrueLine, catalog number: TR5002 )
1.5 ml Eppendorf tubes
0.22 µm cell culture medium filtration unit (LPS, catalog number: 1102-RLS )
Pseudotyped virus solution filtration
0.45 µm filter (Pall, catalog number: 4184 )
10 ml syringes (BD, catalog number: 309604 )
Pipettes and pipettors
Pipettor set:
P1000 (Gilson, catalog numbers: F123602 )
P200 (Gilson, catalog numbers: F123601 )
P20 (Gilson, catalog numbers: F123600 )
Stripettor for pipetting with serological pipette (Corning, catalog number: CLS4910-1EA )
Note: This product has been discontinued.
Sterile serological pipettes:
25 ml (LPS, catalog numbers: TR37129 )
10 ml (LPS, catalog numbers: TR37128 )
5 ml (LPS, catalog numbers: TR37127 )
Repeater dispenser (Eppendorf, catalog numbers: 4981000.019 / 022260201 )
Note: This product has been discontinued.
10 ml sterile tips (Eppendorf, catalog numbers: 0030089677 )
5 ml sterile tips (Eppendorf, catalog numbers: 0030089561 )
Cells
Human embryonic kidney (HEK) HEK-293T/17 cells (ATCC, catalog number: CRL-11268 ), maintained in T75 flasks with complete DMEM (DMEM-C)
Human hepatic Huh-7 cells (National Institutes of Biomedical Innovation, Health and Nutrition, catalog number: JCRB0403 ), maintained in T75 flasks with DMEM-C
Transfection plasmids and reagents
Plasmids pCMV-MLVgag-pol (ampicillin resistance) (Bartosch et al., 2003)
pTG-Luc (ampicillin resistance) (Bartosch et al., 2003)
pCAGGS-MERS-S (ampicillin resistance) (Millet and Whittaker, 2014)
pCAGGS-VSV-G (ampicillin resistance)
pCAGGS (ampicillin resistance)
Lipofectamine 2000 (Thermo Fisher Scientific, InvitrogenTM, catalog number: 11668-027 )
Opti-minimal essential medium (Opti-MEM) (Thermo Fisher Scientific, GibcoTM, catalog number: 31985-070 )
Disinfection/decontamination reagents
Ethanol (95%) (VWR, BDH®, catalog number: BDH1158-4LP ) diluted to 70% with water in spray bottle for surface disinfection
Paper towels to soak in 70% ethanol and wipe surfaces to disinfect (Georgia-Pacific Consumer Products, catalog number: 23304 )
Bleach solution for decontamination (The Clorox Company, catalog number: Germicidal Bleach )
Cell culture reagents
0.25% trypsin EDTA solution (Mediatech, catalog number: 25-053-Cl )
Dulbecco’s phosphate buffered saline (DPBS) with Ca2+ and Mg2+ (Mediatech, catalog number: 21-030-CV )
Dulbecco’s modification of Eagles medium (DMEM) with 4.5 g/L glucose, L-glutamine but without sodium pyruvate (Mediatech, catalog number: 10-017-CV )
Heat-inactivated fetal bovine serum (FBS) (Thermo Fisher Scientific, GibcoTM, catalog number: 1614071 )
100x penicillin-streptomycin (PS) solution (Mediatech, catalog number: 30-002-Cl )
1 M N-2-hydroxyethylpiperazine-N'-2-ethanesulfonic acid (HEPES) solution (Mediatech, catalog number: 25-060-Cl )
Luciferase assay reagents
Luciferase assay lysis buffer (Promega, catalog number: E1531 )
Luciferin substrate (Promega, catalog number: E1501 )
Sterile water (VWR, catalog number: E476-1L )
Others
Cryovials
Complete DMEM (DMEM-C) (see Recipes)
Transfection DMEM (DMEM-T) (see Recipes)
Equipment
Temperature-controlled water bath (Labnet, model: W1106A )
Biosafety cabinet (Class II-A2) connected to a vacuum aspiration system (Labconco, model: 3440009 )
Inverted light microscope with 10x objective (Nikon Instruments, model: TS100 ) for checking cell density and health
Plate rocker in 37 °C 5% CO2 cell culture incubator (Thermo Fisher Scientific, Fisher ScientificTM, model: 13-687-704 )
Plate rocker, room temperature (VWR, model: 40000-300 )
37 °C 5% CO2 humidified cell culture incubator – Symphony (VWR, model: 98000-368 )
Vortex Genie (Scientific Industries, model: G560 )
Pocket calculator (Sharp Elsimate, Sharp, model: EL-334TB )
Inverted light microscope with 10x objective (Carl Zeiss, model: Axiovert 200 ) connected to a CCD camera (PCO, model: Sensicam QE )
Centrifuge (Eppendorf, model: 5810R )
GloMax 20/20 luminometer (Promega, model: 2030-100 )
Lab refrigerator set at 4 °C (GE Appliances, model: GMR06AAMBRWW )
Lab freezer set at -20 °C (SUMMIT APPLIANCE, model: FS-603 )
Lab freezer set at -80 °C (Thermo Fisher Scientific, Thermo ScientificTM, model: UXF30086A )
Timer (VWR, catalog number: 61161-346 )
Software
Prism (GraphPad, version 7)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Millet, J. K. and Whittaker, G. R. (2016). Murine Leukemia Virus (MLV)-based Coronavirus Spike-pseudotyped Particle Production and Infection. Bio-protocol 6(23): e2035. DOI: 10.21769/BioProtoc.2035.
Download Citation in RIS Format
Category
Microbiology > Microbe-host interactions > Virus
Microbiology > Microbe-host interactions > In vitro model
Molecular Biology > DNA > Transfection
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,036 | https://bio-protocol.org/exchange/protocoldetail?id=2036&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
In vitro Autophosphorylation and Phosphotransfer Assay of Cyanobacterial Histidine Kinase 2
Iskander M. Ibrahim
Published: Vol 6, Iss 23, Dec 5, 2016
DOI: 10.21769/BioProtoc.2036 Views: 10532
Edited by: Maria Sinetova
Reviewed by: Anna A. ZorinaTatsuki Kunoh
Original Research Article:
The authors used this protocol in Feb 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Feb 2016
Abstract
This is a detailed protocol of an autophosphorylation and phosphotransfer activities of Synechocystis sp. PCC 6803 full-length Histidine Kinase 2 (Hik2) protein described by Ibrahim et al., 2016. In this protocol, radioactively labelled ATP was used to study an autophosphorylation and phosphotransfer activity of the full-length Hik2 protein.
Keywords: Histidine Kinase 2 Autophosphorylation Phosphotransfer Rre1 RppA Synechocystis sp. PCC 6803
Background
Protein phosphorylation is an important post-translational modification of proteins that takes place in every living organism. The activity of protein kinases, the enzyme that catalyses the phosphorylation of proteins, was first described by Burnett and Kennedy in 1954, where they showed phosphorylation of casein by a liver enzyme (Burnett and Kennedy, 1954). However, its significance was not appreciated until the 1970s and 1980s (Cohen, 2002). The transfer of the γ-phosphate from an ATP molecule to proteins can be studied using coupled assays or directly with radioactively labelled ATP. Kinase assays based on incorporation of 32P can easily be followed by autoradiography, whereas coupled assays require monitoring of indirect reporter enzyme-catalysed colorimetric or chemiluminescence signals. The work presented here was conducted using radioactive ATP. Serine/threonine-type protein kinases dominate in eukaryotes, while in prokaryotes histidine kinases are the primary protein kinases involved in signal transduction. A histidine kinase catalyses the transfer of only γ-phosphate from an ATP molecule to its conserved histidine residue and transfers phosphoryl group to its response regulator (see Figure 1), but cannot catalyse the transfer of α-phosphate of ATP (Pernestig et al., 2001). Therefore [α-32P]ATP can be used as a negative control when characterising the autophosphorylation activity of putative histidine kinases.
Figure 1. Domain architecture of two-component system. The sensor domain is indicated by oval, the dimerisation and phosphoaccepting (DHp) domain by a cylinder, and the catalytic and ATP-binding (CA) domain by a triangle; receiver (Rec) domain by a hexagon; effector (Effe) domain by a pentagon.
Materials and Reagents
Eppendorf tubes
50 ml Falcon tubes
Pipette tips
Chelating Sepharose Fast Flow (GE Healthcare, catalog number: 17057501 )
PD-10 desalting columns (GE Healthcare, catalog number: 17085101 )
1 ml cuvette
Polyethylene bags (Thermo Fisher Scientific, Fisher Scientific, catalog number: 01817200 )
BL21-DE3 E.coli cells containing Hik2, Rre1, and RppA clones. Each protein should be prepared fresh for each assay.
pET-21b vector (Invitrogen)
One Shot® TOP10 chemically competent E. coli (Thermo Fisher Scientific, InvitrogenTM, catalog number: C404006 )
BL21-(DE3) chemical competent cells
NdeI endonuclease (New England BioLabs, catalog number: R0111S )
XhoI endonuclease (New England BioLabs, catalog number: R0146S )
KpnI
Primers were purchased from Eurofins MWG Operon, Germany.
Deoxynucleoside triphosphate set (Sigma-Aldrich, catalog number: DNTP-RO )
Phusion® high-fidelity DNA polymerase (New England BioLabs, catalog number: M0530S )
RNase/DNase free water
GeneJET Gel Extraction Kit (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: K0691 )
Tris-HCl
Bovine serum albumin (BSA) (New England BioLabs, catalog number: B9000S )
DNA loading dye (6x) (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: R0611 )
Agarose
Fermentas Gel Extraction Kit
T4-ligase (New England BioLabs, catalog number: M0202S )
Ampicillin sodium salt (Sigma-Aldrich, catalog number: A9518-25G )
Isopropyl β-D-1-thiogalactopyranoside (IPTG) (Melford Laboratories, catalog number: MB1008 )
Imidazole
Bradford reagent (Sigma-Aldrich, catalog number: B6916-500ML )
500 μCi [γ-32P]-ATP (6,000 Ci mmol-1) (PerkinElmer, catalog number: NEG502Z500UC )
Adenosine 5’-triphosphate disodium salt hydrate (Sigma-Aldrich, catalog number: A2383-5G )
Luria broth (LB), low salt, granulated (Melford Laboratories, catalog number: GL1703 )
KCl
MgSO4
MgCl2
Glucose
NaCl
PMSF
Glycerol
SDS
β-2-mercaptoethanol
30% acrylamide/bis-acrylamide
APS
TEMED
Precision Plus Protein All Blue Standards (Bio-Rad Laboratories, catalog number: 161-0373 )
LB medium (see Recipes)
Super optimal broth with catabolic repressor (SOC) (see Recipes)
Lysis buffer/wash buffer 1 (see Recipes)
Wash buffer 2 (see Recipes)
Wash buffer 3 (see Recipes)
Elution buffer (see Recipes)
PD-10 desalting column equilibration buffer (see Recipes)
5x kinase reaction buffer (see Recipes)
5x ATP mix (see Recipes)
SDS-PAGE Laemmli sample buffer (see Recipes)
SDS-PAGE (see Recipes)
1x SDS-PAGE running buffer (see Recipes)
Equipment
PCR machine
Pipette shield
2 L Erlenmeyer flask
Bottle assembly, J-Lite PC-1000, polycarbonate (Beckman Coulter, catalog number: 363676 )
Backment Coulter AvantiTM J-30I centrifuge (Beckman Coulter, model: Avanti J-30I )
EmulsiFlex-C3 homogenizer (Abestin, model: EmulsiFlex-C3 )
Bottle assembly, polycarbonate, 50 ml (Beckman Coulter, order number: 357000 )
Heating block
Phosphorimager (Molecular Dynamics)
Fume-hood
GM counters
Perspex Eppendorf holders
JA-30.5 Ti rotor (Beckman Coulter, model: JA-30.5 Ti Rotor )
JLA-9.1000 rotor, fixed angle (Beckman Coulter, catalog number: 366754 )
Gilson pipettes
Plexiglas shielding
Mini-PROTEAN® Electrophoresis system (Bio-Rad Laboratories, catalog number: 1658000EDU )
Bio-Rad PowerPac (Bio-Rad Laboratories, catalog number: 1645050 )
Phosphor cassette (Molecular Dynamics)
Phosphor plate (Molecular Dynamics)
Image Eraser (Molecular Dynamics)
Software
ImageQuant software (Molecular Dynamics)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Ibrahim, I. M. (2016). In vitro Autophosphorylation and Phosphotransfer Assay of Cyanobacterial Histidine Kinase 2. Bio-protocol 6(23): e2036. DOI: 10.21769/BioProtoc.2036.
Download Citation in RIS Format
Category
Microbiology > Microbial signaling > Phosphorylation
Molecular Biology > Protein > Phosphorylation
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,037 | https://bio-protocol.org/exchange/protocoldetail?id=2037&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Preparation of Purified Gram-positive Bacterial Cell Wall and Detection in Placenta and Fetal Tissues
Beth Mann
LL Lip Nam Loh
GG Geli Gao
Elaine Tuomanen
Published: Vol 6, Iss 23, Dec 5, 2016
DOI: 10.21769/BioProtoc.2037 Views: 9574
Reviewed by: Alexander B. WestbyeMigla Miskinyte
Original Research Article:
The authors used this protocol in Mar 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Mar 2016
Abstract
Cell wall is a complex biopolymer on the surface of all Gram-positive bacteria. During infection, cell wall is recognized by the innate immune receptor Toll-like receptor 2 causing intense inflammation and tissue damage. In animal models, cell wall traffics from the blood stream to many organs in the body, including brain, heart, placenta and fetus. This protocol describes how to prepare purified cell wall from Streptococcus pneumoniae, detect its distribution in animal tissues, and study the tissue response using the placenta and fetal brain as examples.
Keywords: Cell wall Peptidoglycan Bacterial inflammation Neuroproliferation Fetal neurogenesis Placental trafficking Toll like receptor 2 ligand Streptococcus pneumonae
Background
Host response to infection involves recognition of many bacterial components including the cell wall (CW), a complex macromolecule that forms the surface of all Gram-positive bacteria. The CW of Gram-positive bacteria is formed by the covalent network of peptidoglycan and teichoic acid. Streptococcus pneumoniae, a leading cause of pneumonia, sepsis, and meningitis, has served as an important model organism for studying the innate immune response to Gram-positive bacterial infection including CW.
When upon Streptococcus pneumoniae (pneumococcal) infection CW components are released from bacteria during growth or antibiotic-induced death, it circulates in the blood stream and crosses cellular barriers, including the placenta and blood brain barrier. CW components have inflammatory activities equal to or greater than intact bacteria (Tuomanen et al., 1985a and 1985b). The CW can be viewed as the Gram-positive equivalent of endotoxin. The vast amount of CW pieces released during infection greatly stimulates the host inflammatory response by activating the innate immune receptor, Toll like receptor 2 (TLR2) (Yoshimura et al., 1999). Responses differ depending on the organ infected: the postnatal brain undergoes apoptosis, scarring predominates in heart, and the fetal brain escapes damage, showing striking neuroproliferation (Orihuela et al., 2006; Braun et al., 1999; Fillon et al., 2006; Humann et al., 2016).
This protocol describes how to prepare purified CW from Streptococcus pneumoniae (Tuomanen et al., 1985b) and follow its distribution in mice after intravenous injection, focusing on the placenta and fetal brain as examples (Humann et al., 2016). This model yields histopathologic sections of organs for study of the tissue response to CW components. Our model’s focus on pneumococcal CW derives from its well-described role in inflammation and injury in many organs, its extensive known chemistry and its recognition as a classic TLR2 pathogen associated molecular pattern.
Materials and Reagents
0.22 µm bottle top filter (Corning, catalog number: 431096 )
Glass tubes (Thermo Fisher Scientific, Fisher Scientific, catalog number: 14-961-32 )
1,000 ml centrifuge bottle (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 3120-1000 )
30 ml centrifuge bottle (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 3119-0050 )
Serological pipettes, 1 case of 5 ml, 10 ml, 25 ml
Microcentrifuge tubes (Eppendorf, catalog number: 022364111 )
Aluminum foil (Thermo Fisher Scientific, Fisher Scientific, catalog number: 01-213-100 )
25 gauge needles (BD, catalog number: 305122 )
50 ml polypropylene tubes (SARSTEDT, catalog number: 62.547.254 )
Petri dishes (Thermo Fisher Scientific, Fisher Scientific, catalog number: FB0875712 )
Small electric razor to shave animals
Superfrost microslides (VWR, catalog number: 48311-703 )
Premium cover glass (Thermo Fisher Scientific, Fisher Scientific, catalog number: 12-548-5P )
Magnetic stir bars
Inoculation loops (Thermo Fisher Scientific, Fisher Scientific, catalog number: 22-363-595 )
1 ml syringe (BD, catalog number: 309628 )
Acid washed 106 µm glass beads (Sigma-Aldrich, catalog number: G4649 )
Plastic embedding molds for histology (Polysciences, catalog number: 18646D-1 )
Streptococcus pneumoniae strains - CW is much easier to purify from strains that are unencapsulated such as R6 (ATCC, catalog number: BAA-255 )
C57Bl6 mice, mixture of male and female (THE JACKSON LABORATORY, catalog number: 000664 )
Water (Sigma-Aldrich, catalog number: W3500-1L )
Ultrapure water (example: Milli-Q, EMD Millipore)
Tryptic soy agar (TSA) (EMD Millipore, catalog number: 105458 )
Sterile defibrinated sheep blood (i-Tek Medical Technologies, catalog number: 103-100-3 )
Glycerol
Sodium dodecyl sulfate (SDS) (Sigma-Aldrich, catalog number: L4390 )
Note: This product has been discontinued.
Sodium chloride (NaCl) (Sigma-Aldrich, catalog number: 71382 )
Magnesium sulfate (MgSO4) (Sigma-Aldrich, catalog number: 208094 )
DNase I (Sigma-Aldrich, catalog number: DN25-10MG )
RNase A (Sigma-Aldrich, catalog number: R6513-10MG )
Calcium chloride dihydrate (CaCl2·2H2O) (Sigma-Aldrich, catalog number: C-3881 )
Trypsin (AMRESCO, catalog number: M150 )
α-amylase (Sigma-Aldrich, catalog number: A3176 )
Lithium chloride (LiCl) (Sigma-Aldrich, catalog number: L9650 )
Ethylenediaminetetraacetic acid disodium salt dehydrate (EDTA) (Sigma-Aldrich, catalog number: E5134 )
Acetone (Thermo Fisher Scientific, Fisher Scientific, catalog number: A946-4 )
PierceTM LAL Chromogenic Endotoxin Quantitation Kit (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 88282 )
Fluorescein isothiocyanate isomer I (FITC) (Sigma-Aldrich, catalog number: F7250 )
Dulbecco’s phosphate buffered saline (DPBS) (Mediatech, catalog number: 21-030- CV )
Paraformaldehyde, 16% w/v (Alfa Aesar, catalog number: 43368 )
Sucrose (Sigma-Aldrich, catalog number: S9378 )
Tissue Tek OCT compound (SAKURA FINETEK USA, catalog number: 4583 )
Prolong Gold Antifade with DAPI (Thermo Fisher Scientific, Molecular ProbesTM, catalog number: P36931 )
Trizma HCl (Sigma-Aldrich, catalog number: T5941 )
Tris-base (Sigma-Aldrich, catalog number: 1070897600 )
Hydrochloric acid (HCl) (Sigma-Aldrich, catalog number: 320331-500ml )
Sodium carbonate (Na2CO3) (Sigma-Aldrich, catalog number: 451614 )
Sodium bicarbonate (NaHCO3) (Sigma-Aldrich, catalog number: S-6014 )
Magnesium chloride hexahydrate (MgCl2) (Sigma-Aldrich, catalog number: M0250 )
Calcium chloride (CaCl2) (Sigma-Aldrich, catalog number: C1016 )
MnSO4 monohydrate (Sigma-Aldrich, catalog number: M7634 )
Glucose (Sigma-Aldrich, catalog number: G7528 )
Adenosine (Oakwood Products, catalog number: 093333 )
Uridine (EMD Millipore, catalog number: 6680 )
Glutamine (Sigma-Aldrich, catalog number: G8540 )
Nicotinic acid (Sigma-Aldrich, catalog number: N4126 )
(B6) Pyridoxine HCl (Sigma-Aldrich, catalog number: P9755 )
Ca-pantothenate (D-pantothenic acid) (Sigma-Aldrich, catalog number: P3161 )
Note: This product has been discontinued.
Thiamine HCl (Sigma-Aldrich, catalog number: 5871-100GM )
Riboflavin (Sigma-Aldrich, catalog number: R4500 )
Biotin (Sigma-Aldrich, catalog number: B4639 )
10 N NaOH solution (Thermo Fisher Scientific, Fisher Scientific, catalog number: SS255-1 )
Ferrous sulfate heptahydrate (FeSO4·7H2O) (Thermo Fisher Scientific, Fisher Scientific, catalog number: I146-500 )
Copper(II) sulfate pentahydrate (CuSO4·5H2O) (Sigma-Aldrich, catalog number: C8027 )
Zinc sulfate heptahydrate (ZnSO4·7H2O) (Sigma-Aldrich, catalog number: Z4750 )
Manganese chloride tetrahydrate (MnCl2·4H2O) (Thermo Fisher Scientific, Fisher Scientific, catalog number: M87-500 )
Pyruvic acid (Sigma-Aldrich, catalog number: 107360-25g )
Potassium phosphate monobasic (KH2PO4) (Sigma-Aldrich, catalog number: P5655 )
Potassium phosphate dibasic (K2HPO4) (Sigma-Aldrich, catalog number: P3786 )
Yeast extract (BD, BactoTM, catalog number: 212750 )
Sodium acetate anhydrous (Sigma-Aldrich, catalog number: S8625 )
Casamino acids technical (BD, BactoTM, catalog number: 223120 )
L-tryptophan (Sigma-Aldrich, catalog number: T8941 )
L-cysteine HCl (Thermo Fisher Scientific, Fisher Scientific, catalog number: BP376-100 )
Asparagine (Sigma-Aldrich, catalog number: A4284 )
Choline chloride (Sigma-Aldrich, catalog number: C7527 )
Dry ice
Solutions used to treat CW during purification
50 mM Tris-HCl, pH 7.0 (see Recipes)
5% (v/v) SDS (see Recipes)
1 M NaCl (see Recipes)
100 mM Tris, pH 7.5 (see Recipes)
1 M MgSO4 (see Recipes)
1 M CaCl2 (see Recipes)
1% (v/v) SDS (see Recipes)
8 M LiCl (see Recipes)
100 mM EDTA (see Recipes)
Carbonate buffer, pH 9.2 (see Recipes)
Preparation of C+Y components
‘3 in 1’ salts (see Recipes)
20% glucose (see Recipes)
50% sucrose (see Recipes)
Adenosine (2 mg/ml) (see Recipes)
Uridine (2 mg/ml) (see Recipes)
Glutamine (1 mg/ml) (see Recipes)
Adams I (see Recipes)
Adams II (see Recipes)
2% pyruvate (see Recipes)
1 M KH2PO4 (see Recipes)
1 M K2HPO4 (see Recipes)
5% yeast extract (see Recipes)
Media preparation
PreC media (see Recipes)
Supplement (see Recipes)
Adams III (see Recipes)
1 M potassium phosphate buffer (see Recipes)
C+Y medium (see Recipes)
Equipment
37 °C CO2 incubator (Thermo Fisher Scientific, Thermo ScientificTM, model: 3110 )
Benchtop microcentrifuge (Eppendorf, model: 5417C )
1,000 ml Erlenmeyer flasks
4,000 ml Erlenmeyer flasks
Sorvall centrifuge RC 5C Plus and appropriate rotor for the centrifuge tubes or bottles
500 ml beaker
Stirring hotplate
Vortex mixer
Speed-vac (Savant, model: SC110A )
Water-bath sonicator (Thermo Fisher Scientific, Fisher Scientific, model: FS20 )
Heating pad
Cryostat microtome (Microme, model: HM505E )
Zeiss LSM 510 NLO Meta confocal microscope
Spectrophotometer (Turner, Model: 340 )
Spectra MAX340 plate reader to measure absorbance at 405 nm (Molecular Device, model: Spectra MAX340 )
Software
Zen 2008 software package (Carl Zeiss MicroImaging, Inc.)
ImageJ (imagej.net/Particle_Analysis)
Graphpad Prism (Graphpad)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Mann, B., Loh, L. N., Gao, G. and Tuomanen, E. (2016). Preparation of Purified Gram-positive Bacterial Cell Wall and Detection in Placenta and Fetal Tissues. Bio-protocol 6(23): e2037. DOI: 10.21769/BioProtoc.2037.
Download Citation in RIS Format
Category
Microbiology > in vivo model > Bacterium
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,038 | https://bio-protocol.org/exchange/protocoldetail?id=2038&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Single Cell Flow Cytometry Assay for Peptide Uptake by Bacteria
Monica Benincasa*
Quentin Barrière*
Giulia Runti
Olivier Pierre
Mick Bourge
Marco Scocchi
Peter Mergaert
*Contributed equally to this work
Published: Vol 6, Iss 23, Dec 5, 2016
DOI: 10.21769/BioProtoc.2038 Views: 12871
Edited by: Zhaohui Liu
Reviewed by: Lior Lobel
Original Research Article:
The authors used this protocol in Nov 2015
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Nov 2015
Abstract
Antimicrobial peptides (AMPs) can target the bacterial envelope or alternatively have intracellular targets. The latter requires uptake of the peptide by the bacterial cells. The bacterial internalization of an AMP can be evaluated by a fluorescence-based method that couples the use of the fluorescently labelled AMP to the fluorescence quencher trypan blue. Trypan blue is excluded from the interior of intact cells and the fluorescence of the extracellular peptide or of the peptide bound on the bacterial surface can be quenched by it, while the fluorescence of the internalized peptide is not affected. The uptake of the peptide by the bacteria is determined by measuring the fluorescence in individual cells by flow cytometry.
Keywords: Antimicrobial peptide Flow cytometry Peptide uptake Peptide transporter Trypan blue Propidium iodide uptake
Background
AMPs consist of a broad and diverse class of potent antimicrobials that have potential as novel therapeutic agents (Wang et al., 2015). AMPs are part of innate immunity and are produced by organisms of all kingdoms. They are mobilized by these organisms to fight infecting microbes, that can be either bacteria, fungi or viruses. They do so by directly killing the microbes, but they can also act as sentinels that alert other immune pathways. Interestingly, it has also become clear that AMPs are not only agents against bad microbes, but that they also have key roles in the control of symbiotic bacterial populations in animal and plant hosts (Maróti et al., 2011; Kondorosi et al., 2013).
The diversity of AMPs in sequence and structure is so large that it is difficult to classify them. Moreover, AMPs of different origin have also highly diverse modes of action. They can be broadly divided in peptides that target the bacterial envelope, destroying its cell barrier function by permeabilizing cell membranes, and peptides that are internalized and target a vital intracellular function (Scocchi et al., 2016). Therefore, in the initial characterization of a novel antibacterial peptide, it is important to determine its major site of action. The protocol we described here is based on a flow cytometry method and enables a rapid determination if an AMP of interest is internalized by bacteria at sublethal concentrations (Benincasa et al., 2009). This characterization can be done prior to the biochemical identification of the cellular targets.
We have applied the method to Escherichia coli, Salmonella typhimurium, Sinorhizbobium meliloti and Bradyrhizobium spp. using different antibacterial peptides, including the mammalian Bac7 peptide which inhibits the ribosomes (Mardirossian et al., 2014), and the plant peptide NCR247 which permeabilizes bacterial membranes but can also be internalized and bind diverse intracellular targets (Farkas et al., 2014; Guefrachi et al., 2015). This simple method can be easily adapted for use in other bacteria and other AMPs or other types of bioactive peptides. The method is also suitable for testing the activity of peptide uptake transporters in bacteria as illustrated in an example (Mattiuzzo et al., 2007; Guefrachi et al., 2015).
Materials and Reagents
Eppendorf tubes
Sterile membrane filters 0.2 µm (SARSTEDT, catalog number: 83.1826.001 )
Microscopy slides and cover-glasses (Chance Propper LTD)
96-well microplates, black with transparent bottom, 400 µl (Greiner Bio One, catalog number: 655096 )
Bacteria of interest: e.g., Escherichia coli HB101, BW25113 (Mattiuzzo et al. 2007; Benincasa et al., 2009; Runti et al., 2013; Guida et al., 2015), Salmonella typhimurium ATCC 14028 (Benincasa et al., 2015), Sinorhizobium meliloti Sm1021 (Arnold et al., 2013; Guefrachi et al., 2015), Bradyrhizobium sp. ORS285 (Guefrachi et al., 2015)
Bacterial growth media:
Mueller-Hinton broth, MHB (see Recipes) (BD, DifcoTM, catalog number: 275710 ), for E. coli or S. typhimurium
Yeast extract broth, YEB (see Recipes), for S. meliloti
Yeast extract mannitol broth, YMB (see Recipes), for Bradyrhizobium
Chemicals and components for bacterial growth media preparation and buffer solutions:
a.Technical agar (BD, DifcoTM, catalog number: 281230 )
b.Yeast extract (BD, BactoTM, catalog number: 212750 )
c.Peptone (BD, BactoTM, catalog number: 211677 )
d.Beef extract (Conda, catalog number: 1700 )
e.Saccharose (VWR, catalog number: 27483.363 )
f.Mannitol (VWR, catalog number: 25311.297 )
g.Sodium glutamate (VWR, catalog number: 27872.298 )
h.Magnesium sulfate heptahydrate (MgSO4·7H2O) (EMD Millipore, catalog number: 105886 )
i.Dibasic potassium phosphate (K2HPO4) (VWR, catalog number: 26930.362 )
j.Sodium phosphate dibasic heptahydrate (Na2HPO4·7H2O) (Sigma-Aldrich, catalog number: S9390 )
k.Sodium phosphate monobasic dehydrate (NaH2PO4·2H2O) (Sigma-Aldrich, catalog number: 71505 )
l.Iron(III) chloride (FeCl3) (Sigma-Aldrich, catalog number: 701122 )
m.Calcium chloride dihydrate (CaCl2·2H2O) (EMD Millipore, catalog number: 102382 )
n.Sodium chloride (NaCl) (EMD Millipore, catalog number: 106404 )
o.Sodium hydroxide (NaOH) (VWR, catalog number: 567530-250 )
p.HCl (CARLO ERBA Reagents, catalog number: 403871 )
q.Magnesium chloride (MgCl2) (Sigma-Aldrich, catalog number: M8266 )
r.Tween 20 (Sigma-Aldrich, catalog number: P1379 )
Stock solution of fluorescently labelled peptides
Note: Fluorophores successfully used to label peptides are BODIPY FL (Guida et al., 2015), fluorescein (FITC) (Guefrachi et al., 2015), Alexa dye (Benincasa et al., 2010). Before internalization studies, check that labelling does not affect the biological activity of the peptide using a Minimal Inhibitory Concentration assay. Labelled peptides can be synthesized in house if a peptide synthesizer is available or obtained from a commercial supplier offering a custom peptide synthesis service (http://www.proteogenix.science/custom-peptide-synthesis/).
Buffered-saline (BS) (see Recipes)
Buffered high salt solution (BHSS) (see Recipes)
Phosphate buffer (PB) (see Recipes)
PB supplemented with Tween 20 (PBT) (see Recipes)
Trypan blue (Sigma-Aldrich, catalog number: T6146) stock solution (see Recipes)
Propidium iodide (PI) (Sigma-Aldrich, catalog number: P4170) stock solution (see Recipes)
Equipment
Incubator for bacterial growth (FIRLABO, Bioconcept)
Thermostatic bath (Thermo Fisher Scientific, Thermo ScientificTM, model: TSGP02 )
Flow cytometer (Beckman Coulter, model: Cytomics FC 500 equipped with an argon laser [488 nm, 5 mW]) or Moflo Astrios (Beckman-Coulter, model: Moflo Astrios) equipped with an argon laser (488 nm, 100 mW) and photomultiplier tube fluorescence detectors for filtered light set at 525 nm for BODIPY (BY) detection (filter 526/52 nm)
Note: The product 'Cytomics FC 500' has been discontinued.
HeraeusTM PicoTM and FrescoTM centrifuge for Eppendorf tubes (Thermo Fisher Scientific, Thermo ScientificTM, model: Heraeus Pico 17 )
Spectrophotometer (Amersham Biosciences, Ultrospec 10 cell density meter)
Confocal microscope with an oil immersion objective lens (Nikon Eclipse C1si or Leica TCS SP X)
Fluorescence plate reader (Tecan Trading, Infinite®, model: M200 )
Software
FCS Express 3 or later version (De Novo Software, Los Angeles, CA)
Summit 6.2.2(Beckman-Coulter, Inc.)
Leica Application Suite X
EZ-C1 Free Viewer (Nikon Corporation)
ImageJ (Wayne Resband, National Institutes of Health, USA)
MagellanTM - Data Analysis Software (Tecan Trading AG)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Benincasa, M., Barrière, Q., Runti, G., Pierre, O., Bourge, M., Scocchi, M. and Mergaert, P. (2016). Single Cell Flow Cytometry Assay for Peptide Uptake by Bacteria. Bio-protocol 6(23): e2038. DOI: 10.21769/BioProtoc.2038.
Download Citation in RIS Format
Category
Microbiology > Antimicrobial assay > Antibacterial assay
Microbiology > Microbial biochemistry > Protein
Biochemistry > Protein > Fluorescence
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,039 | https://bio-protocol.org/exchange/protocoldetail?id=2039&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
DNA Damage Induction by Laser Microirradiation
Marianna Tampere
Oliver Mortusewicz
Published: Vol 6, Iss 23, Dec 5, 2016
DOI: 10.21769/BioProtoc.2039 Views: 20554
Edited by: HongLok Lung
Reviewed by: Marco Di Gioia
Original Research Article:
The authors used this protocol in Feb 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Feb 2016
Abstract
Genome instability can lead to cell death, senescence and cancerous transformation. Specific repair pathways have evolved to prevent accumulation of DNA lesions. Studying these highly dynamic and specific repair pathways requires precise spatial and temporal resolution, which can be achieved through a combination of laser microirradiaiton and live cell microscopy. DNA lesions are introduced at pre-determined sub-nuclear sites and repair can be analyzed in real time in living cells when using fluorescently tagged repair proteins (Mortusewicz et al., 2008). Alternatively, laser microirradiation can be combined with immunofluorescence analysis to study recruitment of endogenous proteins to laser-induced DNA damage tracks that can be visualized by positive controls like, e.g., γH2AX that mark sites of DNA breaks.
Keywords: Microirradiation Live cell imaging DNA damage DNA repair DNA lesions DNA damage response Immunofluorescence Microscopy
Background
The genomic integrity of mammalian cells is constantly challenged by DNA damage introduced through external and internal sources. Amongst the most common DNA lesions are oxidized bases, double strand breaks, single strand breaks, inter- and intra-strand crosslinks and UV adducts. Various DNA damage signalling and repair pathways have evolved to deal with these lesions. For DNA repair to be fast, precise and efficient, numerous proteins involved in sensing, signalling and repairing specific DNA lesions have to be coordinated in space and time. Furthermore, DNA is organized into higher order chromatin structures and thus for DNA lesions to be accessible to DNA repair enzymes, chromatin has to be remodeled. Laser microirradiation in combination with advanced live cell microscopy allows studying these highly dynamic processes in the context of living cells (Mortusewicz et al., 2008). The protocol described here uses a 405 nm laser that should be readily available at most confocal or spinning disk microscopes to induce DNA damage in living cells and should therefore be cost effective and feasible in most standard cell biology laboratories. Using different sensitization methods (e.g., Hoechst versus BrdU sensitization) and laser energies, the ratio between double strand breaks, single strand breaks, oxidative lesions and UV damage can be modified to the experimental needs.
Materials and Reagents
Live cell microscopy compatible Petri dish or chambers (e.g., Ibidi, catalog number: 35 mm µ-Grid )
Adherent cell lines, e.g., U2OS
If no CO2 control is available at your microscope, use CO2 independent medium without phenol red (e.g., Leibovitz's L-15 medium or CO2 independent medium, Thermo Fisher Scientific, GibcoTM, catalog number: 18045088 ) supplemented with 10% FBS (Thermo Fisher Scientific, GibcoTM, catalog number: 10082139 ) and antibiotics (Thermo Fisher Scientific, GibcoTM, catalog number: 15140-122 ). Alternatively, HEPES (Sigma-Aldrich, catalog number: H4034 ) can be added to your medium of chose.
5-bromo-2’-deoxycytidine (e.g., Santa Cruz Biotechnology, catalog number: 1022-79-3 )
Hoechst 33342 (Thermo Fisher Scientific, Molecular ProbesTM, catalog number: H1399 )
4% formaldehyde in PBS (Santa Cruz Biotechnology, catalog number: 30525-89-4 )
Triton X-100 (Sigma-Aldrich, catalog number: 234729 )
Note: This product has been discontinued.
Mouse-anti-γH2AX (EMD Millipore, catalog number: 05-636 )
Donkey anti-Mouse IgG (H+L) secondary antibody, Alexa Fluor® 488 (Thermo Fisher Scientific, InvitrogenTM, catalog number: A-21202 )
Bovine serum albumin (BSA) (Sigma-Aldrich, catalog number: A4503-500g )
Tween 20 (Sigma-Aldrich, catalog number: P1379-500ML )
Optional: plasmids encoding for fluorescently tagged proteins of interest, e.g., GFP-Timeless (Figure 1). Fluorescently tagged proteins known to be involved in different DNA repair pathways, like PARP-1, XRCC1 or 53BP1, can be used as controls to set up optimal conditions.
Optional: transfection reagent of choice, e.g., self-made PEI solution or commercial distributor
Equipment
Inverted confocal or spinning disk microscope equipped with a 405 nm laser and an environmental chamber or insert to control temperature and CO2/humidity for long-term live cell experiments, e.g., Zeiss LSM710 or LSM780 confocal laser scanning microscope equipped with a UV-transmitting Plan-Apochromat 63x/1.40 Oil DIC M27 or Plan-Apochromat 40x/1.30 Oil DIC M27 objective, respectively
Cell incubator
Software
Microscope software, e.g., ZEN from Zeiss (Zeiss)
Microsoft Excel (Microsoft)
Image J (https://imagej.nih.gov/ij/)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Tampere, M. and Mortusewicz, O. (2016). DNA Damage Induction by Laser Microirradiation. Bio-protocol 6(23): e2039. DOI: 10.21769/BioProtoc.2039.
Download Citation in RIS Format
Category
Cancer Biology > Genome instability & mutation > Cell biology assays
Cell Biology > Cell imaging > Live-cell imaging
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
204 | https://bio-protocol.org/exchange/protocoldetail?id=204&type=1 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Make Human Umbilical Vein Endothelial Cells from Cords
HP Huan Pang
Published: Apr 20, 2012
DOI: 10.21769/BioProtoc.204 Views: 13513
Download PDF
Ask a question
Favorite
Cited by
Abstract
Human umbilical vein endothelial cells (HUVEC) can be isolated from normal human umbilical veins, and are responsive to cytokine stimulation by expressing cell adhesion molecules. These cell systems are commonly used for physiological and pharmacological investigations, such as macromolecule transport, blood coagulation, and angiogenesis. This protocol describes the generation of HUVECs.
Materials and Reagents
Collagenase I (Life Technologies, InvitrogenTM, catalog number: 17100-017 )
Endothelial cell growth supplement (ECGS) (Sigma-Aldrich, catalog number: E2759 )
M199 medium
Fetal calf serum (FCS)
Phosphate buffered saline (PBS)
Pen/Strep
Sodium pyruvate
Antibiotic
Ethanol
Collagenase solution
Culture medium (see Recipes)
Equipment
Needle
Clamps
Syringes
Syringe filter
Parafilm
Heparin
Culture hood
Sterilized beaker
50 ml tube
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2012 The Authors; exclusive licensee Bio-protocol LLC.
Category
Cell Biology > Cell isolation and culture > Cell isolation
Developmental Biology > Cell growth and fate > Umbilical cord
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,040 | https://bio-protocol.org/exchange/protocoldetail?id=2040&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Mouse Model of Dengue Virus Infection with Serotypes 1 and 2 Clinical Isolates
Satoru Watanabe
Kitti Wing Ki Chan
SV Subhash G. Vasudevan
Published: Vol 6, Iss 23, Dec 5, 2016
DOI: 10.21769/BioProtoc.2040 Views: 9438
Edited by: Yannick Debing
Reviewed by: Longping Victor Tse
Original Research Article:
The authors used this protocol in Mar 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Mar 2016
Abstract
Dengue is a global public health threat caused by infection with any of the 4 related dengue virus serotypes (DENV1-4). Clinical manifestations range from self-limiting febrile illness, known as dengue fever (DF), to life-threatening severe diseases, such as dengue hemorrhagic fever (DHF) or dengue shock syndrome (DSS). Most cases of DHF/DSS are associated with secondary heterotypic infections through a phenomenon that is described as antibody-dependent enhancement of infection (ADE). There are an estimated 400 million human infections and several hundred thousand cases of severe dengue occurring yearly. At present, however, there are no approved antiviral drugs against DENV infection. The lack of a suitable animal model has hampered the evaluation of novel antiviral candidates for DENV infection. Since DENV poorly establishes infection in immunocompetent mice, AG129 mice (lacking type I and II IFN [interferon] receptors) and mouse-adapted DENV2 strains have been applied to dengue animal models that enable to reproduce several of the major pathologies of human infection. Recently, we developed new mouse models with clinical isolates DENV1 and DENV2 that would be useful for drug testing and dengue pathogenesis studies (Watanabe et al., 2016). Here we describe the details to establish dengue mouse models of clinical isolates; from in vitro preparation of the materials to in vivo virus infection. Of note, since infectivity of DENV in mice differs among virus strains, not all clinical isolates can induce severe dengue.
Keywords: Dengue virus Lethal mouse model Clinical virus Antibody-dependent enhancement of virus infection Drug testing
Background
To overcome the drawback that DENV does not replicate well in rodent cells, many efforts have been made over the years to develop small animal models that mimic human dengue infection. The inbred mouse model system allows experimental variability to be minimized, and genetically engineered mouse models enable to reproduce some aspects of dengue clinical symptoms in the animals. A past study showed that AG129 mice (lacking type I and II IFN receptors) infected with a DENV2 clinical isolate succumbed to infection with signs of paralysis, a condition of central nervous system involvement that is rare in human cases (Shresta et al., 2004). Alternatively, mouse-adapted DENV2 strains that can induce human DHF/DSS-like diseases in AG129 mice were generated and have been used for dengue research (Shresta et al., 2006; Zellweger et al., 2010). Although the use of the mouse-adapted strains is valuable for some aspects of DENV pathogenesis studies and potential therapeutic drug testing, one considerable limitation is the variable pathogenesis depending on the serotype/genotype, and adaptation of virus in mouse might alter tissue tropism. Recently, we developed new mouse models of clinical isolates DENV1 and DENV2; the mice succumbed to infection with signs of severe dengue symptoms (Watanabe et al., 2016). Non-lethal infection with clinical isolates becomes lethal accompanied with high levels of viremia and cytokine production in the presence of DENV antibodies (Abs) (ADE condition) in AG129 mice, suggesting that this system enables to extend the use of clinical DENV isolates for the study of Ab-mediated DENV pathogenesis and the evaluation of anti-dengue candidates.
Materials and Reagents
50 ml centrifuge tubes (Corning, Falcon®, catalog number: 357550 )
0.45 μm membrane filter (Sartorius, Minisart®, catalog number: 16537 )
0.2 μm membrane filter unit for bulk culture (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 567-0020 )
HiTrap Protein G HP-5 ml (GE Healthcare, catalog number: 170-0405-01 )
96-well PCR plate (Bio-Rad Laboratories, catalog number: HSP9601 )
SnakeskinTM dialysis tubing 10 kDa (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 68100 )
30 G insulin syringe (BD, catalog number: 328818 )
27 G needle (BD, catalog number: 305109 )
1.5 ml Eppendorf tubes (Corning, Axygen, catalog number: MCT-150-c )
Plate cover seal (Bio-Rad Laboratories, catalog number: MSB1001 )
CryoTubes vials for freezing viruses (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 368632 )
Dengue virus: DENV-2 mouse-adapted S221 strain (Zellweger et al., 2010), DENV-1 clinical isolate (EDEN1: GenBank accession
EU081230.1) (Low et al., 2006), DENV2 clinical isolate (EDEN2: GenBank accession EU081177.1) (Low et al., 2006)
Cells of the Aedes albopictus C6/36 line (clone C6/36) (ATCC, catalog number: CRL-1660TM )
Cells of the baby hamster kidney cell line (BHK-21 [C-13]) (ATCC, catalog number: CCL-10TM )
Hybridoma cells (D1-4G2-15) (ATCC, catalog number: HB-112TM )
Sv/129 mice deficient in type I and II IFN receptors (AG129 mice) (B&K Universal)
RPMI1640 medium (Thermo Fisher Scientific, GibcoTM, catalog number: 11875093 )
Heat-inactivated fetal bovine serum (FBS) (Thermo Fisher Scientific, GibcoTM, catalog number: 10082147 )
Liquid nitrogen
3.7% formaldehyde (Sigma-Aldrich, catalog number: F1635 )
Crystal violet (Sigma-Aldrich, catalog number: C3886 )
Note: This product has been discontinued.
Protein-Free hybridoma medium (PFHM-II medium) (Thermo Fisher Scientific, GibcoTM, catalog number: 12040077 )
1x PBS (Lonza, catalog number: 17-516Q )
Glycine (Sigma-Aldrich, catalog number: G7126 )
0.25% trypsin-EDTA (Thermo Fisher Scientific, GibcoTM, catalog number: 25200056 )
Ethylenediaminetetraacetic acid (EDTA) (EMD Millipore, catalog number: 819040 )
QIAamp Viral RNA Mini Kit (Qiagen, catalog number: 52906 )
qScript One-Step qRT-PCR Kit (Quantabio, catalog number: 95057 )
Methyl-cellulose powder (EMD Millipore, catalog number: 17851 )
L-glutamine (Thermo Fisher Scientific, GibcoTM, catalog number: 25030081 )
Penicillin and streptomycin (PenStrep) (Thermo Fisher Scientific, GibcoTM, catalog number: 15140122 )
7.5% sodium bicarbonate solution (Thermo Fisher Scientific, GibcoTM, catalog number: 25080094 )
1 M HEPES (Thermo Fisher Scientific, GibcoTM, catalog number: 15630080 )
Ethanol (EtOH) (EMD Millipore, catalog number: 1009832511 )
RPMI 1640 powder (Thermo Fisher Scientific, GibcoTM, catalog number: 31800022 )
1 N HCl (Sigma-Aldrich, catalog number: 258148 )
Tris (First BASE Laboratories Sdn Bhd, catalog number: BIO-1400 )
Primers and probes
DENV1 forward primer: 5’-ACACCAGGGGCTGTACCTTGG-3’
DENV1 reverse primer: 5’-CATTCCATTTTCTGGCGTTCT-3’
DENV1 taqman probe: FAM-5’-CTGTCTCTACAGCATCATTCCAGGCA-3’-TAMRA
DENV2 forward primer: 5’-CATATTGACGCTGGGAAAGA-3’
DENV2 reverse primer: 5’-AGAACCTGTTGATTCAAC-3’
DENV2 taqman probe: FAM-5’-CTGTCTCCTCAGCATCATTCCAGGCA-3’-TAMRA
Standard for realtime RT-PCR: plasmids containing whole genome sequences of DENV-1 (EDEN1: EU081230.1) or DENV-2 (EDEN2: EU081177.1)
0.8% methyl-cellulose medium (see Recipes)
1% Crystal violet (see Recipes)
0.1 M glycine (pH 2.7) (see Recipes)
1 M Tris- HCl (pH 9.0) (see Recipes)
Equipment
NuncTM 175 cm2 angled-neck easy flasks (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 159920 )
Cell scraper (Corning, catalog number: 3010 )
Incubator (SANYO, model: MIR-262 ) without CO2 atmosphere at 28 °C
Humidified incubator (NuAire, model: NU5500 ) with 5% CO2 atmosphere at 37 °C
Swinging rotor centrifuge (for cells) (Thermo Fisher Scientific, model: Heraeus Multifuge 3S-R )
Benchtop fixed-angle rotor centrifuge (for serum) (Eppendorf, model: 5424 )
-80 °C freezer (Thermo Fisher Scientific, Thermo ScientificTM, model: Forma 900 Series )
Autoclave (TOMY DIGITAL BIOLOGY, model: SX-700 )
AKTApurifierTM UPC 10 (GE Healthcare, catalog number: 28406268 )
pH meter (Sartorius, model: pH Basic Series )
NanoDrop 2000 spectrophotometer (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: ND-2000 )
Real-time thermal cycler (Bio-Rad Laboratories, model: CFX96 )
Mouse restrainer (Plas-labs, catalog number: 551-BSRR )
Olympus inverted fluorescence microscope (Olympus, model: IX71 )
Software
GraphPad Prism software
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Watanabe, S., Chan, K. W. K. and Vasudevan, S. G. (2016). Mouse Model of Dengue Virus Infection with Serotypes 1 and 2 Clinical Isolates. Bio-protocol 6(23): e2040. DOI: 10.21769/BioProtoc.2040.
Download Citation in RIS Format
Category
Microbiology > in vivo model > Viruses
Cell Biology > Tissue analysis > Tissue isolation
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
Subsets and Splits
No saved queries yet
Save your SQL queries to embed, download, and access them later. Queries will appear here once saved.