id
int64 7
5.24k
| url
stringlengths 48
63
| content
stringlengths 567
149k
|
|---|---|---|
1,771 | https://bio-protocol.org/exchange/protocoldetail?id=1771&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Preparation of Mitotic and Meiotic Metaphase Chromosomes from Young Leaves and Flower Buds of Coccinia grandis
Sangram Sinha
Kanika Karmakar
Ravi S. Devani
Jayeeta Banerjee
Rabindra K. Sinha
Anjan K. Banerjee
Published: Vol 6, Iss 7, Apr 5, 2016
DOI: 10.21769/BioProtoc.1771 Views: 14714
Edited by: Samik Bhattacharya
Reviewed by: Xinyan Zhang
Original Research Article:
The authors used this protocol in Dec 2014
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Dec 2014
Abstract
Somatic chromosomes are usually studied from the root tip cells of the plants for cytological investigations. In dioecious plant species like Coccinia grandis, it is very difficult to get meristematic root tip cells from the mature plants of the respective sex forms. In this report, young leaves of the respective sexual phenotypes were used as tissue samples for mitotic chromosome analysis. For meiotic preparation, flower buds of appropriate size were selected for chromosomal studies. Following protocols could be effectively used for routine chromosome preparations in other plant species as well.
Keywords: Sex chromosomes Mitosis Meiosis Dioecious Coccinia grandis
Materials and Reagents
Blotting papers
Glass slides and cover-slips
Specimen tube
1st, 2nd and 3rd leaf from the shoot apical region for mitotic study
Note: Young leaves can be harvested from seedlings as well as from mature plants.
Flower buds of 7 and 8 stages for meiotic study
Note: Assigned according to the length of flower buds.
Saturated solution of para-dichlorobenzene (Sigma-Aldrich, catalog number: D56829 )
Note: It is also named “1,4-Dichlorobenzene” on Sigma-Aldrich website.
Glacial acetic acid (SRL, catalog number: 85801 )
Hydrochloric Acid (HCl)
Orcein (Sigma-Aldrich, catalog number: O7380 )
Carmine (Sigma-Aldrich, catalog number: C1022 )
Absolute ethanol (99%) (Merck Millipore Corporation, catalog number: 100983 )
2% w/v aceto-orcein stain (see Recipes)
1% w/v aceto-carmine stain (see Recipes)
Equipment
Compound microscope (ZEISS, model: Primo-star )
Refrigerator (household refrigerator having a freezer compartment with sub-zero temperature)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Sinha, S., Karmakar, K., Devani, R. S., Banerjee, J., Sinha, R. K. and Banerjee, A. K. (2016). Preparation of Mitotic and Meiotic Metaphase Chromosomes from Young Leaves and Flower Buds of Coccinia grandis. Bio-protocol 6(7): e1771. DOI: 10.21769/BioProtoc.1771.
Download Citation in RIS Format
Category
Plant Science > Plant cell biology > Cell imaging
Cell Biology > Cell structure > Chromosome
Molecular Biology > DNA > DNA structure
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,772 | https://bio-protocol.org/exchange/protocoldetail?id=1772&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Isolation and Culture of Human CD133+ Non-adherent Endothelial Forming Cells
MC Michaelia P. Cockshell
CB Claudine S. Bonder
Published: Vol 6, Iss 7, Apr 5, 2016
DOI: 10.21769/BioProtoc.1772 Views: 10577
Reviewed by: Ningfei AnThomas J. Bartosh
Original Research Article:
The authors used this protocol in May 2015
Download PDF
Ask a question
Favorite
Cited by
Original research article
The authors used this protocol in:
May 2015
Abstract
Circulating endothelial progenitor cells (EPCs) have been the focus of many clinical trials due to their roles in revascularisation following ischemic events such as acute myocardial infarction as well as their contribution to vascular repair during organ transplantation. Research on EPCs has been controversial due to the lack of distinct markers expressed at the cell surface and varying methods for isolation and culture have resulted in the identification of a multitude of cell types, with differing phenotype and function, all falling under the label of “EPCs”. The most widely documented EPCs isolated for cell therapy are adherent in nature and lacking the progenitor markers such as CD133 and therefore unlikely to represent a true circulating EPC, the cells mobilised in response to a vascular injury.
We recently published the isolation and extensive characterisation of a population of non-adherent endothelial forming cells (naEFCs) (Appleby et al., 2012) (Figure 1). These cells expressed the progenitor cell markers (CD133, CD34, CD117, CD90 and CD38) together with mature endothelial cell markers (VEGFR2, CD144 and CD31). These cells also expressed low levels of CD45 but did not express the lymphoid markers (CD3, CD4, CD8) or myeloid markers (CD11b and CD14) which distinguishes them from ‘early’ EPCs, the ‘late outgrowth EPC’ [more recently known as endothelial colony forming cells (ECFCs)] as well as mature endothelial cells (ECs). Figure 2A exemplifies the surface expression profile of the naEFCs. Functional studies demonstrated that these naEFCs (i) bound Ulex europaeus lectin (Figure 2A), (ii) demonstrated acetylated-low density lipoprotein uptake, (iii) increased vascular cell adhesion molecule (VCAM-1) surface expression in response to tumor necrosis factor and (iv) in co-culture with mature ECs increased the number of tubes, tubule branching and loops in a 3-dimensional in vitro matrix. More importantly, naEFCs placed in vivo generated new lumen containing vasculature lined by CD144 expressing human ECs and have contributed to various advances in scientific knowledge (Appleby et al., 2012; Barrett et al., 2011; Moldenhauer et al., 2015; Parham et al., 2015). Here, we describe the isolation and enrichment of a non-adherent CD133+ endothelial forming population of cells from human cord blood.
Keywords: Endothelial progenitor cells Expansion Human CD133 Non-adherent
Figure 1. Enrichment of human naEFCs. A. Umbilical cord blood derived CD133+ enriched cells (naEFCs) at 4 days of culture and human umbilical vein endothelial cells (ECs) were compared for cell size by light microscopy. Scale bar=200 µm B. The cells were assessed for heterogeneity of enrichment process (0-10 days) via forward scatter and side scatter profiling using flow cytometric analysis and compared to mature ECs.
Figure 2. Surface expression phenotype of human naEFCs. A. CD133+ enriched cells at 4 days of culture were assessed for progenitor and endothelial markers by flow cytometry. Histograms show a representative experiment from ≥3 biological replicates where grey dashed lines represent isotype controls and solid black lines represent cells stained with the indicated marker. B. The function of the naEFCs was assessed by flow cytometry and compared to mature ECs, detecting the ability of cells to uptake DiI labelled acetylated low density lipoprotein (Ac-LDL) and bind FITC labelled Ulex europaeus agglutinin I (UEA-1) lectin. Density plots represent stained cells of one representative experiment from ≥3 biological replicates.
Materials and Reagents
For manual cell sorting
MS Columns (Miltenyi Biotec, catalog number: 130-042-201 )
MacoPharma cord blood collection bags (MacoPharma, catalog number: MSC1201DU )
50 ml tubes (Corning, Falcon®, catalog number: 352070 )
10 ml tubes (Sarstedt AG, catalog number: 62.9924.284 )
2 ml soft sterile bulb transfer pipette, sterile (Stephen Gould corporation, catalog number: 222-1S )
Note: Currently, it is “Capitol Scientific, catalog number: 222-1S”.
20 µm filter (Sartorius Stedim Biotec, Minisart, catalog number: 16534-K )
24-well plate (Corning, Falcon®, catalog number: 353047 )
Microfuge tubes
20 ml syringes
0.2 µm filter
Human umbilical cord blood (40-250 ml)
20x Dulbecco’s phosphate buffered (DPBS) (Life Technologies, Gibco®, catalog number: 14200-075 )
Note: Currently, it is “Thermo Fisher Scientific, GibcoTM, catalog number: 14200-075”.
Sterile water (Baxter, catalog number: UKF7114 )
LymphoprepTM (Axis-Shield, catalog number: 114547 )
CD133 microbeads including human FcR blocking reagent (Miltenyi Biotec, catalog number: 130-050-801 )
AutoMACS Pro Washing Solution (Miltenyi Biotec, catalog number: 130-092-987 )
AutoMACS Running Buffer (Miltenyi Biotec, catalog number: 130-091-221 )
Note: If the AutoMACS Pro separator is not available, cells of interest can be isolated by manual sorting (see below). This manual method, however, is not necessarily optimal for naEFC cell sorting with lower cell viability and number observed; thus the AutoMACS method is preferred.
Endothelial growth media with Bullet kit (EGM-2) (Lonza, catalog number: cc-3162 )
Fetal bovine serum, characterized (FBS) (VWR International, HycloneTM, catalog number: SH30071.03 )
Recombinant human Vascular endothelial growth factor (VEGF) (Sigma-Aldrich, catalog number: V7259 )
Recombinant human Insulin-like growth factor-1 (IGF-I) (R&D Systems, catalog number: 291-G1-200 )
Recombinant human fibroblast growth factor basic (FGFb) (R&D Systems, catalog number: 233-FB-025 )
L-Ascorbic acid (Sigma-Aldrich, catalog number: A5960 )
Bovine Serum Albumin (BSA) (Sigma-Aldrich, catalog number: A6003 )
EDTA (Merck Millipore Corporation, catalog number: 1.08418 )
Medium 199 (Sigma-Aldrich, catalog number: M4530 )
Sodium bicarbonate (7.5%) (Life Technologies, Gibco, catalog number: 25080-094 )
Note: Currently, it is “Thermo Fisher Scientific, GibcoTM, catalog number: 25080-094 ”.
HEPES (1 M) (Life Technologies, Gibco, catalog number: 15630-080 )
Note: Currently, it is “Thermo Fisher Scientific, GibcoTM, catalog number: 15630-080”.
Pen Strep 100x (Life Technologies, Gibco, catalog number: 15140-122 )
Note: Currently, it is “Thermo Fisher Scientific, GibcoTM, catalog number: 15140-122”.
MEM Non-essential amino acid solution 100x (Sigma-Aldrich, catalog number: M7145 )
Sodium pyruvate 100 mM (Sigma-Aldrich, catalog number: S8636-100 )
GlutaMAXTM 100x (Life Technologies, Gibco, catalog number: 35050-061 )
Note: Currently, it is “Thermo Fisher Scientific, GibcoTM, catalog number: 35050-061”.
Acetic acid, glacial (Chem Supply, catalog number: AA009-2.5 L )
Crystal violet (Sigma-Aldrich, catalog number: C3886-25 g )
1x DPBS (see Recipes)
0.1% BSA/DPBS (see Recipes)
EGM-2 Media with bullet kit (see Recipes)
White blood cell counting fluid (see Recipes)
Fibronectin (Roche Diagnostics, catalog number: 10838039001 ) (see Recipes)
VEGF (see Recipes)
FGFb (see Recipes)
Ascorbic acid (see Recipes)
IGF-I (see Recipes)
HUVE media + 20% FBS (see Recipes)
EGM-2 Media + FBS and growth factors (see Recipes)
MACS buffer (see Recipes)
Equipment
Certified biological safety cabinet
AutoMacs® Pro with chill 15 rack (Miltenyi Biotec, catalog number: 130-092-545 )
Pipettes
Pipette gun with ability to set to slow
Centrifuge with lids (Eppendorf AG, model: 5810R ) with A-4-81 rotor
Cell counting device (i.e., Haemocytometer)
Microscope
CO2 incubator
For manual cell sorting
MiniMACSTM separator (Miltenyi Biotec, catalog number: 130-042-102 )
MACS MultiStand separator (Miltenyi Biotec, catalog number: 130-042-303 )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
Category
Stem Cell > Adult stem cell > Epithelial stem cell
Cell Biology > Cell isolation and culture > Cell isolation
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,773 | https://bio-protocol.org/exchange/protocoldetail?id=1773&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Colon Cancer-associated Fibroblast Establishment and Culture Growth
MH Mercedes Herrera
Alberto Herrera
ML María Jesús Larriba
GF Gemma Ferrer-Mayorga
Antonio García de Herreros
Félix Bonilla
JB Josep Baulida
CP Cristina Peña
Published: Vol 6, Iss 7, Apr 5, 2016
DOI: 10.21769/BioProtoc.1773 Views: 12698
Edited by: HongLok Lung
Reviewed by: Isabel Cristiane da SilvaVanesa Olivares-Illana
Original Research Article:
The authors used this protocol in Jan 2015
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jan 2015
Abstract
Cancer-associated fibroblasts (CAFs) are one of the major players in tumor-stroma crosstalk. Findings in experimental studies suggest important roles for CAFs in regulation of tumor growth, metastasis and drug response (Hanahan and Coussens, 2012). Furthermore, their clinical relevance is supported by new findings from tumor analyses, demonstrating the prognostic and response-predictive significance of CAF-derived markers or gene signatures (Berdiel-hacer et al., 2014; Finak et al., 2008; Navab et al., 2011; Paulsson and Micke, 2014). CAFs are a heterogeneous pool of cell subsets with distinct functions which needs to be better defined by their marker expressions. The development of a methodology for the establishment of fibroblast primary cultures derived from human colon tumors allowed us to characterize their functional and molecular properties (Herrera et al., 2013). In addition, the different molecular mechanisms through which CAFs affect tumor growth and metastasis are still to be clarified. Therefore, functional and molecular characterization of the cancer-associated fibroblasts is essential to fully understand their role in tumor progression.
Materials and Reagents
50 ml Falcon tubes
Sterile disposable plastic Pasteur pipettes or sterile forceps
10 cm tissue culture dishes
T-25 tissue culture flasks
MW6 tissue culture plates (Jet Biofil, catalog number: TCP-011-006 )
Human tissue samples (colon normal and tumor tissue)
Dulbecco’s Modified Eagle Medium (DMEM) high glucose without L-glutamine (Lonza, catalog number: BE12-614F )
L-glutamine (Lonza, catalog number: BE17-605E )
NormocinTM (InvivoGen, catalog number: ANT-NR-2 )
Penicillin/Streptomycin (Lonza, catalog number: BE17-602E )
Amphotericin B (Carl Roth GmbH + Co., catalog number: 0246.1 )
Gentamicin (Carl Roth GmbH + Co., catalog number: 0233.2 )
Phosphate-buffered saline (PBS) (Lonza, catalog number: BE17-516F )
Fetal Bovine Serum medium (FBS) (Biowest, catalog number: S181B-500 )
Trypsin/EDTA (Thermo Fisher Scientific, GibcoTM, catalog number: 25200-056 )
FBM & FGM-2 Bullet kit [Lonza, catalog number:( CC-3131 ) and ( CC-4126 )]
Note: FBM & FGM-2 Bullet kit is on the list of Fibroblast Growth Media (FGM) Kits] (Lonza, catalog number: CC-3132 ).
DMEM (see Recipes)
FBS with high concentration of antibiotics (see Recipes)
FBS with normal concentration of antibiotics (see Recipes)
Equipment
Laminar flow tissue culture hood
Scalpels
37 °C shaker
37 °C and 5% CO2 cell culture incubator
Centrifuge
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Herrera, M., Herrera, A., Larriba, M. J., Ferrer-Mayorga, G., Herreros, A. G. D., Bonilla, F., Baulida, J. and Peña, C. (2016). Colon Cancer-associated Fibroblast Establishment and Culture Growth. Bio-protocol 6(7): e1773. DOI: 10.21769/BioProtoc.1773.
Download Citation in RIS Format
Category
Cancer Biology > Invasion & metastasis > Cell biology assays
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,774 | https://bio-protocol.org/exchange/protocoldetail?id=1774&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
This protocol has been corrected. See the correction notice.
Peer-reviewed
Strategies for Performing Dynamic Gene Perturbation Experiments in Flowers
Diarmuid S. Ó’Maoiléidigh
EG Emmanuelle Graciet
FW Frank Wellmer
Published: Vol 6, Iss 7, Apr 5, 2016
DOI: 10.21769/BioProtoc.1774 Views: 8370
Edited by: Samik Bhattacharya
Reviewed by: Xinyan Zhang
Original Research Article:
The authors used this protocol in Jul 2015
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jul 2015
Abstract
Dissecting the gene regulatory networks (GRNs) underlying developmental processes is a central goal in biology. The characterization of the GRNs underlying flower development has received considerable attention, however, novel approaches are required to reveal temporal and spatial aspects of these GRNs. Here, we provide an overview of the options available to perform dynamic gene perturbations to identify downstream response genes at specific stages of development in the flowers of Arabidopsis thaliana.
Keywords: Arabidopsis thaliana Flower Development Inducible promoters Genomics Metabolomics
[Introduction] Gene activity perturbation followed by expression analysis of downstream targets represents a powerful method to understand gene function and dissect regulatory hierarchies. The transcriptomes of “static” mutant lines (e.g., caused by point mutations, transfer-DNA insertions, or constitutive expression) are often compared with those of wild type counterparts, which can confound the biological interpretation of the expression data. For example, a null mutant (noted ag-1) of the transcription factor AGAMOUS (AG) lacks stamens and carpels, which are replaced by sepals and petals (Figure 1A and 1B) (Bowman et al., 1989). A comparison of the transcriptomes of ag-1 flowers with wild-type flowers may lead to the conclusion that AG regulates the expression of genes controlling the specification of mature tissues in the anther and gynoecium. This interpretation is inappropriate, as AG is required for the specification of these organ-types (Bowman et al., 1989; Yanofsky et al., 1990). Therefore, the cause of the expression differences observed may be a result of tissue biases (Wellmer et al., 2004). Dynamic perturbations circumvent these and other issues: i) the tissues harvested will be morphologically identical, as tissue from “mock-treated” and inducer-treated plants would normally be harvested within a 24 h time-frame, ii) the response of downstream targets can be measured in the range of minutes and hours, which can be useful to infer direct and indirect interactions, iii) the development-dependent functions of the regulators of interest can be dissected (O'Maoileidigh et al., 2015). Flowers of the model plant Arabidopsis thaliana are minute, particularly at early stages of development. Furthermore, they are initiated in a sequential manner such that no two flowers are at the exact same stage of development on any given inflorescence (Smyth et al., 1990). Until recently, these traits have inhibited investigations into the molecular mechanisms underlying the earliest stages of flower development. There are many strategies available to isolate tissue from young flower buds including laser capture microdissection and fluorescent activated cell sorting (Birnbaum et al., 2003; Mantegazza et al., 2014; Wuest and Grossniklaus, 2014). We prefer to use a floral induction system (FIS) to isolate flowers at specific stages of development, as it is a user friendly, low-cost approach (O'Maoileidigh et al., 2015; Wellmer et al., 2006; O'Maoileidigh and Wellmer, 2014). This system is based on the reintroduction of APETALA1 (AP1) activity into the apetala1-1 cauliflower-1 (ap1-1 cal-1) background via either a rat glucocorticoid (Wellmer et al., 2006; O'Maoileidigh and Wellmer, 2014; O’Maoileidigh et al., 2013) or a mouse androgen (O'Maoileidigh et al., 2015) receptor ligand binding domain (noted GR and AR, respectively) fusion with AP1. Once the FIS ap1-1 cal-1 inflorescences are treated with dexamethasone or dihydrogentestosterone (DHT, 5α-androstan-17β-ol-3-one), respectively, AP1 translocates to the nucleus to regulate transcription, which leads to the formation of many flowers on a single inflorescence that are at similar stages of development (Wellmer et al., 2006; O'Maoileidigh and Wellmer, 2014). We have shown that stage-specific flowers can be reliably harvested from early to late stages of development (Wellmer et al., 2006; Ryan et al., 2015). We have also demonstrated that these FISs can be combined with two-component inducible systems that facilitate dynamic perturbations (O'Maoileidigh et al., 2015; O’Maoileidigh et al., 2013; Wuest et al., 2012). We have generated FISs that are responsive to dexamethasone and DHT, which we have combined with the ethanol-responsive AlcApro/AlcR and the OPpro/GR-LhG4 dexamethasone-responsive two-component systems, respectively, to express artificial microRNAs (amiRNAs) that perturb gene activity. We have successfully used these lines to assess the stage-specific functions of genes of interest (O'Maoileidigh et al., 2015; O’Maoileidigh et al., 2013; Wuest et al., 2012). Notably, we also observed that these two-component inducible systems can influence the expression of the A. thaliana genome independently of the intended amiRNA-mediated perturbation (O'Maoileidigh et al., 2015). Therefore, we developed and described several control measures that must be taken in order to account for these experimental artifacts (O'Maoileidigh et al., 2015). In the following protocol, we provide technical advice for implementing dynamic perturbation strategies during flower development and the establishment of the experimental design. As a guide, we briefly discuss the perturbation strategies implemented to understand the functions of the homeotic gene AG, including our published and unpublished results, as well as data from the literature.
Materials and Reagents
20 cm x 32 cm x 50 cm trays with plastic lids [Romberg & Sohn, catalog number: 51221K (trays) and 74051K (lids)]
50 ml centrifuge tubes (Sigma-Aldrich, catalog number: CLS430829-500E )
Disposable pasteur pipettes (Thermo Fisher Scientific, catalog number: 12837625 )
Mouse AR coding sequence [obtained from the vector pBJ36-mAR (O'Maoileidigh et al., 2015)]
Note: Only the ligand-binding domain was fused to AP1.
Rat GR coding sequence [obtained from the vector pBJ36-GR (O’Maoileidigh et al., 2013)]
Note: Only the ligand-binding domain was fused to AP1.
SRDX domain fusions [produced using the vector p35SSRDXG (Mitsuda et al., 2011)]
Note: The SRDX amino acid sequence is LDLELRLGFA (Ikeda and Ohme-Takagi, 2009).
The WUSB coding sequence [obtained from the vector p35SWUSB (Ikeda et al., 2009)]
Note: The WUSB amino acid sequence is HRRTLPLFPMHGED (Ikeda et al., 2009).
VP16 domain fusions [produced using the vector p35SVP16 (Mitsuda et al., 2011)]
Note: Genbank accession KM486811 for VP16 activation domain sequence in a cloning vector.
AlcA sequence [obtained from AlcApro-pBJ36 (Leibfried et al., 2005)]
AlcR coding sequence [obtained from 35Spro:AlcR-pML-BART (Leibfried et al., 2005)]
GR-LhG4 coding sequence [obtained from 35Spro:GR-LhG4-pML-BART (Wuest et al., 2012)]
OPpro sequence [obtained from 6xOPpro-pBJ36 (Wuest et al., 2012)]
Floral induction system (FIS) [Various versions of the FISs are available from Dr. Frank Wellmer (O'Maoileidigh et al., 2015; Wellmer et al., 2006; O'Maoileidigh and Wellmer, 2014)]
CONTROL-amiRNA sequence [obtained from pBJ36-AlcApro:CTRL-amiRNA (O'Maoileidigh et al., 2015)]
GR antibody [obtained from Santa Cruz ( sc-1002 ) (Kaufmann et al., 2010)]
Dexamethasone (Sigma-Aldrich, catalog number: D4902 )
α-Androstan-17β-ol-3-one (DHT) (Sigma-Aldrich, catalog number: A8380 )
General reagents for molecular cloning and expression analysis
Liquid nitrogen
10 mM dexamethasone stock solution (see Recipes)
100 mM DHT stock solutionpowder (see Recipes)
GR activation solution (see Recipes)
AR activation solution (see Recipes)
Equipment
Sharp Forceps (Sigma-Aldrich, catalog number: T5790 )
Dissection microscope
General equipment for molecular cloning and expression analysis
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Ó’Maoiléidigh, D. S., Graciet, E. and Wellmer, F. (2016). Strategies for Performing Dynamic Gene Perturbation Experiments in Flowers. Bio-protocol 6(7): e1774. DOI: 10.21769/BioProtoc.1774.
Download Citation in RIS Format
Category
Plant Science > Plant developmental biology > General
Plant Science > Plant molecular biology > DNA
Molecular Biology > DNA > Mutagenesis
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,775 | https://bio-protocol.org/exchange/protocoldetail?id=1775&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Analysis of Telomeric G-overhangs by in-Gel Hybridization
SV Sona Valuchova*
ED Elisa Derboven*
KR Karel Riha
*Contributed equally to this work
Published: Vol 6, Iss 7, Apr 5, 2016
DOI: 10.21769/BioProtoc.1775 Views: 8135
Edited by: Tie Liu
Reviewed by: Shyam SolankiTzvetina Brumbarova
Original Research Article:
The authors used this protocol in Oct 2014
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Oct 2014
Abstract
Telomeric DNA in majority of eukaryotes consists of an array of TG-rich tandem repeats. The TG-rich DNA strand is oriented with its 3’ end towards chromosome termini and is usually longer than its complementary CA-rich strand, thus forming 3’ single stranded overhang (G-overhang). G-overhangs arise from incomplete replication of chromosome termini by the lagging strand mechanism and post-replicative nucleolytic processing. The G-overhang is important for telomere protection as it serves as a binding platform for specific proteins and is required for t-loop formation. Hence, structure of telomeric G-overhang is an important indicator of telomere maintenance and functionality. Here we describe a method for analysis of G-overhangs in a model plant Arabidopsis thaliana by in-gel hybridization technique. This method allows relative quantification of the amount of single stranded telomeric DNA. Short telomeric probes are radioactively labeled and hybridized to DNA under non-denaturing conditions to specifically detect ssDNA. Total telomeric DNA can be measured using denaturing conditions in the same gel and this procedure usually follows the non-denaturing in-gel hybridization. Terminal nature of the ssDNA is verified by exonuclease treatment. This technique was originally developed in yeast and now is used as a major tool for G-overhang analysis in a variety of organisms ranging from human to plants.
Keywords: Telomere G-overhang In-gel hybridization Arabidopsis Telomere analysis
Materials and Reagents
Plastic wrap (common food wrap or FisherbrandTM Clear Plastic Wrap) (Thermo Fisher Scientific, catalog number: 22-305654 )
Whatman® papers (Sigma-Aldrich, catalog number: 3030917 )
GeneJET Plant Genomic DNA Purification Kit (Life Technologies, catalog number: K0792 )
Note: Currently, it is “Thermo Fisher Scientific, catalog number: K0792”.
T4 DNA polymerase (NEB, catalog number: M0203S )
NEB buffer #2 (NEB, catalog number: B7002S )
dNTPs (Life Technologies, catalog number: R0181 )
Note: Currently, it is “Thermo Fisher Scientific, catalog number: R0181”.
Isopropanol
Absolute ethanol (EtOH)
HindIII (Thermo Fisher Scientific, catalog number: ER0501 )
3 M NaOAc (pH 5.2)
DNA Gel Loading Dye (6x) (Life Technologies, catalog number: R0611 )
Note: Currently, it is “Thermo Fisher Scientific, catalog number: R0611”.
PeqGold Universal agarose (VWR, catalog number: 732-2789 )
Ethidium Bromide (EtBr) solution (1%) (Applichem, catalog number: A1152 )
T4 polynucleotide kinase (PNK) (10 U/µl) (Thermo Fisher Scientific, catalog number: EK0031 )
Custom oligonucleotide probe, (TA3C3)4 or (TA3C3)3 (10 pmol/µl) (Sigma-Aldrich)
γ32P-ATP (> 6,000 Ci/mmol) (HARTMANN ANALYTIC GmbH, catalog number: SRP-501 )
QIAquick Nucleotide Removal Kit (QIAGEN, catalog number: 28304 )
Tris
Acetic acid
EDTA (pH 8.0)
NaCl
Sodium citrate (pH 7.0)
SDS
Na-phosphate buffer (pH 7.2)
BSA
Tris-Cl (pH 8)
1x TAE (see Recipes)
20x SSC (see Recipes)
Hybridisation buffer (see Recipes)
Wash solution-1 (see Recipes)
Wash solution-2 (see Recipes)
Denaturation solution (see Recipes)
Neutralization solution (see Recipes)
Equipment
EppendorfTM ThermoMixerTM C
Centrifuge (Eppendorf AG)
Horizontal Midi Gel Electrophoresis system (PerfectBlue Gel System Midi S, Peqlab)
Gel DocTM XR+ System (Bio-Rad Laboratories)
Gel dryer (Bio-Rad Laboratories, model: 583 )
Imaging plate (Fujifilm, catalog number: BAS-IP MS 2025 )
Note: Currently, it is “GE Healthcare, catalog number: BAS-IP MS 2025”.
Vacuum pump (Gardner Denver Thomas GmbH, ILMVAC, catalog number: 412711 )
Water bath with shaking
Pharos FX Plus Molecular Imager (Bio-Rad Laboratories)
PC with an image analysis software (e.g., Image Lab from Bio-Rad Laboratories)
Software
Image Lab 5.1 (Bio-Rad Laboratories) (freely available at http://www.bio-rad.com/en-us/product/image-lab-software)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Valuchova, S., Derboven, E. and Riha, K. (2016). Analysis of Telomeric G-overhangs by in-Gel Hybridization. Bio-protocol 6(7): e1775. DOI: 10.21769/BioProtoc.1775.
Download Citation in RIS Format
Category
Plant Science > Plant molecular biology > DNA
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,776 | https://bio-protocol.org/exchange/protocoldetail?id=1776&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Rust Removal Experiments
Mahmoud Kamal Ahmadi
Blaine A. Pfeifer
Published: Vol 6, Iss 7, Apr 5, 2016
DOI: 10.21769/BioProtoc.1776 Views: 23357
Edited by: Valentine V Trotter
Reviewed by: Modesto Redrejo-Rodriguez
Original Research Article:
The authors used this protocol in Aug 2015
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Aug 2015
Abstract
Iron oxidation, known as rust formation, causes enormous loss in term of property damages and associated economic risks. Depending on the degree of formation, rust consists of several layers of iron in different oxidation states. The brownish top layer is mostly iron (III) oxide-hydroxide [FeO(OH), Fe(OH)3] while the deepest black layers possess iron oxide (Fe2O3.nH2O). The flaky nature of surface rust meditates diffusion of oxygen and water to inner material sections which can lead to total disintegration of iron mass. As a result, it is desirable to remove rust and protect fresh surface from oxidizers. The common rust removal reagents are mainly based on complex formation of ferric ion with organic and inorganic acids such as citric acid, oxalic acid, and phosphoric acid. Rust removal ability is typically a qualitative observation which makes direct comparison between treatment options cumbersome if not impractical. In our recent work (Ahmadi et al., 2015), we have developed a colorimetric assay to measure ferric concentration in rust removal treatment media using a bacterially-produced siderophore (yersiniabactin) in comparison to a commercial rust removal reagent. In this approach, ferric concentration is correlated to the mass of rust being dissolved in the presence of different removal agents. This assay is based on a modification of the 1, 10-phenanthroline assay (Skoog and West, 1979) to enable detection using a 96-well plate format for higher throughput screening and assessment.
Materials and Reagents
Rusted iron samples
1,10-phenanthroline (Sigma-Aldrich, catalog number: 131377 )
Hydroxylamine hydrochloride (Sigma-Aldrich, catalog number: 159417 )
Ammonium acetate (Sigma-Aldrich, catalog number: 09689 )
Ammonium iron (II) sulfate hexahydrate (Sigma-Aldrich, catalog number: 09719 )
Oxalic acid (Sigma-Aldrich, catalog number: 241172 )
High pure water (Milli-Q)
0.3% 1,10-phenanthroline (wt/vol) (see Recipes)
1% Hydroxylamine hydrochloride (wt/vol) (see Recipes)
0.1 M Ammonium acetate (see Recipes)
Ammonium iron (II) sulfate hexahydrate standard solution (see Recipes)
10% Oxalic acid (wt/vol) (see Recipes)
Equipment
MaxQTM 4000 Benchtop Orbital Shakers (Thermo Fisher Scientific, catalog number: SHKA4000 )
Biotek Synergy 4 microplate reader (http://www.biotek.com/resources/articles/hybrid-plate-reader.html)
(Preferred) Milli-Q (Millipore) water purification system
(Optional) Vertical Band Saw (for machine-generated iron samples)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Ahmadi, M. K. and Pfeifer, B. A. (2016). Rust Removal Experiments. Bio-protocol 6(7): e1776. DOI: 10.21769/BioProtoc.1776.
Download Citation in RIS Format
Category
Microbiology > Microbial biochemistry > Other compound
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,777 | https://bio-protocol.org/exchange/protocoldetail?id=1777&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Total RNA Extraction from Grape Berry Skin for Quantitative Reverse Transcription PCR and Microarray Analysis
Mami Suzuki
Katsuhiro Shiratake
Published: Vol 6, Iss 7, Apr 5, 2016
DOI: 10.21769/BioProtoc.1777 Views: 8070
Edited by: Tie Liu
Original Research Article:
The authors used this protocol in May 2015
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
May 2015
Abstract
Extraction of high quality RNA is an essential step for quantitative reverse transcription PCR (qRT-PCR) and microarray analysis. However, it is not easy to extract high quality RNA from fruit materials, which contain high amounts of polysaccharides, lipids and secondary metabolites. Wan and Wilkins (1994) had developed ‘Hot Borate Method’ to isolate high quality RNA. Here, we describe a modified protocol of the ‘Hot Borate Method’ to isolate high quality RNA from grape berry skin for qRT-PCR and microarray analysis (Suzuki et al., 2015a; Suzuki et al., 2015b).
Keywords: RNA extraction Grape berry skin Hot Borate Method
Materials and Reagents
50 ml centrifuge tubes (e.g., the Falcon tubes)
1.5 ml microcentrifuge tubes
2 ml microcentrifuge tubes
Stainless steel spoon
Grape berry skins
Notes:
Skins isolated from grape berries using tweezers (Figure 1A, Video 1) . Skins were put in 15 or 50 ml tubes and frozen in liquid nitrogen immediately (Figure 1B, Video 1). These were stored at -80 °C. We recommend that preparation of about 20 pieces (about 1 g skin) because there are variations among berries.
This method could be applied to all grape varieties.
Liquid nitrogen
Proteinase K solutions (20 mg/ml) (Siyaku, Wako Pure Chemical Industries, catalog number: 160-22752 )
Lithium chloride (LiCl) (2 M, 10 M) (Siyaku, Wako Pure Chemical Industries, catalog number: 127-01165 )
Note: DEPC treated and autoclaved.
2 M potassium acetate (KOAC) (Siyaku, Wako Pure Chemical Industries, catalog number: 160-03175 )
Note: DEPC treated and autoclaved.
10 mM Tris-HCl (pH 7.5) (Siyaku, Wako Pure Chemical Industries, catalog number: 207-06275 )
Note: DEPC treated and autoclaved.
1 M potassium chloride (KCl) (Siyaku, Wako Pure Chemical Industries, catalog number: 163-03545 )
Note: DEPC treated and autoclaved.
Ethanol [70%, 99.8% (v/v)] (Siyaku, Wako Pure Chemical Industries, catalog number: 057-00456 )
RNeasy Plant Mini Kit (QIAGEN, catalog number: 74903 or 74904 )
RNase free water
Sodium borate decahydrate (Borax) (Siyaku, Wako Pure Chemical Industries, catalog number: 194-01415 )
Ethylene glycol tetraacetic acid (EGTA) (Dojindo, catalog number: 346-01312 )
1% (w/v) sodium dodecyl sulfate (SDS) (Siyaku, Wako Pure Chemical Industries, catalog number: 191-07145 )
1% (w/v) deoxycholate sodium salt (Siyaku, Wako Pure Chemical Industries, catalog number: 192-08312 )
10 mM dithiothreitol (DTT) (Siyaku, Wako Pure Chemical Industries, catalog number: 045-08974 )
1% (w/v) Triton X-114 (Sigma-Aldrich, catalog number: X114 )
2% (w/v) polyvinylpyrrolidone (PVP-40) (Sigma-Aldrich, catalog number: PVP40 )
Diethyl pyrocarbonate (DEPC) (Sigma-Aldrich, catalog number: D5758 ) treated and autoclaved
Hot Borate Extraction Buffer (see Recipes)
Equipment
Crusher (Automill) (Tokken, model: TK-AM5-H )
Shaking water bath (42 °C) (TAITEC CORPORATION, model: THERMO MINDER SM-05 with PERSONAL-11)
Centrifuge with angle rotor for 50 ml tube (SAKURA, model: 50A-7 with 50F-8A)
Centrifuge with angle rotor for 1.5 ml tube (SAKURA, model: SS1500X with 15M-24AM)
Vacuum equipment (EYELA, model: CVE-2000 )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
How to cite： Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Suzuki, M. and Shiratake, K. (2016). Total RNA Extraction from Grape Berry Skin for Quantitative Reverse Transcription PCR and Microarray Analysis. Bio-protocol 6(7): e1777. DOI: 10.21769/BioProtoc.1777.
Suzuki, M., Nakabayashi, R., Ogata, Y., Sakurai, N., Tokimatsu, T., Goto, S., Suzuki, M., Jasinski, M., Martinoia, E., Otagaki, S., Matsumoto, S., Saito, K. and Shiratake, K. (2015b). Multiomics in grape berry skin revealed specific induction of the stilbene synthetic pathway by ultraviolet-C irradiation. Plant Physiol 168(1): 47-59.
Download Citation in RIS Format
Category
Plant Science > Plant molecular biology > RNA
Molecular Biology > RNA > RNA extraction
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,778 | https://bio-protocol.org/exchange/protocoldetail?id=1778&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Expression, Purification and Enzymatic Assay of Plant Histone Deacetylases
ML Ming Luo
KW Keqiang Wu
Published: Vol 6, Iss 7, Apr 5, 2016
DOI: 10.21769/BioProtoc.1778 Views: 8335
Edited by: Tie Liu
Reviewed by: Arsalan Daudi
Original Research Article:
The authors used this protocol in Jun 2015
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jun 2015
Abstract
Histone deacetylases (HDACs) catalyzing the removal of acetyl groups from lysine residues of histone and non-histone proteins play vital roles in regulation of gene transcription. In plants, HDACs can be grouped into three families, including RPD3-type, SIR2-type and plant specific HD2-type HDACs. Here we describe a method to determine plant HDAC enzymatic activity. This protocol includes expression, purification and enzymatic activity assay of recombinant plant HDACs expressed in Escherichia coli (E. coli) and Arabidopsis thaliana (A. thaliana).
Keywords: Histone deacetylases HDACs Arabidopsis
Materials and Reagents
Sterile Syringe Filters (Merck Millipore Corporation, Millex, catalog number: SLGV033RS )
Ice
Seeds of A. thaliana ecotype Columbia (Col-0)
Escherichia coli (BL21) (Thermo Fisher Scientific, InvitrogenTM, catalog number: C6000-03 )
pGEX-4T-3 expression vector (GE Healthcare, Amersham, catalog number: 28-9545-52 )
Agrobacterium (GV3101)
LB medium (Caisson Laboratories, catalog number: LBP01-500 GM )
Murashige and Skoog (MS) media (Sigma-Aldrich, catalog number: M5524 )
Ampicillin (Beyotime, catalog number: ST007 )
Isopropyl-b-D-thiogalactopyranoside (IPTG) (Sigma-Aldrich, catalog number: 367-93-1 )
Sucrose (Sigma-Aldrich, catalog number: 57-50-1 )
Potassium hydroxide (KOH) (Sigma-Aldrich, catalog number: 1310-58-3 )
Bacto Agar (Sigma-Aldrich, catalog number: 9002-18-0 )
Ethanol
NP40 (Sigma-Aldrich, Abcam, catalog number: 9016-45-9 )
Sodium chloride (NaCl) (Sigma-Aldrich, catalog number: 31434 )
Potassium chloride (KCl) (Sigma-Aldrich, catalog number: 7447-40-7 )
Sodium phosphate dibasic (Na2HPO4) (Sigma-Aldrich, catalog number: 7558-79-4 )
Potassium phosphate monobasic (KH2PO4) (Sigma-Aldrich, catalog number: 7778-77-0 )
Hydrochloric acid (HCl)
Ethylenediaminetetraacetic acid (EDTA) (Sigma-Aldrich, catalog number: 60-00-4 )
Glycerol (Sigma-Aldrich, catalog number: 56-81-5 )
L-Glutathione reduced (Sigma-Aldrich, Abcam, catalog number: 70-18-8 )
Ultrapure water
Liquid N2
GST.BindTM Resin (Merck Millipore Corporation， Novagen, catalog number: 70541 )
Protease inhibitors (Roche Diagnostics, catalog number: 11873580001 )
Glycine (Sigma-Aldrich, catalog number: 15527 )
Tris base (Sigma-Aldrich, catalog number: 77-86-1 )
GFP-Trap (ChromoTek, GFP-Trap®_M)
HDAC activity colorimetric assay kit (BioVision, catalog number: K331-100 )
HeLa nuclear extracts (Biovision, catalog number: 1641-1 )
Trichostatin A (Sigma-Aldrich, catalog number: 58880-19-6 )
Bradford Protein Assay Kit (Beyotime, catalog number: P0006 )
Bovine Serum Albumin (BSA) (Sigma-Aldrich, catalog number: A7906 )
Phenylmethanesulfonyl fluoride (PMSF) (Sigma-Aldrich, catalog number: P7626 )
Boc-Lys(Ac)-pNA
Phosphate buffered saline (PBS) (see Recipes)
GST Elution buffer (see Recipes)
Plant protein extraction buffer (see Recipes)
GFP Wash buffer (see Recipes)
GFP Elution buffer (see Recipes)
HDAC Assay Buffer (Biovision) (see Recipes)
HDAC substrate (colorimetric substrate) (see Recipes)
Equipment
Plant growth chamber (Panasonic Healthcare Corporation, model: MLR-352 )
Sterile fume hood (Alibab, Airtech, model: VS-1300L )
Autoclave (HIRAYAMA, model: HVE-50 )
Centrifuge (Eppendorf AG, model: 5418R and 5810R )
Shaker (Eppendorf AG, model: New BrunswickTM Innova® 40 )
Sonicator (SONICS & MATERIALS, model: VCX130 )
Spectrophotometer (Molecular Devices Spectra Max)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Luo, M. and Wu, K. (2016). Expression, Purification and Enzymatic Assay of Plant Histone Deacetylases. Bio-protocol 6(7): e1778. DOI: 10.21769/BioProtoc.1778.
Download Citation in RIS Format
Category
Plant Science > Plant biochemistry > Protein
Microbiology > Heterologous expression system > Escherichia coli
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,779 | https://bio-protocol.org/exchange/protocoldetail?id=1779&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Methods for Detecting Microbial Methane Production and Consumption by Gas Chromatography
Jared T. Aldridge*
Jennie L. Catlett*
Megan L. Smith
Nicole R. Buan
*Contributed equally to this work
Published: Vol 6, Iss 7, Apr 5, 2016
DOI: 10.21769/BioProtoc.1779 Views: 10268
Edited by: Valentine V Trotter
Reviewed by: Laura Molina-García
Original Research Article:
The authors used this protocol in Oct 2015
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Oct 2015
Abstract
Methane is an energy-dense fuel but is also a greenhouse gas 25 times more detrimental to the environment than CO2. Methane can be produced abiotically by serpentinization, chemically by Sabatier or Fisher-Tropsh chemistry, or biotically by microbes (Berndt et al., 1996; Horita and Berndt, 1999; Dry, 2002; Wolfe, 1982; Thauer, 1998; Metcalf et al., 2002). Methanogens are anaerobic archaea that grow by producing methane gas as a metabolic byproduct (Wolfe, 1982; Thauer, 1998). Our lab has developed and optimized three different gas chromatograph-utilizing assays to characterize methanogen metabolism (Catlett et al., 2015). Here we describe the end point and kinetic assays that can be used to measure methane production by methanogens or methane consumption by methanotrophic microbes. The protocols can be used for measuring methane production or consumption by microbial pure cultures or by enrichment cultures.
Materials and Reagents
Balch tubes (Bellco Glass Inc., catalog number: 2048-00150 )
Butyl Rubber Stoppers (Bellco Glass Inc., catalog number: 2048-11800A )
11 mm Aluminum Seal Crimps (Wheaton, catalog number: 224176-01 ) (Figure 1A)
20 mm Aluminum Seal Crimps (Wheaton, catalog number: 224178-01 )
18 G and 22 G BD PrecisionGlide Needle (Becton Dickinson, catalog number: 305195 )
22 G BD PrecisionGlide Needle (Becton Dickinson, catalog number: 305155 )
Hamilton Gas Tight Syringe [1705 Sl 50 μl Syr (22s, 2”, 2) L] (Hamilton Company, catalog number: 80956 ) (Figure 1)
Autosampler vials (National Scientific, catalog number: G4012-1W )** (Figure 1A)
11 mm straight plug stopper, natural red rubber (Wheaton, catalog number: 224100-030 )** (Figure 1A)
UHP 99.99% Methane Gas Tank (Airgas, model: LW908 )
Nalgene Labtop cooler (Sigma-Aldrich, catalog number: C2312-1EA )
Nalgene Labtop cooler, Jr. (Sigma-Aldrich, catalog number: C2437-1 EA )
1 ml, 5 ml and 10 ml BD TB Syringes (Becton Dickinson, catalog number: 309624 , 309632 and 309640 )
15 ml sterile polypropylene Falcon conical centrifuge tubes (Corning, catalog number: 352196 )
Sterile PVDF syringe filter (17 mm diameter, 0.2 μm pore size) (Thermo Fisher Scientific, catalog number: F25136 )
20 ml BD Luer Lok Disposable syringe (Becton Dickinson, catalog number: 302830 )
16 x 132 mm mm Type 1 glass A borosilicate glass test tubes (Bellco Glass Inc., catalog number: 2011-16125 )**
16 mm KAP-UTS test tube caps, various colors (Bellco Glass Inc., catalog number: 2007-16005 )**
1 ml micropipette (Mettler-Toledo, Rainin, model: L-1000 )*
200 μl micropipette (Mettler-Toledo, Rainin, model: L-200 )*
20 μl micropipette (Mettler-Toledo, Rainin, model: L-20 )*
20 μl HydroLogix SoftFit-L Pipet Tips (VWR International, catalog number: 89031-366 )*
200 μl HydroLogix SoftFit-L Pipet Tips (VWR International, catalog number: 89031-388 )*
1 ml HydroLogix SoftFit-L Pipet Tips (VWR International, catalog number: 89031-430 )*
Envision paper towels (Georgia-Pacific, catalog number: 23504 )
Hamilton gastight tapered syringe as injection needle (Hamilton Company, catalog number: 5181-8809 ) (Figure 1)
UHP Air Gas Tank with regulator plumbed to GC (Matheson Tri-Gas®, model: SG SPPULW700 )
UHP Helium Gas Tank with regulator plumbed to GC (Matheson Tri-Gas®, model: SG SPPULW800P )
UHP Nitrogen Gas Tank with regulator plumbed to GC (Matheson Tri-Gas®, model: LW 411P )
UHP Hydrogen Gas Tank with regulator plumbed to GC (Matheson Tri-Gas®, model: SG SPPULW500P )
ddH2O
Mupirocin (Sigma-Aldrich, catalog number: M7694 )**
Sodium hydroxide (NaOH) anhydrous pellets (Sigma-Aldrich, catalog number: S8045-500 G )
HS culture medium
3-N-(morpholino) propanesulfonate (MOPS) (pH 6.8)
UHP 100% nitrogen (Matheson Tri-Gas®, model: SG SPPULW411 )
50 mM methanol
General preparation of anaerobic solutions (see Recipes)
200x mupirocin stock (see Recipes)
Plain medium (no C source) (see Recipes)
2x C medium (see Recipes)
Notes:
*Materials and reagents are only used for anaerobic condition.
** Materials and reagents can be used for both anaerobic and aerobic conditions.
Equipment
250 ml beaker (Thermo Fisher Scientific, catalog number: FB-100-250 )
Anaerobic chamber or glove box with (Coylab, model: type B ) (Figure 2)
Agilent 7890A Gas Chromatograph with Flame Ionization detector (Agilent Technologies, model: G3440A )
Agilent Autosampler (Agilent Technologies, model: G4513A )
Agilent Technologies OpenLAB CDS ChemStation Edition Rev C.01.02
GS-CarbonPLOT GC Column (Agilent Technologies, catalog number: 113-3132 )
Agilent Liner 4mm ID tap GW (Agilent Technologies, catalog number: 5062-3587 )
Merlin Microseal High-Pressure Replacement Septum (Restek Corporation, catalog number: 22812 )
IEC Medilite Microcentrifuge (Thermo Fisher Scientific, catalog number: 004480F ) (Figure 2)
Note: Equipment is used for anaerobic condition.
Spectronic 20D+ (Thermo Fisher Scientific, catalog number: 14-385-129 )
Software
Agilent OpenLAB CDS ChemStation software
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Aldridge, J. T., Catlett, J. L., Smith, M. L. and Buan, N. R. (2016). Methods for Detecting Microbial Methane Production and Consumption by Gas Chromatography. Bio-protocol 6(7): e1779. DOI: 10.21769/BioProtoc.1779.
Download Citation in RIS Format
Category
Microbiology > Microbial metabolism > Other compound
Biochemistry > Other compound > Alkane
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
178 | https://bio-protocol.org/exchange/protocoldetail?id=178&type=1 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Double in situ Hybridization
LJ Lili Jing
Published: Feb 5, 2012
DOI: 10.21769/BioProtoc.178 Views: 16449
Download PDF
Ask a question
Favorite
Cited by
Abstract
Double in situ hybridization I very useful to examine the relationship between the expression of two genes. But it is tricky because of the cross reaction of two different antibodies. This protocol is a valid method to do double color in situ hybridization in zebrafish embryos.
Materials and Reagents
Methanol
5-Bromo-4-Chloro-3-Indolyl Phosphate (BCIP)
Nitrotetrazolium blue chloride (NBT)
EDTA
INT
Tris
Tween 20
Glycine
Na2HPO4
HCl
NaCl
Sodium Citrate
MgCl2
KCl
PFA
Sheep serum
BSA
Citric acid
Formamide
Dechorionate
Hybe+ buffer (5ml/tube)
Torula Yeast RNA (Sigma-Aldrich, catalog number: R6225)
Heparin (Sigma-Aldrich, catalog number: H0777 )
Lamb Serum (GibcoBRL, catalog number: 16070096 )
Fast Red staining buffer (FRSB) [1 M Tris (pH 8.2), 0.1% Tween]
Proteinase K (Roche Diagnostics, catalog number: 10165921001 )
Fast Red talets (Roche Diagnostics, catalog number: 11496549001 ) or INT/BCIP (Roche Diagnostics, catalog number: 11681460001 )
NBT/BCIP (Promega Corporation, catalog number: S3771 )
Anti-DIG -AP (Roche Diagnostics, catalog number: 11093274910 )
Anti-Fluorescine AP (Roche Diagnostics, catalog number: 11426338910 )
NBT/BCIP (see Recipes)
1x PBT (see Recipes)
20x SSC (see Recipes)
10x PBS (see Recipes)
4% Paraformaldehyde (see Recipes)
Hybe+ buffer (5ml/tube) (see Recipes)
Heat Inactivated Lamb Serum (see Recipes)
Blocking solution (see Recipes)
Staining buffer (see Recipes)
Stop solution (see Recipes)
Equipment
Rotator
Nalgene filter
Hybridization Incubator
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2012 The Authors; exclusive licensee Bio-protocol LLC.
Category
Cell Biology > Cell staining > Nucleic acid
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,780 | https://bio-protocol.org/exchange/protocoldetail?id=1780&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Measurement of Inositol Triphosphate Levels from Rat Hippocampal Slices
NT Nino Tabatadze
CW Catherine Woolley
Published: Vol 6, Iss 7, Apr 5, 2016
DOI: 10.21769/BioProtoc.1780 Views: 8306
Edited by: Oneil G. Bhalala
Reviewed by: Manuel D. GaheteKae-Jiun Chang
Original Research Article:
The authors used this protocol in Aug 2015
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Aug 2015
Abstract
Inositol triphosphate (IP3) is an important second messenger that participates in signal transduction pathways in diverse cell types including hippocampal neurons. Stimulation of phospholipase C in response to various stimuli (hormones, growth factors, neurotransmitters, neurotrophins, neuromodulators, odorants, light, etc.) results in hydrolysis of phosphatidylinositol 4, 5-bisphosphate (PIP2), a phospholipid that is located in the plasma membrane, and leads to the production of IP3 and diacylglycerol. Binding of IP3 to the IP3 receptor (IP3R) induces Ca2+ release from intracellular stores and enables the initiation of intracellular Ca2+-dependent signaling. Here we describe a procedure for the measurement of cellular IP3 levels in tissue homogenates prepared from rat hippocampal slices.
Keywords: Hippocampus Polarization assay Inositol triphosphate
Materials and Reagents
Syringes (1 ml and 60 ml) and needles (24 and 27 gauge) (Becton Dickinson, catalog numbers: 309659 and 309653 )
Single edge razor blade (IDL TechniEdge, catalog number: 05-091C )
Double edge razor blade (Electron Microscopy Sciences, catalog number: 72002-10 )
Costar Netwell Insert with 440 μm polyester mesh (Corning, catalog number: 3478 )
Corning assay plate, black 384 well with non-binding surface (Corning, catalog number: 3575 )
Conical tube (15 ml) (BD Biosciences, catalog number: REF352196 )
Note: Currently, it is “Thermo Fisher Scientific, FalconTM, catalog number: REF352196”.
Micro-centrifuge tubes (1.5 ml) (VWR International, catalog number: 20170-038 )
Aerosol barrier pipette tips (30 μl and 200 μl) (Thermo Fisher Scientific, catalog numbers: 02-707-33 and 02-707-42 )
Disposable transfer pipette (Thermo Fisher Scientific, catalog number: 13-711-9AM )
Glass plate (Electron Microscopy Sciences, catalog number: 70312-22 )
Glass staining dish (Newcomer supply, catalog number: 6816A )
Coarse fritted glass bubbler (Corning, catalog number: 39533-12EC )
Integrid Petri dishes (Becton Dickinson, Falcon, catalog number: 351112 )
Note: Currently, it is “Thermo Fisher Scientific, FalconTM, catalog number: 351112 ”.
Adult (47-57 days old) male and female Sprague Dawley rats (Harlan Laboratories)
Hit-Hunter IP3 fluorescence polarization assay kit (DiscoveRx Corporation, catalog number: 90-0037 )
70% Perchloric acid (HClO4) (Sigma-Aldrich, catalog number: 244252 )
Complete protease inhibitor cocktail tablets (Roche Diagnostics, catalog number: 11697498001 )
Quick Start Bovine Serum Albumin (BSA) standard (Bio-Rad Laboratories, catalog number: 500-0206 )
Protein assay reagent (Bio-Rad Laboratories, catalog number: 500-0006 )
Sodium pentobarbital solution (Virbac, catalog number: 710101 )
Calcium chloride solution (CaCl2) (Sigma-Aldrich, catalog number: 21115 )
Magnesium chloride solution (MgCl2) (Sigma-Aldrich, catalog number: M1028 )
Super glue (Super Glue Corporation, catalog number: SGP3 )
70% ethanol (Thermo Fisher Scientific, Decon labsTM, catalog number: 04-355-305 )
95% O2/5% CO2 gas mixture (Airgas, catalog number: X02OX95C2003102 )
NaCl
NaHCO3
Dextrose
KCl
NaH2PO4
HEPES (pH 7.4)
EGTA
Sodium orthovanadate
NaF
Sodium pyrophosphate
PMSF
Artificial cerebrospinal fluid (aCSF) (see Recipes)
Sucrose aCSF (s-aCSF) (see Recipes)
HEPES homogenization buffer (see Recipes)
Equipment
Scissors (Fine science tools, catalog numbers: 14000-12 and 14060-10 )
Forceps (Stoelting, catalog numbers: 52104-37 and 52104-35 )
Hemostat (Fine science tools, catalog number: 13008-12 )
Spatula (Thermo Fisher Scientific, catalog number: S50822 )
Accuspin micro 17R microcentrifuge (Thermo Fisher Scientific, catalog number: 13-100-676 )
Biophotometer (Eppendorf AG, catalog number: 6133000010 )
Leica VT1200S vibrating blade microtome (Leica Biosystems Nussloch GmbH, catalog number: 1491200S001 )
Isotemp 105 water bath (Thermo Fisher Scientific, catalog number: S63077Q )
Qsonica Q500 sonicator (Thermo Fisher Scientific, catalog number: 15-338-282 )
Synergy 4 multimode microplate reader (BioTek Instruments)
Vapor pressure osmometer 5520 (Wescor)
Accumet AB15 plus pH meter (Thermo Fisher Scientific, catalog number: 13-636-AB15PC )
Rotator (Labline Instruments)
Micropipettes (2-20 μl, 20-200 μl and 100-1,000 μl) (Capitol Scientific, Eppendorf, catalog numbers: 3120000038 , 3120000054 and 3120000062 )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
How to cite： Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Tabatadze, N. and Woolley, C. (2016). Measurement of Inositol Triphosphate Levels from Rat Hippocampal Slices. Bio-protocol 6(7): e1780. DOI: 10.21769/BioProtoc.1780.
Tabatadze, N., Huang, G., May, R. M., Jain, A. and Woolley, C. S. (2015). Sex differences in molecular signaling at inhibitory synapses in the hippocampus. J Neurosci 35(32): 11252-11265.
Download Citation in RIS Format
Category
Neuroscience > Cellular mechanisms > Intracellular signalling
Biochemistry > Other compound > Sugar alcohol
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,781 | https://bio-protocol.org/exchange/protocoldetail?id=1781&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Extraction and Quantification of Tryptophan and Kynurenine from Cultured Cells and Media Using a High Performance Liquid Chromatography (HPLC) System Equipped with an Ultra-sensitive Diode Array Detector
JK Jeffrey Kim
BS Benjamin Stewart
RW Robert H Weiss
Published: Vol 6, Iss 7, Apr 5, 2016
DOI: 10.21769/BioProtoc.1781 Views: 8114
Edited by: Masahiro Morita
Reviewed by: Michael Enos
Original Research Article:
The authors used this protocol in Jun 2015
Download PDF
Ask a question
Favorite
Cited by
Original research article
The authors used this protocol in:
Jun 2015
Abstract
Evidence of the involvement of tryptophan and its metabolite, kynurenine, in various biological processes including cancer is constantly expanding. Analysis of cell extracts and culture media can allow for quick snapshots of the metabolic fluctuations occurring in vitro. Here, we describe a method for metabolite extraction from mammalian cells and analysis of extracted metabolites and cell culture media by HPLC with detection using an ultra-sensitive diode array detector.
Keywords: Tryptophan Kynurenine Immune surveillance HPLC
Materials and Reagents
Disposable 2 ml plastic microcentrifuge tubes
1.5 ml glass vials (Agilent Technologies, catalog number: 5182-0715 ), screw top caps (Agilent Technologies, catalog number: 5182-0717 ) and 200 μl glass inserts (Agilent Technologies, catalog number: 5182-0549 )
AcroVac Filter Unit (Pall Life Sciences, catalog number: AVFP02L )
Chloroform (HPLC grade) (Thermo Fisher Scientific, catalog number: C607 )
L-Tryptophan (Sigma-Aldrich, catalog number: T0254 )
L-Kynurenine (Sigma-Aldrich, catalog number: K8625 )
3-Nitro-L-tyrosine (nitrotyrosine) (Sigma-Aldrich, catalog number: N7389 )
Methanol (HPLC grade) (Thermo Fisher Scientific, catalog number: A452 )
Acetonitrile (HPLC grade) (Thermo Fisher Scientific, catalog number: A998 )
Potassium phosphate monobasic anhydrous (KH2PO4) (Thermo Fisher Scientific, catalog number: P285-500 )
Potassium phosphate dibasic anhydrous (K2HPO4) (Thermo Fisher Scientific, catalog number: P288-500 )
PIPES (Thermo Fisher Scientific, catalog number: BP292450 )
EDTA (Thermo Fisher Scientific, catalog number: S311-500 )
Kynurenic acid (Sigma-Aldrich, catalog number: K3375 )
Quinolinate (Sigma-Aldrich, catalog number: P63204 )
Phosphate buffered saline (PBS)
50% methanol/50% 3 mM PIPES-3 mM EDTA (pH 7.4) (see Recipes)
Potassium phosphate (pH 6.4) with 2.7% (v/v) acetonitrile (see Recipes)
Standard mix (see Recipes)
Equipment
Refrigerated tabletop centrifuge
HPLC system with binary pump, autosampler and UV diode array detector (DAD) (Agilent Technologies, model: 1100 )
Hypersil GOLD C18 column (50 mm with 2.1 mm diameter) (Thermo Fisher Scientific, catalog number: 25003-052130 )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
Category
Cancer Biology > Cellular energetics > Biochemical assays
Cell Biology > Cell metabolism > Amino acid
Biochemistry > Other compound
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,782 | https://bio-protocol.org/exchange/protocoldetail?id=1782&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Conjugation of Duplexed siRNN Oligonucleotides with DD-HyNic Peptides for Cellular Delivery of RNAi Triggers
AH Alexander S. Hamil
KG Khirud Gogoi
SD Steven F. Dowdy
Published: Vol 6, Iss 7, Apr 5, 2016
DOI: 10.21769/BioProtoc.1782 Views: 8151
Edited by: Arsalan Daudi
Reviewed by: Vikash Verma
Original Research Article:
The authors used this protocol in Dec 2014
Download PDF
Ask a question
Favorite
Cited by
Original research article
The authors used this protocol in:
Dec 2014
Abstract
Despite the great promise that short interfering RNA (siRNA) induced RNAi responses hold as a therapeutic modality, due to their size (~15 kDa) and high negative charge (Bumcrot et al., 2006), siRNAs have no bioavailability and require a delivery agent to enter cells (Figure 1). TAT peptide transduction domain (PTD) has been developed as an agent that mediates cellular delivery of macromolecular therapeutics that otherwise lack bioavailability, making it a tantalizing candidate for siRNA delivery (Farkhani et al., 2014). Unfortunately, when conjugated to TAT PTD, the presence of 40 negative phosphodiester backbone charges on siRNA neutralizes the cationic PTD resulting in aggregation and poor cellular delivery (Meade and Dowdy, 2007). In light of this, we synthesized a neutral RNAi trigger, termed siRiboNucleic Neutrals, for conjugation to TAT PTD (Meade et al., 2014). In brief, the negatively charged phosphodiester backbone was neutralized by synthesis with bio-reversible phosphotriester protecting groups which are specifically converted into charged phosphodiester bonds inside of cells by the action of cytoplasmic restricted thioesterases resulting in a wild type siRNA that can induce RNAi responses. Here we describe the conjugation and cellular delivery of siRNN oligonucleotides with TAT PTD delivery domain (DD) HyNic peptides.
Keywords: siRNA siRNN Phosphotriester Peptide Transduction Domain Oligonucleotide conjugation
Materials and Reagents
1.5 ml microcentrifuge tubes (Polypropylene, Pyrogen, RNase, DNase-free)
Amicon Ultra 0.5 ml centrifugal filter unit with Ultracel-30 membrane (Merck Millipore Corporation, catalog number: UFC503024 )
50 ml conical centrifuge tubes (VWR International, catalog number: 21008-714 )
24-well cell culture plates, flat bottom, TC treated (Genesee Scientific, catalog number: 25-107 )
H1299 cells (ATCC, catalog number: CRL-5803 )
Note: H1299 cells constitutively expressing destabilized enhanced green fluorescent protein (dGFP) are used in this protocol for rapid assaying of RNAi responses by flow cytometry.
GFP and non-targeting siRNNA4 (RNN phosphoramidite and oligonucleotide synthesis is described in Meade et al., 2014), RNN sequences (5’ to 3’):
GFP passenger strand: CDCACUAACCUGAGCAACCACAGUAT
GFP guide strand: CUSGGGUSGCUSCAGGUSAGUSGGUST
Non-targeting passenger strand: UDGAGAAGAUCCUCAAUAAAAGAUAT
Non-targeting guide strand: UCSUUUASUGASGGAUCSUCUSCAUST
Key: subscript D = dimethyl-butyl phosphotriester group, subscript A = aldehyde A-SATE phosphotriester group, subscript S = tBu-SATE phosphotriester group
UltraPure DNase/RNase-free distilled water (Life Technologies, Invitrogen, catalog number: 10977023 )
Note: Currently, it is “Thermo Fisher Scientific, InvitrogenTM, catalog number: 10977023”.
TAT Delivery Domain (DD) Hynic peptide, 3T3S-Hy [TAT = RKKRRQRRR, 3T3S-Hy sequence: HyNic-GG-(TAT)-PEG18-(TAT)-PEG18-(TAT)] (Note 1)
Acetonitrile (ACN), Anhydrous (Glen Research, catalog number: 40-4050-50 )
Sodium chloride (NaCl) (Sigma-Aldrich, catalog number: S7653 )
HEPES (AmericanBio, catalog number: AB00892 )
Aniline (Alfa Aesar, catalog number: A14443 )
Acetic Acid, Glacial (Thermo Fisher Scientific, catalog number: MAX00739 )
Dry ice
40% acrylamide/bis solution (19:1) (Bio-Rad Laboratories, catalog number: 161-0144 )
10x Tris-Borate-EDTA (TBE) Buffer (Mediatech, catalog number: 46-011-CM )
Ammonium persulfate (VWR International, catalog number: EM-2300 )
10% (w/v) sodium dodecyl sulfate (SDS) solution (Bio-Rad Laboratories, catalog number: 161-0416 )
N, N, N’, N’-Tetramethylethylenediamine (TEMED) (VWR International, catalog number: EM-8920 )
Deionized water
Orange G (Sigma-Aldrich, catalog number: O-3756 )
Glycerol (Sigma-Aldrich, catalog number: G5516 )
SilverQuest Silver Staining Kit (Life Technologies, Novex™, catalog number: LC6070 )
Note: Currently, it is “Thermo Fisher Scientific, InvitrogenTM, catalog number: LC6070”.
DMEM, high glucose (Life Technologies, Gibco, catalog number: 11965-092 )
Note: Currently, it is “Thermo Fisher Scientific, GibcoTM, catalog number: 11965-092”.
Fetal Bovine Serum (FBS), heat inactivated (Omega Scientific, catalog number: FB-02 )
Penicillin-Streptomycin (10,000 U/ml) (Life Technologies, Gibco, catalog number: 15140-122 )
Note: Currently, it is “Thermo Fisher Scientific, GibcoTM, catalog number: 15140-122”.
Phosphate buffered saline (Thermo Fisher Scientific, catalog number: BP665-1 )
Opti-MEM reduced serum medium (Life Technologies, Gibco, catalog number: 31985-070 )
Note: Currently, it is “Thermo Fisher Scientific, GibcoTM, catalog number: 31985-070”.
0.05% Trypsin-EDTA, phenol red (Life Technologies, Gibco, catalog number: 25300-054 )
Note: Currently, it is “Thermo Fisher Scientific, GibcoTM, catalog number: 25300-054”.
5x siRNN conjugation buffer (see Recipes)
0.4% SDS non-denaturing polyacrylamide gel solution (see Recipes)
0.4% SDS-PAGE running buffer (see Recipes)
1x 0.4% SDS non-denaturing loading buffer (see Recipes)
Equipment
Rotisserie (Barnstead International, model: Labquake 4001100 )
Lyophilizer (SP Scientific, VirTis, model: Freezemobile 25EL )
Microcentrifuge (Eppendorf, model: 5424 )
UV Spectrophotometer (capable of measuring absorbance at 260 nm)
Polyacrylamide gel casting stand and glass with 1.5 mm spacers (Bio-Rad Laboratories)
Gel running apparatus (Bio-Rad Laboratories, model: Mini-PROTEAN 3 Cell )
Gel staining dish
Gel Doc (Bio-Rad Laboratories, model: Molecular Imager Gel Doc XR+ System )
Benchtop centrifuge (Beckman Coulter, model: Allegra X-15R )
Flow cytometer (BD Sciences, model: LSRII )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
Category
Molecular Biology > RNA > RNA interference
Molecular Biology > RNA > RNA synthesis
Biochemistry > RNA > RNA structure
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,783 | https://bio-protocol.org/exchange/protocoldetail?id=1783&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Procedure for Rhamnolipids Quantification Using Methylene-blue
Tsiry Rasamiravaka
OV Olivier M. Vandeputte
MJ Mondher El Jaziri
Published: Vol 6, Iss 7, Apr 5, 2016
DOI: 10.21769/BioProtoc.1783 Views: 15488
Edited by: Valentine V Trotter
Reviewed by: Alexander B. Westbye
Original Research Article:
The authors used this protocol in Jul 2015
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jul 2015
Abstract
Rhamnolipids produced by Pseudomonas aeruginosa (P. aeruginosa) represent a group of biosurfactants with various applications (e.g., bioremediation of oil spills, cosmetics, detergents and cleaners). The commonly used colorimetric methods for rhamnolipid quantification, including anthrone, phenol−sulfuric acid and orcinol based quantification (Helbert and Brown, 1957; Chandrasekaran and BeMiller, 1980), are laborious and operationally hazardous because of the strong acid/chemical emanation which can cause deterioration of instruments measurements (e.g., spectrophotometer). Therefore, the methylene-blue-based analysis appears as a promising alternative to safely quantify whole rhamnolipid molecules based on chemical complexation reaction (Pinzon and Ju, 2009). Indeed, methylene blue and rhamnolipids form a complex in a water-chloroform phase system. The rhamnolipids-methylene blue complex is partitioned into the chloroform phase which will develop a blue color that can be quantified at 638 nm to deduce rhamnolipids concentration. Here, we describe a variant of methylene-blue-based rhamnolipids quantification procedure that allows spectrophotometric quantification on standard 96-well plastic microplate contrarily to original methylene blue procedure that requires specific and expensive microplate due to chloroform chemical properties.
Keywords: Rhamnolipids Pseudomonas aeruginosa Methylene-blue Complexation Quantification
Materials and Reagents
Borate Buffer Packs BupHTM (Thermo Fisher scientific, catalog number: 28384 )
Centrifuge round bottom reaction tubes (30 ml) (Krackeler Scientific, COREX®, catalog number: 1-8445-30 )
Greiner CELLSTAR® 96 well plates (clear polystyrene wells flat bottom) (Sigma-Aldrich, catalog number: M3687-60 EA )
Microcentrifuge tube [2 ml, transparent polypropylene (PP) with Lid] (Sigma-Aldrich, Brand®, catalog number: Z628034-500 EA )
Sterile culture tube (PP) (14 ml) (The Lab Depot Inc., catalog number: TLDT8235 )
Centrifugal Filter (0.1 µm pore size, Non-Sterile) with Durapore® PVDF Membrane UFC40VV25 Ultrafree® (2 ml) (Merck Millipore Corporation, catalog number: UFC40VV25 )
Aluminium foil
Micropipettor (10 µl,100 µl and 1,000 µl) tips
Pseudomonas aeruginosa (P. aeruginosa) PAO1 Wild-type (strain PAO0001) (http://www.pseudomonas.med.ecu.edu/)
Chloroform (≥ 99% ) (Carl Roth GmbH & Co. KG, catalog number: 3313.1 )
Ethyl acetate (> 99.5%) (Merck Millipore Corporation, EMSURE®, catalog number: 1096231000 )
Hydrochloric acid (HCl) standard (1 N solution) (Sigma-Aldrich, Fluka analytical, catalog number: 318949-500 ml )
HCl standard (0.2 N solution in water) (Sigma-Aldrich, Fluka analytical, catalog number: 343102-500 ml )
Luria Bertani (LB) Broth (Lennox) Powder microbial growth medium (Sigma-Aldrich, catalog number: L3022-250 G )
Methylene blue solution [1.4% (w/v) in 95% ethanol] (Sigma-Aldrich, catalog number: 1808-50 ml )
3-(N-morpholino) propanesulfonic acid (MOPS) (99.5%) (Sigma-Aldrich, catalog number: M1254-100 G )
Rhamnolipids (90%, Standard) (Sigma-Aldrich, catalog number: R90 )
Sodium hydroxide (NaOH) solution
LB-MOPS broth (see Recipes)
Borax buffer (50 mM) (see Recipes)
Methylene blue aqueous solution (see Recipes)
Equipment
Micropipettor (100 µl-1,000 µl)
Micropipettor (10 µl-100 µl)
Autoclave
Stopwatch
Measuring Pipette (5 ml) (Jaytec Glass Limited, catalog number: WJ.485 )
96-well microplate spectrophotometer (e.g. Molecular Devices, model: SpectraMax M2 device )
Vacuum concentrator (e.g. Savant SPEEDVAC SVC 200H: 200 x g)
Tabletop centrifuge
Vortex mixer
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Rasamiravaka, T., Vandeputte, O. M. and Jaziri, M. E. (2016). Procedure for Rhamnolipids Quantification Using Methylene-blue. Bio-protocol 6(7): e1783. DOI: 10.21769/BioProtoc.1783.
Download Citation in RIS Format
Category
Microbiology > Microbial biochemistry > Lipid
Biochemistry > Lipid > Extracellular lipids
Biochemistry > Lipid > Lipid measurement
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,784 | https://bio-protocol.org/exchange/protocoldetail?id=1784&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Cloud-point PEG Glass Surfaces for Imaging of Immobilized Single Molecules by Total-internal-reflection Microscopy
ZZ Zhengjian Zhang
SP Sang Ryul Park
AP Alexandros Pertsinidis
AR Andrey Revyakin
Published: Vol 6, Iss 7, Apr 5, 2016
DOI: 10.21769/BioProtoc.1784 Views: 11210
Edited by: Arsalan Daudi
Original Research Article:
The authors used this protocol in Feb 2014
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Feb 2014
Abstract
This effective, robust protocol generates glass coverslips coated with biotin-functionalized polyethylene glycol (PEG), making the glass surface resistant to non-specific absorption of biomolecules, and permitting immobilization of biomolecules for subsequent single-molecule tracking of biochemical reactions. The protocol can be completed in one day, and the coverslips can be stored for at least 1 month. We have confirmed that the PEG surfaces prepared according to the protocol are resistant to non-specific adsorption by a wide range of biomolecules (bacterial, mitochondrial, and human transcription factors, DNA, and RNA) and biological buffers.
Keywords: Single-molecule fluorescence Polyethylene glycol Aminopropyltriethoxysilane Cloud-point Surface chemistry
[Introduction] Single-molecule imaging methods of studying dynamics of biomolecules complement traditional ‘bulk’ biochemical methods by allowing real-time tracking of multi-step reactions without the need to synchronize the reagents (Weiss, 1999). In most single-molecule imaging methods, a biomolecule of interest is first labeled with a single fluorophore, the labeled biomolecule is then immobilized on an optically transparent surface (usually glass or silica), and detected as diffraction-limited image (‘spot’) using an optical microscope equipped with a high-sensitivity camera (Selvin and Ha, 2008). The surface immobilization serves two purposes. First, it permits tracking of molecular states on time scales longer than hundreds of milliseconds (otherwise, the biomolecule would diffuse out of the focal plane). Second, the surface permits excitation of fluorescence in total-internal-reflection geometry (Axelrod, 1981), which dramatically increases the signal-to-noise ratio of detection of molecules located in close proximity (<100 nm) to the surface (Selvin and Ha, 2008). Despite these clear advantages, surfaces are also the most common source of artifacts in single-molecule analysis (Visnapuu et al., 2008). For example, irreversible, non-specific adsorption of bio-molecules onto the imaging surface may reduce the effective concentration of the bio-molecules in the ‘bulk’, and thus perturb the rate of the biochemical reaction. Moreover, if the ‘sticky’ molecule is fluorescently labeled, the noise from numerous non-specifically ‘stuck’ fluorescent molecules may obscure the signal from specifically bound molecules, which will complicate data analysis. Finally, tethering a biomolecule to a surface greatly increases the effective concentration of that molecule with respect to the surface, and further increases the probability of non-specific binding due to repetitive ‘bumping’ of the tethered molecule during long-term tracking. Overall, the compatibility of a surface for the biomolecules of interest needs to be validated on a case by case basis, and there remains a great demand in the single-molecule imaging field for effective, robust methods of surface passivation.
The current protocol builds upon a technique first introduced by Ha and colleagues (Ha et al., 2002) which, in turn, built upon finding that polyethylene glycol (PEG) is most effective in creating anti-fouling surfaces (Prime and Whitesides, 1993), also see references in (Ostuni et al., 2001). In the original protocol by Ha et al. (2002), glass surfaces were first coated with a silanol-reactive aminopropyltriethoxysilane (APTES) to create amine groups, followed by deposition of a mixture of amine-reactive N-hydroxysuccinimide (NHS)-PEG (to create a passivation layer on the glass) and NHS-PEG-biotin (to create a handle for immobilization of bio-molecules for single-molecule tracking). In our protocol, PEG deposition is performed in cloud-point conditions, which reduces the size of the PEG globule and results in a denser, more adsorption-resistant, PEG layer (Kingshott et al., 2002). In addition, our protocol maximizes the reactivity of NHS-PEG during deposition. Furthermore, the protocol includes an end-capping step intended to eliminate residual amine groups remaining after PEG coupling, which we found to reduce non-specific adsorption of nucleic acids to surfaces in low-ionic-strength buffers required by some enzymes (Zhang et al., 2014). Finally, the protocol provides simple quality-control tips to help trouble-shooting. Despite these key improvements, we found that some proteins are still prone to non-specific adsorption to ’cloud point’ PEG surfaces. For instance, we found that the general transcription factor TFIID, a key component of the human transcription machinery, absorbs to ‘cloud-point’ PEG surfaces, whereas other five components of the basal human transcription machinery (TFIIB, TFIIF, TFIIE, TFIIH and RNA polymerase II) do not (Revyakin et al., 2012). Thus, we recommend testing the ‘cloud-point’ PEG surfaces using your specific buffers, biomolecules of interest, and biochemical activity assays.
Materials and Reagents
Corning borosilicate cover glasses (24 x 40 mm, #1.5) (VWR International, catalog number: 48393-230 )
PYREX crystallization dish (Thermo Fisher Scientific, catalog number: 08-741D )
Nalgene 125 ml polypropylene jars (Thermo Fisher Scientific, catalog number: 11-815-10C )
Two non-coring Syringe needles, luer, No 18, 6” long (Sigma-Aldrich, catalog number: Z102717-1EA )
Parafilm (100 mm wide) (various suppliers)
pH paper strips (0-14 range) (various suppliers)
Double-sided tape (3M formulation 4095) (McMaster, catalog number: 76665A67 )
30% hydrogen peroxide (Thermo Fisher Scientific, catalog number: H325-4 )
95-98% sulfuric acid (Sigma-Aldrich, catalog number: 320501-2.5 L )
99% 3-aminopropyltriethoxysilane (APTES) (Acros, catalog number: 430941000 ) ,
Note: Stored under nitrogen in a container equipped with a rubber septum.
Acetone (Chromasolv for HPLC) (Sigma-Aldrich, catalog number: 270725-1 L )
Biotin-PEG-succinimidyl valerate [(bio-PEG-SVA) Mw = 5,000], (Laysan Bio)
Note: Aliquoted into individual microtubes (1-2 mg/tube) by the end users and stored under desiccation at -80 °C.
Methoxy-PEG-succinimidyl valerate [(mPEG-SVA), MW= 5,000] (Laysan Bio)
Note: Aliquoted into individual microtubes (~5 mg/ tube) by the end users and stored under desiccation at -80 °C, with the mass of reagent written for each aliquot with 0.1 mg accuracy (e.g., 4.9 mg, 5.1 mg, and so on).
Fluorescein-PEG-NHS (Nektar, catalog number: 1K4M0F02 )
Sulfosuccinimidyl acetate (Thermo Fisher Scientific, PierceTM, catalog number: 26777 )
TRIONE ninhydrin reagent (Pickering Laboratories, catalog number: T100 )
Potassium hydroxide (KOH) (semiconductor grade) (Sigma-Aldrich, catalog number: 306568-100 G )
Sodium bicarbonate (NaHCO3) (ACS grade) (Sigma-Aldrich, catalog number: S6014-25 G )
Potassium sulfate (K2SO4) (ACS grade) (Sigma-Aldrich, catalog number: 221325-500 G )
Protein samples labeled at > 70% with a fluorophore suitable for single-molecule imaging with 532 nm or 640 nm excitation (e.g., Cy3, Alexa555, Atto633 and Alexa647N)
Note: These should be the protein of interest to the end user. Commercially available ones can also be used.
0.5 M KOH (see Recipes)
0.5 M K2SO4 (see Recipes)
1 M NaHCO3 (see Recipes)
Phosphate-buffered saline containing 0.1% Tween-20 (see Recipes)
Equipment
Ceramic rack (for 12 coverslips) (Thomas Scientific, catalog number: 8542E40 )
Forceps (for handling of ceramic staining racks) (Thermo Fisher Scientific, catalog number: 10-316C )
Flat-tip tweezers (for handling of individual cover glasses) (Electron Microscopy Sciences, catalog number: 78335-35A )
250 ml PYREX beaker (various suppliers)
A compressed nitrogen cylinder with a regulator and 0.2 micro filter (various suppliers)
Two-Way Valve (PTFE) (Sigma-Aldrich, catalog number: 20926 )
UV-Vis spectrophotometer (various suppliers)
Horizontal platform shaker (common lab equipment) (various suppliers)
Bath sonicator (Sonicsonline, Branson, catalog number: 2510 )
Ultrapure water system (Merck Millipore Corporation)
Diamond scriber (Ted Pella, catalog number: 54463 )
Objective-type total-internal-reflection (TIR) microscope (Olympus TIRF objective lens NA = 1.49) equipped with an electron-multiplication CCD camera (Andor iXon+) and 532 and 640 nm laser excitation sources (various suppliers)
Procedure
Piranha preparation and treatment to clean cover glasses
Note: Be very careful as the Piranha solution used in this step is extremely corrosive. Follow your institution’s safety regulations. We recommend, at least, wearing a lab coat, a full-length rubber apron coat, long-sleeve butyl gloves, a full-face splash shield, and working under a chemical fume hood free of flammable organic chemicals. Use PYREX glassware for preparation of Piranha solutions (regular soda-lime glass beakers may crack upon heating when Pirahna solutions are prepared).
Place 12 coverslips into ceramic rack using flat-tip tweezers.
In a designated chemical fume hood, place two clean 250 ml PYREX beakers (beaker 1 and 2) in two separate crystallization dishes. The dishes serve as secondary containers to ensure safety.
Very carefully add 1 part (50 ml) of 30% hydrogen peroxide (H2O2) to beaker 1, followed by 3 parts (150 ml) of concentrated sulfuric acid (H2SO4). Gently stir to mix the solution with a clean glass rod. The solution will immediately form bubbles and heat up to ~100 °C.
Using forceps, very carefully transfer the rack with the coverslips into beaker 1 and incubate for 30 min. To ensure safety, leave a note indicating that Piranha is in use.
Repeat Piranha treatment one more time with a fresh Piranha solution in beaker 2.
Transfer the coverslips from beaker 2 into a Nalgene 125 ml polypropylene jar filled with double-distilled water. Dispose of piranha waste according to your institution’s regulations. Rinse the coverslips copiously with double-distilled water until pH stabilizes (verified by pH paper). The cleaned coverslips can be stored in double-distilled water without noticeable changes in reactivity and fluorescent background for at least 1 month.
Quality control.
Surface hydrophilicity. Piranha-treated coverslips become uniformly hydrophilic, which can be qualitatively verified by dipping a coverslip in water using flat-end tweezers, taking it out vertically, and observing water slowly receding as a uniform sheet, and forming Young’s rings before drying out. In contrast, untreated coverslips form patches of water when dipped into and taken out of water
Fluorescent background. After Piranha treatment, blow-dry a coverslip with pressurized pure nitrogen (see step C12) and place it onto a total-internal-reflection microscope. One should observe essentially no fluorescent spots (<3 identifiable ‘spots’ per 100 x 100 micron area) under typical single-molecule imaging conditions (excitation with 532 and 640 nm sources at density ~0.5 kW/cm2, imaging in 580/60 nm and 670/45 nm optical bands, sampling rate 2.5 Hz).
Mild KOH etching to maximize the density of silanol groups on the glass surface (Iler, 1979)
Transfer the Piranha-treated coverslips from water to a clean 250 ml polypropylene jar containing 125 ml of 0.5 M KOH, then sonicate for 1 h in a bath sonicator.
Be sure that the water level is up to the marked operating level, and is about level with the solution inside the jar.
Ensure that the temperature does not exceed 40 °C by supplying ice (100~200 g by estimation) at t = 0 and t = 30 min during sonication. Otherwise the bath will heat up, which accelerates etching of the coverslips and creates micron-size pits in the glass surfaces.
Transfer the coverslips back into the polypropylene jar containing water and copiously rinse the coverslips with double-distilled water until pH stabilizes, as verified by pH paper.
Silanization to create amine groups on glass surface
Note: In this step, the glass surface is functionalized with amine groups by incubating in a solution of APTES. Although APTES is one the best studied silanization agents, there is currently no consensus on the best method to cost-effectively create molecularly homogenous, reactive, stable APTES films. The parameter space for APTES deposition conditions is vast, as the quality of films has been shown to depend on the substrate (e.g. glass, silica, or oxidized silicon), surface cleaning method, deposition phase (e.g. liquid or vapor), water content of the solvent and the surface, concentration of APTES, temperature, incubation times, and annealing conditions [for references, see Kim et al. (2009)]. Our procedure is based on the simple technique introduced to the single-molecule imaging field by Ha and colleagues (Ha et al., 2002). In our hands, more sophisticated deposition methods did not create APTES surfaces superior to the ones prepared per Ha et al. (2002).
Under a fume hood, prepare three clean 125 ml polypropylene jars (maximal capacity of ~170 ml) containing 125 ml acetone.
Connect a non-coring needle to a 10 cc gas-tight glass syringe via a PTFE valve. Close the PTFE valve. Insert the needle through the septum of the APTES bottle and ensure that the needle orifice is below the surface of the APTES. Create slight positive pressure inside the APTES sealed bottle using a nitrogen line and a second non-coring needle. Open the PTFE valve. Withdraw 3.75 ml of APTES with the syringe and close the PTFE valve. Remove the needle from the bottle, open the PTFE valve, and add the APTES into the 125 ml of acetone in one of the jars. Gently stir to prepare 3% APTES.
Using forceps, remove the rack with coverslips from double-distilled water, and dip the rack successively into the two 125 ml polypropylene jars containing acetone, spending ~10 sec in each jar with gentle agitation. Then transfer immediately into the freshly prepared 3% APTES solution. Do not allow acetone to dry between transfers. Place the APTES container on a horizontal platform shaker and incubate for 1 h.
Note: Immediately after use, during silanization, rinse the syringe, the syringe needles, and the PTFE valve sequentially with acetone and double-distilled water, and then blow with dry nitrogen. Also, during silanization, prepare PEG solutions (steps D14-15).
After silanization, wash the coverslips with acetone by dipping the rack in the two jars containing acetone (see step C11) in reverse order and place the rack back into double-distilled water. Copiously rinse with double-distilled water. Do not let the coverslips spend more than 5 min in water. Blow the coverslips dry one-by-one with nitrogen. To that end, hold a coverslip on its corner with the flat-end tweezers, and direct the nitrogen gas flow across the surface of the coverslip towards the corner held by the tweezers. When dry, place the coverslip on a piece of Parafilm positioned on a flat, clean surface. Mark the upper surface of the coverslip by scoring the upper-left corner with a diamond scriber. The coverslips are now ready for PEGylation.
Notes:
We usually carry out PEGylation in a clean environment (e.g., a positive-pressure HEPA-filtered room), but we also have had success in a regular environment if PEGylation was carried out immediately after treatment by APTES. We typically do not store amine-treated coverslips.
Many APTES deposition protocols include a high-temperature curing step following silanization, meant to form stable covalent bonds between physisorbed APTES molecules (Plueddemann, 1982). However, on the molecular scale, curing may lead to lateral rearrangement of APTES molecules and create islands of unmodified glass (Kim et al., 2009). In our hands, curing offered no additional improvement in surface quality in terms of preventing non-specific adsorption of biomolecules.
Quality control: Concentration of amine groups. You can measure the concentration of amine groups on coverslip surfaces using TRIONE ninhydrin reagent. To that end, crush one coverslip by placing it into a 50 ml Falcon tube and centrifuging at 2,000 x g in a swing-bucket centrifuge for 1 min. Then fill the tube with 1 ml of the ninhydrin reagent and follow the manufacturer’s protocol to spectrophotometrically quantify the average density of amine groups on the coverslip surface (for 24 x 40 mm coverslips, with the thickness of ~0.15 mm, the total surface area is 1,940 mm2). Using standard dilutions of APTES as create a calibration curve, we typically get 3 amine groups per nm2.
Treatment of amine-glass surfaces with NHS-PEG at cloud-point conditions
Notes:
The procedure builds upon the method introduced by Ha et al. (2002), with modifications to maximize the density of PEG molecules, and to block and neutralize positively charged amine groups after PEG deposition (section E). Thus, amine-treated coverslips are coupled to succinimidyl-PEG at pH 9.0 in a bicarbonate buffer containing 0.45 M K2SO4, at 10.0 % NHS-PEG (w/v). The high salt and the high PEG concentration bring the PEG solution just below its ‘cloud point’, which maximizes the density of the PEG layer on the surface (Kingshott et al., 2002).
NHS group hydrolyzes in aqueous buffers, which makes NHS-PEG non-reactive. The lifetime of the NHS group is between a few seconds and a few minutes, depending on the nature of the NHS-PEG linker, pH, and temperature (Hermanson, 2008). For example, we found that NHS-SVA hydrolyses with a half-life of ~5 min at pH 9.0 at room temperature, which is a good compromise between the reactivity of the NHS group and the reactive species lifetime. Thus, our protocol minimizes the time the reactive NHS-SVA species spends at pH=9.0 prior to addition to the amine-glass surface. Specifically, we initially dissolve dry PEG-SVA at pH 6.0, at which the NHS group remains unhydrolyzed for at least 1 h. Then, immediately before addition of the PEG solution to the glass surface, we bring the pH up to 9.0. If you are using a non-SVA linker, you have to optimize the pH of the reaction to achieve the NHS lifetime of ~5 min.
The lifetime of the reactive NHS group can be measured spectrophotometrically by monitoring the kinetics of accumulation of free NHS upon hydrolysis [free NHS strongly adsorbs at 260 nm (Miron, 1982)]. We also highly recommend measuring the percentage of reactive PEG-NHS in new batches of purchased PEG reagents. We have had cases in which completely hydrolyzed, non-reactive PEGs had been shipped by major suppliers.
This step is best done during the APTES incubation at step C11. Take out 6 single-use aliquots of dry mPEG-SVA from storage at -80 °C. Each aliquot should be about 5 mg, which is sufficient to treat two coverslips. The mass of dry mPEG-SVA in the 6 aliquots should have been pre-written on each tube with 0.1 mg accuracy prior to storage at -80 °C (e.g., 4.9, 5.0, 5,1, 4.9, 5.0, and 5.1 mg for 6 tubes). In addition, take out 1-2 mg of biotin-PEG-SVA from storage. Let all tubes warm up to room temperature.
This step is best done during the APTES incubation at step C11. Calculate the volume of 0.5 M K2SO4 solution to add to each mPEG-SVA tube by multiplying the aliquot mass by 8 (e.g., the tube containing 4.9 mg will require 4.9 x 8 = 39.2 μl of K2SO4 solution) and record all volumes in a notebook. Sum up all the volumes, to get the minimal volume of 0.5 M K2SO4 required to make six PEG solutions [e.g., for 6 tubes containing 4.9, 5.0, 5,1, 4.9, 5.0, and 5.1 mg mPEG-SVA one needs (4.9 + 5.0 + 5.1 + 4.9 + 5.0 + 5.1) x 8 = 240 μl of K2SO4]. Based on the calculated minimal volume, prepare sufficient amount of 0.5% biotin-PEG-SVA solution in 0.5 M K2SO4 (e.g., dissolve 1.3 mg of biotin-PEG-SVA with 260 μl 0.5 M K2SO4). Pipet the pre-calculated volumes of the 0.5% biotin-PEG-SVA solution into each of the 6 mPEG-SVA aliquots (e. g. add 39.2 μl to the 4.9 mg tube, and so on), vortex for 10 sec, and briefly spin with a tabletop centrifuge. Each tube now should have a clear solution and a small (~5 μl in volume) pellet of PEG on the bottom.
Note: PEG precipitation is expected, because the PEG solution is currently at 11.6% concentration (w/v), which is above its ‘cloud point’ (10% w/v).
The tubes can remain at room temperature for at least 1 h without appreciable hydrolysis of the NHS group while the coverslips are being treated with APTES and laid out for PEGylation.
With all APTES-treated coverslips laid out for PEGylation, set up the PEGylation reactions using one PEG-NHS aliquot at a time. To that end, add 1/8 of 1 M NaHCO3 (pH 9.0) to the PEG solution in K2SO4 (e.g. add 4.9 μl of NaHCO3 to a tube that originally contained a 4.9 mg mPEG-SVA aliquot, and now contains 39.2 μl of the biotin-PEG-SVA solution), quickly mix by pipetting up and down, and deposit the whole solution in the center of a dry APTES-treated coverslip. Cover the drop with another coverslip carefully, making sure that the scored surfaces of both coverslips face towards the PEG solution, and avoiding formation of bubbles (by practicing). Repeat for the rest five pairs of coverslip and incubate for 30 min at room temperature.
Note: The PEG solution appears clear after addition of NaHCO3, because the total PEG concentration is now just below the ‘cloud point’. We noticed that additional coating of coverslips with a fresh solution of PEG does not improve the quality of surfaces (in terms of non-specific adsorption of biomolecules).
Carefully separate the coverslip pairs using tweezers and place individual coverslips back into the ceramic rack in the double-distilled water. Rinse extensively with water until there is no more foaming of the solution.
Quality control: Density of PEG molecules. You can estimate the packing density of the PEG molecules on the glass surface by depositing fluorescein-PEG-NHS in the same conditions as described above, and measuring the absorbance at 494 nm using a high-sensitivity double-beam spectrophotometer (e.g., Perkin Elmer Lambda 35). The molecules density = [(OD494/extinction coefficient) x 6.02 x 1023 mol−1]/area. By this estimation, the average packing density should be consistent with the radius of gyration of a Mw = 5,000 PEG molecule at cloud point [R = 2.8 nm (Dalsin et al., 2005)].
Blocking of unreacted amines with acetyl groups
Note: Due to the bulkiness of PEG molecules, only a fraction of amine groups on the surface reacts with NHS-PEG. As a result, the remaining amines contribute to non-specific adsorption of negatively charged molecules, such as DNA, which is problematic in buffers of low ionic strengths. Thus, we cap the unreacted amines with NHS-acetate to convert them to neutral, stable amides.
Blow-dry 12 PEGylated coverslips as described in step C12. Place dry coverslips on Parafilm, with the PEGylated surface facing up.
Immediately prior to use, dissolve 3 mg of sulfo-NHS-acetate in 300 μl of 0.1 M NaHCO3 (pH 9.0), deposit 50 μl drops of the solution onto the 6 PEG coverslips, and cover with the remaining 6 coverslips, with the PEGylated surface facing the solution. Incubate for 30 min at room temperature. Rinse coverslips with double-distilled water, blow-dry, and store dry at -80 °C.
Testing fluorescent background of PEGylated surfaces and non-specific absorption of biomolecules
Note: The following protocol is for a rapid test of non-specific ‘stickiness’ of the surface to fluorescently labeled biomolecules. However, this test does not address the biological activity of surface-immobilized molecules (for instance, the activity of a transcription factor on a surface-immobilized DNA). Thus, the most relevant test of surface quality is a biochemical assay of the activity of surface-bound biomolecule, performed side-by-side with a positive control in which the activity of the same amount of biomolecules is measured in solution-based conditions (Revyakin et al., 2012).
Create 5 open wells on a coverslip using 1 mm-wide strips of double-sided tape (by simply sticking 6 strips on to the modified side), and place the coverslip on an objective-type TIRF microscope. The 5 wells allow testing of 5 different biomolecules.
Deposit a 5 μl drop of PBST into a well, turn on the excitation laser, and focus the microscope onto the surface. Acquire a movie to measure the fluorescent background on the surface, under single-molecule imaging conditions (e.g., excitation with 532 and 640 nm sources at density ~0.5 kW/cm2, imaging in 580/60 nm and 670/45 nm optical bands, sampling rate 2.5 Hz). In our hands, silanization and PEGylation increase the number of fluorescent background spots ~3 fold in comparison to Piranha-treated glass (i.e., an increase from ~3 spots to ~10 spots per 100 x 100 μm field of view), which is an acceptable level of background for most single-molecule imaging experiments. Allow the background spots to photobleach.
Prepare a 10 nM solution of the fluorescently labeled test protein in PBST, and deposit 20 μl of the solution on top of the 5 μl PBST drop already in the well. Acquire a movie to quantify the non-specific adsorption of the molecule to the surface. For simplicity, in this test we do not supply oxygen scavenger to the solution of test protein. Thus, to avoid immediate photobleaching upon sticking of a molecule to the surface (which will lead to over-estimation of surface quality) use minimal laser power (30~100 W/cm2) and fluorescent labels that photobleach in >5 seconds in the absence of oxygen scavengers (e.g., Cy3 and Atto633). For a good-quality surface, we typically observe a ‘cloud’ of 10 nM biomolecules rapidly diffusing in the bulk solution (at 2.5 Hz acquisition rate), and ~10 single-molecule limited spots in any given movie frame (100 x 100 μm field of view). No additional accumulation of spots should be observed within 10 min (with the excitation light switched off, and then turned back on again), indicating that non-specific adsorption is rare and reversible. Repeat the test with other biomolecules of interest using the remaining 4 wells.
Recipes
0.5 M KOH (per liter)
28 g KOH
Note: Solution can be re-used.
0.5 M K2SO4 (pH 6.0) (per liter)
174g K2SO4
Note: Store at room temperature. If your double-distilled water supply is acidic, no pH adjustment of the K2SO4 solution is necessary. If your double-distilled water supply is basic, adjust pH to 6.0 using diluted H2SO4.
1 M NaHCO3 (pH 9.0) (10x) (per liter)
82 g NaHCO3
Note: Adjust pH to 9.0 with NaOH and store in single-use aliquots at -80 °C.
Phosphate-buffered saline containing 0.1% Tween (PBST) (per liter)
2.0 g KCl
2.4 g KH2PO4
80 g NaCl
14.4 g Na2HPO4
1 ml Tween 20
Acknowledgments
We thank the groups of Steven Chu and Robert Tjian for support (University of California, Berkeley, and Janelia Farm Research Camus, supported by the NIH grant 1P01CA112181-01A1 and Howard Hughes Medical Institute).
References
Axelrod, D. (1981). Cell-substrate contacts illuminated by total internal reflection fluorescence. J Cell Biol 89(1): 141-145.
Dalsin, J. L., Lin, L., Tosatti, S., Voros, J., Textor, M. and Messersmith, P. B. (2005). Protein resistance of titanium oxide surfaces modified by biologically inspired mPEG-DOPA. Langmuir 21(2): 640-646.
Ha, T., Rasnik, I., Cheng, W., Babcock, H. P., Gauss, G. H., Lohman, T. M. and Chu, S. (2002). Initiation and re-initiation of DNA unwinding by the Escherichia coli Rep helicase. Nature 419(6907): 638-641.
Hermanson, G. T. (2008). Bioconjugation techniques. Academic Press, 10, p.0123705010.
Iler, R. K. (1979). The chemistry of silica: solubility, polymerization, colloid and surface properties, and biochemistry. Wiley 896.
Kim, J., Seidler, P., Wan, L. S. and Fill, C. (2009). Formation, structure, and reactivity of amino-terminated organic films on silicon substrates. J Colloid Interface Sci 329(1): 114-119.
Kingshott, P., Thissen, H. and Griesser, H. J. (2002). Effects of cloud-point grafting, chain length, and density of PEG layers on competitive adsorption of ocular proteins. Biomaterials 23(9): 2043-2056.
Miron, T. and Wilchek, M. (1982). A spectrophotometric assay for soluble and immobilized N-hydroxysuccinimide esters. Anal Biochem 126(2): 433-435.
Ostuni, E., Chapman, R. G., Holmlin, R. E., Takayama, S. and Whitesides, G. M. (2001). A survey of structure - property relationships of surfaces that resist the adsorption of protein. ASC Publications 17(9): pp.5605-5620.
Plueddemann, E. (1982). Silane coupling agents, Springer Netherlands.
Prime, K. L. and Whitesides, G. M. (1993). Adsorption of proteins onto surfaces containing end-attached oligo(ethylene oxide): a model system using self-assembled monolayers. J Am Chem Soc 115(23): 10714-10721.
Revyakin, A., Zhang, Z., Coleman, R. A., Li, Y., Inouye, C., Lucas, J. K., Park, S. R., Chu, S. and Tjian, R. (2012). Transcription initiation by human RNA polymerase II visualized at single-molecule resolution. Genes Dev 26(15): 1691-1702.
Selvin, P. R. and Ha, T. (2008). Single-molecule techniques : a laboratory manual. Cold Spring Harbor Laboratory Press.
Visnapuu, M. L., Duzdevich, D. and Greene, E. C. (2008). The importance of surfaces in single-molecule bioscience. Mol Biosyst 4(5): 394-403.
Weiss, S. (1999). Fluorescence spectroscopy of single biomolecules. Science 283(5408): 1676-1683.
Zhang, Z., Revyakin, A., Grimm, J. B., Lavis, L. D. and Tjian, R. (2014). Single-molecule tracking of the transcription cycle by sub-second RNA detection. Elife 3: e01775.
Copyright: Zhang et al. This article is distributed under the terms of the Creative Commons Attribution License (CC BY 4.0).
How to cite： Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Zhang, Z., Park, S. R., Pertsinidis, A. and Revyakin, A. (2016). Cloud-point PEG Glass Surfaces for Imaging of Immobilized Single Molecules by Total-internal-reflection Microscopy. Bio-protocol 6(7): e1784. DOI: 10.21769/BioProtoc.1784.
Zhang, Z., Revyakin, A., Grimm, J. B., Lavis, L. D. and Tjian, R. (2014). Single-molecule tracking of the transcription cycle by sub-second RNA detection. Elife 3: e01775.
Download Citation in RIS Format
Category
Biochemistry > DNA > Single-molecule Activity
Biochemistry > Protein > Single-molecule Activity
Biochemistry > RNA > Single-molecule Activity
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,785 | https://bio-protocol.org/exchange/protocoldetail?id=1785&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Isolation and Primary Cell Culture of Mouse Dorsal Root Ganglion Neurons
TH Theresa Heinrich
CH Christian A. Hübner
IK Ingo Kurth
Published: Vol 6, Iss 7, Apr 5, 2016
DOI: 10.21769/BioProtoc.1785 Views: 31150
Edited by: Xuecai Ge
Original Research Article:
The authors used this protocol in Jun 2015
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jun 2015
Abstract
We here provide a detailed protocol for the isolation and culture of primary mouse sensory neurons. The cell bodies of sensory afferent pseudounipolar neurons are located in dorsal root ganglia (DRGs) along the vertebral column. Dissected mouse DRGs can be dissociated into single cells by enzymatic digestion to obtain primary cultures of mouse sensory neurons as performed in the studies reported by Khaminets et al. (2015).
Materials and Reagents
T25 cell culture flask (25 cm2) (Greiner Bio-One GmbH, catalog number: 690160 )
24-well plate (Greiner Bio-One GmbH, catalog number: 662160 )
Cover glasses (Marienfeld-Superior, catalog number: 0111550 )
Glass Pasteur pipettes (Marienfeld-Superior, catalog number: 3233050 )
Filtropur S 0.2 syringe filters (Sarstedt AG, catalog number: 83.1826.001 )
Syringe Omnifix® (B. Braun Medical, catalog number: 4616103V )
Dissection dish (petri dish) (94 x 16 mm) (Sigma-Aldrich, catalog number: Z617636 ) with silicone pad
Greiner Petri dishes (35 x 10 mm) (Sigma-Aldrich, catalog number: P5112 )
15 ml Cellstar centrifugation tubes (Greiner Bio-One GmbH, catalog number: 188261 )
Mice (2 to 6 months) (strain: C57BL/6)
Poly-L-lysine hydrobromide (Sigma-Aldrich, catalog number: P2636 )
HEPES (AppliChem GmbH, catalog number: A3268 )
H3BO3 (Carl Roth GmbH + Co., catalog number: 6943.1 )
Sodium tetraborate (Na2B4O7) (Sigma-Aldrich, catalog number: 221732 )
Bovine Serum Albumin (PAA, catalog number: K41-001 )
HBSS (Thermo Fisher Scientific, GibcoTM, catalog number: 14175-053 )
Neurobasal®-A medium (Thermo Fisher Scientific, GibcoTM, catalog number: 10888022 )
B-27® Supplement (50x) (Thermo Fisher Scientific, GibcoTM, catalog number: 17504-044 )
L-glutamine (200 mM) (Thermo Fisher Scientific, GibcoTM, catalog number: 25030 )
Penicillin/streptomycin (100x) (Thermo Fisher Scientific, GibcoTM, catalog number: 15140 )
Minimum Essential Medium (MEM) (Thermo Fisher Scientific, GibcoTM, catalog number: 31095-029 )
D(+)-Glucose (C6H12O6) (Merck Millipore Corporation, catalog number: 108337 )
Collagenase-II (Worthington Biochemical Corporation, catalog number: LS004176 )
Horse serum (Thermo Fisher Scientific, GibcoTM, catalog number: 26050-88 )
Trypsin from bovine pancreas (Sigma-Aldrich, catalog number: T1426 )
β-nerve growth factor (β-NGF) (Preprotec, catalog number: 450-01 )
Borate buffer (see Recipes)
Poly-L-lysine hydrobromide (PLL) stock solution (see Recipes)
Poly-L-lysine hydrobromide (PLL) working solution (see Recipes)
Dissociation solution (see Recipes)
30% Glucose stock solution (see Recipes)
0.5% BSA-blocking solution (see Recipes)
DRG neuronal culture medium (see Recipes)
DRG preparation medium (see Recipes)
Collagenase-II solution (see Recipes)
2% trypsin stock solution (see Recipes)
Equipment
CO2 incubator (37 °C, 5% CO2 concentration and 95% relative humidity) (Labotect, model: C-200 )
Laminar flow work bench (Heraeus Holding)
Stereo microscope (Carl Zeiss, model: Stemi 2000C )
Cold light source (equipped with a flexible dual branch light guide) (Carl Zeiss, model: CL1500ECO )
Scissors
Standard scissors (Fine Science Tools, catalog number: 14002-12 )
Student spring scissors (Fine Science Tools, catalog number: 91500-09 )
Angled spring scissors (Fine Science Tools, catalog number: 15006-09 )
Forceps
Dumont #7b medical forceps (Fine Science Tools, catalog number: 11270-20 )
Dumont #4 forceps (Fine Science Tools, catalog number: 11242-40 )
Dumont #5 mirror finish forceps (Fine Science Tools, catalog number: 11252-23 )
Bunsen burner Fireboy plus (Integra Biosciences)
Glass Pasteur pipettes (Marienfeld-Superior, catalog number: 3233050 )
Dropper bulb for Pasteur pipettes (Thermo Fisher Scientific, catalog number: 03-448-25 )
Centrifuge 5810R (Eppendorf AG)
Pipetman P20/P200/P1000 (Gilson)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Heinrich, T., Hübner, C. A. and Kurth, I. (2016). Isolation and Primary Cell Culture of Mouse Dorsal Root Ganglion Neurons. Bio-protocol 6(7): e1785. DOI: 10.21769/BioProtoc.1785.
Download Citation in RIS Format
Category
Neuroscience > Sensory and motor systems > Cell isolation and culture
Cell Biology > Tissue analysis > Tissue isolation
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,786 | https://bio-protocol.org/exchange/protocoldetail?id=1786&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
HPLC Analysis of Secreted Organic Acids
Fiona K. Davies
SD Sarah D’Adamo
MP Matthew C. Posewitz
Published: Vol 6, Iss 8, Apr 20, 2016
DOI: 10.21769/BioProtoc.1786 Views: 11071
Edited by: Maria Sinetova
Reviewed by: Elizabeth LibbyRoman A. Sidorov
Original Research Article:
The authors used this protocol in Sep 2015
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Sep 2015
Abstract
Under certain growth conditions some microorganisms secrete organic acids into the extracellular medium to relieve the accumulation of excess energy carriers, and/or to reduce toxic concentrations of organic acids. For example, a glycogen-deficient ∆glgC mutant of the cyanobacterium Synechococcus sp. PCC 7002 secretes pyruvate, acetate, α-ketoglutarate, α-ketoisocaproate and succinate (Davies et al., 2014; Jackson et al., 2015). Secretion of these organic acids functions as a putative energy-spilling mechanism in the absence of glycogen, the major carbon and reductant sink in this organism. Identification of secreted organic acids can facilitate the design of metabolic engineering strategies that funnel over-accumulating organic acids towards metabolic pathways that make a product of interest (such as a biofuel). Here, we describe a method for analyzing secreted organic acids in the extracellular media using high-performance liquid chromatography (HPLC). This method was developed for analysis of organic acids secreted by photosynthetic microbes (cyanobacteria and algae) into media, but could be used to analyze organic acids secreted by any microorganism cultivated in liquid medium.
Keywords: Organic acids Microorganism HPLC Secreted metabolites Metabolism
Materials and Reagents
2 ml Eppendorf tubes (VWR international, catalog number: 20170-170 )
PIPETMAN Classic P1000 pipette (Gilson Scientific Ltd., catalog number: F123602 )
P1000 pipette tips (VWR international, catalog number: 83007-376 )
1 ml disposable syringe (BD, catalog number: 309659 )
Syringe filter, 0.45 µm PTFE membrane (Pall Corporation, catalog number: PN4543 )
Disposable filter unit (0.45 µm) (Thermo Fisher Scientific, NalgeneTM, catalog number: 166-0045 )
Screw-thread chromatography vials (VWR International, catalog number: 66009-858 )
Cyanobacterium Synechococcus sp. PCC 7002
Liquid culture (cyanobacteria or other microorganism)
Sulfuric acid (H2SO4) (Merck Millipore Corporation, catalog number: SX1244 )
Succinate (Sigma-Aldrich, catalog number: S3674 )
α-ketoglutarate acid (Sigma-Aldrich, catalog number: 75890 )
Acetic acid (Sigma-Aldrich, catalog number: 338826 )
Pyruvate (Sigma-Aldrich, catalog number: 107360 )
α-ketoisocaproate (Sigma-Aldrich, catalog number: 68255 )
Note: It is also named “4-Methyl-2-oxovaleric acid” on Sigma-Aldrich website.
8 mM H2SO4 (see Recipes)
50 mM succinate stock solution (see Recipes)
50 mM α-ketoglutarate stock solution (see Recipes)
50 mM acetic acid stock solution (see Recipes)
50 mM pyruvate stock solution (see Recipes)
50 mM α-ketoisocaproate stock solution (see Recipes)
10 mM organic acids standard mixture (see Recipes)
Equipment
Microcentrifuge (Beckman Coulter, catalog number: B30147 )
Surveyor Plus HPLC (Thermo Fisher Scientific) composed of
Surveyor LC pump
Surveyor Autosampler (AS)
Surveyor Photo Diode Array (PDA) Plus detector
Surveyor Refractive Index (RI) Plus detector
Aminex fermentation monitoring column (150 mm by 7.8 mm), stationary phase Polystyrene-divinylbenzene sulfonic acid resin, 9 μM particle size, 8% cross linkage (Bio-Rad Laboratories, catalog number: 1250115 )
Micro-Guard Cation H Cartridge guard column, 30 x 4.6 mm, hydrogen form, pH range 1-3, for Aminex® hydrogen-form columns (Bio-Rad Laboratories, catalog number: 1250129 )
ChromQuest™ Software Platform (Thermo Fisher Scientific, catalog number: INQSOF012 )
Software
Chromquest software
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Davies, F. K., D’Adamo, S. and Posewitz, M. C. (2016). HPLC Analysis of Secreted Organic Acids. Bio-protocol 6(8): e1786. DOI: 10.21769/BioProtoc.1786.
Download Citation in RIS Format
Category
Biochemistry > Other compound > Acid
Microbiology > Microbial biochemistry > Other compound
Microbiology > Microbial metabolism > Other compound
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,787 | https://bio-protocol.org/exchange/protocoldetail?id=1787&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Aβ Extraction from Murine Brain Homogenates
BC Brad T. Casali
GL Gary E. Landreth
Published: Vol 6, Iss 8, Apr 20, 2016
DOI: 10.21769/BioProtoc.1787 Views: 10923
Edited by: Oneil G. Bhalala
Reviewed by: Geoff LauKae-Jiun Chang
Original Research Article:
The authors used this protocol in Jun 2015
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jun 2015
Abstract
This protocol details beta-amyloid (Aβ) extraction from transgenic murine brain homogenates. Specifically, mechanical homogenization of brain tissue and sequential extraction of both soluble and insoluble proteins are detailed. DEA extracts soluble proteins, such as Aβ isoforms and APP. Formic acid enables extraction of insoluble protein aggregates, such as Aβ isoforms associated with plaques. This procedure produces soluble and insoluble extracts that are amenable to analysis of Aβ species via western blotting and/or enzyme-linked immunosorbent assays (ELISAs), and these results help assess amyloidogenic burden in animals.
Keywords: Beta-amyloid ELISA Extraction Abeta Murine
Materials and Reagents
5.0 ml open-top polyallomer ultracentrifuge tubes (or tubes capable of undergoing high-speed centrifugation) (Denville Scientific, catalog number: U5022 )
Diethylamine (DEA) (≥ 99.5%) (Sigma-Aldrich, catalog number: 471216 )
95% formic acid (FA) (AMRESCO, catalog number: 0961 )
100 mM NaCl (store at room temperature)
Tris base (Thermo Fisher Scientific, catalog numeber: BP152 )
0.5 M sodium phosphate dibasic (Na2HPO4) (AMRESCO, catalog numeber: 0348 )
0.05% sodium azide (NaN3) (Thermo Fisher Scientific, catalog numeber: S2271 )
250 mM sucrose (Thermo Fisher Scientific, catalog numeber: S5 )
0.5 mM Ethylenediaminetetraacetic Acid, Disodium Salt Dihydrate (EDTA) (Thermo Fisher Scientific, catalog numeber: S311 )
0.5 mM Ethylene glycol-bis(2-aminoethylether)-N, N, N’, N’-tetraacetic acid (EGTA) (Sigma Aldrich, catalog numeber: 03777 )
Tris-hydrochloride (Tris-HCl)
0.4% DEA in 100 mM NaCl (see Recipes)
0.5 M Tris-HCl (pH 6.8) (see Recipes)
Formic acid neutralization buffer (see Recipes)
Tissue homogenization buffer (THB) (see Recipes)
Protease inhibitor cocktail (Sigma-Aldrich, catalog number: P8340 ) (see Recipes)
Equipment
Beckman Coulter Optima L-90K Ultracentrifuge (used with an SW50.1 rotor)
Ultrasonic sonicator (see Note 7, below) (Kontes, model: KT50 , catalog number: 12038 )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
How to cite： Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Casali, B. T. and Landreth, G. E. (2016). Aβ Extraction from Murine Brain Homogenates. Bio-protocol 6(8): e1787. DOI: 10.21769/BioProtoc.1787.
Casali, B. T., Corona, A. W., Mariani, M. M., Karlo, J. C., Ghosal, K. and Landreth, G. E. (2015). Omega-3 fatty acids augment the actions of nuclear receptor agonists in a mouse model of Alzheimer's disease. J Neurosci 35(24): 9173-9181.
Download Citation in RIS Format
Category
Neuroscience > Nervous system disorders > Animal model
Biochemistry > Protein > Isolation and purification
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,788 | https://bio-protocol.org/exchange/protocoldetail?id=1788&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Primary Neuron-glia Culture from Rat Cortex as a Model to Study Neuroinflammation in CNS Injuries or Diseases
Ya-Ni Huang
Jia-Yi Wang
Published: Vol 6, Iss 8, Apr 20, 2016
DOI: 10.21769/BioProtoc.1788 Views: 10736
Edited by: Soyun Kim
Reviewed by: Pengpeng LiHong-guang Xia
Original Research Article:
The authors used this protocol in Aug 2015
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Aug 2015
Abstract
Primary neuron-glia cultures are commonly used in vitro model for neurobiological studies. Here, we provide a protocol for the isolation and culture of neuron-glial cells from cortical tissues of 1-day-old neonatal Sprague-Dawley pups. The procedure makes available an easier way to obtain the neuron and glia. In this culture system, neuron-glia cultures consisted of approximately 37% neurons, 51% astrocytes, 7% microglia, and a small percentage (<5%) of other cells after fourteen days in vitro. Primary neuron-glia cultures is a simplified in vitro model for studies focusing on interactions between neurons and glia cells. Activated glial cells, mainly astrocytes and microglia, are histopathological hallmarks of acute injury of the central nervous system (CNS) or chronic neurologic diseases (Hirsch and Hunot, 2009; Lee et al., 2009; Minghetti, 2005). Inflammatory mediators (e.g., nitric oxide, reactive oxygen species, proinflammatory cytokines, and chemokines) released by activated glia can directly or indirectly cause neuronal damage or neurodegeneration. Neuroinflammation is a common mechanism of various neurological diseases leading to neurodegeneration. The advantages of neuron-glia cultures are that: (1) Cultured cells can bypass complicated physiological interactions (such as leukocyte infiltration, blood-brain barrier, reflex or other systemic regulation) in vivo to allow direct observation of neuroinflammation caused by various CNS insults (hypoxia, ischemia, trauma. infection, neurotoxins, chronic stress or diseases); (2) Unlike cell lines that are mostly derived from tumor cells, primary cultured neuron-glia system is closer to the cell population ratio in vivo and can mimic the in situ microenvironment; and (3) Cultures can be prepared from various brain regions (e.g., cortex, hippocampus, mesencephalon…etc.) and allow an opportunity to examine the regional difference in the susceptibility to neurodegeneration following neuroinflammation caused by various CNS insults (Kim et al., 2000). The following protocol is an example for primary rat cortical neuron-glia culture preparation (Huang et al., 2015; Huang et al., 2014; Huang et al., 2012; Huang et al., 2009).
Keywords: Primary neuron-glia culture Neuroinflammation CNS injuries I
Materials and Reagents
Tissue culture dishes (60 x 15 mm) (Sigma-Aldrich, catalog number: P5237 )
Tissue culture dishes (100 x 20 mm) (Nunc, catalog number: 172958 )
Screw cap centrifuge tube (50 ml) (Sigma-Aldrich, catalog number: BR114821 )
24-well plates (Sigma-Aldrich, catalog number: CLS 3527 )
Pipette tips (10 μl, 200 μl and 1,000 μl) (Shineteh instruments co ltd., catalog number: PT4-W10 , PT1-Y200 and PT5-W10 )
Neonatal Sprague-Dawley pups (1-day-old)
Trypan blue (Thermo Fisher Scientific, GibcoTM, catalog number: 15250061 )
Hanks’ Balanced Salt solution (HBSS) (Sigma-Aldrich, catalog number: 55021C )
Sodium bicarbonate (Sigma-Aldrich, catalog number: S5761 )
Pyruvate (Sigma-Aldrich, catalog number: P2256 )
HEPES (Sigma-Aldrich, catalog number: H3375 )
Bovine Serum Albumins (BSA) (Sigma-Aldrich, catalog number: A9418 )
DMED powder (Thermo Fisher Scientific, GibcoTM, catalog number: 12100-046 )
DMED/F-12, HEPES, no phenol red (Thermo Fisher Scientific, GibcoTM, catalog number: 11039-021 )
Penicilline/Stretomycin (100x) (Thermo Fisher Scientific, GibcoTM, catalog number: 15140-122 )
100 mM Sodium pyruvate solution (100x) (Thermo Fisher Scientific, GibcoTM, catalog number: 11360-070 )
MEM non-essential amino acids solution (100x) (Thermo Fisher Scientific, GibcoTM, catalog number: 11140-050 )
Fetal bovine serum (FBS) (NQBB, catalog number: A6806-11 )
Hank’s solution (see Recipes)
Dulbecco's modified Eagle’s medium (DMEM) (see Recipes)
Serum-free medium (100 ml) (see Recipes)
Equipment
37 °C, 5% CO2 incubator (Water Jacketed Laboratory CO2 Incubator)
Stereo microscope (Shineteh instruments co., catalog number: IH1-ZM150A )
Biological Inverted microscope (OLYMPUS CORPORATION, model: IX71 )
Mini micro centrifuge (Shineteh instruments co., catalog number: IC-MINIMAX )
Centrifuge (Hermle, catalog number: Hermle Z232K )
Water bath (Bioman Scientific Co Ltd, catalog number: SWB-20-1 )
Counting chamber (Shineteh instruments co., catalog number: PT14-901001 )
Operating scissors STR (Shineteh instruments co., catalog number: ST-014 )
Iris scissors STR (Shineteh instruments co., catalog number: ST-S009 )
Dressing forceps (Shineteh instruments co., catalog number: ST-D114 )
Iris forceps (Shineteh instruments co., catalog number: ST-I510 )
Tweezers forceps (Shineteh instruments co ltd., catalog number: ST-NO5 )
Pipetman (Gilson, catalog number: P10 , P200 and P1000)
Pipet-aid (Thomas Scientific, FlaconTM, catalog number: 0410C04 )
Pipets (10 ml) (Tseng Hsiang Life Science ltd., catalog number: SP-1-C )
Ice bucket (Shineteh instruments co ltd., catalog number: PA8-4 )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Huang, Y. and Wang, J. (2016). Primary Neuron-glia Culture from Rat Cortex as a Model to Study Neuroinflammation in CNS Injuries or Diseases. Bio-protocol 6(8): e1788. DOI: 10.21769/BioProtoc.1788.
Download Citation in RIS Format
Category
Neuroscience > Cellular mechanisms > Cell isolation and culture
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,789 | https://bio-protocol.org/exchange/protocoldetail?id=1789&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Identification and Characterization of Bacterial Chemoreceptors Using Quantitative Capillary and Gradient Plate Chemotaxis Assays
Jose Antonio Reyes-Darias
Vanina García
Miriam Rico-Jiménez
Andrés Corral-Lugo
Tino Krell
Published: Vol 6, Iss 8, Apr 20, 2016
DOI: 10.21769/BioProtoc.1789 Views: 11436
Edited by: Valentine V Trotter
Reviewed by: Seda EkiciAmit Dey
Original Research Article:
The authors used this protocol in Aug 2015
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Aug 2015
Abstract
Bacterial chemotaxis is a motility-based response that biases cell movement toward beneficial molecules, called attractants, and away from harmful molecules, also known as repellents. Since the species of the genus Pseudomonas are characterized by a metabolic versatility, these bacteria have developed chemotactic behaviors towards a wide range of different compounds. The specificity of a chemotactic response is determined by the chemoreceptor, which is at the beginning of the signaling cascade and which receives the signal input. The basic elements of a typical chemoreceptor are the periplasmic ligand binding domain (LBD), responsible for sensing environmental stimuli, and the cytosolic methyl-accepting (MA) domain, that interacts with other components of the cellular signaling cascade. Escherichia coli (E. coli), the traditional model in chemotaxis research, has 5 well-characterized chemoreceptors. However, genome sequence analyses have revealed that many other bacteria possess many more chemoreceptors, some of which with partially overlapping signal profiles. This high number of chemoreceptors complicates their study by the analysis of single chemoreceptor mutants. We have pursued an alternative strategy for chemoreceptor characterization which corresponds to the generation of chimeric receptors composed of the LBD of the chemoreceptor under investigation and the MA domain of an E. coli receptor (Tar). The chimer is then introduced into a chemoreceptor free mutant of E. coli and the chemotaxis of the resulting strain is entirely due to the action of this chimeric receptor. In this publication we describe the use of quantitative capillary and gradient plate assays to study Pseudomonas chemotaxis as well as E. coli strains harboring chimeric receptors.
Keywords: Chemotaxis capillary assays Chemoreceptors Receptor chimeras Chemotaxis Gradient plate assays
Materials and Reagents
Materials
SterilinTM Standard 90 mm Petri Dishes (Thermo Fisher Scientific, catalog number: 101/IRR )
Microtest plate 96-well, F (SARSTEDT AG & Co, catalog number: 82.1581.501 )
1.5 ml Eppendorf tubes
Square petri dishes (120 mm x 120 mm) with grid (Greiner Bio-One GmbH, catalog number: 688102 )
Capillaries (Sigma-Aldrich, Drummond Microcaps®, catalog number: P1424 )
Bulb for Pasteur pipette
Erlenmeyer flasks 100 ml
Strains
P. aeruginosa PAO1 (Stover et al., 2000)
E. coli HD49 (Reyes-Darias et al., 2015a), chemoreceptor free strain E. coli UU1250 (Ames et al., 2002) harboring a plasmid encoding a chimeric receptor comprising the LBD of the PctC chemoreceptor of P. aeruginosa PAO1 (Taguchi et al., 1997; Rico-Jimenez et al., 2013) and the MA domain of the E. coli Tar receptor.
Reagents
HEPES sodium salt (Sigma-Aldrich, catalog number: H7006 )
Potassium phosphate dibasic (HK2PO4) (Sigma-Aldrich, catalog number: P3786 )
Sodium salicylate (Sigma-Aldrich, catalog number: S3007 )
Chloramphenicol (Sigma-Aldrich, catalog number: C-0378 )
Potassium phosphate monobasic (H2KPO4) (Sigma-Aldrich, catalog number: 60220 )
Ammonium sulfate [(NH4)2SO4] (Merck Millipore Corporation, catalog number: 1.01217 )
Sodium citrate tribasic dihydrate (Sigma-Aldrich, catalog number: C7254 )
Magnesium sulfate heptahydrate (MgSO4.7H2O) (Sigma-Aldrich, catalog number: 63140 )
Thiamine hydrochloride (Thiamine HCl) (Sigma-Aldrich, catalog number: 47858 )
Glycerol (Scharlab, S.L., catalog number: GL0027005P )
L-threonine (Sigma-Aldrich, Fluka, catalog number: 89179 )
L-methionine (Sigma-Aldrich, catalog number: M9625 )
L-leucine (Merck Millipore Corporation, catalog number: 5360 )
Note: Currently, it is “Merck Millipore Corporation, catalog number: 105360 ”.
L-histidine (Sigma-Aldrich, catalog number: 153688 )
γ-Aminobutyric acid (GABA) (Sigma-Aldrich, catalog number: A2129 )
Bacto-Agar (BD, DifcoTM, catalog number: 281230 )
Sodium chloride (NaCl) (Sigma-Aldrich, catalog number: S9888 )
Tryptone Broth (TB) medium (see Recipes)
0.9% NaCl solution (see Recipes)
LB medium (see Recipes)
5x minimal A salts (see Recipes)
5 mg/ml Aminoacid-mix (see Recipes)
Minimal A gradient plate medium (see Recipes)
Equipment
Spectrophotometer (Perkin Elmer, model: uv/vis lambda 20 )
Incubators (30 °C and 37 °C) (Thermo Fisher Scientific, Heraeus, model: B6060 incubator)
Orbital shaker incubator SH maxi (Controltécnica Instruments)
Centrifuge Allegra X-22R (Beckman Coulter)
pH meter GLP22 (HACH LANGE SPAIN, Crison)
Bunsen burner
Two pairs of tweezers
Bulb dispenser (Drummond Scientific Company, catalog number: 1-000-9000 )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Reyes-Darias, J. A., García, V., Rico-Jiménez, M., Corral-Lugo, A. and Krell, T. (2016). Identification and Characterization of Bacterial Chemoreceptors Using Quantitative Capillary and Gradient Plate Chemotaxis Assays. Bio-protocol 6(8): e1789. DOI: 10.21769/BioProtoc.1789.
Download Citation in RIS Format
Category
Microbiology > Microbial cell biology > Cell-based analysis
Microbiology > Microbial signaling > Sensory receptor
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
179 | https://bio-protocol.org/exchange/protocoldetail?id=179&type=1 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
In situ Hybridization in Zebrafish Embryos
LJ Lili Jing
Published: Feb 5, 2012
DOI: 10.21769/BioProtoc.179 Views: 15122
Download PDF
Ask a question
How to cite
Favorite
Cited by
Abstract
In situ hybridization is routinely used to examine the gene expression level and location of embryos. This protocol is modified from the Thisse protocol and is a detailed description of the in situ hybridization procedures in zebrafish embryos.
Materials and Reagents
Bovine serum albumin (BSA) (Sigma-Aldrich, catalog number: A9418 )
PFA (powder) (Thermo Fisher Scientific)
DEPC (Sigma-Aldrich, catalog number: D5758 )
Glutaradehyde (Sigma-Aldrich, catalog number: G5882 )
Roche anti-DIG AP (Roche Diagnostics, catalog number: 11093274910 )
Torula yeast RNA (Sigma-Aldrich, catalog number: R6225 )
Heparin (Sigma-Aldrich, catalog number: H0777 )
Lamb/Sheep Serum (Thermo Fisher Scientific, catalog number: 16070-096 )
Formamide (High purity grade)
Methanol
Sodium Citrate
EDTA
NaCl
KCl
MgCl2
Na2HPO4
KH2PO4
HCl
Tween 20
Citric acid
1x PBT(made from DEPC H2O) (see Recipes)
Pronase (Roche Diagnostics, catalog number: 10165921001 ) (see Recipes)
NBT/BCIP color substrate (Promega Corporation, catalog number: S3771 ) (see Recipes)
Hybe+ buffer (see Recipes)
Hybe- buffer (see Recipes)
20x SSC (see Recipes)
10x PBS (see Recipes)
4% paraformaldehyde/PBS (see Recipes)
Blocking solution (see Recipes)
Stop solution (see Recipes)
Heat inactivated lamb serum (see Recipes)
Pre-staining buffer (see Recipes)
Equipment
Hybridization Incubator
1.5 ml tube
24-well plate
Aluminum foil
Nalgene filter
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2012 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Jing, L. (2012). In situ Hybridization in Zebrafish Embryos. Bio-101: e179. DOI: 10.21769/BioProtoc.179.
Download Citation in RIS Format
Category
Cell Biology > Cell staining > Nucleic acid
Molecular Biology > DNA > Gene expression
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,790 | https://bio-protocol.org/exchange/protocoldetail?id=1790&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Measuring the Interactions between Peroxisomes and Chloroplasts by in situ Laser Analysis
Kazusato Oikawa
SM Shoji Mano
Kenji Yamada
YH Yoichiro Hosokawa
Mikio Nishimura
Published: Vol 6, Iss 8, Apr 20, 2016
DOI: 10.21769/BioProtoc.1790 Views: 7385
Edited by: Tie Liu
Reviewed by: Ru Zhang
Original Research Article:
The authors used this protocol in Mar 2015
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Mar 2015
Abstract
Quantitative analysis has been necessary for deeply understanding characteristic of organelles function. This is the detailed protocol for the quantification of the physical interaction between peroxisomes and chloroplasts taken by laser scanning microscopy described by Oikawa et al. (2015). To clarify the morphological interactions between both organelles, we measured the contact length between two organelles (interaction length) in the fluorescent microscope image by using image analysis software ImageJ. The result clearly revealed that the contact length in light condition is much longer than that in dark condition. In addition, the force of the morphological interaction was quantified utilizing intersection technology of femtosecond laser and atomic force microscope (AFM). When an intense femtosecond laser is focused near the interface of two organelles, the adhesion is broken by a force due to the laser. The adhesion strength in light and dark conditions was estimated from the force calibrated by AFM. The detailed procedure is described in Bio-protocol as another protocol entitled “Quantification of the adhesion strength between peroxisomes and chloroplasts by femtosecond laser technology” (Hosokawa et al., 2016). These methods can be applied to other physical interaction between different types of organelles such as nuclei, mitochondria, Golgi, and chloroplasts.
Keywords: Peroxisome Chloroplast Organelle interaction Measurement of interaction
Materials and Reagents
Glass slide (super frost) (Matsunami Glass)
Note: Any types of glass slide suitable for fluorescence observation can be used. We attached black tape on the glass slide to envelop the sample with cover slip (see Figure 1D).
Cover slip (24 x 60 No.1, Thickness 0.12-0.17 mm) (Matsunami Glass)
10 ml disposable syringe (Terumo Medical Corporation)
Arabidopsis thaliana (ecotype Columbia) expressing peroxisome-targeted GFP (GFP-PTS1) (Mano et al., 2002)
Note: 1-4 is shown in Figure 1A.
1/3 x Murashige and Skoog salts (MS) medium (Wako Pure Chemical Industries, catalog number: 392-00591 ) containing vitamins, 1% sucrose, and MES buffer (pH 5.7) (Wako Pure Chemical Industries, catalog number: 341-01622 )
Agar powder for plant growth (Funakoshi, catalog number: BA-10 )
Distilled water
KOH
Plant culture medium (see Recipes)
Equipment
Scissors and tweezers (shown in Figure 1A)
40x dry system objective lens (ZEISS, EC Plan-Neofluar®)
Growth chamber for growing plants (100 µmol m-2 sec-1 white Light for 16 h and dark for 8 h, 22 °C)
Black box for dark condition
Confocal laser scanning microscope (ZEISS, model: LSM510 META )
Software
NIH ImageJ software 1.46 (http://imagej.nih.gov/ij)
Note: ImageJ is also available on Mac OS X, Windows and Linux.
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Oikawa, K., Mano, S., Yamada, K., Hosokawa, Y. and Nishimura, M. (2016). Measuring the Interactions between Peroxisomes and Chloroplasts by in situ Laser Analysis. Bio-protocol 6(8): e1790. DOI: 10.21769/BioProtoc.1790.
Download Citation in RIS Format
Category
Plant Science > Plant cell biology > Organelle isolation
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,791 | https://bio-protocol.org/exchange/protocoldetail?id=1791&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
ACE-score-based Analysis of Temporal miRNA Targetomes During Human Cytomegalovirus Infection Using AGO-CLIP-seq
SK Sungchul Kim
Kwangseog Ahn
Published: Vol 6, Iss 8, Apr 20, 2016
DOI: 10.21769/BioProtoc.1791 Views: 11038
Edited by: Yannick Debing
Reviewed by: Feng LiVaibhav B Shah
Original Research Article:
The authors used this protocol in Jun 2015
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jun 2015
Abstract
Although temporal regulation of gene expression during the course of infection is known to be critical for determining the outcome of host-virus interactions, systematic temporal analysis of the miRNA targetomes during productive viral infection has been technically challenging due to the large range of miRNA-mRNA cross-talks at the host-virus interface. High-confidence quantifying models of the suppression efficacy in targeting sites by integrating bioinformatics with Argonaute-crosslinking and immunoprecipitation followed by high-throughput sequencing (AGO-CLIP-seq) (Chi et al., 2009) data have been poorly developed. To accurately identify miRNA target sites and calculate the targeting efficacy of miRNA-target interactions, we developed a new bioinformatic quantitation method, AGO-CLIP-seq enrichment (ACE)-scoring algorithm (Kim et al., 2015). Inclusion of the uninfected control in our AGO-CLIP-seq analysis can significantly improve the accuracy of authentic target site identification for viral or human miRNAs and extract physiologically significant changes during productive human cytomegalovirus (HCMV) infection using our ACE-scoring method. Thus, we suggest that our new ACE-scoring-based methodology can be applied to various miRNA targetome studies, which will be performed in other kinds of temporal contexts, such as developmental stages, immune stimulation by cytokines or pathogens, and lytic infection by other viruses.
Keywords: CLIPseq ACE score MicroRNA Human cytomegalovirus Argonaute
Materials and Reagents
100 mm cell culture dish (Sarstedt AG & Co, catalog number: 83.3902 )
Disposable serological pipettes (Orange)
Filter micropipette tips (Biotix, NEPTUNE)
1.6 ml microcentrifuge tube (Biotix, NEPTUNE, catalog number: 3745X )
Cell scraper (25 cm) (Sarstedt AG & Co, catalog number: 83.1830 )
Plastic wrap (CLEANWRAP)
BAS film (Fujifilm Corporation)
Razor (Dorco, model: Pace Single Edge Blades DN52 )
Costar Spin-X centrifugation column (Sigma-Aldrich, catalog number: CLS8162-96EA )
Human foreskin fibroblast (HFF) cells (ATCC, catalog number: SCRC-104 )
Dulbecco’s modified Eagle’s medium (DMEM) (with High Glucose, with 4 mM L-Glutamine, without Sodium Pyruvate) (GE Healthcare, HyCloneTM, catalog number: SH30022.FS )
Fetal bovine serum (FBS) (Enhance growth of cells with U.S. sourced GE Healthcare HyClone characterized) (GE Healthcare, HyCloneTM, catalog number: SH30071.03HI )
GlutaMAX-I (100x) (100 ml) (Thermo Fisher Scientific, GibcoTM, catalog number: 35050-061 )
Penicillin/Streptomycin solution (P/S) (100x, 10,000 U/ml) (Thermo Fisher Scientific, GibcoTM, catalog number: 15-140-122 )
Ice
Towne strain of human cytomegalovirus (HCMV) (ATCC, model: VR-977 ; NCBI accession number: FJ616285.1)
Dynabeads® Sheep-Anti Mouse IgG (Thermo Fisher Scientific, InvitrogenTM, catalog number: 11031 )
Dynabeads® Pan Mouse IgG (Thermo Fisher Scientific, InvitrogenTM, catalog number: 11041 )
Pan anti-AGO mAb 2A8 (Diagenode, catalog number: C15200167-100 )
Protease inhibitor cocktail (Cell Signaling Technology, catalog number: 5871 )
Recombinant DNase I (Takara Bio Company, catalog number: 2270B )
RNase A (1 MG, 20 units/μl; 5 mg/ml) (Thermo Fisher Scientific, Affymetrics, catalog number: 70194Y )
Alkaline Phosphatase, Calf Intestinal (CIP) (New England Biolabs, catalog number: M0290S )
3’-Adaptor (RA3) (5’-rApp-TGGAATTCTCGGGTGCCAAGG-3’-ddC, 5’-Adenylation, 3’-Dideoxy-C) (Integrated DNA Technologies, RNase Free HPLC Purification)
T4 RNA Ligase 2, truncated K227Q (New England Biolabs, catalog number: M0351L )
SUPERase.In RNase Inhibitor (Thermo Fisher Scientific, AmbionTM, catalog number: AM2696 )
ATP, [γ-32P], 6,000 Ci/mmol (222 TBq/mmol) (PerkinElmer, catalog number: NEG502Z500UC )
T4 Polynucleotide Kinase (PNK) (Takara Bio Company, catalog number: 2021A )
10 mM Adenosine 5’-Triphosphate (ATP) (New England Biolabs, catalog number: P0756S )
NuPAGE® LDS Sample Buffer (4x) (Thermo Fisher Scientific, NovexTM, catalog number: NP0007 )
NuPAGE® Sample Reducing Agent (10x) (Thermo Fisher Scientific, NovexTM, catalog number: NP0004 )
NuPAGE® Antioxidant (Thermo Fisher Scientific, NovexTM, catalog number: NP0005 )
NuPAGETM NovexTM 4-12% Bis-Tris Protein Gels, 1.0 mm, 10-well (Thermo Fisher Scientific, InvitrogenTM, catalog number: NP0321BOX )
NuPAGE® MOPS SDS Running Buffer (20x) (Thermo Fisher Scientific, NovexTM, catalog number: NP0001 )
NuPAGE® Transfer Buffer (20x) (Thermo Fisher Scientific, NovexTM, catalog number: NP0006 )
Amersham Protran Supported 0.45 NC (GE Healthcare Life Sciences, catalog number: 10600016 )
Bovine serum albumin (BSA) (life science grade powder) (Merck Millipore Corporation, Probumin®, catalog number: 821006 )
Anti-AGO mAb 21D2 (Made in laboratory of Narry V. Kim, School of Biological Sciences, Seoul National University, Seoul, Republic of Korea)
Peroxidase AffiniPure Goat Anti-Mouse IgG (H+L) (Jackson ImmunoResearch Inc., catalog number: 115-035-003 )
EMD Millipore ImmobilonTM Western Chemiluminescent HRP Substrate (ECL) (Thermo Fisher Scientific, catalog number: WBKLS0050 )
Acid-Phenol:Chloroform, pH 4.5 (with IAA, 125:24:1) (RNA phenol/chloroform) (Thermo Fisher Scientific, AmbionTM, catalog number: AM9720 )
Linear acrylamide (Thermo Fisher Scientific, InvitrogenTM, catalog number: AM9520 )
3 M Sodium acetate (pH 5.5) (Thermo Fisher Scientific, AmbionTM, catalog number: AM9740 )
Ethanol (Merck Millipore Corporation, catalog number: 100983 )
Isopropanol (2-propanol) (Merck Millipore Corporation, catalog number: 109634 )
UltraPureTM DNase/RNase-Free Distilled Water (D.W.) (Thermo Fisher Scientific, InvitrogenTM, catalog number: 10977-015 )
2x RNA loading buffer (Thermo Fisher Scientific, AmbionTM, catalog number: AM8546G )
mirVanaTM Probe & Marker Kit (Thermo Fisher Scientific, AmbionTM, catalog number: AM1554 )
10% Novex® TBE-Urea Gels, 10 well (Thermo Fisher Scientific, InvitrogenTM, catalog number: EC6875BOX )
T4 RNA ligase (Takara Bio Company, catalog number: 2050B )
Proteinase K (PK) (Thermo Fisher Scientific, Macherey-Nagel, catalog number: 740506 )
5’-adaptor oligonucleotide (5’-Solexa adaptor)
5’-rGrUrUrCrArGrArGrUrUrCrUrArCrArGrUrCrCrGrArCrGrArUrC-3’ (Integrated DNA Technologies, RNase Free HPLC Purification)
RNA RT primer (RTP)
5’-GCCTTGGCACCCGAGAATTCCA-3’ (Integrated DNA Technologies, RNase Free HPLC Purification)
5’-Primer (Integrated DNA Technologies, RNase Free HPLC Purification)
RNA PCR Primer (RP1)
5’-AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGA-3’
3’-Primers (Integrated DNA Technologies, RNase Free HPLC Purification)
RNA PCR Primer, Index 1 (RPI1)
5’-CAAGCAGAAGACGGCATACGAGATCGTGATGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA-3’
RNA PCR Primer, Index 2 (RPI2)
5’-CAAGCAGAAGACGGCATACGAGATACATCGGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA-3’
RNA PCR Primer, Index 3 (RPI3)
5’-CAAGCAGAAGACGGCATACGAGATGCCTAAGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA-3’
RNA PCR Primer, Index 4 (RPI4)
5’-CAAGCAGAAGACGGCATACGAGATTGGTCAGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA-3’
Phusion® High-Fidelity DNA Polymerase (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: F-530L )
dNTP mixture (Enzynomics, catalog number: N001L )
SuperScriptTM III reverse transcriptase (RT) (Thermo Fisher Scientific, InvitrogenTM, catalog number: 18080-044 )
Novex® TBE Gels, 6%, 10 Well (Thermo Fisher Scientific, InvitrogenTM, catalog number: EC6265BOX )
Low Molecular Weight DNA Ladder (New England Biolabs, catalog number: N3233L )
Ethidium bromide (EtBr) (Sigma-Aldrich, catalog number: E7637 )
Dynabeads® mRNA DIRECTTM Kit (Thermo Fisher Scientific, AmbionTM, catalog number: 61011 )
NEBNext® Magnesium RNA Fragmentation Module (New England Biolabs, catalog number: E6150S )
Sodium chloride (NaCl) (BioXtra, ≥99.5%) (Sigma-Aldrich, catalog number: S7653 )
Potassium chloride (KCl) (BioXtra, ≥99.0%) (Sigma-Aldrich, catalog number: P9333 )
Sodium phosphate dibasic (Na2HPO4) (BioXtra, ≥99%) (Sigma-Aldrich, catalog number: S7907 )
Potassium phosphate monobasic (KH2PO4) (≥99.0%) (Sigma-Aldrich, catalog number: P5655 )
Trizma® base (An high-quality Tris base) (BioXtra, ≥99.9%) (Sigma-Aldrich, catalog number: T6791 )
NP-40 Alternative (Merck Millipore Corporation, catalog number: 492018 )
Sodium dodecyl sulfate (SDS) [BioXtra, ≥99.0% (GC)] (Sigma-Aldrich, catalog number: L6026 )
Sodium deoxycholate (BioXtra, anhydrous, ≥98%) (Sigma-Aldrich, catalog number: 30970 )
Ethylenediaminetetraacetic acid (EDTA) (BioUltra, anhydrous, ≥98%) (Sigma-Aldrich, catalog number: EDS )
Magnesium chloride (MgCl2) (anhydrous, ≥98%) (Sigma-Aldrich, catalog number: M8266 )
Tween-20 (Sigma-Aldrich, catalog number: P7949 )
NEBuffer3 (New England Biolabs, catalog number: B7003S )
10x T4 RNA ligase buffer (New England Biolabs, catalog number: B0216L )
50% PEG8000 (supplied with 10x T4 RNA ligase buffer)
10 mM Adenosine 5’-Triphosphate (ATP) (supplied with 10x T4 RNA ligase buffer)
Bromophenol blue (ACS reagent) (Sigma-Aldrich, catalog number: 114391 )
Xylene cyanol FF (BioReagent) (Sigma-Aldrich, catalog number: X4126 )
Glycerol (BioXtra, anhydrous, ≥99%) (Sigma-Aldrich, catalog number: G6279 )
Boric acid (BioReagen, ≥99.5%) (Sigma-Aldrich, catalog number: B6768 )
Trizol® reagent (Thermo Fisher Scientific, AmbionTM, catalog number: 15596018 )
Dynabeads® mRNA DIRECTTM Purification Kit (Thermo Fisher Scientific, AmbionTM, catalog number: 61011)
NEBNext® Magnesium RNA Fragmentation Module (New England Biolabs, catalog number: E6150S)
Antarctic phosphatase (New England Biolabs, catalog number: M0289S )
Phosphate-buffered saline (PBS) (see Recipes)
Lysis buffer (see Recipes)
High-salt buffer (see Recipes)
Wash buffer (see Recipes)
CIP mix (see Recipes)
3’-ligation mix (see Recipes)
Hot PNK mix (see Recipes)
0.1% PBS-T (see Recipes)
PK buffer (see Recipes)
PK mix (see Recipes)
PK/Urea buffer (see Recipes)
5’-ligation mix (see Recipes)
PCR mix (see Recipes) (see Recipes)
6x DNA Loading buffer (see Recipes)
TBE (Tris-borate-EDTA) (see Recipes)
Equipment
CO2 incubator (LabX, Sanyo, model: CO2 Incubator MCO-18AIC )
Micropipettes (Gilson, PIPETMAN ClassicTM P10, P20, P200 and P1000, catalog number: F144802 , F123600 , F123601 and F123602 )
Rocker (FINEPCR, model: CR300 )
UV crosslinker (Spectronics Corporation, model: XL1500 )
Vortexer (Scientific Industries, model: Vortex-Genie® 2 and catalog number: SI-0256 )
DynaMagTM-2 Magnet (Thermo Fisher Scientific, catalog number: 12321D )
Rotator (FINEPCR, model: AG) with an accessary Roller Drum (FINEPCR, model: RD25-42 )
Eppendorf® Thermomixer® R, dry block heating and cooling shaker (Sigma-Aldrich, catalog number: T3317 )
Refrigerated tabletop microcentrifuge (Hanil BioMed Inc., model: Centrifuge Micro 17TR )
XCell SureLock® Mini-Cell (Thermo Fisher Scientific, NovexTM, catalog number: EI0001 )
Chemidoc (Vilber Lourmat, model: Fusion Spectra )
BAS 2500 (Fujifilm Corporation)
Deep freezer (-80 °C freezer)
PCR cycler (MyCyclerTM Thermal Cycler System) (Bio-Rad Laboratories, catalog number: 1709703 )
Illumina HiSeq2000
Software
CutAdap software
Human genome (hg19) BLAST+ (v. 2.2.27) software (Camacho et al., 2009)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Kim, S. and Ahn, K. (2016). ACE-score-based Analysis of Temporal miRNA Targetomes During Human Cytomegalovirus Infection Using AGO-CLIP-seq . Bio-protocol 6(8): e1791. DOI: 10.21769/BioProtoc.1791.
Download Citation in RIS Format
Category
Microbiology > Microbial biochemistry > RNA
Biochemistry > RNA > miRNA targeting
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,792 | https://bio-protocol.org/exchange/protocoldetail?id=1792&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Measurement of Intracellular cAMP Levels Using the Cyclic Nucleotide XP Enzymatic Immunoassay Kit in Bacteria
Sarah K Giles
Uwe H Stroeher
Melissa H Brown
Published: Vol 6, Iss 8, Apr 20, 2016
DOI: 10.21769/BioProtoc.1792 Views: 11869
Edited by: Valentine V Trotter
Reviewed by: Daan C. SwartsAksiniya Asenova
Original Research Article:
The authors used this protocol in Jun 2015
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jun 2015
Abstract
Cyclic AMP (cAMP) is a ubiquitous secondary signaling molecule, commonly associated with many bacterial processes, including the regulation of virulence factors, such as biofilms, pellicles and motility (Wolfgang, 2003). The quantity of available cAMP is controlled by the interplay between the synthesis of adenosine triphosphate (ATP) to cAMP by adenylyl cyclases, and the degradation of cAMP by phosphodiesterase (McDonough et al., 2012). Adequate quantification of cAMP levels within a bacterial cell is an important step in identifying the impact that secondary signaling molecules play on the regulatory pathway within the cell. The principle of this method is to measure total cAMP levels within a bacterial cell, using crude bacterial whole cell lysate. The Cyclic AMP XPTM Assay kit used in this protocol was originally designed to be used for determining the level of cAMP in eukaryotic cells, however, the antibodies used in coating the wells will react with cAMP from any species and thus can be used for determining levels in bacterial cells. The measurement of cAMP in prokaryotic cells described here is a simple and cost effective method of producing quantifiable results.
Materials and Reagents
1 ml cuvettes (SARSTEDT AG & Co., catalog number: 67.742 )
15 ml tubes (Falcon Tube) (DKSH, catalog number: LP021015 )
50 ml tubes (Falcon Tubes) (DKSH, catalog number: LP21050 )
96-well microtitre tray (tissue culture plate) (DKSH, catalog number: LP031096 )
Aluminum foil
Bacterial cell culture
Mueller Hinton (MH) broth (prepared as per manufacturer’s instructions) (Oxoid Australia, catalog number: CM0405 )
MH agar media (25 ml/Petri dish) (prepared as per manufacturer’s instructions) (Oxoid Australia, catalog number: CM0337 )
Cyclic AMP XPTM Assay kit (Cell Signaling Technology, catalog number: 4339 )
Protein assay DCTM reagents A & B (Bio-Rad Laboratories, catalog number: 500-121 )
Protein assay bovine serum albumin (BSA) standards (0, 0.125, 0.25, 0.5, 1, 2.5, 5 mg/ml of protein)
Milli Q water
Sodium Chloride (NaCl) (Chem Supply, catalog number: SA046-5 kg )
Potassium Chloride (KCl) (Thermo Fisher Scientific, Ajax Finechem, catalog number: A383-500 g )
Sodium Phosphate (Na2HPO4) (Merck Millipore Corporation, catalog numer: 7558-79-4 )
Potassium Phosphate (KH2PO4) (Merck Millipore Corporation, catalog number: 7778-77-0 )
Phosphate buffered saline (PBS) (see Recipes)
Equipment
VIS spectrophotometer able to read OD600 nm [e.g., DU®640 (Beckman Coulter)]
ELISA plate reader able to read absorption at 450 nm [e.g., Multiskan EX original (Adelab Scientific)]
French pressure cell able to operate at 30,000 psi or cell disruptor [e.g., One Shot Head from the TS series bench top disruptor (Constant Systems)]
Ice bucket
Sterile inoculating loop
Shaking incubator (37 °C, at 200 rpm)
Centrifuge (able to hold 50 ml tubes, spin at 8,000 x g and hold a pre-cooled temperature of 4 °C) [e.g. Benchtop Centrifuge Hermle Z383K (DKSH)]
Horizontal orbital shaker (at ~30 rpm) [e.g., OM5 (Ratek, Adelab Scientific)]
Software
Software for use with the ELISA plate reader that can export raw OD600 nm values (e.g. Microsoft Excel)
GraphPad prism (GraphPad Software Inc)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Giles, S. K., Stroeher, U. H. and Brown, M. H. (2016). Measurement of Intracellular cAMP Levels Using the Cyclic Nucleotide XP Enzymatic Immunoassay Kit in Bacteria. Bio-protocol 6(8): e1792. DOI: 10.21769/BioProtoc.1792.
Download Citation in RIS Format
Category
Microbiology > Microbial signaling > Secondary messenger
Microbiology > Microbial biochemistry > Other compound
Biochemistry > Other compound > cAMP
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,793 | https://bio-protocol.org/exchange/protocoldetail?id=1793&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Mating and Progeny Isolation in the Corn Smut Fungus Ustilago maydis
MN Marina Nadal
JT Johanna E. Takach
DA David L. Andrews
SG Scott E. Gold
Published: Vol 6, Iss 8, Apr 20, 2016
DOI: 10.21769/BioProtoc.1793 Views: 10459
Edited by: Zhaohui Liu
Reviewed by: Chijioke Joshua
Original Research Article:
The authors used this protocol in Jan 2015
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jan 2015
Abstract
The corn smut pathogen, Ustilago maydis (U. maydis) (DC.) Corda, is a semi-obligate plant pathogenic fungus in the phylum Basidiomycota (Alexopoulos et al., 1996). The fungus can be easily cultured in its haploid yeast phase on common laboratory media. However, to complete its sexual cycle U. maydis strictly requires its specific plant host, maize (Zea mays). The fungus is an interesting and important model organism for the study of the interactions of fungal biotrophic pathogens with plants. In this protocol, we describe the process of plant inoculation, teliospore recovery, germination, progeny isolation and initial mating type analysis. The primary purpose of this protocol is to identify individual progeny strains of U. maydis that can be used for downstream genetic analyses. Generation of targeted mutants to study various processes is a common approach with this and many plant pathogenic fungi. The ability to generate combinations of mutations is facilitated by sexual crossing without the need for additional selectable markers.
Materials and Reagents
Plastic sterile syringes: 3 ml (BD, catalog number: 309657 ) and 10 ml (BD, catalog number: 309604 )
Needles: 22 gauge (BD, EclipseTM, catalog number: 305768 ) and 27 gauge (BD, EclipseTM, catalog number: 305758 )
Conical tubes: Falcon® 50 ml (Corning, catalog number: 352070 )
Test tubes
1.5 ml Microfuge tubes (Thermo Fisher Scientific, catalog number: 05-408-130 )
Haploid Ustilago maydis tester strains of known mating type
Seeds for maize seedling assay: Variety Golden Bantam (Rich Farm Garden Supply)
Seeds for maize ear inoculation: Variety Tom Thumb (Seed Savers Exchange)
Sterile distilled water (sdH2O)
CuSO4 solution (1%) (Sigma-Aldrich, catalog number: 451657 )
Casamino acids (Becton, Dickinson and Company, catalog number: 223050 )
Ammonium nitrate (Sigma-Aldrich, catalog number: A9642 )
Yeast extract (Sigma-Aldrich, catalog number: Y1625 )
Activated charcoal (Sigma-Aldrich, catalog number: C9157 )
Potassium phosphate monobasic (KH2PO4) (Sigma-Aldrich, catalog number: P5655 )
Sodium sulfate (Na2SO4) (Sigma-Aldrich, catalog number: 239313 )
Calcium chloride dihydrate (CaCl2·2H2O) (Sigma-Aldrich, catalog number: 223506 )
Boric acid (H3BO3 ) (Sigma-Aldrich, catalog number: B6768 )
Manganese(II) chloride (MnCl2) (Sigma-Aldrich, catalog number: 244589 )
Zinc chloride (ZnCl2 ) (Sigma-Aldrich, catalog number: 746355 )
Sodium molybdate dehydrate (Na2MoO4·2H2O) (Sigma-Aldrich, catalog number: 331058 )
Iron(III) chloride (FeCl3) (Sigma-Aldrich, catalog number: 157740 )
Potato dextrose agar (PDA) 2% agar (Sigma-Aldrich) (see Recipes)
Potato dextrose broth (PDB) (Sigma-Aldrich) (see Recipes)
Charcoal mating plate medium (see Recipes)
U. maydis salt solution (Sigma-Aldrich) (see Recipes)
Trace element solution (Sigma-Aldrich) (see Recipes)
Equipment
Glass stirring rods
Pipettes
Ceramic mortars and pestles
Sterile cheesecloth
Hemocytometer or automated cell counter
Light microscope
Centrifuge holding 50 ml conical tubes (Beckman Coulter, model: J25I ) with a JS7.5 rotor (Beckman Coulter)
Growth chamber (Conviron, model: E15 )
Laminar flow hood
Rotational Incubator (VWR International, New Brunswick model: 12500KC )
Stationary incubator (PrecisionTM, model: 815 )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Nadal, M., Takach, J. E., Andrews, D. L. and Gold, S. E. (2016). Mating and Progeny Isolation in the Corn Smut Fungus Ustilago maydis. Bio-protocol 6(8): e1793. DOI: 10.21769/BioProtoc.1793.
Download Citation in RIS Format
Category
Plant Science > Plant immunity > Host-microbe interactions
Microbiology > Microbial genetics > Gene mapping and cloning
Molecular Biology > DNA > DNA cloning
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,794 | https://bio-protocol.org/exchange/protocoldetail?id=1794&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Visualization of Intracellular Tyrosinase Activity in vitro
Riddhi Atul Jani*
Sudeshna Nag*
Subba Rao Gangi Setty
*Contributed equally to this work
Published: Vol 6, Iss 8, Apr 20, 2016
DOI: 10.21769/BioProtoc.1794 Views: 8950
Edited by: Ralph Bottcher
Reviewed by: Hsin-Yi Chang
Original Research Article:
The authors used this protocol in Sep 2015
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Sep 2015
Abstract
Melanocytes produce the melanin pigments in melanosomes and these organelles protect the skin against harmful ultraviolet rays. Tyrosinase is the key cuproenzyme which initiates the pigment synthesis using its substrate amino acid tyrosine or L-DOPA (L-3, 4-dihydroxyphenylalanine). Moreover, the activity of tyrosinase directly correlates to the cellular pigmentation. Defects in tyrosinase transport to melanosomes or mutations in the enzyme or reduced intracellular copper levels result in loss of tyrosinase activity in melanosomes, commonly observed in albinism. Here, we describe a method to detect the intracellular activity of tyrosinase in mouse melanocytes. This protocol will visualize the active tyrosinase present in the intracellular vesicles or organelles including melanosomes.
Keywords: Tyrosinase Melanosome Oculocutaneous albinism Copper L-DOPA
Materials and Reagents
Glass coverslips (diameter-12 mm, No.1) (Polar Industrial Corporation, Blue Star, catalog number: 12mm Circular )
Note: See Recipes for acid wash and sterilization.
Micro slides (L-75 mm x W-25 mm x h-1.35 mm) (Polar Industrial Corporation, Blue Star, catalog number: PIC-1 )
Plastic tissue culture (6 well) plate (Corning, catalog number: 3506 ) and bottle-top vacuum filter (pore size 0.22 μm) (Corning, catalog number: 430015 )
Melanocytes (Immortal wild type mouse melanocytes, melan-Ink4a-Arf-1 from C57BL/6J mice, referred to here as melan-Ink4a) [Resource: The Wellcome Trust Functional Genomics Cell Bank (Sviderskaya et al., 2010)]
Copper(II) sulphate pentahydrate (CuSO4·5H2O) (Sigma-Aldrich, catalog number: C7631 )
3, 4-Dihydroxy-D-phenylalanine (D-DOPA) (Sigma-Aldrich, catalog number: D9378 )
3, 4-Dihydroxy-L-phenylalanine (L-DOPA) (Sigma-Aldrich, catalog number: D9628 )
HCl (Sigma-Aldrich, catalog number: H1758 )
HNO3 (Merck Millipore, catalog number: 101799 )
KCl (Sigma-Aldrich, catalog number: P9541 )
KH2PO4 (Merck Millipore, catalog number: 104873 )
NaCl (Fisher Scientific, catalog number: BP358-1 )
Na2HPO4·2H2O (Fisher Scientific, catalog number: S472-500 )
Ethanol (70%) (Merck Millipore, catalog number: 818760 )
Fetal bovine serum (Biowest, catalog number: S1810-500 )
Formaldehyde (36.5-38% in H2O) solution (HCHO solution) (Sigma-Aldrich, catalog number: F8775 )
Fluromount-G or mounting medium (SouthernBiotech, catalog number: 0100-01 )
Matrigel Matrix (Corning Matrigel Growth Factor Reduced Basement Membrane Matrix, Phenol Red-Free) (Corning, catalog number: 356231 )
Penicillin-Streptomycin (antibiotic) (Thermo Fisher Scientific, GibcoTM, catalog number: 15140-122 )
RPMI-1640 media (Thermo Fisher Scientific, GibcoTM, catalog number: 31800-022 )
L-Glutamine (Thermo Fisher Scientific, GibcoTM, catalog number: 25030-081 )
0.1% DOPA solution (see Recipes)
4% Formaldehyde solution (see Recipes)
Growth media (see Recipes)
0.1% Matrigel matrix solution (see Recipes)
1x PBS (see Recipes)
Equipment
CO2 incubator (maintained at 37 °C, 10% CO2) (Thermo Fisher Scientific, model: Forma Water Jacketed CO2 incubator )
Forceps (sterilized by autoclave)
Bright field microscope (Olympus Corporation, model: IX81 motorized inverted fluorescence microscope )
Hot-air-oven (Eyela, catalog number: NDO-420W )
Glass beaker (250 ml) (Borosil, catalog number: 1000D21 )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Jani, R. A., Nag, S. and Setty, S. R. G. (2016). Visualization of Intracellular Tyrosinase Activity in vitro. Bio-protocol 6(8): e1794. DOI: 10.21769/BioProtoc.1794.
Download Citation in RIS Format
Category
Biochemistry > Protein > Activity
Cell Biology > Cell staining > Protein
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,795 | https://bio-protocol.org/exchange/protocoldetail?id=1795&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Phagocytosis Assay of Microglia for Dead Neurons in Primary Rat Brain Cell Cultures
Xiurong Zhao
LZ Liyan Zhang
ST Shun-Ming Ting
JA Jaroslaw Aronowski
Published: Vol 6, Iss 8, Apr 20, 2016
DOI: 10.21769/BioProtoc.1795 Views: 10620
Edited by: Oneil G. Bhalala
Reviewed by: Alka MehraVivien Jane Coulson-Thomas
Original Research Article:
The authors used this protocol in Aug 2015
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Aug 2015
Abstract
Clearance of dead brain tissue including the dead neurons through phagocytosis is an endogenous function of microglia in the brain, which is critical for inflammation resolution after ischemic stroke or head trauma. By regulating the function or polarization status of microglia, we may control their phagocytosis efficacy and therefore the cleanup process for the dead brain tissue. We cultured rat cortical neurons and microglia from the same litter of embryos. The cultured neurons are subjected to irradiation for inducing neuronal apoptosis. After labeling with propidium iodide (PI), the dead neurons (DNs) are exposed to the cultured microglia for phagocytosis assay. By counting the number of DNs in each microglia, we calculate the phagocytosis index to quantify the phagocytosis efficacy of microglia toward DNs. The protocol is divided into 4 sections: A) culturing rat cortical neurons from pre-natal rat embryos, B) preparing dead neurons as phagocytosis target, C) culturing rat brain microglia, D) quantifying phagocytosis index of microglia toward the dead neurons.
Keywords: Microglia Phagocytosis assay Apoptotic neurons
Materials and Reagents
Cell Strainer (100 μm and 40 μm) (BD, Falcon, catalog number: 431752 and 431750)
Note: Currently, it is “Corning, Falcon, catalog number: 431752 and 431750 ”.
Cell Lifter (VWR International, catalog number: 89030-910 )
100 mm Petri dish (Thermo Fisher Scientific, catalog number: 263991 )
60 mm TC dish (Corning, catalog number: CLS430166 )
75 cm2 TC flask (Corning, catalog number: 430825 )
24-well TC plate (BD, Falcon, catalog number: 353047)
Note: Currently, it is “Corning, Falcon, catalog number: 353047 ”.
1 ml Syringe (BD, Falcon, catalog number: 305217 )
Glass Pasteur pipet (VWR International, catalog number: 14673-043 )
E-18 Pregnant Sprague Dawley (SD) rat (Charles River Laboratories International)
Pentobarbital (Sigma-Aldrich, catalog number: P-3761 )
Neurobasal medium (Thermo Fisher Scientific, GibcoTM, catalog number: 21103 )
B27 Supplement (Thermo Fisher Scientific, GibcoTM, catalog number: 17504 )
Glutamine (Sigma-Aldrich, catalog number: G7513 )
Penicillin/Streptomycin (100x) (GE Healthcare, HycloneTM, catalog number: SV30079 )
DMEM (Corning, catalog number: 10-013-CM )
Propidium Iodide (PI) (Sigma-Aldrich, catalog number: P-4170 )
DAPI (4’, 6-Diamidino-2-Phenylindole, Dilactate) (Invitrogen, catalog number: D3571 )
Note: Currently, it is “Thermo Fisher Scientific, Molecular ProbesTM, catalog number: D3571”.
16% Paraformaldehyde (PFA) (Electron Microscopy Sciences, catalog number: 15170 )
Fetal Bovine Serum (FBS) (GE Healthcare, HycloneTM, catalog number: SH30071 )
Sodium pyruvate (Sigma-Aldrich, catalog number: P5280 )
HEPES Buffer solution (Sigma-Aldrich, catalog number: 83264 )
Sodium bicarbonate (Sigma-Aldrich, catalog number: S5761 )
Poly-D-Lysine (Sigma-Aldrich, catalog number: P0889 )
HBSS (Lonza, catalog number: 10-543F )
PBS (Corning, catalog number: 21-040-CV )
0.4% Trypan blue (Sigma-Aldrich, catalog number: T8154 )
Alexa Fluor 488-Phalloidin (Invitrogen, catalog number: A12379 )
Note: Currently, it is “Thermo Fisher Scientific, Molecular ProbesTM, catalog number: A12379”.
Mouse anti-MAP2 antibody (Sigma-Aldrich, catalog number: M4403 )
Rabbit anti-mouse IgG-Alexa Fluor 488 (Thermo Fisher Scientific, InvitrogenTM, catalog number: A11029 )
Dissection buffer (see Recipes)
DMEM/FBS (see Recipes)
Neurobasal/B27 (see Recipes)
Notes:
All reagents and chemicals for cell cultures must be sterile. Without special indication, all culture medium or buffer is used at room temperature (RT). And all operational procedures for neuronal culture and microglia (MΦ) culture, including animal dissecting, tissue triturating, cell plating or harvesting, and medium changing, have to be performed in a dissecting hood or cell culture hood using sterile tools.
Poly-D-Lysine coated tissue culture (TC) plate. The TC dish and plate for the primary neuronal cells or purified microglia must be pre-coated with Poly-D-lysine (0.1 mg/ml in H2O) (2 ml for 60 mm2 TC dish, 0.5 ml per well for 24w-TC plate) for 30 min at 37 °C. After washing with sterile water, the TC dishes/plates have to be air-dried in the cell culture hood before use.
The age of the embryos for cell culture. Although E16 embryos are more suitable for neuronal culture and post-natal 1-2 -day-old pups are more suitable for glia culture, we used the E-18 embryos to prepare the neuron culture and also the glial culture (to isolate MΦ). Thus, the neurons and MΦ are prepared from the same litter of embryos. The neuronal culture and microglia can be prepared from embryos or pups of different litters.
The purity of neurons in the cortical neuronal culture. The Neurobasal/B27 medium is serum-free medium, which is optional for neuronal culture. However, there are other cell types in the cultures. In the 2-day-old neuronal cultures, the ratio of MAP2+-neurons is 43.6 ± 23% (n = 10, Figure 1).
Figure 1. MAP2 immunofluorescence of 2-day-old rat cortical neurons in culture. The cortical neuron culture is fixed in 2% PFA and labeled by mouse anti-MAP2 antibody. The signals are visualized with Alexa Fluor 488 (Green). The nuclei of all cells are labeled with DAPI (red). The arrows indicate the MAP2+-neurons. Scale bar = 50 μm.
All animal studies followed the guidelines outlined in Guide for the Care and Use of Laboratory Animals from the National Institutes of Health and were approved by the Animal Welfare Committee of The University of Texas Health Science Center at Houston.
The Irradiation operation followed the guidelines for Environment Health & Safety of The University of Texas Health Science Center at Houston.
Equipment
Hemacytometer (VWR International, catalog number: 15170)
Cell culture CO2 incubator (LabX, Sanyo, model: MCO-19AIC )
Fluorescence microscopy with Imaging System, Olympus IX81 controlled by MetaMorph 7.4
Dissecting microscope (Nikon Corporation, model: SMZ-27 )
Digital controlled orbital shaker (Thermo Fisher Scientific, model: MaxQTM 2000 )
137Cs Irradiation Source (J. L. SHEPHERD & ASSOCIATES, model: 143 ) (Figure 2)
Figure 2. Photos of the 137Cs irradiator. The cultured neurons grown in the 60 mm TC dishes are loaded into the metal cylinder at top of the irradiator. Upon pressing the red button on the right controller, the cylinder will rotate and go down until completely being imbedded in the irradiator (the round bottom portion) for irradiation. By the irradiation time (the left controller) is over, the irradiator will automatically rotate the cylinder upward to its original position. By now, the irradiated cultures are ready to be removed from the cylinder and returned to the CO2 incubator.
Software
MetaMorph software, version 7.4
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
How to cite： Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Zhao, X., Zhang, L., Ting, S. and Aronowski, J. (2016). Phagocytosis Assay of Microglia for Dead Neurons in Primary Rat Brain Cell Cultures. Bio-protocol 6(8): e1795. DOI: 10.21769/BioProtoc.1795.
Zhao, X., Wang, H., Sun, G., Zhang, J., Edwards, N. J. and Aronowski, J. (2015). Neuronal interleukin-4 as a modulator of microglial pathways and ischemic brain damage. J Neurosci 35(32): 11281-11291.
Download Citation in RIS Format
Category
Neuroscience > Cellular mechanisms > Cell isolation and culture
Cell Biology > Cell isolation and culture > Cell isolation
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,796 | https://bio-protocol.org/exchange/protocoldetail?id=1796&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Assessment of Mitochondrial DNA Content and Mass in Macrophages
Jae-Min Yuk
TK Tae Sung Kim
EJ Eun-Kyeong Jo
Published: Vol 6, Iss 9, May 5, 2016
DOI: 10.21769/BioProtoc.1796 Views: 11745
Edited by: Ivan Zanoni
Reviewed by: Shannon Ruppert
Original Research Article:
The authors used this protocol in Jul 2015
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jul 2015
Abstract
Mitochondria are essential regulators in not only ATP generation and metabolic reprogramming but also the generation of reactive oxygen species (ROS) in response to pathogenic stimuli. During exposure to environmental stresses including oxidative stress, exercise, cell division and caloric restriction, mitochondria can be divided to increase mitochondrial number, size, and mass. Moreover, mitochondrial biogenesis has a crucial role in the resolution of inflammation through preserving metabolic function. Recently, diverse biochemical methods have been utilized to evaluate activity of mitochondrial biogenesis. In this protocol, we will describe an in vitro assay to measure mitochondrial DNA content and mass. Quantitative real-time PCR analysis for determination of mitochondrial DNA content is a powerful tool with the addition of flow cytometry or confocal microscopy for evaluating mitochondrial mass. Together, these protocols may provide the significant information for mitochondria studies.
Keywords: Mitochondrial DNA content Macrophages Mitochondrial DNA Mass Quantitative real-time PCR analysis Flow cytometry
Materials and Reagents
Microcentrifuge tube (1.5 ml or 2 ml)
Lipopolysaccharide (InvivoGen, catalog number: tlrl-3pelps )
G-DEXTM IIc Genomic DNA Extraction Kit (iNtRON Biotechnology, catalog number: 17231 )
Absolute or 70% ethanol (Merck Millipore Corporation, catalog number: 100983 )
Isopropanol (Sigma-Aldrich, catalog number: I9030 )
DEPC water (Merck Millipore Corporation, Calbiochem, catalog number: 9062-500 ML_CN )
Primer (EC21, Solgent Co)
Stock concentration: 100 μM; Working concentration: 10 μM
mND-1 (mitochondrially encoded NADH dehydrogenase 1)
forward: 5’ GGCTACATACAATTACGCAAAG-3’
reverse: 5’-TAGAATGGAGTAGACCGAAAGG-3’
mPyruvate kinase
forward: 5’ ACTGGCCGGTGTCATAGTGA-3’
reverse: 5’-TGTTGACCAGCCGTATGGATA-3’
SYBR green PCR master mix (QIAGEN, catalog number: 330520 )
MitoTracker Green FM (Thermo Fisher Scientific, Molecular ProbesTM, catalog number: M-7514 )
Accutase (Sigma-Aldrich, catalog number: A6964 )
Phosphate Buffered Saline (PBS) (Thermo Fisher Scientific, GibcoTM, catalog number: 70011044 )
Formaldehyde for cell fixation (Sigma-Aldrich, catalog number: F8755 )
Triton® X-100 (Sigma-Aldrich, catalog number: T8787 )
DMSO (Sigma-Aldrich, catalog number: D8418 )
DMEM (Thermo Fisher Scientific, catalog number: 11965 )
Macrophage Colony-Stimulating Factor (M-CSF) from mouse (Sigma-Aldrich, catalog number: M9170 )
Tris-HCl (Sigma-Aldrich, catalog number: T5941 )
EDTA solution (Sigma-Aldrich, catalog number: 03690 )
Heat-inactivated FBS (Thermo Fisher Scientific, GibcoTM, catalog number: 1600044 )
Penicillin (50 U/ml)/Streptomycin (50 mg/ml) (Thermo Fisher Scientific, GibcoTM, catalog number: 15140-122 )
TE buffer (see Recipes)
M-CSF-containing medium (see Recipes)
Equipment
Tabletop microcentrifuge (KITA, Hanil, model: Micro12 )
DNA electrophoresis chamber (Takara Bio Company, catalog number: AD140 )
Qiagen Rotor gene 6000 instrument for quantitative real-time PCR analysis (Takara Bio Company, catalog number: AD140)
BD FACSCantoTM II flow cytometer (BD Biosciences)
37 °C, 5% CO2 incubator (Thermo Fisher Scientific, catalog number: 3111 )
Centrifuge (LaboGene, catalog number: i730R )
Water bath or heat block for heating at 65 °C
Vortex mixer (PRONEER, model: MX-S )
Software
FlowJo (Tree Star Inc)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Yuk, J., Kim, T. S. and Jo, E. (2016). Assessment of Mitochondrial DNA Content and Mass in Macrophages. Bio-protocol 6(9): e1796. DOI: 10.21769/BioProtoc.1796.
Download Citation in RIS Format
Category
Immunology > Immune cell function > Macrophage
Molecular Biology > DNA > DNA extraction
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,797 | https://bio-protocol.org/exchange/protocoldetail?id=1797&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Preparation and Immunofluorescence Staining of the Trachea in Drosophila Larvae and Pupae
FC Feng Chen
Published: Vol 6, Iss 9, May 5, 2016
DOI: 10.21769/BioProtoc.1797 Views: 20608
Edited by: Xuecai Ge
Reviewed by: Jihyun Kim
Original Research Article:
The authors used this protocol in Jan 2014
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jan 2014
Abstract
The Drosophila melanogaster trachea is a branched network of rigid chitin-lined tubes that ramify throughout the body and functions as the fly’s respiratory organ. Small openings at the ends of the tracheal tubes allow gas exchange to occur by diffusion between internal tissues and the exterior environment. Tracheal tubes are lined by a single layer of epithelial cells, which secrete chitin and control tube morphology and size. Studies of tracheal development in Drosophila embryos have elucidated fundamental mechanisms of tube morphogenesis and maintenance in vivo, and identified major signaling pathways that regulate these processes (Manning and Krasnow, 1993; Affolter and Shilo, 2000; Zuo et al., 2013; Kerman et al., 2006; Schottenfeld et al., 2010). In recent years, there has been growing interest in the trachea during metamorphosis, when tracheal branches that had served as the respiratory organ in the larva decays and is repaired or replaced by new tracheal tissue arising from committed tracheal progenitor cells, or mature tracheal cells de-differentiated to a progenitor state (Manning and Krasnow, 1993; Sato and Kornberg, 2002; Guha et al., 2008; Guha, and Kornberg, 2005; Weaver and Krasnow, 2008; Pitsouli and Perrimon, 2010; Chen and Krasnow, 2014) forming the adult tracheal by the end of the process. The ongoing decay and tissue formation models aspects of tissue repair and regeneration in other organisms, and has been used to understand how progenitor cells divide and differentiate (Pitsouli and Perrimon, 2010; Pitsouli and Perrimon, 2013), and how they grow out of their niche to replace decaying tissue (Chen and Krasnow, 2014). Here, we present a protocol to dissect, fix, and immunostain tracheal tissue in Drosophila larvae and pupae undergoing metamorphosis. This protocol can be used to immunostain proteins expressed in tracheal tissue, or to amplify signals from weakly expressed fluorescent reporters (as shown in Figure 6). With the appropriate antibodies and genetic reporters, this protocol can be used to visualize decaying larval trachea and the progenitor cells that replace them in a time-course analysis, as well as determine expression of proteins in these cells that may play a role in tissue decay and replacement.
Materials and Reagents
60 mm x 15 mm petri dish [i.e., Falcon® Petri dish (Corning, catalog number: 351007 )]
Flat-bottom 4-well dish [i.e., Nunclon® Δ Multidishes, 4 wells, flat bottom (Sigma-Aldrich, catalog number: D6789-1CS )]
Gold SealTM Rite-OnTM Frosted microslides (VWR International, Erie Scientific, catalog number: 3050 )
Micro cover glasses (coverslips), 22 x 22 mm Square No. 1 (VWR International, catalog number: 48366-067 )
Black electrical tape (i.e., 3M Scotch Super 33+ Vinyl Electrical Tape 0.75 in x 450 in)
Clear nail polish [i.e., crystal clear (Sally Hansen Hard as nails polish)]
KimwipesTM (4.4 x 8.4 in.) (Thermo Fisher Scientific, catalog number: 06-666 )
Austerlitz Insect Pins® ,12 mm length x 0.10 mm diameter (Minutiens in stainless steel, size 0.10 mm) (Entomoravia)
10 μl, 200 μl and 1,000 μl pipet tips (USA Scientific, TipOne, catalog number: 1111-3000 , 1111-0000 and 1111-2021 )
Disposable glass Pasteur pipettes (Corning, catalog number: 7095D-5x ) with 1 ml rubber bulbs (Sigma-Aldrich, catalog number: Z111589 )
Aluminum foil
Parafilm M® All-Purpose laboratory film (2" x 250') (VWR International, Bemis Company, catalog number: PM992 )
Drosophila melanogaster larvae and pupae of desired genotype raised at 25 °C
Vials and bottles with closures [FisherbrandTM stock bottles (catalog number: AS117 ), FisherbrandTM cotton balls (catalog number: 22-456-880 ), FisherbrandTM Drosophila products, BuzzPlugsTM (catalog number: AS277 ), FisherbrandTM Drosophila vials (catalog number: AS514 )] with Drosophila food (see Cold Spring Harbor Protocols, 2014)
Dow Corning SYLGARD® 184 Silicone Elastomer Kit [184 SIL ELAST KIT 0.5 KG (Ellsworth Adhesives)]
4% paraformaldehyde (PFA) diluted in PBS [i.e., 16% paraformaldehyde (VWR International, catalog number: 100503-916 ) diluted to 4% in PBS]
Primary antibody to stain protein of interest [i.e., Chicken-anti-GFP (Abcam, catalog number: ab13970 ) to stain tracheal-expressed GFP in ppk4-Gal4, UAS-GFP larvae and pupae]
Fluorescence conjugated secondary antibody to visualize and amplify primary antibody staining [i.e., Alexa488-conjugated Goat-anti-Chicken (Thermo Fisher Scientific, InvitrogenTM, catalog number: A-11039 ) to stain the above anti-GFP primary antibody]
Normal serum from the same species as the secondary antibody [i.e., normal goat serum (Vector laboratories, catalog number: S-1000 )]
Vectashield® mounting media (Vector Laboratories, catalog number: H-1000 )
NaCl
KCl
Na2HPO4
KH2PO4
1x Phosphate-buffered saline (PBS) (see Recipes)
TritonTM X-100 (Sigma-Aldrich, catalog number: X100 ) diluted to 0.1% in PBS (see Recipes)
Block solution (see Recipes)
DAPI staining solution (see Recipes)
Dissection dish (see Recipes)
Equipment
Incubator to house Drosophila set to 25 °C
Stereomicroscope with light source [i.e., Carl ZeissTM StemiTM 2000C with KL 300 LED Cold Light Source (120 V) (Thermo Fisher Scientific, catalog number: 12-070-284 )]
Dumont #5 mirror finish forceps biology tips/straight/inox/11 cm (Fine Science Tools, catalog number: 11252-23 )
Vannas spring scissors-straight/sharp/8 cm/3 mm cutting edge (Fine Science Tools, catalog number: 15000-00 )
Benchtop shaker (i.e., Bellco Glass 7744-06115 Mini Orbital Shaker)
Clay AdamsTM Nutator Mixer (BD, catalog number: 421105 )
P2, P20, P100, and P1000 Pipetman® Pipettes (Gilson Scientific Ltd., catalog number: F144801 , F123600 , F123615 and F123602 )
Small watercolor paintbrush, round, size 0
Stainless steel spatula with a micro spoon end (Ted Pella Inc., catalog number: 13500 )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Chen, F. (2016). Preparation and Immunofluorescence Staining of the Trachea in Drosophila Larvae and Pupae. Bio-protocol 6(9): e1797. DOI: 10.21769/BioProtoc.1797.
Download Citation in RIS Format
Category
Developmental Biology > Morphogenesis > Metamorphosis
Cell Biology > Tissue analysis > Tissue staining
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,798 | https://bio-protocol.org/exchange/protocoldetail?id=1798&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
3D Gel Invasion Assay of Gastric Cancer Cells with Fibroblasts
Masamitsu Tanaka
Published: Vol 6, Iss 9, May 5, 2016
DOI: 10.21769/BioProtoc.1798 Views: 12073
Edited by: HongLok Lung
Original Research Article:
The authors used this protocol in Jan 2015
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jan 2015
Abstract
Cancer tissue is composed of cancer cells and a large number of stromal cells including fibroblasts. In order to understand the relationship between fibroblasts and cancer cells during invasion of the stroma, 3D gel invasion assay is useful. Most tumors are associated with a biologically active type of fibroblasts known as cancer-associated fibroblasts (CAFs), which promote the invasion of cancer cells. Here, we describe the method of imaging the invasion by fluorescently labeled CAFs and gastric cancer cells in gels containing extracellular matrix. For two-color fluorescence labeling of living cells, long-chain dialkylcarbocyanines, DiO and DiI were used. This method is also applicable for studying invasion by other stromal cells and cancer cells, and for evaluation of drugs targeting cancer stromal cells.
Keywords: CAF Scirrhous Invasion
Materials and Reagents
Collagen-coated dish (Sanyo, IWAKI, catalog number: 4010-010 )
Transparent PET membrane 24 well 3.0 μm pore size (Corning, Falcon®, catalog number: 353096 )
24 well plate for use with cell culture inserts (Corning, Falcon®, catalog number: 353504 )
Razor blades (Esbjerg, Feather, catalog number: FA-10 )
Microslide glass (Matsunami Glass Ind, catalog number: TF0215M )
Micro cover glass, 24 x 24 mm (Thickness NO.1: 0.12-0.17 mm) (Matsunami Glass Ind)
Gastric cancer cells (44As3) (Yanagihara K et al., 2005)
Note: It’s established from gastric cancer patient.
Fibroblasts (CAF) (Fuyuhiro Y et al., 2011)
Note: It’s isolated from surgical materials of gastric cancer patients.
Type I-collagen (Nitta Gelatin Inc., Cellmatrix Type I-P)
Matrigel matrix (Corning, catalog number: 356234 )
3, 3’-dioctadecycloxacarbo-cyanine perchlorate (DiO) (Thermo Fisher Scientific, Molecular Probes™, catalog number: D-275 )
1, 1’-dioctadecyl-3, 3, 3’, 3’-tetramethyllindo-carbocyanine perchlorate (DiI) (Thermo Fisher Scientific, Molecular Probes™, catalog number: D-282 )
Trypsin-EDTA solution (Sigma-Aldrich, catalog number: T3924 )
Penicillin-Streptomycin (Sigma-Aldrich, catalog number: P4333 )
Dulbecco’s modified Eagle’s medium (Sigma-Aldrich, catalog number: D6046 )
RPMI-1640 medium (Sigma-Aldrich, catalog number: R8758 )
10x Dulbecco’s modified Eagle’s medium (Sigma-Aldrich, catalog number: D2429 )
10x RPMI-1640 medium (Sigma-Aldrich, catalog number: R1145-500ML )
Fetal bovine serum (heat inactivated) (Sigma life science, catalog number: 172012-500ML , batch: S13C490)
Phosphate buffered saline (PBS) (Sigma-Aldrich, catalog number: P4417 )
4% Paraformaldehyde phosphate buffer (Wako Pure Chemical Industries, catalog number: 163-20145 )
Polyvinyl alcohol mounting medium (Sigma-Aldrich, Fluka, catalog number: 10981 )
Instant glue (Krazy Glue, catalog number: KG585 )
NaHCO3 (Sigma-Aldrich, catalog number: S6014-500G )
NaOH (Sigma-Aldrich, catalog number: S5881-500G )
HEPES (Sigma-Aldrich, catalog number: H7006-25G )
Gel (0.2 mg/ml type I-collagen and 2.5 mg/ml matrigel matrix) (see Recipes)
Reconstitution buffer (see Recipes)
Equipment
Tweezers (Electron Microscopy Sciences, Dumont, model: No.5 )
37 °C, 5% CO2 incubator (LabX, Sanyo, model: MCO-19AIC )
Dissecting microscope (OLYMPUS CORPORATION, model: SZ61 )
Light source (OLYMPUS CORPORATION, KL1600LED )
Vibratome (DOSAKA EM, model: LinearSlicer PRO7 )
Confocal laser scanning microscope (ZEISS, model: LSM 780 )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Tanaka, M. (2016). 3D Gel Invasion Assay of Gastric Cancer Cells with Fibroblasts. Bio-protocol 6(9): e1798. DOI: 10.21769/BioProtoc.1798.
Download Citation in RIS Format
Category
Cancer Biology > Invasion & metastasis > Tumor microenvironment
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,799 | https://bio-protocol.org/exchange/protocoldetail?id=1799&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Preparation of Synovial Mesenchymal Stem Cells from a Rat Knee Joint
Nobutake Ozeki
Takeshi Muneta
Mitsuru Mizuno
Ichiro Sekiya
Published: Vol 6, Iss 9, May 5, 2016
DOI: 10.21769/BioProtoc.1799 Views: 9313
Reviewed by: Hui Zhu
Original Research Article:
The authors used this protocol in Jun 2015
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jun 2015
Abstract
Mesenchymal stem cells (MSCs), first described in human bone marrow, are emerging as promising cell-based therapeutics for a wide range of diseases (Caplan and Correa, 2011). MSCs have been isolated from various organs in the body, and synovial MSCs were first reported by De Bari et al. (2001). We previously reported that synovial MSCs have superior proliferation and chondrogenic potentials as compared to bone marrow-, muscle-, and adipose- derived MSCs in humans (Sakaguchi et al., 2005) and rats (Yoshimura et al., 2007). In addition, administration of synovial MSCs for osteochondral defect promoted cartilage regeneration in a rabbit (Koga et al., 2008) and a pig model (Nakamura et al., 2012). In 2008, we started a clinical trial in human and obtained satisfactory results of symptoms and regenerated cartilage by Magnetic Resonance Imaging (Sekiya et al., 2015). We have also engaged in multiple research lines using synovial MSCs for meniscus regeneration in rats (Horie et al., 2009; Horie et al., 2012; Katagiri et al., 2013; Okuno et al., 2014; Ozeki et al., 2015). In this article, we demonstrated how to harvest the synovium including infrapatellar fat pad from a rat knee joint, and to describe the technique of isolation and culture of rat synovial MSCs.
Keywords: Synovium Mesenchymal stem cells Rat
Materials and Reagents
Culture dish (culture area: 56.7 cm2, diameter: 100 mm) (Thermo Fisher Scientific, catalog number: 150350 )
Cell strainer (70 µm) (VWR International, Greiner Bio-One GmbH, catalog number: 89508-344 )
Clip (Mitsuya, catalog number: GM-590 ) cut by pliers in a half size (Figure 1B)
Styrene foam (RIKAKEN) (Figure 1C)
50 ml Falcon tube (Corning, catalog number: 352070 )
8-12 weeks old Lewis rat (Charles River Laboratories International)
Collagenase V (Wako Pure Chemical Industries, catalog number: 038-17851 )
α-minimal essential medium (α-MEM) (Thermo Fisher Scientific, catalog number: 12561-056 )
Fetal bovine serum (FBS) (Thermo Fisher Scientific, catalog number: 12483-020 )
Streptomycin, Penicillin, Amphotericin B (Antibiotic-Antimycotic, 100x) (Thermo Fisher Scientific, Gibco™, catalog number: 15240-062 )
Phosphate buffer saline (PBS) (Thermo Fisher Scientific, Gibco™, catalog number: 14190-235 )
α-MEM containing 10% FBS with antibiotics (see Recipes)
3 mg/ml Collagenase solution (for synovium from both knee joints) (see Recipes)
Equipment
37 degree, 5% CO2 forced-air incubator (ASTEC, catalog number: SCA-165DS )
Centrifuge machine (KUBOTA Corporation, model: Model 8730 )
Scalpel holder (Natsume, catalog number: No.3 D-11 ) with blade (Natsume, catalog number: No.11 D-13 ), scissors (Natsume, catalog number: B-12 ), and tweezers (Natsume, catalog number: A-6 ) (Figure 1A)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Ozeki, N., Muneta, T., Mizuno, M. and Sekiya, I. (2016). Preparation of Synovial Mesenchymal Stem Cells from a Rat Knee Joint. Bio-protocol 6(9): e1799. DOI: 10.21769/BioProtoc.1799.
Download Citation in RIS Format
Category
Stem Cell > Adult stem cell > Mesenchymal stem cell
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
2 Q&A
A small puzzle to this protocol
0 Answer
4 Views
Jun 11, 2024
How to distinguish the isolated cells by this protocol is MSC or fibroblast-like synovial cells, for their extremely similar protocol
0 Answer
2 Views
Jun 11, 2024
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
18 | https://bio-protocol.org/exchange/protocoldetail?id=18&type=1 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Yeast Vacuole Staining with FM4-64
Bio-protocol Editor
Published: Jan 5, 2011
DOI: 10.21769/BioProtoc.18 Views: 28801
Download PDF
Ask a question
Favorite
Cited by
Abstract
The lipophilic probe, FM 4-64 does not fluoresce much in water but fluoresces strongly after binding to the outer plasma membrane, providing clear and distinguishable plasma membrane staining. The binding is rapid and reversible. In this protocol vacuoles in yeast cells are stained with the FM4-64 dye, permitting the use of live-cell imaging if needed.
Materials and Reagents
FM4-64 (Life Technologies, Molecular Probes, catalog number: F34653 )
DMSO (Sigma-Aldrich)
YES medium
FM4-64 stock solution
EMM
PBS
Equipment
Water bath
Bench-top centrifuge
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2011 The Authors; exclusive licensee Bio-protocol LLC.
Category
Microbiology > Microbial cell biology > Cell staining
Cell Biology > Organelle isolation > Vacuole
Cell Biology > Cell staining > Organelle
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
180 | https://bio-protocol.org/exchange/protocoldetail?id=180&type=1 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Preparation of Torula Yeast RNA for Hybe Solutions
LJ Lili Jing
Published: Feb 5, 2012
DOI: 10.21769/BioProtoc.180 Views: 20453
Download PDF
Ask a question
How to cite
Favorite
Cited by
Abstract
In situ hybridization in zebrafish embryos frequently suffers from high background signal. Torular yeast RNA is often added to reduce the non-specific binding that leads to the high background signal. Without appropriate preparation, torular yeast RNA can also add background to the staining. This method is an easy and quick way to clean torular RNA for Hybe solution used in in situ hybridization.
Materials and Reagents
Torula RNA (RNA from torula yeast, type VI) (Sigma-Aldrich, catalog number: R6225 , 100 g)
TE (Life Technologies, Invitrogen™, catalog number: 12090-015 )
RNase-free H2O (Life Technologies, Ambion®, catalog number: AM9932 )
3 M NaOAc
Ethanol
Phenol
Chloroform
RNase-free 80% ethanol
Equipment
Standard tabletop centrifuges
50 ml Falcon tubes
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2012 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Jing, L. (2012). Preparation of Torula Yeast RNA for Hybe Solutions. Bio-101: e180. DOI: 10.21769/BioProtoc.180.
Download Citation in RIS Format
Category
Cell Biology > Cell staining > Nucleic acid
Molecular Biology > RNA > RNA detection
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
1 Q&A
how to do step 6 and 7?
0 Answer
9 Views
Nov 30, 2022
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,800 | https://bio-protocol.org/exchange/protocoldetail?id=1800&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
An in vitro Transcription/translation System for Detection of Protein Interaction
PL Pin-Chun Lin
YC Ya-Chun Chang
SL Shih-Shun Lin
Published: Vol 6, Iss 9, May 5, 2016
DOI: 10.21769/BioProtoc.1800 Views: 16226
Edited by: Zhaohui Liu
Reviewed by: Pablo Bolanos-Villegas
Original Research Article:
The authors used this protocol in Jun 2015
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jun 2015
Abstract
Studying protein-protein interaction is crucial to understand the fundamental processes of molecular biology. High-throughput screening, such as immunoprecipitation followed by proteomic analysis, allows for the identification of numerous candidate partners that might interact with a selected protein. However, experimental validation of protein-protein interaction requires conventional cloning and recombinant protein expression/purification, which are complicated and labor-intensive techniques. Here, we demonstrate an efficient experimental pipeline for verifying protein-protein interactions between a bait protein using the example of Odontoglossum ringspot virus (ORSV) capsid protein (CP) and the host CP-binding protein. These candidate CP-binding proteins were identified through high-throughput proteomic and transcriptomic approaches. Using the TOPO cloning strategy, each candidate gene was cloned into an expression vector for the expression of His-tagged recombinant proteins in a single step of an in vitro transcription/translation system. Such expressed His-tagged candidates can be used as prey with the CP bait protein in a co-immunoprecipitation (co-IP) assay to verify their physical interaction. Without the need for traditional protein expression and purification, this pipeline simplifies the validation process and provides a solution for high-throughput protein-protein interaction studies.
Keywords: Protein-protein interaction in vitro transcription/translation Co-immunoprecipitation
Materials and Reagents
TOPO cloning for the protein expression construct
Heat shock-competent cell of E. coli strain DH5α
pEXP5-CT/TOPO TA Expression Kit (Thermo Fisher Scientific, InvitrogenTM, catalog number: V960-06 )
Forward/reversed primers for candidate genes
ExTaq polymerase (Takara Bio Company, catalog number: RR001A )
UltraPure agarose (Thermo Fisher Scientific, InvitrogenTM, catalog number: 16500 )
QIAEX® II Gel Extraction Kit (QIAGEN, catalog number: 20051 )
Luria-Bertani (LB) broth and LB agar plates
Ampicillin sodium salt (Sigma-Aldrich, catalog number: A0166 )
T7 forward primer (5’-TAATACGACTCACTATAGGG-3’)
PrestoTM Mini Plasmid Kit (Geneaid Biotech Ltd., catalog number: PDH300 )
Expression of recombinant protein via single-step in vitro transcription/translation
ExpresswayTM Cell-Free E. coli Expression System (Thermo Fisher Scientific, InvitrogenTM, catalog number: K9901-00 )
Polyacrylamide gel electrophoresis (PAGE) system (Bio-Rad Laboratories, catalog number: 1610158 )
Anti-His (C-term)-HRP monoclonal antibody (Thermo Fisher Scientific, InvitrogenTM, catalog number: R931-25 )
COOMASSIE Brilliant Blue G-250 (VWR International, J.T.Baker, catalog number: F789 )
Protein-protein interaction and co-immunoprecipitation (co-IP)
pGEX-4T-1 DNA vector (GE Healthcare, catalog number: 28-9545-49 )
Bait protein with tag [herein, GST-CP (recombinant of ORSV CP protein with the N-terminus fused to glutathione S-transferase)
Anti-bait antibody [herein, anti-CP antibody (Lee and Chang, 2008)]
Protein G PLUS-Agarose (Santa Cruz Biotechnology, catalog number: sc-2002 )
Anti-tag antibody (anti-GST mouse monoclonal antibody) (Bioman, catalog number: GST001M )
Tris base (J.T.Baker, catalog number: 4109 )
NaCl (Sigma-Aldrich, catalog number: S9888 )
Glycerol (Sigma-Aldrich, catalog number: G5516 )
Triton X-100 (Sigma-Aldrich, catalog number: T8787 )
2-mercaptoethanol (Sigma-Aldrich, catalog number: M6250 )
Sodium dodecyl sulfate (SDS) (Sigma-Aldrich, catalog number: L3771 )
Bromophenol blue (Sigma-Aldrich, catalog number: B0126 )
Acrylamide/bis-acrylamide (37.5:1) (Bio-Rad Laboratories, catalog number: 1610158 )
Ammonium persulfate (Sigma-Aldrich, catalog number: A3678 )
TEMED (Sigma-Aldrich, catalog number: T9281 )
Glycine (Sigma-Aldrich, catalog number: G8898 )
Methanol (Sigma-Aldrich, catalog number: 322415 )
Co-precipitation buffer (see Recipes)
Wash buffer (see Recipes)
2x sample buffer (see Recipes)
SDS-PAGE separating gel (see Recipes)
SDS-PAGE stacking gel (see Recipes)
PAGE running buffer (see Recipes)
Western blot transfer buffer (see Recipes)
Equipment
Thermal cycler (Biocompare, Biometra, catalog number: T3000 )
Horizontal gel electrophoresis device (Bio-Rad Laboratories)
42 °C waterbath (FIRSTEK, catalog number: B101 )
37 °C Orbital Shaking Incubator (FIRSTEK, catalog number: S300R )
Polyacrylamide gel electrophoresis system (Bio-Rad Laboratories, catalog number: 1658003 )
Western blot transfer apparatus (Bio-Rad Laboratories, catalog number: 1703930 )
Mixer for Eppendorf tube (ELMI North America, catalog number: RM-2L )
Microcentrifuge (Eppendorf AG, catalog number: 05400002 )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Lin, P., Chang, Y. and Lin, S. (2016). An in vitro Transcription/translation System for Detection of Protein Interaction. Bio-protocol 6(9): e1800. DOI: 10.21769/BioProtoc.1800.
Download Citation in RIS Format
Category
Molecular Biology > Protein > Protein-protein interaction
Plant Science > Plant molecular biology > Protein
Microbiology > Microbe-host interactions > Virus
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,801 | https://bio-protocol.org/exchange/protocoldetail?id=1801&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Analysis of Monosaccharides in Total Mucilage Extractable from Arabidopsis Seeds
Cătălin Voiniciuc
MG Markus Günl
Published: Vol 6, Iss 9, May 5, 2016
DOI: 10.21769/BioProtoc.1801 Views: 10060
Edited by: Marisa Rosa
Reviewed by: Harrie van ErpFernanda Salvato
Original Research Article:
The authors used this protocol in Sep 2015
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Sep 2015
Abstract
The Arabidopsis thaliana seed coat epidermis produces copious amounts of mucilage polysaccharides (Haughn and Western, 2012). Characterization of mucilage mutants has identified novel genes required for cell wall biosynthesis and modification (North et al., 2014). The biochemical analysis of seed mucilage is essential to evaluate how different mutations affect cell wall structure (Voiniciuc et al., 2015c). Here we describe a robust method to screen the monosaccharide composition of Arabidopsis seed mucilage using ion chromatography (IC). Mucilage from up to 48 samples can be extracted and prepared for IC analysis within 24 h (only 4 h hands-on). Furthermore, this protocol enables fast separation (31 min per sample), automatic detection and quantification of both neutral and acidic sugars.
Keywords: Matrix polysaccharides Seed coat Plant cell wall HPAEC-PAD Ion chromatography
Materials and Reagents
Sterile Petri dishes
Filter paper (MACHEREY-NAGEL GmbH & Co., catalog number: 434009 or similar types)
3M Micropore paper tape (VWR International, catalog number: 115-8172 )
Square (7 x 7 cm) or round (Ø 5 cm; 35 multi-well insets) plastic pots, and trays
Peat-sand-pumice substrate (SoMi 513 Dachstauden) (HAWITA GRUPPE GmbH)
ARACON cone and tube (Betatech bvba)
Large (sandwich-style) brown paper bags
Small white paper bags (Baumann Saatzuchtbedarf, catalog number: 3.065.002 , or similar style)
15 ml Falcon tubes (VWR International, catalog number: 734-0452 )
2 ml Eppendorf safe-lock tubes (VWR International, catalog number: 211-2165 )
2 ml screw-cap tubes (VWR International, catalog number: 211-0093 )
Chromatography vials with inserts (VWR International, catalog number: 548-0120 )
Snap cap for chromatography vials (VWR International, catalog number: 548-1151 )
Manual pipettes tips
Arabidopsis thaliana seeds
Murashige and Skoog (MS) basal salts (Sigma-Aldrich, catalog number: M5519-10L )
Agar (Carl Roth GmbH + Co, catalog number: 4807.2 )
D-(-)-Ribose (Rib) (Sigma-Aldrich, catalog number: R7500-5 G )
L-(+)-Arabinose (Ara) (Sigma-Aldrich, catalog number: A3256-25 G )
L-(-)-Fucose (Fuc) (Sigma-Aldrich, catalog number: F2252-5 G )
D-(+)-Galactose (Gal) (Sigma-Aldrich, catalog number: G0750-25 G )
D-(+)-Galacturonic acid monohydrate (GalA) (Sigma-Aldrich, catalog number: 48280-5G-F )
D-(+)-Glucose (Glc) (Sigma-Aldrich, catalog number: G8270-100 G )
D-Glucuronic acid (GlcA) (Sigma-Aldrich, catalog number: G5269-10 G )
D-(+)-Mannose (Man) (Sigma-Aldrich, catalog number: M8574-25 G )
L-Rhamnose monohydrate (Rha) (Sigma-Aldrich, catalog number: R3875-5 G )
D-(+)-Xylose (Xyl) (Sigma-Aldrich, catalog number: X3877-25 G )
Ultrapure water (18.2 MΩ cm at 25 °C)
Sodium hydroxide (NaOH) (VWR International, catalog number: BAKR3727.2500 )
Trifluoroacetic acid (TFA) (Carl Roth GmbH + Co., catalog number: 6957.1 )
½ MS plates (see Recipes)
Sugar standard stocks (see Recipes)
9-Sugar mix (see Recipes)
2 M TFA (see Recipes)
10 mM NaOH (see Recipes)
733 mM NaOH (see Recipes)
Equipment
Laminar flow clean bench
Growth chamber (Johnson Controls)
Autoclave
Water purification system (Milli-Q or similar style)
Manual pipettes (Eppendorf AG, Research plus and Repeater Plus style)
Analytical balance (Mettler-Toledo, model: XSE205DU )
Ball mill (Retsch GmbH, catalog number: MM400 )
Two 24 TissueLyser adapters for ball mill (QIAGEN, catalog number: 69982 )
Safety glasses
Lab coat
Chemical resistant gloves (Honeywell, Dermatril, catalog number: 740 , or similar style)
Fume hood
Sample concentrator (Bibby Scientific Limited, Techne, catalog number: FSC400D ), equipped with
127 mm needles (Bibby Scientific Limited, Techne, catalog number: F7210 )
A Dri-block heater (Bibby Scientific Limited, Techne, catalog number: DB200/3 )
Three aluminium blocks (Bibby Scientific Limited, Techne, catalog number: F3505 )
Connected to a central air supply, in a fume hood
Ice machine
Ion chromatography (IC): Dionex DX-600 system equipped with
AS50 autosampler
GP50 gradient pump
ED50 electrochemical detector
CarboPac PA20 guard column (Thermo Fisher Scientific, Dionex Softron, catalog number: 060144 )
CarboPac PA20 analytical column (Thermo Fisher Scientific, Dionex Softron, catalog number: 60142 )
Vortex mixer (Scientific Industries Inc., model: Vortex-Genie 2 , or similar style)
Benchtop centrifuge (compatible with 2 ml tubes)
Racks with lids for 2 ml tubes (VWR International, catalog number: 211-0215 )
Boxes with lids for vials (neoLab, catalog number: 2-2580 )
Fine-tipped forceps (VWR International; catalog number: 232-0107 , or similar types)
Serological pipettes (Thermo Fisher Scientific, Nunc-type or similar style)
2 L volumetric flask
Helium gas tank
Software
Chromeleon 6.8 chromatography data system software (Thermo Fisher Scientific, Dionex)
Microsoft Excel with the Real Statistics Resource Pack (http://www.real-statistics.com/)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
How to cite： Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Voiniciuc, C. and Günl, M. (2016). Analysis of Monosaccharides in Total Mucilage Extractable from Arabidopsis Seeds. Bio-protocol 6(9): e1801. DOI: 10.21769/BioProtoc.1801.
Voiniciuc, C., Schmidt, M. H., Berger, A., Yang, B., Ebert, B., Scheller, H. V., North, H. M., Usadel, B. and Gunl, M. (2015b). MUCILAGE-RELATED10 produces galactoglucomannan that maintains pectin and cellulose architecture in Arabidopsis seed mucilage. Plant Physiol 169(1): 403-420.
Download Citation in RIS Format
Category
Plant Science > Plant biochemistry > Carbohydrate
Biochemistry > Carbohydrate > Polysaccharide
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,802 | https://bio-protocol.org/exchange/protocoldetail?id=1802&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Quantification of the Mucilage Detachment from Arabidopsis Seeds
Cătălin Voiniciuc
Published: Vol 6, Iss 9, May 5, 2016
DOI: 10.21769/BioProtoc.1802 Views: 7663
Edited by: Marisa Rosa
Reviewed by: Harrie van ErpFernanda Salvato
Original Research Article:
The authors used this protocol in Sep 2015
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Sep 2015
Abstract
The Arabidopsis thaliana seed coat produces large amounts of cell wall polysaccharides, which swell out of the epidermal cells upon hydration of the mature dry seeds. While most mucilage polymers immediately diffuse in the surrounding solution, the remaining fraction tightly adheres to the seed, forming a dense gel-like capsule (Macquet et al., 2007). Recent evidence suggests that the adherence of mucilage is mediated by complex interactions between several cell wall components (Griffiths et al., 2014; Voiniciuc et al., 2015a). Therefore, it is important to evaluate how different cell wall mutants impact this mucilage property. This protocol facilitates the analysis of monosaccharides in sequentially extracted mucilage fractions, and quantifies the detachment of each component from seeds.
Keywords: Mucilage adherence Sequential extractions Ion chromatography Monosaccharides Plant cell wall
Materials and Reagents
15 ml Falcon tubes (VWR International, catalog number: 734-0452 )
2 ml Eppendorf safe-lock tubes (VWR International, catalog number: 211-2165 )
2 ml screw-cap tubes (VWR International, catalog number: 211-0093 )
Chromatography vials with inserts (VWR International, catalog number: 548-0120 )
Snap cap for chromatography vials (VWR International, catalog number: 548-1151 )
Manual pipettes tips
Arabidopsis thaliana seeds
2-Deoxy-D-glucose (2-deoxy-Glc) (Sigma-Aldrich, catalog number: D6134-1 G )
D-(-)-Ribose (Rib) (Sigma-Aldrich, catalog number: R7500-5 G )
L-(+)-Arabinose (Ara) (Sigma-Aldrich, catalog number: A3256-25 G )
L-(-)-Fucose (Fuc) (Sigma-Aldrich, catalog number: F2252-5 G )
D-(+)-Galactose (Gal) (Sigma-Aldrich, catalog number: G0750-25 G )
D-(+)-Galacturonic acid monohydrate (GalA) (Sigma-Aldrich, catalog number: 48280-5G-F )
D-(+)-Glucose (Glc) (Sigma-Aldrich, catalog number: G8270-100 G )
D-Glucuronic acid (GlcA) (Sigma-Aldrich, catalog number: G5269-10 G )
D-(+)-Mannose (Man) (Sigma-Aldrich, catalog number: M8574-25 G )
L-Rhamnose monohydrate (Rha) (Sigma-Aldrich, catalog number: R3875-5 G )
D-(+)-Xylose (Xyl) (Sigma-Aldrich, catalog number: X3877-25 G )
Ultrapure water (18.2 MΩ cm at 25 °C)
Sodium hydroxide (NaOH) (VWR International, catalog number: BAKR3727.2500 )
Trifluoroacetic acid (TFA) (Carl Roth GmbH + Co., catalog number: 6957.1 )
Sugar standard stocks (see Recipes)
9-Sugar mix (see Recipes)
2 M TFA (see Recipes)
10 mM NaOH (see Recipes)
733 mM NaOH (see Recipes)
Equipment
Autoclave
Water purification system (Milli-Q or similar style)
Manual pipettes (Eppendorf AG, Research plus and Repeater Plus style)
Analytical balance (Mettler-Toledo, model: XSE205DU )
Ball mill (Retsch GmbH, catalog number: MM400 )
Two 24 TissueLyser adapters for ball mill (QIAGEN, catalog number: 69982 )
Lab coat
Safety glasses
Chemical resistant gloves (Honeywell, Dermatril, catalog number: 740 , or similar style)
Fume hood
Sample concentrator (Bibby Scientific Limited, Techne, catalog number: FSC400D ), equipped with
127 mm needles (Bibby Scientific Limited, Techne, catalog number: F7210 )
A Dri-block heater (Bibby Scientific Limited, Techne, catalog number: DB200/3 )
Three aluminium blocks (Bibby Scientific Limited, Techne, catalog number: F3505 )
Connected to a central air supply, in a fume hood
Ice machine
Ion chromatography (IC): Dionex DX-600 system equipped with
AS50 autosampler
GP50 gradient pump
ED50 electrochemical detector
CarboPac PA20 guard column (Thermo Fisher Scientific, Dionex Softron, catalog number: 060144 )
CarboPac PA20 analytical column (Thermo Fisher Scientific, Dionex Softron, catalog number: 60142 )
Vortex mixer (Scientific Industries Inc., model: Vortex-Genie 2 , or similar style)
Benchtop centrifuge (compatible with 2 ml tubes)
Racks with lids for 2 ml tubes (VWR International, catalog number: 211-0215 )
Serological pipettes (Thermo Fisher Scientific, Nunc-type or similar style)
2 L volumetric flask
Helium gas tank
Software
Chromeleon 6.8 chromatography data system software (Thermo Fisher Scientific, Dionex)
Microsoft Excel with the Real Statistics Resource Pack (http://www.real-statistics.com/)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
How to cite： Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Voiniciuc, C. (2016). Quantification of the Mucilage Detachment from Arabidopsis Seeds. Bio-protocol 6(9): e1802. DOI: 10.21769/BioProtoc.1802.
Voiniciuc, C., Schmidt, M. H., Berger, A., Yang, B., Ebert, B., Scheller, H. V., North, H. M., Usadel, B. and Gunl, M. (2015b). MUCILAGE-RELATED10 produces galactoglucomannan that maintains pectin and cellulose architecture in Arabidopsis seed mucilage. Plant Physiol 169(1): 403-420.
Download Citation in RIS Format
Category
Plant Science > Plant biochemistry > Carbohydrate
Biochemistry > Carbohydrate > Polysaccharide
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,803 | https://bio-protocol.org/exchange/protocoldetail?id=1803&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Olfactory Recognition Memory Test in Mice
SJ Stephanie A. Jacobs
FH Fengying Huang
JT Joe Z. Tsien
WW Wei Wei
Published: Vol 6, Iss 9, May 5, 2016
DOI: 10.21769/BioProtoc.1803 Views: 8977
Edited by: Soyun Kim
Reviewed by: Tifany DesprezPascal Fossat
Original Research Article:
The authors used this protocol in Aug 2015
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Aug 2015
Abstract
Olfactory memory is an ethologically relevant task that relies on a mouse’s innate ability to use olfaction to forage for food (Zou et al., 2015), and identify safe foods. Although many of the same brain areas involved in other forms of memory are also involved in olfactory memory, the mechanisms are different (Sanchez-Andrade et al., 2005; Tong et al., 2014). Here, we describe one way to test olfactory memory in mice. The protocol described can be used to test long-term memory (memory which requires de novo protein synthesis) or short term memory by adjusting the delay time between the training session and the recall session (Freedman et al., 2013) and has been designed to mimic the single presentation of the social recognition paradigm. This paradigm relies on the mouse’s innate tendency to investigate a novel scent more than a familiar scent. Transgenic NR2A overexpression mice are known to have impaired long-term olfactory memory, but intact short-term memory, and are used here to demonstrate how one form of impaired olfactory memory may appear. Other genetically or chemically manipulated mice may be used in place of the transgenic mice used here.
Materials and Reagents
Filter paper (Bio-Rad Laboratories, catalog number: 1703967 )
Pipet or syringe (BD, catalog number: 309625 )
Low odor epoxy or glue, or tape to seal the scent cup
Adult 3-8 months old mice, for the testing group (transgenic NR2A overexpression mice) and wild type mice for the control group (referred to as “subject mouse”)
70% ethanol solution
Fresh or canned, non-expired 100% juice samples [pineapple (Dole), orange (Tropicana), 100% lemon and 100% lime juices] (see Figure 1)
Equipment
Clean mouse cages identical to the home cage (7.5 in x 11 in x 5 in), one for each subject mouse per phase
Clear Plexiglas to cover the cage top (so the mice cannot climb out)
Small plastic container with a lid (i.e., a plastic petri dish, 35 mm x 10 mm) (Thermo Fisher Scientific, catalog number: FB0875711YZ , or other similar replacement)
Drill with small (1 mm) drill bit or 18 g needle (BD, catalog number: 305196 ) for making holes in top of scent cup
Digital recording camera
Laboratory timer
Stopwatch for recording investigation times
Figure 1. Experimental set-up for the olfactory recognition task. For the olfactory recognition task, a selection of juices (pineapple, orange, lemon and lime), a small Petri dish, a syringe and an empty clean mouse cage are used.
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Jacobs, S. A., Huang, F., Tsien, J. Z. and Wei, W. (2016). Olfactory Recognition Memory Test in Mice. Bio-protocol 6(9): e1803. DOI: 10.21769/BioProtoc.1803.
Download Citation in RIS Format
Category
Neuroscience > Behavioral neuroscience > Learning and memory
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,804 | https://bio-protocol.org/exchange/protocoldetail?id=1804&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Social Recognition Memory Test in Rodents
SJ Stephanie A. Jacobs
FH Fengying Huang
JT Joe Z. Tsien
WW Wei Wei
Published: Vol 6, Iss 9, May 5, 2016
DOI: 10.21769/BioProtoc.1804 Views: 15475
Edited by: Soyun Kim
Reviewed by: Tifany DesprezPascal Fossat
Original Research Article:
The authors used this protocol in Aug 2015
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Aug 2015
Abstract
Social recognition memory is essential for the establishment and maintenance of a rodent colony. Recognition memory is important for social hierarchy, mate and offspring recognition, and interspecies recognition. Interspecies recognition is vital for recognizing frequent visitors to the animal’s habitat and whether or not the visitors pose a threat to the animals or colony (Macbeth et al., 2009; Noack et al., 2010). Here, we describe a protocol which effectively and reproducibly measures the social recognition for a juvenile male, a female, a mouse of another strain, and a rat. This task relies on the animal’s innate tendency to explore a novel social partner and decrease the exploration of a known familiar social partner (Thor et al., 1982). A significant decrease in the exploration of a partner from the training session to the recall session demonstrates a memory of the social partner. Also, we describe a social recognition procedure, the habituation-dishabituation paradigm that closely mimics typical short, frequent interactions between animals in a colony (Dantzer et al., 1987; Winslow and Camacho, 1995). Further, olfaction is a key component of social recognition, to test olfaction see Jacobs et al. (2016). In this protocol, we use transgenic NR2A overexpression mice to demonstrate how an impairment in social recognition memory may appear.
Materials and Reagents
Adult (3-8 months old) transgenic, knockout or treatment group mice (we use NR2A transgenic mice) and wild type mice (referred to as “subject mouse”)
Juvenile (approximately 6-week old) male mice on the same genetic background
Juvenile male mice on a different genetic background of a different color
Approximately 3-month old adult female mice on the same genetic background
Juvenile male rats
70% ethanol solution
Equipment
Clean mouse cage identical to the home cage (standard mouse cage dimensions are 11 in x 7.5 in x 5 in), one for each subject mouse tested, change between sessions
Clean rat home cage (standard rat housing cage dimensions are 22 in x 12.5 in x 8 in), one for each subject rat tested, change between sessions
Clear Plexiglas to cover the cage top
Small wire enclosure (for a female mouse), small wire pencil cup can be used (see Figure 1)
Large wire mesh enclosure (for a juvenile male rat), made in-house from Plexiglas and wire mesh (Thermo Fisher Scientific, catalog number: AA42777HZ ) (see Figure 2)
Digital recording camera
Laboratory timer
Stopwatch for recording investigation times
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Jacobs, S. A., Huang, F., Tsien, J. Z. and Wei, W. (2016). Social Recognition Memory Test in Rodents. Bio-protocol 6(9): e1804. DOI: 10.21769/BioProtoc.1804.
Download Citation in RIS Format
Category
Neuroscience > Behavioral neuroscience > Learning and memory
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,805 | https://bio-protocol.org/exchange/protocoldetail?id=1805&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
ER Microsome Preparation and Subsequent IAA Quantification in Maize Coleoptile and Primary Root Tissue
Verena Kriechbaumer
Published: Vol 6, Iss 9, May 5, 2016
DOI: 10.21769/BioProtoc.1805 Views: 10501
Edited by: Samik Bhattacharya
Reviewed by: Laura ZaninAgnieszka Zienkiewicz
Original Research Article:
The authors used this protocol in Sep 2015
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Sep 2015
Abstract
Auxin is a major growth hormone in plants and the first plant hormone to be discovered and studied (Darwin and Darwin, 1880). The auxin molecule in plants was first identified as indole-3-acetic acid (IAA) by Kögl et al. (1934). Active research over nearly a decade has shed light on many of the molecular mechanisms of its action but the complexity and redundancy of the auxin biosynthetic network raises questions about control of this system. We have shown that some enzymes involved in the YUCCA-route of auxin biosynthesis are not cytosolic but localised to the endoplasmic reticulum (ER) in both Arabidopsis thaliana (YUCCA4.2) (Kriechbaumer et al., 2012) as well as Zea mays (ZmTAR1 and ZmSPI) (Kriechbaumer et al., 2015). This is raising the intriguing possibility of subcellular compartmentation of auxin biosynthesis. To show that maize auxin biosynthesis indeed can take place in microsomal as well as cytosolic cellular fractions from maize seedlings we applied the protocol described here: Microsomes are being isolated from maize coleoptile and primary root tissue, enzyme assays with microsomal and cytosolic fractions using either tryptophan (Trp) or indole- -3pyruvic acid (IPyA) as a substrate are carried out and the auxin IAA is extracted and quantified.
Keywords: Maize Microsomes Endoplasmic reticulum Auxin IAA
Materials and Reagents
Pipettes (1 ml, 200 µl and 10 µl) (Gilson Scientific Ltd., catalog number: F123602 , F123601 and F144802 )
Eppendorf tubes (2 ml) (Eppendorf AG, catalog number: 0030120094 )
Eppendorf conical tubes (50 ml) (Eppendorf AG, catalog number: 0030122178 )
0.45 µm syringe filters (Sigma-Aldrich, catalog number: F8273 )
Cheese cloth (DUTSCHER SCIENTIFIC, catalog number: 789056 )
Ice box and ice
Liquid nitrogen
Triethanolamine-acetic acid (TEA-HOAc) (Sigma-Aldrich, catalog number: 90278 )
Potassium acetate (KOAc) (Sigma-Aldrich, catalog number: P1190 )
Magnesium acetate [Mg(OAc)2] (Sigma-Aldrich, catalog number: M5661 )
Sucrose (Sigma-Aldrich, catalog number: S0389 )
DL-Dithiothreitol (DTT) (Sigma-Aldrich, catalog number: 43815 )
Ethylenediaminetetraacetic acid (EDTA) (Sigma-Aldrich, catalog number: E5391 )
Tris-Hydrochloride (Tris-HCl) (Sigma-Aldrich, catalog number: 252859 )
β-Nicotinamide adenine dinucleotide phosphate disodium salt (NADPH) (Sigma-Aldrich, catalog number: 93205 )
Flavin adenine dinucleotide (FAD) (Sigma-Aldrich, catalog number: F6625 )
Indole-3-pyruvic acid (IPyA) (Sigma-Aldrich, catalog number: I7017 )
Tryptophan (Sigma-Aldrich, catalog number: T0254 )
Ethyl acetate (Sigma-Aldrich, catalog number: 270989 )
Sodium carbonate (Na2CO3) (Sigma-Aldrich, catalog number: S7795 )
Distilled water
Ethyl acetate for HPLC (Sigma-Aldrich, catalog number: 650528 )
Acetic acid for HPLC (Sigma-Aldrich, catalog number: A6283 )
Methanol for HPLC (Sigma-Aldrich, catalog number: 34860 )
Stock solutions (see Recipes)
Buffers (see Recipes)
Buffers for microsome extraction (Buffer 1, Buffer 2, Buffer 3 and Buffer 4)
Buffers for HPLC analysis
Equipment
Porcelain mortar & pestle (Sigma-Aldrich, catalog number: Z247464 and Z247502 )
Glass bottles for buffers (100 ml, 250 ml and 500 ml) (Sigma-Aldrich, catalog number: Z305170 , Z305189 and Z305197 )
Refrigerated table centrifuge (Eppendorf AG, model: 5430R )
Ultracentrifuge with swing-out rotor SW41 (Beckman Coulter, catalog number: 331362 )
Ultracentrifuge corex tubes (Beckman Coulter, catalog number: 331372 )
Glass rod and a 2 ml Potter–Elvehjem homogenizer (Sigma-Aldrich, catalog number: P7734-1EA )
water bath (37 °C) (Thermo Fisher Scientific, model: TSGP02 )
Speed-vac (LABCONCO, catalog number: 7810016 )
Nanodrop ND-2000 (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 13400504 )
High-performance liquid chromatography (HPLC) (600E multisolvent delivery system) (WATERS, catalog number: 720000699EN )
Reverse phase column (Apollo C18) (250 mm x 4.6 mm, 5 μm) (Thermo Fisher Scientific, GraceTM, catalog number: 5126767 )
UV monitor 486 (WATERS) and a fluorescence monitor 470 (WATERS)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Kriechbaumer, V. (2016). ER Microsome Preparation and Subsequent IAA Quantification in Maize Coleoptile and Primary Root Tissue. Bio-protocol 6(9): e1805. DOI: 10.21769/BioProtoc.1805.
Download Citation in RIS Format
Category
Plant Science > Plant cell biology > Organelle isolation
Cell Biology > Organelle isolation > Microsome
Plant Science > Plant biochemistry > Plant hormone
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,806 | https://bio-protocol.org/exchange/protocoldetail?id=1806&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Affymetrix Genome-wide Human SNP Assay
AB Alexis Bosman
Published: Vol 6, Iss 10, May 20, 2016
DOI: 10.21769/BioProtoc.1806 Views: 7723
Reviewed by: Francesco Dal GrandeIrit Adini
Original Research Article:
The authors used this protocol in May 2015
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
May 2015
Abstract
To assess genomic variation, it is possible to identify the single nucleotide polymorphisms (SNP) which an individual carries. Using the Affymetrix Genome-wide Human SNP Assay, it is possible to assess 906,600 SNPs on a single array. This protocol, the next iteration of the GeneChip Mapping 500K array set, is based directly on the manufacturers’ protocol and shows steps which are highly similar to that which is found here: http://media.affymetrix.com/support/downloads/manuals/genomewidesnp6_manual.pdf.
Keywords: Single nucleotide polymorphisms Array Human cells
Materials and Reagents
96-well V-bottom plates, elution catch (Greiner Bio-One GmbH, catalog number: 651101 )
Greiner UV star transparent, 96-well (Greiner Bio-One GmbH, catalog number: 82050-788 )
Note: Currently, it is “VWR International, catalog number: 82050-788”.
Multiplate 96-well unskirted PCR plate (Bio-Rad Laboratories, catalog number: MLP-9601 )
Multiscreen deep well plate (Merck Millipore Corporation, catalog number: MDRLN0410 )
2.4 ml deep well storage plate/pooling plate (Greiner Bio-One GmbH, catalog number: 780280 )
100 ml solution basin (VWR International, LabcorTM, catalog number: 730-014 )
55 ml solution basin (VWR International, LabcorTM, catalog number: 730-004 )
15 ml centrifuge tubes (VWR International, catalog number: 20171-020 )
50 ml centrifuge tubes (VWR International, catalog number: 21008-178 )
2.0 ml Eppendorf tubes (VWR International, catalog number: 20901-540 )
0.2 ml 12-strip tubes (VWR International, catalog number: 21008-940 )
Lab tape
Tough-Spots®
Microseal ‘B’ adhesive seal (Bio-Rad Laboratories, model: MSB1001 )
MicroAmp® clear adhesive film applied (Biosystems, catalog number: 4306311 )
Note: Currently, it is “Thermo Fisher Scientific, Applied BiosystemsTM, catalog number: 4306311”.
Kimwipes (source as desired)
Pipet tips as appropriate for pipettes (source as desired)
AccuGENE® water, molecular biology-grade (Affymetrix, catalog number: 71786 )
GenElute Mammalian Genomic DNA Miniprep (Sigma-Aldrich, catalog number: G1N70 )
Affymetrix SNP 6 Core Reagent Kit, 100 reactions (Affymetrix, catalog number: 901706 )
10x Sty I buffer/NE buffer 3 (New England Biolabs)
T4 DNA Ligase (400 U/μl) (New England Biolabs)
T4 DNA Ligase Buffer (10x) (New England Biolabs)
Adaptor, sty (50 μM)
PCR Primer 002 (100 μM)
10x Nsp I buffer/NE buffer 2 (New England Biolabs)
NspI (10 U/μl) (New England Biolabs)
Adaptor, nsp (50 μM)
Elution buffer (Buffer EB)
Fragmentation buffer (10x)
Fragmentation reagent (DNase I)
DNA Labeling reagent
Terminal deoxynucleotidyl transferase (TdT) (30 U/μl)
Terminal deoxynucleotidyl transferase buffer (TdT buffer) (5x)
Oligo control reagent (OCR), 0100
10 mg/ml BSA (100x)
Hybridization Master Mix
DNA marker (Bionexus, catalog number: BN2050 )
2% TBE gel (Thermo Fisher Scientific, InvitrogenTM, catalog number: G8008-02 )
Gel loading solution (Faster Better Media, catalog number: SB5N-8 )
Ethanol (Sigma-Aldrich, catalog number: 459844 )
50 ml magnetic beads (AMPure, catalog number: A63881 )
Note: It is named “Agencourt AMPure XP-PCR Purification” on Beckman Coulter website.
4% TBE gel (Thermo Fisher Scientific, InvitrogenTM, catalog number: G8008-04 )
MES hydrate (Sigma-Aldrich, catalog number: M8250 )
MES sodium salt (Sigma-Aldrich, catalog number: M3885 )
Note: All catalog numbers are listed in the Affymetrix datasheet (http://media.affymetrix.com/support/downloads/manuals/genomewidesnp6_manual.pdf).
Clontech TITANIUMTM DNA Amplification Kit (Clontech, catalog number: 639240 ) (see Recipes)
12x MES Stock Solution (see Recipes)
Equipment
Applied Biosystems units
2720 Thermal Cycler
GeneAmp® PCR System 9700
GeneAmp® PCR System 9700 (silver block or gold-plated silver block)
48 Genome-Wide Human SNP Array 6.0 (one array per sample)
GeneChip® Hybridization Oven 640
Jitterbug
Spectrophotometer plate reader
Vacuum Manifold (Merck Millipore Corporation)
Vortexer
Cooler (chilled to -20 °C)
Cooling chamber (chilled to 4 °C) (do not freeze)
Cooling chamber (double, chilled to 4 °C) (do not freeze)
Ice bucket, filled with ice
Marker, fine point, permanent
Microcentrifuge
Pipet, 12-channel P1200
Pipet, 12-channel P200
Pipet, 12-channel P20 (accurate to within ± 5%)
Pipet, serological
Pipet, single channel P1000
Pipet, single channel P200
Plate centrifuge with deep-well capacity (54 mmH x 160 g)
Optical plates
Centrifuge plate holders
Notes:
Use only the PCR plate, adhesive film and thermal cyclers listed here.
All relevant equipment numbers are listed in the Affymetrix datasheet.
(http://media.affymetrix.com/support/downloads/manuals/genomewidesnp6_manual.pdf)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Bosman, A. (2016). Affymetrix Genome-wide Human SNP Assay. Bio-protocol 6(10): e1806. DOI: 10.21769/BioProtoc.1806.
Download Citation in RIS Format
Category
Molecular Biology > DNA > Microarray
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,807 | https://bio-protocol.org/exchange/protocoldetail?id=1807&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Biotinylation and Purification of Plasma Membrane-associated Proteins from Rodent Cultured Neurons
MC Margarida Caldeira
JF Joana S. Ferreira
AC Ana Luísa Carvalho
Carlos B. Duarte
Published: Vol 6, Iss 10, May 20, 2016
DOI: 10.21769/BioProtoc.1807 Views: 9817
Edited by: Oneil G. Bhalala
Reviewed by: Pamela MaherEdgar Soria-Gomez
Original Research Article:
The authors used this protocol in Jun 2015
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jun 2015
Abstract
This protocol aims at the biotin labeling and affinity purification of plasma membrane proteins from cultured neurons. Protein biotinylation consists in the covalent attachment of biotin to proteins. Biotin is a membrane unpermeable molecule with a small size (MW 244.31 g/mol) and therefore does not interfere with the normal function of proteins. Biotin binds to streptavidin and avidin molecules with high affinity. This binding is extremely resistant to temperature, pH and proteolysis, which allows capture and purification of plasma membrane proteins. Moreover, proteins can bind several biotin molecules, that will allow the consequent binding of several streptavidin or avidin molecules, increasing the sensitivity of detection of the proteins of interest. In this protocol proteins at the cell surface of live cultured neurons are biotinylated. Neuronal extracts are prepared and biotinylated proteins are collected with NeutrAvidin-coupled beads, and analyzed by Western blotting.
Keywords: Plasma-membrane proteins Affinity purification Biotin Cell surface Cultured neurons
Materials and Reagents
Centrifuge microtube with 0.45 μm filter (VWR International, catalog number: 82031-360 )
Cell scraper with 1.7 cm blade length (SARSTEDT AG & Co, catalog number: 831830 )
Primary cultures of rodent hippocampal or cortical neurons (as described in Caldeira et al., 2007a; Caldeira et al., 2007b; Ferreira et al., 2015)
Glycine (Sigma-Aldrich, catalog number: 15527 )
NeutrAvidin plus ultralink resin (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 53151 )
EZ link sulfo-nhs-ss-biotin (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 21331 )
Phenylmethylsulfonyl fluoride (PMSF) (Sigma-Aldrich, catalog number: P7626-1 g )
Chymostatin (Sigma-Aldrich, catalog number: C7268-1 mg )
Leupeptin (Sigma-Aldrich, catalog number: L2884-1 mg )
Antipain dihydrochloride from microbial source (Sigma-Aldrich, catalog number: A6191-1 mg )
Pepstatin A (Sigma-Aldrich, catalog number: P5318-5 mg )
Deoxycholic acid (DOC) (Sigma-Aldrich, catalog number: D5670 )
Note: it is also named “Sodium deoxycholate monohydrate” on Sigma-Aldrich website.
Dithiothreitol (DTT) (NZYTech, catalog number: MB03101 )
Liquid Nitrogen
DMSO (Sigma-Aldrich, catalog number: D8418-100 ml )
PierceTM Bicinchoninic acid protein assay-Reagent A (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 23223 )
PierceTM Bicinchoninic acid protein assay-Reagent B (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 23224 )
NaCl
KCl
KH2PO4
Na2HPO4
MgCl2
CaCl2
Tris-HCl
EGTA
EDTA
Triton X-100
SDS
Sodium orthovanadate
Bromophenol blue
PBS (see Recipes)
PBS/Ca2+/Mg2+ (see Recipes)
Radioimmune precipitation assay (RIPA) buffer (see Recipes)
Lysis buffer for insoluble proteins (see Recipes)
2x denaturating buffer (see Recipes)
Protease inhibitor cocktail (see Recipes)
Equipment
Orbital horizontal shaker (GFL, model: 3005 )
Sonicator (Sonics & Materials, model: VC50 )
Benchtop microcentrifuge (Eppendorf AG, model: 5415D )
Laboratory tube rotator (Falc Intruments s.r.l., model: F205 )
Heating block (Bibby Scientific, Stuart Scientific, model: SHT200D )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
How to cite： Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Caldeira, M., Ferreira, J. S., Carvalho, A. L. and Duarte, C. B. (2016). Biotinylation and Purification of Plasma Membrane-associated Proteins from Rodent Cultured Neurons. Bio-protocol 6(10): e1807. DOI: 10.21769/BioProtoc.1807.
Ferreira, J. S., Schmidt, J., Rio, P., Águas, R., Rooyakkers, A., Li, K. W., Smit, A. B., Craig, A. M. and Carvalho, A. L. (2015). GluN2B-containing NMDA receptors regulate AMPA receptor traffic through anchoring of the synaptic proteasome. J Neurosci 35(22): 8462-8479.
Download Citation in RIS Format
Category
Neuroscience > Cellular mechanisms > Cell isolation and culture
Biochemistry > Protein > Isolation and purification
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,808 | https://bio-protocol.org/exchange/protocoldetail?id=1808&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Induction, Isolation and Counting of Akinetes in Aphanizomenon ovalisporum
Assaf Sukenik
Ruth N. Kaplan-Levi
YV Yehudit Viner-Mozzini
AL Achsa Lupu
DS Dotan Sela
Published: Vol 6, Iss 10, May 20, 2016
DOI: 10.21769/BioProtoc.1808 Views: 7819
Edited by: Maria Sinetova
Reviewed by: Claudia Catalanotti
Original Research Article:
The authors used this protocol in Jul 2015
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jul 2015
Abstract
Akinetes are spore-like resting (dormant) cells formed by strains of filamentous cyanobacteria for surviving long periods of unfavorable conditions. During deprivation for potassium, vegetative photosynthetic cells along the filaments of the cyanobacterium Aphanizomenon ovalisporum (A. ovalisporum) (strain ILC-164) differentiate into akinetes. Akinetes are larger than vegetative cell, have a thick wall, accumulate storage compounds (cyanophycine, glycogen, lipids) and excess of DNA (Sukenik et al., 2015; Sukenik et al., 2007; Maldener et al., 2014). Differences in structure and composition between akinetes and vegetative cells allow separation and isolation of akinetes. Akinetes isolated by the described protocol can be utilized for protein analysis, measurements of metabolic activities, fluorescence in situ hybridization (FISH) studies and more.
Materials and Reagents
Erlenmeyer flasks of appropriate volume
50 ml tubes (SARSTEDT AG & Co, catalog number: 62.547.004 )
250 ml centrifuge bottle (TermoFisher SCIENTIFIC, catalog number: 3141-0250 )
Aphanizomenon ovalisporum, strain ILC-164 [isolated from Lake Kinneret, Israel (Banker et al., 1997)]
BG11 growth medium (Stanier et al., 1971)
BG/-K akinete induction medium
Note: BG11 medium in which the K2HPO4 component was substituted with Na2HPO4.
Sodium chloride (NaCl) (Sigma-Aldrich, catalog number: S9888 )
Ethylenediaminetetraacetic acid disodium salt dehydrate (Na-EDTA) (Sigma-Aldrich, catalog number: E5134 )
Magnesium chloride (MgCl2) (Sigma-Aldrich, catalog number: M8266 )
Lysozyme from chicken egg white (Sigma-Aldrich, catalog number: L6876 )
Note: It is also named as “Mucopeptide N-acetylmuramoylhydrolase” or “muramidase”.
Lugol’s solution (Sigma-Aldrich, catalog number: L6146 )
SYTOX (Invitrogen, catalog number: S7020 )
Note: Currently, it is “SYTOX® Green Nucleic Acid Stain-5 mM Solution in DMSO” (Thermo Fisher Scientific, Molecular ProbesTM, catalog number: S7020).
Coomassie brilliant blue R-250 staining solution (BIO RAD catalog number: 1610436 ).
Molecular weight markers [All blue pre-stained protein standards (M. W. 10-250 kD)] (Bio-Rad Laboratories, catalog number: 1610373 )
Tris (Sigma-Aldrich, catalog number: 252859 )
Note: It is also named as “Tris (hydroxymethyl) aminomethane” on Sigma-Aldrich website.
Tris buffer(see Recipes)
Tris-EDTA-Mg buffer (see Recipes)
Tris-Mg buffer (see Recipes)
TE buffer (see Recipes)
0.5 M EDTA stock solution (see Recipes)
1 M MgCl2 stock solute (see Recipes)
1 M NaCl (see Recipes)
Equipment
Spectrophotometer (such as Uvikon XS SECOMAM)
Sorvall centrifuge RC 6 Plus and appropriate rotor for the centrifuge tubes or bottles
Vortex
Sonicator [e.g., Sonifier 450 (Branson Ultrasonics)]
Orbital shaker (e.g., MaxQTM 2000 and 3000 benchtop orbital shaker, TermoFisher SCIENTIFIC, model number: SHKA2000 )
Incubator (regulated temperature and light)
Bright field/fluorescent inverted microscope (e.g., Zeiss Axioobserver Z1)
Note: Use the following filter sets: for chlorophyll (EX-425-443 nm; BS-452 nm; EM-496 nm LP), for Phycobilins (EX-510-550 nm; BS-565 nm; EM-582 nm LP) and for SYTOX (EX-445-495 nm; BS-500 nm; EM-505-555 nm).
Utermohl sedimentation chamber (Aquatic Research Instruments, http://www.aquaticresearch.com/sedimentation_chamber.htm)
Thermostatic water bath
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Sukenik, A., Kaplan-Levi, R. N., Viner-Mozzini, Y., Lupu, A. and Sela, D. (2016). Induction, Isolation and Counting of Akinetes in Aphanizomenon ovalisporum. Bio-protocol 6(10): e1808. DOI: 10.21769/BioProtoc.1808.
Download Citation in RIS Format
Category
Microbiology > Microbial cell biology > Cell isolation and culture
Microbiology > Microbial cell biology > Cell viability
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,809 | https://bio-protocol.org/exchange/protocoldetail?id=1809&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Isolating Liver Mitochondria by Differential Centrifugation
Ignacio Amigo
JT Javier Traba
CR Carlos B. Rueda
Published: Vol 6, Iss 10, May 20, 2016
DOI: 10.21769/BioProtoc.1809 Views: 18073
Edited by: Oneil G. Bhalala
Reviewed by: Tifany DesprezHong Lok Lung
Original Research Article:
The authors used this protocol in Feb 2015
Download PDF
Ask a question
Favorite
Cited by
Original research article
The authors used this protocol in:
Feb 2015
Abstract
In addition to methods aimed at the study of mitochondrial function in-situ, a full understanding of mitochondrial function requires their purification from cells or tissues under specific physiological or pathological conditions. This protocol illustrates a sequential procedure to obtain functional mitochondria with high yield from mice liver tissue. Mitochondria obtained with this method can be used to assess different mitochondrial parameters, including oxygen consumption, membrane potential and calcium retention capacity.
Keywords: Mitochondria Liver Respiration Bioenergetics Mice
Materials and Reagents
Centrifuge tubes
Mice
Potassium salts
Sodium salts
Sucrose (Sigma-Aldrich, catalog number: 84100 )
Bovine serum albumin (BSA) (Sigma-Aldrich, catalog number: A6003 )
Disodium ethylenediaminetetraacetate dihydrate (EDTA) (Sigma-Aldrich, catalog number: ED2SS )
Ethylene glycol-bis(2-aminoethylether)-N, N, N’, N’-tetraacetic acid (EGTA) (Sigma-Aldrich, catalog number: E4378 )
Dithiothreitol (DTT) (Sigma-Aldrich, catalog number: 646563 )
HEPES (Thermo Fisher Scientific, GibcoTM, catalog number: 15630-080 )
Protease inhibitors (100x) (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 78429 )
D-Mannitol (Sigma-Aldrich, catalog number: M4125 )
Magnesium chloride hexahydrate (MgCl2) (Sigma-Aldrich, catalog number: M9272 )
Potassium hydroxide (KOH) (Sigma-Aldrich, catalog number: 221473 )
Sodium hydroxide (NaOH) (Sigma-Aldrich, catalog number: S5881 )
Extraction buffer (see Recipes)
Note: Approximately 100 ml extraction buffer per liver.
Equipment
Dounce homogenizer and pestles (A and B)
Small scissors
Tweezers
Figure 1. Tools for mincing and homogenate the tissue. Dounce homogenizer and pestles (A and B), Small scissors and tweezers.
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
Category
Cell Biology > Organelle isolation > Mitochondria
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
1 Q&A
Can mitochondria be extracted from mouse gut tissue in the same way? How to avoid over homogenization? Must I use a dounce homogenizer? Will a simple
0 Answer
5 Views
Aug 30, 2023
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
181 | https://bio-protocol.org/exchange/protocoldetail?id=181&type=1 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Genotyping Transgenic Zebrafish Using Genomic DNA Extracted from Clutch of Embryos
LJ Lili Jing
Published: Feb 5, 2012
DOI: 10.21769/BioProtoc.181 Views: 14550
Download PDF
Ask a question
Favorite
Cited by
Abstract
Transgenic zebrafish are very useful genetic tools to study various biological processes. Identification the right transgene founder and the subsequent transgenic animals are always tedious and time consuming. This protocol provides a relatively rapid and easy method to identify the founder parent using a clutch of embryos.
Materials and Reagents
Zebrafish embryos
MeOH
Phenol
Chloroform
Isoamyl alcohol (IAA)
NaCl
KCl
MgCl2
EtOH
TE
Tween 20
NaOAC
Gelatine
NP40
Proteinase K
ddH2O
Phenol: chloroform: isoamyl alcohol (25:24:1)
Primers (custom ordered from IDT)
1x RAPD buffer (see Recipes)
RAPD+ (see Recipes)
PCR lysis buffer (see Recipes)
Equipment
PCR thermal cycler
Incubator
Glass pipette
Remove MeOH and dry embryos in 55 °C incubator.
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2012 The Authors; exclusive licensee Bio-protocol LLC.
Category
Molecular Biology > DNA > Genotyping
Molecular Biology > DNA > DNA extraction
Molecular Biology > DNA > PCR
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,810 | https://bio-protocol.org/exchange/protocoldetail?id=1810&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Isolating Brain Mitochondria by Differential Centrifugation
Ignacio Amigo
JT Javier Traba
CR Carlos B. Rueda
Published: Vol 6, Iss 10, May 20, 2016
DOI: 10.21769/BioProtoc.1810 Views: 16720
Edited by: Oneil G. Bhalala
Reviewed by: Tifany DesprezHong Lok Lung
Original Research Article:
The authors used this protocol in Feb 2015
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Feb 2015
Abstract
In addition to methods aimed at the study of mitochondrial function in-situ, a full understanding of mitochondrial function requires their purification from cells or tissues under specific physiological or pathological conditions. This protocol illustrates a sequential procedure to obtain functional mitochondria with high yield from mice brain tissue. Mitochondria obtained with this method can be used to assess different mitochondrial parameters, including oxygen consumption, membrane potential and calcium retention capacity.
Keywords: Mitochondria Brain Respiration Bioenergetics Mice
Materials and Reagents
Centrifuge tubes
Mice
Sucrose (Sigma-Aldrich, catalog number: 84100 )
Bovine serum albumin (BSA) (Sigma-Aldrich, catalog number: A6003 )
Ethylene glycol-bis(2-aminoethylether)-N, N, N’, N’-tetraacetic acid (EGTA) (Sigma-Aldrich, catalog number: E4378 )
HEPES (Thermo Fisher Scientific, GibcoTM, catalog number: 15630-080 )
Protease inhibitors (100x) (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 78429 )
Digitonin (Sigma-Aldrich, catalog number: D141 )
D-Mannitol (Sigma-Aldrich, catalog number: M4125 )
Magnesium chloride hexahydrate (MgCl2) (Sigma-Aldrich, catalog number: M9272 )
Potassium hydroxide (KOH) (Sigma-Aldrich, catalog number: 221473 )
Sodium hydroxide (NaOH) (Sigma-Aldrich, catalog number: S5881 )
Extraction buffer (approximately 50 ml per brain) (see Recipes)
Equipment
Dounce homogenizer and pestles (A and B)
Scissors
Tweezers
Figure 1. Tools for mincing and homogenate the tissue. Dounce homogenizer and pestles (A and B), Small scissors and tweezers.
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
How to cite： Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Amigo, I., Traba, J. and Rueda, C. B. (2016). Isolating Brain Mitochondria by Differential Centrifugation. Bio-protocol 6(10): e1810. DOI: 10.21769/BioProtoc.1810.
Rueda, C. B., Traba, J., Amigo, I., Llorente-Folch, I., Gonzalez-Sanchez, P., Pardo, B., Esteban, J. A., del Arco, A. and Satrustegui, J. (2015). Mitochondrial ATP-Mg/Pi carrier SCaMC-3/Slc25a23 counteracts PARP-1-dependent fall in mitochondrial ATP caused by excitotoxic insults in neurons. J Neurosci 35(8): 3566-3581.
Download Citation in RIS Format
Category
Neuroscience > Cellular mechanisms > Mitochondria
Cell Biology > Organelle isolation > Mitochondria
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,811 | https://bio-protocol.org/exchange/protocoldetail?id=1811&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Proximity Ligation Assay (PLA) Protocol Using Duolink® for T Cells
Valentin Derangère
Mélanie Bruchard
Frédérique Végran
François Ghiringhelli
Published: Vol 6, Iss 10, May 20, 2016
DOI: 10.21769/BioProtoc.1811 Views: 19179
Edited by: Jia Li
Reviewed by: Griselda Zuccarino-Catania
Original Research Article:
The authors used this protocol in Jul 2015
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jul 2015
Abstract
Protein-protein interaction experiments, such as co-immunoprecipitation (IP) assays, classically require tremendous amount of cells. This becomes a problem when your work focuses on rare cell populations (e.g., lymphocyte subtypes). O-link Bioscience has developed Proximity Ligation Assay (PLA) reagents and procedures to alleviate and solve this kind of issue. Moreover PLA experiments are read out using fluorescence or bright field microscopy, providing additional information on intracellular interactions localization significantly bettering classical IP procedures.
PLA reagents are made of complementary small oligonucleotides “minus” and “plus” probes which specifically recognize host species from the primary antibodies (Abs) targeting the two proteins you are interested in. Experiments have to be designed with primary Abs from different species (rabbit, mouse or goat) as PLA probes “minus” or “plus” react against a specific host species of the primary antibody (e.g. “plus” anti-rabbit with “minus” anti-mouse or “plus” anti-mouse with “minus” anti-rabbit combos are allowed if mouse and rabbit primary Abs are used). When the two PLA probes are close enough (40 nm) a ligation occurs upon ligase incubation generating a circle DNA. These circle-forming DNAs are next amplified thanks to a polymerase and complementary fluorescent nucleotides, being incorporated at this step. Each luminescent spot is thereafter considered being an interaction site between the two proteins (Figure 1).
Figure 1. Schematic representation of Duolink® experiment. Primary Abs from different host species were used [i.e., Mouse (Ms) anti-Nlrp3 and Rabbit (Rb) anti-IRF4]. When protein-protein interaction occurs PLA probes allow incorporation of fluorescent oligonucleotides which are analyzed by microscopy.
PLA experiments have been performed on differentiated T cells from mice. T cells were grown on cover slip coated with poly-L-Lysine. Please be aware that for T cells and other non-adherent cells, experiments and staining are also possible in 500 µl microtubes until the last washing step before mounting cover slip on slide. This microtube method saves cytokines reagents and allows T cells to grow with usual methods but centrifugation repetition for washing steps is hazardous. Primary Abs incubation also requires also a specific setup if microtube method is chosen.
Keywords: Protein interaction Fluorescence CD4 T cells
Materials and Reagents
Glass cover slip (Ø13 mm thickness, No. 1, 5) (VWR International, catalog number: 631-0150 )
Primary antibodies (Abs)
Mouse anti-Nlrp3 (1/100) (Adipogen International, catalog number: AG-20B-0014 )
Note: Starting concentration of mouse anti-Nlrp3 is1 µg/µl.
Rabbit anri-IRF4 (1/100) (Novus Biologicals, catalog number: NBP1-00893 )
Note: Starting concentration of rabbit anri-IRF4 is 0.08 µg/µl.
Duolink® reagents
Anti-rabbit PLUS probe (1/5) (Sigma-Aldrich, catalog number: Duo92002 )
Anti-mouse MINUS probe (1/5) (Sigma-Aldrich, catalog number: Duo92004 )
Ligation reagents (5x) (Sigma-Aldrich, catalog number: Duo92007 )
Note: Ligation reagents, ligase and amplification reagents are all included in the pack # DUO92007 .
Ligase (1 unit/μl) (Sigma-Aldrich, catalog number: Duo82029 )
Amplification reagents (containing orange labeled oligonucleotides) (5x) (Sigma-Aldrich, catalog number: Duo92007 )
Polymerase (10 unit/μl) (Sigma-Aldrich, catalog number: Duo82030 )
Wash buffer A (Sigma-Aldrich, catalog number: Duo82049 )
Wash buffer B (Sigma-Aldrich, catalog number: Duo82049 )
Poly-L-Lysine (Sigma-Aldrich, catalog number: P4707 )
Triton X-100 (0.1% in PBS) (Sigma-Aldrich, catalog number: T8787 )
Blocking & Abs dilution buffer (0.5% BSA in PBS)
Mounting medium containing DAPI (Thermo Fisher Scientific, Molecular ProbesTM, catalog number: P36931 )
1x PBS (Lonza, catalog number: 17-516F )
RNase free water (Thermo Fisher Scientific, InvitrogenTM, catalog number: 10977035 )
4% formaldehyde (PFA) (VWR International, catalog number: 9713.1000 )
Equipment
Pipets (from 1 to 1,000 µl)
Fluorescence microscope (with DAPI and Cy2 or Cy3 emission filter) (ZEISS, model: Imager M2)
Note: Objective 63x is recommended for T cells imaging.
37 °C incubator
Freeze block for enzymes
Orbital shaker
Software
ImageJ
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Derangère, V., Bruchard, M., Végran, F. and Ghiringhelli, F. (2016). Proximity Ligation Assay (PLA) Protocol Using Duolink® for T Cells. Bio-protocol 6(10): e1811. DOI: 10.21769/BioProtoc.1811.
Download Citation in RIS Format
Category
Immunology > Immune cell function > General
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,812 | https://bio-protocol.org/exchange/protocoldetail?id=1812&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Liquid Luminescent DNA-precipitation Assay
Frédérique Végran
Mélanie Bruchard
Valentin Derangère
François Ghiringhelli
Published: Vol 6, Iss 10, May 20, 2016
DOI: 10.21769/BioProtoc.1812 Views: 7847
Edited by: Jia Li
Reviewed by: Griselda Zuccarino-Catania
Original Research Article:
The authors used this protocol in Jul 2015
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jul 2015
Abstract
Working on transcription factors requires studying interactions between protein and DNA. After identification of putative binding-sequences and motifs, Electrophoretic Mobility Shift Assay (EMSA) experiment is classically used to determine specific interactions of proteins and nucleic acids. This lengthy process is rather heavy-handed because of radioisotopically labeled DNA and autoradiographic visualization that are required for the experiments.
Liquid luminescent DNA precipitation assay provides rapid, reliable and quantitative results concerning protein-DNA interactions. This protein-DNA binding assay is based on solution hybridization between Digoxigenin-labeled (DIG) DNA and glutathione S-transferase (GST)-fused DNA binding protein bound to Glutathione Sepharose 4B beads (Figure 1), without electrophoresis (Toshiharu et al., 2008). Digoxigenin is a steroid found in plants. It is increasingly used as a label for nonradioactive detection of nucleic acids and proteins.
Figure 1. Representation of liquid chemiluminescent DNA pull-down assay. A Glutathione S-transferase (GST)-fused NLRP3 (GST-NLRP3) bound to Glutathione Sepharose 4B beads is incubated with a DIG-labeled double-stranded DNA fragment containing putative NLRP3 Binding Site (NBS) in protein-DNA binding buffer. After extensive washing, protein-DNA binding on beads is detected using anti-DIG antibody conjugated to alkaline phosphatase, which is measured by a chemiluminescent reaction using a luminometer Disodium 3-(4-methoxyspiro {1,2-dioxetane-3,2′-(5′-chloro) tricyclo [3.3.1.13, 7] decan}-4-yl) phenyl phosphate(CSPD).
Here, we described how we used this technique to demonstrate the interaction between NLRP3 protein and its DNA binding site (Bruchard et al., 2015).
Keywords: Transcription factor DNA binding Chemiluminescent
Materials and Reagents
BL21 bacteria (DE3) (Thermo Fisher Scientific, InvitrogenTM)
pGEX-4T-1 vector (Addgene, catalog number: 27458001 )
GST fusion NLRP3 protein
Glutathione sepharose 4B (GE Healthcare, catalog number: 17-0756-01 )
Potassium chloride (KCl) (Sigma-Aldrich, catalog number: P9541 )
Sodium chloride (NaCl) (Sigma-Aldrich, catalog number: S7653 )
Ethylenediaminetetraacetic acid (EDTA), pH 8 (Sigma-Aldrich, catalog number: E9884 )
Dithiothreitol (DTT) (Sigma-Aldrich, catalog number: D0632 )
Glycerol (Sigma-Aldrich, catalog number: G5516 )
Triton X-100 (Sigma-Aldrich, catalog number: T9284 )
Double-stranded oligonucleotides containing the putative binding sequence (Life Technologies)
DIG gel shift kit (Roche Diagnostics, catalog number: 03353591910 )
Disodium 3-(4-methoxyspiro {1, 2-dioxetane-3, 2′-(5′-chloro) tricyclo [3.3.1.13,7] decan}-4-yl) phenyl phosphate (CSPD) (chemiluminescent substrate)
Note: It is included in DIG gel shift kit.
DNAse/RNase free water (Thermo Fisher Scientific, catalog number: 11538646 )
Tris-HCl (Sigma-Aldrich, catalog number: T5941 )
Binding buffer (see Recipes)
Washing buffer (see Recipes)
Maleic acid buffer (see Recipes)
10x blocking solution (see Recipes)
Detection buffer (see Recipes)
Equipment
End-over-end rotator
PerkinElmer Envision Plate Reader (PerkinElmer Inc., catalog number: 2104-0010A )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Végran, F., Bruchard, M., Derangère, V. and Ghiringhelli, F. (2016). Liquid Luminescent DNA-precipitation Assay. Bio-protocol 6(10): e1812. DOI: 10.21769/BioProtoc.1812.
Download Citation in RIS Format
Category
Cell Biology > Cell-based analysis > Protein-DNA interactions
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,813 | https://bio-protocol.org/exchange/protocoldetail?id=1813&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Preparation of Knockdown Transformants of Unicellular Charophycean Alga, Closterium peracerosum-strigosum-littorale Complex
JA Jun Abe
NH Naoko Hirano
AK Ayumi Komiya
NK Naho Kanda
AF Anri Fujiwara
SH Sachie Hori
YT Yuki Tsuchikane
HS Hiroyuki Sekimoto
Published: Vol 6, Iss 10, May 20, 2016
DOI: 10.21769/BioProtoc.1813 Views: 9013
Edited by: Maria Sinetova
Reviewed by: Christian Sailer
Original Research Article:
The authors used this protocol in Jul 2015
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jul 2015
Abstract
To prepare the knockdown transformants of the Closterium peracerosum-strigosum-littorale (C. psl.) complex, particle bombardment was applied with a newly constructed vector (pSA0104) with an endogenous constitutive promoter fused to a DNA fragment corresponding to an antisense strand of a target gene. Using a hygromycin resistance gene (aph7”), hygromycin-resistant colonies were selected. After the second screening, integration of the vector into the genome was checked by PCR and the knockdown effect was evaluated by Western blotting using a specific antibody against the target protein.
Keywords: Knockdown Alga Closterium Charophycean Transformation
Materials and Reagents
0.6 µm gold microcarriers (Bio-Rad Laboratories, catalog number: 165-2262 ) or 0.25 µm gold nanoparticle (BBI Solutions, catalog number: EMGC250 )
Cell culture dishes, 90 mm x 20 mm polystyrene (AGC TECHNO GLASS CO., catalog number: SH90-20 )
50 ml culture tube (Thomas Scientific, Labcon, catalog number: 3181-345-008 )
1.5 ml microtube (BMbio, catalog number: BM-15 )
Parafilm (VWR International, Bemis, catalog number: PM996 )
Micropore surgical tape (3M, catalog number: 1530-0 )
Qualitative filter paper No. 2 (Toyo Roshi Kaisha, Advantec, catalog number: 00021110 )
Test tube for incubation of transformant (AGC TECHNO GLASS CO., catalog number: TST-SCR16-150 )
pSA0104 Vector
Species: Heterothallic C. psl. complex strains [NIES-67 (mt+) and NIES-68 (mt-) (the National Institute for Environmental Studies)]
KOD-plus NEO DNA polymerase (TOYOBO CO., catalog number: KOD-401 )
KOD-FX DNA polymerase (TOYOBO CO., catalog number: KFX-101 )
GENEART seamless cloning and assembly kit (Thermo Fisher Scientific, InvitrogenTM, catalog number: A13288 )
High Pure Plasmid Isolation kit (Roche Diagnostics, catalog number: 11754785001 )
Spermidine (Wako Pure Chemical Industries, catalog number: 191-13831 )
Agar powder (Nacalai tesque, catalog number: 01028-85 )
Ethanol absolute (Wako Pure Chemical Industries, catalog number: 057-00451 )
Glycerol (Wako Pure Chemical Industries, catalog number: 075-00616 )
Quant-iT dsDNA Assay Kit, broad range (Thermo Fisher Scientific, InvitrogenTM, catalog number: Q-33130 )
Hygromycin B (Wako Pure Chemical Industries, catalog number: 085-06153 )
QuickExtract Plant DNA Extraction Solution (Epicentre, catalog number: QEP80705 )
Calcium nitrate tetrahydrate [Ca(NO3)2.4H2O] (Wako Pure Chemical Industries, catalog number: 039-00735 )
Potassium nitrate (KNO3) (Wako Pure Chemical Industries, catalog number: 160-04035 )
Disodium β-glycerophosphate pentahydrate (Sigma-Aldrich, catalog number: 50020-1000 G )
Magnesium sulfate heptahydrate (MgSO4.7H2O) (Nacalai tesque, catalog number: 21003-75 )
Vitamin B12 (Wako Pure Chemical Industries, catalog number: 226-00343 )
Biotin (Wako Pure Chemical Industries, catalog number: 023-08711 )
Thiamine HCl (Wako Pure Chemical Industries, catalog number: 201-00852 )
2-amino-2-hydroxymethyl-1, 3-propanediol (Wako Pure Chemical Industries, catalog number: 011-16381 )
Hydrochloric acid (HCl) (Nacalai tesque, catalog number: 18321-05 )
Na2EDTA.2H2O (Wako Pure Chemical Industries, catalog number: 345-01865 )
Iron(III) chloride hexahydrate (FeCl3.6H2O) (Wako Pure Chemical Industries, catalog number: 091-00872 )
Manganese(II) chloride tetrahydrate (MnCl2.4H2O) (Nacalai tesque, catalog number: 21211-45 )
Zinc sulfate heptahydrate (ZnSO4.7H2O) (Nacalai tesque, catalog number: 37011-62 )
CoCl2.6H2O (Wako Pure Chemical Industries, catalog number: 003-00368 )
Na2MoO4.2H2O (Wako Pure Chemical Industries, catalog number: 019-00247 )
Calcium chloride dihydrate (CaCl2.2H2O) (Wako Pure Chemical Industries, catalog number: 039-00431 )
C medium (see Recipes)
PIV metals (see Recipes)
Conditioned C medium (see Recipes)
MI medium (see Recipes)
Equipment
300 ml Erlenmeyer flask (AGC TECHNO GLASS CO., catalog number: 4980FK300 )
Growth chamber (Nippon Medical & Chemical Instruments, model: KCLP-1400II CT ), being discontinued
Handmade hemocytometer (1 x 1 mm, grid length x grid width) (not commercially available)
Thermal cycler (Thermo Fisher Scientific, Applied BiosystemsTM, model: veriti200)
Centrifuge (Hitachi Ltd., model: CF16RX )
Swing rotor (Hitachi Ltd., model: T5SS31 )
Angle rotor (Hitachi Ltd., model: T15AP31 )
Centrifuge (KUBOTA Corporation, model: 1920 ), being discontinued
Angle rotor (KUBOTA Corporation, model: RA-48J ), being discontinued
Cute mixer (EYELA, model: CM-1000 )
Qubit fluorometer (Thermo Fisher Scientific, InvitrogenTM, catalog number: Q32857 ), being discontinued
Ultrasonic cleaner (Sigma-Aldrich, Branson®, model: 3510J-DTH )
Gene transfer system (Tanaka co., model: IDERA GIE-III )
Fluorescence stereomicroscope LEICA MZ16 F (Leica Microsystems)
Micro Pick and Place System (Nepa Gene Co., catalog number: MPP-300 )
Light microscope (Olympus, model: CK-40 ), being discontinued
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Abe, J., Hirano, N., Komiya, A., Kanda, N., Fujiwara, A., Hori, S., Tsuchikane, Y. and Sekimoto, H. (2016). Preparation of Knockdown Transformants of Unicellular Charophycean Alga, Closterium peracerosum-strigosum-littorale Complex. Bio-protocol 6(10): e1813. DOI: 10.21769/BioProtoc.1813.
Download Citation in RIS Format
Category
Molecular Biology > DNA > Transformation
Plant Science > Phycology > DNA
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,814 | https://bio-protocol.org/exchange/protocoldetail?id=1814&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Reconstitution of Lymphopaenic Mice with Regulatory and Conventional T cell Subsets
Holly A. Bolton
Barbara Fazekas de St Groth
Published: Vol 6, Iss 10, May 20, 2016
DOI: 10.21769/BioProtoc.1814 Views: 8086
Edited by: Jia Li
Reviewed by: Mareta RusevaSabine Le Saux
Original Research Article:
The authors used this protocol in Sep 2015
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Sep 2015
Abstract
Transfer of mature T cells into immunodeficient mice results in sub-optimal reconstitution of the peripheral T cell pool. Under lymphopenic conditions, dendritic cells are released from tonic control by regulatory T cells (Tregs), and consequently drive activation and proliferation of low affinity T cells specific for endogenous antigens. This oligoclonal proliferation results in a T cell population dominated by T cells possessing an effector/memory phenotype and a limited TCR repertoire. Oligoclonal expansion can be prevented by selectively reconstituting the Treg compartment prior to T cell transfer (Bolton et al., 2015). Reconstitution of the Treg compartment of lymphopenic mice has been tested in immunodeficient mouse strains such as Rag-1-/-or Rag-2-/- mice, and in immunosufficient mice rendered transiently lymphopaenic by lethal whole body irradiation as conditioning for bone marrow transplantation (BMT). Transfer of purified Tregs into these hosts, combined with treatment with exogenous IL-2 for 7 days, is sufficient to reconstitute the Treg compartment and reduce expression of dendritic cell costimulatory molecules, a critical process in preventing inappropriate expansion of self-reactive T cells. T cells transferred after Treg reconstitution do not undergo rapid spontaneous proliferation, and instead undergo slow homeostatic division to repopulate the T cell pool with naive T cells, thus allowing optimal reconstitution of peripheral T cell pool.
Keywords: Lymphopenia Immune reconstitution T cell Regulatory T cell Animal model
Materials and Reagents
50 ml conical tube (Corning, Falcon®, catalog number: 352070 )
10 ml conical tube (SARSTEDT AG & Co, catalog number: 62.9924.272 )
70 µm nylon cell strainer (Corning, Falcon®, catalog number: 352350 )
1 ml syringe (BD, catalog number: 309659 )
25 gauge needle (BD, catalog number: 305125 )
1 ml insulin syringe with 29 G needle (BD, catalog number: 326719 )
225 cm tissue culture flasks (Sigma-Aldrich, catalog number: CLS431082 )
LD columns (Miltenyi Biotec, catalog number: 130-042-901 )
LS columns (Miltenyi Biotec, catalog number: 130-042-401 )
Vitamin K1, 10 mg/ml (International Animal Health Products, Koagulon)
PBS (10x, pH 7.4, without Ca2+ and Mg2+) (Mediatech Inc., catalog number: 46-013-CM )
Fetal bovine serum (FBS), heat-inactivated at 65 °C (Scientifix, catalog number: FBS-500S )
Bovine serum albumin (BSA) Fraction V (Amresco, catalog number: 0332-1 kg )
Ethylenediaminetetraacetic acid (EDTA) (Sigma-Aldrich, catalog number: E5134 )
RPMI-1640 (Thermo Fisher Scientific, GibcoTM, catalog number: 11875-093 )
Rat anti-mouse Thy1.2 clone 30H12 hybridoma supernatant (prepared in house)
Rat anti-mouse B220 clone RA3.6B2 hybridoma supernatant (prepared in house)
Rat anti-mouse CD8a clone 53-6.7 hybridoma supernatant (prepared in house)
Rat anti-mouse CD11b clone M1/70 hybridoma supernatant (prepared in house)
Rat anti-mouse erythroid lineage clone Ter119 hybridoma supernatant (prepared in house)
Anti-CD25 PE clone PC61 (BD Biosciences, catalog number: 553866 )
Anti-rat IgG microbeads (Miltenyi Biotec, catalog number: 130-048-501 )
Anti-PE microbeads (Miltenyi Biotec, catalog number: 130-048-801 )
Recombinant mouse IL-2 (Peprotech, catalog number: 212-12 )
Anti-IL-2 mAb clone JES6-1 (WEHI monoclonal antibody facility)
Sulfamethoxazole (400 mg/5 ml) and Trimethoprim (80 mg/5 ml) (Hospira, DBL, catalog number: 618670BAU )
MACS wash buffer (see Recipes)
MACS running buffer (see Recipes)
RPMI + 10% FBS (see Recipes)
IL-2/JES6-1 (see Recipes)
Preparation of hybridoma supernatants (see Recipes)
Equipment
Surgical scissors and forceps
80 gauge stainless steel mesh sieves
MACS MultiStand (Miltenyi Biotec, catalog number: 130-042-303 )
QuadroMACS separator (Miltenyi Biotec, catalog number: 130-090-976 ) or MidiMACS separator (Miltenyi Biotec, catalog number: 130-042-302 )
37 °C water bath
Benchtop centrifuge
Gammacell irradiator (Nordion), or equivalent
Heat lamp
Perspex mouse restrainer
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Bolton, H. A. and Groth, B. F. D. S. (2016). Reconstitution of Lymphopaenic Mice with Regulatory and Conventional T cell Subsets. Bio-protocol 6(10): e1814. DOI: 10.21769/BioProtoc.1814.
Download Citation in RIS Format
Category
Immunology > Animal model > Mouse
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,815 | https://bio-protocol.org/exchange/protocoldetail?id=1815&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Study of Epithelium Barrier Functions by Real-time TER Measurement
JM Jingjing Meng
SR Sabita Roy
Published: Vol 6, Iss 10, May 20, 2016
DOI: 10.21769/BioProtoc.1815 Views: 7678
Edited by: Ivan Zanoni
Original Research Article:
The authors used this protocol in Jun 2015
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jun 2015
Abstract
Transepithelial Electrical Resistance (TER) measurement is a reliable and efficient method to quantify the permeability of barrier forming cells such as epithelial cells. Measuring the permeability of the epithelial cells will help the researchers to investigate the barrier function of epithelium in various infectious and inflammatory diseases. Here we provide a real-time and impedance-based approach for measuring the permeability of epithelial cell monolayer using the Electrical Cell Substrate Impedance Sensing (ECIS®) instrumentation.
Keywords: ECIS Barrire Epithelium
Materials and Reagents
Epithelial cell lines (e.g., Caco-2, IEC-6, CMT-93 cell lines)
DMEM medium (Thermo Fisher Scientific, GibcoTM, catalog number: 11965-092 )
Fetal bovine serum (FBS) (Thermo Fisher Scientific, GibcoTM, catalog number: 10082147 )
Collagen (Type I, Rat tail) (Corning, catalog number: 354236 )
L-cysteine (Sigma-Aldrich, catalog number: C7352 )
Lipopolysaccharide from E. coli 0111:B4 (Sigma-Aldrich, catalog number: L4391 )
Saline (Sigma-Aldrich, catalog number: S8776 )
Note: It is also named as “Sodium chloride solution (0.9%)” on Sigma-Aldrich website.
Acetic acid (Sigma-Aldrich, catalog number: A6283 )
Penicillin-Streptomycin (Thermo Fisher Scientific, GibcoTM, catalog number: 15140122 )
Collagen solution (see Recipes)
Cysteine solution (see Recipes)
Cell culture medium (see Recipes)
Equipment
ECIS Zθ (Theta) and 16 W array station (Applied BioPhysics, http://www.biophysics.com/products-ecisz0.php)
8W10E+ Cultureware (Figure 1)
Figure 1. 8W10E+ Cultureware (Applied BioPhysics, http://www.biophysics.com/cultureware.php#link8)
Software
ECIS Zθ Software
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Meng, J. and Roy, S. (2016). Study of Epithelium Barrier Functions by Real-time TER Measurement. Bio-protocol 6(10): e1815. DOI: 10.21769/BioProtoc.1815.
Download Citation in RIS Format
Category
Immunology > Mucosal immunology > Epithelium
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,816 | https://bio-protocol.org/exchange/protocoldetail?id=1816&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Running Reward Conditioned Place Preference Task
Maria Fernanda A. Fernandes
SF Stephanie Fulton
Published: Vol 6, Iss 10, May 20, 2016
DOI: 10.21769/BioProtoc.1816 Views: 12777
Edited by: Masahiro Morita
Reviewed by: Shai BerlinAna Perez-Villalba
Original Research Article:
The authors used this protocol in Oct 2015
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Oct 2015
Abstract
The conditioned place preference (CPP) test is a standard pre-clinical behavioral tool used to study the motivational effects of drugs and non-drug treatments in experimental animals. The basic characteristic of this task involves the association of a particular environment and contextual cues with a reward stimulus, followed by the association of a different environment with the absence of the reward stimulus (Prus and Rosecrans, 2009). Besides the motor component, voluntary wheel running exercise also has a rewarding component, and has been suggested as a strong natural reinforcer. Consistent with this notion, rodents will readily begin to run when a wheel is introduced (Eikelboom and Mills, 1988; Looy and Eikelboom, 1989), will work by lever pressing to gain access to a running wheel (Pierce et al., 1986), and spend more time in a place previously associated with the aftereffects of running (Lett et al., 2000; Lett et al., 2001). More recently, we underscored an important role for the adipocyte-derived hormone leptin in midbrain dopamine neurons in the modulation of running reward (Fernandes et al., 2015). Here, we describe a CPP protocol to measure the rewarding aftereffects of wheel running exercise in mice.
Keywords: Physical activity Motivation Behavior Animal model Wheel running
Materials and Reagents
Animals
Floxed Stat3 mice (C57Bl6 background) [Osaka, Japan (Takeda et al., 1998)]
Note: All experiments were carried out in accordance with the guidelines and approval of the Institutional Animal Care Committee of the CHUM Research Center. Floxed Stat3 mice (C57Bl6 background) in which loxP sites flank exon 22 of the Stat3 gene that encodes a tyrosine residue (tyr705) essential for Stat3 activation, were graciously provided by Dr. Shizuo Akira [Osaka, Japan (Takeda et al., 1998)]. Female mice homozygous for the floxed Stat3 allele were crossed with male mice heterozygous for the floxed Stat3 allele and heterozygous for the DAT-Cre transgene [B6.SJL-Slc6a3tm1.1(cre)Bkmn/J] (Backman et al., 2006) to generate DAT-Cre-Stat3fl/fl mice and littermate controls (Stat3fl/fl or Stat3fl). Male mice were weaned at P28 and housed in a temperature and humidity controlled room that was maintained on a 12:12 hour reverse light/dark cycle. CPP experiment (pre-test, conditioning trials and post-test) was conducted in the dark phase of the cycle.
Equipment
Low-profile wireless running wheel for mouse (Med Associates Inc., catalog number: ENV-044 )
Three-compartment automated mouse CPP chambers (Med Associates Inc., catalog number: ENV-3013 )
Software
Wheel Manager software (Med Associates Inc., catalog number: SOF-860)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Fernandes, M. F. A. and Fulton, S. (2016). Running Reward Conditioned Place Preference Task. Bio-protocol 6(10): e1816. DOI: 10.21769/BioProtoc.1816.
Download Citation in RIS Format
Category
Neuroscience > Behavioral neuroscience > Animal model
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,817 | https://bio-protocol.org/exchange/protocoldetail?id=1817&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Extraction and Quantification of Sphingosine 1-Phosphate (S1P)
Christina-Maria Reimann
Markus H. Gräler
Published: Vol 6, Iss 10, May 20, 2016
DOI: 10.21769/BioProtoc.1817 Views: 9187
Edited by: Ivan Zanoni
Reviewed by: Yang Fu
Original Research Article:
The authors used this protocol in Aug 2015
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Aug 2015
Abstract
Sphingosine 1-phosphate (S1P) is a lipid metabolite and signaling molecule involved in many different physiological processes including lymphocyte circulation, T cell differentiation, antigen presentation, and maintenance of the vascular endothelial barrier. S1P is a ligand of five different G protein-coupled cell surface receptors designated S1P1-5. It has also been described as an intracellular second messenger. Quantification of S1P in biological samples is therefore an important task to decipher its signaling capabilities in vivo under physiological and pathophysiological conditions in different body fluids and organs. In this protocol, quantification of S1P is performed by liquid chromatography coupled to triple-quadrupole mass spectrometry (LC-MS/MS).
Keywords: Liquid chromatography Mass spectrometry Triple-quadrupole Sphingolipid Electrospray ionization
Materials and Reagents
Chloroform (CHCl3) (HPLC-Grade) (Carl Roth GmbH + Co., catalog number: 7331.1 )
Methanol (MeOH) (HPLC-Grade) (VWR International, catalog number: 20864.320 )
Formic acid (Carl Roth, catalog number: 4742.1 )
Sphingosine 1-phosphate (S1P) (Sigma-Aldrich, catalog number: S9666 )
C17-S1P (Avanti Polar Lipids, catalog number: 860641P )
Hydrochloric acid (HCl) (37%) (Carl Roth GmbH + Co., catalog number: 9277.1 )
Sodium chloride (NaCl) (Carl Roth GmbH + Co., catalog number: 3957.3 )
Potassium chloride (KCl) (Carl Roth GmbH + Co., catalog number: 6781.3 )
di-Sodium hydrogen phosphate dehydrate (Na2HPO4.2H2O) (Carl Roth GmbH + Co., catalog number: 4984.2 )
Potassium dihydrogen phosphate (KH2PO4) (Carl Roth GmbH + Co., catalog number: 3904.1 )
Phosphate-buffered saline (see Recipes)
Equipment
S1P extraction
VX-2500 vortexer (VWR International, catalog number: 58816-116 )
Pyrex® glass centrifuge vials (VWR International, catalog number: 734-4240 )
RVC 2-25 CD plus vacuum concentrator (Christ)
Autosampler vials (VWR International, catalog number: 548-0029 )
Note: It is also named “Short thread vials, ND9” on VWR International website.
Inserts for autosampler vials (VWR International, catalog number: 548-3006 )
Note: It is also named “Screw neck vials, ND10” on VWR International website.
Screw caps for autosampler vials (VWR International, catalog number: 548-0382 )
LC-MS/MS
Binary pump 1100 series HPLC system (Hewlett Packard/Agilent)
2 x 60 mm MultoHigh C18-RP column, 3 µm particle size (CS Chromatographie-Service GmbH, catalog number: 536201 )
2000 QTrap LC/MS/MS system (AB Sciex)
Software
Analyst 1.6.2 (AB Sciex)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Reimann, C. and Gräler, M. H. (2016). Extraction and Quantification of Sphingosine 1-Phosphate (S1P). Bio-protocol 6(10): e1817. DOI: 10.21769/BioProtoc.1817.
Download Citation in RIS Format
Category
Immunology > Immune cell function > General
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,818 | https://bio-protocol.org/exchange/protocoldetail?id=1818&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Nitrite Reduction Assay for Whole Pseudomonas Cells
MT Michael P. Thorgersen
Michael W. Adams
Published: Vol 6, Iss 10, May 20, 2016
DOI: 10.21769/BioProtoc.1818 Views: 11437
Edited by: Valentine V Trotter
Reviewed by: Geneviève Ball
Original Research Article:
The authors used this protocol in Aug 2015
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Aug 2015
Abstract
The second step of the dissimilatory denitrification pathway in which nitrite (NO2-) is converted to nitric oxide (NO) is catalyzed by the enzyme nitrite reductase. Two distinct enzymes are found in nature that catalyze this reaction, and they contain different metal sites, either iron (Fe), in the form of heme, or copper (Cu) (Zumft, 1997). The Pseudomonas stutzeri (P. stutzeri) RCH2 strain used in this assay contains both an Fe and a Cu form of nitrite reductase. In this assay, total nitrite reductase activity can be measured in whole cells using fumarate or some other carbon source as an electron source by measuring the disappearance of nitrite over time (Thorgersen et al., 2015).
Keywords: Nitrite reductase Pseudomonas Griess
Materials and Reagents
Borosilicate glass culture tubes, 16 x 125 mm (VWR International, catalog number: 47729-578 )
Hungate tubes (16 x 125 mm) with butyl rubber stopper (Bellco Glass, catalog number: 2047-16125 )
Pseudomonas cells
M9, minimal salts, 5x (Sigma-Aldrich, catalog number: M6030 )
Bacto yeast extract technical (BD Biosciences, catalog number: 288610 )
Potassium phosphate (dibasic, powder) (VWR International, J.T. Baker®, catalog number: 3252-05 )
Potassium phosphate (monobasic, crystal) (VWR International, J.T. Baker®, catalog number: 3246-05 )
Sodium fumarate dibasic (Sigma-Aldrich, catalog number: F1506 )
Sodium nitrate (VWR International, J.T. Baker®, catalog number: 3770-01 )
Sodium nitrite (VWR International, J.T. Baker®, catalog number: 3780-01 )
Griess reagent (Sigma-Aldrich, catalog number: G4410 )
High purity 100% argon gas (Airgas, catalog number: ARHP300 )
50 mM potassium phosphate buffer (pH 7.0) (see Recipes)
Assay buffer (see Recipes)
Equipment
Allegra 25R centrifuge (Beckman Coulter)
Spectrophotometer (measuring absorption in the visible range)
Innova 4230 refrigerated incubator shaker (New Brunswick Scientific)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Thorgersen, M. P. and Adams, M. W. W. (2016). Nitrite Reduction Assay for Whole Pseudomonas Cells. Bio-protocol 6(10): e1818. DOI: 10.21769/BioProtoc.1818.
Download Citation in RIS Format
Category
Microbiology > Microbial biochemistry > Protein
Biochemistry > Protein > Activity
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,819 | https://bio-protocol.org/exchange/protocoldetail?id=1819&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Respiratory Syncytial Virus Infection in Mice and Detection of Viral Genomes in the Lung Using RT-qPCR
YS Yan Sun
CL Carolina B. López
Published: Vol 6, Iss 10, May 20, 2016
DOI: 10.21769/BioProtoc.1819 Views: 10189
Edited by: Yannick Debing
Reviewed by: Chang Ho LeeDavid Paul
Original Research Article:
The authors used this protocol in Sep 2015
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Sep 2015
Abstract
Respiratory syncytial virus (RSV) is a single-stranded negative sense RNA virus that belongs to the paramyxovirus family. RSV infections lead to a variety of clinical outcomes ranging from a mild “cold-like disease” to death. Infection is usually more severe in infants and the elderly. RSV is associated with the development and exacerbation of chronic lung conditions including asthma, and it is a major cause of hospitalizations in infants. Because of its clinical relevance, experimental animal models to study RSV in vivo are needed. The most common and accessible animal model in research laboratories is the mouse. However, commonly use RSV strains poorly establish infection in mice and thus titration of the virus from mouse lungs to confirm infection is not sensitive enough to detect early viral infection. Here we discuss in detail how to infect BALB/c mice with RSV and how to detect RSV genomes in the lung using reverse transcription quantitative PCR (RT-qPCR). This method allows detection of viral genomes as early as day 1 post-infection (shown in Figure 2), whereas traditional TCID50 fails to detect significant virus until after day 2 post-infection. Of note, despite of higher sensitivity, genome RT-qPCR only shows the production of viral genomes and thus positive results for this assay are not proof of production of infectious viral particles.
Keywords: Respiratory syncytial virus Respiratory infection Virus detection
Materials and Reagents
Vacuum-driven Sterilcup® 500 ml Millipore ExpressPLUS 0.22 μm PES (Merck Millipore Corporation, catalog number: SCGPU05RE )
FastPrep® tubes (MP Biomedicals, catalog number: 5076-400 )
¼” ceramic sphere (MP Biomedicals LLC, catalog number: 116540412 )
CryoTubesTM vials for freezing viruses (Thermo Fisher Scientific, catalog number: 377267 )
Surgical scissors (Roboz Surgical Instrument Co)
Tweezers (Roboz Surgical Instrument Co)
384-well PCR plate (VWR International, catalog number: 82051-470 )
PCR strip tubes, 0.2 ml (Bioexpress, catalog number: T-3035-2 )
0.22 μm filter used in the pipette aid (VWR International, catalog number: 28145-481)
BSL2 personal protective equipment (PPE)
Mice (Balb/c, 6-8 weeks old, gender-mixed) (Taconic)
Human RSV strain A2 (ATCC, catalog number: VR-1540 )
SYBR green master mix (Applied Biosystems, catalog number: 4368708 )
qPCR primer sets
Genes
Forward primer
Reverse primer
RSV g
5’AACATACCTGCCCAGAATC3’
5’GGTCTTGACTGTTGTAGATTGCA3’
Rsp11
5’CGTGACGAAGATGAAGATGC3’
5’ GCACATTGAATCGCACAGTC3’
α-tubulin
5’ TGCCTTTGTGCACTGGTATG3’
5’ CTGGAGCAGTTTGACGACAC3’
RSV genome RT primer: 5’GATAAATATAGGCATGGGGAAAGTG3’
TRIzol reagent (Thermo Fisher Scientific, AmbionTM, catalog number: 15596018 )
Chloroform (Sigma-Aldrich, catalog number: C2432-25 ml )
Isopropanol (Sigma-Aldrich, catalog number: 437522 )
Note: It is also named “2-propanol” on Sigma-Aldrich website.
Ultra-Pure nuclease-free water
SuperScript® III First-Strand Synthesis System (Thermo Fisher Scientific, InvitrogenTM, catalog number: 18080-051 )
High capacity RNA-to-cDNATM kit (Thermo Fisher Scientific, Applied BiosystemsTM, catalog number: 4387406 )
Ketamine (Henry Schein)
Xylazine (U.S. Food and Drug Administration, AnaSed, catalog number: 139-236 )
Phosphate buffered saline (PBS) (Thermo Fisher Scientific, GibcoTM, catalog number: 10010-023 )
Ketamine/Xylazine solution (see Recipes)
Primer preparation (see Recipes)
Equipment
Biosafety hood in biosafety level 2 facility
Applied Biosystem ViiATM 7 LightCycler (Life Technologies, catalog number: 4453536 )
Note: Currently, it is “Thermo Fisher Scientific, catalog number: 4453536”.
Eppendorf centrifuge 5415R (Eppendorf AG, catalog number: 22636570 )
Note: This product has been discontinued by Eppendorf AG.
NanoDrop 1000 spectrophotometer (Thermo Fisher Scientific, catalog number: ND-1000 )
BioRad C1000 thermal cycler (Bio-Rad Laboratories, catalog number: 1851148EDU )
MP Fastprep-24 homogenizer (MP Biomedicals, catalog number: 116004500 )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
How to cite： Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Sun, Y. and López, C. B. (2016). Respiratory Syncytial Virus Infection in Mice and Detection of Viral Genomes in the Lung Using RT-qPCR. Bio-protocol 6(10): e1819. DOI: 10.21769/BioProtoc.1819.
Sun, Y., Jain, D., Koziol-White, C. J., Genoyer, E., Gilbert, M., Tapia, K., Panettieri, R. A., Jr., Hodinka, R. L. and Lopez, C. B. (2015). Immunostimulatory defective viral genomes from respiratory syncytial virus promote a strong innate antiviral response during infection in mice and humans. PLoS Pathog 11(9): e1005122.
Download Citation in RIS Format
Category
Microbiology > in vivo model > Viruses
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
182 | https://bio-protocol.org/exchange/protocoldetail?id=182&type=1 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Genotyping for Single Zebrafish (Fin Clip) or Zebrafish Embryo
LJ Lili Jing
Published: Feb 5, 2012
DOI: 10.21769/BioProtoc.182 Views: 28444
Download PDF
Ask a question
Favorite
Cited by
Abstract
Zebrafish is increasingly used a genetic model organism in biomedical studies. This protocol provides a detailed procedure about the identification of the genotype of an adult zebrafish or a zebrafish embryo.
Materials and Reagents
Tricane (Sigma-Aldrich, catalog number: 886-86-2 )
dNTPS (QIAGEN, catalog number: 201900 )
Proteinase K (Roche Diagnostics, catalog number: 03115836001 )
MEOH
DNA polymerase
MgCl2
Tris
KCl
MgCl2
Gelatine
BSA
NP40
Tween 20
PCR lysis buffer (see Recipes)
RAPD+ (see Recipes)
1x RAPD buffer (see Recipes)
2x RAPD+ buffer (see Recipes)
Tricane solution (see Recipes)
Equipment
Standard tabletop centrifuges
Incubator (55 °C and 65 °C)
PCR thermal cycler
96-well PCR plate
Razors
Plastic plates
Plastic beaker
Forceps
Spoon
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2012 The Authors; exclusive licensee Bio-protocol LLC.
Category
Molecular Biology > DNA > Genotyping
Molecular Biology > DNA > PCR
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,820 | https://bio-protocol.org/exchange/protocoldetail?id=1820&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Preparation of Respiratory Syncytial Virus with High or Low Content of Defective Viral Particles and Their Purification from Viral Stocks
YS Yan Sun
CL Carolina B. López
Published: Vol 6, Iss 10, May 20, 2016
DOI: 10.21769/BioProtoc.1820 Views: 17074
Edited by: Yannick Debing
Reviewed by: Chang Ho LeeDavid Paul
Original Research Article:
The authors used this protocol in Sep 2015
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Sep 2015
Abstract
Respiratory syncytial virus (RSV) belongs to the paramyxovirus family that includes many clinically relevant viruses, such as the human metapneumovirus and measles. RSV infection can cause severe disease in infants, the elderly, and some immunocompromised adults. During RSV replication, a series of truncated forms of the viral genome is generated. These truncated viral genomes are known as defective viral genomes (DVGs) and are generated by many viruses (Lazzarini et al., 1981; Rao and Huang, 1982; Prince et al., 1996; Sun et al., 2015; Tapia et al., 2013). DVGs can restrict the replication of the full-length virus and are the primary natural triggers of the innate immune response to RSV (Sun et al., 2015; Tapia et al., 2013). Here we discuss in detail how to prepare RSV stocks with a high or low content of DVGs, and how to purify defective viral particles containing DVGs from an RSV stock enriched in defective viral particles. These procedures are useful for the preparation of viral stocks and defective viral particles necessary for laboratory research. In brief, the different RSV stocks are produced in HEp2 cells, which are commonly used to amplify this virus in the laboratory. To generate an RSV stock with a high content of DVGs, HEp2 cells are sequentially infected with a high multiplicity of infection (MOI) multiple times followed by purification of the viral particles containing DVGs using gradient centrifugation. The procedure describe here has four parts: 1. Amplification of seed RSV stock with a low DVG content (RSV-LD), 2. Generation of a stock with a high DVG content (RSV-HD), 3. Purification of DVGs by gradient centrifugation, 4. Characterization of purified DVGs.
Keywords: Respiratory syncytial virus Defective viral genomes Defective viral particles DVGs RSV preparation
Materials and Reagents
Sterile polypropylene conical 15 and 50 ml tubes (BD, Falcon®, catalog number: 352070 , or equivalent)
Note: Currently, it is “Corning, Falcon®, catalog number: 352070 ”.
Disposable cell scraper (Thermo Fisher Scientific, catalog number: 08-100-241 )
Sterile screw-cap microtubes, 2 ml (SARSTEDT AG & Co., catalog number: 15071353 )
Sterile, aerosol-resistant micropipette tips (1-1,000 μl capacity) (Eppendorf AG or equivalent)
Cotton-plugged, sterile serological pipettes (1-25 ml capacity) (Eppendorf AG or equivalent)
Straight-neck polystyrene tissue culture flasks with vented caps, 75 cm2 (Bioexpress, catalog number: T-3001-2 ) and 225 cm2 (BD, FalconTM, catalog number: 353139 )
Note: Currently, it is “Corning, Falcon®, catalog number: 353139”.
Polystyrene tissue culture plates with lids 12 (Greiner Bio-One GmbH, catalog number: 665180 ) and 96 (Greiner Bio-One GmbH, catalog number: 655086 )
0.22 μm filter for pipette aid (VWR International, catalog number: 28145-481 )
Vacuum-driven Stericup® 500 ml Millipore ExpressPLUS 0.22 μm PES (Merck Millipore Corporation, model: SCGPU05RE )
Ultra-centrifuge tubes
Ultra-ClearTM centrifuge tube, 14 x 89 mm (Beckman Coulter, catalog number: 344059 )
Ultra-ClearTM centrifuge tube, 25 x 89 mm (Beckman Coulter, catalog number: 344058 )
HEp2 cells (ATCC, catalog number: CCL-23 )
Human RSV strain A2 (ATCC, catalog number: VR-1540 )
Mycoplasma removal agent (MP BioMedical, catalog number: 093050044-5 ml )
Dulbecco’s modified eagle medium (DMEM) (Life Technologies, catalog number: 11995073 )
Note: Currently, it is “Thermo Fisher Scientific, GibcoTM, catalog number: 11995073”.
UltraPureTM EDTA (0.5 M) (Gibco, catalog number: 15575 )
Note: Currently, it is “Thermo Fisher Scientific, InvitrogenTM, catalog number: 15575”.
Trypsin-EDTA, 0.25% (wt/vol) (Thermo Fisher Scientific, GibcoTM, catalog number: 25300054 )
Fetal bovine serum (FBS), heat-inactivated at 56 °C for 30 min (Thermo Fisher Scientific, catalog number: 10082-147 )
Note: Aliquots should be stored at -20 °C and thawed before use.
Gentamicin reagent solution (Thermo Fisher Scientific, GibcoTM, catalog number: 15750-060 )
Sodium pyruvate solution (Thermo Fisher Scientific, InvitrogenTM, catalog number: 11360070 )
L-glutamine (Thermo Fisher Scientific, InvitrogenTM, catalog number: 25030-081 )
Hanks’ balanced salt solution (HBSS) (Thermo Fisher Scientific, GibcoTM, catalog number: 14025-092 )
Phosphate-buffered saline (PBS) (pH 7.4) (Thermo Fisher Scientific, GibcoTM, catalog number: 10010056 )
Ethanol (Thermo Fisher Scientific, DeconTM, catalog number: 64-17-5 )
Methanol (HPLC) (Thermo Fisher Scientific, Fisher Scientific, catalog number: A452 )
Crystal violet (Thermo Fisher Scientific, catalog number: C581 )
Dry ice
Thermo ScientificTM GeneRulerTM 100 bp Plus DNA Ladder 100 to 3,000 bp (Thermo Fisher Scientific, catalog number: FERSM0322 )
Electrophoresis, loading dyes, Thermo Scientific, 6x DNA loading dye (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: R0611 )
UltraPure agarose (Thermo Fisher Scientific, InvitrogenTM, catalog number: 16500-500 )
Tris-acetate-EDTA (TAE), 10x (Thermo Fisher Scientific, InvitrogenTM, catalog number: 15558026 )
D-sucrose (Sigma-Aldrich, catalog number: BP220 )
Note: Currently, it is “Thermo Fisher Scientific, catalog number: BP220”.
Gelatin, from bovine skin (Sigma-Aldrich, catalog number: G9391 )
Superscript® III first-strand synthesis system (Thermo Fisher Scientific, InvitrogenTM, catalog number: 18080-051 )
Platinum Taq DNA polymerase (Thermo Fisher Scientific, InvitrogenTM, catalog number: 10966018 )
TRIzol reagent (Thermo Fisher Scientific, AmbionTM, catalog number: 15596018 )
dNTP set (100 mM) (Thermo Fisher Scientific, InvitrogenTM, catalog number: 10297117 )
PierceTM coomassie plus (Bradford) protein assay (Thermo Fisher Scientific, catalog number: 23236 )
RT-PCR primers
DI1 primer: 5’-CTTAGGTAAGGATATGTAGATTCTACC-3’
gRSV/DI primer: 5’-CCTCCAAGATTAAAATGATAACTTTAGG-3’
Regular tissue culture medium (TCM) (see Recipes)
Infection medium (see Recipes)
PNE buffer (see Recipes)
20% sucrose (see Recipes)
0.1% Gelatin in PBS (see Recipes)
1% crystal violet stock solution (see Recipes)
Crystal violet working solution (see Recipes)
Equipment
Class II biological safety cabinets
Approved BSL-2 or enhanced BSL-2 laboratory facilities
Personal protective equipment (PPE)
Spray bottles for 70% (vol/vol) ethanol
Micropipettes (1-1,000 μl capacity), multiple channel pipettes (1-200 μl capacity)
Pipette controller (VWR International)
Vortex mixer (Thermo Fisher Scientific)
Water bath, 37 °C (Thermo Fisher Scientific)
Refrigerated table-top centrifuge (for 15 ml and 50 ml conical tubes) (Eppendorf AG, model: 5810R )
OptimaTM L-90K ultracentrifuge (Beckman Coulter, catalog number: 365670 )
SW 32 Ti rotor package, swinging bucket (fit for 25 x 89 mm tube) (Beckman Coulter, catalog number: 369694 )
SW 41 Ti rotor package, swinging bucket (fit for 14 x 89 mm tube) (Beckman Coulter, catalog number: 331362 )
Gradient Master (BioComp Instruments Inc., catalog number: 107-201M )
Freezers and refrigerators: -80 °C, -20 °C, and 4 °C
Tissue culture incubator (37 °C, 5-7% CO2) (Thermo Fisher Scientific)
Cell counter
Cell culture microscope (Nikon Corporation or equivalent)
Microwave
Glass Erlenmeyer flask (500 ml)
Agarose gel casting tray (Thermo Fisher Scientific)
Electrophoresis chamber (Thermo Fisher Scientific)
Power supply (Thermo Fisher Scientific)
UV light box (Thermo Fisher Scientific)
Gel DocTM XR+ gel imaging system (Bio-Rad Laboratories)
NanoDrop 1000 spectrophotometer (Thermo Fisher Scientific)
VariokanTM Flash Multimode Reader (Thermo Fisher Scientific)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
How to cite： Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Sun, Y. and López, C. B. (2016). Preparation of Respiratory Syncytial Virus with High or Low Content of Defective Viral Particles and Their Purification from Viral Stocks. Bio-protocol 6(10): e1820. DOI: 10.21769/BioProtoc.1820.
Sun, Y., Jain, D., Koziol-White, C. J., Genoyer, E., Gilbert, M., Tapia, K., Panettieri, R. A., Hodinka, R. L. and Lopez, C. B. (2015). Immunostimulatory Defective Viral Genomes from Respiratory Syncytial Virus Promote a Strong Innate Antiviral Response during Infection in Mice and Humans. Plos Pathogens 11(9).
Download Citation in RIS Format
Category
Microbiology > Microbial biochemistry > Protein
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,821 | https://bio-protocol.org/exchange/protocoldetail?id=1821&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Sensitive Assessment of Hippocampal Learning Using Temporally Dissociated Passive Avoidance Task
Andrew L. Eagle
Hongbing Wang
AR Alfred J. Robison
Published: Vol 6, Iss 11, Jun 5, 2016
DOI: 10.21769/BioProtoc.1821 Views: 8102
Edited by: Soyun Kim
Reviewed by: Adler R. DillmanXi Feng
Original Research Article:
The authors used this protocol in Oct 2015
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Oct 2015
Abstract
The temporally dissociated passive avoidance (TDPA) paradigm is a variant of passive avoidance testing, and allows for more sensitive investigation of mild impairments in avoidance learning. Passive avoidance learning measures the latency to enter a “dark” context in which an aversive stimulus (foot shock) has been previously experienced using a light-dark box paradigm. Briefly, the animal is placed into the light side of the box and the time spent to cross into the dark side is measured. After entry into the dark chamber, the animal receives a mild (0.4-1.6 mA) footshock and is removed from the box. After a period of time, typically 24 h (note that this is entirely dependent on whether various levels of memory retention, e.g., short or long, are being measured), the animal is placed back into the box and cross-over latency is measured. Passive avoidance is learned after one trial and results in a robust increase in crossover latency. This behavior requires the association between a normally neutral environment and an aversive stimulus, and is dependent on hippocampal function (Stubley-Weatherly et al., 1996; Impey et al., 1998). TDPA extends this learning across multiple once-daily trials, producing a more graded and malleable latency score, and thus allows a more sensitive evaluation of changes in hippocampal function The task remains dependent on an intact hippocampus (Zhang et al., 2008), and subtle changes in hippocampal gene expression can result in robust alterations in TDPA latency scores (Eagle et al., 2015). We describe here a common method used to assess TDPA learning in mice.
Keywords: Memory Fear Hippocampus Mouse Behavior
Materials and Reagents
Adult (7 weeks or older) mice (C57BL/6J) (the Jackson laboratory)
Note: C57BL/6J mice are typical, though alternate strains and ages of mice may also be used. Mice are housed singly or in groups of 4-5 per cage. Conditions should comply with the Guide for the Care and Use of Laboratory Animals, 8th ed. (https://grants.nih.gov/grants/olaw/Guide-for-the-Care-and-use-of-laboratory-animals.pdf). See Animals considerations in Notes for more details.
Ethanol (70% volume/volume) diluted in distilled water
Equipment
Light-dark box (14 in. W x 7 in. D x 12 in. H) equipped with overhead houselight (light side only), guillotine-style door, drop pan, and shock-capable grid flooring (Coulbourn Instruments, model: H10-11M-PA )
Precision animal shocker (Coulbourn Instruments, model: H13-15 ) and cable
Video camera, IR-capable (Panasonic Corporation of North America, model: WV-CP304 ), mounted in front of box with side-view of light chamber and door
Timer
Sound-attenuating cubicle, as needed
Note: For example, Coulbourn Instruments provides a range of isolation cubicles in different sizes (H10-24 series) that are suitable for the needs of this experiment.
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
How to cite： Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Eagle, A. L., Wang, H. and Robison, A. J. (2016). Sensitive Assessment of Hippocampal Learning Using Temporally Dissociated Passive Avoidance Task. Bio-protocol 6(11): e1821. DOI: 10.21769/BioProtoc.1821.
Eagle, A. L., Gajewski, P. A., Yang, M., Kechner, M. E., Al Masraf, B. S., Kennedy, P. J., Wang, H., Mazei-Robison, M. S. and Robison, A. J. (2015). Experience-dependent induction of hippocampal DeltaFosB controls learning. J Neurosci 35(40): 13773-13783.
Download Citation in RIS Format
Category
Neuroscience > Behavioral neuroscience > Learning and memory
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,822 | https://bio-protocol.org/exchange/protocoldetail?id=1822&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Sucrose Preference Test to Measure Stress-induced Anhedonia
Andrew L. Eagle
Michelle Mazei-Robison
AR Alfred J. Robison
Published: Vol 6, Iss 11, Jun 5, 2016
DOI: 10.21769/BioProtoc.1822 Views: 32209
Edited by: Soyun Kim
Reviewed by: Adler R. DillmanXi Feng
Original Research Article:
The authors used this protocol in Oct 2015
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Oct 2015
Abstract
The 2-bottle choice procedure for assessing sucrose preference is a useful test to investigate anhedonia (i.e., inability to feel pleasure) in laboratory rodents, particularly in stress-based models of depression. The 2-bottle choice procedure allows for a comparison between behavioral preference for sucrose solution in drinking water compared to water only. Preference is measured by volume and/or weight of liquid consumed daily, which is then converted to a percent preference compared to a water only baseline period. Sucrose preference is attenuated by a diversity of chronic stressors, including chronic mild and unpredictable stress (Willner et al., 1992; Willner, 1997; Pothion et al., 2004) and social defeat stress (Krishnan et al., 2007). It may also be susceptible to perturbation in mouse models of drug addiction because sucrose preference is altered in drug-dependent individuals (Kampov-Polevoy et al., 1997; Bogucka-Bonikowska et al., 2002; Janowsky et al., 2003). Both stress- and drug-induced alterations in sucrose preference may stem from maladaptations in the reward pathway, which consists of the dopaminergic neurons extending from the ventral tegmental area to the nucleus accumbens (NAc). Indeed, alterations in cyclic-AMP response element binding protein (CREB) activity in NAc underlie preference for sucrose (Barrot et al., 2002). Additionally, the transcription factor ΔFosB in NAc (Wallace et al., 2008), but not dorsal hippocampus (Eagle et al., 2015), regulates natural rewards, such as sucrose consumption. Therefore, the sucrose preference test described below provides a well-validated model to assess anhedonia and the function of specific brain regions and circuits.
Keywords: Anhedonia Reward Mouse Behavior Drinking
Materials and Reagents
Sipper caps, composed of 2.5 cm straight stainless steel sipper tubes (VWR International, catalog number: 10718-330 ) inserted into rubber stoppers (VWR International, catalog number: 59581-287 )
50 ml conical centrifuge tubes (VWR International, catalog number: 89039-656 )
Adult (7 weeks or older) mice (C57BL/6J) (The Jackson Laboratory)
Note: Alternate strains and ages of mice may also be used. Mice are housed singly, in an environment with controlled temperature (around 23 °C) and humidity under a 12-12 h light-dark cycle with food and water ad libitum. See Animal considerations in Notes for more details.
Sucrose (crystals)
Reverse osmosis (RO) filtered water
Note: Alternatively substitute with the mouse’s normal drinking water.
Equipment
Mouse caging
Polycarbonate tubs (Mouse Cage; 7 ½ in W x 11 ½ in L x 5 in H) (Ancare) with standard woodchip mouse bedding (NORTHEASTERN PRODUCTS CORP., Aspen Chip)
Note: Standard cage changes are allowed during the acclimation period (see below), however it is recommended to avoid cage changes during the period of data collection (Procedure steps 2-5) to prevent leakage. Leakage should be avoided to reduce undesired variability.
Stainless steel wire cage lid (Ancare, model: N10SSR Mouse Lid )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
How to cite： Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Eagle, A. L., Mazei-Robison, M. and Robison, A. J. (2016). Sucrose Preference Test to Measure Stress-induced Anhedonia. Bio-protocol 6(11): e1822. DOI: 10.21769/BioProtoc.1822.
Eagle, A. L., Gajewski, P. A., Yang, M., Kechner, M. E., Al Masraf, B. S., Kennedy, P. J., Wang, H., Mazei-Robison, M. S. and Robison, A. J. (2015). Experience-dependent induction of hippocampal DeltaFosB controls learning. J Neurosci 35(40): 13773-13783.
Download Citation in RIS Format
Category
Neuroscience > Behavioral neuroscience > Cognition
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,823 | https://bio-protocol.org/exchange/protocoldetail?id=1823&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Bioassays to Investigate the Effects of Insect Oviposition on a Plant’s Resistance to Herbivores
Michele Bandoly
Anke Steppuhn
Published: Vol 6, Iss 11, Jun 5, 2016
DOI: 10.21769/BioProtoc.1823 Views: 12235
Edited by: Marisa Rosa
Reviewed by: Jihyun Kim
Original Research Article:
The authors used this protocol in Aug 2015
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Aug 2015
Abstract
Plants respond to herbivory with diverse defence responses (Schoonhoven et al., 2005). Many herbivorous insects deposit their eggs on their host plants before their larvae start to feed. Thus, plants could use insect eggs as a signal to increase their resistance to herbivores. Here, we report experimental procedures to explore whether and how insect oviposition impacts on plant resistance against the feeding larvae. The described approach revealed that Nicotiana attenuata (N. attenuata) plants that were previously exposed to oviposition by lepidopteran moths respond to herbivory by generalist Spodoptera exigua (S. exigua) and specialist Manduca sexta (M. sexta) larvae with an increased induction of defence responses, which results in a decreased performance or immune state of the feeding larvae (Bandoly et al., 2015; Bandoly et al., 2016). Consequently, insect oviposition can prime feeding-induced plant defence (priming: an enhanced plant response to stress upon the experience of a prior stimulus; Hilker et al., 2015). Full-factorial experiments with standardised procedures for insect oviposition and larval herbivory allow to decipher the effect of the plant exposure to insect eggs on the larval performance, feeding damage and immune state as well as to discriminate egg-induced plant responses from egg-primed responses to larval feeding.
Materials and Reagents
Reaction tubes, 0.2 ml (e.g., Carl Roth GmbH + Co. KG, catalog number: H560.1 )
Reaction tubes, 1.5 ml or 2 ml (e.g., Carl Roth GmbH + Co. KG, catalog number: CK06.1 )
Nicotiana attenuata Torr. ex. Watson (Solanaceae), 4-5 weeks old (rosette stage)
Spodoptera exigua Hübner (Noctuidae, Lepidoptera) or Manduca sexta Linnaeus (Sphingidae, Lepidoptera)
Liquid nitrogen
Note: All materials and equipment used is rather general lab equipment or houseware and we just referred to example products we used.
Equipment
General equipment
A soft paint brush [e.g., Rotmarder 122A, size 2 (Habico, catalog number: 50122A10 )]
Featherweight forceps (e.g., Carl Roth GmbH + Co. KG, catalog number: AN00.1 )
Rearing boxes (e.g., 14 x 21 x 5 cm), lid with gauze (nylon mesh 0.12 mm width)
Precision balance (e.g., Sartorius AG, model: Sartorius MC210S )
Oviposition on plants
Flight cages [e.g., kweekkooi, 60 x 60 x 90 cm (Vermandel, catalog number: 80.304 ) or flexarium, 42 x 42 x 76 cm (Rolf C. Hagen Inc., Exo Terra, model: PT2552 )]
Note: Flight cages eventually with slots at the cage sides through which defined leaves can be exposed and that can be closed with small claw hair clips.
Hanging labels [e.g., Hängeetiketten, HERMA FACHSHOP, model: 6901 ]] or a thread
Headlamp (e.g., Petzl, model: PIXA® 3 )
Larval performance, feeding damage and haemolymph sampling
Vented clip cages [e.g., made of two dressing cups (e.g., Ø 7.03, 2.3 cm (KIV-KREIS, catalog number: 770405509 )) with polyurethane foam at the rims, the bottom of one cup is replaced by gauze (nylon mesh 0.12 mm width) and the cage can be closed with small claw hair clips]
Folding magnifier [e.g., TRIPLET 20x, 21 mm (Light In The Box Ltd., catalog number: 01239576 )]
Laboratory support stand with clamps
Whiteboard with reference areas (e.g., a laminated sheet of white paper with black squares of 1 x 1 cm)
Camera [e.g., Canon EOS 1200D (Canon Inc., model: Canon EOS 1200D ) with EFS 18-25 mm macro lenses (Canon Inc., model: Canon EF-S 18-55mm f/3.5-5.6 IS II)]
Standardised damage and harvest of leaf tissue for analyses of plant defence traits
Vacuum pump (e.g., Vacuubrand, model: PC 510 )
Teflon tube [e.g., outer Ø 1.6 mm (VWR International, catalog number: BOHLS1810-01 )]
Glass vial with rubber septum cap [e.g., 4 ml HPLC vial (Techlab, catalog number: FLK 101.243 and FLK 101.972 )]
Tracing/Pattern wheel (e.g., Nähmit, catalog number: 070210 )
10 µl pipette
Scalpel (e.g., Carl Roth GmbH + Co. KG, catalog number: X004.1 )
Dissecting forceps (e.g., Carl Roth GmbH + Co. KG, catalog number: 2690.1 )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Bandoly, M. and Steppuhn, A. (2016). Bioassays to Investigate the Effects of Insect Oviposition on a Plant’s Resistance to Herbivores. Bio-protocol 6(11): e1823. DOI: 10.21769/BioProtoc.1823.
Download Citation in RIS Format
Category
Plant Science > Plant physiology > Plant growth
Plant Science > Plant physiology > Biotic stress
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,824 | https://bio-protocol.org/exchange/protocoldetail?id=1824&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Isolating Taste Buds and Taste Cells from Vallate Papillae of C57BL/6J Mice for Detecting Transmitter Secretion
Anthony Y. Huang
SW Sandy Y. Wu
Published: Vol 6, Iss 11, Jun 5, 2016
DOI: 10.21769/BioProtoc.1824 Views: 8776
Edited by: Soyun Kim
Reviewed by: Renate WeizbauerGeoff Lau
Original Research Article:
The authors used this protocol in Sep 2015
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Sep 2015
Abstract
Mouse is a well-accepted model for studying taste bud function. Mice readily detect and respond to taste substances that humans consider to have sweet, bitter, salty, sour and umami taste qualities. A great deal of recent research on taste receptors is based on this species. Live mice are needed for these experiments because no alternative in vitro model incorporates all elements of taste transduction and peripheral signaling. The C57BL/6J strain was selected because these mice respond robustly to many taste stimuli and because of variety of transgenic animals, such as PLCβ2-GFP and GAD67-GFP, were derived from that strain. Prior analyses on behavior, nerve responses, cellular electrophysiology and molecular biology, all conducted on C57BL/6J mice will form a solid foundation for the proposed studies (Finger et al., 2005; Huang and Wu, 2015; Huang et al., 2007). Thus, freshly euthanized animals must be used as a source of taste buds from which we will isolate taste buds and taste cells.
Keywords: Taste bud Ca2+ imaging Biosensor Transmitter
Materials and Reagents
Fire-polished borosilicate glass micropipette (World Precision Instrument) with suction apparatus (Figure 1D)
Polyethylene tubing (BD, Intramedic™, model: PE#205 )
1 ml syringe (BD)
Caution: Pipette tip must be large enough to allow taste buds to easily pass through the opening (60~80 µm and 20~30 µm for taste buds and taste cells collection, respectively). However, a wide opening will result in a large volume of solution being drawn into the suction pipette.
Sylgard dish with dissecting pins (Figure 2A)
Eppendorf centrifuge tubes (1.5 ml)
35 mm culture dishes (Corning)
Plastic two-way valve of syringes (Figure 1D)
Cell-TAK cell and tissue adhesive (Corning) coated coverslip(s)
Caution: Apply a tiny drop of Cell-TAK onto the center of 12-mm coverslips. Wait until the droplet is completely dry. Use ethanol (75%) followed by nanopure UV water to rinse and clean coverslips.
C57BL/6J strain mice (the Jackson laboratory) (Figure 1A)
100% CO2
Nanopure UV water (Thermo Fisher Scientific)
Collagenase A (Roche Diagnostics, catalog number: 10103578001 )
Dispase II (Roche Diagnostics, catalog number: 04942078001 )
Elastase (Worthington Biochemical Corporation, catalog number: 2292 )
Trypsin inhibitor (Roche Diagnostics, catalog number: 10109886001 )
Calcium chloride (CaCl2) (Sigma-Aldrich, catalog number: C5670 )
HEPES (Sigma-Aldrich, catalog number: H4034 )
Potassium chloride (KCl) (Sigma-Aldrich, catalog number: P5405 )
Magnesium chloride (MgCl2) (Sigma-Aldrich, catalog number: M4880 )
Sodium chloride (NaCl) (Sigma-Aldrich, catalog number: S7653 )
Sodium bicarbonate (NaHCO3) (Sigma-Aldrich, catalog number: S6297 )
Sodium pyruvate (Sigma-Aldrich, catalog number: P5280 )
D-(+)-Glucose (Sigma-Aldrich, catalog number: G7021 )
BAPTA (EMD Millipore Corporation, Calbiochem, catalog number: 196418 )
Ethylene glycol-bis(2-aminoethylether)-N, N, N’, N’-tetraacetic acid (EGTA) (Sigma-Aldrich, catalog number: E0396 )
Enzyme mixture (see Recipes)
Tyrode’s buffer (see Recipes)
Ca2+/Mg2+-free Tyrode’s buffer (see Recipes)
Equipment
Olympus IX73 inverted fluorescence microscope (Olympus Imaging America Inc., Olympus Optical)
Stereo dissecting microscope (ZEISS, ZEISS Optical) (Figure 1C)
Fiber optical illuminator (Dolan-Jenner Industrial Inc.)
Compressed CO2 gas in the cylinder (Figure 1B)
Plastic chamber connecting with an ample length of vinyl tubing
XSE analytical balance (Mettler-Toledo International Inc.)
Single-sample micro osmometer (Advanced Instruments, model: 3320 )
Thermo Scientific benchtop pH meter (Thermo Fisher Scientific, Accumet™, model: XL15 )
Narishige microforge for fire polishing with tungsten filament, electrically heated (NARISHIGE Group, model: MF-900 )
Flaming/Brown glass micropipette puller (Sutter Instruments, model: P-1000 )
Recording/Perfusion chamber (Warner Instruments, model: RC-25 ) (Figure 2B)
Magnetic platform (PH4) for RC-25 recording chamber, and for mounting onto an Olympus IX73 microscope (Figure 2B)
Thermolyne stirrer (Thomas Scientific, model: Nuova II )
Spectrafuge 7M microcentrifuge (ReGen Lab Equipment, model: SKU: W095074 )
Eppendorf 5702 centrifuge (Thermo Fisher Scientific, Fisher ScientificTM, model: Eppendorf 5702 )
VWR vortex mixer for vortexing the enzyme mix (VWR International, model: MINI 230V )
Gilson pipettors (200 μl and 1 ml tips) (VWR International)
Sharp tweezers
Microsurgical scissors
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
How to cite： Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Huang, A. Y. and Wu, S. Y. (2016). Isolating Taste Buds and Taste Cells from Vallate Papillae of C57BL/6J Mice for Detecting Transmitter Secretion. Bio-protocol 6(11): e1824. DOI: 10.21769/BioProtoc.1824.
Huang, A. Y. and Wu, S. Y. (2015). Calcitonin gene-related peptide reduces taste-evoked ATP secretion from mouse taste buds. J Neurosci 35(37): 12714-12724.
Download Citation in RIS Format
Category
Cell Biology > Cell isolation and culture > Cell isolation
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,825 | https://bio-protocol.org/exchange/protocoldetail?id=1825&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
MNase Digestion for Nucleosome Mapping in Neurospora
CS Cigdem Sancar
GS Gencer Sancar
MB Michael Brunner
Published: Vol 6, Iss 11, Jun 5, 2016
DOI: 10.21769/BioProtoc.1825 Views: 9389
Edited by: Valentine V Trotter
Reviewed by: Emily CopeEmilia Krypotou
Original Research Article:
The authors used this protocol in Mar 2015
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Mar 2015
Abstract
Digestion of chromatin by micrococcal nuclease MNase followed by high throughput sequencing allows us to determine the location and occupancy of nucleosomes on the genome. Here in this protocol we have described optimized conditions of MNase digestion of filamentous fungus Neurospora crassa chromatin without a requirement of a nuclear fractionation step.
Keywords: Neurospora crassa Nucleosome occupancy MNase digestion
Materials and Reagents
Filter paper (VWR International, catalog number: 1001-090 )
D-(+)-glucose monohydrate (Sigma-Aldrich, catalog number: 49159 )
L-arginine-13C6,15N4 hydrochloride (Sigma-Aldrich, catalog number: 608033 )
1x Vogel’s salt (Vogel, 1956; Vogel, 1964)
D-biotin (Thermo Fisher Scientific, Molecular ProbesTM, catalog number: B1595 )
Sucrose (Sigma-Aldrich, catalog number: S0389 )
KCl (Thermo Fisher Scientific, AmbionTM, catalog number: AM9640G )
NaCl (Thermo Fisher Scientific, InvitrogenTM, catalog number: 24740011 )
Tris hydrochloride (Tris-HCl) (Sigma-Aldrich, catalog number: 10812846001 )
MgCl2 (Thermo Fisher Scientific, AmbionTM, catalog number: AM9530G )
Calcium chloride (CaCl2) (Sigma-Aldrich, catalog number: 793639-500G )
NP-40 (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 85124 )
Dithiothreitol (DTT) (Thermo Fisher Scientific, Thermo FisherTM, catalog number: 20290 )
Spermidine (Sigma-Aldrich, catalog number: S0266 )
HEPES (Sigma-Aldrich, catalog number: H4034 )
EGTA (Sigma-Aldrich, catalog number: E3889 )
Sodium dodecyl sulfate (SDS) (Sigma-Aldrich, catalog number: L3771 )
EDTA (Thermo Fisher Scientific, Thermo FisherTM, catalog number: 17892 )
Glycerol (Sigma-Aldrich, catalog number: G6279 )
Glycogen, molecular biology grade (Thermo Fisher Scientific, Thermo FisherTM, catalog number: R0561 )
Ethanol
Paraformaldehyde (Sigma-Aldrich, catalog number: P6148 )
Glycine (Thermo Fisher Scientific, InvitrogenTM, catalog number: 15527013 )
Nuclease free H2O (Thermo Fisher Scientific, Thermo FisherTM, catalog number: R0581 )
Liquid nitrogen
Agarose (Thermo Fisher Scientific, Fisher ScientificTM, catalog number: BP1356100 )
MNase (Sigma-Aldrich, catalog number: N3755-500 )
RNase cocktail enzyme mix (Thermo Fisher Scientific, InvitrogenTM, catalog number: AM2286 )
Proteinase K solution (Thermo Fisher Scientific, InvitrogenTM, catalog number: AM2548 )
Wizard® SV gel and PCR clean-up system (Promega Corporation, catalog number: A9281 )
EDTA-free protease inhibitor tablets (Roche Diagnostics, catalog number: 05892791001 )
C6H8O7
ZnSO4.7H2O
Fe(NH4)2(SO4)2.6H2O
CuSO4.5H2O
MnSO4.1H2O
H3BO3 (anhydrous)
Na2MoO4.2H2O
Chloroform
MilliQ water
Na3C6H5O7
KH2PO4
NH4NO3
MgSO4.7H2O
CaCl2.2H2O
Liquid medium (see Recipes)
Trace element solution (see Recipes)
50x Vogel’s salt (see Recipes)
Lysis buffer (see Recipes)
MNase resuspension buffer (see Recipes)
Stop buffer (see Recipes)
TE buffer (see Recipes)
Equipment
Centrifuge
Vortex
Mortar and pestle
Thermo-mixer (Eppendorf AG, model: Thermo-mixer R )
Buhner funnel (Thermo Fisher Scientific, Fisher ScientificTM, catalog number: FB966B )
Shaking incubator
Agarose gel electrophoresis
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Sancar, C., Sancar, G. and Brunner, M. (2016). MNase Digestion for Nucleosome Mapping in Neurospora. Bio-protocol 6(11): e1825. DOI: 10.21769/BioProtoc.1825.
Download Citation in RIS Format
Category
Microbiology > Microbial genetics > DNA
Microbiology > Microbial biochemistry > DNA
Molecular Biology > DNA > DNA-protein interaction
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,826 | https://bio-protocol.org/exchange/protocoldetail?id=1826&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Differential and Simultaneous Visualization of Cells and Airspaces in Plant Leaves
TK Takashi Kawase
SS Shigeo S. Sugano
TS Tomoo Shimada
IH Ikuko Hara-Nishimura
Published: Vol 6, Iss 11, Jun 5, 2016
DOI: 10.21769/BioProtoc.1826 Views: 8014
Edited by: Tie Liu
Original Research Article:
The authors used this protocol in Jan 2015
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jan 2015
Abstract
This protocol is to differentially and simultaneously visualize both cells and airspaces in intact leaves and to create 3D structures of cells and airspaces from confocal images using the software DSLT_Demo (https://github.com/nslab2000/DSLT). Leaves stained with Nile Red in silicone-oil solution provide red color to cell membranes and green color to airspaces filled with silicone oil solution. This method is applicable to any tissues (except for dry seeds) of various plants including Arabidopsis, Nicotiana, Lemna and moss, and applicable even to hard leaves of plants such as switchgrass and Cinnamomum. Repeated use of this method enables time-lapse imaging of leaves over days and weeks because both Nile Red and silicone oil are harmless to plant tissues.
Materials and Reagents
>100 ml container to hold the staining solution (see procedure A) during rotational incubation
An incubation container for staining (e.g., 1.5 ml micro tube, Petri dish)
Super frost slide glass (Matsunami Glass Ind., catalog number: S2441 )
NEO microscope coverslip, 24 x 32 mm (Matsunami Glass, catalog number: C024321 )
Parafilm M® (Bemis Company, Inc., catalog number: PM-996 )
Pipetman p200 or 1 ml disposable transfer pipette
Silicone oil (Shin-Etsu Chemical Co., catalog number: KF96L-1.0 cs or KF96L-1.5 cs )
Note: It is named “Dimethyl Silicone Fluid” on Shin-Etsu Chemical Co. website.
Nile Red (Invitrogen, catalog number: N-1142 )
Note: Currently, it is “Thermo Fisher Scientific, Molecular Probes™, catalog number: N-1142”.
Equipment
Tube rotator or shaker
Electronic scale
Confocal microscope (Carl Zeiss Microscopy, model: LSM-780) or fluorescence microscope (Carl Zeiss Microscopy, model: Axioskop2 plus)
Sonication bath (HONDA ELECTRONICS Co., model: W-113 )
Note: This is not absolutely necessary.
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Kawase, T., Sugano, S. S., Shimada, T. and Hara-Nishimura, I. (2016). Differential and Simultaneous Visualization of Cells and Airspaces in Plant Leaves. Bio-protocol 6(11): e1826. DOI: 10.21769/BioProtoc.1826.
Download Citation in RIS Format
Category
Plant Science > Plant physiology > Phenotyping
Cell Biology > Cell imaging > Confocal microscopy
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,827 | https://bio-protocol.org/exchange/protocoldetail?id=1827&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
In vitro mTORC1 Kinase Assay for Mammalian Cells Protocol
Kayleigh Margaret Dodd
AT Andrew Robert Tee
Published: Vol 6, Iss 11, Jun 5, 2016
DOI: 10.21769/BioProtoc.1827 Views: 12026
Edited by: HongLok Lung
Reviewed by: Shravani Mukherjee
Original Research Article:
The authors used this protocol in Apr 2015
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Apr 2015
Abstract
Historically, mechanistic target of rapamycin (mTOR) was purified from mammalian cells using mild nonionic detergents such as NP-40 and or Triton-X100 that resulted in dissociation of core regulatory components essential for its native kinase activity. Consequently, these older kinase assays required MnCl2 to artificially enhance the weak phosphotransfer activity observed (Bai et al., 2007; Kim et al., 2002). With the use of the zwitterionic detergent 3-[(3-Cholamidopropyl) dimethylammonio]-1-propanesulfonate (CHAPS), the mTOR complex 1 (mTORC1) containing Regulatory-associated protein of mTOR (Raptor) and Lst8 (also known as GbetaL) can be successfully purified as a complex. This in vitro kinase assay allows for purification of mTORC1 that resembles its physiological state and retains kinase activity under physiological MgCl2 concentrations (Sancak et al., 2007). The activity of mTORC1 can be further enhanced through the use of hyperactive mutations within the kinase domain of mTOR or inclusion of GTP-bound RAS enriched in brain (Rheb) that is supplemented into the in vitro kinase assays. Rheb is a small-G-protein that binds to and activates mTORC1 to phosphorylate downstream substrates, such as eukaryotic initiation factor 4E-BP1 (4E-BP1) (Burnett et al., 1998), ribosomal protein S6 kinase 1 (S6K1) (Kim et al., 2002), Signal transducer and activator of transcription 3 (STAT3) (Dodd et al., 2015), and proline-rich Akt substrate of 40 kDa (PRAS40) (Dunlop et al., 2009).
Materials and Reagents
HEK293E cells
Plasmids and vectors
HA-Raptor (Addgene, catalog number: 8513 )
myc-mTOR (Addgene, catalog number: 1861 )
Rheb (National Center for Biotechnology Information, Gene, catalog number: 6009 ) cloned into pDEST27 using the gateway cloning system in accordance with manufacturer protocol (Life Technologies, catalog number: 11812-013 )
Note: Currently, it is “Thermo Fisher Scientific, Invitrogen™, catalog number: 11812-013 ”.
GST-4E-BP1/pGEX vectors generated as previously described (Dunlop et al., 2009)
Antibodies
Clone 9E10 anti-Myc antibodies (Sigma-Aldrich, catalog number: M5546 )
Clone 9B11 anti-Myc antibodies (Cell Signaling Technology, catalog number: 2276 )
Anti-HA (Roche Diagnostics, catalog number: 11867431001 )
Anti-GST (Merck Millipore Corporation, catalog number: 05-782 )
Cell culture and transfection
Dulbecco’s modified eagle’s medium (DMEM)
10% foetal bovine serum (FBS), EU Approved (South American) (Thermo Fisher Scientific, GibcoTM, catalog number: 10270-106 )
Penicillin-streptomycin (Thermo Fisher Scientific, GibcoTM, catalog number: 15070-063 )
Note: HEK293E cells were cultured in DMEM supplemented with 10% FBS, 1 μg/ml penicillin and 1 µg/ml streptomycin.
Insulin (Sigma-Aldrich, catalog number: I9278 )
Rapamycin (EMD Millipore Corporation, catalog number: 553210 )
Chemicals of analytical grade
HEPES (Sigma-Aldrich, catalog number: H3375 )
EDTA (Sigma-Aldrich, catalog number: 431788 )
β-glycerophosphate (disodium salt, pentahydrate) (Sigma-Aldrich, catalog number: 50020 )
Sodium chloride (NaCl) (Sigma-Aldrich, catalog number: S7653 )
Magnesium chloride (MgCl2) (Sigma-Aldrich, catalog number: M8266 )
Adenine triphosphate (ATP) (Sigma-Aldrich, catalog number: A26209 )
Leupeptin (Sigma-Aldrich, catalog number: L5793 )
Antipain (Sigma-Aldrich, catalog number: 10791 )
Benzamidine (Sigma-Aldrich, catalog number: 12072 )
Pepstatin A (Sigma-Aldrich, catalog number: P5318 )
Sodium vanadate (Sigma-Aldrich, catalog number: 289361 )
Dithiothreitol (Sigma-Aldrich, catalog number: 43815 )
Phenylmethylsulfonyl fluoride (Sigma-Aldrich, catalog number: 78830 )
Wortmannin (Sigma-Aldrich, catalog number: W1628 )
3-[(3-Cholamidopropyl)dimethylammonio]-1-propanesulfonate hydrate (CHAPS) (Sigma-Aldrich, catalog number: 226947 )
mTOR lysis buffer (see Recipes)
Low salt mTOR wash buffer (see Recipes)
High salt mTOR wash buffer (see Recipes)
mTOR wash buffer (see Recipes)
3x mTOR kinase assay buffer (see Recipes)
Rheb lysis buffer (see Recipes)
Rheb storage buffer (see Recipes)
Phosphate buffered saline (see Recipes)
mTOR assay start buffer (see Recipes)
Protease inhibitors (see Recipes)
Equipment
Thermomixer heating block (Eppendorf AG, model: Eppendorf thermomixer® compact )
Refrigerated mini centrifuge (Thermo Fisher Scientific, Thermo Scientific™, model: Heraeus and Fresco 17 centrifuge )
StuartTM SB2 fixed speed rotator (Bibby Scientific Limited, Stuart Scientific)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Dodd, K. M. and Tee, A. R. (2016). In vitro mTORC1 Kinase Assay for Mammalian Cells Protocol. Bio-protocol 6(11): e1827. DOI: 10.21769/BioProtoc.1827.
Download Citation in RIS Format
Category
Cancer Biology > Cancer biochemistry > Protein
Biochemistry > Protein > Activity
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,828 | https://bio-protocol.org/exchange/protocoldetail?id=1828&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Hemagglutination Inhibition (HI) Assay of Influenza Viruses with Monoclonal Antibodies
YW Ying Wu*
MC MyungSam Cho*
DS David Shore*
MS Manki Song
JC JungAh Choi
TJ Tao Jiang
YD Yong-Qiang Deng
MB Melissa Bourgeois
LA Lynn Almli
HY Hua Yang
LC Li-Mei Chen
YS Yi Shi
JQ Jianxu Qi
AL An Li
KY Kye Sook Yi
MC MinSeok Chang
JB Jin Soo Bae
HL HyunJoo Lee
JS JiYoung Shin
JS James Stevens
SH SeoungSuh Hong
CQ Cheng-Feng Qin
GG George F. Gao
SC Shin Jae Chang
RD Ruben O. Donis
*Contributed equally to this work
Published: Vol 6, Iss 11, Jun 5, 2016
DOI: 10.21769/BioProtoc.1828 Views: 33314
Edited by: Ivan Zanoni
Reviewed by: Migla Miskinyte
Original Research Article:
The authors used this protocol in Aug 2015
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Aug 2015
Abstract
Heamagglutination is inhibited when antibodies are present because antibodies to the influenza virus will prevent attachment of the virus to red blood cells. The highest dilution of antibody that prevents hemagglutination is called the HI titer. Human monoclonal antibodies generated from single human B cells were tested to characterize their ability to inhibit hemagglutination against virus A/California/07/2009 (H1N1) and A/Brisbane/10/2007 (H3N2).
Keywords: Haemagglutination inhibition Influenza Antibody
Materials and Reagents
Materials
1.96 well microtiter plates (V bottom) (Corning, catalog number: 3897 )
2.Tips for multichannel pipette (Gilson, model: D10 , D200 and D1000 )
3.Centrifuge tubes (SARSTEDT AG & Co, catalog number: 72.690 )
Reagents
Viral antigen
H1N1
A/California/07/2009
H3N2
A/Brisbane/10/2007
Note: Viruses were amplified in embryonated eggs. Refer to Manual for the Laboratory Diagnosis and Virological Surveillance of Influenza, WHO.
Erythrocytes
Turkey red blood cells (RBCs)
Note: Both in-house RBCs and commercial RBCs are usable.
Antibody
Human monoclonal antibodies CT146, CT147, CT149, CT164 and CT166
Notes:
Maximum concentration of antibody is 20 μg/ml.
Expressed in CHO cells.
Purified according to manufacturer’s instruction [HiTrapTM MabSelect SuRe (GE Healthcare, catalog number: 11-0034-93 )].
Other reagents
Receptor destroying enzyme (RDE) (DENKA SEIKEN CO., catalog number: 370013 )
Phosphate buffered saline (1x PBS) (pH 7.2) (Sigma-Aldrich, catalog number: P4417 )
Physiological saline (0.85% NaCl) (Sigma-Aldrich, catalog number: S9888 )
Equipment
Hemocytometer (Hausser Scientific, catalog number: 1492 )
Multichannel pipette (Gilson, model: PIPETMAN Neo® Multichannel )
Centrifuge (Beckman Coulter, model: Allegra X-15R )
Water bath (JULABO GmbH, model: MB13 )
Inverted routine microscopy (Nikon Instruments Inc., model: TS-100 )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Wu, Y., Cho, M., Shore, D., Song, M., Choi, J., Jiang, T., Deng, Y., Bourgeois, M., Almli, L., Yang, H., Chen, L., Shi, Y., Qi, J., Li, A., Yi, K. S., Chang, M., Bae, J. S., Lee, H., Shin, J., Stevens, J., Hong, S., Qin, C., Gao, G. F., Chang, S. J. and Donis, R. O. (2016). Hemagglutination Inhibition (HI) Assay of Influenza Viruses with Monoclonal Antibodies. Bio-protocol 6(11): e1828. DOI: 10.21769/BioProtoc.1828.
Download Citation in RIS Format
Category
Immunology > Antibody analysis > Antibody function
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,829 | https://bio-protocol.org/exchange/protocoldetail?id=1829&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Micro Neutralization (MN) Assay of Influenza Viruses with Monoclonal Antibodies
YW Ying Wu*
MC MyungSam Cho*
DS David Shore*
MS Manki Song
JC JungAh Choi
TJ Tao Jiang
YD Yong-Qiang Deng
MB Melissa Bourgeois
LA Lynn Almli
HY Hua Yang
LC Li-Mei Chen
YS Yi Shi
JQ Jianxu Qi
AL An Li
KY Kye Sook Yi
MC MinSeok Chang
JB Jin Soo Bae
HL HyunJoo Lee
JS JiYoung Shin
JS James Stevens
SH SeoungSuh Hong
CQ Cheng-Feng Qin
GG George F. Gao
SC Shin Jae Chang
RD Ruben O. Donis
*Contributed equally to this work
Published: Vol 6, Iss 11, Jun 5, 2016
DOI: 10.21769/BioProtoc.1829 Views: 14761
Edited by: Ivan Zanoni
Reviewed by: Migla Miskinyte
Original Research Article:
The authors used this protocol in Aug 2015
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Aug 2015
Abstract
The human monoclonal antibodies generated from single human B cells were tested to characterize their ability to neutralize virus infectivity. The microneutralization assay is a highly sensitive and specific assay for detecting virus-specific neutralizing antibodies to influenza viruses. This protocol is to measure the ability of human monoclonal antibody to neutralize influenza virus by microneutralization assay.
Materials and Reagents
Materials
96 well microtiter plates (Corning, catalog number: 3595 )
Tips for multichannel pipette (Gilson, model: D10 , D200 and D1000 )
Centrifuge tubes (SARSTEDT AG & Co, catalog number: 72.690 )
Reagents
Viral antigen
Note: Viruses were amplified in embryonated eggs or Madin–Darby canine kidney (MDCK) cells. Refer to Manual for the laboratory diagnosis and virological surveillance of influenza, WHO.
H1N1
A/Ohio/83
A/Solomon Islands/2006
A/Ohio/07/2009
A/Texas/05/2009-RG15
A/Texas/18/2009-RG18
A/California/04/2009
H2N2
A/Ann Arbor/6/60 ca
H5N1
A/Vietnam/1203/04 (VNH5N1-PR8/CDC-RG)
A/Anhui/01/2005(H5N1)-PR-IBCDC-RG6
H9N2
A/ck/HK/G9/97(H9N2)/PR8-IBCDC-2
A/Green-winged teal/209/TX/2009
H3N2
A/Hong Kong/68
A/Philippines/2/1982
A/Beijing/353/89-X109-H3N2 PR8 reassortant
A/Beijing/32/92-R-H3N2 PR8 reassortant
A/Johannesburg/33/94 R-H3N2 PR8 reassortant
A/Nanchang/933/95
A/Sydney/5/97
A/Panama/2007/99
A/Wyoming/3/03.rg
A/Brisbane/10/07
H7N2
A/turkey/Virginia/2002(H7N2)/ PR8-IBCDC-5
H7N9
A/Anhui/1/2013
A/Shanghai/2/2013
Cells
Madin-Darby canine kidney (MDCK) cells (ATCC, catalog number: CCL-34 )
Neutralization antibody
Human monoclonal antibody, CT149 (Celltrion INC., South Korea) from convalescent patients infected with A(H1N1)pdm09
Media
DMEM (Invitrogen, catalog number: 11965-092 )
Note: Currently, it is “Thermo Fisher Scientific, Gibco™, catalog number: 11965-092”.
Fetal bovine serum (FBS) (VWR International, Hyclone™, catalog number: SH30070.03 )
Penicillin-streptomycin (Invitrogen, catalog number: 15140-122 )
Note: Currently, it is (Thermo Fisher Scientific, Gibco™, catalog number: 15140-122)”.
L-glutamine, 200 mM solution (Invitrogen, catalog number: 25030-081 )
Note: Currently, it is “Thermo Fisher Scientific, Gibco™, catalog number: 25030-081”.
Bovine serum albumin (BSA) (fraction V, protease free) (Roche Diagnostics, catalog number: 0 3117332001 )
HEPES, 1 M Buffer Solution (Invitrogen, catalog number: 15630-080 )
Note: Currently, it is (Thermo Fisher Scientific, Gibco™, catalog number: 15630-080)”.
Other reagents
a.Antibody for ELISA
Primary antibodies [Anti-nucleoprotein (NP) antibodies], Mouse Anti-Influenza A antibody (Merck Millipore Corporation, catalog number: MAB8257 ) and Anti-Influenza A antibody (Merck Millipore Corporation, catalog number: MAB8258 )
Secondary antibody, goat anti-mouse IgG conjugated to horseradish peroxidase (HRP) (Kirkegaard & Perry Laboratories, Inc., catalog number: 074-1802 )
b.Phosphate buffered saline (PBS) (Gibco, catalog number: 14190 )
c.Tween-20 (Merck Millipore Corporation, catalog number: 8.17072 )
d.Antibody diluent (Teknova, catalog number: D5120 )
e.Acetone (Sigma-Aldrich, catalog number: 270725 )
f.3, 3’, 5, 5’-Tetramethylbenzidine (TMB) (Sigma-Aldrich, catalog number: T0440 )
g.Stop solution (Merck Millipore Corporation, catalog number: 109072 )
Note: It is named “Sulfuric acid” on Merck Millipore Corporation website.
Wash buffer (see Recipes)
MDCK medium (see Recipes)
Virus diluent media (see Recipes)
Equipment
Haemacytometer (Hausser Scientific, catalog number: 1492 )
Multichannel pipette (Gilson, model: PIPETMAN Neo® Multichannel )
Incubator, 37 °C, 5% CO2 (Panasonic Corporation, Sanyo Electronics company, model: MCO-170AIC-PE )
SpectraMax M5 multi-detection microplate reader system (Molecular Devices, model: M5 )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Wu, Y., Cho, M., Shore, D., Song, M., Choi, J., Jiang, T., Deng, Y., Bourgeois, M., Almli, L., Yang, H., Chen, L., Shi, Y., Qi, J., Li, A., Yi, K. S., Chang, M., Bae, J. S., Lee, H., Shin, J., Stevens, J., Hong, S., Qin, C., Gao, G. F., Chang, S. J. and Donis, R. O. (2016). Micro Neutralization (MN) Assay of Influenza Viruses with Monoclonal Antibodies. Bio-protocol 6(11): e1829. DOI: 10.21769/BioProtoc.1829.
Download Citation in RIS Format
Category
Immunology > Antibody analysis > Antibody function
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
183 | https://bio-protocol.org/exchange/protocoldetail?id=183&type=1 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Flourescent Immunostaining Protocol for a-Bungorotoxin (AChRs) in Zebrafish
LJ Lili Jing
Published: Feb 20, 2012
DOI: 10.21769/BioProtoc.183 Views: 12994
Download PDF
Ask a question
How to cite
Favorite
Cited by
Abstract
Zebrafish embryo is convenient for studying neuromuscular system due to its transparency. This protocol is a rapid method to visualize the AChR clusters on the postsynaptic muscle membrane.
Materials and Reagents
Paraformaldehyde (USB Corporation, catalog number: 19943 )
Phosphate buffered saline (PBS)
DMSO
Triton-100
Na2HPO4
NaH2PO4
Collagenase (Sigma-Aldrich, catalog number: C-9891 )
α-Bungorotoxin conjugated to Alexa 594 (Life Technologies, Invitrogen™, catalog number: B-13423)
Vectashied (Vector Lab, catalog number: H-1400 )
Primary antibody
Secondary antibody
Incubation Buffer (IB) (see Recipes)
0.1 M phosphate buffer(7.4) (see Recipes)
Equipment
Rotator (Storvall Life Science, the Belly Dancer)
Fluorescence microscope
Transfer pipette
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2012 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Jing, L. (2012). Flourescent Immunostaining Protocol for a-Bungorotoxin (AChRs) in Zebrafish. Bio-101: e183. DOI: 10.21769/BioProtoc.183.
Download Citation in RIS Format
Category
Neuroscience > Development > Immunofluorescence
Biochemistry > Protein > Immunodetection > Immunostaining
Cell Biology > Cell imaging > Fluorescence
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,830 | https://bio-protocol.org/exchange/protocoldetail?id=1830&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
In vitro Tumor Cell Migration Assay Using ThinCertsTM (Transwells)
Marc A. Schneider
Published: Vol 6, Iss 11, Jun 5, 2016
DOI: 10.21769/BioProtoc.1830 Views: 17839
Edited by: Lee-Hwa Tai
Original Research Article:
The authors used this protocol in Aug 2015
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Aug 2015
Abstract
The high migration rate of tumor cells often results in poor prognosis for the survival of the patients. Here, we describe a protocol to measure the migration of cells using a quantitative assay. The relative tumor cell migration was measured using ThinCertsTM cell culture inserts and a lactate dehydrogenase (LDH) assay to quantify the relative cell number. The quantification of the migration with the LDH kit is much more precise than other methods using i.e. crystal blue to count the cells.
Keywords: Migration assay Transwells Tumor cells LDH assay
Materials and Reagents
12 well cell culture plate (Greiner Bio One International GmbH, catalog number: 665180 )
96 well tissue culture test plate (TPP Techno Plastic Products AG, catalog number: 92696 )
1.5 ml tubes (Carl Roth GmbH + Co., catalog number: 7080.1 )
ThinCertsTM cell culture inserts with a pore diameter of 8 µm (Greiner Bio-One GmbH, catalog number: 665638 )
Cover slips for haemocytometer (Carl Roth GmbH + Co., catalog number: L189.1 )
Filter tips (10 µl, 20 µl, 100 µl, 200 µl and 1,000 µl) (Carl Roth GmbH + Co., catalog number: 771288 , 774288 , 772288 , 739288 and 740288 )
Tumor cells (the lung cancer cell lines H1975 and 2106T)
Cell culture medium (cell line specific), with and without fetal bovine serum (FBS)
Heat-inactivated FBS (E.U.-approved, South America Origin) (Thermo Fischer Scientific, catalog number: 10500-064 )
1x Dulbecco’s phosphate-buffered saline (DPBS, no calcium, no magnesium) (Thermo Fischer Scientific, GibcoTM, catalog number: 14190-094 )
StemPro® Accutase® cell dissociation reagent (Thermo Fischer Scientific, GibcoTM, catalog number: A11105-01 )
Mitomycin C (AppliChem GmbH, catalog number: A2190,0002 )
Trypan blue solution (Sigma-Aldrich, catalog number: T8154 )
10x cell lysis buffer (Cell Signaling Technology, catalog number: 9803S )
Cytotoxicity detection kit (LDH) (Roche Diagnostics, catalog number: 11644793001 )
Equipment
CO2 cell incubator (Panasonic Corporation, Sanyo, model: SANYO-InCu saFe® )
Neubauer cell counting chamber (VWR International, catalog number: BRND717810 )
Microcentrifuge (Eppendorf AG, model: 5417R )
Vortex mixer (VWR International, catalog number: 444-1372 )
Versatile microplate absorbance reader (Tecan Trading AG, model: sunriseTM )
Gilson’s Pipetman classic pipettes ( P10 , P20 , P100 , P200 , P1000 )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Schneider, M. A. (2016). In vitro Tumor Cell Migration Assay Using ThinCertsTM (Transwells). Bio-protocol 6(11): e1830. DOI: 10.21769/BioProtoc.1830.
Download Citation in RIS Format
Category
Cancer Biology > Invasion & metastasis > Cell biology assays
Cancer Biology > Tumor immunology > Tumor microenvironment
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,831 | https://bio-protocol.org/exchange/protocoldetail?id=1831&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Development and Application of a Fully Blind Flexible Peptide-protein Docking Protocol, pepATTRACT
Christina EM Schindler
SV Sjoerd J. de Vries
Martin Zacharias
Published: Vol 6, Iss 11, Jun 5, 2016
DOI: 10.21769/BioProtoc.1831 Views: 7565
Edited by: Arsalan Daudi
Reviewed by: Prashanth SuravajhalaMichael Tscherner
Original Research Article:
The authors used this protocol in Aug 2015
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Aug 2015
Abstract
Peptide-mediated interactions are involved in many signaling and regulatory pathways as well as the DNA replication machinery and are linked to many pathological disorders. Many research groups are currently working towards a more detailed understanding of these important interactions by characterizing the 3D complex structures with experimental methods like X-ray crystallography and NMR. However, for a large number of peptide-protein complexes such atomistic structural information is lacking to date. Computational peptide docking methods can yield information complementary to experimental information by predicting the protein-peptide complex structure from the 3D structure of the protein and the peptide sequence. This approach can also be used to study interactions between folded and disordered proteins/protein regions (e.g., the interactions of the disordered regions in tumor suppressor p53 with its different partners). Here, we describe the development and usage of the fully blind, flexible peptide-protein docking protocol pepATTRACT. The ATTRACT docking engine is implemented as a suite of command line tools and options that can be combined at will. Therefore, ATTRACT protocols like pepATTRACT are typically invoked via a custom, hand-written shell script. Although this approach is very flexible, it limits the accessibility of ATTRACT to expert users only. To make pepATTRACT easily accessible to non-expert users, we created a web-interface which helps the user set up a peptide docking protocol by editing parameters in a web browser (www.attract.ph.tum.de/peptide.html). pepATTRACT docking scripts can then executed on the user's local machine, once the ATTRACT software has been installed. Here, we describe all the steps necessary for setting up a pepATTRACT docking run via the web-interface including installation of the ATTRACT software.
Keywords: Protein-peptide interaction Disordered protein binding Protein-peptide complex structure Peptide binding prediction Binding site prediction
Materials and Reagents
Atomic 3D structure of protein of interest in PDB file format (www.pdb.org)
Sequence of peptide of interest in one-letter code
Note: The protocol was tested on peptide lengths of up to 15 residues.
Optional: information on protein residues involved in binding (literature research)
Equipment
Any computer with Unix-based OS (Linux/Mac) and at least 2-3 GB RAM
Note: It should be sufficient to run the protocol.
Software
ATTRACT software
ATTRACT source code (available at www.attract.ph.tum.de/services/ATTRACT/attract.tgz)
ATTRACT virtual machine (VM) ( www.attract.ph.tum.de/services/ATTRACT/ATTRACT.vdi.gz)
Molecular viewer (PyMOL, VMD, Rasmol etc.)
VirtualBox (www.virtualbox.org)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Schindler, C. E., de Vries, S. J. and Zacharias, M. (2016). Development and Application of a Fully Blind Flexible Peptide-protein Docking Protocol, pepATTRACT. Bio-protocol 6(11): e1831. DOI: 10.21769/BioProtoc.1831.
Download Citation in RIS Format
Category
Biochemistry > Protein > Structure
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,832 | https://bio-protocol.org/exchange/protocoldetail?id=1832&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Preparation of Single Cell Suspensions from Mouse Aorta
Desheng Hu
CY Changjun Yin
Sarajo Mohanta
Christian Weber
AH Andreas J. R. Habenicht
Published: Vol 6, Iss 11, Jun 5, 2016
DOI: 10.21769/BioProtoc.1832 Views: 16943
Reviewed by: Ruth A. Franklin
Original Research Article:
The authors used this protocol in Jun 2015
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jun 2015
Abstract
Atherosclerosis is a chronic inflammatory disease of the arterial wall characterized by lipid deposition, plaque formation, and immune cell infiltration. Innate and adaptive immune cells infiltrate the artery during development of the disease. Moreover, advanced disease leads to formation of artery tertiary lymphoid organs in the adventitia (Grabner et al., 2009; Hu et al., 2015). Various and diverse types of immune cells have been identified in the aorta adventitia vs atherosclerotic plaques (Elewa et al., 2016; Galkina et al., 2006; Lotzer et al., 2010; Mohanta et al., 2016; Mohanta et al., 2014; Moos et al., 2005; Srikakulapu et al., 2016; Zhao et al., 2004). There are conflicting reports on the number and subtypes of immune cells in the aorta depending on the age of the animals, the protocol that is used to obtain single cell suspensions, and the dietary conditions of the mice (Campbell et al., 2012; Clement et al., 2015; Galkina et al., 2006; Kyaw et al., 2012). The number of immune cells in the aorta differs as much as tenfold using different protocols (Butcher et al., 2012; Galkina et al., 2006; Gjurich et al., 2015; Grabner et al., 2009; Hu et al., 2015). These discrepant results call for a protocol that robustly documents bona fide aorta cells rather than those in the surrounding tissues or blood. Critical methodological hurdles include the removal of adjacent adipose tissue and small paraaortic lymph nodes lining the entire aortic tree that are not visible by the naked eye. A dissection microscope is therefore recommended. Moreover protocols of aorta preparations should ascertain that lymphocyte aggregates referred to as fat associated lymphoid clusters (FALCs) (Benezech et al., 2015; Elewa et al., 2015) that are often present at the border between the adipose tissue and the adventitia are removed before enzyme digestion. We propose - besides other approaches (Hu et al., 2015; Mohanta et al., 2014) - a combination of immunohistochemical staining and fluorescence activated cell sorter (FACS) analyses from single cell suspensions to quantify the cells of interest. This protocol describes isolation of single cells from mouse aorta for FACS and other analysis.
Materials and Reagents
50 ml Falcon tube (VWR International, CellStar®, catalog number: 188271 )
100 µm cell strainer (BD, catalog number: 352360 )
Note: Currently, it is “Corning, Falcon®, catalog number: 352360”.
1 ml syringe (Henke-Sass, Wolf GmbH, Soft-JECT®, catalog number: 5010-200V0 )
5 ml syringe (BD, catalog number: 309646 )
Needle-26G (B. Braun Medical Inc., catalog number: 4657683 )
6-well plate (BD Falcon, catalog number: 353046 )
Note: Currently, it is “Corning, Falcon®, catalog number: 353046”.
1.5 ml Eppendorf tube (Eppendorf AG, catalog number: 0030123328 )
Trypan blue solution (Sigma-Aldrich, catalog number: 93595 )
Phosphate-buffered saline (PBS), pH 7.4 (Thermo Fisher Scientific, GibcoTM, catalog number: 10010023 )
Dulbecco’s phosphate-buffered saline (DPBS) (Thermo Fisher Scientific, GibcoTM, catalog number: 14040133 )
Fetal bovine serum (FBS) (PAN Biotech UK Ltd., catalog number: P30-1506 )
Ethylenediaminetetraacetic acid (EDTA) (Sigma-Aldrich, catalog number: E6758 )
Collagenase from Clostridium histolyticum, type I (Sigma-Aldrich, catalog number: C0130 )
Collagenase from Clostridium histolyticum, type XI (Sigma-Aldrich, catalog number: C7657 )
Hyaluronidase from bovine testes, type I-s (Sigma-Aldrich, catalog number: H3506 )
DNase I (Sigma-Aldrich, catalog number: 11284932001 )
4-(2-Hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES) (1 M) (Thermo Fisher Scientific, GibcoTM, catalog number: 15630106 )
Ethanol solution (Sigma-Aldrich, catalog number: 48075 )
Anti-mouse CD45 APC antibody (Thermo Fisher Scientific, eBioscience, catalog number: 17-0451-82 )
LIVE/DEAD® fixable blue dead cell stain kit (Invitrogen, catalog number: L23105 )
Note: Currently, it is “Thermo Fisher Scientific, Molecular ProbesTM, catalog number: L23105”.
Fc block (anti-CD16/32) (Thermo Fisher Scientific, eBioscience, catalog number: 16-0161-82 )
FACS buffer (see Recipes)
EDTA buffer (see Recipes)
Enzyme cocktail (see Recipes)
Equipment
Dissecting scissors (Fine Science Tools, catalog number: 91460-11 )
Curved forceps (Fine Science Tools, catalog number: 11073-10 )
CO2 supply machine (Next Advance, model: Quietek CO2 induction system )
Neubauer cell counting chamber (Marienfeld-Superior)
Microscope (Carl Zeiss Microscopy, model: Axiovert 40C )
Dissecting microscope equipped with cold light (Carl Zeiss Microscopy, model: Stemi2000 )
Water bath (Thomas Scientific, model: 1196x11 )
BD LSRFortessa (BD Bioscience)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Hu, D., Yin, C., Mohanta, S., Weber, C. and Habenicht, A. J. R. (2016). Preparation of Single Cell Suspensions from Mouse Aorta. Bio-protocol 6(11): e1832. DOI: 10.21769/BioProtoc.1832.
Download Citation in RIS Format
Category
Immunology > Immune cell isolation > Leukocyte
Cell Biology > Cell isolation and culture > Cell isolation
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,833 | https://bio-protocol.org/exchange/protocoldetail?id=1833&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Aorta Atherosclerosis Lesion Analysis in Hyperlipidemic Mice
Sarajo Mohanta
CY Changjun Yin
Christian Weber
Desheng Hu
AH Andreas J. R. Habenicht
Published: Vol 6, Iss 11, Jun 5, 2016
DOI: 10.21769/BioProtoc.1833 Views: 20827
Reviewed by: Ruth A. FranklinRakesh Bam
Original Research Article:
The authors used this protocol in Jun 2015
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jun 2015
Abstract
Atherosclerosis is a chronic inflammatory disease of large and medium-sized arteries. Apolipoprotein E-deficient (ApoE-/-) mice are used as experimental models to study human atherosclerosis. ApoE-/- mice are constitutively hyperlipidemic and develop intima plaques that resemble human plaques. Various issues including experimental design for lesion analysis, dietary conditions, isolation of the aorta, staining methods, morphometry, group size, age, the location within the arterial tree, and statistical analyses are important parameters that need to be addressed to obtain robust data. Here, we provide detailed methods to quantify aorta atherosclerosis.
Keywords: Atherosclerosis Lesion analysis Plaque Media Inflammation
Materials and Reagents
Petri dish sets, glass (VWR International, catalog number: 89000-306 )
Black dissection wax (CR Scientific, catalog number: C3541 )
Minutien pins (0.15 mm diameter) to fix the aorta (Fine Scientific Tools, catalog number: 26002-15 )
50 ml Falcon tube (VWR International, CellStar®, catalog number: 188271 )
10 ml syringe (BD, catalog number: 309695 )
20 ml syringe (BD, catalog number: 301625 )
Sterican single use needles-23G (B. Braun Medical Inc., catalog number: 4657640 )
Poly-L-lysine coated glass slides (Menzel Glaeser, catalog number: J2800AMNZ )
Coverslips (Menzel Glaeser, catalog number: BBAD02400500#A )
OHP permanent marker pen (STAEDTLER MARS LIMITED)
Microscope slide holder/mailer, 5 place (Sigma-Aldrich, catalog number: Z708313-25EA )
Cryogenic freezer storage box (VWR International, catalog number: 82021-114 )
Staining jar with cover (VWR International, catalog number: 25460-907 )
Grade 410 filter paper (VWR International, catalog number: 28321-077 )
Polystyrene petri dishes (150 mm x 15 mm) (Sigma-Aldrich, catalog number: P5981 )
Ethanol (Merck Millipore Corporation, catalog number: 1009832500 )
Ethylenediaminetetraacetic acid (EDTA) (Sigma-Aldrich, catalog number: E6758 )
Phosphate buffer saline (PBS) (Sigma-Aldrich, catalog number: P4417-100TAB )
Paraformaldehyde (PFA) (Sigma-Aldrich, catalog number: 16005 )
Sucrose (Sigma-Aldrich, catalog number: S0389 )
Isopropanol (Merck Millipore Corporation, catalog number: 1096341011 )
Acetone (Merck Millipore Corporation, catalog number: 1000141000 )
Isopentane (VWR International, catalog number: 103614T )
Note: It is also named “2-Methylbutan” on VWR International website.
Dry ice (TKD KABEL GmbH)
Sudan IV (Sigma-Aldrich, catalog number: 198102 )
OCT compound-Tissue-Tek (SAKURA FINETEK USA, catalog number: 4583 )
Cryomold (SAKURA FINETEK USA, catalog number: 25608-924 )
Oil Red O (Sigma-Aldrich, catalog number: 00625 )
Hematoxylin solution, Mayer’s (Sigma-Aldrich, catalog number: MHS-16 )
Faramount aqueous mounting medium (Dako, catalog number: S3025 )
Distilled water
NaOH
Sudan IV staining solution (see Recipes)
Oil Red O (ORO) working solution (see Recipes)
EDTA (see Recipes)
PBS (see Recipes)
Paraformaldehyde (PFA) (see Recipes)
Sucrose (see Recipes)
PFA-sucrose (see Recipes)
Black wax petri dish (see Recipes)
Equipment
CO2 supply machine (Next Advance, model: Quietek CO2 induction system )
Dissection scissors (Fine Science Tools, catalog number: 91460-11 )
Fine iris scissors (Fine Science Tools, catalog number: 14094-11 )
Spring scissors (Fine Science Tools, catalog number: 15009-08 )
Curved forceps (Fine Science Tools, catalog number: 11073-10 )
Delicate suture tying forceps (Fine Science Tools, catalog number: 11063-07 )
Dissection stereo microscope equipped with fibre-optic light source from top (Carl Zeiss Microscopy, model: Stemi 2000 )
Measuring scale (LACO)
Camera (Nikon, model: D5300 )
-80 °C freezer (Thermo Fisher Scientific)
Cryostat microtome (Microm GmbH, model: HM500 OM )
Precision hotplate (HARRY GESTIGKEIT GMBH, model: PZ28-2T )
Axio-Imager A2 microscope equipped with Axiovision release 4.8 software (Carl Zeiss Microscopy, model: 490022-0002-000 )
Software
Statistical analysis software [IBM SPSS Statistics 20.0 (IBM Corporation, Released 2011, NY, USA)]
Image J software [National Institutes of Health (NIH), USA]
Axiovision release 4.8 software (Carl Zeiss)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Mohanta, S., Yin, C., Weber, C., Hu, D. and Habenicht, A. J. R. (2016). Aorta Atherosclerosis Lesion Analysis in Hyperlipidemic Mice. Bio-protocol 6(11): e1833. DOI: 10.21769/BioProtoc.1833.
Download Citation in RIS Format
Category
Cell Biology > Tissue analysis > Tissue isolation
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,834 | https://bio-protocol.org/exchange/protocoldetail?id=1834&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Quantification of the Adhesion Strength between Peroxisomes and Chloroplasts by Femtosecond Laser Technology
YH Yoichiroh Hosokawa
TI Takanori Iino
Kazusato Oikawa
SM Shoji Mano
Kenji Yamada
Mikio Nishimura
Published: Vol 6, Iss 11, Jun 5, 2016
DOI: 10.21769/BioProtoc.1834 Views: 9377
Edited by: Tie Liu
Reviewed by: Jaroslav ĎurkovičDennis Nürnberg
Original Research Article:
The authors used this protocol in Feb 2015
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Feb 2015
Abstract
This is the detailed protocol to quantify adhesion strength between peroxisomes and chloroplasts in plant leaf palisade mesophyll cells described by Oikawa et al. (2015). The quantification was performed by utilizing local explosion induced by focusing femtosecond laser pulses into a mesophyll cell under a confocal microscope. When an impulsive force generated by an explosion is loaded on the interface between a peroxisome and a chloroplast, the peroxisome is frequently detached from the chloroplast. The probability of a peroxisome detaching from a chloroplast was estimated (left-top of Figure 1). Next, the magnitude of the impulsive force was quantified by an atomic force microscope (AFM) cantilever (right-top of Figure 1). On the basis of these results, the pressure to break adhesion between a peroxisome and a chloroplast was quantified as an index of the adhesion strength (bottom of Figure 1). In this protocol, these procedures are summarized. As the local explosion is induced not only in the medium of the mesophyll cells but also in aqueous medium generally, this method could be applied to various adhesions between organelles and between cells around 1 to 100 μm in diameter (e.g., adhesions between mitochondria and chloroplasts, between nucleus and cell membrane, and between two cells with weak physical interaction). Additionally, we have evaluated the interaction between peroxisomes and chloroplasts from the interaction length between two organelles. This protocol has been presented in Bio-protocol as “Measuring the interactions between peroxisomes and chloroplasts by in situ laser analysis” (Oikawa et al., 2015).
Figure 1. Flow chart estimating adhesion strength between a peroxisome and a chloroplast by utilizing femtosecond laser and atomic force microscope
Keywords: Force measurement Adhesion estimation Laser manipulation Atomic force microscopy Advance optical tweezers
Materials and Reagents
Glass slide (26 x 76 No.1, thickness 0.8-1.0 mm) (Matsunami Glass Ind.)
Note: Any types of glass slide suitable for fluorescence observation can be used. We attached black tape on the glass slide to envelop the sample with the cover slip (see Figure 4D).
Cover slip (24 x 60 No.1, thickness 0.12-0.17 mm) (Matsunami Glass Ind.)
10 ml disposable syringe (Terumo Medical Corporation)
Razor blade (43 x 23)
Arabidopsis thaliana (ecotype Columbia) expressing peroxisome-targeted GFP (GFP-PTS1) (Mano et al., 2002)
Agar powder (Funakoshi, catalog number: BA-10 )
Distilled water
1/3x Murashige and Skoog salts (MS) medium (Wako Pure Chemical Industries, catalog number: 392-00591 )
Equipment
Confocal microscope combined with amplified Ti:Sapphire femtosecond laser system (Figure 2)
Ti:Sapphire femtosecond laser system (Cyber Laser Inc., model: IFRIT-SP-01 )
Confocal microscope (Olympus Corporation of the America, model: FV300-IX71 )
Objective (OLYMPUS CORPORATION, model: PlanN100x )
Mechanical shutter (Gate time: 1/125 s) [SIGMAKOKI, model: 65GR (discontinued product); compatible product: SIGMAKOKI, model: SSH-25RA ]
Collimator lenses
λ/2 plate
Polarizer
Figure 2. Experimental setup of confocal microscope and femtosecond laser system. Femtosecond laser pulses from an amplified Ti:Sapphire femtosecond laser system (Wavelength: 780 nm, Pulse duration: 230 fs, Pulse energy: <1 mJ/pulse, Repetition rate: 125 Hz) are introduced to a confocal microscope (Excitation wavelength: 488 nm, Detection wavelength: 515-550 nm). Mechanical shutter (Gate time: 1/125 s), collimator lenses, λ/2 plate and polarizer were placed in the beam line between the laser and the microscope.
Atomic force microscope (AFM) (Figure 3)
AFM [Pacific Nanotechnology, model: Nano-R2 (discontinued product); compatible product: JPK Instruments, model: NanoWizard4 NanoScience ]
Ti:Sapphire femtosecond laser system (see Equipment Section, 1a)
Confocal microscope (see Equipment Section, 1b)
Objective (see Equipment Section, 1c)
A tipless AFM cantilever (NanoWorld AG, NANOSENSORSTM, model: TL-NCH )
Motorized stage (SIGMAKOKI, model: BIOS-206T )
Oscilloscope [TEKTRONIX, model: DP4104 (discontinued product); compatible product: TEKTRONIX, model: MDO4104c ]
Figure 3. Experimental setup of AFM head on the microscope stage. The head of an AFM was mounted on the confocal microscope (Objective, PlanN100x) combined with the amplified Ti:Sapphire femtosecond laser system with the same setting as that mentioned in the former item. A tipless AFM cantilever is attached to the AFM head. The cantilever is placed between a water shield plate and cover glass, and immersed in distilled water or culture medium.
Note: The distance between the top of the cantilever and the laser focal point was tuned by a motorized stage equipped on the microscope. The normal function of the AFM system [feedback system between quadrant photo diode (QPD) and piezoelectric (PZT) motor] is deactivated. The signal of the QPD in the AFM head is directly monitored with an oscilloscope. The detailed settings are described in Hosokawa et al., 2011.
Software
IGOR Pro 6.22J (WaveMetrics, https://www.wavemetrics.com)
Visual Basic 6.0J (Microsoft, https://msdn.microsoft.com/en-us/vstudio/ms788229.aspx)
Note: Multivariate least-square fittings in procedures C and D were performed by a data analysis and graphing software, IGOR Pro 6.22J. For the least-square fitting in step C8, a user defined macro-program on the IGOR Pro was produced. The calculation program for step C9 was produced using a GUI programming language software, Visual Basic 6.0J.
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Hosokawa, Y., Iino, T., Oikawa, K., Mano, S., Yamada, K. and Nishimura, M. (2016). Quantification of the Adhesion Strength between Peroxisomes and Chloroplasts by Femtosecond Laser Technology. Bio-protocol 6(11): e1834. DOI: 10.21769/BioProtoc.1834.
Download Citation in RIS Format
Category
Plant Science > Plant cell biology > Cell imaging
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
1 Q&A
Is molecular weight cutoff of Vivaspin 500 centrifugal concentrator right?
0 Answer
58 Views
Aug 5, 2022
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,835 | https://bio-protocol.org/exchange/protocoldetail?id=1835&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
In utero Electroporation of Mouse Cerebellar Purkinje Cells
Yukari H. Takeo
Published: Vol 6, Iss 11, Jun 5, 2016
DOI: 10.21769/BioProtoc.1835 Views: 15380
Edited by: Oneil G. Bhalala
Reviewed by: Emmanuelle BerretXuecai Ge
Original Research Article:
The authors used this protocol in Sep 2015
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Sep 2015
Abstract
In utero electroporation (IUE) of mouse cerebellar Purkinje cells allows high expression levels of transgenes without toxicity (Nishiyama et al., 2012). This technique is suitable for co-transfection of multiple plasmid genes. Therefore, it is useful to express various sets of genes such as drug-inducible Cre/loxP constructs and CRISPR/Cas9 genome editing constructs (Takeo et al., 2015). Murine Purkinje cells arise from subventricular zone of fourth ventricle at embryonic day (E) 10-12. IUE at E11.5 into fourth ventricle results the most efficient transfection into Purkinje cells.
Keywords: Purkinje cell In utero electroporation Cerebellum
Materials and Reagents
Glass capillary [(Sutter Instrument Company, catalog number: BF100-50-10 ) for microinjector or (World Precision Instruments, catalog number: 1B150F-3 ) for mouth pipette]
Sterile gauze (KAWAMOTO CORPORATION, catalog number: 7164 )
Surgical tape (3M, catalog number: 1527SP-0 )
Surgical scalpel blade (Swann Morton, model: No.11 )
Suture needle (Alfresa pharma, catalog number: HT1605 NA75-KF2 )
E11.5 (or E10~12) pregnant mouse
QIAFilter plasmid maxi kit (QIAGEN, catalog number: 12263 )
Fast green (Sigma-Aldrich, catalog number: F7258 )
Sodium pentobarbital (Somnopentyl) (KYORITSU SEIYAKU CORPORATION, catalog number: 4992945014418 )
Ethanol
Ritodrine hydrochloride (Sigma-Aldrich, catalog number: R0758 )
(Optional) EEG conductive paste (NIHON KOHDEN CORPORATION, catalog number: Z181JE )
HEPES (Sigma-Aldrich, catalog number: H4034 )
Sodium chloride (NaCl) (Sigma-Aldrich, catalog number: S7653 )
Potassium chloride (KCl) (Sigma-Aldrich, catalog number: P9333 )
Disodium hydrogenphosphate 12-water (Na2HPO4･12H2O) (Wako Pure Chemical Industries, catalog number: 196-02835 )
Potassium dihydrogen phosphate (KH2PO4) (Wako Pure Chemical Industries, catalog number: 169-04245 )
HEPES-buffered saline (HBS) (see Recipes)
Phosphate-buffered saline (PBS) (see Recipes)
Equipment
Micropipette puller (Sutter Instrument Company, model: P-87 )
Microscope with 40x objective (Nikon Instruments Inc., model: Eclipse E100 )
Scissors, fine forceps and ring forceps
Square wave electroporator (Nepa Gene Co., model: CUY21SC )
Tweezers-type electrodes (Nepa Gene Co., model: CUY650P3 )
Microinjector (Eppendorf AG, model: 5242 ) or mouth pipette
LED light source with flexible light guide (Kenko Tokina, model: KTX-20L )
Reflex 7 mm wound clip applier (Cellpoint Scientific Inc., catalog number: 204-1000 )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
How to cite： Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Takeo, Y. H. (2016). In utero Electroporation of Mouse Cerebellar Purkinje Cells. Bio-protocol 6(11): e1835. DOI: 10.21769/BioProtoc.1835.
Takeo, Y. H., Kakegawa, W., Miura, E. and Yuzaki, M. (2015). RORalpha regulates multiple aspects of dendrite development in cerebellar purkinje cells in vivo. J Neurosci 35(36): 12518-12534.
Download Citation in RIS Format
Category
Neuroscience > Development > Electroporation
Cell Biology > Tissue analysis > Electroporation
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,836 | https://bio-protocol.org/exchange/protocoldetail?id=1836&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Pit Assay to Measure the Bone Resorptive Activity of Bone Marrow-derived Osteoclasts
Alexander Vesprey
Wentian Yang
Published: Vol 6, Iss 12, Jun 20, 2016
DOI: 10.21769/BioProtoc.1836 Views: 14118
Reviewed by: Jalaj Gupta
Original Research Article:
The authors used this protocol in May 2015
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
May 2015
Abstract
Although it is possible to use a tartrate-resistant acid phosphatase (TRAP) stain to assist in identifying osteoclasts, a separate method is needed to determine the bone resorption activity of osteoclasts. Since osteoclasts leave “pits” after bone matrix resorption (Charles et al., 2014), it is possible to stain pits as a method of measuring osteoclast bone resorption activity. The pit assay protocol enables researchers to stain bony slices that were co-cultured with osteoclasts with toluidine blue in order to allow the visualization, capture, and analysis of osteoclast resorptive activity based on the number, size and depth of pits (Zhou et al., 2015). The pit assay protocol is separated into three sequential stages: Preparation of bone slices (1); preparation of osteoclast precursors (Ross et al., 2006; Teitelbaum et al., 2000) (2), and bone resorption pit assay (3).
Keywords: Osteoclast function Bone resorption Pit assay
Materials and Reagents
Parafilm
Razor blade
Tissue culture tubes (standard 15 or 50 ml conical TC tubes)
5 ml syringe with 25 G needle
Cell strainer (70 μm) (Corning, catalog number: 352350 )
Cell culture 96 well plates
Tissue culture petri dish
Whatman filter paper (Sigma-Aldrich, catalog number: WHA10347509 )
6- to 10-week-old mice
Phosphate buffered saline (PBS), sterilized, pH 7.4 (Thermo Fisher Scientific, catalog number: 10010023 )
Dulbecco's modified Eagle medium, high glucose (Thermo Fisher Scientific, GibcoTM, catalog number: 11965092 )
Penicillin/streptomycin (10,000 U/ml) (Thermo Fisher Scientific, catalog number: 15140-122 )
Fetal bovine serum (FBS) (Thermo Fisher Scientific, GibcoTM, catalog number: 16000044 )
MEMα, nucleosides (Thermo Fisher Scientific, catalog number: 12571-063 )
Macrophage-stimulating factor (M-CSF) (PeproTech, catalog number: 315-02 ) and receptor activated nuclear factor k-B ligand (RANKL) (PeproTech, catalog number: 315-11 )
Bovine femurs (from meat market)
Ethanol
Glutaraldehyde (Sigma-Aldrich, catalog number: G5882 )
Toluidine blue (Sigma-Aldrich, catalog number: T3260-5G )
MilliQ water
Acid phosphatase, leukocyte (TRAP) Kit (Sigma-Aldrich, catalog number: 387A-1KT )
Sodium borate 10-hydrate (Fisher Scientific, catalog number: 02-003-999 )
Trypan-blue (Thermo Fisher Scientific, catalog number: T6146-5G )
Ammonium chloride (NH4Cl) (Sigma-Aldrich, catalog number: A9434-500G )
Trizma® hydrochloride (Tris-HCl) (Sigma-Aldrich, catalog number: T5941-100G )
Red blood cell (RBC) lysis buffer (Sigma-Aldrich, catalog number: R7757 ) (see Recipes)
Osteoclast precursor culture media (see Recipes)
Osteoclast differentiation media (see Recipes)
1% toluidine blue (see Recipes)
Glutaraldehyde solution (see Recipes)
Equipment
Forceps scissors
Hacksaw
Scalpel
Water ultrasonicator
Isomet low speed saw (BUEHLER, catalog number: 111280 ) with wafering blade
Light microscope
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Vesprey, A. and Yang, W. (2016). Pit Assay to Measure the Bone Resorptive Activity of Bone Marrow-derived Osteoclasts. Bio-protocol 6(12): e1836. DOI: 10.21769/BioProtoc.1836.
Download Citation in RIS Format
Category
Stem Cell > Adult stem cell > Maintenance and differentiation
Cell Biology > Cell staining > Whole cell
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
1 Q&A
Will Frozen cells work ?
0 Answer
4 Views
Oct 17, 2023
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,837 | https://bio-protocol.org/exchange/protocoldetail?id=1837&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Whole-mount Enteroid Proliferation Staining
CB Caitlyn W. Barrett
SS Sarah P. Short
Y Yash A. Choksi
CW Christopher Shawn Williams
Published: Vol 6, Iss 12, Jun 20, 2016
DOI: 10.21769/BioProtoc.1837 Views: 11095
Edited by: Ivan Zanoni
Reviewed by: Achille Broggi
Original Research Article:
The authors used this protocol in Jul 2015
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jul 2015
Abstract
Small intestinal organoids, otherwise known as enteroids, have become an increasingly utilized model for intestinal biology in vitro as they recapitulate the various epithelial cells within the intestinal crypt (Mahe et al., 2013; Sato et al., 2009). Assessment of growth dynamics within these cultures is an important step to understanding how alterations in gene expression, treatment with protective and toxic agents, and genetic mutations alter properties essential for crypt growth and survival as well as the stem cell properties of the individual cells within the crypt. This protocol describes a method of visualization of proliferating cells within the crypt in three dimensions (Barrett et al., 2015). Whole-mount proliferation staining of enteroids using EdU incorporation enables the researcher to view all proliferating cells within the enteroid as opposed to obtaining growth information in thin slices as would be seen with embedding and sectioning, ensuring a true representation of proliferation from the stem cell compartment to the terminally differentiated cells of the crypt.
Materials and Reagents
12-well MatTek plate with 1.5 coverslip thickness (MATTEK, catalog number: P12G-1.5-14-F )
18 G non-flexible stainless steel oral gavage needle (Cadence, Inc., catalog number: 7906 )
10 ml syringe (Thermo Fisher Scientific, Fisher ScientificTM, catalog number: 14-823-2A )
50 ml sterile Falcon tubes (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 339653 )
Sterile 12-well cell culture dish (Sigma-Aldrich, catalog number: CLS3513 )
15 ml sterile Falcon tubes (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 339651 )
Pre-chilled sterile pipette tips
Notes:
Any tips that are sterile and can be used with the lab’s pipettors.
These tips can be placed in a -20 °C freezer for 30 min or in a 4 °C refrigerator one hour prior to plating.
70 μM cell strainer (Thermo Fisher Scientific, Fisher ScientificTM, catalog number: 08-771-2 )
C57BL/6 mouse (male or female, 6-8 weeks of age)
Isofluorane (Allivet, catalog number: 50562 )
Ice cold sterile 1x DPBS without calcium or magnesium (Thermo Fisher Scientific, GibcoTM, catalog number: 14190-235 )
UltraPure EDTA (Thermo Fisher Scientific, InvitrogenTM, catalog number: 15576-028 )
Sucrose (Sigma-Aldrich, catalog number: S0389 )
D-Sorbitol (Sigma-Aldrich, catalog number: S1876 )
Matrigel® basement membrane matrix (Corning, catalog number: 356237 )
Note: Thaw at 4 °C the night before use.
Epidermal growth factor (EGF) (R&D Systems, catalog number: 2028-EG-200 )
Noggin (R&D Systems, catalog number: 1967-NG-025/CF )
R-spondin (R&D Systems, catalog number: 3474-RS-050 )
Wnt3A (R&D Systems, catalog number: 1324-WN-010 )
Advanced DMEM/F12 (Thermo Fisher Scientific, GibcoTM, catalog number: 12634-010 )
L-glutamine (Thermo Fisher Scientific, GibcoTM, catalog number: 25030-081 )
Penicillin-streptomycin (Thermo Fisher Scientific, GibcoTM, catalog number: 15140-148 )
1 M HEPES (pH 7.0-7.6, Sterile filtered) (Sigma-Aldrich, catalog number: H0887 )
N2 supplement (R&D Systems, catalog number: AR003 )
B27 supplement (Thermo Fisher Scientific, GibcoTM, catalog number: 17504-044 )
Fetal bovine serum (FBS) (Thermo Fisher Scientific, GibcoTM, catalog number: 10437-028 )
Click-iT EdU cell proliferation assay (Thermo Fisher Scientific, Molecular ProbesTM, catalog number: C10337 )
Paraformaldehyde (Sigma-Aldrich, catalog number: P6148 )
Bovine serum albumin (BSA) (Sigma-Aldrich, catalog number: A8531 )
Triton X-100 (Sigma-Aldrich, catalog number: X100 )
TO-PRO-3 Iodide (Thermo Fisher Scientific, Molecular ProbesTM, catalog number: T3605 )
Chelation buffer, prepare fresh (see Recipes)
Shaking buffer (see Recipes)
Minigut culture media (see Recipes)
2% Formaldehyde (see Recipes)
Equipment
Scissors for dissection (Fisher Scientific, catalog number: 08-951-20 )
Sorvall Legend X1R Centrifuge (or other large refrigerated centrifuge)
37 °C, 5% CO2 cell culture incubator (Thermo Fisher Scientific, model: HERAcell 150i )
LSM 510 META Inverted (or other inverted laser scanning) confocal microscope with 647 (TO-PRO-3) and 488 (EdU) emission filters
Software
ImageJ Image Analysis Software
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Barrett, C. W., Short, S. P., Choksi, Y. A. and Williams, C. S. (2016). Whole-mount Enteroid Proliferation Staining. Bio-protocol 6(12): e1837. DOI: 10.21769/BioProtoc.1837.
Download Citation in RIS Format
Category
Immunology > Immune cell isolation > Maintenance and differentiation
Immunology > Immune cell function > General
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,838 | https://bio-protocol.org/exchange/protocoldetail?id=1838&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
In vivo OVA-specific Cytotoxic CD8+ T Cell Killing Assay
Nada Chaoul
Catherine Fayolle
Claude Leclerc
Published: Vol 6, Iss 12, Jun 20, 2016
DOI: 10.21769/BioProtoc.1838 Views: 22051
Edited by: Lee-Hwa Tai
Reviewed by: Martin V Kolev
Original Research Article:
The authors used this protocol in Aug 2015
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Aug 2015
Abstract
Cytotoxic CD8+ T cells are responsible for the lysis of cells expressing peptides associated with MHC class I molecules and derived from infection with a pathogen or from mutated antigens. In order to quantify in vivo this antigen-specific CD8+ T cell killing activity, we use the in vivo killing assay (IVK). Here we describe the protocol for the lysis of cells expressing a CD8+ T cell epitope of the OVA protein (SIINFEKL). Mice are previously immunized with the OVA protein and 7 days after immunization, they receive a mix of target cells, prepared from naive C57BL/6 spleen cells pulsed with the SIINFEKL peptide and labeled with high level of CFSE and of non-pulsed control cells labeled with low level of CFSE. One day later, the spleen cells of recipient mice are isolated and analyzed by FACS to measure the amount of CFSEhigh cells and CFSElow cells. The percentage of lysis is calculated by the difference between CFSE high versus low in immunized vs non-immunized mice.
Measuring the ability of antigen-specific CD8+ T cell to lyse their antigen in vivo is very important to evaluate the adaptive cytotoxic response induced against a pathogen or a tumor antigen.
Keywords: Cytotoxic T cells CD8 T cells Killing assay In vivo assay Ovalbumin
Materials and Reagents
0.5 ml insulin syringe (Terumo Corporation, catalog number: SS05M2713M )
Falcon® 50 ml high clarity PP centrifuge tube (Corning, catalog number: 352070 )
40 μm nylon mesh cell strainer (Corning, catalog number: 352340 )
6-well plate (TPP Techno Plastic Products AG., catalog number: 92006 )
Cell counting material
5 ml round bottom polystyrene test tube (Corning, catalog number: 352235 )
C57BL/6 mice
CpG B-1826 (5’-TCCATGACGTTCCTGACGTT-3’) (Sigma-Aldrich, PrOligo, custom made)
N-[1-(2,3-dioleoyloxy)propyl]-N,N,N-trimethylammoniumethyl sulfate (DOTAP) (Roche Diagnostics, catalog number: 11202375001 )
Albumin from chicken egg white (OVA protein) (Sigma-Aldrich, catalog number: A5503 )
Sterile DPBS, 1x (Life Technologies, Gibco, catalog number: 14190-094 )
Note: Currently, it is “DPBS, no calcium, no magnesium (Thermo Fisher Scientific, GibcoTM, catalog number: 14190-094 )”.
Carboxyfluorescein succinimidyl ester (CFSE) (Life Technologies, catalog number: C1157 )
Note: Currently, it is “(5-(and-6)-carboxyfluorescein diacetate, succinimidyl ester) (CFSE) (Thermo Fisher Scientific, Molecular ProbesTM, catalog number: C1157)”.
ACK lysing buffer (1x) (Lonza Group Ltd., catalog number: 10548E )
RPMI 1640 Medium, GlutaMAXTM (Thermo Fisher Scientific, GibcoTM, catalog number: 61870-010 )
Penicillin/streptomycin (Life Technologies, GibcoTM, catalog number: 15140-12 )
Note: Currently, it is “Penicillin/streptomycin (Thermo Fisher Scientific, GibcoTM, catalog number: 15140122 )”.
Peptide SIINFEKL (PolyPeptide Group, custom made)
Fetal calf serum (Thermo Fischer Scientific, HycloneTM, catalog number: SV30160.03 )
Bovine serum albumin (Sigma-Aldrich, catalog number: A7906 )
FACS buffer (see Recipes)
Equipment
Dissection kit (containing scissors, curved forceps)
Centrifuge (Eppendorf, model: 5810R )
MyBathTM 4 mini water bath (Benchmark Scientific, model: B2000-4 )
Flow cytometer: Cyan (Beckman Coulter) or Fortessa (Becton Dickinson)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Chaoul, N., Fayolle, C. and Leclerc, C. (2016). In vivo OVA-specific Cytotoxic CD8+ T Cell Killing Assay. Bio-protocol 6(12): e1838. DOI: 10.21769/BioProtoc.1838.
Download Citation in RIS Format
Category
Immunology > Immune cell function > Cytotoxicity
Immunology > Immune cell function > Antigen-specific response
Immunology > Immune cell staining > Flow cytometry
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,839 | https://bio-protocol.org/exchange/protocoldetail?id=1839&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Measurement of Mitochondrial DNA Release in Response to ER Stress
DB Denise N. Bronner
MO Mary X. O’Riordan
Published: Vol 6, Iss 12, Jun 20, 2016
DOI: 10.21769/BioProtoc.1839 Views: 16445
Edited by: Ivan Zanoni
Original Research Article:
The authors used this protocol in Sep 2015
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Sep 2015
Abstract
Mitochondria house the metabolic machinery for cellular ATP production. The mitochondrial network is sensitive to perturbations (e.g., oxidative stress and pathogen invasion) that can alter membrane potential, thereby compromising function. Healthy mitochondria maintain high membrane potential due to oxidative phosphorylation (Ly et al., 2003). Changes in mitochondrial function or calcium levels can cause depolarization, or a sharp decrease in mitochondrial membrane potential (Bernardi, 2013). Mitochondrial depolarization induces opening of the mitochondrial permeability transition pore (MPTP), which allows release of mitochondrial components like reactive oxygen species (mtROS), mitochondrial DNA (mtDNA) or intermembrane space proteins into the cytosol (Martinou and Green, 2001; Tait and Green, 2010; Bronner and O'Riordan, 2014). These contents trigger inflammation, and can lead to cell death (West et al., 2011). Both mtROS and cytosolic mtDNA contribute to the activation of inflammasomes, multiprotein complexes that process the proinflammatory cytokines, IL-18 and IL-1β. Studies indicate that cytosolic mtDNA in particular can bind two different inflammasome sensors, AIM2 and NLRP3, leading to inflammasome activation (Burckstummer et al., 2009; Hornung and Latz, 2010). In this protocol, you will be able to specifically extract cytosolic mtDNA and quantify the amount using a qPCR assay.
Figure 1. Flowchart for extracting, purifying, and amplifying cytosolic mtDNA
Part I. Extraction and purification of cytosolic mtDNA
Materials and Reagents
For extraction (see Figure 1)
1.5 ml microcentrifuge tubes (Denville Scientific Inc., catalog number: C2170 )
Gloves
6 well-plates, tissue culture-treated (Corning, catalog number: 3506 )
Cell lifter (Biologix Group Limited, catalog number: 70-2180 )
Murine immortalized bone marrow derived macrophages (Bernardi, 2013)
Thapsigargin, 97%, ACROS OrganicsTM (Thermo Fisher Scientific, Fisher ScientificTM, catalog number: AC328570010 ) (Bronner et al., 2015)
1% NP-40 (Igepal CA-630) (Sigma-Aldrich, catalog number: I8896 ) (Bronner and O'Riordan, 2014)
DPBS (Thermo Fisher Scientific, GibcoTM, catalog number: 14040-133 ) (Burckstummer, 2009)
DMEM (Thermo Fisher Scientific, GibcoTM, catalog number: 11965-092 )
Fetal bovine serum (FBS) (Thermo Fisher Scientific, GibcoTM, catalog number: 10437-028 )
Medium (see Recipes)
NP-40 (Igepal CA-630) solution (see Recipes)
Thapsigargin stock solution (see Recipes)
For purification
Gloves
DNeasy blood & tissue kit, 50 samples (QIAGEN, catalog number: 69504 ) or 250 samples (QIAGEN, catalog number: 69506 )
Ethanol 200 proof (Decon Labs, catalog number: 2716 )
Equipment
Centrifuge (Thermo Fisher Scientific, Fisher ScientificTM, model: accuSpinTM Micro 17 )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Bronner, D. N. and O’Riordan, M. X. (2016). Measurement of Mitochondrial DNA Release in Response to ER Stress. Bio-protocol 6(12): e1839. DOI: 10.21769/BioProtoc.1839.
Download Citation in RIS Format
Category
Immunology > Immune cell function > General
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
1 Q&A
Hello. Will 1% NP-40 lyse both nuclear and mitochondrial membranes? In this way, supernatant will also contain mitochondrial and nuclear DNA?
0 Answer
39 Views
Oct 12, 2023
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
184 | https://bio-protocol.org/exchange/protocoldetail?id=184&type=1 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Zebrafish Embryo DNA Preparation
LJ Lili Jing
Published: Feb 20, 2012
DOI: 10.21769/BioProtoc.184 Views: 21350
Download PDF
Ask a question
Favorite
Cited by
Abstract
This protocol explains how to extract DNA from a single zebrafish embryo. It does not require the use of expensive kits.
Materials and Reagents
Proteinase K (Roche Diagnostics, catalog number: 03115836001 )
1 M Tris (pH 8.3)
NaCl
KCl
CaCl2·2H2O
MgSO4·7H2O
Sterile water
10%Tween 20 (EMD Biosciences, catalog number: 655207 )
10% NP40 (Merck KGaA, catalog number: 492018 )
Embryo lysis buffer (see Recipes)
1x PCR buffer (see Recipes)
E3 (see Recipes)
Equipment
PCR Thermal cycler
Centrifuges
Incubator
96-well plate
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2012 The Authors; exclusive licensee Bio-protocol LLC.
Category
Molecular Biology > DNA > DNA extraction
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,840 | https://bio-protocol.org/exchange/protocoldetail?id=1840&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Isolation and Culture of the Islets of Langerhans from Mouse Pancreas
KG Kate L Graham
SF Stacey Fynch
EP Evan G Pappas
CT Christina Tan
TK Thomas WH Kay
HT Helen E Thomas
Published: Vol 6, Iss 12, Jun 20, 2016
DOI: 10.21769/BioProtoc.1840 Views: 24626
Edited by: Ivan Zanoni
Reviewed by: Francesca MingozziEmilie Battivelli
Original Research Article:
The authors used this protocol in Sep 2015
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Sep 2015
Abstract
The islets of Langerhans are clusters of endocrine cells located within the pancreas. Insulin-producing beta cells are the major cell type within islets, with glucagon-producing alpha cells and somatostatin-producing delta cells the other major cell types. The beta cells are the target of immune-mediated destruction in type 1 diabetes (Graham et al., 2012). Failure of beta cell function accompanied by loss of beta cell mass is also a feature of type 2 diabetes (Wali et al., 2013). Therefore studying the biology of pancreatic islets is important to understand the pathogenesis of diabetes and to develop new therapies. Here we describe the isolation of mouse islets. This requires gentle enzymatic and mechanical digestion of the exocrine tissue and density gradient separation (Chong et al., 2004; Liu and Shapiro, 1995; Thomas et al., 1998). We then describe how islets can be cultured whole or dispersed into single cells for use in a variety of in vitro and in vivo analyses. Using this protocol reliably results in the isolation of 200-400 islets, depending on the strain of mouse.
Part I. Islet isolation
Materials and Reagents
50 ml polypropylene conical tubes (Corning, Falcon®, catalog number: 352070 )
0.2 µm syringe filter (e.g., Sartorius AG, catalog number: 16534-k )
Syringe (volume dependent on volume of collagenase P prepared)
Ice
2 ml slip tip syringe (will hold total volume of 3 ml) (BD, catalog number: 302204 )
30 G x ½ in. needle (BD, catalog number: 305106 )
500 micron mesh (Sefar Pty Ltd., catalog number: 06-500/38 )
Note: cut into approximately 5 cm squares and autoclaved (Figure 1) (see Notes for alternative product)
Figure 1. 500 µm islet mesh from Sefar Pty Ltd and 50 ml tube lid shown for size reference
Collagenase P (Roche Diagnostics, catalog number: 11213865001 )
Note: It requires testing and optimisation prior to use (see Note 1).
RPMI 1640 medium (Life Technologies, Gibco, catalog number: 21870-076 )
Note: Currently, it is “Thermo Fisher Scientific, GibcoTM, catalog number: 21870-076”.
Histopaque®-1077 (Sigma-Aldrich, catalog number: H8889 )
Hanks balanced salt solution (HBSS) (Life Technologies, Gibco, catalog number: 14175-079 )
Note: Currently, it is “Thermo Fisher Scientific, GibcoTM, catalog number: 14175-079”.
Calcium chloride dihydrate (CaCl2·2H2O) (Sigma-Aldrich, catalog number: C5080 )
HEPES (Sigma-Aldrich, catalog number: H3375-100G )
HBSS/Ca/HEPES (see Recipes)
Equipment
Icebox
Dissecting microscope [e.g., Stereoscopic zoom microscope, (Nikon Instruments Inc., model: SMZ745 )]
Fibre optic light source (e.g., AmScope Dual Goose-neck Fiber-Optic Illuminator, model: HL150-AY )
Forceps [e.g., Graefe forceps, 100 mm, curved (ProSciTech Pty Ltd., catalog number: T131C-2 )]
Scissors [e.g., Iris scissors, 115 mm, straight (ProSciTech Pty Ltd., catalog number: T097-2 )]
Clamp [e.g., 150 mm spencer wells forceps, straight (ProSciTech Pty Ltd., catalog number: T124 )]
Bench-top centrifuge at room temperature, no brake required (e.g., Thermo Fisher Scientific, HeraeusTM, model: Multifuge X1R )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Graham, K. L., Fynch, S., Papas, E. G., Tan, C., Kay, T. W. and Thomas, H. E. (2016). Isolation and Culture of the Islets of Langerhans from Mouse Pancreas. Bio-protocol 6(12): e1840. DOI: 10.21769/BioProtoc.1840.
Download Citation in RIS Format
Category
Immunology > Immune cell isolation > Maintenance and differentiation
Cell Biology > Cell isolation and culture > Cell isolation
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,841 | https://bio-protocol.org/exchange/protocoldetail?id=1841&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
This protocol has been corrected. See the correction notice.
Peer-reviewed
Cytology and Microscopy: Immunolocalization of Covalently Modified Histone Marks on Barley Mitotic Chromosomes
Isabelle Colas
Katie Baker
Andrew J. Flavell
Published: Vol 6, Iss 12, Jun 20, 2016
DOI: 10.21769/BioProtoc.1841 Views: 8636
Edited by: Marisa Rosa
Reviewed by: Xinyan ZhangYurong Xie
Original Research Article:
The authors used this protocol in Oct 2015
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Oct 2015
Abstract
Barley is a diploid inbreeding crop with a genome of 5 GB organized into seven chromosomes. The relatively low chromosome number and their large size make barley an excellent model for chromosome cytogenetic studies of large genome cereal crops. Chromatin can be defined as euchromatin or heterochromatin. Euchromatin is gene-rich, less condensed, and transcriptionally active while the heterochromatin is gene-poor, remains highly condensed and has low transcriptional activity (Bartova et al., 2008; Sharakhov and Sharakhova, 2015). However, the mapping of nine Histone modifications has shown that this simple description is not accurate in barley. Instead, it has been shown that combinations of histones carrying different covalent modifications reveal 10 chromatin states partitioning barley chromosomes into three global environments (Baker et al., 2015). Briefly, in this protocol, barley roots (cv Morex) were collected, fixed in paraformaldehyde and squashed onto slides. Chromosome spreads were immunostained using antibodies against specific histone modifications, in particular H3K27me3, K3K27me1 and H3K9me2. We used confocal imaging to acquire stacked images and confirm the locations of these histone modifications on barley chromosomes.
Keywords: Barley Chromosome Immunocytology H3K27me3 3D micrcoscopy
Materials and Reagents
SterilinTM 9 cm petri dish (Thermo Fisher Scientific, catalog number: 1011RR )
Whatman® 9 cm filter paper (Sigma-Aldrich, catalog number: Z240079 )
Fine marker pen permanent (STABILO International GmbH)
HB graphite pencil
15 ml centrifuge tube (any brand)
Single edge razor blade (Thermo Fisher Scientific, catalog number: 11904325 )
1.5 ml microcentrifuge tubes (VWR International, catalog number: 89000-028 )
Microscope Polysine® slide (Thermo Fisher Scientific, Menzel Glaser, catalog number: 10143265 ) or Superfrost® plus micro slide (VWR International, catalog number: 48311-703 )
Note: Currently, it is “Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 10143265 ”.
Borosilicate glass coverslip, 25 x 50, thickness 0.13 mm (VWR International, catalog number: 631-0137 )
Tissue paper
PAP pen for immunostaining (Sigma-Aldrich, catalog number: Z377821 )
0.45 μm, 26 mm diameter syringe filter (Cole-Parmer, catalog number: UY-02915-58 )
Glass Coplin staining jar (any brand)
Seeds from barley cv. Morex
Immersion oil, ImmersolTM W 2010 (Carl Zeiss)
Autoclaved distilled water (Barnstead® E-pure 4 modules cartridges)
5% bleach (Domestos)
70% ethanol
Liquid nitrogen
Bovine serum albumin (BSA) (Sigma-Aldrich, catalog number: A7030 )
Antibodies
Primary antibodies: anti-trimethyl-histone H3 (Lys27) antibody (H3K27me3) (Merck Millipore Corporation, catalog number: 07-449 ), anti-monomethyl-histone H3 (Lys27) antibody (K3K27me1) (Merck Millipore Corporation, catalog number: 07-448 ) and histone H3K9me2 antibody (pAb) (H3K9me2) (Active Motif, catalog number: 39375 )
Note: Currently, it is “EMD Millipore Corporation, catalog numbers: 07-449 and 07-448 ”.
Secondary antibodies: goat anti-Rabbit IgG (H+L), Alexa Fluor® 488 conjugate (Thermo Fisher Scientific, catalog number: A-11034 )
Hoechst 33342 (10 mg/ml) (Thermo Fisher Scientific, Molecular ProbesTM, catalog number: H3570 )
Vectashield antifade mounting medium (Vector Laboratories, catalog number: H-1000 )
Clear nail varnish (Technic)
Sodium chloride (NaCl) (Sigma-Aldrich, catalog number: S7653 )
Potassium chloride (KCl) (Sigma-Aldrich, catalog number: P9541 )
Sodium phosphate dibasic (Na2HPO4) (Sigma-Aldrich, catalog number: 255793 )
Potassium phosphate monobasic (KH2PO4) (Sigma-Aldrich, catalog number: P5379 )
Tween® 20 (Sigma-Aldrich, catalog number: P9416 )
TritonTM X-100 (Sigma-Aldrich, catalog number: T8787 )
Sodium hydroxide (NaOH) (Sigma-Aldrich, catalog number: S8045 )
Paraformaldehyde (Sigma-Aldrich, catalog number: P6148 )
Cellulase Onozuka R10 (Duchefa Biochemie, catalog number: C8001 )
Pectolyase Y23 (Dushefa Biochemie, catalog number: P8004 )
10x PBS (see Recipes)
1x PBS, 0.5% Triton® X-100 (see Recipes)
1 M NaOH (see Recipes)
4% formaldehyde (see Recipes)
0.1 M citric acid (see Recipes)
0.1 M sodium citrate (see Recipes)
Citrate buffer (see Recipes)
Enzyme mixture (see Recipes)
Blocking solution (see Recipes)
Equipment
Optoelectronically controlled small orbital shaker, 2,200 rpm, 230 V (IKA, model: VXR basic Vibrax® )
Stereomicroscope (optional) (TEC Microscopes LTD., model: HM-4 )
Light microscope (TEC Microscopes LTD., model: LM-2TR )
Confocal microscope LSM 710 (Carl Zeiss)
Objective (for Zeiss LSM 710): 60x APO C-apochromat 63x/1.20 W Korr M27
DAPI fluorescence (blue 405, UV lamp) (Hoechst)
Fitted 405 nm diode laser (for Hoechst acquisition on the LSM 710)
Fitted 488 argon laser (for Alexa Fluor® 488 acquisition on the LSM 710)
Moisture or wet chamber
Note: Commercially available for immunohistochemistry application or home made by using a plastic box lined with wet paper and wax sheet or glass rod to keep the slides out of direct contact with water (Figure 1). The chamber needs to be closed so the humidity is preserved during the protocol.
Aluminium slide tray, 20 slides capacity (Brunel Microscopes Ltd.)
Figure 1. Wet chamber. The principle of the wet chamber is to keep the sample moist at all times.
Software
Zen 2010 software (Carl Zeiss, version 6.0)
Fiji (Image J, version 1.49m) (Schindelin et al., 2012) with deconvolution package (EPFL, Biomedical Imaging Group, Switzerland)
Imaris (optional) (Bitplane AG, version 8.1.2)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Colas, I., Baker, K. and Flavell, A. J. (2016). Cytology and Microscopy: Immunolocalization of Covalently Modified Histone Marks on Barley Mitotic Chromosomes. Bio-protocol 6(12): e1841. DOI: 10.21769/BioProtoc.1841.
Download Citation in RIS Format
Category
Plant Science > Plant molecular biology > Protein
Plant Science > Plant cell biology > Cell imaging
Molecular Biology > Protein > Detection
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,842 | https://bio-protocol.org/exchange/protocoldetail?id=1842&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Measuring Auxin Transport Capacity in Seedling Roots of Medicago truncatula
Jason Liang Pin Ng
UM Ulrike Mathesius
Published: Vol 6, Iss 12, Jun 20, 2016
DOI: 10.21769/BioProtoc.1842 Views: 9074
Edited by: Marisa Rosa
Reviewed by: Scott A M McAdamMoritz Bomer
Original Research Article:
The authors used this protocol in Aug 2015
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Aug 2015
Abstract
Measurement of auxin transport capacity provides quantitative data on the physiological machinery involved in auxin transport within plants. This technique is easy to perform and gives quick results. Radiolabelled auxin (indole-3-acetic-acid) is fed into the roots of Medicago truncatula via an agar block. The resulting radioactivity from radiolabelled auxin uptake in the roots is measured with a liquid scintillation counter. Here, we describe the measurement of auxin transport capacity around the nodulation susceptible zone in young seedling roots of M. truncatula in response to rhizobia inoculation. Similar assays could be adapted in other plant species and to answer other biological questions.
Keywords: Indole-3-acetic acid Nodulation Acropetal auxin transport Basipetal auxin transport
Materials and Reagents
Petri dish (150 x 15 mm) (BD, catalog number: 351058 )
Note: Currently, it is “Corning, catalog number: 351058”.
Petri dish (35 x 10 mm) (BD, catalog number: 351008 )
Note: Currently, it is “Corning, catalog number: 351008”.
SandBlaster fine 320 grit sandpaper (3M, catalog number: 70-0710-1785-2 )
50 ml Falcon tube (Greiner Bio One International GmbH, catalog number: 227261 )
Waste bottle
Aluminium foil (Confoil)
1.5 ml Eppendorf tube
Kimwipes
6 ml scintillation vials (Pico Prias vial) (PerkinElmer, catalog number: 6000192 )
Parafilm strips
Medicago truncatula seeds (cultivar Jemalong A17) (SARDI)
Sinorhizobium meliloti (rhizobia) culture
Sodium hypochlorite solution (Bleach) (Pelikan)
Sterilised distilled water
Ethanol (EMD Millipore Corporation, EMSURE®)
Agarose (AMRESCO, catalog number: 0710 )
Emulsifier-safe, 2 x 5 L (scintillation fluid) (PerkinElmer, catalog number: 6013389 )
CaCl2.2H2O (Sigma-Aldrich, catalog number: C3306 )
Magnesium sulfate heptahydrate (MgSO4.7H2O) (Sigma-Aldrich, catalog number: M1880 )
KH2SO4 (Sigma-Aldrich, catalog number: P0772 )
Na2HPO4.2H2O (Sigma-Aldrich, catalog number: 71643 )
Fe citrate (Sigma-Aldrich, Fluka®, catalog number: 44941 )
Note: It is also named “Iron(III) citrate tribasic monohydrate” on Sigma-Aldrich website.
H3BO3 (Sigma-Aldrich, catalog number: B6768 )
MnSO4.4H2O (Merckmillipore, catalog number: 102786 )
ZnSO4.7H2O (Sigma-Aldrich, catalog number: Z4750 )
CuSO4.5H2O (Sigma-Aldrich, catalog number: C7631 )
H2MoO4 (Sigma-Aldrich, catalog number: 232084 )
Na2MoO4.2H2O (Sigma-Aldrich, catalog number: 331058 )
Agar (TEKNOVA, catalog number: A7777 )
Tritium-labelled indole-3-acetic acid (3H-IAA) blocks (pH 4.8) (American Radiolabelled Chemicals, catalog number: ART 0340 )
Fahraeus media (see Recipes)
3H-IAA blocks (see Recipes)
Equipment
Plant growth chamber, set at 25 °C, 16/8 h day/night cycle with 150 μmol m−2 s−1 light intensity (Thermo Fisher Scientific)
Scintillation counter (PerkinElmer, model: Tri-Carb 2800TR )
Scintillation racks (PerkinElmer)
Pipettes (Eppendorf AG)
Scissors (ECKERSLEY’S)
Fine forceps (Dumont and Fils) (D'OUTILS DUMONT S.A.)
Rotating shaker (SeouLin Bioscience, model: MyLabTM Intelli-Mixer )
Platform shaker (Eppendorf AG, New BrunswickTM, model: INNOVA 2100 )
Microwave
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Ng, J. L. P. and Mathesius, U. (2016). Measuring Auxin Transport Capacity in Seedling Roots of Medicago truncatula. Bio-protocol 6(12): e1842. DOI: 10.21769/BioProtoc.1842.
Download Citation in RIS Format
Category
Plant Science > Plant biochemistry > Plant hormone
Plant Science > Plant physiology > Tissue analysis
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,843 | https://bio-protocol.org/exchange/protocoldetail?id=1843&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Quantifying Auxin Metabolites in Young Root Tissue of Medicago truncatula by Liquid Chromatography Electrospray-ionisation Quadrupole Time-of-flight (LC-ESI-QTOF) Tandem Mass Spectrometry
Jason Liang Pin Ng
Thy T. Truong
Charles H. Hocart
UM Ulrike Mathesius
Published: Vol 6, Iss 12, Jun 20, 2016
DOI: 10.21769/BioProtoc.1843 Views: 9591
Edited by: Marisa Rosa
Reviewed by: Scott A M McAdam
Original Research Article:
The authors used this protocol in Aug 2015
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Aug 2015
Abstract
Auxins represent a major group of phytohormones controlling plant development. The spatio-temporal regulation of auxin gradients is essential for the initiation, growth and correct development of plant organs. Because auxins and their metabolites occur at trace levels in plant tissue, experiments requiring identification plus their selective and specific quantification can be most conveniently achieved using mass spectrometry (MS) and the associated chromatographic methods. With the advent of appropriate liquid-based ionisation techniques, emphasis has moved from the use of gas chromatography as the sample interface to the MS (GC/MS), with its concomitant need for derivatisation, to the more sensitive liquid chromatography tandem mass spectrometry (LC-MS/MS). We describe an optimized liquid chromatography electrospray-ionisation quadrupole time-of-flight (LC-ESI-QTOF) methodology for the quantification of auxins. While the solvent extraction of young Medicago truncatula (M. truncatula) roots, as described herein, is relatively straightforward, older, woody or oily plant tissues may also be analyzed with appropriate modification to remove interferences and/or enhance extraction efficiency. In our hands, the analytical assay has proved sufficiently sensitive for the quantification of auxins to investigate their roles in various organogenic events, such as root nodulation in M. truncatula. Further increases in sensitivity can be expected with the use of the latest generation of instruments.
Keywords: Auxin Nodulation Liquid chromatography Quadrupole time-of-flight Masshunter
Materials and Reagents
Stainless steel balls, 3 mm diameter, sequentially washed with detergent, rinsed with tap water, Milli-Q water, and then sterilized in ethanol overnight prior to being air dried before use (AussieSapphire)
2 ml sterile non-autoclaved Eppendorf tubes (Sigma-Aldrich, catalog number: T2795 )
1.5 ml sterile non-autoclaved microtubes (Sigma-Aldrich, catalog number: SIAL311NZ1.5C )
Nanosep® MF GHP 0.45 μm filter (Pall Life Sciences, catalog number: ODGHPC35 )
Note: Currently, it is “VWR International, catalog number: ODGHPC35”.
2 ml amber glass autosampler vials (Pacific lab, catalog number: SV11AW )
250 μl inserts (Pacific lab, catalog number: IST0925N )
1 L Schott bottles (acid washed)
Medicago truncatula seeds
Liquid N2
Methanol (99.8%) HPLC grade (Thermo Fisher Scientific, ACROS OrganicsTM, catalog number: 413770025 )
Propanol, HPLC grade (Fisher Scientific, catalog number: A461-212 )
Glacial acetic acid, HPLC grade (Fisher Scientific, catalog number: A113-50 )
Formic acid, HPLC grade (Fisher Scientific, catalog number: A117-50 )
Milli-Q water
Ultra high purity N2 gas
Indole-2, 4, 5, 6, 7-d5-3-acetic acid, D5-IAA (Cambridge Isotope Laboratories, catalog number: DLM-2926 )
Note: It is also named “Indole-3-acetic acid (indole-D5, 97-98%)” on Cambridge Isotope Laboratories website.
Indole-3-acetic acid, IAA (Sigma-Aldrich, catalog number: I3750 )
Indole-3-butyric acid, IBA (Sigma-Aldrich, catalog number: I5386 )
4-chloro-indole-3-acetic acid, 4-Cl-IAA (OlChemIm Ltd., catalog number: 0031131 )
Phenylacetic acid, PAA (Sigma-Aldrich, catalog number: P16621 )
N-(3-indolylacetyl)-L-alanine, IAA-Ala (Sigma-Aldrich, catalog number: 345911 )
N-(3-indolylacetyl)-DL-aspartate, IAA-Asp (Sigma-Aldrich, catalog number: 345938 )
N-(3-indolylacetyl)-L-isoleucine, IAA-Ile (Sigma-Aldrich, catalog number: 347914 )
Note: This product has been discontinued.
N-(3-indolylacetyl)-L-leucine, IALeu (OlChemIm Ltd., catalog number: 0031611 )
N-(3-Indolylacetyl)-L-phenylalanine, IAPhe (OlChemIm Ltd., catalog number: 0031623 )
N-(3-indolylacetyl)-L-tryptophan, IATrp (OlChemIm Ltd., catalog number: 0031631 )
N-(3-indolylacetyl)-L-valine, IAVal (OlChemIm Ltd., catalog number: 0031641 )
Notes:
Solvents and chemicals should be of the highest available purity.
Auxin standards and internal standards are prepared in HPLC grade methanol. 1,000 mg/L stock solutions are prepared using acid washed volumetric flasks and aliquoted (1 ml) into 2 ml amber glass vials with crimped caps and stored at -80 °C until use.
Equipment
TissueLyser LT (QIAGEN, catalog number: 69980 )
Sonicator bath (Cole-Parmer Instrument Company, model: 8545-4 )
SpeedVac vacuum centrifuge (LabConco)
Agilent 6530 High Resolution Accurate Mass LC-MS Q-TOF with Agilent Jetstream (AJS) ESI ion source interface
Agilent Zorbax Eclipse high resolution XDB-C18 2.1 x 50 mm, 1.8 μm LC column
Software
Agilent MassHunter software version B.05.00 for data acquisition and data analysis
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Ng, J. L. P., Truong, T. T., Hocart, C. H. and Mathesius, U. (2016). Quantifying Auxin Metabolites in Young Root Tissue of Medicago truncatula by Liquid Chromatography Electrospray-ionisation Quadrupole Time-of-flight (LC-ESI-QTOF) Tandem Mass Spectrometry. Bio-protocol 6(12): e1843. DOI: 10.21769/BioProtoc.1843.
Download Citation in RIS Format
Category
Plant Science > Plant biochemistry > Plant hormone
Plant Science > Plant physiology > Tissue analysis
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,844 | https://bio-protocol.org/exchange/protocoldetail?id=1844&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Protocol for Microfluidic System to Automate the Preparation and Fractionation of the Nucleic Acids in the Cytoplasm Versus Nuclei of Single Cells
Kentaro Kuriyama*
Hirofumi Shintaku*
Juan G. Santiago
*Contributed equally to this work
Published: Vol 6, Iss 12, Jun 20, 2016
DOI: 10.21769/BioProtoc.1844 Views: 8164
Edited by: Samik Bhattacharya
Original Research Article:
The authors used this protocol in Jul 2015
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jul 2015
Abstract
This protocol describes the extraction, fractionation, and recovery of cytoplasmic nucleic acids (e.g., cytoplasmic RNA) versus nucleic acids in the cell nucleus (including genomic DNA, gDNA) from single cells with a microfluidic system. The method enables independent, sequence-specific analyses of these critical markers (Kuriyama et al., 2015). The system uses a microfluidic chip with a simple geometry and four end-channel electrodes, and completes the entire process in less than 5 min, including lysis, purification, fractionation, and delivery to two output reservoirs: One for the nucleus (including gDNA and nuclear RNA) and one for cytoplasmic RNA. Each reservoir then contains high quality and purity aliquots with no measurable cross-contamination of cytoplasmic RNA versus nucleic acids in nucleus. As described here, our protocol focuses on the analysis of cytoplasmic RNA versus gDNA from the nucleus. We have tested this protocol with mouse and human cells but not with walled cells such as plant cells.
Keywords: Single cell analysis RNA DNA Electrophoresis Microfluidics
Materials and Reagents
Microfluidic chip fabrication
Fabricate a microfluidic device (Figure 1) from polydimethylsiloxane (PDMS) (Dow Corning, Sylgard® 184 Silicone Elastomer Kit) and glass slides by using soft lithography. The nominal channel width and depth of the microfluidic device are 90 μm and 35 μm, respectively. The basic design is similar to the microchannel used by Shintaku et al. (2014) except for a downstream branch channel. We have made available the CAD file for the device in the supporting information.
Figure 1. Schematic of channel geometry. A. The letters (a to f) in the figure identify the various channel sections. Vi (for I = 1 to 5) refer to the voltages applied to platinum electrodes placed in respective reservoirs. The numbers also refer to the reservoirs, e.g., 1 = I, 2 = nNA, 3 = cNA, 4 = B, and 5 = V. B. The lengths of channel sections in the chip.
Reagents for extraction
Prepare following solutions in UltraPure DNase-/RNase-free deionized (DI) water (Thermo Fisher Scientific, InvitrogenTM, catalog number: 10977 ). Prepare buffer solutions under DNA/RNA free and DNase/RNase free environment (e.g., clean room conditions)
Cells (A20, mouse B cell lymphoma)
Sodium hydroxide (NaOH) (Sigma-Aldrich, catalog number: S8045 )
TritonTM X-100 (Sigma-Aldrich, catalog number: X100 )
Tris (Sigma-Aldrich, catalog number: 93362 )
Hydrochloric acid (HCl) (Sigma-Aldrich, catalog number: 258148 )
Polyvinylpyrrolidone (PVP) (Sigma-Aldrich, catalog number: 437190 )
HEPES (Sigma-Aldrich, catalog number: PHG0001 )
Sucrose (Sigma-Aldrich, catalog number: S0389 )
Leading electrolyte (LE) (see Recipes)
Trailing electrolyte (TE) (see Recipes)
Cell suspension buffer (see Recipes)
Reagents for RT-qPCR and qPCR
The reagents described here are for an experiment similar to Kuriyama et al. (2015) wherein we performed quantitation of gDNA for the nucleus and cytoplasmic RNA for the cytoplasm. However, we note the general lysing, fractionation, and preparation protocol described here is well applicable to other studies (e.g., analysis of nuclear versus cytoplasmic fractions of RNA from single cells).
TaqMan® RT-PCR mix (2x)*
TaqMan® gene expression assay
TaqMan® RT enzyme mix (40x)*
TaqMan® RNA-to-CTTM 1-step kit (Thermo Fisher Scientific, Applied BiosystemsTM, catalog number: 4392653 )
Primer set (forward primer, reverse primer) (TaqMan® probe)
DI water
RT-qPCR master mix for cytoplasmic RNA analysis for two reactions (see Recipes)
qPCR master mix for gDNA analysis for one reaction (see Recipes)
*Note: TaqMan® RNA-to-CTTM 1-step kit contains both reagents.
Equipment
Microscope
A phase contrast microscope fitted with a CCD camera enables monitoring the lysing and cytoplasmic nucleic acid fraction focusing via isotachophoresis (ITP) [see on-line movies by Garcia-Schwarz et al. (2012) for a typical on-chip ITP experiment.]. It also helps monitor migration of nucleus and its fractionation from the cytoplasmic fraction in the ITP zone. Avoid using fluorescence-based visualization, e.g., intercalation dye, which may interfere specificity and stringency of downstream assay.
High voltage sequencer
A voltage sequencer (e.g., LabSmith, Inc., model: HVS448-3000D) automates the lysis, extraction, and fractionation via ITP.
Note: A current measurement helps monitor the ITP zone migration and fractionation of the nucleus.
Send the voltage sequence to the voltage sequencer.
Connect the voltage outputs to platinum wire electrodes that will be placed to the reservoirs.
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Kuriyama, K., Shintaku, H. and Santiago, J. G. (2016). Protocol for Microfluidic System to Automate the Preparation and Fractionation of the Nucleic Acids in the Cytoplasm Versus Nuclei of Single Cells. Bio-protocol 6(12): e1844. DOI: 10.21769/BioProtoc.1844.
Download Citation in RIS Format
Category
Cell Biology > Single cell analysis > Microfluidics
Molecular Biology > DNA > DNA extraction
Molecular Biology > RNA > RNA extraction
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,845 | https://bio-protocol.org/exchange/protocoldetail?id=1845&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Aspergillus terreus Infection of Fruits and Terrein Quantification by HPLC Analysis
MG Markus Gressler
MB Matthias Brock
Published: Vol 6, Iss 12, Jun 20, 2016
DOI: 10.21769/BioProtoc.1845 Views: 7937
Edited by: Arsalan Daudi
Reviewed by: Kanika GeraTatsuki Kunoh
Original Research Article:
The authors used this protocol in Jul 2015
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jul 2015
Abstract
The opportunistic fungal human and plant pathogen Aspergillus terreus (A. terreus) can be isolated from sea water, soil or decaying organic matter such as rotting leaves and fruits. While growing on fruits A. terreus produces secondary metabolites such as terrein, which may ease its penetration into plant tissues. In addition, biological activities of terrein may support competition against other microorganisms. In summary, terrein is a small polyketide that reduces germination of seedlings, induces lesions on fruit surfaces but also shows moderate antifungal activity. With this manuscript we provide a fruit infection protocol with Aspergillus terreus with subsequent determination of terrein production rates on infected fruits using an HPLC-based quantification approach.
Keywords: Aspergillus terreus Terrein Secondary metabolite quantification Ethyl acetate extraction Banana
Materials and Reagents
Petri dish with three cams (SARSTEDT AG & Co, catalog number: 82.1473 )
T-shaped plastic spreaders (VWR International, catalog number: 30002-110 )
40 μm cell strainer (Corning, catalog number: 352340 )
50 ml screw cap tubes (Sigma-Aldrich, catalog number: T2318 )
Glass beaker (1,000 ml)
Scalpel, sterile (VWR International, catalog number: 95039-116 )
2 ml HPLC vials (VWR International, catalog number: 66020-950 )
Plastic syringes with syringe filters (nylon, 0.45 μm) (Sigma-Aldrich, catalog number: Z260428 )
Fluted cellulose filter MN 1672 (MACHEREY-NAGEL GmbH & Co. KG, catalog number: 57 20 11 )
Aspergillus terreus conidia
Strain SBUG844 (www.leibniz-hki.de/en/jena-microbial-resource-collection.html) [Jena Microbial Research Collection(JMRC)] or
Strain FGSC A1156 (www.fgsc.net) [Fungal Genetics Stock Center(FGSC)]
Organic fruits (preferable bananas, apples or peaches)
KLEENEX® C-fold towels, Kimberly-Clark Professional® (cotton tissue) (VWR International, catalog number: 10815-990 )
Deionised water, sterile
Ethanol (Carl Roth GmbH + Co. KG, catalog number: 5054.4 )
Ethyl acetate, acetic ester (Carl Roth GmbH + Co. KG, catalog number: 7336.1 )
HPLC grade methanol (Carl Roth GmbH + Co. KG, catalog number: P717.1 )
Terrein standard (Sigma-Aldrich, catalog number: T5705 )
Formic acid (Sigma-Aldrich, catalog number: 56302 )
D-Glucose (Carl Roth GmbH + Co. KG, catalog number: 6887.1 )
NaOH (Carl Roth GmbH + Co. KG, catalog number: 6771.1 )
Agar (Carl Roth GmbH + Co. KG, catalog number: 2266.1 )
NaNO3 (Carl Roth GmbH + Co. KG, catalog number: A136.1 )
KCl (Carl Roth GmbH + Co. KG, catalog number: 6781.1 )
MgSO4·7H2O (Carl Roth GmbH + Co. KG, catalog number: P027.1 )
KH2PO4 (Carl Roth GmbH + Co. KG, catalog number: 3904.1 )
ZnSO4·7H2O (Carl Roth GmbH + Co. KG, catalog number: K301.1 )
H3BO3 (Carl Roth GmbH + Co. KG, catalog number: 6943.1 )
MnCl2·4H2O (Carl Roth GmbH + Co. KG, catalog number: T881.1 )
FeSO4·7H2O (Carl Roth GmbH + Co. KG, catalog number: P015.1 )
CoCl2·6H2O (Carl Roth GmbH + Co. KG, catalog number: T889.1 )
CuSO4·5H2O (Carl Roth GmbH + Co. KG, catalog number: P024.1 )
(NH4)6Mo7O24·4H2O (Sigma-Aldrich, catalog number: 09880-100G )
Disodium ethylene diamine tetraacetate (Na2EDTA) (Sigma-Aldrich, catalog number: E9884-100G )
KOH (Carl Roth GmbH + Co. KG, catalog number: 6751.1 )
Aspergillus minimal medium (AMM) plates (see Recipes)
20x salt stock solution (see Recipes)
1,000x Hutner’s trace elements (see Recipes)
HPLC solvent A (see Recipes)
HPLC solvent B (see Recipes)
Equipment
Porcelain pestles (VWR International, catalog number: 470149-080 )
Counting cell chamber (Thoma chamber) (VWR International, catalog number: 101765-022 )
Accuracy balance
500 ml round bottom flask (VWR International, catalog number: BOHLA158-09 )
Magnetic stirrer
Magnetic stirring bar (VWR International, catalog number: 58948-954 )
Drying cabinet
Rotary evaporator (e.g.,Carl Roth GmbH + Co. KG, catalog number: PE53.1 )
High-performance liquid chromatography (HPLC) system equipped with a diode array detector (e.g., Agilent 1260 modular HPLC system) with bifunctional-phenylpropyl-modified C18 column (e.g., Sphinx RP, 4.0 x 3 x 250 mm; 5 mm) (MACHEREY-NAGEL GmbH & Co. KG, catalog number:760808.46) with a binary solvent system (solvents and running parameters see below)
Procedure
Streak Aspergillus terreus conidia from a frozen glycerol stock (60%) onto Aspergillus Minimal Medium (AMM) plate (9.2 cm diameter, 25 ml medium solidified with 2% agar) and cultivate for 4 days at 37 °C in the dark (Figure 1A).
Figure 1. Preparation of Aspergillus terreus conidia suspensions. A. AMM agar plate with Aspergillus terreus grown for 4 d at 37 °C. Note the cinnamon coloured conidia on top of the colonies. B. Aqueous suspension of conidia. C. Microscopic image of Aspergillus terreus conidia (arrows). Note the round shape of the conidia and an average size of 2.5-3.0 μm. Scale bar = 10 μm.
Collect the conidia with a spreader by adding 10 ml distilled sterile water. Filter conidia over a 45 μm cell strainer to remove any clumps and hyphal fragments and collect in a 50 ml screw cap tube (Figure 1B).
Centrifuge (10 min at 2,600 x g), wash the cells at least once with 10 ml distilled sterile water with subsequent second centrifugation (10 min, 2,600 x g) and suspend conidia in 5 ml distilled sterile water.
Estimate the conidia concentration in suspension using a counting chamber (Thoma or Neubauer chamber) (Figure 1C). If necessary, dilute the crude suspension by factor 10 or 100 in sterile water prior to counting.
Slightly wipe the surface of the fruits with 70% ethanol. Subsequently, wash with distilled water and dry the surface with a soft cotton tissue (Figure 2A).
Figure 2. Preparation of fruits for fungal infection. A. Surface disinfection with 70% ethanol. B. Longitudinal sectioning with a sterile scalpel. C. Infection with conidia suspension in the longitudinal groove. D. Incubation in a sterile glass beaker (pre-weighed) for 5 to 7 days at room temperature.
Cut the fruit longitudinally with a sterile scalpel (length around 10 cm; depth around 1.5 cm) (Figure 2B).
Inoculate with 200 μl of a conidia suspension containing 2 x 108 conidia/ml. Disperse the volume evenly over the complete length of the groove (Figure 2C). For negative control use 200 μl of sterile water. Fruits used for infection and for the control must be taken from the same batch! At least three technical replicates (three fruits, each from the same batch or parental plant) and five biological (five different batches) replicates should be carried out.
Weigh a sterile 1,000 ml glass beaker including a covering aluminium foil.
Put the fruit into the sterile 1,000 ml beaker glass and cover it with aluminium foil (Figure 1D).
Incubate the fruit for 5 to 7 days at room temperature (Figure 3).
Figure 3. Cross-section of bananas after 7 days of incubation. A. Control (mock) infected banana. B. Banana infected with 200 μl of A. terreus conidia suspension (2 x 108 conidia/ml).
Cut the fruit into pieces of approximately 2 x 2 cm size and smash the fruit in the glass beaker using a pestle.
Add a magnetic stir bar and pour 150 ml ethyl acetate into the beaker.
Extract the fruits while stirring on a magnetic stirrer at 150 rpm for 15 min.
Decant the supernatant into a 500 ml round bottom flask and repeat the extraction procedure. Pool both extracts.
For dry weight determination of bananas evaporate the fruit debris in the glass beaker under a fume hood. Subsequently dry it at 37-50 °C. Weigh the glass beaker including its cover and calculate the dry weight by subtracting the weight of the empty glass beaker as previously determined.
Evaporate the ethyl acetate from the fruit extractions to dryness using a rotary evaporator.
Solve the residue in 2 ml HPLC grade methanol. Dilute the extract in a ratio of 1:10, 1:20 and 1:50 in methanol. Filter the dilutions over a 0.45 μm nylon filter into a HPLC vial.
Run a calibration curve by applying 10 μl serial dilutions of the terrein standard (2.5 to 500 μg/ml in methanol) to a bifunctional C18 column (e.g., Macherey-Nagel Sphinx RP, 4.0 x 3 x 250 mm; 5 mm) in a modular HPLC system equipped with DAD (e.g., Agilent 1260 modular HPLC system). The following gradient (solution A = water + 0.1% formic acid, solution B = methanol) with a flow rate of 0.8 ml/min should be applied: 0.5 min = 10% B, 0.5-20 min = 10%-70% B, 20-25 min = 70%-100% B, 25-28 min = 100% B, and 28-33 min = 100%-10% B. Terrein is detected at a wavelength of 254 nm.
Generate a calibration curve from peak integrations at 254 nm.
Apply 10 μl aliquots of the diluted fruit extracts to the column.
Use the calibration curve to calculate the amount of terrein (μg) by peak integration from the UV profile. Note that the total volume of terrein extract in methanol was 2 ml.
Determine the total terrein content as terrein (μg)/dry-weight of fruit (g).
Notes
If the supernatant after the ethyl acetate extraction is not clear (contaminating fruit debris) the extract can be optionally filtered over a fluted cellulose filter.
Typical terrein yields range from 10 to 450 μg terrein per (g) of fruit dry weight depending on the type of fruits and cultivation time. To increase the accuracy of measurements on a given type of fruit, at least 15 replicates (including technical and biological replicates) should be performed.
Organic fruits should be used to avoid contaminating fungicides or pesticides, which could impede with fungal growth and terrein production. The amount of sugars in the fruits has an additional impact on terrein production and could cause experimental variations between different batches of fruits. Therefore, to quantify the terrein amount on fruits of different Aspergillus terreus strains a relative production rate (in %) can be calculated by simultaneous cultivation of a well-characterised producer such as strain SBUG844 (Zaehle et al., 2014).
Recipes
Aspergillus minimal medium plates
For 1 L:
D-Glucose10 g
20x salt stock solution (see Recipe 2)50 ml
1,000x Hutner´s trace elements (see Recipe 3)1 ml
Water900 ml
Adjust to pH 6.5 with 10 M NaOH
Agar20 g
Watermake up to 1,000 ml
Autoclave 20 min at 121 °C
20x salt stock solution
For 1 L:
NaNO3 120 g
KCl10.4 g
MgSO4·7H2O 10.4 g
KH2PO4 30.4 g
1,000x Hutner´s trace elements
For 100 ml:
ZnSO4·7H2O2.2 g
H3BO3 1.1 g
MnCl2·4H2O0.5 g
FeSO4·7H2O0.5 g
CoCl2·6H2O0.16 g
CuSO4·5H2O0.16 g
(NH4)6Mo7O24·4H2O0.11 g
Na2EDTA5.0 g
Heat to boiling, cool to 60 °C, add KOH adjusting pH to 6.5-6.8. The colour of the solution should turn to deep purple after storing in the dark for several days.
HPLC solvent A
HPLC pure water + 0.1% formic acid
Add 1 ml formic acid (98% purity) to 999 ml of water and filter
HPLC solvent B
Methanol (HPLC grade)
Acknowledgments
This protocol gives a detailed description of methods published previously in Gressler et al. (2015) and Zaehle et al. (2014). This work was financially supported by the German Science Foundation (DFG grant BR 2216/4-1) and internal funding from the Hans Knöll Institute, Jena (Germany).
References
Gressler, M., Meyer, F., Heine, D., Hortschansky, P., Hertweck, C. and Brock, M. (2015). Phytotoxin production in Aspergillus terreus is regulated by independent environmental signals. Elife 4.
Zaehle, C., Gressler, M., Shelest, E., Geib, E., Hertweck, C. and Brock, M. (2014). Terrein biosynthesis in Aspergillus terreus and its impact on phytotoxicity.ChemBiol 21(6): 719-731.
Copyright: Gressler and Brock. This article is distributed under the terms of the Creative Commons Attribution License (CC BY 4.0).
How to cite： Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Gressler, M. and Brock, M. (2016). Aspergillus terreus Infection of Fruits and Terrein Quantification by HPLC Analysis. Bio-protocol 6(12): e1845. DOI: 10.21769/BioProtoc.1845.
Gressler, M., Meyer, F., Heine, D., Hortschansky, P., Hertweck, C. and Brock, M. (2015). Phytotoxin production in Aspergillus terreus is regulated by independent environmental signals. Elife 4.07861.
Download Citation in RIS Format
Category
Microbiology > Microbe-host interactions > Fungus
Microbiology > Microbial biochemistry > Other compound
Plant Science > Plant immunity > Host-microbe interactions
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,846 | https://bio-protocol.org/exchange/protocoldetail?id=1846&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Micro-chromatin Immunoprecipitation (μChIP) Protocol for Real-time PCR Analysis of a Limited Amount of Cells
Sébastien Gillotin
François Guillemot
Published: Vol 6, Iss 12, Jun 20, 2016
DOI: 10.21769/BioProtoc.1846 Views: 8663
Reviewed by: Salma Hasan
Original Research Article:
The authors used this protocol in Jul 2015
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jul 2015
Abstract
Chromatin immunoprecipitation followed by deep sequencing (ChIP-Seq) is an important strategy to study gene regulation. When availability of cells is limited, however, it can be useful to focus on specific genes to investigate in depth the role of transcription factors or histone marks. Unfortunately, performing ChIP experiments to study transcription factors’ binding to DNA can be difficult when biological material is restricted. This protocol describes a robust method to perform μChIP for over-expressed or endogenous transcription factors using ~100,000 cells per ChIP experiment (Masserdotti et al., 2015). We also describe optimization steps, which we think are critical for this protocol to work and which can be used to further reduce the number of cells.
Keywords: Chromatin PCR MicroChIP Limited Astrocyte
Materials and Reagents
Microcentrifuge tubes (siliconized polypropylene, 1.7 ml) (Sigma-Aldrich, catalog number: T3406-250EA )
Dynabeads® Protein G (Thermo Fisher Scientific, NovexTM, catalog number: 10004D )
SYBR® green master mix (choose according to the Real-time PCR system used)
Protease cocktail inhibitor (Roche Diagnostics, catalog number: 04693116001 )
37% formaldehyde solution (Sigma-Aldrich, catalog number: F8775 )
Di(N-succinimidyl) glutarate (Sigma-Aldrich, catalog number: 80424 )
Glycine (Thermo Fisher Scientific, Fisher ScientificTM, catalog number: 10070150 )
Note: 20x glycine stock solution (2.5 M) in water
DNase-free RNase A (ThermoFisher Scientific, catalog number: EN0531 )
Proteinase K (Thermo Fisher Scientific, AmbionTM, catalog number: AM2546 )
8 M lithium chloride solution (LiCl) (Sigma-Aldrich, catalog number: L7026 )
DynaMag®-2 magnet (Thermo Fisher Scientific, NovexTM, catalog number: 12321D )
DNA MinElute kit (QIAGEN, catalog number: 28004 )
Histone mark H3K9Acetyl antibody (Abcam plc, catalog number: ab4441 )
HA antibody (Abcam plc, catalog number: ab9110 )
SDS (Sigma-Aldrich, catalog number: L3771 )
EDTA (Sigma-Aldrich, catalog number: 798681 )
Tris (TRIZMA® base) (Sigma-Aldrich, catalog number: T1503 )
Bovine serum albumin (BSA) (Sigma-Aldrich, catalog number: A3608 )
Note: 250 mg/ml BSA stock solution in water
HEPES (Sigma-Aldrich, catalog number: H3375 )
NP-40 (Ipegal®) (Sigma-Aldrich, catalog number: I-3021 )
Na-DOC (Sigma-Aldrich, catalog number: D6750 )
NaHCO3 (Sigma-Aldrich, catalog number: S5761 )
ChIP IP buffer (see Recipes)
Lysis buffer (see Recipes)
Lithium chloride (LiCl) washing buffer (see Recipes)
Tris-EDTA (TE) buffer (see Recipes)
Elution buffer (see Recipes)
Equipment
Rotating wheel
Dry heat block
Thermomixer (Eppendorf AG)
Nanodrop
Water bath sonicator (Diagenode, Bioruptor®)
Real-time PCR instrument
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Gillotin, S. and Guillemot, F. (2016). Micro-chromatin Immunoprecipitation (μChIP) Protocol for Real-time PCR Analysis of a Limited Amount of Cells. Bio-protocol 6(12): e1846. DOI: 10.21769/BioProtoc.1846.
Download Citation in RIS Format
Category
Molecular Biology > DNA > DNA-protein interaction
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,847 | https://bio-protocol.org/exchange/protocoldetail?id=1847&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Efficient Isolation of Influenza Specific CTLs
Prerak Trivedi
Stuart I. Mannering
Published: Vol 6, Iss 12, Jun 20, 2016
DOI: 10.21769/BioProtoc.1847 Views: 8306
Edited by: Jia Li
Original Research Article:
The authors used this protocol in Mar 2015
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Mar 2015
Abstract
Human antigen-specific CD8+ T-cell clones are valuable tools for dissecting CD8+ T-cell responses against antigens derived from infectious agents, cancer and self antigens. Here we describe a protocol for isolating human antigen-specific CD8+ T cells. This protocol uses surface capture of IFNγ to identify antigen responsive cells that are then cloned by single-cell sorting. Here we use CD8+ T-cell responses to influenza matrix protein (MP) as an example, but this approach can be applied to any antigen specificity.
Keywords: Cloning CD8 CTL Human T cell
Materials and Reagents
50 ml Falcon tubes
Greiner CELLSTAR®, 96-well round-bottom tissue culture plates (Sigma-Aldrich, catalog number: M9311 )
Corning® Costar® 24 and 48 well tissue culture plates (Sigma-Aldrich, catalog number: CLS3524 and CLS3548 )
10 ml tube
Vials
Peripheral blood
EBV-transformed B-cell lines (HLA-A2)
Ficoll (GE Healthcare, catalog number: 17-1440-03 )
Phosphate buffered saline (DPBS) (Lonza, catalog number: 17-512F )
Trypan blue solution (0.4%) (Sigma-Aldrich, catalog number: T8154 )
RPMI 1640 (Sigma-Aldrich, catalog number: R8758 )
Synthetic peptide(s) (Purar Chemicals)
Influenza matrix peptide 58-66 (MP58-66; GILGFVFTL) (GL-Biochem)
5% pooled human serum
Cytokines IL-2 (Peprotech, catalog number: AF-200-02 ), IL-15 (Peprotech, catalog number: AF-200-15 )
Human IFNγELISA Kit (BioLegend, catalog number: 430106 )
Miltenyi IFN-γ secretion assay kit-PE (Miltenyi Biotec, catalog number: 130-054-202 )
CD8-FITC (SK1) mAb (clone SK1) (Thermo Fisher Scientific, eBiosciencesTM, catalog number: 11-0087-42 )
Fungizone (Thermo Fisher Scientific, catalog number: 15290-018 )
Propidium iodide (Sigma-Aldrich, catalog number: 81845 )
Phorbol 12-myristate 13-acetate (PMA) (Sigma-Aldrich, catalog number: P8139 )
Ionomycin (Sigma-Aldrich, catalog number: I0634 )
Dimethyl sulfoxide (DMSO) (Sigma-Aldrich, catalog number: D2650 )
HEPES (1 M) (Life technologies, GibcoTM, catalog number: 15630-080 )
Note: Currently, it is “Thermo Fisher Scientific, GibcoTM, catalog number: 15630-080”.
Non-essential amino acids (NEAA) (Life Technologies, GibcoTM, catalog number: 11140-050 )
Note: Currently, it is “Thermo Fisher Scientific, GibcoTM, catalog number: 11140-050”.
GlutaMAXTM (Life Technologies, GibcoTM, catalog number: 35050-061 )
Note: Currently, it is “Thermo Fisher Scientific, GibcoTM, catalog number: 35050-061”.
UltraPureTM 0.5 M EDTA, pH 8.0 (Thermo Fisher Scientific, InvitrogenTM, catalog number: 15575-020 )
Penicillin-Streptomycin (Sigma-Aldrich, catalog number: P0781 )
Bovine serum albumin (BSA) (Sigma-Aldrich, catalog number: A7906 )
Stock concentration of cytokines and peptides (see Recipes)
Cell culture media (see Recipes)
Staining buffer (see Recipes)
Stock concentration of propidium iodide (PI) (see Recipes)
Stock concentration of PMA and ionomycin (see Recipes)
Stock concentration of fungizone (see Recipes)
Equipment
Megafuge 40R centrifuge (ThermoFisher, catalog number: 75004503 )
Neubauer chamber
Freezing container, Nalgene® Mr. Frosty (Sigma-Aldrich, C1562 )
Cell culture CO2 incubator (Panasonic Healthcare Co., model: MCO-20AIC ) with 5% CO2
Flow cytometer (BD Biosciences, model: BD FACSAria III )
Liquid nitrogen dewar
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Trivedi, P. and Mannering, S. I. (2016). Efficient Isolation of Influenza Specific CTLs. Bio-protocol 6(12): e1847. DOI: 10.21769/BioProtoc.1847.
Download Citation in RIS Format
Category
Immunology > Immune cell function > Antigen-specific response
Cell Biology > Cell isolation and culture > Cell isolation
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,848 | https://bio-protocol.org/exchange/protocoldetail?id=1848&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Root-knot Nematode Penetration and Sclareol Nematicidal Activity Assays
TF Taketo Fujimoto
TM Takayuki Mizukubo
HA Hiroshi Abe
SS Shigemi Seo
Published: Vol 6, Iss 12, Jun 20, 2016
DOI: 10.21769/BioProtoc.1848 Views: 10255
Edited by: Zhaohui Liu
Reviewed by: Krzysztof Wieczorek
Original Research Article:
The authors used this protocol in Apr 2015
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Apr 2015
Abstract
Plant parasitic nematodes parasitize roots and/or stems of various plants thereby inhibiting absorption of nutrients and moisture. In particular, root-knot nematodes (RKN) are a group of the most devastating pests. Various techniques, such as soil sterilization, cultivation of resistant crops, and chemical application, have been developed to control damage caused by RKN. Among these techniques, diminish by chemicals that induce or activate host defense to RKN is an attractive method because of its potential to reduce the environmental burden caused by crop protection. Sclareol, a diterpene, was identified as a chemical that induces resistance to RKN (Fujimoto et al., 2015). Here we provide a protocol for assessing the impact of sclareol on the penetration of RKNs into tomato and Arabidopsis roots and the direct nematicidal impact of the chemical on nematodes. This protocol can be used for other nematode resistance-inducing chemicals.
Keywords: Root-knot nematode Nematicidal activity Nematode penetration Stain method
Materials and Reagents
220 ml bottom opened plastic pot
Glass petri dish, 9 cm in diameter
Note: not necessary sterilized
Sterilized 50 ml glass culture bottle with cap
1 ml glass pipette
Note: Polypropylene pipette tips tend to retain Root-knot nematode (RKN), hence use of such tips should be avoided.
Sterilized 24-well tissue culture plate (e.g., IWAKI, catalog number: 3820-024 )
RKN Meloidogyne incognita (NIAS Genebank, MAFF number: 108258 )
Note: We obtained a strain 108258 of RKN from the MAFF gene bank of the National Institute of Agrobiological Sciences of Japan (http://www.gene.affrc.go.jp/about_en.php). This strain can survive and propagate on plants carrying Mi-genes for RKN resistance (resistance breaking strain).
Tomato (Solanum lycopersicum), cultivar Momotaro
Note: The cultivar Momotaro carries Mi-genes for RKN resistance. Seeds of tomato cultivars possessing Mi-genes (e.g., Momotaro) can be obtained from a seed company (Takii & Co. Ltd., Kyoto, Japan).
Arabidopsis thaliana (Columbia)
Water (Milli-Q grade)
Sodium hypochlorite solution (Nacalai Tesque, catalog number: 31518-35 )
Ethanol (99.5%) (Nacalai Tesque, catalog number: 09666-85 )
Sea sand with an average size of 0.3 mm
Note: Shift and wash sea sand to remove the pebbles and the salt with a large amount of tap water in a metal tub and autoclave the washed sand.
Liquid fertilizer (Hyponex)
Methanol (99.8%) (Nacalai Tesque, catalog number: 21915-93 )
Acid fuchsin (e.g., Sigma-Aldrich, catalog number: F8129-25G , or Wako, catalog number: 061-01332 )
Lactic acid (85~92%) (Nacalai Tesque, catalog number: 20006-75 )
Glycerol (99%) (Nacalai Tesque, catalog number: 17018-83 )
Sclareol (Sigma-Aldrich, catalog number: 357995-1G )
Sodium hydroxide (Nacalai Tesque, catalog number: 31511-05 )
Acetic acid (99%) (Nacalai Tesque, catalog number: 00211-95 )
Acid fuchsin solution (see Recipes)
100 mM sclareol solution (see Recipes)
Equipment
Greenhouse or chamber for plant growth
Stainless tweezer
Incubator (e.g., Sibata, model: SMU-0541 )
Light microscope (e.g., OLYMPUS, model: BX53M )
Refrigerator (e.g., PANASONIC, model: MPR-162DCN )
Stainless steel tray (9.2 cm in height x 18 cm depth x 32 cm width)
Scissors (e.g., V. Mueller, catalog number: 25601-164 )
Water bath (e.g., Taitec, model: SH-10N )
Note: You can also use a commercially available microwave oven for cooking.
Microwave oven (e.g., HITACHI, model: MRO-NT5 )
Stereoscopic microscope (e.g., Nikon, model: SMZ-U )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Fujimoto, T., Mizukubo, T., Abe, H. and Seo, S. (2016). Root-knot Nematode Penetration and Sclareol Nematicidal Activity Assays. Bio-protocol 6(12): e1848. DOI: 10.21769/BioProtoc.1848.
Download Citation in RIS Format
Category
Plant Science > Plant immunity > Disease bioassay
Microbiology > Microbe-host interactions > Nematode
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,849 | https://bio-protocol.org/exchange/protocoldetail?id=1849&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Extraction and Profiling of Plant Polar Glycerol Lipids
Yu Liu
XW Xuemin Wang
Published: Vol 6, Iss 12, Jun 20, 2016
DOI: 10.21769/BioProtoc.1849 Views: 11021
Edited by: Marisa Rosa
Reviewed by: Agnieszka Zienkiewicz
Original Research Article:
The authors used this protocol in May 2015
Download PDF
Ask a question
Favorite
Cited by
Original research article
The authors used this protocol in:
May 2015
Abstract
This protocol describes a method to extract total polar glycerol lipids from plant materials, followed by mass spectrometry profiling. Different glycerol lipid classes can be distinguished by their head-groups, which can be profiled automatically and quantitatively by a triple quadrupole mass spectrometry in multiple reaction monitoring (MRM) mode with an autosampler. Comparing with other established methods, such as thin layer chromatography (TLC) separation followed by Gas spectrometry (GC) analysis, this method requires little effort in sample preparation and separation, while the resolution is not limited to general lipid classes but at side chain level. This method was described and used successfully to profile plant lipids changes under freezing stress in Welti et al. (2002).
Keywords: Mass spectrometry Lipidomics Phospholipids Glycolipids
Materials and Reagents
PYREXTM screw cap culture tubes with PTFE lined phenolic caps (Thermo Fisher Scientific, catalog number: 14-933D )
Disposable glass pipettes (Thermo Fisher Scientific, Fisher ScientificTM, catalog number: 13-678-20C )
Autosampler vials (Sigma-Aldrich, catalog number: 29133-U ) with pre-cut cap (Sigma-Aldrich, catalog number: 29494-U )
TLC Silica gel 60 plate (Merck)
1 ml syringe
Injection loop
4-6 weeks old Arabidopsis rosette leaves
Note: Other plant materials can be used, additional precautions may be needed (see Notes).
Isopropanol (Thermo Fisher Scientific, catalog number: A416 )
Potassium chloride (KCl) (Sigma-Aldrich, catalog number: P9333 )
Chloroform (Thermo Fisher Scientific, catalog number: C607 )
Methanol (Thermo Fisher Scientific, Fisher ScientificTM, catalog number: A456 )
Acetic acid
Iodine
Primuline
Acetone
Nitrogen gas
Butylated hydroxytoluene (BHT) (Sigma-Aldrich, catalog number: B1378 )
7.5 M ammonium acetate solution (NH4Ac) (Sigma-Aldrich, catalog number: A2706 )
Phospholipid (PL) standard [kindly provided by Dr. Ruth Welti, (Kansas State University)]
Note: An example PL standard list is shown in Table 1.
Monogalactosyldiacylglycerol (MGDG), hydrogenated (Matreya, catalog number: 1058 )
Digalactosyldiacylglycerol (DGDG), hydrogenated (Matreya, catalog number: 1059 )
Note: The actual composition of MGDG and DGDG standards need to be determined experimentally, such as transmethylation followed by GC analysis (Politz et al., 2013).
Isopropanol solution with BHT (see Recipes)
Lipid extraction solution (see Recipes)
KCl solution (see Recipes)
Solution B (see Recipes)
Galactolipid (GL) standard (see Recipes)
Phospholipid (PL) standard (see Recipes)
Equipment
Water bath (Thermo Fisher Scientific, model: Isotemp2340 )
Water bath shaker (Labnet International, model: SWB5050 )
Nitrogen evaporator N-EVAP (Organomation, model: 111 )
Fume hood
Ultraviolet light (360 nm)
Oven (Thermo Fisher Scientific, Fisher ScientificTM, model: 13-247-650G )
API 4000 LC-MS/MS system (AB SCIEX) with TurboIonspray probe and HTC PAL autosampler (LEAP Technologies)
Table 1. Example of PL standard list
Software
Analyst 1.5.1 (AB SCIEX)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
Category
Biochemistry > Lipid > Lipid isolation
Biochemistry > Lipid > Lipid measurement
Plant Science > Plant biochemistry > Lipid
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
185 | https://bio-protocol.org/exchange/protocoldetail?id=185&type=1 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Cell Cycle Analysis and GFP Expression of Zebrafish Embryos by FACS
LJ Lili Jing
Published: Feb 20, 2012
DOI: 10.21769/BioProtoc.185 Views: 17110
Download PDF
Ask a question
Favorite
Cited by
Abstract
Cell cycle analysis in combination of GFP expression has been well used to study the cell cycle distribution of GFP labeled cells. This protocol is a method to analyze the cell cycles of GFP marked cells from zebrafish embryos.
Materials and Reagents
Phosphate buffered saline (PBS) (Life Technologies, Invitrogen™, catalog number: 14040 )
Fetal bovine serum (FBS)
Ethanol
PFA (USB)
EtOH
Formaldehyde
RNaseA
Hoechst 33342 solution (Life Technologies, Molecular Probes, catalog number: H3570 )
40 μm cell strainer (BD Biosciences, catalog number: 352340 )
Polystyrene FACS tube (BD Biosciences, Falcon®, catalog number: 352054 )
50 ml Falcon tube (BD Biosciences, catalog number: 352070 )
PI solution (see Recipes)
PBS + 5% FBS (see Recipes)
Equipment
FACS
Standard tabletop centrifuges
Water bath
Polystyrene FACS tube
Cell strainer
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2012 The Authors; exclusive licensee Bio-protocol LLC.
Category
Cell Biology > Cell imaging > Fluorescence
Cell Biology > Cell-based analysis > Flow cytometry
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,850 | https://bio-protocol.org/exchange/protocoldetail?id=1850&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Positional Analysis of Fatty Acids in Phospholipids by PLA2 Treatment
Yu Liu
XW Xuemin Wang
Published: Vol 6, Iss 12, Jun 20, 2016
DOI: 10.21769/BioProtoc.1850 Views: 6872
Edited by: Marisa Rosa
Reviewed by: Agnieszka Zienkiewicz
Original Research Article:
The authors used this protocol in May 2015
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
May 2015
Abstract
Plant phospholipids can be produced in the endoplasmic reticulum or plastids. Lipids from different sources can be distinguished by the fatty acid profile, in terms of the preferred fatty acid species esterified to the sn-1 or sn-2 position of the glycerol backbone (Ohlrogge and Browse, 1995). This protocol is used to determine the fatty acid profile in total plant phospholipids by the treatment of sn-2 specific phospholipase A2 (PLA2).
Keywords: Lipidomics Phospholipase A2 Prokaryotic pathway Eukaryotic pathway
Materials and Reagents
Glass tubes [PYREXTM screw cap culture tubes with PTFE lined phenolic caps (Thermo Fisher Scientific, Fisher ScientificTM, catalog number: 14-932H )]
Pipette 100-1,000 µl (Eppendorf Research 2100)
AxygenTM 1,000 µl universal pipette tips (Thermo Fisher Scientific, Fisher ScientificTM, catalog number: 14-222-690 )
Total plant lipids
Note: Extracted by the method described in the companion lipid extraction and profiling protocol by the same authors (Liu and Wang, 2016) and the original publication (Welti et al., 2002)
Chloroform (Thermo Fisher Scientific, catalog number: C607 )
PLA2 from honey bee venom (Sigma-Aldrich, catalog number: P9279 )
Note: Dissolved in reaction buffer to 1 unit/µl before use.
Sodium chloride (NaCl) (Sigma-Aldrich, catalog number: S7653 )
Nitrogen gas
HEPES (Sigma-Aldrich, catalog number: H3375 )
Calcium chloride (CaCl2) (Sigma-Aldrich, catalog number: C8106 )
Magnesium chloride hexahydrate (MgCl2·6H2O) (Sigma-Aldrich, catalog number: M2670 )
Methanol (Thermo Fisher Scientific, Fisher ScientificTM, catalog number: A456 )
Reaction buffer (see Recipes)
NaCl solution (see Recipes)
Extraction solution (see Recipes)
Equipment
Nitrogen evaporator N-EVAP (Meyer Organomation, model: 111 )
Ultrasonic processor with probe, work at 30% power (GEX 130PB) or similar equipment [e.g., ultrasonic processor, (Cole-parmer, model: EW-04714-51 )]
Incubator (Thermo Fisher Scientific, model: Isotemp 537D ) or similar equipment [e.g., microbiological incubators (Thermo Fisher Scientific, IsotempTM, catalog number: 15-103-0513 )]
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Liu, Y. and Wang, X. (2016). Positional Analysis of Fatty Acids in Phospholipids by PLA2 Treatment. Bio-protocol 6(12): e1850. DOI: 10.21769/BioProtoc.1850.
Download Citation in RIS Format
Category
Biochemistry > Lipid > Lipid measurement
Plant Science > Plant biochemistry > Lipid
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,851 | https://bio-protocol.org/exchange/protocoldetail?id=1851&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Retinal Differentiation of Mouse Embryonic Stem Cells
Anna La Torre
Published: Vol 6, Iss 13, Jul 5, 2016
DOI: 10.21769/BioProtoc.1851 Views: 14188
Reviewed by: Hui ZhuPatrick Ovando-Roche
Original Research Article:
The authors used this protocol in Sep 2015
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Sep 2015
Abstract
Groundbreaking studies from Dr. Yoshiki Sasai’s laboratory have recently introduced novel methods to differentiate mouse and human Embryonic Stem Cells (mESCs and hESCs) into organ-like 3D structures aimed to recapitulate developmental organogenesis programs (Eiraku et al., 2011; Eiraku and Sasai, 2012; Nakano et al., 2012; Kamiya et al., 2011). We took advantage of this method to optimize a 3D protocol to efficiently generate retinal progenitor cells and subsequently retinal neurons in vitro. This culture system provides an invaluable platform both to study early developmental processes and to obtain retinal neurons for transplantation approaches. The protocol described here has been successfully applied to several mouse ESC (including the R1, WD44 and G4 cell lines) and mouse induced-Pluripotent Stem Cell (iPSCs) lines.
Keywords: Retina Mouse Embryonic Stem Cells Embryoid Bodies Developmental Biology Organogenesis
Materials and Reagents
96-well ultra low-cell-adhesion plate, Lipidure-Coat (Amsbio LLC, catalog number: AMS.51011610 ) or PrimeSurface 96U plate (Sumitomo Bakelite, catalog number: MS-9096U )
6-well ultra low-cell-adhesion plate (Thermo Fisher Scientific, CorningTM, catalog number: 07-200-601 )
100 mm cell culture dish (Corning, BD Falcon®, catalog number: 353003 )
Glass Pasteur pipette
Mouse Embryonic Stem Cells (mESCs) or mouse Induced-Pluripotent Stem Cells (miPSCs)
Phosphate Buffer Saline (PBS) (Thermo Fisher Scientific, GibcoTM, catalog number: 10010-023 )
Water, cell culture grade (Thermo Fisher Scientific, catalog number: 15230-162 )
Dulbecco’s Modified Eagle Medium (DMEM) high glucose (Thermo Fisher Scientific, GibcoTM, catalog number: 10564-011 )
Glasgow’s MEM (GMEM) (Thermo Fisher Scientific, GibcoTM, catalog number: 11710-035 )
Dulbecco’s modified Eagle’s medium/nutrient F-12 Ham (DMEM/F12 Ham) (Thermo Fisher Scientific, GibcoTM, catalog number: 10565-018 )
Fetal Bovine Serum (FBS), ESC Qualified (Thermo Fisher Scientific, catalog number: 10439-024 )
Knock-Out Serum Replacement (KSR) (Thermo Fisher Scientific, GibcoTM, catalog number: 10828-028 )
Mixture of penicillin and streptomycin (Pen/Strep) (Thermo Fisher Scientific, GibcoTM, catalog number: 15140-122 )
Leukemia Inhibitory Factor (LIF) (Merck Millipore Corporation, catalog number: ESG1107 )
GSK3b inhibitor (Stemolecule CHIR99021) (Stemgent, catalog number: 04-0004-02 )
MAPK/ERK inhibitor (Stemolecule PD0325901) (Stemgent, catalog number: 04-0006-02 )
TrypLE Trypsin Replacement (Thermo Fisher Scientific, catalog number: 12605-028 )
10 mM non-essential amino acids (NEAA) solution (Thermo Fisher Scientific, GibcoTM, catalog number: 11140-050 )
Sodium pyruvate solution (Thermo Fisher Scientific, GibcoTM, catalog number: 11360-070 )
2-mercaptoethanol (2-ME) (Sigma-Aldrich, catalog number: M7522 )
Growth factor reduced Matrigel® (GFR Matrigel) (Corining®, catalog number: 356230 )
B27 supplement (Thermo Fisher Scientific, GibcoTM, catalog number: 17504044 )
N2 supplement (Thermo Fisher Scientific, GibcoTM, catalog number: 17502-048 )
All-trans retinoic acid (Sigma-Aldrich, catalog number: R2625-50MG )
Taurine (Sigma-Aldrich, catalog number: T-8691 )
MEF medium (see Recipes)
LIF + 2i medium (see Recipes)
Retinal Differentiation medium (RD medium) (see Recipes)
Tom’s medium (see Recipes)
Equipment
Incubator (37 °C and 5% CO2) (Thermo Scientific, model: HERACell 150i )
Centrifuge (Eppendorf, model: Conical centrifuge 5702 )
Tissue culture hood, Type B2 Biological Safety Cabinet (Thermo Scientific, model: 1300 Series Class II )
Hemocytometer (Neubauer chamber) or equivalent method
Inverted microscope (Leica, model: DMi8 )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：La Torre, A. (2016). Retinal Differentiation of Mouse Embryonic Stem Cells. Bio-protocol 6(13): e1851. DOI: 10.21769/BioProtoc.1851.
Download Citation in RIS Format
Category
Stem Cell > Embryonic stem cell > Maintenance and differentiation
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,852 | https://bio-protocol.org/exchange/protocoldetail?id=1852&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
High Fat Diet-induced Breast Cancer Model in Rat
Meng Ju Wu
CC Chun Ju Chang
Published: Vol 6, Iss 13, Jul 5, 2016
DOI: 10.21769/BioProtoc.1852 Views: 7637
Edited by: Masahiro Morita
Reviewed by: Pooja Mehta
Original Research Article:
The authors used this protocol in Jun 2015
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jun 2015
Abstract
Obesity has been linked to breast cancer progression but the underlying mechanisms remain obscure. Being overweight or obese for a woman at the time she is diagnosed with breast cancer is linked to a high risk of recurrence regardless of treatment factors. In rodents, high body weight is also associated with increased incidence of spontaneous and chemically induced tumors. To study the complex interaction between the mammary epithelia and the microenvironment, with a focus on the mechanism underlying the role obesity plays in the regulation of the cancer stem cell traits and the development of mammary cancer in vivo, we have established a diet-induced obesity (DIO) rat model of breast cancer (Chang et al., 2015).
Keywords: Obesity High-fat diet Breast cancer
Materials and Reagents
40 µm cell strainer (STEMCELL Technologies, catalog number: 27305 )
Female Sprague-Dawley rats (Envigo, Harlan Laboratories, catalog number: Sprague Dawley® SD®)
1 ml, 26 G x 3/8 in. BD Tuberculin syringe with detachable needle, slip tip (BD Biosciences, catalog number: 309625 )
N-methylnitrosourea (Sigma-Aldrich, catalog number: N1517 )
Sodium chloride (Sigma-Aldrich, catalog number: S7653 )
10% neutral formalin (Sigma-Aldrich, catalog number: HT501128 )
EpiCultTM-B Mouse Medium Kit (STEMCELL Technologies, catalog number: 05610 )
10x Gentle Collagenase/Hyaluronidase (STEMCELL Technologies, catalog number: 07919 )
Hanks’ balanced salt solution modified (HBSS) (STEMCELL Technologies, catalog number: 37150 )
Trypsin-EDTA
Ammonium chloride (NH4Cl) (STEMCELL Technologies, catalog number: 07800 )
40 µm cell strainer (STEMCELL Technologies, catalog number: 27305)
Fetal bovine serum (FBS) (Corning, catalog number: 35-011-CV )
Flow Cytometry Stain Buffer (BD Biosciences, catalog number: 554656 )
FITC-conjugated anti-OBR antibody (aa956-986, polyclonal antibody) (Lifespan Biosciences, catalog number: LS-C261832 )
Regular rat chow diet (Envigo, catalog number: 8604 ) (see Recipes)
Western diet (Research Diets, catalog number: D12079B ) (see Recipes)
0.9% saline (see Recipes)
N-methylnitrosourea solution (see Recipes)
Equipment
Dual-energy x-ray absorptometry (Lunar Corporation, model: Lunar PIXImus II Densitometer )
Cell analyzer (BD Biosciences, model: BD FACSCanto II )
Software
BD FACSDiva and FCS Express Flow Cytometry Software
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Wu, M. J. and Chang, C. J. (2016). High Fat Diet-induced Breast Cancer Model in Rat. Bio-protocol 6(13): e1852. DOI: 10.21769/BioProtoc.1852.
Download Citation in RIS Format
Category
Cancer Biology > General technique > Animal models
Cancer Biology > Proliferative signaling > Tumor formation
Cancer Biology > General technique > Tumor formation
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,853 | https://bio-protocol.org/exchange/protocoldetail?id=1853&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Identification of Natural Hybrids by SSR Markers in Mussaenda
Zhonglai Luo
TD Tingting Duan
SY Shuai Yuan
SC Shi Chen
XB Xiufeng Bai
Dianxiang Zhang
Published: Vol 6, Iss 13, Jul 5, 2016
DOI: 10.21769/BioProtoc.1853 Views: 9156
Edited by: Samik Bhattacharya
Reviewed by: Gazala Ameen
Original Research Article:
The authors used this protocol in Oct 2015
Download PDF
Ask a question
Favorite
Cited by
Original research article
The authors used this protocol in:
Oct 2015
Abstract
Detection of natural hybrids is of great significance for plant taxonomy, reproductive biology, and population genetic studies. Compared with methods depending on morphological characters, molecular markers provide reliable and much more accurate results. This protocol describes approaches employing microsatellite (SSR) markers to identify inter-specific hybrids in Mussaenda (Rubiaceae).
Keywords: Gene flow Natural hybridization SSR
Materials and Reagents
Consumables
Microfuge tubes (Corning, Axygen®, catalog number: MCT-150-C )
Pipette tips (Corning, Axygen®, catalog number: T-1000-C , T-200-C , T-300 )
Plant material
Fresh leaves of the putative hybrid individuals, as well as the parental species, were collected and dried in silica gel. It usually takes 3-5 days for complete drying of the leaves.
Chemicals
Taq PCR mastermix (Tiangen, catalog number: KT201 )
Liquid nitrogen
Absolute ethanol (Sinopharm Chemical Reagent, catalog number: 10009228 ) (ice cold)
70% ethanol (ice cold)
7.5 M ammonium acetate (Sigma-Aldrich, catalog number: A1542-250G )
Chloroform: isoamyl alcohol (24:1) (Sinopharm Chemical Reagent, catalog number: chloroform, 10006818 ; isoamyl alcohol, 10003218 )
ddH2O (sterile)
5x Loading buffer with GelRed (Shanghai Generay Biotech, catalog number: GR0205-500 )
Cetyltrimethylammonium bromide/Hexadecyl trimethyl-ammonium bromide (CTAB) (Thermo Fisher Scientific, catalog number: ICN19400480 )
Ethylenediaminetetraacetic acid (0.5M solution/pH 8.0) (EDTA) (Thermo Fisher Scientific, catalog number: BP2482-500 )
Polyvinyl pyrrolidone, MW 40,000 (PVP 40)
NaCl (Sigma-Aldrich, catalog number: S5886-500G )
HCl (Sigma-Aldrich, catalog number: 258148 )
Tris base (Thermo Fisher Scientific, catalog number: BP152-1 )
Boric acid (Sigma-Aldrich, catalog number: B0394-100G )
Agarose (Biowest, catalog number: 111860 )
Hi-DiTM formamide (Thermo Fisher Scientific, Applied BiosystemsTM, catalog number: 4311320 )
GeneScan 500Liz (Thermo Fisher Scientific, Applied BiosystemsTM, catalog number: 4322682 )
CTAB buffer (see Recipes)
1 M Tris (pH 8.0) (see Recipes)
TE buffer (see Recipes)
5x TBE (Tris-Borate-EDTA) buffer (Stock) (see Recipes)
1% agarose gel (see Recipes)
Equipment
Mortar and pestle
Microcentrifuge (Eppendorf, model: 5427R )
Water bath (IKA, model: HB10 )
PCR thermal cycler (EASTWIN, model: ETC-811 )
Agarose gel electrophoresis system [include PowerPacTM Basic Power Supply for electrophoresis (Bio-Rad Laboratories, catalog number: 1645050 )]
Genetic Analyzer (Invitrogen, model: ABI PRISM 3100 )
Software
GeneMarker version 2.4.0 (http://www.softgenetics.com/GeneMarker.html)
FSTAT version 2.9.3 (http://www2.unil.ch/popgen/softwares/fstat.htm)
GenAlEx version 6.2 (http://biology-assets.anu.edu.au/GenAlEx/Download.html)
STRUCTURE version 2.2 (http://pritchardlab.stanford.edu/software/structure2_2.html)
NewHybrids version 1.1 beta (http://ib.berkeley.edu/labs/slatkin/eriq/software/software.htm#NewHybs)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
Category
Plant Science > Plant molecular biology > DNA
Molecular Biology > DNA > Genotyping
Molecular Biology > DNA > PCR
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,854 | https://bio-protocol.org/exchange/protocoldetail?id=1854&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Chromosome Dosage Analysis in Plants Using Whole Genome Sequencing
Ek Han Tan
Luca Comai
Isabelle M. Henry
Published: Vol 6, Iss 13, Jul 5, 2016
DOI: 10.21769/BioProtoc.1854 Views: 11615
Edited by: Arsalan Daudi
Reviewed by: Rainer Melzer
Original Research Article:
The authors used this protocol in May 2015
Download PDF
Ask a question
Favorite
Cited by
Original research article
The authors used this protocol in:
May 2015
Abstract
Relative chromosome dosage, i.e., increases or decreases in the number of copies of specific chromosome regions in one sample versus another, can be determined using aligned read-counts from Illumina sequencing (Henry et al., 2010). The following protocol was used to identify the different classes of aneuploids that result from uniparental genome elimination in Arabidopsis thaliana, including chromosomes that have undergone chromothripsis (Tan et al., 2015). Uniparental genome elimination results in the production of haploid progeny from crosses to specific strains called “haploid inducers” (Ravi et al., 2014). On the other hand, chromothripsis, which was first discovered in cancer genomes, is a phenomenon that results in clustered, highly rearranged chromosomes. In plants, chromothripsis has been observed as a result of genome elimination (Tan et al., 2015). Detecting variation in chromosome dosage has multiple applications beside those linked to genome elimination. For example, a dosage variant population of poplar hybrids was created by gamma-irradiation of pollen grains. Hundreds of dosage lesions, insertions and deletions, were identified using this technique and provide a way to associate loci with the phenotypic consequences observed in this population (Henry et al., 2015).
This method has been successfully used to detect changes in chromosome dosage in many different species, including Arabidopsis thaliana (Tan et al., 2015), Arabidopsis suecica (Ravi et al., 2014), rice (Henry et al., 2010) and poplar (Henry et al., 2015). It is important to note that dosage plots always indicate dosage variation relative to the control sample used (Note 1). Therefore, this approach is not suitable to detect ploidy variants (diploid vs triploid, for example). Similarly, this technique does not allow the detection of balanced chromosomal rearrangements such as reciprocal translocations.
Keywords: Dosage Analysis Whole Genome Sequencing Chromothripsis Genome Elimination Aneuploidy
Materials and Reagents
96 microTUBE plate (Covaris Inc., catalog number: 520078 )
Genomic DNA
Illustra Nucleon Phytopure kit (GE Healthcare, catalog number: RPN8511 )
KAPA Hyper Prep kit (KAPA Biosystems, catalog number: KK8504 )
NextFlex-96 adapters (Bioo Scientific, catalog number: 514106 )
Agencourt AMPure XP (Beckman Coulter, catalog number: A63882 )
Fresh 80% ethanol (Sigma-Aldrich, catalog number: E7023 )
DEPC water (BioExpress, catalog number: G-3223-1L )
Qubit dsDNA HS Assay Kit (Thermo Fischer Scientific, catalog number: Q32854 )
Equipment
Ultrasonicator (Covaris, model: E220 Focused-ultrasonicator )
PCR cycler with 96-well plate capacity
Magnetic plate (Thermo Fischer Scientific, model: 12331D )
Qubit 2.0 (Thermo Fisher Scientific, model: Q32866 )
Illumina sequencing platform
Nanodrop 2000 spectrophotometer (Thermo Fischer Scientific, model: ND-2000C )
Software
Burrows-Wheeler aligner (Li and Durbin, 2009)
bwa (http://bio-bwa.sourceforge.net/)
bin-by-sam.py (http://comailab.genomecenter.ucdavis.edu/index.php/Bin-by-sam)
allprep (http://comailab.genomecenter.ucdavis.edu/index.php/Barcoded_data_preparation_tools)
bwa-doall (http://comailab.genomecenter.ucdavis.edu/index.php/Bwa-doall)
Python2.6 or Python2.7
Procedure
Genomic DNA fragmentation by Covaris
Isolate high quality genomic DNA and determine concentration with a minimal yield of 1 μg of and a concentration of at least 20 ng/μl. Please see Note 2 for further details.
Pipet 500 ng of DNA input into each well of the 96 microTUBE Plate and add nuclease-free water to reach 27 μl per well.
Shear DNA in the E220 Covaris sonicator with the following settings:
Peak Incident Power (W) 175
Duty Factor 5%
Cycles per Burst 200
Treatment time 60 sec
Proceed directly to the KAPA PCR-free Hyper-Prep.
KAPA PCR-free Hyper-Prep (Note 3)
End repair and A-tailing
Fragmented DNA 25 μl
End repair & A-tailing buffer (Hyper-Prep kit) 3.5 μl
End repair & A-tailing enzyme mix (Hyper-Prep kit) 1.5 μl
Total volume 30 μl
a. Incubate in a Thermal Cycler at 20 °C for 30 min followed by 65 °C for 30 min.
b. Proceed to the ligation step immediately.
Adapter ligation
End repair & A-tailing reaction 30 μl
DEPC water 3 μl
Ligation buffer (Hyper-Prep kit) 15 μl
DNA ligase (Hyper-Prep kit) 5 μl
Adapter stock (2.5 μM) 2 μl
Total volume 55 μl
a. Incubate at 20 °C for 15 min.
b. Proceed to post-ligation cleanup step immediately.
Post-ligation cleanup
Adapter ligation reaction product 54 μl
Ampure (0.8x vol) 43 μl
Total volume 97 μl
Mix gently and incubate at room temperature for 15 min to allow the DNA to bind to the beads.
Place reactions on a magnetic plate to separate beads from the solution. When the liquid is clear, remove the supernatant and wash the beads twice with 200 μl 80% ethanol.
Let the beads dry (as recommended by the manufacturer) before eluting with 25 μl DEPC water.
Pool the samples. A typical pooling strategy for 96 samples, representing 96 individual libraries for dosage analysis, would be to subpool 3 μl from groups of 12 libraries. The concentration of the 8 subpools is determined using the Qubit dsDNA HS Assay Kit and equal amounts of DNA from each subpool are then combined into a master pool. The concentration of this master pool is determined using the Qubit dsDNA HS Assay Kit and can be submitted for PCR-free Illumina sequencing if it is at least 20 ng/μl with total DNA content of ~1 μg. An additional Ampure (0.8x) purification, followed by elution at a lower volume may be required to increase the final concentration of the master pool. Irrespective of the pooling strategy, sequencing reads from pooled samples can eventually be reassigned to their respective samples based on the index sequence present in the adapters because the libraries are pooled after adapter ligation.
Submit the PCR-free libraries for sequencing [see (Note 3) for other options]. The Illumina sequencing platform used is typically single read 50 (Note 4). The number of reads needed per individual depends on the scope of the experiment and the genome size of the organism at hand [see (Notes 4, 5) as well as Figures 2 and 3].
Mapping and Dosage Plot
Trim the reads for quality and align them onto the TAIR10 genome using the Burrows-Wheeler aligner (Li and Durbin, 2009). We have provided scripts called allprep.py as well as bwa-doall.py for this purpose. Detailed documentation of these scripts is available from the links provided.
Convert .sai files to .sam files after alignment (If you are using the bwa-doall.py script, this step is automatically performed by the script.).
bwa samse [database] [filename]_aln.sai [filename].fq > [filename]_aln.sam
Run bin-by-sam.py in a folder that contains the sam files to generate dosage plots. Highly detailed directions and examples for this script is available from on the main documentation page or can be accessed directly here: http://comailab.genomecenter.ucdavis.edu/images/3/30/README-bin-by-sam.pdf.
bin-by-sam.py -o output-bin-file.txt -s size-of-bins [-c control.sam file] [-u] [-m number of max snps, default is 5] [-b] [-r] [-p ploidy for relative percent calculation] [-C].
For help on the meaning of different parameters: bin-by-sam.py –h.
Input:
Run the script in a directory with the input _aln .sam files.
Output:
One file with a line per non-overlapping, consecutive bin along each of the reference sequences and two columns for each input .sam file: one indicating the number of reads mapping to each bin and the other indicating the corresponding dosage relative to the control.
Specific example: Recommended initial dosage plot analysis based on 1 Mb-sized bins in folder containing a group of .sam files as a starting point.
bin-by-sam.py -o 1Mb_bin.txt -s 1000000
After running this initial analysis, the obtained read counts can be used as an indication of the appropriate minimum bin size. As a rule of thumb, no less than an average of 100 read counts per bin should be used (see Figures 2 and 3).
Parameters
Required:
-o, output file name (for example “-o Dosage_100kb_control2.txt”)
-s, bin size in bps (for example “-s 100000” for 100 kb bins)
Optional:
-c, to use a control sample for relative percent coverage calculations, specify the file name here. If no file is specified, the mean of all samples is used as control value for each bin (Note 1).
-u, to use only samtools flagged unique reads (XT: A: U), in which the read maps uniquely to only one location in the genome.
-m, to specify the maximum number of mapping mismatches allowed for a read to be used. This looks at .sam field 15. The default is 5. This option can be increased if reads are longer or a high number of polymorphisms are expected between the reference genome and the aligned reads. Of course, the most important consideration is to ensure that the same criteria are used for all samples.
-b, inserts empty lines between reference sequences in the result table for easier JMP parsing (Do not use if the reference sequence contains more than few major chromosomes or contigs).
-r, “remove file”, a file containing a list of reference sequences to ignore, in the sam header format. There is an included example file Remove-Sample.txt in the archive. This option can be useful if the organelle sequences are included in the genomic sequence for example (Note 6).
-p, ploidy, default is 2 (diploid), this is used as the multiplier in the relative dosage calculation.
-C, coverage only mode, which only outputs the read counts columns for each library, but not the relative dosage columns. This option cannot be used when a control library is specified.
Data analysis
The [sample]/control columns are plotted as an Overlay Plot on JMP for visualization (Figure 1). Other software platforms with graphing functions such as R can also be used as an alternative to JMP for generating the overlay plots for each (sample)/control column.
Representative data
Figure 1. Example dosage plot of a diploid (Sample 1) and a primary Chr3 trisomic (2n + 1) aneuploid (Sample 2) from Arabidopsis thaliana, based on a 100 kb bin size. Relative centromere positions are indicated by red diamonds. The noisy area around the pericentromeric regions of the trisomic Chr3 is due to increased Col-0:Ler ratio (2:1) of the trisomic chromosome when normalized to a diploid control that contains 50% Col-0 (or 1:1 Col-0:Ler). This variability is absent from the 50% Col-0:Ler diploid individual (Sample 1). Reviewing multiple individuals from the same dataset can identify regions with such variation.
Figure 2. Dosage plot analysis on a shattered aneuploid Chr1 from Arabidopsis thaliana divided in 50 kb bins (each dot represents a bin) and using variable number of reads as input: 250,000 reads (top), 1 million reads (middle) and 4 million reads (bottom). This data illustrates how increased read count is necessary for the detection of smaller dosage variations. For species with bigger genome sizes, the number of reads necessary to obtain a similar level of detection increases accordingly. Similarly, for polyploid genomes, read coverage has to be higher to compensate for the relatively smaller increase or decrease in copy number in a higher ploidy background (Figure 3).
Figure 3. Effect of polyploidy on dosage variation detection. Using data from gamma-irradiated poplar, we created an in silico "dilution series" of the signal originating from a deletion event. Reads from a diploid individual carrying a heterozygous deletion were pooled with increasing numbers of reads from a control diploid individual, to model the decrease in coverage expected from the loss of one copy out of a starting ploidy-level ranging from 2 to 12 (y-axis).
Notes
Controls for dosage plot analyses. A control euploid sequence of at least equal coverage is highly recommended for each analysis especially if there are only a few samples (less than 10). If a larger population is used or no control is available, the mean of all samples can be used as the control.
For example, for work in Tan et al., 2015, genomic DNA was isolated using the Illustra Nucleon Phytopure Kit from 2-3 medium sized Arabidopsis leaves. The resulting DNA was analyzed on a Nanodrop 2000 to determine concentration with 260/230 absorbance ratio of around 2. For reliable results, the DNA must be free of RNA, nucleotides, or other compounds that have a spectral light absorbance similar to that of DNA. If using a different protocol for DNA isolation, running 100 ng of the resulting DNA on an electrophoresis gel should show high molecular weight bands devoid of RNA with no smearing, along with the expected 260/230 absorbance readings from Nanodrop 2000.
Although a PCR-free method is described here, amplified genomic libraries as well as exon capture libraries have been used successfully for this analysis.
Because of the technology used by Illumina’s sequencing platform, each sequencing read represents a single data point such that single 50 bp reads, single 100 bp reads or 100 bp paired-end reads each account for one data point in this analysis. The more expensive paired-end reads should therefore only be used if the additional sequence data is needed for mapping or other purposes, such as SNP analysis.
The depth of sequencing determines the sensitivity of the analysis. For Arabidopsis thaliana, a read count of one hundred thousand is adequate to detect primary aneuploidies at a bin size of 150-200 kb. Finer dosage changes (10-50 kb) will require around 1 million reads (Figure 2).
During the analysis, it is important to compare samples. In our experience, there are regions of the genome that exhibit variability in the dosage plots even in control samples, such as, for example, pericentromeric regions or other repeated regions (Figure 1). This is particularly relevant when mapping reads from one species or variety to a reference sequence from a closely-related yet different species. Additionally, in some species, regions similar to organellar sequences are sometimes included in the genomic reference sequence. Because variable amounts of organellar DNA are often co-purified with the genomic DNA, such regions exhibit wide variation in coverage. These types of variable regions are normally easy to identify as they vary in opposite directions in different samples and should be discarded from analysis. If the reference sequence fasta file contains one or two organellar genome sequences, these can be removed using the -r option, or can be omitted when plotting relative dosage.
Acknowledgments
This work was funded by HHMI and the Gordon and Betty Moore Foundation (GBMF) through grant GBMF3068 to L.C. and by the DOE Office of Science, Office of Biological and Environmental Research (BER), grants no. DE-SC0007183 (to L.C. and I.M.H.). This protocol was adapted from Tan et al. (2015).
References
Henry, I. M., Dilkes, B. P., Miller, E. S., Burkart-Waco, D. and Comai, L. (2010). Phenotypic consequences of aneuploidy in Arabidopsis thaliana. Genetics 186(4): 1231-1245.
Henry, I. M., Nagalakshmi, U., Lieberman, M. C., Ngo, K. J., Krasileva, K. V., Vasquez-Gross, H., Akhunova, A., Akhunov, E., Dubcovsky, J., Tai, T. H. and Comai, L. (2014). Efficient genome-wide detection and cataloging of EMS-induced mutations using exome capture and next-generation sequencing. Plant Cell 26(4): 1382-1397.
Henry, I. M., Zinkgraf, M. S., Groover, A. T. and Comai, L. (2015). A System for Dosage-Based Functional Genomics in Poplar. Plant Cell 27(9): 2370-2383.
Li, H. and Durbin, R. (2009). Fast and accurate short read alignment with Burrows-Wheeler transform. Bioinformatics 25(14): 1754-1760.
Ravi, M., Marimuthu, M. P., Tan, E. H., Maheshwari, S., Henry, I. M., Marin-Rodriguez, B., Urtecho, G., Tan, J., Thornhill, K., Zhu, F., Panoli, A., Sundaresan, V., Britt, A. B., Comai, L. and Chan, S. W. (2014). A haploid genetics toolbox for Arabidopsis thaliana. Nat Commun 5: 5334.
Tan, E. H., Henry, I. M., Ravi, M., Bradnam, K. R., Mandakova, T., Marimuthu, M. P., Korf, I., Lysak, M. A., Comai, L. and Chan, S. W. (2015). Catastrophic chromosomal restructuring during genome elimination in plants. Elife 4.
Copyright: Tan et al. This article is distributed under the terms of the Creative Commons Attribution License (CC BY 4.0).
Category
Plant Science > Plant molecular biology > DNA
Systems Biology > Genomics > Sequencing
Systems Biology > Genomics > Functional genomics
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,855 | https://bio-protocol.org/exchange/protocoldetail?id=1855&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Estimation of the Chromosomal Copy Number in Synechococcus elongatus PCC 7942
Satoru Watanabe
Hirofumi Yoshikawa
Published: Vol 6, Iss 13, Jul 5, 2016
DOI: 10.21769/BioProtoc.1855 Views: 7701
Edited by: Maria Sinetova
Reviewed by: Christian RothDamián Lobato-Márquez
Original Research Article:
The authors used this protocol in Sep 2015
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Sep 2015
Abstract
Cyanobacteria are prokaryotic organisms that perform oxygenic photosynthesis. Freshwater cyanobacteria, such as Synechococcus elongatus PCC 7942 and Synechocystis sp. PCC 6803, are model organisms for the study of photosynthesis, gene regulation, and biotechnological applications because they are easy to manipulate genetically. However, while studying these cyanobacteria, care has to be taken with respect to genetic heterogeneity in the establishment of gene disruptants, because these cyanobacteria contain multiple chromosomal copies per cell. Here, we describe a method for the estimation of chromosomal copy number in Synechococcus 7942. Using this method, we have recently observed that the chromosomal copy number of Synechococcus 7942 significantly changes during its growth phases. This technique is available for studying polyploidy not only in cyanobacteria, but also in other polyploid organisms.
Keywords: Cyanobacteria Ploidy Bacterial Cell Cycle
Materials and Reagents
Plastic disposable dish (for BG-11 plates)
1.5 ml microtubes
Synechococcus elongatus PCC 7942
Escherichia coli K-12 W3110
Chloramphenicol (Nacalai tesque, catalog number: 06285 )
Glutaraldehyde solution (50% in water) (KANTO KAGAKU, catalog number: 17026-32 )
Tween 20 (KANTO KAGAKU, catalog number: 40350-02 )
Phosphate buffered saline (PBS) (Sigma-Aldrich, catalog number: D5652 )
Liquid nitrogen
Trisodium citrate dihydrate (KANTO KAGAKU, catalog number: 37150-00 )
SYTOX Green Nucleic Acid Stain (5 mM solution in DMSO) (Thermo Fisher Scientific, catalog number: S7020 )
BG-11 liquid medium (Castenholz, 1988) (see Recipes)
BG-11 plates (see Recipes)
50x BG-11 stock (see Recipes)
1,000x Micro elements A6 (see Recipes)
1,000x K2HPO4 (see Recipes)
1,000x CaCl2 (see Recipes)
1,000x Ammonium Iron(lll) citrate brown (see Recipes)
1,000x Na2S2O3 (see Recipes)
1 M HEPES-KOH (pH 8.2) (see Recipes)
M9 medium (Sambrook et al., 1989) (see Recipes)
10x M9 salt (see Recipes)
PBS buffer (see Recipes)
Equipment
Plant growth chamber (TOMY, model: CLE-405 )
Growth chamber (YAMATO, model: IC602 )
Laboratory shaker (TAITEC, model: PERSONAL11 )
UV/Vis spectrophotometer (Shimadzu, model: UV-1800 )
Pharmaceutical refrigerator (Panasonic, model: MPR-3120CN-PJ )
Rotator (TAITEC, model: RT-50 )
FACS Calibur instrument (BD Biosciences, FACSCaliburTM)
100 ml test tubes (for culturing)
Microtube centrifuge (TOMY, model: MX-107 )
Software
Analytical software: BD CellQuest Pro (Becton-Dickinson)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
How to cite： Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Watanabe, S. and Yoshikawa, H. (2016). Estimation of the Chromosomal Copy Number in Synechococcus elongatus PCC 7942. Bio-protocol 6(13): e1855. DOI: 10.21769/BioProtoc.1855.
Watanabe, S., Ohbayashi, R., Kanesaki, Y., Saito, N., Chibazakura, T., Soga, T. and Yoshikawa, H. (2015). Intensive DNA replication and metabolism during the lag phase in cyanobacteria. PLoS One 10(9): e0136800.
Download Citation in RIS Format
Category
Molecular Biology > DNA > DNA quantification
Microbiology > Microbial genetics > DNA
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,856 | https://bio-protocol.org/exchange/protocoldetail?id=1856&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Aorta Ring Assay
Jing Jin
XH Xinyang Hu
LZ Ling Zhang
Jian'an Wang
Published: Vol 6, Iss 13, Jul 5, 2016
DOI: 10.21769/BioProtoc.1856 Views: 14559
Reviewed by: Letizia De Chiara
Original Research Article:
The authors used this protocol in Jun 2015
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jun 2015
Abstract
Angiogenesis is the nature and pathological process of blood vessel growth from pre-existing vascular buds. It plays an important role in cancer and cardiovascular disease. The aorta ring assay is an approach to study angiogenesis. In this experiment, we used the aorta of rat as the study material, cleaned the surrounding tissue of aorta and cut it into 1 mm long rings. Next, the rings were cultured in growth factor-reduced matrigel polymerized at 37 °C. Angiogenesis was assessed at 7 days by using an inverted microscope platform.
Materials and Reagents
10 cm dish (Thermo Scientific, catalog number: 172931 )
24 well plates (Thermo Scientific, catalog number: 142475 )
2 ml and 5 ml disposable sterilized syringe
Sprague-Dawley 4-week old rat (Zhejiang Chinese Medical University Animal Center)
Growth factor-reduced matrigel (Corning, catalog number: 354230 )
Dulbecco’s Modification of Eagle’s Medium with 1 g/L glucose glutamine & sodium pyruvate (Mediatech, catalog number: 10-014-CV )
Fetal Bovine Serum (Biological Industries, catalog number: 04-001-1A )
Phosphate buffer saline (PBS) (Shanghai ji’nuo, catalog number: GNM 20012 )
Chloral hydrate (Guoyao chemical reagent co. LTD, catalog number: 30037517 )
70% ethanol
Medium (see Recipes)
4% chloral hydrate (see Recipes)
Equipment
Surgical scissors, scalpel and tweezers
Ruler
37 °C, 5% CO2 cell culture incubator (Thermo Fisher Scientific, catalog number: 51026334 )
Inverted microscope (Leica Microsystems, model: DMi1 )
Electronic scale
Software
Image-Pro Plus 6.0
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Jin, J., Hu, X., Zhang, L. and Wang, J. (2016). Aorta Ring Assay. Bio-protocol 6(13): e1856. DOI: 10.21769/BioProtoc.1856.
Download Citation in RIS Format
Category
Developmental Biology > Cell growth and fate > Angiogenesis
Cell Biology > Tissue analysis > Tissue isolation
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,857 | https://bio-protocol.org/exchange/protocoldetail?id=1857&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Locomotion Activity Measurement in an Open Field for Mice
Levente Gellért
Dániel Varga
Published: Vol 6, Iss 13, Jul 5, 2016
DOI: 10.21769/BioProtoc.1857 Views: 20045
Edited by: Soyun Kim
Original Research Article:
The authors used this protocol in Jul 2015
Download PDF
Ask a question
Favorite
Cited by
Original research article
The authors used this protocol in:
Jul 2015
Abstract
The Open Field (OF) paradigm is one of the most known primary behavioral tests to evaluate locomotion and exploration. Altered OF behaviour is relatively simple to observe, but understanding and explaining the reasons for the observed changes is a complex task. Generally, there are two factors, which determine the behavior in this paradigm; one, a positive exploratory drive originating from the nature of rodents to explore new environments (for food and shelter); and two, the animal nature of avoiding open and brightly lit spaces (exposure to predators).
OF measures locomotor activity, exploratory drive, neophobia and certain aspects of anxiety in rodents at the same time. Furthermore, one can differ between horizontal and vertical activities (number of rearings) in the OF. After all, an altered OF behavior might come from the alterations of all of the above mentioned measures. For the proper interpretation of experimental results one has to be careful.
With the aid of the present protocol we investigated the effect of systemic L-kynurenine sulphate on open field behavior of adult male C57Bl/6j mice (Varga et al., 2015).
Keywords: Open field behavior Moving pattern MANOVA Animal handling Digital video tracking
Materials and Reagents
Adjustable dim light illumination is supplied with conventional argon light tubes
Custom-made OF box prepared from common household plexiglass (Figure 1)
Latex gloves
8-10-week-old male C57Bl/6j mice (n = 55) weighing 20-26 g
Note: The animals were housed under controlled laboratory conditions, in groups of 5, under an inverse 12-h dark/light cycle, with ad libitum access to food and tap water. To avoid the effects of shipping stress a 2-week habituation period was used before initiation of the behavioral testing. All housing and experiments were conducted in accordance with the European Communities Council Directives (86/609/ECC) and the Hungarian Act for the Protection of Animals in Research (XXVIII.tv. 32. §). Efforts were made to minimize the number of animals used and to reduce pain and discomfort.
Figure 1. Custom-made OF box prepared from common household plexiglass. Digital video tracking can be performed with a conventional coloured CCD camera fixed and positioned above the OF arena with a telescopic tripod stand.
Equipment
Video-tracking system (Harvard Apparatus, model: SMART® v 3.0 ) connected to personal computer.
Coloured CCD camera (Sony, model: SSC-DC378P )
Telescopic tripod stand (Manfrotto, model: 420b )
Software
Multivariate ANOVA (mANOVA) (IBM Corporation, SPSS Statistics version 20)
SMART® software
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
Category
Neuroscience > Behavioral neuroscience > Cognition
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,858 | https://bio-protocol.org/exchange/protocoldetail?id=1858&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Measurement of mRNA Decay in Mouse Embryonic Fibroblasts
LQ Lian-Qun Qiu
WL Wi S. Lai
DS Deborah J. Stumpo
PB Perry J. Blackshear
Published: Vol 6, Iss 13, Jul 5, 2016
DOI: 10.21769/BioProtoc.1858 Views: 11130
Edited by: Ivan Zanoni
Original Research Article:
The authors used this protocol in Apr 2015
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Apr 2015
Abstract
mRNA stability control is a critical step in the post-transcriptional regulation of gene expression. Actinomycin D, an antibiotic initially used as an anti-cancer drug, has turned out to be a convenient tool for studying the turnover rates of transcripts in cells, due to its inhibition of mRNA synthesis. Here, we describe a protocol for the measurement of mRNA decay after adding actinomycin D into the medium of stable fibroblast cell lines derived from wild-type and tristetraprolin (TTP)-deficient mouse embryonic fibroblast (MEF) cultures, as well as a protocol for determining the relative transcript abundance using semi-quantitative real-time RT-PCR. Northern blotting or NanoString n-Counter are alternative methods to measure mRNA abundance, which is quantified using a phosphorimager in the former case. This protocol is suitable for studying primary cultured cells and stable cell lines derived from transgenic mice and their respective controls, and provides for direct comparisons of mRNA decay rates in otherwise identical cells with and without the gene of interest.
Keywords: MRNA decay Mouse embryonic fibroblasts Actinomycin D Real-time RT-PCR
Materials and Reagents
60-mm sterile Petri dish (e.g., BD Biosciences, Falcon®, catalog number: 353002 )
Note: Currently, it is “Corning, Falcon®, catalog number: 353002”.
T-75 tissue culture flask (e.g., BD Biosciences, Falcon®, catalog number: 353136 )
Note: Currently, it is “Corning, Falcon®, catalog number: 353136”.
50 ml sterile conical tube (e.g., BD Biosciences, Falcon®, catalog number: 352070 )
Note: Currently, it is “Corning, Falcon®, catalog number: 352070”.
384-well microplate (e.g., BioExpress, catalog number: T-6062-1 )
1.7 ml RNase-free, DNase-free Posi-Click tubes (Denville Scientific Inc., catalog number: C2170 )
Mouse wild-type (WT) and TTP-deficient stable fibroblast cell lines (Lai WS et al., 2006)
1x Phosphate-buffered saline (PBS) without calcium and magnesium
0.05% trypsin/EDTA (Thermo Fisher Scientific, GibcoTM, catalog number: 25300 )
Fetal bovine serum defined (FBS) (GE Healthcare, HyCloneTM, catalog number: SH30070.03 )
Dulbecco’s modified Eagle medium (DMEM) (Thermo Fisher Scientific, GibcoTM, catalog number: 11965-092 )
Penicillin-Streptomycin 10,000 U/ml (Thermo Fisher Scientific, GibcoTM, catalog number: 15140-122 )
L-glutamine 200 mM (Thermo Fisher Scientific, GibcoTM, catalog number: 25030-081 )
Recombinant mouse tumor necrosis factor (TNF) (R&D Systems, catalog number: 410-MT )
Actinomycin D (Sigma-Aldrich, catalog number: A4262 )
Illustra RNAspin MiniRNA isolation kit (Sigma-Aldrich, GE Healthcare, catalog number: 25-0500-72 )
SuperScript First-Strand Synthesis System (Thermo Fisher Scientific, InvitrogenTM, catalog number: 18080-051 )
Power SYBR Green master mix (Thermo Fisher Scientific, Applied BiosystemsTM, catalog number: 4368702 )
Mercaptoethanol (Sigma-Aldrich, catalog number: M3148 )
DEPC water (Baltimore Bioworks, catalog number: WA-137-500 )
Primers for transcripts of interest
70% ethanol
Complete medium (see Recipes)
Serum-starving medium (see Recipes)
Equipment
37 °C, 5% CO2 forced-air incubator (e.g., Thermo Fisher Scientific, FormaTM, model: 3110 )
Centrifuge with swinging-bucket rotor and adaptors for 50-ml conical tubes
ABI Prism 7900HT Real-Time PCR System and Sequence Detection System (Applied Biosystems, model: 7900HT ) or similar
Vortex-Genie-2 (Scientific Industries, catalog number: SI-0236 ) or similar
Nanodrop 2000c spectrophotometer (Thermo Scientific, model: 2000c )
Desktop centrifuge (e.g., Eppendorf, model: 5417R )
DNA Engine Peltier Thermal Cycler (Bio-Rad Laboratories, MJ research, catalog number: PTC-200 ) or similar
Cell scraper (Corning, Costar, catalog number: 3010 )
Software
GraphPad Prism software (GraphPad Software, model: version 6.0)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Qiu, L. Q., Lai, W. S., Stumpo, D. J. and Blackshear, P. J. (2016). Measurement of mRNA Decay in Mouse Embryonic Fibroblasts. Bio-protocol 6(13): e1858. DOI: 10.21769/BioProtoc.1858.
Download Citation in RIS Format
Category
Immunology > Immune cell function > General
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
1 Q&A
Thank you for sharing your protocol! What is the reagent "VRC"? Ribonucleoside Vanadyl Complex ? Also, about how much RNA do you usually end with?
1 Answer
44 Views
Aug 13, 2022
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,859 | https://bio-protocol.org/exchange/protocoldetail?id=1859&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Mouse Embryonic Fibroblast Cell Culture and Stimulation
LQ Lian-Qun Qiu
WL Wi S. Lai
DS Deborah J. Stumpo
PB Perry J. Blackshear
Published: Vol 6, Iss 13, Jul 5, 2016
DOI: 10.21769/BioProtoc.1859 Views: 20852
Edited by: Ivan Zanoni
Original Research Article:
The authors used this protocol in Apr 2015
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Apr 2015
Abstract
Culture of mouse embryonic fibroblast (MEF) cells represents a powerful system to test gene function due to their easy accessibility, rapid growth rates, and the possibility of a large number of experiments. Fibroblasts are a group of heterogeneous resident cells of mesenchymal origin that have various locations, diverse appearances and distinctive activities. Because of their ubiquitous distribution as tissue cells, these cells are poised to respond to factors released by newly activated innate immune cells, thus becoming a useful tool to study inflammation and immunity. Here, we describe procedures for mouse embryonic fibroblast cell isolation, primary culture, and stimulation. Specifically, we have optimized a step of serum starvation prior to stimulation. This step is necessary to maintain the quiescent status of these cells before they are exposed to pro-inflammatory stimuli for optimal responses. As shown in our previous studies, these mouse fibroblasts do not express Tnf, Csf2 or Il2 mRNAs at levels readily detectable by routine northern blotting techniques (Lai WS et al., 2006).
Keywords: Mouse embryonic fibroblast Primary cell culture Tumor necrosis factor Serum starvation
Materials and Reagents
60-mm sterile petri dish (e.g., BD Biosciences, Falcon®, catalog number: 353002 )
Note: Currently, it is “Corning, Falcon®, catalog number: 353002”.
100-mm sterile petri dish (e.g., Corning, catalog number: 430167 )
Note: Currently, it is “Corning, Falcon®, catalog number: 430167”.
50 ml sterile conical tube (e.g., BD Biosciences, Falcon®, catalog number: 352070 )
Note: Currently, it is “Corning, Falcon®, catalog number: 352070”.
5 ml sterile serological pipettes (e.g., Corning Costar®, catalog number: 4051 )
Mice (Male and female, ideally at 8-12 weeks of age)
Ice
Recombinant mouse tumor necrosis factor (TNF) (R&D Systems, catalog number: 410-MT )
1x Phosphate-buffered saline (PBS) without calcium and magnesium
70% ethanol
0.25% trypsin/EDTA (Thermo Fisher Scientific, GibcoTM, catalog number: 25200-056 )
0.05% trypsin/EDTA (Thermo Fisher Scientific, GibcoTM, catalog number: 25300 )
Fetal bovine serum defined (FBS) (GE Healthcare, HyClone, catalog number: SH30070.03 )
Dulbecco’s modified Eagle medium (DMEM) (Thermo Fisher Scientific, GibcoTM, catalog number: 11965-092 )
Penicillin-Streptomycin 10,000 U/ml (Thermo Fisher Scientific, GibcoTM, catalog number: 15140-122 )
L-glutamine 200 mM (Thermo Fisher Scientific, GibcoTM, catalog number: 25030-081 )
Rinsing medium (see Recipes)
Complete medium (see Recipes)
Serum-starving medium (see Recipes)
Equipment
Dissecting microscope (e.g., Leica Microsystems, model: MZ6 )
Dissecting instruments: tweezers and scissors
NuAire Biological Safety Cabinet, class II, or similar
37 °C, 5% CO2 forced-air incubator (e.g., Thermo Fisher Scientific, FormaTM, model: 3110 )
Centrifuge with swinging-bucket rotor and adaptors for 50-ml conical tubes
CO2 chamber for mouse euthanization
37 °C shaker water bath (e.g., Thermo Fisher Scientific, PrecisionTM, model: Shaker Bath 25 )
Autoclaved razor blades
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Qiu, L. Q., Lai, W. S., Stumpo, D. J. and Blackshear, P. J. (2016). Mouse Embryonic Fibroblast Cell Culture and Stimulation. Bio-protocol 6(13): e1859. DOI: 10.21769/BioProtoc.1859.
Download Citation in RIS Format
Category
Immunology > Immune cell isolation > Maintenance and differentiation
Cell Biology > Cell isolation and culture > Cell isolation
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
186 | https://bio-protocol.org/exchange/protocoldetail?id=186&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Analysis of Mouse Liver Glycogen Content
Peichuan Zhang
Published: Vol 2, Iss 10, May 20, 2012
DOI: 10.21769/BioProtoc.186 Views: 39652
Download PDF
Ask a question
Favorite
Cited by
Abstract
Liver is the major site for glycogen storage. Glycogen content can be significantly altered upon disruption of glucose homeostasis in metabolic syndromes, such as diabetes. Glycogen content can be determined by an acid-hydrolysis method (Passonneau and Lauderdale, 1974). Basically, glucose, the hydrolysis product of glycogen, is converted into glucose-6-phosphate (G-6-P) by hexokinase in the presence of ATP. With the supply of NADP, G-6-P is further converted into 6-phosphogluconic acid by G-6-P dehydrogenase (G-6-PDH), while production of NADPH can be measured spectrophotometrically. Our lab has used this method to demonstrate that liver glycogen levels are significantly elevated in diabetic Perk knockout mice (Zhang et al., 2002).
Materials and Reagents
Hydrochloric acid (Sigma-Aldrich, catalog number: 653799 )
Sodium hydroxide
Glucose (HK) assay reagent (Sigma-Aldrich, catalog number: G2020 )
Beta-D(+)-glucose (Sigma-Aldrich, catalog number: G5767 )
ddH2O
Liquid nitrogen
2.0 M HCl
2.0 M NaOH
Equipment
Centrifuges (Eppendorf, Model 5415D )
Cryogenic vials (Thermo Fisher Scientific, catalog number: 5000-0012 )
2 ml Eppendorf tube with locking lid (Thermo Fisher Scientific, catalog number: 02-681-299 )
Spectra Max 384 spectrophotometer (Molecular Devices)
Balance
Quartz cuvette
Scissors
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2012 The Authors; exclusive licensee Bio-protocol LLC.
Category
Biochemistry > Carbohydrate > Glycogen
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,860 | https://bio-protocol.org/exchange/protocoldetail?id=1860&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Isolation and Primary Culture of Adult Mouse Cardiac Fibroblasts
MZ Maria Patapia Zafeiriou
CN Claudia Noack
Laura Cecilia Zelarayan
Published: Vol 6, Iss 13, Jul 5, 2016
DOI: 10.21769/BioProtoc.1860 Views: 18383
Reviewed by: Jingli Cao
Original Research Article:
The authors used this protocol in Sep 2014
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Sep 2014
Abstract
Fibroblasts are often used as a feeder layer for progenitor or stem cells in co-culture systems. In the heart fibroblasts are important for cardiac development, homeostasis, and remodelling. They provide cardiomyocytes and progenitor cells not only with nutrition but also secrete extracellular matrix that forms the microenvironment that ensures cell survival and function. Although different kinds of mouse fibroblasts have been used in co-cultures (embryonic, skin and cardiac fibroblasts) adult mouse cardiac fibroblasts (AMCFs) create the closest microenvironment to the adult murine heart for culturing adult mouse cardiac progenitor cells. This protocol describes the isolation of cardiac fibroblasts from adult mouse hearts as well as their maintenance in culture.
Materials and Reagents
Falcon tubes (50 ml) (Sarsdtedt)
Sterile pipets (Sarsdtedt)
100 mm cell culture dishes (Sarsdtedt)
Aluminum foil
Adult mouse hearts from freshly euthanized mice (C57Bl6/J)
NaCl (Carl Roth, catalog number: 3957.2 )
KCl (Carl Roth, catalog number: HNO2.3 )
Na2HPO4 (Carl Roth, catalog number: 4984.1 )
KH2PO4 (AppliChem, catalog number: A2946 )
CaCl2 (AppliChem, catalog number: A3652 )
MgSO4.7H2O (AppliChem, catalog number: A1037 )
NaHCO3 (AppliChem, catalog number: A1940 )
Collagenase II (Worthington, catalog number: LS004177 )
2.5% Trypsin (Thermo Fisher Scientific, GibcoTM, catalog number: 15090-046 )
DMEM/F12 (Thermo Fisher Scientific, GibcoTM, catalog number: 31331-028 )
PBS (without CaCl2, MgCl2) (Thermo Fisher Scientific, GibcoTM, catalog number: 14190-94 )
FBS (Thermo Fisher Scientific, GibcoTM, catalog number: 10270-106 )
PenStrep (Thermo Fisher Scientific, GibcoTM, catalog number: 15140-122 )
L-glutamine (Thermo Fisher Scientific, GibcoTM, catalog number: 25030-024 )
Ascorbic acid (AppliChem, catalog number: A1052 )
PBS (see Recipes)
Hanks balanced salt solution (HBSS) (see Recipes)
Collagenase II stock (see Recipes)
Digestion buffer (see Recipes)
Fibroblast medium (see Recipes)
Equipment
Scalpel, forceps and scissors (Fine Science Tools)
Autoclaved glass beaker (100 ml) with magnetic stirrer
Sterile cell culture hood
Cell culture incubator (Labotect Labor-Technik Göttingen)
Magnetic stirrer with thermostat (IKA®-Werke GmbH & CO. KG)
Cell culture centrifuge (Eppendorf, model: 5417R )
Autoclave
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Zafeiriou, M. P., Noack, C. and Zelarayan, L. C. (2016). Isolation and Primary Culture of Adult Mouse Cardiac Fibroblasts. Bio-protocol 6(13): e1860. DOI: 10.21769/BioProtoc.1860.
Download Citation in RIS Format
Category
Cell Biology > Cell isolation and culture > Cell isolation
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
Subsets and Splits
No saved queries yet
Save your SQL queries to embed, download, and access them later. Queries will appear here once saved.