id
int64 7
5.24k
| url
stringlengths 48
63
| content
stringlengths 567
149k
|
|---|---|---|
1,681 | https://bio-protocol.org/exchange/protocoldetail?id=1681&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Generation of Mouse Thyroid Calcitonin-producing Cell Tumors from Primary Mouse Tumors
SK Shunsuke Kitajima
FL Fengkai Li
Chiaki Takahashi
Published: Vol 5, Iss 24, Dec 20, 2015
DOI: 10.21769/BioProtoc.1681 Views: 8050
Reviewed by: Hong Lok LungKristopher Marjon
Original Research Article:
The authors used this protocol in May 2015
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
May 2015
Abstract
Medullary thyroid cancers (MTCs) are derived from calcitonin-producing cells (C cells) of neuroendocrine origin. Rb heterozygous mice develop low-grade C cell adenocarcinoma following biallelic inactivation of the Rb tumor suppressor gene loci. Additional inactivation of another tumor suppressor gene such as Trp53, Arf or Cdkn1a allows Rb-deficient mice to generate more aggressive C cell adenocarcinoma (Takahashi et al., 2006; Shamma et al., 2009; Kitajima et al., 2015). To characterize C cell adenocarcinoma cells derived from Rb-deficient mice of different genetic backgrounds, we attempted to extract C cell adenocarcinoma cells from primary thyroid tumor tissue. Since primary mouse small cell lung cancer (SCLC) cells those originate in neuroendocrine cells that also stems C cells, can be established both as non-adhesive and adhesive cells (Calbo et al., 2011), we applied their method to MTCs. Here we describe our isolation technique for non-adhesive and adhesive cell cultures from primary medullary thyroid tumor tissue. We found that the molecular markers of C cell such as Calcitonin and Ascl1 are predominantly enriched in the non-adhesive population (Kitajima et al., 2015). This is in line with the fact that one of most commonly distributed human MTC cell line TT is non-adhesive.
Keywords: Retinoblastoma Thyroid Medullary Cancer Calcitonin C cell Mouse
Materials and Reagents
12 well cell culture plate (Thermo Fisher Scientific, catalog number: 150628 )
100 mm cell culture dish (Thermo Fisher Scientific, catalog number: 172931 )
5 ml centrifuge tube (Thermo Fisher Scientific, catalog number: 339650 )
Phosphate buffered saline (PBS) (pH 7.2) (Life Technologies, catalog number: 20012027 )
Note: Currently, it is “Thermo Fisher Scientific, GibcoTM, catalog number: 20012027”.
100x Antibiotic-Antimycotic (Life Technologies, catalog number: 15240062 )
Note: Currently, it is “Thermo Fisher Scientific, GibcoTM, catalog number: 15240062”.
Dulbecco’s modified Eagle's medium (DMEM) (Wako Pure Chemical Industries, catalog number: 04330085 )
3,000 U/ml Collagenase from Clostridium histolyticum (Sigma-Aldrich, catalog number: C5138 )
1,000 U/ml Hyaluronidase (Wako Pure Chemical Industries, catalog number: 08006201 )
20 mg/ml Deoxyribonuclease I from bovine pancreas (Sigma-Aldrich, catalog number: DN25 )
Fetal bovine serum (FBS) (Thermo Fisher Scientific, catalog number: SH3091003 )
Note: Currently, it is “GE Healthcare, catalog number: SH3091003”.
Penicillin-Streptomycin Mixed Solution (Nakarai tesque, catalog number: 2625384 )
0.5 g/l-Trypsin/0.53 mmol/l-EDTA Solution, with Phenol Red (Nakarai tesque, catalog number: 3277834 )
7-AAD (BD Pharmingen, catalog number: 5168981E )
CELLBANKER1 (Nippon Zenyaku Kogyo Co., ZENOAQ, catalog number: CB011 )
Wash buffer (see Recipes)
Digestion solution (see Recipes)
Growth medium (see Recipes)
Equipment
Surgical scissors and forceps
Pipettes
Centrifuge
Cell culture hood
37 °C, 5% CO2 cell culture incubator
Microscope
FACS Aria ll flow cytometer (BD Biosciences)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2015 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Kitajima, S., Li, F. and Takahashi, C. (2015). Generation of Mouse Thyroid Calcitonin-producing Cell Tumors from Primary Mouse Tumors. Bio-protocol 5(24): e1681. DOI: 10.21769/BioProtoc.1681.
Download Citation in RIS Format
Category
Cancer Biology > General technique > Cell biology assays
Cancer Biology > General technique > Tumor formation
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,682 | https://bio-protocol.org/exchange/protocoldetail?id=1682&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
[14C] Linoleic Acid Uptake and Fractionation Assay in Vibrio cholerae
SP Sarah C. Plecha
JW Jeffrey H. Withey
Published: Vol 5, Iss 24, Dec 20, 2015
DOI: 10.21769/BioProtoc.1682 Views: 6794
Edited by: Valentine V Trotter
Reviewed by: Elizabeth Libby
Original Research Article:
The authors used this protocol in May 2015
Download PDF
Ask a question
Favorite
Cited by
Original research article
The authors used this protocol in:
May 2015
Abstract
The gram-negative curved bacillus Vibrio cholerae (V. cholerae) causes the severe diarrheal illness cholera. The work presented here is to assess whether unsaturated fatty acids (UFAs), such as linoleic acid, have the potential to directly affect proteins involved in DNA binding because they are able to enter the cell. In this protocol, we show how to measure linoleic acid entering V. cholerae when added exogenously and determine whether it is able to enter the cytoplasm. This protocol will quantify how much linoleic acid is able to enter the cell and then identify the amount of linoleic acid that stays in the membrane or ultimately enters the cytoplasm.
Keywords: Vibrio cholerae Cholera Linoleic acid Unsaturated fatty acids
Materials and Reagents
Scintillation vials (Thermo Fisher Scientific, catalog number: 03-337-20 )
Autoclaved 1.7 ml microcentrifuge tubes (BioExpress, catalog number: C-3262-1 )
Test Tubes (Thermo Fisher Scientific, catalog number: 14-955E )
15 ml conical screw cap tubes (BioExpress, catalog number: C-3394-2 )
Vibrio cholerae classical biotype strain O395
14C linoleic acid (PerkinElmer, catalog number: NEC501050UC )
Scintillation cocktail (Thermo Fisher Scientific, catalog number: SX18-4 )
Tryptone (Thermo Fisher Scientific, catalog number: B211705 )
Yeast Extract (Thermo Fisher Scientific, catalog number: B288620 )
Sodium chloride (NaCl) (Thermo Fisher Scientific, catalog number: BP358-212 )
Potassium chloride (KCl) (Thermo Fisher Scientific, catalog number: BP366-500 )
Sodium phosphate (Na2HPO4) (Thermo Fisher Scientific, catalog number: BP332-500 )
Potassium phosphate (KH2PO4) (Thermo Fisher Scientific, catalog number: BP362-500 )
Tris-Base (Thermo Fisher Scientific, catalog number: BP152-500 )
95% ethanol (Decon Labs, catalog number: 2805HC )
Dry ice
LB-Lennox (pH 6.5) (see Recipes)
10x PBS (see Recipes)
20 mM Tris-Base (pH 8.5) (see Recipes)
500 mM NaCl (see Recipes)
Equipment
Shaker-capable of shaking at 200 rpm at 37 °C (VWR International, New Brunswick Scientific, model: Excella E25 )
Water bath shaker-capable of shaking at 30 °C at 200 rpm (VWR International, New Brunswick Scientific, model: Classic C76 )
LS6000IC liquid scintillation counting system (Beckman Coulter)
Timer
Autoclave
Biomate 3S Spectrophotometer-capable of reading at OD600 (Thermo Fisher Scientific)
Semimicro Cuvettes (Thermo Fisher Scientific, catalog number: 14-955-127 )
Table top Centrifuge-capable of spinning at 15,000 rpm at 4 °C (Eppendorf, catalog number: 5424 )
Micropipettes (1,000 μl, 200 μl, 20 μl)
250 ml Erlenmeyer flask
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2015 The Authors; exclusive licensee Bio-protocol LLC.
Category
Microbiology > Microbial biochemistry > Lipid
Microbiology > Microbial cell biology > Organelle isolation
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,683 | https://bio-protocol.org/exchange/protocoldetail?id=1683&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Characterization of HBV Isolates from Patient Serum Samples and Cloning
LC Liang Cao
CW Chunchen Wu
KZ Kaitao Zhao
XC Xinwen Chen
Published: Vol 5, Iss 24, Dec 20, 2015
DOI: 10.21769/BioProtoc.1683 Views: 9709
Reviewed by: Valeria Lulla
Original Research Article:
The authors used this protocol in Aug 2014
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Aug 2014
Abstract
Hepatitis B virus (HBV) mutants can lead to vaccine failure, diagnostic failure of HBV detection, increase viral replication and resistance to antiviral agents. To study the biological characteristics of these mutations may contribute to our knowledge on viral pathogenesis. Therefore, it is essential to isolate and characterize HBV strains from patients. Here we describe the experimental methods to isolate and clone HBV DNA from patient serum. The method will facilitate isolation and functional analysis of new HBV variants.
Materials and Reagents
Extraction of HBV DNA from patient serum samples
1.5 ml microfuge tube (Axygen, catalog number: 17615044 )
Patient serum samples
Tris phenol (Beijing Shuang Xiang Da Company, catalog number: 108952 )
Trichloromethane (Sinopharm Chemical Reagent Co., catalog number: 61553 )
Ethanol (Sinopharm Chemical Reagent Co., catalog number: 32061 )
Isopropyl alcohol (Sinopharm Chemical Reagent Co., catalog number: 32064 )
Yeast RNA (Life Technologies, Ambion®, catalog number: AM7118 )
Note: Currently, it is “Thermo Fisher Scientific, AmbionTM, catalog number: AM7118”.
Sodium acetate trihydrate (NaOAc) (Sigma-Aldrich, catalog number: 236500 )
Ethylenediaminetetraacetic acid (EDTA) (Sigma-Aldrich, catalog number: EDS )
Sodium dodecyl sulfate (SDS) (Sigma-Aldrich, catalog number: L3771 )
Tris-base (Sigma-Aldrich, catalog number: T1378 )
Viral lysis buffer (see Recipes)
Amplification of HBV DNA by Polymerase Chain Reaction (PCR)
KOD-PLUS: a high-fidelity DNA polymerase (TOYOBO CO., catalog number: KOD201 )
Primers used for PCR as described below (Detailed description can refer to Figure 1)
Name
Type
Sequence 5’-3’
Position of 5’-base
P1
forward
CCGGCGTCGACGAGCTCTTCT
TTTTCACCTCTGCCTAATCA
1821
P2
forward
CCGGCGTCGACGAGCTCTTCA
AAAAGTTGCATGGTGCTGG
1825
P3
reverse
CACTGAACAAATGGCACTAGT
AAACTGAGCC
699
P4
reverse
GGCTCAGTTTACTAGTGCCATT
TGTTCAGTG
669
Note: The underlined red letters are the restriction endonuclease binding site. P1: Sal I, Sac I; P2: Sal I, Sac I; P3: Spe I; P4: Spe I. P1/P3 are used to amplify the 2.05 kb fragment (1,821-699 bp), P2/P4 are used to amplify the 1.15 kb fragment (669-1,825 bp).
Gel extraction of HBV DNA
AxyPrepTM DNA Gel Extraction kit (Thermo Fisher Scientific, AxygenTM, catalog number: APGX50 )
Add dATP to generate 3’ overhangs
Taq DNA polymerase (TOYOBO CO., catalog number: TAP201 )
dATP (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: R0141 )
Integration of HBV DNA into pGEM®-T Vector
pGEM®-T Vector System I (Promega Corporation, catalog number: A3600 )
0.5 ml microfuge tube (Axygen, catalog number: 05615119 )
Transformation
Competent DH5α (Takara, catalog number: 9057 )
Ampicillin (Sinopharm Chemical Reagent Co., catalog number: 69523 )
Isopropyl β-D-1-thiogalactopyranoside (IPTG) (Sigma-Aldrich, catalog number: PHG0010-5G )
5-Bromo-4-chloro-3-indolyl β-D-galactopyranoside (X-gal) (Sigma-Aldrich, catalog number: B4252-50MG )
Sodium chloride (NaCl) (Sinopharm Chemical Reagent CO., catalog number: 10019318 )
TRYPTONE (Oxoid Limited, catalog number: LP0042 )
YEAST EXTRACT (Oxoid Limited, catalog number: LP0021 )
LB medium (see Recipes)
Extract HBV DNA-integrated plasmid from E.coli-DH5α
E.Z.N.A.® Plasmid DNA Mini Kit I (Omega Bio-tek Inc., catalog number: D6942-02 )
Integration of full-length HBV genome into the cloning vector pUC19
Sac I (New England Biolabs, catalog number: R0156S )
Sal I (New England Biolabs, catalog number: R0138S )
Spe I (New England Biolabs, catalog number: R0133S )
T4 DNA ligase (New England Biolabs, catalog number: M0202S )
Equipment
Instrument for PCR (Biocompare, Biometra, catalog number: 070851 )
Centrifuge (Eppendorf, model: 5424 )
Electrophoresis system (Beijing Liuyi Biotechnology, model: DYY6C )
Electronic scales (Mettler-Toledo International Inc., model: PB602-N )
Note: Currently, it is “Mettler-Toledo International Inc., model: PB602-S ”.
Bacteriological incubator (bio-equip, Shanghai Jing Hong Laboratory Instrument Co., model number: GNP-9080 )
BIO IMAGING SYSTEM (Syngene, model: SYDR2/1361 )
Heat block
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2015 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Cao, L., Wu, C., Zhao, K. and Chen, X. (2015). Characterization of HBV Isolates from Patient Serum Samples and Cloning. Bio-protocol 5(24): e1683. DOI: 10.21769/BioProtoc.1683.
Download Citation in RIS Format
Category
Microbiology > Microbial biochemistry > DNA
Molecular Biology > DNA > DNA cloning
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,684 | https://bio-protocol.org/exchange/protocoldetail?id=1684&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Extraction and Quantification of Alkanes in Cyanobacteria
HK Hakuto Kageyama
RW Rungaroon Waditee-Sirisattha
SS Sophon Sirisattha
YT Yoshito Tanaka
AM Aparat Mahakhant
TT Teruhiro Takabe
Published: Vol 5, Iss 24, Dec 20, 2015
DOI: 10.21769/BioProtoc.1684 Views: 8490
Edited by: Maria Sinetova
Reviewed by: Claudia Catalanotti
Original Research Article:
The authors used this protocol in Jul 2015
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jul 2015
Abstract
Many species of cyanobacteria accumulate alkanes in their cells. It has been reported that these cyanobacteria accumulate mainly 15 long carbon chain alkane, pentadecane (C15H32), or/and 17 long chain alkane, heptadecane (C17H36). Here we describe a protocol of our laboratory for extraction and quantification of cyanobacterial intracellular pentadecane and heptadecane. We have confirmed this protocol was applicable to at least three kinds of cyanobacteria, nitrogen-fixing filamentous cyanobacterium Anabaena sp. PCC7120, non-diazotrophic unicellular cyanobacterium Synechococcus elongatus PCC7942 and halotolerant unicellular cyanobacterium Aphanothece halophytica.
Materials and Reagents
Sampling tubes (1.5 ml) (Ina-optika corporation, Ina Optica, catalog number: CF-0150 )
Sampling tubes (50 ml) (Corning, Falcon®, catalog number: 352070 )
Glass vial (Shimadzu Scientific Instruments, catalog number: GLC4010-17 )
Capillary column (15 m, 0.25 mm internal diameter) (Restek Corporation, model: Rtx-1MS )
Cyanobacteria (Anabaena sp. PCC7120, Synechococcus elongatus PCC7942 and Aphanothece halophytica)
Sodium nitrate (NaNO3) (Sigma-Aldrich, catalog number: 28-3440-5 )
Note: Currently, it is “Sigma-Aldrich, catalog number: 28-3440 ”.
Potassium phosphate dibasic (K2HPO4) (Sigma-Aldrich, catalog number: 24-5240-5 )
Note: Currently, it is “Sigma-Aldrich, catalog number: 24-5240 ”.
Magnesium sulfate heptahydrate (MgSO4.7H2O) (KANTO KAGAKU, catalog number: 25034-00 )
Calcium chloride dihydrate (CaCl2.2H2O) (Sigma-Aldrich, catalog number: 05-0590-5 )
Note: Currently, it is “Sigma-Aldrich, catalog number: 05-0590 ”.
Citric acid (KATAYAMA CHEMICAL, catalog number: 05-4930 )
Note: Currently, it is “Sigma-Aldrich, catalog number: 05-4930 ”.
Ferric ammonium citrate (Wako Pure Chemical Industries, Siyaku, catalog number: 097-00835 )
Ethylenediaminetetraacetic acid disodium salt dihydrate (EDTA-Na2) (Sigma-Aldrich, catalog number: 09-1420-5 )
Sodium carbonate (Na2CO3) (Sigma-Aldrich, catalog number: 28-2180-5 )
Boric acid (H3BO3) (KATAYAMA CHEMICAL, catalog number: 03-2900 )
Note: Currently, it is “Sigma-Aldrich, catalog number: 03-2900 ”.
Manganese(II) chloride (MnCl2) (KANTO KAGAKU, catalog number: 25061-00 )
Zinc sulfate heptahydrate (ZnSO4.7H2O) (KATAYAMA CHEMICAL, catalog number: 37-0550 )
Note: Currently, it is “Sigma-Aldrich, catalog number: 37-0550 ”.
Sodium molybdate dihydrate (Na2MoO4.2H2O) (KATAYAMA CHEMICAL, catalog number: 28-3400 )
Note: Currently, it is “Sigma-Aldrich, catalog number: 28-3400 ”.
Copper(II) sulfate pentahydrate (CuSO4.5H2O) (KATAYAMA CHEMICAL, catalog number: 05-6220 )
Note: Currently, it is “Sigma-Aldrich, catalog number: 05-6220 ”.
Cobalt(II) nitrate hexahydrate [Co(NO3)2.6H2O] (KATAYAMA CHEMICAL, catalog number: 05-5230 )
Note: Currently, it is “Sigma-Aldrich, catalog number: 05-5230 ”.
Sodium chloride (NaCl) (KANTO KAGAKU, catalog number: 37144-00 )
Potassium chloride (KCl) (Sigma-Aldrich, catalog number: 24-4290-5 )
Magnesium chloride hexahydrate (MgCl2.6H2O) (KANTO KAGAKU, catalog number: 25009-00 )
Methanol (KANTO KAGAKU, catalog number: 25183-70 )
Pentadecane (TCI America, catalog number: S0287 )
Heptadecane (TCI America, catalog number: S0289 )
BG-11 medium for Anabaena sp. PCC7120 and Synechococcus elongatus PCC7942 (Stanier et al., 1971) (see Recipes)
BG-11 medium plus Turk Island salt solution (0.5 M NaCl) for Aphanothece halophytica (Hibino et al., 1999) (see Recipes)
Equipment
Glass conical flask (500 ml size)
Shaker (TAITEC CORPORATION, model: NR-3 )
Thermostatic chamber [Temperature was set to 30 °C (±0.1 °C) by the regulator (Panasonic, catalog number: MCU-201 CPH2 )]
Fluorescent lamp (light quality: natural white, total luminous flux: 2,950 lm) (Yodobashi Camera Co., TOSHIBA, model: FL40SN )
Spectrometer (Shimadzu Scientific Instruments, model: UV-160A )
Centrifuge (for 50 ml tubes) (KUBOTA Corporation, catalog number: 5911 )
Centrifuge (for 1.5 ml tubes) (KUBOTA Corporation, catalog number: 3700 )
Vacuum evaporator (TAITEC CORPORATION, model: Vc-15s )
Sonicator (TAITEC CORPORATION, model: VP-5s )
Fridge
GC-MS (Shimadzu Scientific Instruments, catalog number: GCMS-QP2010 )
Helium gas
Software
GCMSsolution software version 2.40 (Shimadzu Scientific Instruments, catalog number: 225-13067-91)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2015 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Kageyama, H., Waditee-Sirisattha, R., Sirisattha, S., Tanaka, Y., Mahakhant, A. and Takabe, T. (2015). Extraction and Quantification of Alkanes in Cyanobacteria. Bio-protocol 5(24): e1684. DOI: 10.21769/BioProtoc.1684.
Download Citation in RIS Format
Category
Microbiology > Microbial biochemistry > Other compound
Microbiology > Microbial metabolism > Other compound
Biochemistry > Other compound > Alkane
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,685 | https://bio-protocol.org/exchange/protocoldetail?id=1685&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Luminol-based Assay for Detection of Immunity Elicitor-induced Hydrogen Peroxide Production in Arabidopsis thaliana Leaves
NB Nora Gigli Bisceglia
MG Matteo Gravino
Daniel V. Savatin
Published: Vol 5, Iss 24, Dec 20, 2015
DOI: 10.21769/BioProtoc.1685 Views: 20716
Edited by: Zhaohui Liu
Reviewed by: Michael Enos
Original Research Article:
The authors used this protocol in May 2014
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
May 2014
Abstract
In Arabidopsis thaliana, one of the very early immune-related responses induced after elicitor perception is the oxidative burst, i.e., reactive oxygen species (ROS) generation including superoxide anion and hydrogen peroxide (H2O2). ROS production plays different roles in a wide range of biotic and abiotic stress responses, including the closure of stomata and the regulation of cell expansion. In particular, elicitor-induced H2O2 is produced mainly by the membrane localized NAD(P)H oxidases RESPIRATORY BURST OXIDASE HOMOLOGUE D and F. In this protocol, we describe a simple and reproducible luminol/peroxidase-based assay to detect and evaluate immunity-related accumulation of H2O2 produced in Arabidopsis leaf discs treated with immunity elicitors, such as oligogalacturonides (OGs), flagellin (flg22) or the elongation factor-thermo-unstable (EF-Tu - elf18). This method is based on the detection of the luminescence released by excited-luminol molecules generated after the horseradish peroxidase (HRP)-catalyzed oxidation of luminol molecules in the presence of H2O2. Levels as well as duration of the luminescence are proportional to the amount of H2O2 produced by elicited leaf discs.
Materials and Reagents
Petri plates (90 x 15 mm)
96-well luminometer plate (Thermo Fisher Scientific, catalog number: 136101 )
Aluminum foil
At least two Arabidopsis thaliana (e.g., ecotype Columbia-0) plants for each elicitor treatment
Luminol (Sigma-Aldrich, catalog number: 123072 )
Peroxidase from horseradish (Sigma-Aldrich, catalog number: P8125 )
Sterile distilled water
Dimethyl sulfoxide (DMSO) (Sigma-Aldrich, catalog number: 41640 )
Flg22 (QRLSTGSRINSAKDDAAGLQIA) and elf18 (ac-SKEKFERTKPHVNVGTIG)-EZBiolab (http://www.ezbiolab.com/)
OGs with an average degree of polymerization of 10 to 16 prepared as previously described (Bellincampi et al., 2000)
500x luminol stock solution (LSS) (see Recipes)
500x horseradish peroxidase stock solution (HPSS) (see Recipes)
1 mM flg22 stock solution (see Recipes)
1 mM elf18 stock solution (see Recipes)
Equipment
Arabidopsis growth chamber
Surgical blade
Cork borer set (0.125 cm2 area) (Sigma-Aldrich, catalog number: Z165220 )
Plastic bur block
Flat tweezer
GloMax®-Multi+ Detection System with dual injectors (Promega Corporation)
Microsart® e.jet laboratory vacuum pump (Sartorius AG, catalog number: 16612 )
Plastic or glass desiccator
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2015 The Authors; exclusive licensee Bio-protocol LLC.
How to cite： Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Bisceglia, N. G., Gravino, M. and Savatin, D. V. (2015). Luminol-based Assay for Detection of Immunity Elicitor-induced Hydrogen Peroxide Production in Arabidopsis thaliana Leaves. Bio-protocol 5(24): e1685. DOI: 10.21769/BioProtoc.1685.
Bellincampi, D., Dipierro, N., Salvi, G., Cervone, F. and De Lorenzo, G. (2000). Extracellular H(2)O(2) induced by oligogalacturonides is not involved in the inhibition of the auxin-regulated rolB gene expression in tobacco leaf explants. Plant Physiol 122(4): 1379-1385.
Download Citation in RIS Format
Category
Plant Science > Plant immunity > Disease bioassay
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,686 | https://bio-protocol.org/exchange/protocoldetail?id=1686&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Isolation of Tonoplast Vesicles from Tomato Fruit Pericarp
CS Christopher J. Snowden
BT Benjamin Thomas
CB Charles J. Baxter
J. Andrew C. Smith
Lee J. Sweetlove
Published: Vol 5, Iss 24, Dec 20, 2015
DOI: 10.21769/BioProtoc.1686 Views: 9453
Edited by: Samik Bhattacharya
Original Research Article:
The authors used this protocol in Mar 2015
Download PDF
Ask a question
Favorite
Cited by
Original research article
The authors used this protocol in:
Mar 2015
Abstract
This protocol describes the isolation of tonoplast vesicles from tomato fruit. The vesicles isolated using this procedure are of sufficiently high purity for downstream proteomic analysis whilst remaining transport competent for functional assays. The methodology was used to study the transport of amino acids during tomato fruit ripening (Snowden et al., 2015) and based on the procedure used by Betty and Smith (Bettey and Smith, 1993). Such vesicles may be useful in further studies into the dynamic transfer of metabolites across the tonoplast for storage and metabolism during tomato fruit development.
Materials and Reagents
Ultra centrifuge tubes, 32 ml capacity, thick wall, polycarbonate (Beckman Coulter, catalog number: 355631 )
3 ml pastettes
Solanum lycopersicum Lam. cv. M82 or cv. Micro-Tom
Bovine serum albumin (Fraction V) (Sigma-Aldrich, catalog number: A7906 )
D-Mannitol (Sigma-Aldrich, catalog number: M9647 )
Magnesium sulfate heptahydrate (Thermo Fisher Scientific, catalog number: 10256840 )
Ethylenediaminetetraacetic acid disodium salt dihydrate (Sigma-Aldrich, catalog number: E4884 )
Polyvinylpyrrolidone average molecular weight 40,000 (Sigma-Aldrich, catalog number: PVP40 )
2-Amino-2-(hydroxymethyl)-1, 3-propanediol (Trizma® base) (Sigma-Aldrich, catalog number: T1503 )
Butylated hydroxytoluene (Sigma-Aldrich, catalog number: W218405 )
Potassium disulfite (K2S2O5) (Sigma-Aldrich, catalog number: P2522 )
Phenylmethylsulfonyl fluouride (Sigma-Aldrich, catalog number: P7626 )
Ethanol (Thermo Fisher Scientific, catalog number: 12468750 )
(+)-Sodium L-ascorbate (Sigma-Aldrich, catalog number: A7631 )
DL-Dithiothreitol (Sigma-Aldrich, catalog number: D0632 )
Potassium hydroxide (Thermo Fisher Scientific, catalog number: 10366240 )
Glycerol (Thermo Fisher Scientific, catalog number: 10296200 )
BIS-TRIS propane (Sigma-Aldrich, catalog number: B6755 )
Tricine (Sigma-Aldrich, catalog number: T0377 )
Sucrose (Sigma-Aldrich, catalog number: S0389 )
Muslin cloth (100 % cotton)
2-(N-morpholino)ethanesulfonic acid (MES) (Sigma-Aldrich, catalog number: M3671 )
Extraction buffer (see Recipes)
Resuspension buffer (see Recipes)
Sucrose steps (see Recipes)
Transport buffer (see Recipes)
Equipment
Scalpel Handle Swan Morton No.4 (Philip Harris, catalog number: B8R00181 )
Scalpel blades Swan Morton No. 24 (Thermo Fisher Scientific, catalog number: 11712734 )
Blender (For example a Waring 38BL41 with a 40 oz container)
Ultra centrifuge capable of 100,000 x g with swing out rotor (e.g. SW28 Ti)
Soft paint brush (Sable No.5 or equivalent)
1,000 µl micropipette
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2015 The Authors; exclusive licensee Bio-protocol LLC.
Category
Plant Science > Plant biochemistry > Protein
Biochemistry > Protein > Isolation and purification
Cell Biology > Organelle isolation > Membrane
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,687 | https://bio-protocol.org/exchange/protocoldetail?id=1687&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Preparation and Analysis of Crude Autolytic Enzyme Extracts from Staphylococcus aureus
Filipa Vaz
Sérgio R. Filipe
Published: Vol 5, Iss 24, Dec 20, 2015
DOI: 10.21769/BioProtoc.1687 Views: 12713
Edited by: Arsalan Daudi
Original Research Article:
The authors used this protocol in Apr 2014
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Apr 2014
Abstract
The metabolism of the cell surface during bacterial cell division involves synthesis and degradation of peptidoglycan (PGN), the major component of the bacterial cell wall. Bacteria have to ensure that their surface remains capable of withstanding high turgor pressures and, simultaneously, that the PGN at their surface is concealed from receptors produced by the host innate immune system. For cell separation to occur, and for PGN to be kept concealed, “old” PGN is degraded by specific PGN hydrolases, also known as autolysins, that are found at the bacterial cell surface or that are secreted into the growth medium.
Bacterial PGN hydrolases are cell wall lytic enzymes that comprise a broad and diverse group of proteins. It is often difficult to assign a specific function to a PGN hydrolase mainly because an organism can have a large number of hydrolases with redundant activities and one hydrolase can have more than one enzymatic activity and participate in various cell processes (Vollmer et al. 2008). Bacillus subtilis has ca. 35 known or hypothetical PGN hydrolases, whereas Escherichia coli (E. coli) and Staphylococcus aureus (S. aureus) have, respectively, ca.16 and 19 PGN hydrolases (Vollmer, 2012; Heidrich et al., 2001; Singh et al., 2012).
PGN hydrolases can be classified in three main classes: glycosidases, amidases and peptidases. Glycosidases cleave the glycan backbone and are divided into N-acetylglucosaminidases and N-acetylmuramidases. Amidases cleave the linkage between the peptide chain and the N-acetylmuramic residue of the glycan chain. Peptidases, such as endopeptidases and carboxypeptidases, are able to cleave peptide bonds between different amino acids of the PGN stem peptide.
Here we describe a method to extract PGN hydrolases, which are non-covalently linked to the S. aureus cell wall (Vollmer, 2008). Analysis of extracts containing denatured PGN hydrolytic enzymes is performed by running a zymogram gel (a SDS-PAGE gel containing crude bacterial cell walls or substrate cells), which is then incubated in a non-denaturing buffer to allow renaturation of the PGN hydrolases. These renatured enzymes can then be identified through the production of clear bands that are observed where cell wall digestion has occurred. The protocol is divided into three steps: A) Preparation of the crude autolytic extracts from S. aureus cells; B) Preparation of substrate cells for gel zymograms; C) Analysis of crude autolytic extracts by gel zymography.
We also show that this method can be used to determine the absence or altered activity of PGN hydrolases produced by different S. aureus mutant strains.
Keywords: Murein Peptidoglycan PGN hydrolases Zymogram Staphylococcus aureus
Materials and Reagents
Petri dishes (Sarstedt AG, catalog number: 82.1473 )
1 μl loops (Sarstedt AG, catalog number: 86.1567.010 )
25 ml glass (or plastic disposable) pipettes (Normax, catalog number: 4.5434334 )
50 ml Falcon tubes (Sarstedt AG, catalog number: 62.548.004 )
2 ml micro tubes (Sarstedt AG, catalog number: 72.691 )
JA-14 centrifuge tubes (Thermo Fisher Scientific, NalgeneTM, catalog number: 3120-0250 )
JA-20 centrifuge tubes (Thermo Fisher Scientific, NalgeneTM, catalog number: 3114-0050 )
Spacer plates with 0.75 mm integrated spacers (Bio-Rad Laboratories, catalog number: 165-3310 )
Mini-PROTEAN® Comb, 10-well, 0.75 mm (Bio-Rad Laboratories, catalog number: 165-3354 )
Staphylococcus aureus strains to analyze regarding the cell wall lytic activity of their PGN hydrolases.
Note: In order to produce substrate cells, researchers may use the Staphylococcus aureus NCTC8325-4 strain, which has been cured from prophages and it can be obtained from BEI Resources under the reference NR-45937, and Micrococcus luteus DSM20030 strain, which can be obtained from DSMZ stock center.
Tryptic Soy Agar plates (TSA) (BD, Difco, catalog number: 236950 )
Tryptic Soy Broth (TSB) (BD, Bacto, catalog number: 211825 )
Luria Agar (Miller's LB agar) (LA) (Conda, catalog number: 1552 )
Luria Broth (Miller's LB broth) (LB) (Conda, catalog number: 1551 )
Ethanol (Merck Millipore Corporation, catalog number: 1.02371.1000 )
Ice (homemade)
Liquid nitrogen (Air Liquide)
Tris (Trizma® base) (Sigma-Aldrich, catalog number: T1503 )
Sodium chloride (Merck Millipore Corporation, catalog number: 1.06444.1000 )
Hydrochloric acid (Merck Millipore Corporation, catalog number: 1.01834.2500 )
Sodium Dodecyl Sulfate (Sigma-Aldrich, catalog number: L5750 )
Glycine (Sigma-Aldrich, catalog number: G8898 )
30% Acrylamide/Bis Solution (Bio-Rad Laboratories, catalog number: 161-0158 )
Dithiothreitol (DTT) (VWR International, catalog number: V3155 )
Ammonium persulfate (APS) [(NH4)2S2O8] (Sigma-Aldrich, catalog number: A3678 )
Bromophenol Blue sodium salt (Sigma-Aldrich, catalog number: B8026 )
Precision Plus ProteinTM Dual Color Standards (PPPS) (Bio-Rad Laboratories, catalog number: 1610374 )
Methylene Blue hydrate (Sigma-Aldrich, catalog number: 66720 )
Triton X-100 (Sigma-Aldrich, catalog number: T8787 )
Magnesium chloride hexahydrate (Sigma-Aldrich, catalog number: M9272 )
Calcium chloride dihydrate (CaCl2.2H2O) (Sigma-Aldrich, catalog number: C3306 )
Potassium hydroxide (KOH) (Sigma-Aldrich ,catalog number: P5958 )
N, N, N′, N′-Tetramethylethylenediamine (TEMED) (Sigma-Aldrich, catalog number: T9281 )
70% ethanol (see Recipes)
500 mM Tris-HCl (pH 7.5) (see Recipes)
Washing buffer (see Recipes)
4% SDS (w/v) (see Recipes)
10% SDS (w/v) (see Recipes)
1.5 M Tris-HCl (pH 8.8) (see Recipes)
0.5 M Tris-HCl (pH 6.8) (see Recipes)
10% APS (w/v) (see Recipes)
Zymogram SDS-PAGE gels (see Recipes)
5x Laemmli loading buffer (see Recipes)
Tris-Glycine-SDS buffer (see Recipes)
Renaturation buffer (see Recipes)
Methylene Blue solution (see Recipes)
Equipment
Erlenmeyer flasks of 100 ml capacity (Normax, catalog number: 2121624N )
Erlenmeyer flasks of 1 L capacity (Normax, catalog number: 2121654N )
Cuvettes (Sarstedt AG, catalog number: 67.742 )
1.5 ml micro tubes (Sarstedt AG, catalog number: 72.690.001 )
Micropipette (Gilson, model: Pipetman P1000 )
Magnetic stir bars (VWR International, catalog number: 442-0361 )
30 °C/37 °C Incubator shaker (Eppendorf, New Brunswick Scientific, model: Innova® 40 )
30 °C /37 °C Incubator (BINDER GmbH, model: WTB )
Burner
Note: In this work we used a wall-attached burner, but a portable burner also works.
Spectrophotometer (GE Healthcare, Amersham, model: Novaspec Plus Visible Spectrophotometer )
Centrifuge (Beckman Coulter, model: Avanti J-26 XPI )
JA-14 rotor (Beckman Coulter, model: 339247 )
JA-20 rotor (Beckman Coulter, model: 334831 )
Bench centrifuge (Eppendorf, model: 5430R )
Rotor for 1.5 ml tubes (Thermo Fisher Scientific, Eppendorf, model: FA-45-24-11-HS )
Shaker for 1.5 ml tubes (Eppendorf, model: Thermomixer® Comfort )
Nanodrop (Thermo Fisher Scientific, model: ND-2000C )
Autoclave
Speed vac (Labconco, model: 78100 )
Short plates (Bio-Rad Laboratories, catalog number: 165-3308 )
Power Pac HV Power Supply (Bio-Rad Laboratories, catalog number: 164-5056 )
Mini-PROTEAN Casting Stand Gaskets (Bio-Rad Laboratories, catalog number: 165-3305 )
Mini-PROTEAN® Casting Frame (Bio-Rad Laboratories, catalog number: 165-3304 )
Mini-PROTEAN® Casting Stand (Bio-Rad Laboratories, catalog number: 165-3303 )
Mini-PROTEAN® Tetra Cell (Bio-Rad Laboratories, catalog number: 165-8000 )
Procedure
Preparation of the crude autolytic extracts from S. aureus cells
The working area was decontaminated with 70% ethanol (v/v) using paper towels and the burner was turned on. This procedure was done throughout the protocol every time sterile conditions were needed (Note 1).
The bacterial S. aureus strains of interest were inoculated on TSA plates by streak plating using 1 μl loops and incubated overnight in a 30 °C incubator (Note 2).
Under sterile conditions, a single isolated colony was picked with a 1 μl loop and inoculated in 10 ml of TSB in a 100 ml Erlenmeyer flask. Cultures were grown overnight (16 h-18 h) in a 30 °C incubator shaker at 200 rpm.
The optical densities at λ = 600 nm of the overnight cultures were measured after making a 1/10 dilution (100 μl of culture in 900 μl of TSB) in a cuvette, under sterile conditions.
The volume required for a starting OD600 of ~ 0.05 was taken from the overnight cultures and inoculated in 250 ml of TSB in a 1 L Erlenmeyer flask. The cultures were grown in a 30 °C incubator shaker at 200 rpm.
The centrifuge JA-26 XPI was prepared by placing the JA-14 rotor and cooling it down to 4 °C.
An ice/ethanol bath was prepared and kept at 4 °C: The ice was poured into a container and absolute ethanol was homogenously spread onto it. The flask of Washing buffer solution, the JA-14 and JA-20 centrifuge tubes were placed in it to cool down.
When the cultures reached an OD600 ~ 0.3 (which should take about 3 h), they were put in the ice/ethanol bath (Note 3).
The cultures were transferred into cold JA-14 centrifuge tubes. The tubes were balanced and the cells were pelleted at 4 ºC, 15,050 x g for 15 min.
After centrifugation, the JA-14 rotor was replaced by the JA-20, which was cooled down to 4 °C.
The supernatants were discarded by inversion of the tubes.
The cells were resuspended in 20 ml of ice-cold Washing buffer and transferred to cold JA-20 centrifuge tubes. Washing buffer was added to the maximum capacity of the tubes (~46 ml).
Cells were centrifuged as before (step A9).
The supernatants were carefully removed using a 25 ml glass (or plastic) pipette until a semidry pellet was left at the bottom of the tubes.
The cells were carefully resuspended in 250 μl of 4% SDS (w/v), transferred to a 1.5 ml micro tube and incubated in a thermomixer at 25 °C, 700 rpm for 30 min (Note 4).
After incubation, the cells were harvested using a bench centrifuge at 22,380 x g, for 15 min, room temperature (RT).
The supernatants, containing the crude enzyme autolytic extracts, were transferred to clean micro tubes.
The extracts were quantified in the Nanodrop (Proteins-280 nm) using a 2 μl aliquot. Mili-Q water was used as a blank.
Each extract was divided into 50 μl aliquots, frozen in liquid nitrogen and stored at -80 °C until further use (Note 5).
Preparation of substrate cells for gel zymograms
For preparation of substrate cells, the S. aureus NCTC8325-4 and the M. luteus DSM20030 strains were plated on TSA and LA plates, respectively, by streak plating using 1 μl loops, and incubated in a 37 °C incubator. S. aureus was incubated overnight and M. luteus for at least 24 h (Note 2).
Under sterile conditions, a single isolated colony of each strain was picked with a 1 μl loop and inoculated into 10 ml of TSB or LB in 100 ml Erlenmeyer flasks. Cultures were grown overnight (16 h-18 h) in a 37 °C incubator shaker at 200 rpm.
The optical densities at λ = 600 nm of the overnight cultures were measured after 1/10 dilution, using as blanks 1 ml of the sterile TSB or LB.
The volume required for a starting OD600 of ~ 0.05 was taken from the overnight cultures and inoculated in 250 ml of TSB or LB in a 1 L Erlenmeyer flask. The cultures were grown using a 37 °C incubator shaker at 200 rpm.
When the cultures reached an OD600 ~ 1.0 the cells were harvested by centrifugation in a JA-14 tube for 15 min at 15,050 x g at room temperature. M. luteus culture should take one full day while S. aureus should take about 3 h to reach the desired OD (Note 6).
The supernatants were discarded and cells were washed with 250 ml of Milli-Q water.
The cells were centrifuged as above and the supernatants were discarded.
The cells were resuspended in 30 ml of Milli-Q water and transferred to 50 ml Falcon tubes.
The cell suspension was autoclaved for 15 min, 121 °C (Note 7).
The autoclaved cells were transferred to JA-20 tubes and centrifuged for 15 min at 15,050 x g, RT.
The supernatants were discarded and pellets were stored overnight at -20 °C (Note 8).
The pellets were defrosted at room temperature, resuspended in 3 ml of Milli-Q water and divided in half into two pre-weighted 2 ml tubes.
The suspension was lyophilized overnight in the speed vac.
The weight of the tubes containing the cells was determined and the dry weight was calculated.
Bacterial substrate cells were resuspended thoroughly in Milli-Q water at 50 mg/ml final concentration and stored at -20 °C (Note 9).
Analysis of the crude autolytic extracts by gel zymography
Substrate cells were thawed and, to ensure a complete resuspension, kept overnight at room temperature with agitation using a magnetic stirrer at maximum speed (Note 10).
Two resolving Acrylamide/0.2% Bisacrylamide SDS-PAGE gels (Laemmli, 1970) were prepared containing a final concentration of 2 mg/ml of substrate cells from S. aureus (10 % gel) and M. luteus (8% gel) (Note 11 and Figure 1).
A standard stacking gel, lacking substrate cells, was placed on top of the resolving gels (Laemmli, 1970).
10 μg (for the M. luteus gel) and 15 μg (for the S. aureus gel) of crude autolytic enzyme extracts (Note 12) were mixed with Laemmli loading buffer (Laemmli, 1970) at a final concentration of 2x (samples were not heated, see Recipes).
The electrophoresis conditions used were as follows:
Temperature: Room Temperature.
Voltage constant: 70 V (per gel).
Running buffer: Tris-Glycine-SDS buffer.
After electrophoresis, the gels were rinsed once with Milli-Q water.
The gels were washed 3 times with Milli-Q for 15 min at RT with gentle agitation.
The gels were incubated overnight at 37 °C with gentle agitation in Renaturation buffer (Note 13).
Zymograms were stained in Methylene Blue Solution for an hour and destained in water until the bands were clear (Note 14 and Figure 2).
Figure 1. A 10% zymogram gel and SDS-PAGE gel. Left panel shows a zymogram gel, which is slightly opaque. Right panel shows a regular SDS-PAGE gel that is completely transparent due to the lack of substrate cells.
Figure 2. Zymography analysis of S. aureus autolytic enzymes. A. Gel zymography analysis of crude autolytic enzyme extracts of S. aureus. M. luteus and S. aureus zymogram gels were used to analyze the autolytic enzymatic extracts harvested from the parental S. aureus NCTC8325-4 strain and from mutants that lack different autolysins (NCTCΔatl, which lacks the major Atl autolysin; NCTCΔlytM, which lacks the glycyl-glycine endopeptidase LytM; NCTCΔlytN, which lacks the putative cell wall hydrolase LytN and NCTCΔsle1, which lacks the N-acetylmuramoyl-L-alanine amidase Sle1). Five different forms of the major autolysin Atl were seen with either substrate cells. However, only the S. aureus substrate cells allowed detection of Sle1 activity, hence showing Sle1 substrate specificity for S. aureus peptidoglycan. B. Representation of the post-translational cleavage (black arrows) of the atl encoded protein (left). The processed amidase (AM) releases stem peptides from PGN by cutting the bond between the stem peptides and the N-acetylmuramic acid residue. The glucosaminidase (GL) releases muropeptides by cutting the glycosidic linkage between N-acetylmuramic acid and N-acetylglucosamine of glycan strands. Representation of Sle1 (right), which includes three LysM domains (responsible for the interaction with PGN) and a CHAP domain (associated with amidase activity of different PGN hydrolases).
Notes
The working area should be a safe place to work near a flame, i.e., no air currents and away from explosives, flammable materials and solvents. For this protocol, work next to the flame can be substituted by working in a biological safety cabinet. Diligently follow all recommended safety guidelines and waste disposal regulations recommended by your host institution.
Plating of the strains should be done from a glycerol stock onto a fresh media plate to ensure the viability of bacterial culture and to prevent selection of suppressor mutants. Growth of the S. aureus strains used in this work is not affected by light/dark conditions.
Incubating the bacterial culture to an OD600 ~ 0.3 ensures that bacteria are harvested during the exponential growth phase. The fast transfer of bacteria to the ice/ethanol bath will reduce the activity of autolysins, which would modify the PGN present at the surface of the substrate cells, and prevent lysis of bacteria, which would result in the loss of specific PGN hydrolases to the growth medium.
This step is required to extract proteins that are associated with the bacterial cell surface without inducing the lysis of bacteria.
Dividing the extract in different aliquots will prevent the consecutive thawing and freezing steps that would result in the loss of activity of certain PGN hydrolases (3 cycles of thawing and freezing did not result in loss of cell wall lytic activity of Atl and Sle1).
To harvest S. aureus and M. luteus at the same time please take in account their different growth rates.
This step ensures that enzymes in this cell suspension lose their activity, and therefore do not cause lysis of the substrate cells during gel zymography analysis.
We have obtained better results when autoclaved cells were stored at -20 °C prior the step of lyophilization. We assume that freezing step may help the resuspension of the substrate.
The use of different bacteria as substrate cells in the gel zymography analysis may result in differences in the intensity and number of bands observed in the zymogram.
This is a critical step as if substrate cells are not well resuspended, the resulting zymogram will be grainy, lowering the sensitivity of the gel zymography analysis.
The M. luteus cell wall is considerably more sensitive to PGN lytic enzymes than S. aureus cells. Therefore when M. luteus cells are used, there is an increase in the intensity and in the number of bands that are detected in a Zymogram. It is preferable to use an 8% gel when using in M. luteus as substrate cells so that there is a better separation of the high molecular weight. In S. aureus gels, it is preferable to run a more concentrated gel to detect the activity of Sle1 that runs close to the 37 kDa protein standard.
Also due to the high susceptibility of M. luteus cells to PGN hydrolases, the optimum quantity of extracts protein is 5-10 μg whereas for S. aureus gel the minimum extracts protein amount to be used should be 15 μg.
This step is required to regain the activity of the PGN hydrolases, which was lost during treatment with the SDS solution.
In this step, clear bands are observed due to the presence of autolysins. Intact substrate cells will retain the dye, while no color will be observed where substrate bacterial cells have lysed.
In the gel containing M. luteus cells, the clear bands start to be seen after a 15 min wash and a picture of the gel should be taken before changing the water. The washing step should be repeated twice, taking pictures of the gel with every change of the water.
The gel with S. aureus cells will take at least three 15 min washes before the bands start to be seen. We usually take a picture after three washes, then after a fourth or fifth wash of about 3 h-5 h. A final overnight wash is recommended to destain the gel as much as possible so that less active lytic proteins may be better seen (e.g. GL activity).
Recipes
70% ethanol
Into a spray bottle, mix 70 ml of ethanol with 30 ml of water
500 mM Tris-HCl (pH 7.5)
Add 30.3 g of Trizma® base to 300 ml of Milli-Q water
Let it stir until solubilisation occurs
Adjust the pH to 7.5 with 1 M HCl
Fill up to 500 ml with Mili-Q water
Confirm pH and autoclave
Use it as a sterile stock solution
Stored at RT
Washing buffer
50 mM Tris-HCl (pH 7.5)/150 mM NaCl
To 4.4 g of NaCl add 50 ml of 500 mM Tris-HCl (pH 7.5) and 400 ml of Milli-Q water
After solubilisation, confirm pH and add Milli-Q water to 500 ml
Filter sterilize (0.2 μm) or autoclave
Stored at RT until use
4% SDS (w/v)
Dissolve 4 g of SDS in 80 ml of Milli-Q water by stirring
SDS is an irritant agent
Wear a mask while weighting the powder
Fill up to 100 ml with Mili-Q water
Filter sterilize (0.2 μm)
Stored at RT
10% SDS (w/v)
Weight 10 g and dissolve in 80 ml of Milli-Q water by stirring
SDS is an irritant agent
Wear a mask while weighting the powder
Fill up to 100 ml with Milli-Q water
Filter sterilize (0.2 μm)
Stored at RT
1.5 M Tris-HCl (pH 8.8)
Add 18.2 g of Trizma® base to 60 ml of Milli-Q water
Let it stir until solubilisation occurs
Adjust the pH to 8.8 with 1 M HCl
Fill up to 100 ml with Milli-Q water
Confirm pH and filter sterilize (0.2 um)
Keep it as a sterile stock solution-use an aliquot (~20 ml) as a working solution
Stored at RT
0.5 M Tris-HCl (pH 6.8)
Add 6.06 g of Trizma® base to 60 ml of Milli-Q water
Let it stir until solubilisation occurs
Adjust the pH to 6.8 with 1 M HCl
Fill up to 100 ml with Mili-Q water
Confirm pH and filter sterilize (0.2 um)
Keep it as a sterile stock solution-use an aliquot (~20 ml) as a working solution.
Stored at RT
10% APS (w/v)
Weight 1 g and dissolve in 10 ml of Milli-Q water
Stored in 500 μl aliquots at -20 °C
Zymogram SDS-PAGE gels
5x Laemmli loading buffer
Weight 0.77 g DTT, 4.3 g Glycerol, 2 mg Bromophenol Blue
Add 5 ml 0.5 M Tris (pH 6.8) and fill up to 10 ml with Milli-Q water
Stored at -20 °C in 50 μl aliquots
Tris-Glycine-SDS buffer
Dissolve 30.0 g of Tris base, 144.0 g of glycine, and 10.0 g of SDS in 1,000 ml of water
Stored at RT
Renaturation buffer
50 mM Tris-HCl (pH 7.5), 0.1% (v/v) Triton X-100, 10 mM CaCl2, 10 mM MgCl2:
Weight 0.74 g of calcium chloride dihydrate and 1.02 g of magnesium chloride hexahydrate
Take 50 ml of 500 mM Tris-HCl (pH 7.5) and 500 μl of Triton X-100
Stir until solubilisation
Always use fresh
Methylene blue solution
0.1% (w/v) methylene blue in 0.01% potassium hydroxide:
Dissolve 0.5 g of methylene blue and 0.05 g of potassium hydroxide in 500 ml Milli-Q water
Stored at RT
Acknowledgments
This protocol, which was adapted or modified from Grilo et al. (2014) and Yokoi et al. (2008), has been used to describe that autolysins can prevent detection of the PGN at the bacterial cell surface (Atilano et al., 2014). This work was supported by fellowship SFRH/BD/78748/2011 to FV and project PTDC/BIA-PLA/3432/2012 to SRF from Fundação para a Ciência e Tecnologia. We thank Inês Grilo for suggestions and Teresa Baptista da Silva for technical support.
References
Atilano, M. L., Pereira, P. M., Vaz, F., Catalao, M. J., Reed, P., Grilo, I. R., Sobral, R. G., Ligoxygakis, P., Pinho, M. G. and Filipe, S. R. (2014). Bacterial autolysins trim cell surface peptidoglycan to prevent detection by the Drosophila innate immune system. Elife 3: e02277.
Gotz, F., Heilmann, C. and Stehle, T. (2014). Functional and structural analysis of the major amidase (Atl) in Staphylococcus. Int J Med Microbiol 304(2): 156-163.
Grilo, I. R., Ludovice, A. M., Tomasz, A., de Lencastre, H. and Sobral, R. G. (2014). The glucosaminidase domain of Atl - the major Staphylococcus aureus autolysin - has DNA-binding activity. Microbiologyopen 3(2): 247-256.
Heidrich, C., Templin, M. F., Ursinus, A., Merdanovic, M., Berger, J., Schwarz, H., de Pedro, M. A. and Holtje, J. V. (2001). Involvement of N-acetylmuramyl-L-alanine amidases in cell separation and antibiotic-induced autolysis of Escherichia coli. Mol Microbiol 41(1): 167-178.
Laemmli, U. K. (1970). Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227(5259): 680-685.
Oshida, T., Sugai, M., Komatsuzawa, H., Hong, Y. M., Suginaka, H. and Tomasz, A. (1995). A Staphylococcus aureus autolysin that has an N-acetylmuramoyl-L-alanine amidase domain and an endo-beta-N-acetylglucosaminidase domain: cloning, sequence analysis, and characterization. Proc Natl Acad Sci U S A 92(1): 285-289.
Singh, S. K., SaiSree, L., Amrutha, R. N. and Reddy, M. (2012). Three redundant murein endopeptidases catalyse an essential cleavage step in peptidoglycan synthesis of Escherichia coli K12. Mol Microbiol 86(5): 1036-1051.
Yokoi, K. J., Sugahara, K., Iguchi, A., Nishitani, G., Ikeda, M., Shimada, T., Inagaki, N., Yamakawa, A., Taketo, A. and Kodaira, K. (2008). Molecular properties of the putative autolysin Atl(WM) encoded by Staphylococcus warneri M: mutational and biochemical analyses of the amidase and glucosaminidase domains. Gene 416(1-2): 66-76.
Vollmer, W., Joris, B., Charlier, P. and Foster, S. (2008). Bacterial peptidoglycan (murein) hydrolases. FEMS Microbiol Rev 32(2): 259-286.
Vollmer, W. (2012). Bacterial growth does require peptidoglycan hydrolases. Mol Microbiol 86(5): 1031-1035.
Copyright: Vaz and Filipe. This article is distributed under the terms of the Creative Commons Attribution License (CC BY 4.0).
How to cite： Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Vaz, F. and Filipe, S. R. (2015). Preparation and Analysis of Crude Autolytic Enzyme Extracts from Staphylococcus aureus. Bio-protocol 5(24): e1687. DOI: 10.21769/BioProtoc.1687.
Atilano, M. L., Pereira, P. M., Vaz, F., Catalao, M. J., Reed, P., Grilo, I. R., Sobral, R. G., Ligoxygakis, P., Pinho, M. G. and Filipe, S. R. (2014). Bacterial autolysins trim cell surface peptidoglycan to prevent detection by the Drosophila innate immune system. Elife 3: e02277.
Download Citation in RIS Format
Category
Microbiology > Microbial biochemistry > Protein
Microbiology > Microbial cell biology > Cell-based analysis
Biochemistry > Carbohydrate > Glycoprotein
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,688 | https://bio-protocol.org/exchange/protocoldetail?id=1688&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Determination of Keto-deoxy-d-manno-8-octanoic acid (KDO) from Lipopolysaccharide of Escherichia coli
M. R. Sunayana
Manjula Reddy
Published: Vol 5, Iss 24, Dec 20, 2015
DOI: 10.21769/BioProtoc.1688 Views: 16704
Edited by: Valentine V Trotter
Original Research Article:
The authors used this protocol in Jan 2014
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jan 2014
Abstract
2-Keto-3-deoxy-octonate (KDO) is an essential constituent of lipopolysaccharide (LPS) that forms the outermost leaflet of Gram-negative bacterial outer membrane. LPS is mainly composed of lipid A, O-antigen and a core oligosaccharide. Two molecules of KDO are present per one molecule of LPS. A proper level of LPS is required to maintain the outer membrane integrity and either high or low levels of LPS are toxic to the cell. Various methods are available for quantification of LPS; of these, determination of KDO is a simple and accurate method and it can be estimated either directly from crude bacterial cell lysates or from purified LPS by a simple colorimetric assay. Although this procedure can be theoretically used for any Gram-negative bacterium, we used it routinely to measure KDO from cell lysates of Escherichia coli (E. coli) K12 strains.
Method: The protocol is taken from Karkhanis et al. (1978). It is a simple, sensitive and reliable method to measure KDO. The assay is performed after complete acid hydrolysis of cell lysates or LPS to release the various components of LPS. Further, reaction with periodate, arsenite and thiobarbituric acid gives a pink to red color chromophore, which is measured at 548 nm after stabilizing with DMSO.
Keywords: KDO Lipopolysaccharide Outer membrane Escherichia coli
Materials and Reagents
Bacterial strain(s) MG1655 (wild-type) (Escherichia coli K12 strain)
Periodate (H5IO6) (Merck Millipore Corporation, catalog number: 10450-60-9 )
Sodium Arsenite (NaAsO2) (Sigma-Aldrich, catalog number: S7400 )
2-Thiobarbituric acid (Sigma-Aldrich, catalog number: T5500 )
Sulphuric acid (H2SO4) (Thermo Fisher Scientific, catalog number: 7664-93-9 )
Dimethyl sulfoxide (DMSO) (Merck Millipore Corporation, catalog number: 802912 )
HEPES (Merck Millipore Corporation, CalBiochem, catalog number: 7365-45-T )
Quick Start-Bradford Reagent (Bio-Rad Laboratories, catalog number: 5000205 )
2-Keto-3-deoxyoctonate ammonium salt (KDO) (Sigma-Aldrich, catalog number: K2755 )
Bovine Serum Albumin (BSA) (Sigma-Aldrich, catalog number: A9647 )
Tryptone (Difco Laboratories, catalog number: 211705 )
Note: Currently, it is “BD, Bacto, catalog number: 211705”.
Yeast extract (Difco Laboratories, catalog number: 212750 )
Note: Currently, it is “BD, Bacto, catalog number: 212750”.
Sodium chloride (NaCl) (Sisco Research Laboratories, catalog number: 7647-14-5 )
Hydrochloric acid (HCl) (Thermo Fisher Scientific, catalog number: 7647-01-0 )
Ultra Pure water (Milli Q water) Millipore Progard TL1Cl2, MilliQ system (Merck Millipore Corporation, catalog number: PROGTLCS1 )
LB broth (see Recipes)
0.1 M periodate reagent (see Recipes)
4% sodium arsenite reagent (see Recipes)
0.6% thiobarbituric acid reagent (see Recipes)
0.5 N sulphuric acid (see Recipes)
10 mM HEPES buffer (see Recipes)
0.5 N HCl (see Recipes)
Equipment
Sonicator (Probe size, 3 mm) (Sonics Vibra, model: VLB 3X )
Centrifuge (Thermo Fisher Scientific, Eppendorf, model: 5417R )
UV-Visible Spectrophotometer (PerkinElmer, model: LAMBDA-35 )
Thermo heating bath (Labnet International, Accu BlockTM Digital Dry bath)
Pipettes (Gilson)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2015 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Sunayana, M. R. and Reddy, M. (2015). Determination of Keto-deoxy-d-manno-8-octanoic acid (KDO) from Lipopolysaccharide of Escherichia coli. Bio-protocol 5(24): e1688. DOI: 10.21769/BioProtoc.1688.
Download Citation in RIS Format
Category
Microbiology > Microbial biochemistry > Carbohydrate
Biochemistry > Carbohydrate > Polysaccharide
Biochemistry > Lipid > Lipid measurement
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
1 Q&A
Should we consider the buffer fir the Kdo assay?
0 Answer
1 View
Jun 20, 2023
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,689 | https://bio-protocol.org/exchange/protocoldetail?id=1689&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
In vitro CLE Peptide Bioactivity Assay on Plant Roots
Shiyan Chen
Xiaohong Wang
Published: Vol 5, Iss 24, Dec 20, 2015
DOI: 10.21769/BioProtoc.1689 Views: 9553
Edited by: Tie Liu
Reviewed by: Fang XuArsalan Daudi
Original Research Article:
The authors used this protocol in Jan 2015
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jan 2015
Abstract
Plant CLAVATA3/ESR (CLE)-related proteins play diverse roles in plant growth and development including regulating the development of root meristem. The mature functional forms of CLE peptides are typically 12-13 amino acids (aa) in length that are derived from the conserved C-termini of their precursor proteins. Genes encoding small secreted peptides sharing similarity to plant CLE proteins have recently been cloned from plant-parasitic nematodes, pests that infect many important crops. It is demonstrated that exogenous application of synthetic 12-14 aa CLE peptides corresponding to the CLE domain of their precursor proteins can suppress plant root growth. This protocol is to evaluate the bioactivity of CLE peptides originated from plant-parasitic nematodes by measuring the growth of plant roots or the size of root apical meristem (RAM) after CLE peptide treatment. Plants used in the study included Arabidopsis and potato.
Keywords: CLE peptide Plant-parasitic nematode Root apical meristem Potato root growth
Materials and Reagents
Micropore tape (Thermo Fisher Scientific, catalog number: 19-027-761 )
Sterile square petri dishes (VWR International, catalog number: 60872-310 )
Sterile 6-well plates (Greiner Bio-One GmbH, catalog number: 657185 )
1.7 ml microcentrifuge tubes (Laboratory Products Sales, catalog number: L211511 )
50 ml conical centrifuge tubes
Microscope slides (Laboratory Products Sales, catalog number: M130400 )
Sterile steel blades (Staples, catalog number: 111322 )
Arabidopsis thaliana (Columbia-0) seeds (https://www.arabidopsis.org/abrc/index.jsp)
Potato true seeds (Solanum tuberosum) (http://www.ars-grin.gov/nr6/)
Potato plant (Solanum tuberosum cv. Désirée) (http://www.ars-grin.gov/nr6/)
CLE peptides (> 70% purity) (Selleck Chemicals LLC) (www.selleckchem.com)
Bleach (6% sodium hypochlorite) (Clorox Company)
Sterile distilled water
Agarose (Thermo Fisher Scientific, catalog number: BP160-100 )
Timentin (PhytoTechnology Laboratories®, catalog number: T869 )
Thiamine hydrochloride (C12H17ClN4OS.HCl) (Sigma-Aldrich, catalog number: T1270 )
MS salt (Caisson Laboratories, catalog number: MSP01-50LT )
Inositol (Thermo Fisher Scientific, catalog number: AC122261000 )
2-(4-Morpholino)ethane Sulfonic Acid (MES) (Thermo Fisher Scientific, catalog number: BP300-100 )
Sodium Phosphate Monobasic Monohydrate (NaH2PO4.H2O) (Thermo Fisher Scientific, catalog number: S369-500 )
Sucrose (Thermo Fisher Scientific, catalog number: S5-12 )
Gelrite (Thermo Fisher Scientific, catalog number: CAS 71010-52-1 )
Note: Currently, it is “Sigma-Aldrich, catalog number: CAS 71010-52-1 ”.
Agar (Thermo Fisher Scientific, catalog number: BP1423-500 )
Propagation medium (1 L) (see Recipes)
½ MS medium (1 L) (see Recipes)
0.1% agarose (see Recipes)
Sodium phosphate buffer (see Recipes)
Equipment
Sterile forceps and scalpel (sterilized by heat treatment using a Bunsen burner)
360° Multi-functional tube rotator (Thermo Fisher Scientific, Barnstead Thermolyne, model: Labquake Shaker Rotisserie )
Growth chamber (Percival Scientific, model: I-66LLVL )
Biosafety cabinet (NuAire, model: Class II Type A/B3 )
Olympus BX-50 microscope
Digital CCD camera (QImaging, model: Retiga EXi )
Software
MetaMorph imaging analysis software
(http://core.phmtox.msu.edu/Scheduling/ItemDocs/9/MetaMorph_Software_Basic_Analysis_Guide.pdf)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2015 The Authors; exclusive licensee Bio-protocol LLC.
How to cite： Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Chen, S. and Wang, X. (2015). In vitro CLE Peptide Bioactivity Assay on Plant Roots. Bio-protocol 5(24): e1689. DOI: 10.21769/BioProtoc.1689.
Chen, S., Lang, P., Chronis, D., Zhang, S., De Jong, W. S., Mitchum, M. G. and Wang, X. (2015). In planta processing and glycosylation of a nematode CLAVATA3/ENDOSPERM SURROUNDING REGION-like effector and its interaction with a host CLAVATA2-like receptor to promote parasitism. Plant Physiol 167(1): 262-272.
Download Citation in RIS Format
Category
Plant Science > Plant biochemistry > Protein
Plant Science > Plant physiology > Plant growth
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
169 | https://bio-protocol.org/exchange/protocoldetail?id=169&type=1 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
ELISA Measurement of Mouse IL-2
GH Guo N. Huang
Published: Jan 5, 2012
DOI: 10.21769/BioProtoc.169 Views: 11978
Download PDF
Ask a question
Favorite
Cited by
Abstract
Interleukin-2 (IL-2) is a cytokine secreted by T cells that is essential for immune system activation. This protocol is routinely used for quantification of IL-2 concentration in the supernant of cultured lymphocytes under various stimulations and co-culturing conditions. Upon slightly modification and optimization, this protocol can also be adapted to quantitatively measure other secreted proteins and bio-molecules.
Materials and Reagents
BD OptEIA ELISA set including IL-2 standard, capture antibody, detection antibody/enzyme reagent (BD Biosciences, catalog number: 555148 )
Assay diluent (BD Biosciences, catalog number: 555213 ) or medium made of half RPM1640/10% FCS/PS and half RPM1640
Substrate solution (BD Biosciences, catalog number: 555214 )
NaCl
NaHCO3
Na2CO3
Na2HPO4
KH2PO4
KCl
Tween-20
H2SO4
Coating buffer (see Recipes)
Wash buffer (PBST, pH 7.0) (see Recipes)
Stop solution (see Recipes)
Equipment
ELISA plates (100 plates/case) (BD Biosciences, catalog number: 353279 ) and plate sealers (100 plates/case) (PGC Scientifics, catalog number: 045-826 )
96-well plates for dilution (SARSTEDT AG, catalog number: 82.1583 )
Multichannel pipette and pipette tips (eBay, catalog number: RT-L200F )
Reagent reservoir (50 ml, 5/bag) (Corning, Costar®, catalog number: 4870 )
ELISA micro plate reader
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2012 The Authors; exclusive licensee Bio-protocol LLC.
Category
Immunology > Antibody analysis > Antibody detection
Biochemistry > Protein > Immunodetection
Immunology > Immune cell function > Cytokine
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,690 | https://bio-protocol.org/exchange/protocoldetail?id=1690&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Transformation of the Cyanobacterium Leptolyngbya boryana by Electroporation
RT Ryoma Tsujimoto
HK Hiroya Kotani
AN Aoi Nonaka
YM Yuri Miyahara
YH Yuto Hiraide
YF Yuichi Fujita
Published: Vol 5, Iss 24, Dec 20, 2015
DOI: 10.21769/BioProtoc.1690 Views: 11335
Edited by: Maria Sinetova
Original Research Article:
The authors used this protocol in Feb 2015
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Feb 2015
Abstract
Leptolyngbya boryana (L. boryana) (formerly Plectonema boryanum) is a versatile, filamentous cyanobacterium that has the ability to fix nitrogen under microoxic conditions and to grow heterotrophically with glucose in the dark, providing an excellent system to investigate photosynthesis, nitrogen fixation, and their regulatory mechanisms. While L. boryana is not naturally transformable different from the unicellular cyanobacterium Synechocystis sp. PCC 6803, it can be transformed by electroporation. Here we describe the transformation of L. boryana by electroporation to isolate mutants in which a targeted gene is disrupted.
Keywords: Cyanobacteria Transformation Electroporation Targeted gene disruption Shuttle vector
Materials and Reagents
Bottle top filter system (0.22 µm) (Corning, catalog number: 430624 )
Microcentrifuge tubes (1.5 ml) (Ina-optika corporation, BIO-BIK, catalog number: ST-0150F ) or its equivalent, sterilized by autoclave (121 ºC, 20 min)
Micropipettes tips (121 ºC, 20 min)
Sterile syringe filter (Millex-GV Syringe Filter Unit, 0.22 µm), used for filter sterilization of solutions of antibiotics and glucose (Thermo Fisher Scientific, Millipore, catalog number: SLGV033RV ) or its equivalent
Petri dish [sterile Petri dishes (90 mm x 15 mm)] (ASONE Corporation, catalog number: 1-7484-01-30 ) or its equivalent
Pulse cuvettes (Gene Pulser cuvette, 0.1 cm) (Bio-Rad Laboratories, AbD Serotec®, catalog number: 1652089 )
Hybond N+ filter (disc 82 mm diameter) (GE Healthcare, Amersham, catalog number: RPN82B ), sterilized by autoclave (121 ºC, 20 min).
Leptolyngbya boryana (wild type or dg5) (grown on a BG-11 agar plate supplemented with 20 mM HEPES-KOH, pH 7.5 and 30 mM glucose)
Note: The dg5 strain was isolated from the wild type as a natural mutant that grows much faster heterotrophically in the dark than wild type (Fujita et al., 1996). Recently we identified that the mutation responsible for the dg5 phenotype is one adenine insertion causing a frameshift in the cytM gene encoding cytochrome cM (Hiraide et al., 2015).
Sterilized water (150 ml)
Note: Water is purified by RiOs Essential Water Purification System (Merck Millipore Corporation) or WEX system (Yamato). Distilled water can be also used. Autoclave (121 ºC, 20 min) and chill on ice before use.
NaNO3 (Nacalai tesque, catalog number: 31617-35 )
1 M K2HPO4 solution (Wako Pure Chemical Industries, Siyaku, catalog number: 164-04295 )
7.5% (w/v) MgSO4.7H2O (Nacalai tesque, catalog number: 21003-75 )
3.6% (w/v) CaCl2.2H2O (Nacalai tesque, catalog number: 06731-05 )
2.0% (w/v) Na2CO3 (Nacalai tesque, catalog number: 31311-25 )
Citric acid (Wako Pure Chemical Industries, Siyaku, catalog number: 038-05521 )
Ammonium iron (III) citrate, brown (Wako Pure Chemical Industries, Siyaku, catalog number: 092-00802 )
Ethylenediamine-N, N, N', N'-tetraacetic acid, disodium salt, dihydrate (EDTA-Na2) (Dojindo, catalog number: 345-01865 )
H3BO4 (Wako Pure Chemical Industries, Siyaku, catalog number: 021-02195 )
MnCl2.4H2O (Nacalai tesque, catalog number: 21211-45 )
ZnSO4.7H2O (Wako Pure Chemical Industries, Siyaku, catalog number: 268-00405 )
Na2MoO4.2H2O (Wako Pure Chemical Industries, Siyaku, catalog number: 197-02485 )
CuSO4.5H2O (Wako Pure Chemical Industries, Siyaku, catalog number: 033-04415 )
Co(NO3)2.6H2O (Wako Pure Chemical Industries, Siyaku, catalog number: 031-03752 )
1 M Glucose (filter sterilized) (Wako Pure Chemical Industries, Siyaku, catalog number: 049-31165 )
50 mg/ml kanamycin sulfate (filter sterilized) (Wako Pure Chemical Industries, Siyaku, catalog number: 111-00344 )
50 mg/ml chloramphenicol (dissolve in ethanol) (Nacalai tesque, catalog number: 08027-72 )
10 mg/ml streptomycin sulfate (filter sterilized) (Meiji Seika Pharma, catalog number: 4987222665643 )
50 mg/ml erythromycin (filter sterilized) (Wako Pure Chemical Industries, Siyaku, catalog number: 054-05101 )
4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES) (Nacalai tesque, catalog number: 17514-15 )
Plasmid preparation kit (GenElute HP Plasmid Midiprep Kit) (Sigma-Aldrich, catalog number: NA0200 )
Linearized plasmid solution (> 2 µg µl–1)
Note: The concentration of plasmid is determined by a spectrophotometer before the enzyme digestion.
Bacto Agar [1.5% (w/v)] (BD, catalog number: 214010 )
Ferric citrate solution (see Recipes)
Trace metal A5+Co solution (1 L) (see Recipes)
2x BG-11 solution (1 L) (see Recipes)
BG-11 agar plates (supplemented with 20 mM HEPES-KOH, pH 7.5, with or without appropriate antibiotics, Table 1) solidified with Bacto Agar [1.5% (w/v)] (BD, catalog number: 214010) (see Recipes)
Equipment
Forceps
Micropipettes ( P-1000 , P-200 and P-20 , or their equivalents) (Gilson)
Clean bench
Autoclave (TOMY DIGITAL BIOLOGY CO., model: SX-500 or its equivalent)
Gene pulser Xcell (Bio-Rad Laboratories, AbD Serotec®, catalog numbers: 1652666 , 1652668 and 1652669 )
Spectrophotometer (Shimadzu, model: UV-1700 or GE Healthcare, model: NanoVue Plus or its equivalent)
Aspirator (with a vacuum pump)
Growth cabinet (with appropriate fluorescence light bulbs)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2015 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Tsujimoto, R., Kotani, H., Nonaka, A., Miyahara, Y., Hiraide, Y. and Fujita, Y. (2015). Transformation of the Cyanobacterium Leptolyngbya boryana by Electroporation. Bio-protocol 5(24): e1690. DOI: 10.21769/BioProtoc.1690.
Download Citation in RIS Format
Category
Microbiology > Microbial genetics > Transformation
Molecular Biology > DNA > Transformation
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,691 | https://bio-protocol.org/exchange/protocoldetail?id=1691&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Extraction of Apoplastic Wash Fluids and Leaf Petiole Exudates from Leaves of Arabidopsis thaliana
TA Takao Araya
AB Anne Bohner
Nicolaus von Wirén
Published: Vol 5, Iss 24, Dec 20, 2015
DOI: 10.21769/BioProtoc.1691 Views: 13823
Edited by: Tie Liu
Original Research Article:
The authors used this protocol in Feb 2015
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Feb 2015
Abstract
The long-distance translocation of metabolites and mineral elements is crucial for plant growth and reproduction. In most cases, source-to-sink translocation of metabolites and minerals requires their passage through the apoplast, irrespective whether they are transported via the xylem or the phloem. This apoplast-mediated pathway is of particular importance during plant senescence, when photoassimilates as well as organic, inorganic or chelated forms of nutrients are translocated from leaves to fruits or seeds. Recent genetic and physiological studies revealed the involvement of numerous membrane transporters mediating phloem loading of amino acids, sugars, urea or mineral elements. To evaluate the contribution of individual transporters to xylem unloading or phloem loading, the collection of apoplastic fluids and of phloem sap is essential. Here, we describe a method for the extraction of apoplastic fluids and the collection of leaf petiole exudates from Arabidopsis leaves, the latter representing an approximation to the real composition of the phloem sap.
Materials and Reagents
Paper towel
50 ml Falcon tube (Tubes, 50 ml, PP) (Greiner Bio-One GmbH, catalog number: 227 261 )
1.5 ml tube (Safe-Lock tubes 1.5 ml) (Eppendorf, catalog number: 0030 120.086 )
For extraction of apoplastic fluids
Arabidopsis leaves (4 g fresh weight for one repetition)
Note: Healthy leaves should be used, preferentially from hydroponic or soil culture.
Autoclaved distilled water
Ice
For extraction of petiole exudates
Arabidopsis leaves (2-3 leaves for one repetition)
Ethylenediaminetetraacetic acid (EDTA) (Thermo Fisher Scientific, InvitrogenTM, catalog number: 15576-028 )
Potassium hydroxide (KOH) (Carl Roth GmbH + Co., catalog number: P747 )
10 mM EDTA solution (see Recipes)
Equipment
Glass beaker, 600 ml (Kavalierglass of North America, Simax, catalog number: 1632417010600 )
Vacuum desiccator
Vacuum pump with air gauge (KNF Neuberger GmbH, model: N022AT.18 )
Centrifuge for 50 ml tubes (Centrifuge 5810R) Eppendorf, catalog number: 5810 000.017 )
Growth chamber for plant cultivation (Percival Scientific, model: CU-41L4X )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2015 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Araya, T., Bohner, A. and Wirén, N. V. (2015). Extraction of Apoplastic Wash Fluids and Leaf Petiole Exudates from Leaves of Arabidopsis thaliana. Bio-protocol 5(24): e1691. DOI: 10.21769/BioProtoc.1691.
Download Citation in RIS Format
Category
Plant Science > Plant metabolism > Metabolite profiling
Plant Science > Plant physiology > Metabolism
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,692 | https://bio-protocol.org/exchange/protocoldetail?id=1692&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Analysis of Murine Lung Tumors by Micro PET-CT Imaging
Chiara Ambrogio*
Juan Antonio Cámara*
Patricia Nieto
David Santamaría
Francisca Mulero
*Contributed equally to this work
Published: Vol 5, Iss 24, Dec 20, 2015
DOI: 10.21769/BioProtoc.1692 Views: 13701
Edited by: HongLok Lung
Original Research Article:
The authors used this protocol in Nov 2014
Download PDF
Ask a question
Favorite
Cited by
Original research article
The authors used this protocol in:
Nov 2014
Abstract
Accurate live tumor imaging in mice is now possible by means of high-resolution positron emission tomography (micro-PET) and X-ray computed tomography (micro-CT). By providing a powerful tool to examine biological samples with complex structure in vivo, this technology generated a significant advance in the cancer research field, particularly regarding the ability to perform longitudinal studies in combination with a therapeutic intervention. Here, we describe methods to optimize visualization of murine lung tumors by micro-PET, micro-CT and combined micro-PET-CT.
Keywords: Cancer Imaging CT Lung cancer
Part I. Imaging by positron emission tomography (micro-PET)
The imaging of tumors at inner body locations in living animals is more challenging than the imaging of subcutaneous tumors. We have optimized the procedures outlined in the following protocol in order to study lung tumors in genetically modified mice and orthotopic models. Briefly, the mice are anesthetized prior to the administration of the [18F]-Fluorodeoxigluycose (18F-FDG) dose, and kept under anesthesia during the whole period of probe uptake and imaging, ensuring at all times that the mice are warm. The standardization of mouse handling and of anesthesia usage is essential to ensure data reproducibility and comparability.
Materials and Reagents
1-cc tuberculin syringes (B. Braun España, model: Omnifix-F )
30-G needles (B. Braun España, model: Sterican )
Heating pads [e.g., Gaymar Mul-T-Pads (Gaymar industries) (http://www.gaymar.com/)]
Heating pump to maintain temperature of heating pads [e.g., Gaymar TP600 (Gaymar industries) (http://www.gaymar.com/)]
Genetically modified mouse models bearing endogenous lung tumors (i.e., our own K-RasG12V inducible mouse model, Guerra et al., 2003), lung orthotopic implantation of primary tumors (Ambrogio et al., 2014), or tail-vein injected lung tumor cells (Ambrogio et al., 2014) (Figure 1)
Figure 1. Types of murine lung tumors detectable by PET-CT scan. PET-CT technology can be used to detect lung tumors of different origins: from the left, endogenous lung tumors (i.e., tumors induced by a K-RasG12V resident knock-in allele in a genetically engineered mouse model), tail vein-injected lung cancer cell lines or orthotopically implanted lung tumors (either murine or human lung adenocarcinomas). Scale bar: 200 μM.
Special mouse diets as necessary (Cussó et al., 2014)
Inhalational anesthesia:
Sevoflurane [e.g., Sevoflo (Abbott Laboratories, catalog number: 05458-02 ) (http://www.abbottanimalhealth.com/veterinary-professionals/products/anesthesia/sevoflo.html)]
Oxygen obtained from an O2 concentrator
[18F]FDG (0.01 to 0.1 μg/mCi), delivered daily from a local cyclotron (e.g., 40 mCi of [18F]FDG of 95% to 99% radiochemical purity in 1 ml of physiological saline solution buffered at pH 6.0, for ~10 micro-PET scans)
Physiological saline: 0.9% (w/v) NaCl (B. Braun España)
Lacryvisc Gel 10 G (3 mg/ml carbomere in benzalconium chloride) (Alcon) (http://www.alcon.com)
Equipment
O2 concentrator (Eickemeyer Veterinary Equipment, model: Oxymat e3 )
Infrared heating lamp Philips PAR38 IR 175W E27 (Royal Philips Electronics)
Sevoflurane/oxygen-based anesthesia system fitted with an induction chamber and inhalation masks for mice McKinley, Type 2 (Everest tecnologia veterinaria)
Dose calibrator (also known as activimeter) [e.g., VDC-505 dose calibrator (Veenstra Instruments) (http://www.dosecalibrator.com/)]
micro-PET-CT imaging system [e.g., eXplore Vista PET-CT (GE Healthcare) (Figure 2); Argus PET-CT (SEDECAL) (http://www.sedecal.com/)]
Figure 2. Micro-PET-CT machine (Argus SEDECAL) for mice
Workstation (e.g., Dell PowerEdge) for image acquisition, processing, and analysis meeting the following specifications:
PE1950 Xeon 5120 1.86 GHz/4 MB 1066 FSB processor
PE1950 PCIX Riser (2 slots)
PE1950 Bezel Assembly
2 GB FB 667 MHz Memory (2 x 1 GB dual rank DIMMs)
Alienware Dell Studio XPS Desktop 435 MT PC (for 3DOSEM image reconstruction) meeting the following specifications:
Processor: Intel Core i7 Quad CPU 940 4 x 2.93 GHz
Memory: 6144 MB (6 x 1,024) 1067 MHZ DDR3
Graphics: ATI Radeon HD 3450 256 Mb GDDR2
Software
eXplore Vista PET-CT MMWKS software (Desco et al., 2005) or AMIDE software (Loening and Gambhir, 2003) for image acquisition, processing, and analysis
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2015 The Authors; exclusive licensee Bio-protocol LLC.
Category
Cancer Biology > General technique > Tumor formation
Cell Biology > Cell imaging > Live-cell imaging
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,693 | https://bio-protocol.org/exchange/protocoldetail?id=1693&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Porous Scaffold Seeding and Chondrogenic Differentiation of BMSC-seeded Scaffolds
Troy D. Bornes
Nadr M. Jomha
Aillette Mulet-Sierra
Adetola B. Adesida
Published: Vol 5, Iss 24, Dec 20, 2015
DOI: 10.21769/BioProtoc.1693 Views: 8717
Reviewed by: Jalaj Gupta
Original Research Article:
The authors used this protocol in Apr 2015
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Apr 2015
Abstract
Bone marrow-derived mesenchymal stromal stem cells (BMSCs) are a promising cell source for treating articular cartilage defects (Bornes et al., 2014). BMSCs can be seeded within porous biomaterial scaffolds that support three-dimensional cell organization, chondrogenic differentiation and extracellular matrix deposition for the creation of engineered cartilage. This protocol describes our defined methods for isolation and expansion of human and ovine BMSCs, seeding of BMSCs within porous scaffolds and in vitro chondrogenic differentiation (Adesida et al., 2012; Bornes et al., 2015).
Keywords: Mesenchymal stem cell Scaffold Cell seeding Chondrogenesis Cartilage
Materials and Reagents
Culture plate, 24 wells (Becton Dickinson Labware, catalog number: 353047 )
Note: Currently, it is “Corning, Falcon®, catalog number: 353047”.
Pipette tips, 1,000 μl, 200 μl and 10 μl volumes (Corning, DeckWorksTM, catalog numbers: 4124 , 4121 and 4120 )
Pasteur pipettes, 230 mm length (WHEATON, catalog number: 4500448667 )
Note: Currently, it is “WHEATON, catalog number: 357335”.
Conical tube, 50 ml volume (Corning, Falcon®, catalog number: 352070 )
Cell strainer, nylon with 100 μm pores (Corning, BD Biosciences, catalog number: 352360 )
Tissue-culture flask, 150 cm2 surface area (T150) (Corning, Falcon®, catalog number: 355000 )
Conical microtube, 1.5 ml volume (Bio Basic Canada, catalog number: TC152SN )
Biopsy punch, circular with 6 mm diameter (Southern Anesthesia & Surgical, Miltex, catalog number: 3336 )
Bone marrow aspirate, human or ovine, collected through needle aspiration at the iliac crest
Crystal violet solution (Sigma-Aldrich, catalog number: HT90132 )
Alpha minimal essential medium (αMEM), containing Earle’s salts, ribonucleosides, deoxyribonucleosides and L-glutamine (Thermo Fisher Scientific, Corning, Mediatech，catalog number: 10022CV )
Fetal bovine serum (FBS), heat inactivated at 56 °C in the laboratory (Life Technologies, Gibco®, catalog number: 12483 )
Note: Currently, it is “Thermo Fisher Scientific, GibcoTM, catalog number: 12483 ”.
4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES) (1 M) (Life Technologies, Gibco®, catalog number: 15630 )
Note: Currently, it is “Thermo Fisher Scientific, GibcoTM, catalog number: 15630”.
Sodium pyruvate, 100 mM (Life Technologies, Gibco®, catalog number: 11360 )
Note: Currently, it is “Thermo Fisher Scientific, GibcoTM, catalog number: 11360”.
Fibroblast growth factor-two (FGF-2), human recombinant (Neuromics, catalog number: PR80001 )
Dulbecco’s phosphate buffered saline (PBS), sterile filtered (Sigma-Aldrich, catalog number: D8537 )
Human serum albumin (Sigma-Aldrich, catalog number: A4327 )
Transforming growth factor-beta three (TGF-β3), human recombinant, HEK (Prospecbio, ProSpec, catalog number: CYT-113 )
L-Ascorbic acid 2-phosphate sesquimagnesium salt hydrate (Sigma-Aldrich, catalog number: A8960 )
Dexamethasone-Water Soluble (Sigma-Aldrich, catalog number: D2915 )
L-proline (Sigma-Aldrich, catalog number: P5607 )
Trypan blue solution, 0.4% (Sigma-Aldrich, catalog number: T8154 )
Porous scaffolds, collagen I or esterified hyaluronic acid (described in detail in Bornes et al., 2015)
Penicillin-streptomycin-glutamine (Life Technologies, Gibco®, catalog number: 1248310378 ) (see Recipes)
Note: Currently, it is “Thermo Fisher Scientific, GibcoTM, catalog number: 1248310378 ”.
Trypsin-ethylenediaminetetraacetic acid (EDTA) (Thermo Fisher Scientific, Corning, catalog number: 25052 ) (see Recipes)
Dulbecco’s modified Eagle’s medium (DMEM) (Sigma-Aldrich, catalog number: D6429 ) (see Recipes)
Insulin-transferrin-selenium (ITS+) premix (Corning, BD Biosciences, catalog number: 354352 ) (see Recipes)
Expansion medium (see Recipes)
Serum-free medium (see Recipes)
TGF-β3 working solution (see Recipes)
Chondrogenic medium (see Recipes)
Equipment
Biosafety cabinet (Microzone Corporation, catalog number: BK-2-6 A2 )
Incubator, containing humidified air at 37 °C with 5% carbon dioxide, and 3% oxygen (Thermo Fisher Scientific, catalog number: Forma Series II Water Jacket CO2 )
Centrifuge, 1,500 revolutions per min (rpm) (Beckman Coulter, AllegraTM, catalog number: X-22R )
Light microscope (Microscope, Omano, catalog number: OM159T )
Pipette (Drummond Scientific Company, catalog number: Pipet Aid XP )
Micropipettes, volumes of 100-1,000 μl, 20-200 μl, 2-20 μl, and 0.5-10 μl (Bio-Rad Laboratories, catalog numbers: 1660508 , 1660507 , 1660506 , and 1660505 )
Suction source
Forceps
Water bath, set to 37 °C (VWR International, catalog number: 89501 )
Neubauer hemacytometer, 0.1 mm deep (Reichert Bright-Line) (Sigma-Aldrich, catalog number: Z359629 )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2015 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Bornes, T. D., Jomha, N. M., Mulet-Sierra, A. and Adesida, A. B. (2015). Porous Scaffold Seeding and Chondrogenic Differentiation of BMSC-seeded Scaffolds. Bio-protocol 5(24): e1693. DOI: 10.21769/BioProtoc.1693.
Download Citation in RIS Format
Category
Stem Cell > Adult stem cell > Maintenance and differentiation
Cell Biology > Cell isolation and culture > Cell differentiation
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,694 | https://bio-protocol.org/exchange/protocoldetail?id=1694&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Neurite Outgrowth Assay
AF Angela R. Filous
JS Jerry Silver
Published: Vol 6, Iss 1, Jan 5, 2016
DOI: 10.21769/BioProtoc.1694 Views: 11141
Edited by: Soyun Kim
Reviewed by: Yatang LiEmmanuelle Berret
Original Research Article:
The authors used this protocol in Dec 2014
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Dec 2014
Abstract
Neurite outgrowth in culture provides an easy way to determine the effects of a particular substrate or exogenous factor on neuron behavior. Dissociated neurons can be plated on a variety of substrates and the length of the longest neurite outgrowth can be compared. Here, we describe how to isolate and dissociate dorsal root ganglion (DRG) neurons, culture them on coverslips, and measure longest neurite outgrowth.
Keywords: Neurite outgrowth Dorsal root ganglion (DRG) Glia Laminin
Materials and Reagents
12 mm glass coverslips
24 well plate
Pipette tips
Poly-L-lysine hydrobromide (PLL) (Sigma-Aldrich, catalog number: P1274 )
Laminin Mouse Protein, Natural (Invitrogen, catalog number: 23017-015 )
Note: Currently, it is “Thermo Fisher Scientific, GibcoTM, catalog number: 23017-015”.
HBSS-CMF (HBSS) (Thermo Fisher Scientific, GibcoTM, catalog number: 14185-052 )
Collagenase II (Worthington Biochemical Corporation, catalog number: 4176 )
Dispase II (Roche Diagnostics, catalog number: 04942078001 )
Penicillin-streptomycin (Invitrogen, catalog number: 15140122 )
Note: Currently, it is “Thermo Fisher Scientific, GibcoTM, catalog number: 15140122”.
B-27® Serum-Free Supplement (50x) (Invitrogen, catalog number: 17504-044 )
Note: Currently, it is “Thermo Fisher Scientific, GibcoTM, catalog number: 17504-044”.
Glutamax (Thermo Fisher Scientific, GibcoTM, catalog number: 35050 )
Neurobasal-A (Invitrogen, catalog number: 10888-022 )
Note: Currently, it is “Thermo Fisher Scientific, GibcoTM, catalog number: 10888-022”.
1x Phosphate-buffer saline (PBS) (Roche Diagnostics, catalog number: 11-666-789-001 )
4% paraformaldehyde (PFA) (Electron Microscopy Sciences, catalog number: 15710-S )
Monoclonal Anti-β-Tubulin III antibody produced in mouse (msIgG2b) (Sigma-Aldrich, catalog number: T8660 )
Goat anti-mouse IgG2b 594 (Invitrogen, catalog number: A21145 )
Note: Currently, it is “Thermo Fisher Scientific, NovexTM, catalog number: A21145”.
Equipment
37 °C, 5% CO2 forced air incubator
Dissecting microscope
Surgical tools
Forceps (Fine Science Tools, catalog number: 11254-20 )
Microscissors (Fine Science Tools, catalog number: 15003-08 )
Rongeurs (Fine Science Tools, catalog number: 16021-14 )
Pipettes
Hemocytometer
Microcentrifuge
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
How to cite： Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Filous, A. R. and Silver, J. (2016). Neurite Outgrowth Assay. Bio-protocol 6(1): e1694. DOI: 10.21769/BioProtoc.1694.
Filous, A. R., Tran, A., Howell, C. J., Busch, S. A., Evans, T. A., Stallcup, W. B., Kang, S. H., Bergles, D. E., Lee, S. I., Levine, J. M. and Silver, J. (2014). Entrapment via synaptic-like connections between NG2 proteoglycan+ cells and dystrophic axons in the lesion plays a role in regeneration failure after spinal cord injury. J Neurosci 34(49): 16369-16384.
Download Citation in RIS Format
Category
Neuroscience > Cellular mechanisms > Cell isolation and culture
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,695 | https://bio-protocol.org/exchange/protocoldetail?id=1695&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Measurement of 2-methylthio Modifications in Mitochondrial Transfer RNAs by Reverse-transcription Quantitative PCR
Fan-Yan Wei
KT Kazuhito Tomizawa
Published: Vol 6, Iss 1, Jan 5, 2016
DOI: 10.21769/BioProtoc.1695 Views: 8372
Edited by: Masahiro Morita
Reviewed by: Yannick Debing
Original Research Article:
The authors used this protocol in Mar 2015
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Mar 2015
Abstract
2-Methylthio-N6-isopentenyladenosine (ms2i6A) is an evolutionally conserved posttranscriptional modification found at position 37 of four mammalian mitochondrial tRNAs, mt-tRNASer(UCN), mt-tRNATrp, mt-tRNAPhe and mt-tRNATyr. The ms2 modification in ms2i6A strengthens codon-anticodon interaction and contributes to accurate and efficient decoding. Deficiency of ms2 modifications impairs mitochondrial protein synthesis, which ultimately leads to the development of myopathy in mice and patients having mitochondrial diseases. Therefore, the level of ms2 could be utilized as an indicator that reflects the status of mitochondrial protein synthesis. Here, we describe a simple and fast quantitative PCR-based method to measure the ms2 level in total RNA sample.
Keywords: TRNA Modification Mitochondria
Materials and Reagents
Total RNA (200 ng~1 ng)
Note: We have been using 50~200 ng RNA as the starting materials. To compare the results between experiments, it is recommended to use same amount of RNA in all experiments.
It is recommended to use a method that can purify small RNAs [e.g., TRIzol (Invitrogen, catalog number: 15596-018 ) or miRNeasy Mini Kit (QIAGEN, catalog number: 217004 ). Check the purity of RNA by a spectrophotometer. For consistency of experiments, always use RNA with an A260/A280 ratio > 1.8.
Note: Currently, TRIzol is from “Thermo Fisher Scientific, AmbionTM, catalog number: 15596-018”.
PCR grade distilled water
Microtubes for PCR and real-time PCR (MicroAmp® Optical 8-Cap Strip) (Thermo Fisher Scientific, Applied Biosystems®, catalog number: 4323032 )
DNase I (10x buffer is provided along with the enzyme) (Roche Diagnostics, catalog number: 04716728001 )
Reverse transcription reagent (Transcriptor First Strand cDNA Synthesis kit) (Roche Diagnostics, catalog number: 04897030001 )
Critical Point: It is recommended to use Transcriptor First Strand cDNA Synthesis kit for measurement of ms2 modification. Compared with other reverse transcription kits, this kit gives the highest dynamic range.
Real-time PCR reagent (SYBR Premix Ex Taq II) (TAKARA BIO INC., catalog number: RR820S )
Note: SYBR green based PCR reagents from other companies work equally well.
Primers for detecting mitochondrial ms2 modifications in human RNA samples
Hu_tRNAPhe primer f1: CTCCTCAAAGCAATACACTG
Hu_tRNAPhe primer r1: AGCCCGTCTAAACATTTTCA
Hu_tRNAPhe primer r2: GGGTGATGTGAGCCCGTCTA
Hu_tRNASerUCN primer f1: GAGGCCATGGGGTTGG
Hu_tRNASerUCN primer r1: CCCAAAGCTGGTTTCAAGC
Hu_tRNASerUCN primer r2: AATCGAACCCCCCAAAGC
Hu_tRNATrp primer f1: GGTTAAATACAGACCAAGAGC
Hu_tRNATrp primer r1: CAACTTACTGAGGGCTTTGAA
Hu_tRNATrp primer r2: TTAAGTATTGCAACTTACTGAGG
Hu_tRNATyr primer f1: GCTGAGTGAAGCATTGGACT
Hu_tRNATyr primer r1: AACCCCTGTCTTTAGATTTACA
Hu_tRNATyr primer r2: AGAGGCCTAACCCCTGTCTT
Primers for detecting mitochondrial ms2 modification in mouse RNA samples
Ms_tRNAPhe primer f1: GCTTAATAACAAAGCAAAGCA
Ms_tRNAPhe primer r1: TATCCATCTAAGCATTTTCA
Ms_tRNAPhe primer r2: TGGGATACAATTATCCATCT
Ms_tRNASerUCN primer f1: CATATAGGATATGAGATTGGC
Ms_tRNASerUCN primer r1: AACCCCCTAAAATTGGTTTCA
Ms_tRNASerUCN primer r2: GAAGGAATCGAACCCCCTAA
Ms_tRNATrp primer f1: GGATATACTAGTCCGCGAGC
Ms_tRNATrp primer r1: GTGTTTTCTTAGGGCTTTGA
Ms_tRNATrp primer r2: GTTAAACTTGTGTGTTTTCTTAG
Ms_tRNATyr primer f1: ATGGCTGAGTAAGCATTAGA
Ms_tRNATyr primer r1: ACCTCTGTGTTTAGATTTAC
Ms_tRNATyr primer r2: GAGGATTTAAACCTCTGTGT
Notes:
Standard PCR grade primers are sufficient for this protocol.
The r1 primer is used for the measurement of total tRNA level, and the r2 primer is
used for the measurement of ms2-modification level in individual tRNA.
Equipment
Conventional PCR apparatus (Thermo Fisher Scientific, Applied Biosystems®, model: Veriti 96 Well Thermal Cycler )
Real-time PCR apparatus (Life Technologies, Applied Biosystems®, model: 7300 Real Time PCR System )
Note: Currently, it is “Thermo Fisher Scientific, model: 7300 Real Time PCR System ”.
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Wei, F. and Tomizawa, K. (2016). Measurement of 2-methylthio Modifications in Mitochondrial Transfer RNAs by Reverse-transcription Quantitative PCR. Bio-protocol 6(1): e1695. DOI: 10.21769/BioProtoc.1695.
Download Citation in RIS Format
Category
Cancer Biology > Cellular energetics > Biochemical assays
Cell Biology > Cell metabolism > Other compound
Molecular Biology > RNA > qRT-PCR
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,696 | https://bio-protocol.org/exchange/protocoldetail?id=1696&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Preparation of Recombinant Galectin-3 for Cancer Studies
KT Kari Tyler
SL Sok-Hyong Lee
Erwin G. Van Meir
Published: Vol 6, Iss 1, Jan 5, 2016
DOI: 10.21769/BioProtoc.1696 Views: 8671
Edited by: HongLok Lung
Reviewed by: Clara Lubeseder-Martellato
Original Research Article:
The authors used this protocol in May 2006
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
May 2006
Abstract
Galectin-3 is a member of a class of proteins termed Galectins, characterized by their ability to bind glycans containing β-galactose (Cummings and Liu, 2009). Galectin-3 binds preferentially to proteoglycans terminating with N-acetyllactosamine (LacNAc) chains (i.e., tandem repeats of galactose) (Newlaczyl and Yu, 2011). Galectin-3 is unique among the galectins in its chimeric structure. It shares a conserved carbohydrate recognition domain (CRD) with the other galectins, but has a long amino-terminal tail that is thought to be involved in protein aggregation. It can also form homodimers through its CRD (Cummings and Liu, 2009). Galectin-3 has been found to have diverse functions in tumorigenesis including: signaling, apoptosis inhibition, immune suppression, cell growth, and metastasis among others. Galectin-3 is frequently upregulated in cancers (Nangia-Makker et al., 2008). Its function largely depends on its expression and localization properties (Newlaczyl and Yu, 2011). Because of its many roles in cancer-associated processes, establishing a method for Galectin-3 production is valuable for further study of its functions in cancer. Here, we describe how Galectin-3 purification was achieved by cloning of the human Galectin-3 gene into pGEX-2T vector containing the gene for glutathione-S-transferase (GST) upstream of its cloning site. The Galectin-3 gene was cloned into this vector via restriction digests of both the plasmid and the Galectin-3 gene by restriction enzymes BamHI and EcoRI, followed by ligation of the two fragments. The resulting plasmid was then used to transform BL21, an Escherichia coli (E. coli) strain specialized for protein expression. Finally, we discuss how the GST fusion protein was isolated and the recombinant Galectin-3 protein was further purified from the GST.
Keywords: Cancer Galectin GST
Part I. Protocol for GST-Gal3 purification (Harper and Speicher, 2011)
Materials and Reagents
Microcentrifuge tubes (Denville Posi-Click Tubes, catalog number: C-2170 )
15 ml conical tubes (Thermo Fisher Scientific, Corning CentriStar, catalog number: 05-538-59A )
10 ml serological pipettes (Thermo Fisher Scientific, Corning Costar, catalog number: 4488 )
One Shot® BL21 StarTM (DE3) Chemically Competent E. coli (Thermo Fisher Scientific, catalog number: C6010-03 )
pGEX 2T-Gal3 vector (kindly provided by Dr. W. Stallcup, UCSD, CA)
L-broth (Thermo Fisher Scientific, catalog number: BP1426-2 )
Glutathione-Agarose Beads (Thermo Fisher Scientific, PierceTM, catalog number: 16100 )
Protease Inhibitor Tablets, EDTA-free (Thermo Fisher Scientific, PierceTM, catalog number: 88665 )
Ice
Purified Water
10x PBS, diluted to 1x (Thermo Fisher Scientific, Hyclone, catalog number: BP3994 )
Isopropyl-beta-D-thiogalactopyranoside (IPTG) (Gold Biotechnology, catalog number: 12481C25 )
Tris-Cl (pH 7.5)
150 mM NaCl
0.75% CHAPS powder (AG. Scientific, catalog number: C-1019 )
0.75% CHAPS buffer (see Recipes)
Equipment
Microfuge (Beckman Coulter, model: Microfuge 16 )
37 °C shaker (FormaOrbital Shaker)
Shaker (GMI, Lab Companion, model: SK-300 Shaker )
Rotating Platform (24 rpm) (Benchmark model: MiniMixer )
Vortex (Thermo Fisher Scientific, catalog number: 12-812 )
Note: Currently, it is “LabX, catalog number: 12-812”.
Centrifuge (Beckman Coulter, model: Avanti J-20 XP )
Centrifuge rotor (Beckman Coulter, model: JLA-16.250 )
Centrifuge (Beckman Coulter, model: Allegra 25R )
Centrifuge rotor (Beckman Coulter, model: TS-5.1-500 )
250 ml plastic centrifuge bottles (Sigma-Aldrich, Nalgene®, model: B1033 )
2 L flask (Corning, Pyrex®, model: No. 4980 )
10 ml serological pipettes (Corning, Costar®, catalog number: 4488 )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Tyler, K., Lee, S. and Van Meir, E. G. (2016). Preparation of Recombinant Galectin-3 for Cancer Studies. Bio-protocol 6(1): e1696. DOI: 10.21769/BioProtoc.1696.
Download Citation in RIS Format
Category
Cancer Biology > General technique > Biochemical assays
Cancer Biology > General technique > Tumor microenvironment
Biochemistry > Protein > Expression
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,697 | https://bio-protocol.org/exchange/protocoldetail?id=1697&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Super-resolution Imaging of Live BY2 Cells Using 3D-structured Illumination Microscopy
KB Karen Bell
KO Karl Oparka
KK Kirsten Knox
Published: Vol 6, Iss 1, Jan 5, 2016
DOI: 10.21769/BioProtoc.1697 Views: 8760
Edited by: Fanglian He
Original Research Article:
The authors used this protocol in Aug 2015
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Aug 2015
Abstract
Light microscopy is the standard tool for studying sub-cellular structures however, owing to the diffractive properties of light, resolution is limited to 200 nm. Super-resolution microscopy methods circumvent this limit, offering greater resolution, particularly when studying fluorescently labeled sub-cellular structures. Super-resolution methods such as 3D-SIM (Structured Illumination Microscopy) fill a useful niche between confocal and electron microscopy. We have previously had success using fixed plant tissue samples with 3D-SIM (Bell and Oparka, 2014). However, sensitive structures can be altered by fixation and embedding procedures, so we developed a method for imaging live cells. In this protocol we used 3D-SIM to image the ER and Hechtian Strands in live, plasmolysed BY2 cells.
Materials and Reagents
Microscope slides (Thermo Fisher Scientific)
#1.5 coverslips (0.17 mm thick) (Thermo Fisher Scientific)
BY2 cells expressing fluorescent marker
250 ml Erlenmeyer flasks (Thermo Fisher Scientific)
Murashige and Skoog (MS) basal salt media (Sigma-Aldrich, catalog number: M5519 )
Sucrose (Thermo Fisher Scientific)
(2, 4-Dichlorophenoxy) acetic acid sodium salt monohydrate (Sigma-Aldrich, catalog number: D6679 )
Calcofluor white/Fluorescent Brightener 28 (Sigma-Aldrich, catalog number: F3543 )
1 M D-Mannitol pure (Scientific Laboratory Supplies, catalog number: CHE1796 )
Nail varnish
BY2 growth media (see Recipes)
Calcofluor White Stock solution (see Recipes)
Equipment
Controlled temperature (28 °C) incubator or room
Orbital shaker
PersonalDV Deltavision Epi-fluorescence Inverted Microscope (GE Healthcare, Dharmacon)
3D-SIM microscope [DeltaVision OMX Blaze (GE Healthcare, Dharmacon) fitted with an Olympus PlanApo N 100x 1.42 NA oil objective]
Edge sCMOS camera (PCO AG)
Software
SoftWoRx 6.0 (GE)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
How to cite： Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Bell, K., Oparka, K. and Knox, K. (2016). Super-resolution Imaging of Live BY2 Cells Using 3D-structured Illumination Microscopy. Bio-protocol 6(1): e1697. DOI: 10.21769/BioProtoc.1697.
Knox, K., Wang, P., Kriechbaumer, V., Tilsner, J., Frigerio, L., Sparkes, I., Hawes, C. and Oparka, K. (2015). Putting the squeeze on Plasmodesmata: A role for reticulons in primary plasmodesmata formation. Plant Physiol 168(4): 1563-1572.
Download Citation in RIS Format
Category
Plant Science > Plant cell biology > Cell imaging
Plant Science > Plant cell biology > Cell structure
Cell Biology > Cell imaging > Live-cell imaging
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,698 | https://bio-protocol.org/exchange/protocoldetail?id=1698&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Protocol-In vitro T Cell Proliferation and Treg Suppression Assay with Celltrace Violet
KE Kristofor K. Ellestad
CA Colin C. Anderson
Published: Vol 6, Iss 1, Jan 5, 2016
DOI: 10.21769/BioProtoc.1698 Views: 31566
Edited by: Ivan Zanoni
Reviewed by: Andrea Puhar
Original Research Article:
The authors used this protocol in Dec 2014
Download PDF
Ask a question
Favorite
Cited by
Original research article
The authors used this protocol in:
Dec 2014
Abstract
Measurement of the incorporation of radionuclides such as 3H-thymidine is a classical immunological technique for assaying T cell proliferation. However, such an approach has drawbacks beyond the inconvenience of working with radioactive materials, such as the inability of bulk radionuclide incorporation measurements to accurately quantitate T cell divisions, and an inability to combine proliferation analyses with simultaneous evaluation of the expression of cellular markers in divided cells. By labeling T cells with reactive dyes such as CFSE, Celltrace Violet, and others that are partitioned equally between daughter cells at each cell division, one can relatively easily track generations of proliferated cells and their expression of various molecules by flow cytometry.
FoxP3+ regulatory T cells (Treg) are critical mediators of immune tolerance and evaluation of their functionality is an important step in characterizing many immune models (Rudensky, 2011). Classically CD4+ Treg and conventional or “responder” T cells have been isolated based on their surface expression of CD25 (Treg: CD4+CD25+, Tresp: CD4+CD25-). However, we and others have noted that populations of CD4+CD25- cells express the FoxP3 transcription factor and have suppressive function. Therefore we have utilized the transgenic FoxP3-EGFP mouse to facilitate live purification of suppressor and responder populations based on EGFP (and thus FoxP3) expression. Here we present our adapted protocol for assaying regulatory T cell suppression of Celltrace Violet-labeled responder T cells.
Keywords: Treg Proliferation Suppression Regulatory t cell Flow cytometry
Materials and Reagents
70 μm nylon mesh cell strainers (Thermo Fisher Scientific, FisherbrandTM, catalog number: 22363548 )
5 ml polypropylene round-bottom FACS tubes (BD Falcon®, catalog number: 352063 )
Note: Currently, it is “Corning, catalog number: 352063”.
50 m conical polypropylene tubes (BD Falcon®, catalog number: 352098 )
Note: Currently, it is “Corning, catalog number: 352098”.
96 well plate, U bottom (BD, Falcon®, catalog number: 353077 )
Note: Currently, it is “Corning, catalog number: 353077”.
Mice
B6-FoxP3EGFP strain (B6.Cg-Foxp3tm2Tch/J) (Jackson Laboratories, catalog number: 006772 ) (see Note 1)
Rag KO (Rag 1 KO, B6.129S7-Rag1tm1Mom/J) (Jackson Laboratories, catalog number: 002216 )
Biosure preservative-free 8x sheath fluid concentrate (for cell sorter) [Cedarlane, catalog number: 1027(BS) ]
Hank’s Balanced Salt solution (HBSS) (Life Technologies, InvitrogenTM, catalog number: 14170 )
Note: Currently, it is “Thermo Fisher Scientific, catalog number: 14170”.
Fetal bovine serum (Life Technologies, InvitrogenTM, catalog number: 16170078 )
Note: Currently, it is “Thermo Fisher Scientific, GibcoTM, catalog number: 16170078”.
1 M HEPES (Life Technologies, InvitrogenTM, catalog number: 15630080 )
Note: Currently, it is “Thermo Fisher Scientific, GibcoTM, catalog number: 15630080”.
PE anti-mouse CD8a (clone 53-6.7) (eBioscience, catalog number: 120081 )
APC anti-mouse CD4 (clone GK1.5) (eBioscience, catalog number: 170041 )
PerCP-eFluor 710 anti-mouse CD4 (clone RM4-5) (eBioscience, catalog number: 460042 )
APC-eFluor 780 anti-mouse TCRβ (clone H57-597) (eBioscience, catalog number: 475961 )
Ultracomp eBeads (eBioscience, catalog number: 012222 )
“Fc blocking” antibody, anti-mouse CD16/CD32 (clone 2.4g2) (9.6 mg/ml) (Bio X cell, catalog number: CUS-HB-197 )
Functional grade purified anti-mouse CD3ε (clone 145-2C11) (eBioscience, catalog number: 160031 )
Celltrace violet cell proliferation kit (Life Technologies, InvitrogenTM, catalog number: C34557 )
Note: Currently, it is “Thermo Fisher Scientific, Molecular ProbesTM, catalog number: 16170078”.
LIVE/DEAD Fixable Yellow Dead cell stain kit (Life Technologies, InvitrogenTM, catalog number: L34959 ) or 7-Aminoactinomycin D (7-AAD) (Sigma-Aldrich, catalog number: A9400)
Note: Currently, it is “Thermo Fisher Scientific, Molecular ProbesTM, catalog number: L34959”.
18 MΩ.cm deionized water
Dulbecco modified Eagle medium (DMEM) (Life Technologies, InvitrogenTM, catalog number: 11965 )
Note: Currently, it is “Thermo Fisher Scientific, InvitrogenTM, catalog number: 11965 ”.
Pen/strep (100 U/ml Penicillin, 100 μg/ml Streptomycin) (Life Technologies, InvitrogenTM, catalog number: 15140122 )
Note: Currently, it is “Thermo Fisher Scientific, GibcoTM, catalog number: 15140122”.
Non-essential amino acids (Life Technologies, InvitrogenTM, catalog number: 11140050 )
Note: Currently, it is “Thermo Fisher Scientific, GibcoTM, catalog number: 11140050”.
Sodium pyruvate (Life Technologies, InvitrogenTM, catalog number: 11360070 )
Note: Currently, it is “Thermo Fisher Scientific, GibcoTM, catalog number: 11360070”.
L-glutamine (Life Technologies, InvitrogenTM, catalog number: 25030081 )
Note: Currently, it is “Thermo Fisher Scientific, GibcoTM, catalog number: 25030081”.
2-mercaptoethanol (Sigma-Aldrich, catalog number: M3148 )
Enriched DMEM (E-DMEM) (see Recipes)
Phosphate-buffered saline (PBS) (see Recipes)
ACK lysis buffer (see Recipes)
Equipment
Cell sorter (BD Biosciences, model: BD Influx )
Flow cytometer with 405 nm excitation capability (see note 3) (BD Biosciences, model: BD LSR II )
37 °C humidified incubator, 5% CO2
Centrifuge (capable of spinning 50 ml conical tubes, 5 ml FACS tubes and 96 well plates)
Multichannel pipette (30-300 μl) (Eppendorf)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
Category
Immunology > Immune cell function > Lymphocyte
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,699 | https://bio-protocol.org/exchange/protocoldetail?id=1699&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
PhagoKinetic Track Assay: Imaging and Analysis of Single Cell Migration
Michiel Fokkelman
WR Wies van Roosmalen
VR Vasiliki-Maria Rogkoti
SD Sylvia E. Le Dévédec
BG Benjamin Geiger
BW Bob van de Water
Published: Vol 6, Iss 1, Jan 5, 2016
DOI: 10.21769/BioProtoc.1699 Views: 9681
Reviewed by: Guillaume Bompard Shannon Ruppert
Original Research Article:
The authors used this protocol in Apr 2015
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Apr 2015
Abstract
Cell migration is a highly complex and dynamic biological process, essential in several physiological phenomena and pathologies including cancer dissemination and metastasis formation. Thus understanding single cell migration is highly relevant and requires a suitable image-based assay. Depending on the speed of the moving cells, one may require fast time-lapse microscopy, which is not always suitable for high-throughput screening. To overcome this, a quantitative and fixed single cell migration assay was developed based on the PhagoKinetic Tracks (PKT) procedure. Briefly, cells are seeded on top of a monolayer of carboxylated latex beads, and as cells migrate, they phagocytose these beads and leave behind a migratory track. These bead-free migratory tracks can be visualized using a standard bright field microscope and analysed for a multiparametric quantitative assessment of single cell migration (Naffar-Abu-Amara et al., 2008).
Here we describe a detailed and optimized protocol of the PKT assay, adaptable for both RNAi and drug screening (van Roosmalen et al., 2015). This protocol allows the user to study migratory behaviour at the single cell level, without fast and live-imaging microscopy.
Keywords: Cell migration Microscopy High throughput Screening Image analysis
Materials and Reagents
Tumour cells [in particular, this assay was set up for H1299 non-small cell lung carcinoma cells (ATCC, catalog number: CRL-5803 ) and breast cancer cell lines MDA-MB-231 (ATCC, catalog number: HBT-26 ),
MDA-MB-417.5 (kindly provided by Joan Massagué) and Hs578T (ATCC, catalog number: HBT-126 )]
Phosphate buffered saline (PBS) without Ca/Mg (any supplier)
Trypsin-EDTA (Life Technologies, InvitrogenTM)
Fibronectin from bovine plasma (Sigma-Aldrich, catalog number: F1141 )
White carboxylate-modified latex beads (CML Latex Beads, 4% w/v, 0.4 µm), and number of particles is given in the MSDS/COA documents provided by the manufacturer (Thermo Fisher Scientific, catalog number: C37238 )
Black 96-well flat-bottom microscopy plates (µClear 96-well plate) (Greiner Bio-One GmbH, catalog number: 655090 )
4% Formaldehyde (any supplier) in PBS
RPMI medium (Life Technologies)
Fetal Bovine Serum (FBS) (PAA Laboratories)
Penicillin-Streptomycin (Penicillin-Streptomycin) (Life Technologies, Gibco®)
Complete medium (see Recipes)
Equipment
Cell culture set up, including laminar flow hood, cell culture incubator (37 °C and 5% CO2), cell counter or counting chamber, multichannel pipets
BD Pathway 855 BioImager (BD Biosciences); or another brand or type of inverted microscope equipped with brightfield illumination, automated stage, 10x objective and software for automated imaging
Hydroflex plate washer (Tecan Trading AG)
Software
WIS-PhagoTracker v2_3_12 (Weizmann Institute of Science, http://www.weizmann.ac.il/vet/IC/software/wis-phagotracker; open source software)
Montage2MRC (Weizmann Institute of Science, http://www.weizmann.ac.il/vet/IC/software/wis-phagotracker; open source software)
KNIME (optional) (www.knime.org; open source software)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Fokkelman, M., Roosmalen, W. V., Rogkoti, V., Le Dévédec, S. E., Geiger, B. and Water, B. V. D. (2016). PhagoKinetic Track Assay: Imaging and Analysis of Single Cell Migration. Bio-protocol 6(1): e1699. DOI: 10.21769/BioProtoc.1699.
Download Citation in RIS Format
Category
Cancer Biology > General technique > Cell biology assays
Cancer Biology > Invasion & metastasis > Cell biology assays
Cell Biology > Cell imaging > Live-cell imaging
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
17 | https://bio-protocol.org/exchange/protocoldetail?id=17&type=1 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
TAP Purification of Yeast Proteins
Bio-protocol Editor
Published: Jan 5, 2011
DOI: 10.21769/BioProtoc.17 Views: 17470
Download PDF
Ask a question
Favorite
Cited by
Abstract
Tandem affinity purification (TAP) is used to look at protein-protein interaction. Its use relies on generating a fusion protein with a TAP tag on the C- or N- terminal end. In this protocol, a two-step purification of N-terminus TAP-tagged proteins from yeast is described.
Materials and Reagents
Complete Protease Inhibitor Cocktail Tablet (Roche Diagnostics)
100% NP-40 (Sigma-Aldrich)
AcTEV Protease (Life Technologies, Invitrogen™)
IgG Sepharose 6 Fast Flow (GE Healthcare Life Science)
Calmodulin affinity resin (Guidechem/Stratagene)
SDS lysis buffer
Beta-ME
Leupeptin
Mg2 acetate
Acetone
BME
EDTA
CaCl2
NaF
Imidazole
NP40 buffer (see Recipes)
IPP150 buffer (see Recipes)
IPP150 calmodulin binding buffer (see Recipes)
TEV cleavage buffer (see Recipes)
IPP150 calmodulin elution buffer (see Recipes)
Equipment
Avestin Homogenizer (Avestin®)
BECKMAN centrifuge and rotor (BECKMAN Coulter)
Polycarbonate tubes
Chromatography column
Microfuge tube
Shaker
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2011 The Authors; exclusive licensee Bio-protocol LLC.
Category
Biochemistry > Protein > Isolation and purification
Microbiology > Microbial biochemistry > Protein
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
170 | https://bio-protocol.org/exchange/protocoldetail?id=170&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Biotinylation of Cell Surface Proteins
GH Guo N. Huang
Published: Vol 2, Iss 9, May 5, 2012
DOI: 10.21769/BioProtoc.170 Views: 34089
Download PDF
Ask a question
How to cite
Favorite
Cited by
Abstract
Membrane proteins are major sensors of extracellular stimuli and initiators of intracellular signal transduction, and their abundance on the cell surface in particular is often dynamically regulated even when there are no significant changes of their total abundance in a cell. This protocol is designed to biochemically label and separate membrane proteins on the plasma membrane from those in the intracellular compartments. In conjunction with co-immunoprecipitation and western blot analysis, functional analysis of dynamic interaction of membrane proteins with other membrane proteins or intracellular adaptor and effector proteins can be achieved.
Materials and Reagents
HEK293 cells
Poly-dL-Ornithine (PLO) (Sigma-Aldrich, catalog number: P8638 )
Boric Acid (Sigma-Aldrich, catalog number: B0394 )
Sulfo-NHS-SS-biotin solution (Thermo Fisher Scientific, Pierce Antibodies, catalog number: 21331 )
Neuroavidin beads (Thermo Fisher Scientific, Pierce Antibodies, catalog number: 29200 )
EDTA•2H2O (MW 372.2) (Sigma-Aldrich, catalog number: E1644 )
EGTA•2H2O (MW 380.4) (Sigma-Aldrich, catalog number: E4378 )
NaPyrophophate (Sigma-Aldrich, catalog number: S9515 )
NaF (Sigma-Aldrich, catalog number: S7920 )
Na3VO4•10H2O (MW 446.1) (Sigma-Aldrich, catalog number: 5-9515 )
Protease inhibitor (F. Hoffmann-La Roche, catalog number: 1873580 )
NaVO3
NaOH
PBS
CaCl2
MgCl2
Glycine
Triton
HCl
4x loading buffer
Biotin quenching solution (see Recipes)
PBS/CaCl2/MgCl2 (see Recipes)
IP buffer (see Recipes)
Stock (see Recipes)
Equipment
0.22 μm filters
12-well plates
Western blot equipment
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2012 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Huang, G. N. (2012). Biotinylation of Cell Surface Proteins. Bio-protocol 2(9): e170. DOI: 10.21769/BioProtoc.170.
Download Citation in RIS Format
Category
Biochemistry > Protein > Modification
Biochemistry > Protein > Immunodetection
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,700 | https://bio-protocol.org/exchange/protocoldetail?id=1700&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Measurement of Uptake and Root-to-Shoot Distribution of Sulfate in Arabidopsis Seedlings
NY Naoko Yoshimoto
TK Tatsuhiko Kataoka
AM Akiko Maruyama-Nakashita
HT Hideki Takahashi
Published: Vol 6, Iss 1, Jan 5, 2016
DOI: 10.21769/BioProtoc.1700 Views: 8977
Edited by: Marisa Rosa
Reviewed by: Ning Liu
Original Research Article:
The authors used this protocol in Apr 2015
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Apr 2015
Abstract
Sulfur is an essential macronutrient required for growth and development of plants. Plants take up sulfate from the soil environment through the function of plasma membrane-bound sulfate transporters expressed at the root surface cell layers. Plants then utilize the incorporated sulfate as the main sulfur source to synthesize sulfur-containing compounds such as cysteine and methionine. Measurement of root sulfate uptake capacity is essential for analyzing mutants showing altered levels of sulfate transporters and/or sulfur metabolic enzymes as a result of genetic modification or due to the effect of intrinsic or environmental factors modulating their gene expression. The method described in this protocol allows quantitative investigation of sulfate uptake rates and root-to-shoot sulfate distribution in Arabidopsis seedlings using [35S] sulfate as a radioactive tracer. The method is designed for parallel comparisons of multiple Arabidopsis accessions, mutants or transgenic lines at the seedling stage.
Keywords: Arabidopsis thaliana Sulfate uptake Sulfate transport
Materials and Reagents
Nylon mesh (300 μm mesh opening) (NBC Meshtec, model: NMG 58 or similar types)
9 cm x 9 cm square Petri dishes (Simport, catalog number: D210-16 )
Plastic frame [exterior dimension, 10 cm (W) x 12 cm (H) x 1.5 cm (D); window size, 7.5 cm (W) x 9 cm (H)]]
Plastic container [13 cm (W) x 13 cm (H) x 3 cm (D)]-should be transparent and with no color
Double-sided adhesive tape (NICHIBAN, model: NW-10 or similar types)
Single-sided adhesive tape (Shamrock Scientific Specialty Systems, model: ST-12-1 or similar types)
Paper towel (NIPPON PAPER INDUSTRIES CO., catalog number: 37016 or similar types)
Scintillation vials (Sigma-Aldrich, catalog number: Z190527 or similar types)
Seeds of Arabidopsis (Arabidopsis thaliana)
Sterile deionized water
Agar (Wako Pure Chemical Industries, Siyaku, catalog number: 016-11875 or similar types suitable for plant growth)
Sterile agar medium for growth of Arabidopsis seedlings [General nutrient medium can be used. Nutrient source and concentrations may be modified depending on research purposes, e.g., sulfate concentrations to be adjusted to 1,500 μM or 15 μM sulfate (Maruyama-Nakashita et al., 2015)]
Sterile liquid medium for labeling and post-labeling incubation (Nutrient source and concentrations to be adjusted the same as the agar medium mentioned above)
Na235SO4 aqueous solution, 10 mCi/ml (370 MBq/ml) (American Radiolabeled Chemicals, catalog number: ARS0105 )
Hydrochloric acid (HCl) (Sigma-Aldrich, catalog number: H1758 )
Ultima GoldTM scintillation cocktail (PerkinElmer, catalog number: 6013321 )
Equipment
Growth chamber (NKsystem, model: LPH-241SP or similar types. Set the growth conditions appropriately depending on research purposes, e.g., 22 °C, 16 h light/8 h dark cycles)
Autoclave (TOMY SEIKO CO., model: LSX-500 or similar types)
Mechanical pipettes (Gilson, model: P-200 and P-1000 ) and tips
Analytical balance (readability, 0.1 mg) (Cole-Parmer Instrument Company, Mettler Toledo, model: MS204TS or similar types)
Shaker (either reciprocating or rotary shaker) (TAITEC CORPORATION., model: NR-10 or similar types)
Liquid scintillation counter (Hitachi Aloka Medical, model: AccuFLEX LSC-7400 or similar types)
Utility knife (KOKUYO, model: HA-S200YR or similar types)
Stainless steel Forceps (Sigma-Aldrich, catalog number: Z168696 or similar types)
Surgical scissors (stainless steel dissecting scissors) (Sigma-Aldrich, catalog number: Z265977 or similar types)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Yoshimoto, N., Kataoka, T., Maruyama-Nakashita, A. and Takahashi, H. (2016). Measurement of Uptake and Root-to-Shoot Distribution of Sulfate in Arabidopsis Seedlings. Bio-protocol 6(1): e1700. DOI: 10.21769/BioProtoc.1700.
Download Citation in RIS Format
Category
Plant Science > Plant physiology > Nutrition
Plant Science > Plant metabolism > Sulfate
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,701 | https://bio-protocol.org/exchange/protocoldetail?id=1701&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Saccharification Protocol for Small-scale Lignocellulosic Biomass Samples to Test Processing of Cellulose into Glucose
Rebecca Van Acker
RV Ruben Vanholme
KP Kathleen Piens
WB Wout Boerjan
Published: Vol 6, Iss 1, Jan 5, 2016
DOI: 10.21769/BioProtoc.1701 Views: 11315
Edited by: Maria Sinetova
Reviewed by: Harrie van Erp
Original Research Article:
The authors used this protocol in Jan 2014
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jan 2014
Abstract
Second generation biofuels are derived from inedible lignocellulosic biomass of food and non-food crops. Lignocellulosic biomass is mainly composed of cell walls that contain a large proportion of cellulosic and hemicellulosic polysaccharides. An interesting route to generate biofuels and bio-based materials is via enzymatic hydrolysis of cell wall polysaccharides into fermentable sugars, a process called saccharification. The released sugars can then be fermented to fuels, e.g., by use of yeast.
To test the saccharification efficiency of lignocellulosic biomass on a lab-scale, a manual saccharification protocol was established that uses only small amounts of biomass and a low concentration of enzyme. This protocol can be used for different plant species like Arabidopsis thaliana, tobacco, maize and poplar. The low enzyme concentrations make it possible to detect subtle improvements in saccharification yield and to analyze the speed of hydrolysis. Although a specific acid and alkali pretreatment were included, the saccharification step can be preceded by any other pretreatment. Because no advanced equipment is necessary, this protocol can be carried out in many laboratories to analyze saccharification yield. The protocol was initially described in Van Acker et al. (2013).
Keywords: Saccharification Lignocellulose Biofuels
Materials and Reagents
pH-indicator paper (pH 1-14) (Merck Millipore Corporation, catalog number: 1109620003 )
Disposable PD-10 desalting columns (VWR International, catalog number: 95017001 )
Whatman® qualitative filter paper, Grade 1 (Sigma-Aldrich, catalog number: WHA1001110 )
Safe-Lock tubes 2 ml (Thermo Fisher Scientific, Eppendorf, catalog number: 3706 )
Corning® 15 ml centrifuge tubes (Sigma-Aldrich, catalog number: CLS430790 )
Corning® 50 ml centrifuge tubes (Sigma-Aldrich, catalog number: CLS430290 )
Note: Pricing & availability is not currently available.
Nunc 96-well microplate without lid and flat bottom wells (Thermo Fisher Scientific, catalog number: 269787 )
Parafilm (Bemis Flexible Packaging)
Sodium acetate trihydrate (CH3COONa.3H2O) (Sigma-Aldrich, catalog number: S8625-250 G )
Sodium azide (NaN3) (Sigma-Aldrich, catalog number: 71290-100 g )
Cellulase from Trichoderma reesei ATCC 26291 (Sigma-Aldrich, catalog number: C2730 )
Accellerase® BG from Trichoderma reesei (Genencor, DuPont)
D-glucose (C6H12O6) (Sigma-Aldrich, catalog number: G8270-1 kg )
Glucose oxidase from Aspergillus niger (Sigma-Aldrich, catalog number: G6125-50KU )
Peroxidase from horse radish (Roche Diagnostics, catalog number: 10814407001 )
2, 2’-azino-bis(3-ethylbenzothiazoline-6-sulphonic acid) (ABTS) (Roche Diagnostics, catalog number: 11112422001 )
Hydrochloric acid fuming 37% (Merck Millipore Corporation, catalog number: 1003171000 )
Sodium hydroxide pellets for analysis (Merck Millipore Corporation, catalog number: 1064981000 )
Ethanol (Merck Millipore Corporation, catalog number: 1009901001 )
Acetone (Merck Millipore Corporation, catalog number: 1000121000 )
Glacial acetic acid (Merck Millipore Corporation, catalog number: 1000631000 )
MilliQ-water
0.1 M acetic acid buffer solution (pH 4.5) (see Recipes)
0.1 M acetic acid buffer solution (pH 4.8) (see Recipes)
Glucose oxidase (GOD) – peroxidase (POD) solution (see Recipes)
Equipment
Balance (Mettler Toledo, model: XP-105 Delta Range)
Thermoblock (Thermo Fisher Scientific, Eppendorf, model: Thermomixer Compact )
Temperature controlled benchtop microcentrifuge (Thermo Fisher Scientific, Eppendorf, model: 5417R )
Temperature controlled microplate spectrophotometer (Molecular Devices, model: Spectra Max 250 )
Acid-resistant CentriVap Centrifugal Vacuum Concentrator (Labconco, catalog number: 7810016 )
Oven at 37 °C
Tripod with clamp and knots (VWR International, catalog numbers: 2410093 and 2410258 )
Volumetric flask of 100 ml (Duran Group, catalog number: 246712556 )
Rotilabo® Sealing films for microtest plates (Carl Roth GmbH + Co., catalog number: EN76.1 )
Microcentrifuge (LabSource, VWR International, catalog number: 37001298 )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Acker, R. V., Vanholme, R., Piens, K. and Boerjan, W. (2016). Saccharification Protocol for Small-scale Lignocellulosic Biomass Samples to Test Processing of Cellulose into Glucose. Bio-protocol 6(1): e1701. DOI: 10.21769/BioProtoc.1701.
Download Citation in RIS Format
Category
Plant Science > Plant biochemistry > Carbohydrate
Biochemistry > Carbohydrate > Polysaccharide
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,702 | https://bio-protocol.org/exchange/protocoldetail?id=1702&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Fluoro-Jade B Staining for Neuronal Cell Death
Nathalie Laflamme
Paul Préfontaine
SR Serge Rivest
Published: Vol 6, Iss 1, Jan 5, 2016
DOI: 10.21769/BioProtoc.1702 Views: 22928
Edited by: Jia Li
Reviewed by: Sabine Le Saux
Original Research Article:
The authors used this protocol in Apr 2015
Download PDF
Ask a question
Favorite
Cited by
Original research article
The authors used this protocol in:
Apr 2015
Abstract
Fluoro-Jade is a fluorescent derivative used for histological staining of degenerating neurons. This technique is simple and sensitive enough to label distal dendrites, axons, axon terminals as well as neuronal bodies. Fluoro-Jade has excitation and emission peak of 480 and 525 nanometer respectively. It can be visualized using a fluorescein/FITC filter. Some reports have demonstrated that Fluoro-Jade can also be useful to detect glial cell death (Anderson et al., 2013; Damjanac et al., 2007).
Keywords: Fluoro-Jade B Brain staining Cell death Neurone
Materials and Reagents
Superfrost plus Microscope slide (Thermo Fisher Scientific, catalog number: 12-550-17 )
Cover Glass (Thermo Fisher Scientific, catalog number: 12-545-88 )
Tissue sample
Fluoro-Jade B (Merck Millipore Corporation, catalog number: AG310 )
Paraformaldehyde (Electron Microscopy Science, catalog number: 19210 )
Potassium permanganate (KMnO4) (Sigma-Aldrich, catalog number: 223468 )
DAPI (Life Technologies, catalog number: D3571 )
Note: Currently, it is “Thermo Fisher Scientific, Molecular ProbesTM, catalog number: D3571”.
Glacial Acetic acid (CH3CO2H) (Sigma-Aldrich, catalog number: A9967 )
Ethanol
Xylene (Sigma-Aldrich, catalog number: 534056 )
Sodium hydroxide (NaOH) (Sigma-Aldrich, catalog number: S8045 )
Sodium tetraborate decahydrate (Sigma-Aldrich, catalogue number: B9876 )
Sodium chloride (NaCl) (Sigma-Aldrich, catalog number: S3014 )
potassium phosphate dibasic (K2HPO4) (Sigma-Aldrich, catalog number: P3786 )
potassium phosphate monobasic (KH2PO4) (Sigma-Aldrich, catalog number: P9791 )
4% paraformaldehyde (see Recipes)
KPBS (see Recipes)
0.2% Fluoro-Jade (see Recipes)
Fluoro-Jade solution (see Recipes)
0.2% DAPI (see Recipes)
Equipment
Vacuum Desiccators (Thermo Fisher Scientific, catalog number: 08-642-5 )
Tissue-Tek slide staining set (Electron Microscopy Science, catalog number: 62540-01 )
24 slide holder (Electron Microscopy Science, catalog number: 62543-06 )
Orbital shaker
Timer
Slide Warmer
DPX mounting medium (a mixture of the polystyrene distyrene and the plasticizer dibutylphthalate) (Electron Microscopy Science, catalog number: 13512 )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
Category
Neuroscience > Development > Histological staining
Cell Biology > Cell staining > Whole cell
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,703 | https://bio-protocol.org/exchange/protocoldetail?id=1703&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Isolation and Purification of Murine Microglial Cells for Flow Cytometry
Peter Theriault
MB Maude Bordeleau
SR Serge Rivest
Published: Vol 6, Iss 1, Jan 5, 2016
DOI: 10.21769/BioProtoc.1703 Views: 14020
Edited by: Jia Li
Reviewed by: Sabine Le Saux
Original Research Article:
The authors used this protocol in Apr 2015
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Apr 2015
Abstract
The detailed protocol is used to isolate different cell types from murine brain as glial cells, including microglia, using an enzymatic digestion that minimizes cellular mortality. A Percoll gradient (30% to 80%) separation allows a maximal recovery of isolated murine microglial cells prior to flow cytometry analysis.
Keywords: Flow Cytometry Microglial cell Mouse Brain
Materials and Reagents
Syringe 10 ml (BD bioscience, catalog number: 309604 )
Needle 22 G (BD bioscience, catalog number: 305155 )
Syringe 1 ml 27 G (BD bioscience, catalog number: 309623 )
15 ml centrifugation tube (Thermo Fisher Scientific, catalog number: 339651 )
50 ml centrifugation tube (Thermo Fisher Scientific, catalog number: 339653 )
96 v-shaped wells plate (Thermo Fisher Scientific, catalog number: 249662 )
5 ml polystyrene FACS tube (BD Biosciences, Falcon®, catalog number: 352054 )
70 µm nylon filter (VWR International, catalog number: 352350 )
Mice
PBS without Ca2+/Mg2+ (BOLLÉ COMMUNICATIONS, Wisent, catalog number: 311-010-CL )
Ice cold Dulbecco’s Phosphate Buffered Saline (DPBS) without Ca2+/Mg2+/ Dulbecco’s Phosphate Buffered Saline (Sigma-Aldrich, catalog number: D8537 )
PBS 10x without Ca2+/Mg2+ (BOLLÉ COMMUNICATIONS, Wisent, catalog number: 311-012-CL )
Nα-Tosyl-L-lysine chloromethyl ketone hydrochloride (TLCK) (Sigma-Aldrich, catalog number: T7254 )
Liberase TL Research Grade (Roche Diagnostics, catalog number: 05401020001 )
DNAse1 (Roche Diagnostics, catalog number: 11284932001 )
HEPES (1 M) (Sigma-Aldrich, catalog number: H0887 )
Fetal Bovine Serum (FBS) (Sigma-Aldrich, catalog number: F1051 )
EDTA (Sigma-Aldrich, catalog number: E16144 )
Percoll (GE Healthcare, Dharmacon, catalog number: 17-0891-01 )
HBSS 10x without Ca2+/Mg2+ (BOLLÉ COMMUNICATIONS, Wisent, catalog number: 311-506-CL )
HBSS without Ca2+/Mg2+ with red phenol (Life technologies, catalog number: 14170-112 )
Note: Currently, it is “Thermo Fisher Scientific, GibcoTM, catalog number: 14170-112”.
Purified Rat anti-mouse CD16/CD32 (BD Bioscience, catalog number: 553141 )
Anti-mouse CD45 PE/Cy5 (BD Bioscience, catalog number: 553082 )
Anti-mouse CD11b Alexa 700 (eBioscience, catalog number: 56-0112-82 )
Anti-mouse CD16/CD32 (1:100) (BD Biosciences, catalog number: 553142 )
Live/Dead Fixable Blue Dead Cell (Life technologies, catalog number: L23105 )
Note: Currently, it is “Thermo Fisher Scientific, Molecular ProbesTM, catalog number: L23105”.
Digestion medium (see Recipes)
Ice-cold FACS buffer (see Recipes)
Percoll dilution medium (see Recipes)
PFA 4% (w/v) solution (see Recipes)
Equipment
Tissue grinder Capacity 3 ml (VWR International, catalog number: 886000-0020 )
Centrifuge Sorvall legend RT (Mandel, catalog number: 75004377 )
Flow cytometer BD Canto II or LSR II (BD bioscience)
Peristaltic pump, facultative (Cole-Parmer Instrument Company, catalog number: EW-78001-02 )
Software
BD FACS Diva software (version 6.1.2)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Theriault, P., Bordeleau, M. and Rivest, S. (2016). Isolation and Purification of Murine Microglial Cells for Flow Cytometry. Bio-protocol 6(1): e1703. DOI: 10.21769/BioProtoc.1703.
Download Citation in RIS Format
Category
Neuroscience > Cellular mechanisms > Cell isolation and culture
Cell Biology > Cell-based analysis > Flow cytometry
Cell Biology > Cell isolation and culture > Cell isolation
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,704 | https://bio-protocol.org/exchange/protocoldetail?id=1704&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Quantification of Low Molecular Weight Thiols in Arabidopsis
ZM Ziqing Miao
ZW Zhen Wang
CX Cheng-Bin Xiang
Published: Vol 6, Iss 1, Jan 5, 2016
DOI: 10.21769/BioProtoc.1704 Views: 7162
Edited by: Samik Bhattacharya
Reviewed by: Moritz Bomer
Original Research Article:
The authors used this protocol in Feb 2015
Download PDF
Ask a question
Favorite
Cited by
Original research article
The authors used this protocol in:
Feb 2015
Abstract
Low-molecular-weight (LMW) thiols are a class of highly reactive compounds due to their thiol moiety. They play important roles in the maintenance of cellular redox homeostasis, detoxification, and development. Monobromobimane (mBBr) is weakly fluorescent but selectively reacts with thiols to yield highly fluorescent thioethers (mBSR) products, which is especially useful for the quantification of LMW thiols. The stable mBSR products can be separated by high-performance liquid chromatography (HPLC) equipped with a fluorescent detector. The main cellular LMW thiols are L-cysteine, gamma-glutamylcysteine, and glutathione (GSH). The following protocol describes the extraction and quantification of L-cysteine, gamma-glutamylcysteine, and glutathione from Arabidopsis tissues as reported (Xiang and Oliver, 1998; Zhao et al., 2014; Wang et al., 2015) with minor revision. Modifications may be required if the HPLC system or the C18 column is different.
Keywords: Cysteine Glutathione Arabidopsis HPLC Fluorescent
Materials and Reagents
1.5 ml microcentrifuge tube
0.2 μm nylon filter (Sigma-Aldrich, catalog number: Z259969 )
100 ml glass syringe
Pipette tip
Fresh Arabidopsis thaliana tissues (any plant part you want to test, 50-100 mg is sufficient)
L-cysteine (Sigma-Aldrich, catalog number: 778672 )
Gamma-glutamylcysteine (γ-Glu-Cys) (Sigma-Aldrich, catalog number: G0903 )
L-Glutathione reduced (Sigma-Aldrich, catalog number: G4251 )
Double distilled water (supplied by School of Life Sciences, University of Science and Technology of China)
Double distilled water
Hydrochloric Acid (HCl) (Sigma-Aldrich, catalog number: 435570 ) (see Recipes)
2-(N-Morpholino)ethanesulfonic acid hydrate (MES) (Sigma-Aldrich catalog number: M8250 ) (see Recipes)
Ethylenediaminetetraacetic acid disodium salt dihydrate (EDTA.2Na.2H2O) (Sangon Biotech, catalog number: A100105 ) (see Recipes)
Monobromobimane (mBBr) (Sigma-Aldrich, catalog number: 69898 ) (see Recipes)
Trifluoroacetic acid (TFA) (Sigma-Aldrich, catalog number: 302031 ) (see Recipes)
Acetonitrile (OCEANPAK, catalog number: Ac00030281 ) (see Recipes)
Equipment
Analytic balance (Mettler-Toledo International Inc., model: ML104 )
Mortar and Pestle
Refrigerated microcentrifuge (Thermo Fisher Scientific, Eppendorf, model: 5424R )
37 °C degree incubator (Shanghai Jinghong Laboratory Instrument, model: GNP-9080 )
Reverse-phase C18 column (5 µm, 110A, 150 x 4.6 mm) (Phenomenex, model: Gemini C18 column ) or equivalent, guard column (Phenomenex, SecurityGuard Standard, model: AJ0-7597 )
HPLC equipment (Agilent Technologies, model: 1200 series )
Pump (Agilent Technologies, model: G1312A )
Sampler (Agilent Technologies, model: G1328A )
Column heater (Agilent Technologies, model: G1316A )
FLD detector (Agilent Technologies, model: G1321A )
200 μl pipette
pH meter (Thermo Fisher Scientific, Mettler Toledo, model: FE20–FiveEasy PlusTM )
Ultrasonic cleaner (Shanghai Sonxi Ultrasonic Instrument, model: DS-2510DT )
Software
Suitable data collection and processing software (Agilent Technologies, model: 1200 ChemStation)
Standard curve plotting (Microsoft Excel)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
Category
Plant Science > Plant biochemistry > Other compound
Biochemistry > Other compound > Thiol
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,705 | https://bio-protocol.org/exchange/protocoldetail?id=1705&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
A Technique for the Measurement of in vitro Phospholipid Synthesis via Radioactive Labeling
Lucia Rodriguez-Berdini
Gabriel O. Ferrero
Published: Vol 6, Iss 2, Jan 20, 2016
DOI: 10.21769/BioProtoc.1705 Views: 13712
Reviewed by: Neelanjan BoseDaniel Kraus
Original Research Article:
The authors used this protocol in Aug 2014
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Aug 2014
Abstract
This is an assay designed to examine the radioactive phosphorous incorporation when the molecule is being synthesized, which means that only de novo synthesized phospholipids can be detected. Thus, with this technique it is possible to detect in vitro phospholipid synthesis under different required experimental conditions respect to controls (Guido and Caputto, 1990; Ferrero et al., 2014). There are different types of lipids. Among them we can find phospholipids, which contain glycerol esterified with two fatty acyl chains and a phosphate group that can also be bound to an organic molecule that acts as “hydrophilic head”, as shown in Figure 1 for the case of phosphatidylcholine. This structure confers amphipathic properties to lipid molecules that allow them to form lipid bilayers, making phospholipids the main components of biological membranes.
Figure 1. Representation of phospholipid structure. Extracted from: http://bio1151.nicerweb.com/Locked/media/ch05/phospholipid.html
Keywords: Phospholipids Synthesis Radioactive In vitro ATP-P32 Labeling
Materials and Reagents
PYREX® 5 ml Rimless Kahn Culture Tubes (12 x 75 mm) (Corning, catalog number: 9820-12 )
Scintillation vials (Sigma-Aldrich, catalog number: Z190527 )
The enzymes and substrates are obtained as protein homogenates from homogenized cells or tissue (see Step 1 of the Procedure)
Bio-Rad Protein Assay Dye Reagent Concentrate (Bio-Rad Laboratories, AbD Serotec®, catalog number: 5000006 )
HEPES (Sigma-Aldrich, catalog number: H3375 )
Sodium chloride (NaCl) (Sigma-Aldrich, catalog number: S7653 )
Potassium chloride (KCl) (Sigma-Aldrich, catalog number: P9333 )
D-(+)-Glucose (Sigma-Aldrich, catalog number: G8270 )
Magnesium chloride (MgCl2) (Sigma-Aldrich, catalog number: M8266 )
[γ32P]ATP (PerkinElmer, catalog number: BLU002001MC )
Chloroform (Sigma-Aldrich, catalog number: C2432 )
Methanol (Sigma-Aldrich, catalog number: 34860 )
Trichloroacetic acid (TCA) (Sigma-Aldrich, catalog number: T6399 )
Phosphotungstic acid (PTA) (Sigma-Aldrich, catalog number: P4006 )
Non-aqueous liquid scintillation cocktail (PerkinElmer, catalog number: 1200-434 )
Buffer HEPES (see Recipes)
Reaction buffer (see Recipes)
TCA-PTA 10-1 (% w/v) (see Recipes)
TCA-PTA 5-0.5 (% w/v) (see Recipes)
Carrier brain homogenate (see Recipes)
Equipment
Tip sonicator (Branson Sonic Power Company, model: Sonifier B-12 ) or ULTRA-TURRAX®
Spectrophotometer (Wavelength to be used: 595 nm) (Shimadzu Scientific Instruments, model: BioSpec-mini )
Vortex (IKA® VORTEX 3) (Sigma-Aldrich, catalog number: Z654779 )
Pipettes (PIPETMAN® L Starter Kit) (Gilson, catalog number: F167350 )
Centrifuge (Cavourargetina, model: VT-3216Dx24 )
Water thermostatic bath (Vicking, model: Masson D )
Scintillation counter (WinSpectral, Wallac, PerkinElmer)
Laboratory prepared with all the required equipment for safe receiving, storage, manipulation and waste processing of radioactive material, according to laws governing in each country
Geiger counter (Ludlum Measurements, model: 3 survey meter )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Rodriguez-Berdini, L. and Ferrero, G. O. (2016). A Technique for the Measurement of in vitro Phospholipid Synthesis via Radioactive Labeling. Bio-protocol 6(2): e1705. DOI: 10.21769/BioProtoc.1705.
Download Citation in RIS Format
Category
Cancer Biology > General technique > Biochemical assays
Biochemistry > Lipid > Lipid measurement
Cell Biology > Cell metabolism > Lipid
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,706 | https://bio-protocol.org/exchange/protocoldetail?id=1706&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
A Reliable Method for Phytophthora cajani Isolation, Sporangia, Zoospore Production and in Planta Infection of Pigeonpea
Mamta Sharma
Raju Ghosh
Published: Vol 6, Iss 2, Jan 20, 2016
DOI: 10.21769/BioProtoc.1706 Views: 11847
Edited by: Samik Bhattacharya
Reviewed by: Shahin S. Ali
Original Research Article:
The authors used this protocol in Mar 2015
Download PDF
Ask a question
Favorite
Cited by
Original research article
The authors used this protocol in:
Mar 2015
Abstract
Pigeonpea (Cajanus cajan L.) is an important legume crop of rainfed agriculture. High levels of protein in pigeonpea make it a valuable protein source for developing countries. Phytophthora blight caused by Phytophthora cajani (P. cajani) is a potential threat to pigeonpea (Cajanus cajan L.) production, affecting the crop irrespective of cropping system, cultivar grown and soil types (Pande et al., 2011; Sharma et al., 2006). The primary mode of infection of P. cajani is sporangium and zoospore. Therefore, sensitive and reliable methods for zoospore production and estimating infection severity are desirable in case of Phytophthora blight of pigeonpea (Sharma et al., 2015). Here we present a protocol for isolation of P. cajani from infected plants, sporangia and zoospore production and in planta infection technique of pigeonpea seedlings. These methods will be important tool to devise a platform for rapid and reliable screening against Phytophthora blight disease of pigeonpea as well as for host x pathogen x environment interaction studies.
Keywords: Phyophthora cajani Pigeonpea Phytophthora stem blight Inoculation technique
Materials and Reagents
Cotton (Jaycot Industries)
Glass slide (75 x 25 x 1.35 mm) (Blue star)
Parafilm (Sigma-Aldrich, catalog number: P7793 )
Petri dish (100 x 19.5 mm) (Borocil, catalog number: 5550300 )
Phytophthora cajani isolate ICPC 1 (NCBI, GenBank Acc, catalog number: 10534 )
Pigeonpea seedlings, cultivar ICP 7119
Agar (HiMedia Laboratories, catalog number: RM201 )
Ampicillin (Srlchem, catalog number: 61314 )
Calcium carbonate (CaCO3) (HiMedia Laboratories, catalog number: GMR 397 )
Dextrose (HiMedia Laboratories, catalog number: GRM077 )
Dimethyl sulfoxide (DMSO) (Sigma-Aldrich, catalog number: 472301 )
Ethanol
Pentachloronitrobenzene (PCNB) (Purity: ≥ 94%) (Sigma-Aldrich, catalog number: P2205 )
Pimaricin (Sigma-Aldrich, catalog number: P9703 )
Rifampicin (Sigma-Aldrich, catalog number: R7382 )
Sodium hypochlorite (Scribd Inc., Qualigens, catalog number: 27905 )
Sterilized pond water
Sterilized water
Sterilized river sand
V8 Agar media (HiMedia Laboratories, catalog number: M638 )
Vermiculite (locally available)
Tomato juice
Tomato juice agar (see Recipes)
V8 juice agar (see Recipes)
PARP solutions (see Recipes)
Tomato broth (see Recipes)
Equipment
Autoclave (Tomy Seiko)
Beaker (100 and 400 ml) (Borocil, catalog number: 1000D16 and 1000D23 )
Conical flask (50 ml) (Borocil, catalog number: 4060012 )
Cork borer (approximately 5 mm diameter)
Greenhouse (25-28 °C)
Haemocytometer (1/400 mm2 and 1/10 mm deep) (Sigma-Aldrich)
Hot air oven (Thermo Fisher Scientific)
Incubator (Temperature range: 5-60 °C, humidity: 0-100%) (Tomy Percival)
Inoculating needle
Horizontal laminar flow clean benches (Esco Micro Pte, Labculture, model: LHC-4C )
Light microscope (OLYMPUS)
Measuring cylinder (100 ml) (Borocil, catalog number: 3024016 )
Plastic tray (30 x 48 x 10 cm)
Test tube (18 x 150 mm) (Borocil, catalog number: 9820U06 )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
Category
Microbiology > Microbe-host interactions > Fungus
Microbiology > Microbe-host interactions > In vivo model
Plant Science > Plant immunity > Disease bioassay
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,707 | https://bio-protocol.org/exchange/protocoldetail?id=1707&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Soybean Cyst Nematode, Heterodera glycines, Infection Assay Using Soybean Roots
Benjamin F. Matthews
Reham M. Youssef
Published: Vol 6, Iss 2, Jan 20, 2016
DOI: 10.21769/BioProtoc.1707 Views: 10527
Edited by: Arsalan Daudi
Reviewed by: Tie Liu
Original Research Article:
The authors used this protocol in Dec 2014
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Dec 2014
Abstract
Soybean cyst nematode (SCN; Heterodera glycines), an obligate parasite of plants, is the most damaging pathogen of soybean, causing $469 to $818 million in soybean yield losses annually in the United States. However, there are no soybean cultivars available that are resistant to all SCN populations. Therefore, much research is being conducted to develop soybean cultivars resistant to SCN (Matthews et al., 2013; Matthews et al., 2014; Youssef et al., 2013). Here we describe the rearing and harvesting of SCN, as well as how SCN can be assayed by determining the Female Index.
Materials and Reagents
Plastic Pasteur pipettes (Corning, Falcon®, catalog number: 357575 )
Nylon cloth at 30 micron pore
90 mm Whatman circle filter size
White filter paper (GE Healthcare, catalog number: 10347009 )
Fleaker filtration unit (Cole Parmer fluid handling and analysis Item) (Cole-Parmer Instrument Compan, catalog number: EW-08917-50 )
Disposable Petri Dishes (Kord-Valmark Labware Products, catalog number: 2900 )
Compost soil
Soybean seeds (William 82 or Essex) (Glycine max) (ARS-USDA)
Sodium hypochlorite (Commercial Bleach-Clorox contains 8.3% Na-hyperchlorite)
Sucrose (Baker Analyzed Reagent, catalog number: 4072-1 )
Table sugar (Commercial sugar)
Ethyl alcohol (The Warner-Graham Company, catalog number: 64-17-5 )
Note: Currently, it is “Sigma-Aldrich, catalog number: 64-17-5 ”.
Zinc sulfate heptahydrate (Sigma-Aldrich, catalog number: 91f-0135 )
Sucrose solution (see Recipes)
Sodium hypochlorite solution (see Recipes)
3 mm Zinc sulfate heptahydrate (ZnSO4) solution (see Recipes)
Equipment
Greenhouse with a sink to divert drain water to a chlorine holding tank to kill nematodes that go down the drain
8-10 inch round Pots (Myers Lawn&Garden)
Sieves (Sieve sizes: #20 = 841 micron; #60 = 250 micron; #80 = 177 micron; #100 = 149 micron; #250 = 58 micron; #500 = 25 micron) (U.S Standard Sieve Series)
1 liter glass cylinder (Pyrex USA)
Dissecting microscope (Spenser)
Gyrotory water bath Shaker (LabX, New Brunswick Scientific, model: G76 )
1 liter glass beaker (Pyrex)
Platform Shaker (New Brunswick Scientific)
10 ml pipette (Thermo Fisher Scientific, Fisherbrand)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Matthews, B. F. and Youssef, R. M. (2016). Soybean Cyst Nematode, Heterodera glycines, Infection Assay Using Soybean Roots. Bio-protocol 6(2): e1707. DOI: 10.21769/BioProtoc.1707.
Download Citation in RIS Format
Category
Plant Science > Plant immunity > Disease bioassay
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,708 | https://bio-protocol.org/exchange/protocoldetail?id=1708&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Agrobacterium rhizogenes-Based Transformation of Soybean Roots to Form Composite Plants
Benjamin F. Matthews
Reham M. Youssef
Published: Vol 6, Iss 2, Jan 20, 2016
DOI: 10.21769/BioProtoc.1708 Views: 10694
Edited by: Zhaohui Liu
Reviewed by: Joern KlinkenbergTeresa Lenser
Original Research Article:
The authors used this protocol in Dec 2014
Download PDF
Ask a question
Favorite
Cited by
Original research article
The authors used this protocol in:
Dec 2014
Abstract
Transgenic soybean roots of composite plants are a powerful tool to rapidly test the function of genes and activity of gene promoters. No tissue culture is needed, thus avoiding loss of valuable material due to contamination. This is a simple technique that requires less training and care than tissue culture techniques. Furthermore, it takes less time to produce transgenic roots than techniques using sterile tissue culture. If the transgenic roots are to be challenged with a pathogen, there is no need to produce axenic pathogens with this technique, because sterile tissue culture medium is not used. Therefore, there is no agar medium on which contaminants may grow resulting in obscured results or diseased roots. Here, we describe the production of transgenic soybean roots on 7-day-old soybean seedlings using Agrobacterium rhizogenes. These composite plants may be grown in the greenhouse for further experimentation, such as to determine the effect of gene expression on nematode development.
Materials and Reagents
17 x 100 mm, 14 ml culture tubes designed for bacteria
Sodium hypochlorite (Commercial Bleach-Clorox)
Soybean seeds (William 82) (Glycine max)
Agrobacterium rhizogenes strain K599 (Homemade culture)
PRAP15, pRAP17 or other plasmid
Tetracycline hydrochloride, min. 95% (Sigma-Aldrich)
Murashige & Skoog Medium- including vitamins (Duchefa Biochemie, catalog number: P08805.02 )
Ethyl alcohol (The Warner Graham Company, Gas, catalog number: 64-17-5 )
Note: Currently, it is “Sigma-Aldrich, catalog number: 64-17-5 ”.
Anti-bacterial soap (Clean & smooth)
MS salts
3% sucrose
Casein digest peptone
Yeast extract
Dipotassium phosphate (K2HPO4)
Potassium phosphate (K3PO4)
Glycerol
KOH
MS media (see Recipes)
Terrific Broth, Modified (Research products International Corp., catalog number: 31237 ) (see Recipes)
Fertilizer-Peters Excel 13-2-13 150 ppm nitrogen (pH 6.1) (see Recipes)
Equipment
162 pots flat trays and 32 pot flats (Myers Lawn&Garden)
Promix Flexible Purpose (Pro-Mix, model: Flex Loose 2.8 cuft )
Heated growing mat (Home depot)
1 L culture flasks (Pyrex)
Spectrophotometer UV-120-02 (Shimadzu Corporation, catalog number: 204-00010-08 )
Centrifuge with a GSA rotor (model: Sorvall RC-5B Refrigerated Super speed Centrifuge)
Plastic pasteur pipette (Corning, Falcon®, catalog number: 357575 )
A desiccator attached to a vacuum pump
G10 Gyrotory shaker (New Brunswick Scientific)
Gyrotory water bath Shaker (LabX, New Brunswick Scientific, model: G76 )
Buckets (Home depot)
Growth chamber
Stainless steel scissors (Roboz Surgical Instrument Co., catalog number: RS-5912 )
Dark Reader Spot Lamp-SL85 (Clare Chemical Research)
Orange filter glasses (Clare Chemical Research)
Patio/Paver Sand. Multi-purpose (Pavestone)
50 ml disposable plastic beakers
Clear plastic tub
Rotating platform
Thermo Fisher Scientific Nalgene Spherical-Bottom Centrifuge Bottle, Polycarbonate (PC)-Jade Scientific Inc./ NalgeneTM Spherical-Bottom Polycarbonate Centrifuge Bottle (Thermo Fisher Scientific, catalog number: 3123-0250 )
Vacuum 380 mm Hg (Torr)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
Category
Plant Science > Plant developmental biology > General
Plant Science > Plant molecular biology > DNA
Plant Science > Plant transformation > Agrobacterium
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,709 | https://bio-protocol.org/exchange/protocoldetail?id=1709&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Cytohistochemical Determination of Calcium Deposition in Plant Cells
Wan-Jun Zhang
TW Tao Wang
Published: Vol 6, Iss 2, Jan 20, 2016
DOI: 10.21769/BioProtoc.1709 Views: 7634
Edited by: Marisa Rosa
Reviewed by: Rumen Ivanov
Original Research Article:
The authors used this protocol in May 2015
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
May 2015
Abstract
Calcium plays important roles in maintaining plant cellular structure and also acts as a key secondary messenger in intercellular signaling. Thirty years ago, methods of detecting calcium in sub-cellular level had been established (Stockwell and Hanchey, 1982; Borgers et al., 1982) and reviewed extensively (Wick and Heplerm, 1982). We had used the method of testing calcium localization in salt tolerance improved transgenic alfalfa plant (Zhang and Wang, 2015). Here, we describe the protocol of testing calcium deposition by staining with potassium pyroantimonate (PPA) in detail, which was adapted from former reports (Stockwell and Hanchey, 1982; Borgers et al., 1982). The principle of this protocol is that the Ca2+ can react with antimonite and from black granules, which can be observed under a transmission electron microscope. The protocol includes common micromanipulation techniques of plant tissue, observation with a transmission electron microscope and photography.
Keywords: Calcium Localization Antimonite
Materials and Reagents
Grids (Sigma-Aldrich, catalog number: G5526 ) for transmission electron microscopy
200 μl centrifuge tubes (Eppendorf or other brand)
1.5 ml centrifuge tubes (Eppendorf or other brand)
50 ml centrifuge tubes (Eppendorf or other brand)
0.22 μm Millipore filter unit (Merck Millipore Corporation)
Plant root tips (cut into ~2 mm in size)
25% Glutaraldehyde (Sigma-Aldrich, catalog number: G6257 )
Disodium hydrogen phosphate dodecahydrate (Na2HPO4) (Sinopharm Chemical Reagent Co., catalog number: 10039-32-4 )
Potassium pyroantimonate (PPA) (Sigma-Aldrich, catalog number: 60500 )
1 M NaOH (Sinopharm Chemical Reagent Co., catalog number: 10019718 )
Acetone (100%) (Sigma-Aldrich, catalog number: 69508 )
Ethanol (100%) (Sinopharm Chemical Reagent Co., catalog number: 100092690 )
Ethylene glycol-O, O′-bis (2-aminoethyl)-1 N, N, N′, N′-tetraacetic acid (EGTA) (Sigma-Aldrich, catalog number: E3889 )
1 M HCl (Sinopharm Chemical Reagent Co., catalog number: 10011061 )
Epon 812 (Sigma-Aldrich, catalog number: 45346 )
Formvar solution (Sigma-Aldrich, catalog number: 09823 )
Equipment
Refrigerator (4 °C)
Incubator
Vacuum equipment (Vacuum pump connect to a desiccator)
pH meter
Transmission electron microscope (Hitachi High-Technologies Europe GmbH, model: H-7500 )
Ultramicrotome (Leica Microsystems, model: EM UC6 )
Tweezers (sharp tip)
Glass beakers
Glass stirring rods
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Zhang, W. and Wang, T. (2016). Cytohistochemical Determination of Calcium Deposition in Plant Cells. Bio-protocol 6(2): e1709. DOI: 10.21769/BioProtoc.1709.
Download Citation in RIS Format
Category
Plant Science > Plant cell biology > Cell imaging
Plant Science > Plant physiology > Ion analysis
Biochemistry > Other compound > Ion
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
171 | https://bio-protocol.org/exchange/protocoldetail?id=171&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
T Cell Calcium Mobilization Study (Flow Cytometry)
GH Guo N. Huang
Published: Vol 2, Iss 9, May 5, 2012
DOI: 10.21769/BioProtoc.171 Views: 15170
Download PDF
Ask a question
Favorite
Cited by
Abstract
Antigen recognition and activation of T cell receptor (TCR) triggers transient calcium release from intracellular compartments and subsequent sustained calcium influx through cell surface Icrac channels. Sustained elevation of the cytoplasmic calcium level activates many calcium-dependent enzymes and transcription factors, which are essential for T cell activation and function. This protocol uses non-ratiometric dyes, in combination with flow cytometry, to monitor TCR-triggered calcium changes over time, and is a simple assay to examine the existence of T cell calcium mobilization defects in transgenic mice.
Materials and Reagents
Anti-CD3 Armernian hamster primary antibody (BD Biosciences, catalog number: 553057 , NA/LE)
Goat anti-Armernian Hamster IgG antibody (Jackson ImmunoResearch, catalog number: 127-005-099 )
Phosphate buffered saline (PBS)
CaCl2
MgCl2
DMSO (Merck KGaA, Calbiochem®, catalog number: 540025 )
Fluo-3 AM in DMSO (Life Technologies, Molecular Probes®, catalog number: F-1242 )
(Note: Fluo-3 fluorescence is calcium-dependent) (see Recipes)
Fura Red AM in DMSO (Life Technologies, Molecular Probes®, catalog number: F-3020 ) (Note: Fura Red fluorescence is calcium-independent. Fura Red serves as a control of dye loading efficiency) (see Recipes)
Pluronic F-127 in DMSO (Life Technologies, Molecular Probes®, catalog number: F-1242) (see Recipes)
Hanks buffered solution (HBSS) (Life Technologies, Gibco®, catalog number: 14170-112 ) (see Recipes)
Dye loading buffer (see Recipes)
Equipment
Flow Cytometry
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2012 The Authors; exclusive licensee Bio-protocol LLC.
Category
Cell Biology > Cell-based analysis > Flow cytometry
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,710 | https://bio-protocol.org/exchange/protocoldetail?id=1710&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Detection of Hydroxyproline O-galactoside by LC/MS
MO Mari Ogawa-Ohnishi
YM Yoshikatsu Matsubayashi
Published: Vol 6, Iss 2, Jan 20, 2016
DOI: 10.21769/BioProtoc.1710 Views: 6324
Edited by: Renate Weizbauer
Reviewed by: Harrie van Erp
Original Research Article:
The authors used this protocol in Mar 2015
Download PDF
Ask a question
Favorite
Cited by
Original research article
The authors used this protocol in:
Mar 2015
Abstract
Hydroxyproline (Hyp) O-galactosylation is a plant-specific post-translational modification found in extracellular glycoproteins such as arabinogalactan proteins (AGPs). Hyp O-galactosylation is mediated by Hyp O-galactosyltransferase (HPGT) that catalyzes the transfer of a D-galactopyranosyl residue to the hydroxyl group of Hyp residues of peptides from the sugar donor UDP-α-D-Gal. Here we describe an LC/MS-based method for the detection of Hyp O-galactoside.
Materials and Reagents
Cotton
1 ml Micropipette tip
Hyp O-galactosylated peptides or proteins
0.22 M Ba(OH)2
0.32 M sulfuric acid
1 M NaOH
1 M HCl
10% aqueous ammonia
80% acetonitrile containing 0.1% formic acid
99.9% acetonitrile (HPLC grade) containing 0.1% formic acid
Water (HPLC grade) containing 0.1% formic acid
Equipment
Heat block
Centrifugal evaporator
BT AG 50W-X8 Resin (100-200 mg resin, H+ form) (Bio-Rad Laboratories, catalog number: 143-5441 )
Micro centrifuge
Micro HPLC system (JASCO International Co., model: micro21 LC-01 )
LCQ Deca XP-plus ESI ion-trap mass spectrometer (Thermo Fisher Scientific)
TSK-gel Amide-80 (3 μm) column (2.0 x 150 mm) (Tosoh Bioscience LLC, catalog number: 21865 )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
Category
Plant Science > Plant biochemistry > Carbohydrate
Biochemistry > Carbohydrate > Polysaccharide
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,711 | https://bio-protocol.org/exchange/protocoldetail?id=1711&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
LC/MS-based Detection of Hydroxyproline O-galactosyltransferase Activity
MO Mari Ogawa-Ohnishi
YM Yoshikatsu Matsubayashi
Published: Vol 6, Iss 2, Jan 20, 2016
DOI: 10.21769/BioProtoc.1711 Views: 7141
Edited by: Renate Weizbauer
Reviewed by: Harrie van Erp
Original Research Article:
The authors used this protocol in Mar 2015
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Mar 2015
Abstract
Arabinogalactan proteins (AGPs) are plant-specific extracellular glycoproteins regulating a variety of processes during growth and development. AGP biosynthesis involves O-galactosylation of hydroxyproline (Hyp) residues followed by a stepwise elongation of the complex sugar chains. The initial Hyp O-galactosylation is mediated by Hyp O-galactosyltransferase (HPGT) that catalyzes the transfer of a D-galactopyranosyl residue to the hydroxyl group of Hyp residues of peptides from the sugar donor UDP-α-D-galactose (Figure 1). Here we describe a LC/MS-based method for the detection of HPGT activity in vitro.
Figure 1. Reaction scheme for Hyp galactosylation by HPGT. HPGT catalyzes the addition of a D-galactopyranose from an UDP-α-D-Gal to the hydroxylgroup of Hyp residues.
Materials and Reagents
1-week-old Arabidopsis T-87 cells (50 g fresh weight)
Bio-Rad Protein Assay (Bio-Rad Laboratories, catalog number: 5000006JA )
2 mM synthesized substrate peptide [e.g., (OAOSOT)3S] [using standard Fmoc solid-phase synthesis chemistry on a 431A peptide synthesizer (Life Technologies)]
2 mM Uridine 5’-diphosphogalactose disodium salt (Sigma-Aldrich, catalog number: U4500 )
1 M MOPS-KOH (pH 7.0)
10 mM MnCl2
10% TX-100
1% Formic acid
Acetonitrile (HPLC grade) containing 0.1% formic acid
Water (HPLC grade) containing 0.1% formic acid
Tris-HCl (pH 7.0)
MgCl2
Dithiothreitol
Leupeptin
Phenylmethanesulfonyl fluoride
Sucrose
Extraction buffer (see Recipes)
Suspension buffer (see Recipes)
Equipment
Waring blender
Miracloth (Merck Millipore Corporation, catalog number: 475855 )
Ultracentrifuge
30 °C incubator
Micro centrifuge
Semi-micro HPLC system (JASCO International Co., model: Micro21LC )
LCQ Deca XP-plus ESI ion-trap mass spectrometer (Thermo Fisher Scientific)
TSK-gel Amide-80 (3 μm) column (2 x 150 mm) (Tosoh Bioscience LLC, catalog number: 21865 )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Ogawa-Ohnishi, M. and Matsubayashi, Y. (2016). LC/MS-based Detection of Hydroxyproline O-galactosyltransferase Activity. Bio-protocol 6(2): e1711. DOI: 10.21769/BioProtoc.1711.
Download Citation in RIS Format
Category
Plant Science > Plant biochemistry > Protein
Biochemistry > Carbohydrate > Glycoprotein
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,712 | https://bio-protocol.org/exchange/protocoldetail?id=1712&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Cotyledon Wounding of Arabidopsis Seedlings
DG Debora Gasperini
IA Ivan F. Acosta
EF Edward E. Farmer
Published: Vol 6, Iss 2, Jan 20, 2016
DOI: 10.21769/BioProtoc.1712 Views: 11481
Edited by: Arsalan Daudi
Reviewed by: Kaisa Kajala
Original Research Article:
The authors used this protocol in Jun 2015
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jun 2015
Abstract
Damage to plant organs through both biotic and abiotic injury is very common in nature. Arabidopsis thaliana 5-day-old (5-do) seedlings represent an excellent system in which to study plant responses to mechanical wounding, both at the site of the damage and in distal unharmed tissues. Seedlings of wild type, transgenic or mutant lines subjected to single or repetitive cotyledon wounding can be used to quantify morphological alterations (e.g., root length, Gasperini et al., 2015), analyze the dynamics of reporter genes in vivo (Larrieu et al., 2015; Gasperini et al., 2015), follow transcriptional changes by quantitative RT-PCR (Acosta et al., 2013; Gasperini et al., 2015) or examine additional aspects of the wound response with a plethora of downstream procedures. Here we illustrate how to rapidly and reliably wound cotyledons of young seedlings, and show the behavior of two promoters driving the expression of β-glucuronidase (GUS) in entire seedlings and in the primary root meristem, following single or repetitive cotyledon wounding respectively. We describe two procedures that can be easily adapted to specific experimental needs.
Keywords: Plant Jasmonate JA-Ile
Materials and Reagents
Single wounding of seedling cotyledons
Sterile 6 cm x 6 cm nylon mesh, 200 μm pore size (Lanz-Anliker AG, custom made)
Standard 9 cm round Petri plates
3MTM MicroporeTM Tape, 1.25 cm x 9.14 m, hypoallergenic tape, standard roll (3M, catalog number: 1530-0 )
Two 25 G x 5/8” hypodermic needles, 0.5 mm x 16 mm (BD Bioscience, catalog number: 305760 )
Arabidopsis thaliana sterile seeds, e.g., MYC2p-GUS reporter line (Gasperini et al., 2015)
Sterile double distilled H2O (ddH2O)
Murashige and Skoog (MS) medium (Duchefa Biochemie, catalog number: M0221.0050 )
MES hydrate (Sigma-Aldrich, catalog number: M8250 )
Agar (AppliChem GmbH, catalog number: A2111 1000 )
Standard 9 cm round Petri plates filled with 30 ml of solid half-strength Murashige and Skoog (0.5x MS) medium with 0.7% agar (see Recipes)
Repetitive wounding of seedling cotyledons
3MTM MicroporeTM Tape, 2.5 cm x 9.14 m, hypoallergenic tape, standard roll (3M, catalog number: 1530-1 )
One 25 G x 5/8” hypodermic needle, 0.5 mm x 16 mm (BD Bioscience, catalog number: 305760 )
One 36 gauge beveled NanoFil needle, 110 µM outer diameter (World Precision Instruments, catalog number: NF36BV )
Standard 12 cm x 12 cm square Petri plates
Racks for vertical growth (e.g., Milian, catalog number: 086680 )
Arabidopsis thaliana sterile seeds, e.g., CYCB1;1p-GUS reporter line (Colón-Carmona et al., 1999)
Sterile ddH2O
Standard 12 cm x 12 cm square Petri plates filled with 70 ml 0.5x MS with 0.85% agar (see Recipes)
GUS staining
Staining dish [e.g., 12 well suspension culture plate (Greiner Bio-One GmbH, Cell Star®, catalog number: 665102 )]
Ice bucket with ice
Microscopy slides (e.g., Thermo Fisher Scientific, Menzel-Glaser，catalog number: AD00000112E ) and coverslips (e.g., Thermo Fisher Scientific, Menzel-Glaser, catalog number: BB024060A1 )
90% (v/v) acetone in ddH2O
50 mM sodium phosphate buffer (pH 7.0)
70% (v/v) ethanol (EtOH) in ddH2O
Potassium Ferrocyanide [e.g., Potassium hexacyanoferrate(II) trihydrate (Sigma-Aldrich, catalog number: 60279 )]
Potassium Ferricyanide [e.g., Potassium hexacyanoferrate(III) (Merck Millipore Corporation, catalog number: 104973 )]
5-Bromo-4-chloro-3-indoxyl-beta-D-glucuronic acid (X-Gluc) (e.g., Biosynth, catalog number: B-7300 )
Chloral hydrate (e.g., Sigma-Aldrich, catalog number: 23100 )
Safety note: acute toxicity, avoid inhalation.
Glycerol (e.g., Sigma-Aldrich, catalog number: G6279 )
GUS staining solution (see Recipes)
Chloride hydrate solution (see Recipes)
Equipment
Sterile hood (laminar flow hood)
Fine forceps style 4 (e.g., Dumont, catalog number: 0508-4-PO )
Micropipettes (P20, P200, P1000)
Phytotron or plant growth chamber set with the following growth conditions: 21 °C, 100 μE m-2 s-1 light intensity, 14 h light/ 10 h dark photoperiod
Portable dissecting stereomicroscope
Vacuum pump
37 °C incubator
Stereomicroscope [e.g., Leica Microsystems, model: Leica MZ16A fitted with a camera (model: DFC310FX )]
Differential Interference Contrast (DIC) microscope [e.g., Leica Microsystems, model: Leica DM5500 fitted with a camera (model: DFC420 )]
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Gasperini, D., Acosta, I. F. and Farmer, E. E. (2016). Cotyledon Wounding of Arabidopsis Seedlings. Bio-protocol 6(2): e1712. DOI: 10.21769/BioProtoc.1712.
Download Citation in RIS Format
Category
Plant Science > Plant physiology > Abiotic stress
Plant Science > Plant physiology > Tissue analysis
Plant Science > Plant immunity > Perception and signaling
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,713 | https://bio-protocol.org/exchange/protocoldetail?id=1713&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Analysis of Starch Synthase Activities in Wheat Grains using Native-PAGE
Zhongyi Li
Published: Vol 6, Iss 2, Jan 20, 2016
DOI: 10.21769/BioProtoc.1713 Views: 10434
Edited by: Samik Bhattacharya
Reviewed by: Saminathan ThangasamyCindy Ast
Original Research Article:
The authors used this protocol in May 2014
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
May 2014
Abstract
Starch synthases are one class of key enzymes involving in the synthesis of cereal starch, which transfer glucose from ADP-glucose to the non-reducing end of pre-existing α-(1-4)-liked glucosyl chains of amylopectin. This protocol is highly reproducible for assaying activities for starch synthase I and IIIa in wheat and barley endosperm at qualitative level and quantitative level. The protocol includes separating proteins isolated from developing endosperm with native-PAGE containing glycogen from oyster, incubating protein gels with ADP-glucose solution, and staining gels with iodine solution. The method allows researchers to compare the levels or changes of starch synthase activities.
Keywords: Starch synthase Enzymatic activity assay Wheat Grain Native-PAGE
Materials and Reagents
Glad-wrap (Microwave safe, Capri)
Kimwipe (Kimtech Science* Kimwipes delicate task wipers) (Kimberly-Clark, catalog number: 34133 )
Gel-cassette (size of 100 mm x 100 mm with 1 mm gap) (Invitrogen, catalog number: NC2010 )
Note: Currently, it is “Thermo Fisher Scientific, Novex™, catalog number: NC2010”.
15 ml blue cap Falcon tube (sterile) (Thermo Fisher Scientific)
Epipestle (bioWORLD, catalog number: 42741000-1 )
96 well UV microplate (Flat bottom) (Thermo Fisher Scientific, catalog number: 8404 )
Cuvette (plastic) (SARSTEDT AG & Co, catalog number: 67.746 )
MilliQ water
70% ethanol (Chem Supply, catalog number: 64-17-5 )
2% agarose (Progen, catalog number: 200-0011 )
Tris (2-Amino-2-hydroxymethyl-propane-1, 3-diol) (VWR International, catalog number: 103157P )
Glycogen from oyster (Sigma-Aldrich, catalog number: G8751 )
Acrylamide (40% Acrylamide/Bis Solution, 37.5:1) (Bio-Rad Laboratories, catalog number: 161-0148 )
TEMED (Tetramethylethylenediamine) (AMRESCO, catalog number: 0761-25 ML )
APS (Ammonia persulfate) (Sigma-Aldrich, catalog number: A-7460 )
Coomassie Plus Protein Assay Reagent (Thermo Fisher Scientific, catalog number: 1856210)
Bovine serum albumin (BSA) (Freeze dried, Reagent Grade, pH 7) (Moregate Biotech)
HCl (Ajax Finechem Pty, catalog number: 1367-2.5 L )
Ammonium Sulfate [(NH4)2SO4] (AR) (Chem Supply, catalog number: AA014-500 G )
Magnesium Chloride Hexahydrate (MgCl2) (AR) (Chem Supply, catalog number: MA029-500 G )
β-mercaptoethanol (Sigma-Aldrich, catalog number: M-7154 )
Adenosine-5’-diphosphoglucose disodium salt (ADPG) (Sigma-Aldrich, catalog number: A0627-250 mg )
Protease inhibitor cocktail for plant cell and tissue extracts (Sigma-Aldrich, catalog number: P9599 )
DL-Dithiothreitol (DTT) (Sigma-Aldrich, catalog number: D-9779 )
Glycine (Chem Supply, catalog number: GA007-500 G )
Bromophenol blue (Sigma-Aldrich, catalog number: B0126-25 G )
Glycerol (AR) (Chem Supply, catalog number: GA010-2.5 L )
Extraction buffer (see Recipes)
1x electrophoresis buffer (see Recipes)
Equipment
Gel tank (XCell SureLock) (Invitrogen, catalog number: EI0001 )
Note: Currently, it is “Thermo Fisher Scientific, NovexTM, catalog number: EI0001”.
Pipette (Thermo Fisher Scientific, model: Finnpipette F1 )
Spectrophotometer (Agilent Technologies, model: Cary 300 Bio UV-Visible Spectrophotometer )
Microplate reader (BMG LABTECH GmbH, model: FLUOstar Omega Microplate Reader )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Li, Z. (2016). Analysis of Starch Synthase Activities in Wheat Grains using Native-PAGE. Bio-protocol 6(2): e1713. DOI: 10.21769/BioProtoc.1713.
Download Citation in RIS Format
Category
Plant Science > Plant biochemistry > Carbohydrate
Plant Science > Plant physiology > Nutrition
Biochemistry > Carbohydrate > Polysaccharide
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,714 | https://bio-protocol.org/exchange/protocoldetail?id=1714&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Virus-based MicroRNA Silencing
Jinping Zhao
Yule Liu
Published: Vol 6, Iss 2, Jan 20, 2016
DOI: 10.21769/BioProtoc.1714 Views: 10100
Edited by: Feng Li
Original Research Article:
The authors used this protocol in Jan 2014
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jan 2014
Abstract
Virus-based microRNA silencing (VbMS) is a viable and prompt method to screen and characterize the function of microRNAs (miRNAs) in plants. The Tobacco rattle virus (TRV)-based VbMS method was originally developed by the Yule Liu's group (Sha et al., 2014) using miRNA target mimic (TM) methodology. Here, we describe the TRV-based VbMS method for silencing endogenous miRNA in Nicotiana benthamiana and tomato via Agrobacterium infiltrations. For each assay, Agrobacterium cultures containing pTRV1 and specific pTRV2e derivative harboring TM fragments are mixed and infiltrated into plant tissues. Generally within 3 weeks, the target miRNAs gene will be silenced and the newly developed tissues will exhibit corresponding phenotypes.
Keywords: MicroRNA Plant virus MicroRNA silencing MicroRNA target mimic Virus-based vector
Materials and Reagents
Centrifuge tubes
Sterile 1 ml syringe (needle removed)
Sterile bacterial culture tubes
Plant materials
Nicotiana benthamiana, tomato (cultivar Moneymaker)
Note: seeds can be obtained from Yule Liu’s lab.
Bacteria strains
Escherichia coli: DH5α, ccdb survival (Thermo Fisher Scientific, InvitrogenTM, catalog number: A10460 )
Agrobacterium tumefaciens: GV3101, GV2260 (alternative to GV3101)
Note: All strains can be obtained from Yule Liu’s lab.
Plasmids
pTRV1 (Dong et al., 2007): a T-DNA vector containing 2 x 35 s promoter, Nos terminator and full cDNA of TRV RNA1 (from Ppk20 strain).
pTRV2e (Sha et al., 2014): a T-DNA vector containing 2 x 35 s promoter, Nos terminator and cDNA clone of TRV RNA2, of which the sub-genomic promoter of coat protein from Pea early brown virus (PEBV) (Wang et al., 1997) and a ligation independent cloning (LIC) cassette are inserted immediately downstream of the TRV CP gene.
pTRV2e-GFP: GFP gene was inserted at LIC cassette into pTRV2e. This construct can be used in a control assay to show successful exogenous expression.
The pTRV1 (Arabidopsis, ABRC, catalog number: CD3-1039 ) and pTRV2e (Arabidopsis, ABRC, catalog number: CD3-1866 ) vectors can be ordered at the Arabidopsis Biological Resource Center (ABRC, http://www.arabidopsis.org/).
Culture Media
Liquid Luria-Bertani (LB) medium
Solid LB medium plate with 1.5% agar
Note: LB medium is autoclaved at 120 °C for 20 min before appropriate antibiotics are added.
Antibiotics
Kanamycin (Sangon Biotech, USP Grade)
Rifampicin (Sangon Biotech, USP Grade)
Gentamicin (Sangon Biotech, USP Grade)
PCR reagents
EasyTaq DNA polymerase (Beijing TransGen Biotech, catalog number: AP112 )
EasyPfu DNA polymerase (Beijing TransGen Biotech, catalog number: AP211 )
dNTP Mix (Roche Diagnostics, catalog number: 04729706103 )
Infiltration reagents
Dimethyl sulfoxide, DMSO (AMRESCO, ACS grade)
MgCl2 (Beijing Chemical Works, Analytical pure) (see Recipes)
2-(N-Morpholino) ethanesulfonic acid, MES (AMRESCO, Regent Grade) (see Recipes)
Acetosyringone (3, 5-Dimethoxy-4-hydroxyacetophenone) (AS) [Sigma-Aldrich, Purity (HPLC)] (see Recipes)
Infiltration buffer (see Recipes)
Equipment
Plant growth chamber (24 °C, 16 h/8 h light/dark photoperiod, 40-80% humidity)
Centrifuge
PCR instrument
37 °C and 28 °C incubators with shaking
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
How to cite： Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Zhao, J. and Liu, Y. (2016). Virus-based MicroRNA Silencing. Bio-protocol 6(2): e1714. DOI: 10.21769/BioProtoc.1714.
Sha, A., Zhao, J., Yin, K., Tang, Y., Wang, Y., Wei, X., Hong, Y. and Liu, Y. (2014). Virus-based microRNA silencing in plants. Plant Physiol 164(1): 36-47.
Download Citation in RIS Format
Category
Plant Science > Plant molecular biology > RNA
Molecular Biology > RNA > RNA interference
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,715 | https://bio-protocol.org/exchange/protocoldetail?id=1715&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Identification of RNA-binding Proteins by RNA Ligand-based cDNA Expression Library Screening
Min Young Kim
JL Jong Joo Lee
Chul Geun Kim
Published: Vol 6, Iss 2, Jan 20, 2016
DOI: 10.21769/BioProtoc.1715 Views: 7761
Edited by: Antoine de Morree
Reviewed by: Zhen Shi
Original Research Article:
The authors used this protocol in Jun 2014
Download PDF
Ask a question
Favorite
Cited by
Original research article
The authors used this protocol in:
Jun 2014
Abstract
We previously reported when a portion of the Requiem (REQ/DPF2) messenger ribonucleic acid (mRNA) 3’ untranslated region (3’UTR), referred to as G8, was overexpressed in K562 cells, β-globin expression was induced, suggesting that the 3’UTR of REQ mRNA plays a physiological role (Kim et al., 2014). To identify trans-acting factors that bind to the REQ 3’UTR, we describe the RNA ligand based cDNA expression library screening method. This protocol could be adapted to detect specific RNA-protein interactions. Following this method, we identified six positive clones in the initial round of screening and four pure clones after sib-screening. This protocol was originally published in Kim et al. (2014).
Keywords: RNA-protein interaction Phage display Requiem (REQ/DPF2) CDNA library screening
Materials and Reagents
X-Omat AR film (Eastman Kodak Company, catalog number: 0572842 )
Eppendorf tubes
K562 cells
Note: Phagemid-based K562 cDNA expression libraries were constructed by isolating mRNA from cells with an Ultraspec-RNA isolating system and a biotinylated oligo (dT) probe.
XL1-Blue cells (Agilent Technologies, catalog number: 200403 )
XLOR cell (Agilent Technologies, catalog number: 200403 )
10% bovine calf serum (GE Healthcare, HycloneTM, catalog number: SH30073.03 )
RPMI 1640 medium (Life Technologies, GibcoTM, catalog number: 11875-093 )
Note: Currently, it is “Thermo Fisher Scientific, GibcoTM, catalog number: 11875-093”.
Ultraspec-RNA isolating system (Biotech, catalog number: BL-10050 )
Biotinylated oligo (dT) probe (50 pmol/μl) (Promega Corporation, catalog number: Z5261 )
cDNA synthesis kit (Agilent Technologies, catalog number: 200403 )
λZAP II express phage vector (Agilent Technologies, catalog number: 200403 )
Nitrocellulose membrane (immobilon-NC membrane) (EMD Millipore Corporation, catalog number: N8395 )
Ribonucleic acid from torula yeast (RNA type VI) (Sigma-Aldrich, catalog number: R6625 )
[α-32P]-labeled G8-RNA ligand (BMS)
ExAssist helper phage (Agilent Technologies, catalog number: 200253 )
IPTG [≥ 99% (TLC), ≤ 0.1% Dioxan] (Sigma-Aldrich, catalog number: I6758 )
HEPES (pH 7.9)
KCl
0.1% (w/v) Ficoll 400-DL
0.01% polyvinyl-pyrolidon PVP-40
MnCl2
ZnCl2
EDTA
DTT
Tryptone
NaCl
Yeast Extract
DW
MgSO4
Tris-HCl (pH 7.5)
Gelatin
Screening buffer (see Recipes)
LB plates (see Recipes)
SM buffer (see Recipes)
Equipment
Refrigerated Eppendorf centrifuge (Hanil, catalog number: Union 55R )
Heat block (Thermolyne, catalog number: DB17615 )
Tissue culture CO2 incubators set at 37 °C (HERAcell, catalog number: HERAcell® 240 )
Developer (TAEAHN, catalog number: TM-90S )
Vortex (JEIO TECH, catalog number: VM-96B )
Deep freezer (Forma Scientific, catalog number: 917 )
Shaker (SLB, catalog number: SLRM-3 )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
Category
Molecular Biology > Protein > Expression
Molecular Biology > RNA > RNA-protein interaction
Biochemistry > Protein > Interaction
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,716 | https://bio-protocol.org/exchange/protocoldetail?id=1716&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Preparation of Outer Membrane Vesicles from Myxococcus xanthus
James E. Berleman
MZ Marcin Zemla
JR Jonathan P Remis
MA Manfred Auer
Published: Vol 6, Iss 2, Jan 20, 2016
DOI: 10.21769/BioProtoc.1716 Views: 10670
Edited by: Arsalan Daudi
Original Research Article:
The authors used this protocol in Sep 2014
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Sep 2014
Abstract
Outer membrane vesicles (OMVs) represent a unique sub-cellular compartment of bacteria that may act as a scaffold for various extracellular activities, including intercellular signaling. Myxococcus xanthus (M. xanthus) is a predatory bacterium that engages in cell-cell behaviors such as fruiting body formation and contact dependent lysis of other microbes. The OMVs of M. xanthus have been shown to have an elaborate architecture of chains and tubes that can connect cells within a biofilm. These higher order OMV structures have been shown to contain proteins exchanged for community behaviors and small molecules that have antibiotic activities, and may help facilitate directed exchange. M. xanthus OMVs allow material transfer between neighboring cells for motility and predation.
Keywords: EPS Biofilm Cell fractioning Proteomics Extracellular
Materials and Reagents
50 ml plastic tubes for handling harvested cultures (VWR International, catalog number: 62406-200 )
0.45 μm syringe filters (VWR International, catalog number: 28145-477 )
0.22 μm syringe filters (VWR International, catalog number: 28144-050 )
30 ml syringes (VWR International, catalog number: 66064-760 )
1.5 ml Eppendorf tubes (VWR International, catalog number: 89213-152 )
200 mesh formvar coated TEM grids (Electron Microscopy Sciences, catalog number: EMS200-Cu )
NuncTM MicroWellTM 96-Well Optical-Bottom Plates with Coverglass Base (Thermo Fisher Scientific)
Myxococcus xanthus wild type strain DZ2 (UC Regents, Berkeley)
Phosphate buffered saline (PBS) (VWR International, catalog number: 97064-158 )
Fluorescent lipid dye FM 4-64 (Life Technologies, Molecular Probes®, catalog number: T-13320 )
Note: Currently, it is “Thermo Fisher Scientific, Molecular ProbesTM, catalog number: T-13320”.
Uranyl acetate (Electron Microscopy Sciences)
10 mM MOPS (pH 7.6)
2 mM MgSO4
10% (w/w) Bacto casitone
5% (w/w) Bacto yeast extract
CYE Media (see Recipes)
Equipment
Sterile, side arm 250 ml Erlenmeyer Flasks
Shaking incubator (e.g., Thermo Fisher Scientific, model: MaxQ4000 )
Vortexer
Centrifuge with capacity for 25 ml cultures, 5,000 x g (Refrigeration not required)
Ultra-centrifuge with capacity for 1 ml samples, 140, 000 x g required and refrigeration required. (e.g., GMI, Beckman Coulter, model: L8-70M )
Ultra-centrifuge tubes (fit to machine specifications)
-80 °C freezer
Fluorescence plate reader (e.g., Tecan Trading AG, model: Vission-100 )
Transmission Electron Microscope (Philips/FEI, model: 5350 NE Dawson Creek Drive ), capable of imaging negatively-stained samples at voltages ranging between 80 kv and 200 kV equipped with a 2 k x 2 k CCD camera
Autoclave for sterilizing media and flasks (or access to sterile media and growth vessels).
Software
Digital Micrograph software and 2 k x 2 k CCD camera (Gatan Inc.)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Berleman, J. E., Zemla, M., Remis, J. P. and Auer, M. (2016). Preparation of Outer Membrane Vesicles from Myxococcus xanthus. Bio-protocol 6(2): e1716. DOI: 10.21769/BioProtoc.1716.
Download Citation in RIS Format
Category
Microbiology > Microbial cell biology > Organelle isolation
Cell Biology > Organelle isolation > Outer membrane vesicles
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,717 | https://bio-protocol.org/exchange/protocoldetail?id=1717&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
HBV Infection in Human Hepatocytes and Quantification of Encapsidated HBV DNA
KL Kai Li
SS Seiichi Sato
Akinori Takaoka
Published: Vol 6, Iss 2, Jan 20, 2016
DOI: 10.21769/BioProtoc.1717 Views: 10429
Edited by: Jia Li
Reviewed by: Ramalingam Bethunaickan
Original Research Article:
The authors used this protocol in Jan 2015
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jan 2015
Abstract
Human hepatic cancer cell lines such as HepG2, Huh7, and HLE cannot get infected with Hepatitis B virus (HBV) due to lack of an HBV receptor(s). Transfection with HBV genome has so far been referred as a tool to mimic HBV infection. However, since sodium taurocholate cotransporting polypeptide (NTCP) was identified as a functional receptor for HBV (Yan et al., 2012), hepatocyte cell lines that were stably transfected with a plasmid for NTCP expression have been used for HBV infection. This protocol is designed for infection with HBV in human hepatocyte cell line HepG2 expressing NTCP (HepG2-hNTCP-C4 cells; Iwamoto et al., 2014) or primary human hepatocytes (PHHs). In this section, we also describe one of the methods for the assessment of HBV infection: Quantification of the intracellular encapsidated HBV DNA.
Keywords: Hepatitis B virus Hepatocyte Infection Zhr
Materials and Reagents
Materials
0.1-10 μl pipet tips (Thermo Fisher Scientific, catalog number: QSP#TF104 )
1-200 μl and 100-1,000 μl pipet tips (Corning, catalog numbers: 4845 and 4846 , respectively)
Falcon 12-well tissue culture plate (Corning, catalog number: 353043 )
Biocoat collagen I cellware 12-well plate (Corning, catalog number: 356500 )
1.5 ml and 2.0 ml microcentrifuge tubes (Corning, catalog numbers: MCT-150-A and MCT-200-C , respectively)
15 ml and 50 ml centrifuge tubes (Corning Incorporated, catalog numbers: 352096 and 352070 , respectively)
96-well fast plate (NIPPON Genetics, catalog number: 38801 )
Reagents
Hepatocyte culture and infection with HBV
Primary human hepatocytes (PHHs) (PhoenixBio Co.)
HepG2-hNTCP-C4 cells (Drs. Takaji Wakita and Koichi Watashi, Department of Virology II, National Institute of Infectious Diseases, Tokyo, Japan; Iwamoto et al., 2014)
Dulbecco’s Modified Eagle’s Medium (DMEM) (NISSUI PHARMACEUTICAL, catalog number: 05919 )
DMEM/F-12+GlutaMax (Life Technologies, catalog number: 31331-028 )
Note: Currently, it is “Thermo Fisher Scientific, Gibco™, catalog number: 31331-028 ”.
4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES) (Life Technologies, catalog number: 15630-080 )
Note: Currently, it is “Thermo Fisher Scientific, Gibco™, catalog number: 15630-080”.
Fetal bovine serum (FBS) (Life Technologies, catalog number: 10437-028 )
Note: Currently, it is “Thermo Fisher Scientific, Gibco™, catalog number: 10437-028”.
G418 (Nacalai tesque, catalog number: 09380-86 )
Phosphate-buffered saline (PBS) (pH 7.4)
HBV plasmid (pUC19-HBV, genotype C) (Dr. Yasuhito Tanaka, Department of Virology and Liver Unit, Nagoya City University Graduate School of Medical Sciences, Nagoya, Japan; Sugiyama et al., 2006)
FuGENE 6 transfection reagent (Promega Corporation, catalog number: E2692 )
Opti-MEM I reduced-serum medium (Life Technologies, catalog number: 31985-070 )
Note: Currently, it is “Thermo Fisher Scientific, Gibco™, catalog number: 31985-070”.
QIAamp DNA Blood Mini Kit (QIAGEN, catalog number: 51104 )
Polyethyleneglycol 8000 (PEG 8000) (Sigma-Aldrich, catalog number: 81268 )
PHHs culture media (see Recipes)
HepG2-hNTCP-C4 culture media (see Recipes)
Encapsidated HBV DNA extraction
Nuclease free-H2O
Tris (hydroxymethyl) aminomethane (Tris) (Nacalai tesque, catalog number: 35406-91 )
NP-40 (Nacalai tesque, catalog number: 25223-75 )
Magnesium acetate (MgOAc) (Wako Pure Chemical Industries, Siyaku, catalog number: 130-00095 )
Ethylenediaminetetraacetic acid (EDTA) (Wako Pure Chemical Industries, Siyaku, catalog number: 345-01865 )
Proteases K (Life Technologies, catalog number: 25530-015 )
Note: Currently, it is “Thermo Fisher Scientific, Invitrogen™, catalog number: 25530-015”.
Sodium dodecyl sulfate (SDS) (Wako Pure Chemical Industries, Siyaku, catalog number: 191-07145 )
Sodium chloride (NaCl) (Nacalai tesque, catalog number: 31320-05 )
Deoxyribonuclease I (DNase I) (Promega Corporation, catalog number: M6101A )
Ribonuclease A (RNase A) (Life Technologies, catalog number: 12091-021 )
Note: Currently, it is “Thermo Fisher Scientific, Invitrogen™, catalog number: 12091-021”.
Phenol:chloroform:isoamyl alcohol (25:24:1) (Sigma-Aldrich, catalog number: P2069 )
Chloroform (KANTO CHEMICAL, catalog number: 07278-00 )
Sodium acetate (NaOAc) (Wako Pure Chemical Industries, Siyaku, catalog number: 198-01055 )
Glycogen (Roche Diagnostics, catalog number: 10901393001 )
Isopropanol (Nacalai tesque, catalog number: 29113-53 )
Ethanol (99.5%) (Nacalai tesque, catalog number: 14713-95 )
Lysis buffer (see Recipes)
qPCR for quantification of HBV DNA
SYBR Premix Ex Taq (2x) (Tli RNase H Plus) (Takara Bio Company, catalog number: RR420 )
ROX reference dye (50x) (Takara Bio Company, catalog number: A9701A )
Primers for amplification of encapsidated HBV DNA by quantitative PCR
Forward: 5’-CTTCATCCTGCTGCTATGCCT-3’
Reverse: 5’-AAAGCCCAGGATGATGGGAT-3’
(Product length: 222 bp, product Tm: 83.5 °C)
Equipment
37 °C and 5% CO2 cell culture incubator (WAKENBTECH CO., catalog number: 9000EX )
Pipettes (PIPETMAN P2, P20 and P1000) (Gilson Scientific, catalog numbers: F144801 , F123600 and F123602 , respectively)
High speed refrigerated micro centrifuge (KUBOTA Corporation, catalog number: 3500 )
Vortex mixer (Labnet Internationa, catalog number: vx100 )
Shaker (Tokyo Rikakikai Co., EYELA, catalog number: MMS-110 )
Double aluminum block bath (SCINICS CORPORATION, catalog number: ALB-301 )
ABI StepOnePlus™ Real-Time PCR Systems (Life Technologies, catalog number: 4379216 )
Note: Currently, it is “Thermo Fisher Scientific, Applied Biosystems™, catalog number: 4379216”.
qPCR adhesive seal (NIPPON Genetics, catalog number: 4Ti-0560 )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Li, K., Sato, S. and Takaoka, A. (2016). HBV Infection in Human Hepatocytes and Quantification of Encapsidated HBV DNA. Bio-protocol 6(2): e1717. DOI: 10.21769/BioProtoc.1717.
Download Citation in RIS Format
Category
Microbiology > Microbial genetics > DNA
Microbiology > Microbe-host interactions > In vitro model
Microbiology > Microbe-host interactions > Virus
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,718 | https://bio-protocol.org/exchange/protocoldetail?id=1718&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Infection of Human Hepatocyte-chimeric Mice with HBV and in vivo Treatment with εRNA
SS Seiichi Sato
KL Kai Li
Akinori Takaoka
Published: Vol 6, Iss 2, Jan 20, 2016
DOI: 10.21769/BioProtoc.1718 Views: 7074
Edited by: Jia Li
Reviewed by: Ramalingam Bethunaickan
Original Research Article:
The authors used this protocol in Jan 2015
Download PDF
Ask a question
Favorite
Cited by
Original research article
The authors used this protocol in:
Jan 2015
Abstract
Hepatitis B virus (HBV) can cause both acute and chronic disease in human liver with potentially high risk of cirrhosis and liver cancer. The host range of non-human primates susceptible to this virus is limited. Therefore, experimental studies with human hepatocyte-chimeric mice provide an invaluable source of information regarding the biology and pathogenesis of HBV. This section describes the protocol for infection of the human hepatocyte-chimeric mice with HBV. In addition, it has recently been shown that HBV replication can be suppressed by exogenous expression of viral epsilon RNA (εRNA; Sato et al., 2015), which serves as an encapsidation signal (Bartenschlager et al., 1992). Based upon this finding, we also describe the protocol for the liposome-mediated delivery of a plasmid encoding εRNA to liver in these chimeric mice.
Keywords: Hepatitis B virus Human hepatocyte-chimeric mice Infection Epsilon RNA
Materials and Reagents
0.1-10 μl pipet tips (Thermo Fisher Scientific, catalog number: QSP# TF104 )
1-200 μl and 100-1,000 μl pipet tips (Corning, catalog number: 4845 and 4846 , respectively)
0.2 ml 8 strips PCR tubes and caps (NIPPON Genetics, catalog number: FG-028DC )
1.5 ml and 2.0 ml microcentrifuge tubes (Corning, catalog number: MCT-150-A and MCT-200-C , respectively)
15 ml and 50 ml centrifuge tubes (Corning, catalog number: 352096 and 352070 , respectively)
96-well fast plate (NIPPON Genetics, catalog number: 38801 )
1 ml syringe (MonotaRO Co., NIPRO Genetics, catalog number: 08-010 )
Human hepatocyte-chimeric mice (PhoenixBio Co.)
Note: Chimeric mice are intravenously infected with 100 μl of HBV-C in saline solution (106 copies per mouse) derived originally from patient with chronic hepatitis (Sugiyama et al., 2006).
HBV (genotype C; HBV-C) (Dr. Yasuhito Tanaka, Department of Virology and Liver Unit, Nagoya City University Graduate School of Medical Sciences, Nagoya, Japan; Sugiyama et al., 2006)
Sodium chloride (Nacalai tesque, catalog number: 31320-05 )
YSK lipid (a pH-sensitive cationic lipid) (Faculty of Pharmaceutical Sciences, Hokkaido University, Sapporo, Hokkaido, Japan) (Sato et al., 2012)
Cholesterol (Avanti Polar Lipid, catalog number: 57-88-5 )
1, 2-dimyristoyl-sn-glycerol methoxypolyethyleneglycol (PEG-DMG) (NOF Corporation, catalog number: GM-020 )
Nuclease free-H2O
Citrate buffer (12.5 mM citrate, 500 mM NaCl)
pCpGfree-mcs vector (Invivogen)
Primers for vector construction
pLKO.1 Fw SpeI: CCCACTAGTTTTCCCATGATTCCTTCATATTT
pLKO.1 Rv BglII: CCCAGATCTAAAATTGTGGATGAATACTGCC
TaqMan Universal PCR Master Mix (Life Technologies, catalog number: 4304437 )
Note: Currently, it is “Thermo Fisher Scientific, Applied Biosystems™, catalog number: 4304437”.
Primers and probe for quantification of HBV DNA from HBV-infected chimeric mice sera:
Forward Primer: SF2: 5’-CTTCATCCTGCTGCTATGCCT-3’
Reverse Primer: SR2: 5’-AAAGCCCAGGATGATGGGAT-3’
Probe: SP2: FAM-ATGTTGCCCGTTTGTCCTCTAATTCCAG-TAMRA
MISSION® pLKO.1-puro Empty Vector Control Plasmid DNA (Sigma-Aldrich, catalog number: SHC001 )
DNA oligo nucleotides (5’-3’)
Sense: CCGGTGTACATGTCCCACTGTTCAAGCCTCCAAGCTGTGCCTTGGGTGGCTTTGGGGCATGGACATTTTTG
Antisense:
AATTCAAAAATGTCCATGCCCCAAAGCCACCCAAGGCACAGCTTGGAGGCTTGAACAGTGGGACATGTACA
Oligo nucleotides (see Recipes)
Equipment
Biosafety hood in a biosafety level 3 (BSL3) facility (HITACHI, catalog number: SCV-1303 ECIIB )
Pipettes (PIPETMAN P2, P20 and P1000) (Gilson Scientific, catalog number: F144801 , F123600 and F123602 , respectively)
qPCR adhesive seal (NIPPON Genetics, catalog number: 4Ti-0560 )
Applied Biosystems Veriti Thermal Cycler (Life Technologies, catalog number: 4375786 )
Note: Currently, it is “Thermo Fisher Scientific, Applied Biosystems™, catalog number: 4375786”.
ABI StepOnePlusTM Real-Time PCR Systems (Life Technologies, catalog number: 4379216 )
Note: Currently, it is “Thermo Fisher Scientific, Applied Biosystems™, catalog number: 4379216”.
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
Category
Microbiology > Microbe-host interactions > In vivo model
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,719 | https://bio-protocol.org/exchange/protocoldetail?id=1719&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Measurement of PI4P Levels in Intact Chloroplasts Isolated from Arabidopsis thaliana
Kumiko Okazaki
SM Shin-ya Miyagishima
HW Hajime Wada
Published: Vol 6, Iss 3, Feb 5, 2016
DOI: 10.21769/BioProtoc.1719 Views: 9476
Edited by: Tie Liu
Reviewed by: Yingnan HouArsalan Daudi
Original Research Article:
The authors used this protocol in Mar 2015
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Mar 2015
Abstract
Phosphatidylinositol 4-phosphate (PI4P), a major species of phosphoinositides, modulates many fundamental cellular processes. We have recently revealed that PI4P plays an important role in chloroplast division as a negative regulator. Despite its importance in chloroplasts, the content of PI4P in chloroplasts is very low and it is difficult to measure PI4P levels. In this protocol, we describe a simple method that we have developed for measurement of low level of PI4P in chloroplasts. Intact chloroplasts were isolated by a basic method using Percoll gradient centrifugation and acidic lipids were extracted from the isolated chloroplasts. The extracted acidic lipids including PI4P were spotted onto the membrane strip, which had been pre-spotted with PI4P standards and other phosphoinositides as negative controls. PI4P in the spot of acidic lipids on the membrane was detected using a PI4P binding protein.
Keywords: Phosphatidylinositol 4-phosphate PI4P Intact chloroplast Chloroplast isolation
Materials and Reagents
Isolation of intact chloroplasts
Miracloth (Merck Millipore Corporation, Calbiochem®, catalog number: 475855 )
Gauze (Hakujuji Co., model: FC-gauze )
Seedlings of Arabidopsis thaliana
Wild-type (Columbia-0) plants, phosphatidylinositol 4-kinase (PI4K) α1 knockdown plants, pi4kβ2-1 mutants and PI4Kα1 knockdown plants of pi4kβ2-1 mutants were grown for 4 days on MS agar plates and then transferred onto agar plates with or without 5 μM dexamethazone (DEX) and grown for 1 week. The down-regulation of PI4Kα1 expression was induced by DEX treatments in PI4Kα1 knockdown plants and PI4Kα1 knockdown plants of pi4kβ2-1 mutants. For treatments with inhibitors, wild-type 4-d-old seedlings were transferred onto agar plates with PI4K inhibitors, 200 μM wortmannin (WM) or 25 μM phenylarsine oxide (PAO), or a phosphatidylinositol 3-kinase (PI3K) inhibitor, 50 μM LY294002 (LY), or without inhibitors (DMSO) and grown for 3 days.
Percoll (GE Healthcare, Dharmacon, catalog number: 7-0891-01 )
Bradford assay kit (Bio-Rad Laboratories, catalog number: 500-0006JA )
1x protease inhibitor cocktail (Nakarai, catalog number: 03969-21)
Note: Currently, it is “Nacalai tesque, catalog number: 03969-21 ”.
Sorbitol
HEPES-KOH (pH 7.5)
EDTA
Grinding buffer (see Recipes)
80% Percoll or 40% Percoll (see Recipes)
Extraction of PI4P
0.75 M Trichloroacetic acid (TCA) (Wako Pure Chemical Industries, Siyaku, catalog number: 203-04952 )
5% (w/v) TCA with 1 mM EDTA
Methanol (Wako Pure Chemical Industries, Siyaku, catalog number: 137-01823 ): Chloroform (Wako Pure Chemical Industries, Siyaku, catalog number: 038-02601 ) (2:1, v/v)
Methanol: chloroform: 12 N HCl (Wako Pure Chemical Industries, Siyaku, catalog number: 080-01066 ) (80:40:1, v/v/v)
Measurement of PI4P levels
PI(4)P Mass Strip Kit (Echelon Biosciences, catalog number: K-4000E )
Albumin from bovine serum (BSA), fatty acid free (Wako Pure Chemical Industries, Siyaku, catalog number: 017-15146 )
HRP substrate solution (Thermo Fisher Scientific, Pierce, catalog number: NCI32132 )
Phosphate (pH 7.4)
NaCl
0.1% (w/v) Tween-20
Phosphate buffered saline (PBS) (see Recipes)
PBST (see Recipes)
Equipment
Homogenizer (Microtec Co., model: NS-51 )
Centrifuge (TOMY SEIKO CO., models: MX-200 and GX-250 )
Swing rotor (TS-7C)
Paintbrush
Pasteur pipette (Sansyo, Iwaki, catalog number: IK-PAS-9P )
Vacuum dryer (Centrifuge evaporator) (Shimadzu Corporation, model: SPE-200 )
Sonicator (SHARP CORPORATION, model: UT-106 )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Okazaki, K., Miyagishima, S. and Wada, H. (2016). Measurement of PI4P Levels in Intact Chloroplasts Isolated from Arabidopsis thaliana. Bio-protocol 6(3): e1719. DOI: 10.21769/BioProtoc.1719.
Download Citation in RIS Format
Category
Plant Science > Plant biochemistry > Lipid
Biochemistry > Lipid > Lipid measurement
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
172 | https://bio-protocol.org/exchange/protocoldetail?id=172&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Culture, Differentiation and Transfection of C2C12 Myoblasts
LJ Lili Jing
Published: Vol 2, Iss 10, May 20, 2012
DOI: 10.21769/BioProtoc.172 Views: 52910
Original Research Article:
The authors used this protocol in Mar 2009
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Mar 2009
Abstract
C2C12 myoblasts are commonly used in biomedical laboratories as an in vitro system to study muscle development and differentiation. This protocol explains the basic procedures of culture, transfection and differentiation of C2C12 myoblast cells.
Materials and Reagents
C2C12 myoblasts
DMSO (Sigma-Aldrich, catalog number: 472301 )
Fetal bovine serum (FBS)
Horse serum
DMEM (high glucose) (Life Technologies, Invitrogen™, catalog number: 11965142 )
P/S solution
Fugene HD (FHD) (Roche Diagnostics, catalog number: 04709691001 )
Growth media (see Recipes)
Transfection mix (see Recipes)
Freezing media (see Recipes)
Differentiation media (see Recipes)
Equipment
Standard tabletop centrifuges
Water bath
CO2 incubator
100 mm culture dishes
Eppendorf tube
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2012 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Jing, L. (2012). Culture, Differentiation and Transfection of C2C12 Myoblasts. Bio-protocol 2(10): e172. DOI: 10.21769/BioProtoc.172.
Download Citation in RIS Format
Category
Cell Biology > Cell isolation and culture > Cell differentiation
Cell Biology > Cell isolation and culture > Cell growth
Molecular Biology > DNA > Transfection
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,720 | https://bio-protocol.org/exchange/protocoldetail?id=1720&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Preparation of Chloroplast Lipid Membrane and Lipid-protein Interaction Assay
Kumiko Okazaki
SM Shin-ya Miyagishima
HW Hajime Wada
Published: Vol 6, Iss 3, Feb 5, 2016
DOI: 10.21769/BioProtoc.1720 Views: 9636
Edited by: Tie Liu
Reviewed by: Venkatasalam Shanmugabalaji
Original Research Article:
The authors used this protocol in Mar 2015
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Mar 2015
Abstract
Lipid-Protein interaction assay is a method to search lipids, which are bound with proteins in vitro. Since membranes that are spotted with chloroplast lipids such as monogalactosyldiacylglycerol (MGDG), digalactosyldiacylglycerol (DGDG), and sulfoquinovosyldiacylglycerol (SQDG) are not commercially available, we extracted these lipids from cyanobacterial cells and spotted them onto membranes. The prepared membranes could be used for lipid-protein interaction assay.
Keywords: Lipid-protein interaction assay Lipid extraction Chloroplast lipid
Materials and Reagents
Preparation of lipids for chloroplast lipid membrane
Amersham Protran Premium NC0.2 (GE Healthcare, Dharmacon, catalog number: AP-10600081 )
TLC silica gel 60 plate (Merck Millipore Corporation, catalog number: 105721 )
Fused silica capillary column, 0.25 mm x 50 m (Shinwa Chemical Industries, catalog number: HR-SS-10 )
Cells of the cyanobacterium, Synechocystis sp. PCC 6803 (for lipid extraction)
Methanol (Wako Pure Chemical Industries, Siyaku, catalog number: 137-01823 )
Chloroform (Wako Pure Chemical Industries, Siyaku, catalog number: 038-02601 )
0.01% primuline (Sigma-Aldrich, catalog number: 206865 ), in 80% acetone
Pentadecanoic acid (Sigma-Aldrich, catalog number: 91446-5G )
Methanolic HCl (Sigma-Aldrich, catalog number: 33050-U ), dilute with methanol 3 times
Hexane (Wako Pure Chemical Industries, Siyaku, catalog number: 085-00411 )
Lipid-Protein interaction assay
PIP Strips, Membrane Lipid Strips (Echelon Biosciences, catalog numbers: P-6001 and P-6002 )
Hybri-Bag (Cosmo Bio, catalog number: S-1001 )
Albumin from bovine serum (BSA), fatty acid free (Wako Pure Chemical Industries, Siyaku, catalog number: 017-15146 )
Purified tagged proteins
An anti-penta-His mouse monoclonal antibody (QIAGEN, catalog number: 34660 ) and an anti-GST mouse monoclonal antibody (Sigma-Aldrich, catalog number: G1160 )
Horseradish peroxidase (HRP)-conjugated goat anti-mouse secondary antibody (Thermo Fisher Scientific, catalog number: 31432 )
HRP substrate solution (Thermo Fisher Scientific, Pierce, catalog number: NCI32132 )
Phosphate (pH 7.4)
NaCl
0.1 % Tween-20
Phosphate buffered saline (PBS) (see Recipes)
PBST (see Recipes)
Equipment
Glass tubes (Iwaki, catalog numbers: 71-088-004 and 71-063-006 )
Pasteur pipette (Sansyo, Iwaki, catalog number: IK-PAS-9P )
Spectrophotometer (Scinteck Instruments, Pharmacia Biotech, model: Ultrospec 2000 )
Vortex mixer
Centrifuge (TOMY SEIKO CO., model: LC-120 )
Vacuum dryer (Shimadzu Corporation, model: SPE-200 centrifuge evaporator )
TLC developing chamber (AS ONE, catalog number: CK-0544-060 )
Hair dryer (commercially available)
UV illuminator
Razor blade
Heat block
Gas chromatograph (Shimadzu Corporation, model: GC-18A )
Fused silica capillary column, 0.25 mm x 50 m (Shinwa Chemical Industries, catalog number: HR-SS-10 )
Data processor (Shimadzu Corporation, model: C-R2AX )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Okazaki, K., Miyagishima, S. and Wada, H. (2016). Preparation of Chloroplast Lipid Membrane and Lipid-protein Interaction Assay. Bio-protocol 6(3): e1720. DOI: 10.21769/BioProtoc.1720.
Download Citation in RIS Format
Category
Plant Science > Plant biochemistry > Lipid
Biochemistry > Lipid > Lipid isolation
Biochemistry > Lipid > Lipid-protein interaction
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
1 Q&A
Urine based ELISA to detect anti-SARS-CoV-2 nucleocapsid protein antibodies in Great Apes?
0 Answer
56 Views
Jun 17, 2022
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,721 | https://bio-protocol.org/exchange/protocoldetail?id=1721&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Mouse BMDC-dependent T Cell Polarization Assays
Vijaya Satchidanandam
Published: Vol 6, Iss 3, Feb 5, 2016
DOI: 10.21769/BioProtoc.1721 Views: 13913
Edited by: Fanglian He
Reviewed by: Meenal SinhaMarco Di Gioia
Original Research Article:
The authors used this protocol in Jun 2014
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jun 2014
Abstract
In response to exposure to antigen, T cells whose T cell receptor (TCR) are capable of recognizing the self MHC-antigen derived peptide complex, respond to the antigen and differentiate into one of several subsets, namely TH1, TH2, TH17, Treg, etc. characterized by the signature cytokine they secrete, namely IFN-γ, IL-4, IL-17 or IL-10, respectively, referred to as syngeneic polarization as the MHC presenting the foreign antigen/epitope is self-derived.
T cell responses following incubation for defined periods, usually 3 days for mouse splenocytes, are routinely measured by assessing the antigen-stimulated proliferation of T cells by measuring the radiolabeled precursor thymidine incorporated into the genomic DNA of the dividing T cell; the direction of polarization is assessed by measuring the cytokine produced by the proliferating or non-proliferating responding T cells using ELISA of culture supernatants or by intracellular cytokine staining followed by flow cytometry.
In the protocols detailed below, we describe the use of syngeneic mouse bone marrow-derived primary dendritic cells (BMDC) as APC to stimulate spleen derived T cells. The proliferative response of the T cells is measured by incorporation of radiolabeled precursor thymidine into the genomic DNA and their direction of polarization is assessed by measuring the cytokines they secrete, namely IFN-γ, IL-4 and IL-17 over a 72 h period using ELISA. In addition, we used flow cytometry after intracellular cytokine staining to detect IL-17 positive T cells within the CD3+/CD4+/CD25low population. Prior live infection of BMDC with strains of Mycobacterium bovis- Bacille Calmette Guerin (BCG) was used as antigen to pre-condition the BMDC that presented antigens derived therefrom to T cells. We also measured cytokines secreted within 6 to 8 h of BCG infection by BMDC in order to correlate the BMDC cytokine profile with subsequent direction of T cell polarization.
Keywords: Dendritic cells GM-CSF Primary bone marrow cells Cytokines T cell polarization
Materials and Reagents
10 cm Petri dishes, non-treated (Thermo Fisher Scientific, FalconTM, catalog number: 08-757-100D )
6 well 35 mm dia plastic cell culture treated dishes (Thermo Fisher Scientific, FalconTM, catalog number: 353046 )
0.22 µm filter
BALB/c mice (6 to 8 weeks old female)
Iscove’s modification of Dulbecco’s minimum essential medium (IMDM) (Life Technologies, catalog number: 12200069 )
Note: Currently, it is “Thermo Fisher Scientific, GibcoTM, catalog number: 12200069”.
Sterile PBS
Dulbecco’s Phosphate buffered saline (Sigma-Aldrich, catalog number: D5773 )
Saponin from quillaja bark (wash buffer for flow cytometry staining) (Sigma-Aldrich, catalog number: S7900 )
Murine rGM-CSF (recombinant mouse GM-CSF) (PEPROTECH, catalog number: 315-03 )
Note: Recombinant GM-CSF from Peprotech Reconstitute powder (recommended by manufacturer).
ELISA antibodies
Note: We use R&D Systems Duoset capture and detection antibodies or BD paired ELISA antibody sets as detailed below:
Mouse IFN-γ DuoSet ELISA (R&D Systems, catalog number: DY485-05 )
Mouse IL-17 DuoSet ELISA (R&D Systems, catalog number: DY421-05 )
Mouse IL-6 DuoSet ELISA (R&D Systems, catalog number: DY406-05 )
Mouse TNF-α DuoSet ELISA (R&D Systems, catalog number: DY410-05 )
Mouse IL-10 DuoSet ELISA (R&D Systems, catalog number: DY417-05 )
Mouse IL-2 DuoSet ELISA (R&D Systems, catalog number: DY402-05 )
Mouse IL-12p40 DuoSet ELISA (R&D Systems, catalog number: DY499-05 )
Mouse IFN-gamma DuoSet ELISA (R&D Systems, catalog number: DY1679-05 )
1x PBS-1% BSA-0.05% sodium azide
Concanavalin A from Canavalia ensiformis (Jack bean) (Sigma-Aldrich, catalog number: C5275 )
CD11c MicroBeads (Miltenyi Biotech, catalog number: 130-052-001 )
Glutamax-100x (Thermo Fisher Scientific, GibcoTM, catalog number: 35050-061 )
Mitomycin C from Streptomyces caespitosus (Sigma-Aldrich, catalog number: M4287 )
Penicillin-Streptomycin, 100x (Thermo Fischer Scientific, GibcoTM, catalog number: 15070-063 )
Penicillin-Streptomycin (10,000 U/ml) (Thermo Fisher Scientific, GibcoTM, catalog number: 15140-122 )
IL-17-APC (eBioscience, clone: eBio17B7 )
10% FBS
[methyl-3H]
70% and 100% ethanol
Brefeldin A (BFA) (Sigma-Aldrich, catalog number: B7651 )
Ammonium chloride (NH4Cl) (Sigma-Aldrich, catalog number: A9434 )
Potassium bicarbonate (KHCO3) (Sigma-Aldrich, catalog number: 60339 )
Ethylenediaminetetraacetic acid (EDTA) (Sigma-Aldrich, catalog number: E6758 )
Tris (pH 7.5)
IMDM complete (see Recipes)
Thymidine (see Recipes)
Brefeldin A (BFA) (Sigma-Aldrich, catalog number: B7651) (see Recipes)
Monensin sodium salt (Sigma-Aldrich, catalog number: M5273 ) (see Recipes)
RBC lysis buffer (100 ml) (see Recipes)
RBC lysis buffer (see Recipes)
Equipment
Sterile scissors and forceps
Cell scrapers (Corning, Costar®, model: 3010 Small Cell Scraper )
Centrifuges (Table top) (Eppendorf)
Water bath set at 37 °C
Flow cytometer [FACS-Canto-II flow cytometer (BD) or any machine with Argon ion Blue laser)
Biosafety cabinet with laminar air flow
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
How to cite： Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Satchidanandam, V. (2016). Mouse BMDC-dependent T Cell Polarization Assays. Bio-protocol 6(3): e1721. DOI: 10.21769/BioProtoc.1721.
Satchidanandam, V., Kumar, N., Jumani, R. S., Challu, V., Elangovan, S. and Khan, N. A. (2014). The glycosylated Rv1860 protein of Mycobacterium tuberculosis inhibits dendritic cell mediated TH1 and TH17 polarization of T cells and abrogates protective immunity conferred by BCG. PLoS Pathog 10(6): e1004176.
Download Citation in RIS Format
Category
Immunology > Immune cell function > Lymphocyte
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,722 | https://bio-protocol.org/exchange/protocoldetail?id=1722&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Craniotomy for Cortical Voltage-sensitive Dye Imaging in Mice
Takayuki Suzuki
MM Masanori Murayama
Published: Vol 6, Iss 3, Feb 5, 2016
DOI: 10.21769/BioProtoc.1722 Views: 13965
Edited by: Soyun Kim
Reviewed by: Manuel SarmientoTifany Desprez
Original Research Article:
The authors used this protocol in Jun 2015
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jun 2015
Abstract
Cortico-cortical interactions play crucial roles in various brain functions. Here, we present a detailed surgical procedure for cortical voltage-sensitive dye (VSD) imaging that allows monitoring of spatiotemporal dynamics in cortical activity in living mice. Cortical neurons in the upper layers (layer 1-3) are stained with a VSD, and an image sensor with a fast sampling rate (500 Hz) detects fluorescent changes in corrective activity. The procedure includes fixing a mouse brain to a stereotaxic apparatus, craniotomy on a large cortical area, VSD staining, and wide-field imaging of cortical activity. The entire procedure can be completed in 5 h (from the administration of anesthesia to the start of cortical VSD imaging).
Keywords: Voltage-sensitive dye imaging Craniotomy Cortical activity Wide-field imaging
Materials and Reagents
Fine needle (Bonn Micro Probes) (Fine Science Tools, catalog number: 10030-13 )
Cover glass (Matsunami Glass Ind, catalog number: C024241 )
Wild-type mice (Japan SLC, model: C57BL / 6JJmsSlc )
Isoflurane (e.g., Wako Pure Chemical Industries, catalog number: 099-06571 )
Lidocaine solution (80 mg/ml) (e.g., Xylocaine Pump Spray 8%) (AstraZeneca) for local anesthesia
Dental cements (Super-Bond C&B) (Sun medical) (GC's Global, UNIFAST II)
Voltage-sensitive dye (OPTICAL IMAGING LTD, catalog number: RH1691 )
NaCl
KCl
MgCl2.6H2O
CaCl2.2H2O
HEPES
Distilled water
RH1691
Ringer’s solution (see Recipes)
Voltage-sensitive dye (VSD) solution (see Recipes)
Equipment
Anesthesia system for isoflurane (Shinano, catalog number: SN-487-0T )
Electric clipper (e.g., Panasonic Corporation, catalog number: ER803P ) for cutting mouse hair
Feedback-controlled heating pad (Bio Research Center, catalog number: BWT-100A )
Note: The pad monitors the mouse body temperature and maintains it at the desired temperature.
Head holder (stereotaxic apparatus) (NARISHIGE Group, model: SG-4N )
Fine scissors (Fine Science Tools, catalog number: 91460-11 )
Student Dumont #7 Forceps (Fine Science Tools, catalog number: 91197-00 )
Dumont #5SF Forceps (Fine Science Tools, catalog number: 11252-00 )
Cotton swab for absorbing the ringer’s solution
Vacuum pump (e.g., AGC TECHNO GLASS CO., model: VPUMP-140 ) for removing the ringer's solution
Surgical blade (e.g., Kai industries, catalog number: 310-A )
Head-fixation plate (handmade, Figure 1A)
Plate holder (custom-made, Figure 1B)
Stereo Microscope (OLYMPUS, model: SZX7 )
Green LED light (REVOX Inc., model: SLG-50S-G )
Dental drill (SHOFU Inc., model: Tas-35LX )
Dental round bur (SHOFU Inc., model: ELA Steel Bur HP-1 )
Lens blower (e.g., HAKUBA, model: KMC-45 )
Ultra-Fast CMOS Imaging System (Brainvision, model: MiCAM ULtima )
Note: For reference imaging (see procedure step 13), the cortex is illuminated with a blue LED light (center wavelength: 465 nm) through a 506-nm dichroic mirror; green fluorescence is corrected through a 536/40-nm filter.
For voltage-sensitive dye imaging, VSD fluorescence is excited with a red LED light (center wavelength: 625 nm). The excitation light is filtered with a 632/22-nm band-pass filter, reflected using a 655-nm dichroic mirror, and focused 375 μm below the cortical surface. Fluorescence is filtered with a 665-nm long pass filter.
Blue LED light (Brainvision, model: LEX2-B )
Red LED light (REVOX Inc., model: SLG-50S-R )
Stimulator (e.g., NIHON KOHDEN CORPORATION, model: SEN-5201 )
Metal electrodes for hindpaw stimulation (handmade, Figure 1C)
Vortex mixer (e.g., Scientific Industries Inc., model: VORTEX-GENIE 2 )
Figure 1. Head-fixation equipment. A. Handmade head-fixation plate; B. Custom-made plate holder; C. Handmade metal electrodes for hindpaw stimulation.
Software
Acquisition software (Brainvision, model: UL-Acq)
Analysis software (Brainvision, model: BV_Ana)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Suzuki, T. and Murayama, M. (2016). Craniotomy for Cortical Voltage-sensitive Dye Imaging in Mice. Bio-protocol 6(3): e1722. DOI: 10.21769/BioProtoc.1722.
Download Citation in RIS Format
Category
Neuroscience > Neuroanatomy and circuitry > Live-cell imaging
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
1 Q&A
Inquiries about head-fixation equipment
0 Answer
5 Views
Feb 2, 2023
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,723 | https://bio-protocol.org/exchange/protocoldetail?id=1723&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Quantification of Ethylene Production in Tomato Leaves Infected by Xanthomonas euvesicatoria
JK Jung-Gun Kim
WS William Stork
MM Mary Beth Mudgett
Published: Vol 6, Iss 3, Feb 5, 2016
DOI: 10.21769/BioProtoc.1723 Views: 10623
Edited by: Zhaohui Liu
Reviewed by: Malou FraitureDaniel F. CaddellArsalan Daudi
Original Research Article:
The authors used this protocol in Feb 2015
Download PDF
Ask a question
Favorite
Cited by
Original research article
The authors used this protocol in:
Feb 2015
Abstract
Ethylene is a gaseous plant hormone controlling fruit ripening, flower opening, leaf senescence as well as abscission, and disease symptom development. Ethylene plays a critical role in the bacterial pathogen Xanthomonas euvesicatoria (X. euvesicatoria)-elicited symptom development in tomato. This protocol describes the measurement of ethylene gas produced by tomato leaves infected with X. euvesicatoria. Infected leaflets are placed in a glass tube for 30 min without sealing. The glass tubes are then capped with a septa stopper, and incubated for an hour. A 1 ml gas sample is removed from the tube using a syringe and then injected into a gas chromatograph to quantify ethylene gas levels. This protocol will be applicable for other plants with other pathogens with modifications.
Materials and Reagents
1% Ethylene gas can (SCOTT Specialty Gases, catalog number: 01-04-855 )
1 L Tedlar® PLV Gas Sampling Bag w/Thermogreen® LB-2 Septa (Sigma-Aldrich, Supelco, catalog number: 24633 )
1.5 ml Microtubes (Corning, Axygen®, catalog number: MTC-150-C )
1 ml Syringes Without Needles (BD, catalog number: 309659 )
25 G Needle (BD, catalog number: 305122 )
15 ml Polypropylene Centrifuge Tubes (Greiner Bio-One GmbH, catalog number: 188271 )
16 mm diameter x 100 mm Glass tubes (VWR International, catalog number: 47729-576 )
18 mm diameter x 150 mm Glass tubes (VWR International, catalog number: 47729-583 )
Suba-Seal® septa (Sigma-Aldrich, catalog number: Z124613 )
Tomato plants (4-5 week-old) were grown in a greenhouse or growth chamber (16 h light, 25~28 °C)
Xanthomonas euvesicatoria (Xcv) strain 85-10 wild type and mutants (for example, type III effector deletion mutants)
Note: Wild type strain is available upon request.
Magnesium chloride hexahydrate (Sigma-Aldrich, catalog number: M2393 )
Peptone (BD, catalog number: 211677 )
Yeast extract (BD, catalog number: 212750 )
Agar (BD, catalog number: 214530 )
Glycerol (Certified ACS) (Fisher Chemical, catalog number: G334 )
Sodium hydroxide (Sigma-Aldrich, catalog number: 221465 )
Distilled water
NYGA medium (see Recipes)
10 mM MgCl2 (see Recipes)
Equipment
28 ºC Incubator (VWR International, catalog number: 414005-128 )
Vortexer (Scientific Indrustries, model: Vortex-Genie 2 )
Spectrophotometer (Amersham Biosciences, model: Ultrospec 3100 Pro )
Gas chromatograph (GC) (Shimadzu Corporation, model: GC-8A )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
Category
Plant Science > Plant immunity > Disease bioassay
Microbiology > Microbe-host interactions > Bacterium
Biochemistry > Other compound > Plant hormone
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,724 | https://bio-protocol.org/exchange/protocoldetail?id=1724&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Cell-based Assays to Monitor AID Activity
Ludivine C. Litzler
Stephen P. Methot
Anne-Marie Patenaude
Astrid Zahn
Javier M. Di Noia
Published: Vol 6, Iss 3, Feb 5, 2016
DOI: 10.21769/BioProtoc.1724 Views: 8772
Edited by: Jia Li
Reviewed by: Smita Nair
Original Research Article:
The authors used this protocol in Apr 2015
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Apr 2015
Abstract
The enzyme Activation induced deaminase (AID) underpins antibody affinity maturation and isotype switching through its mutagenic activity of deaminating deoxycytidine to deoxyuridine in DNA. Subsequent processing of the deoxyuridine initiates the processes of somatic hypermutation (SHM) and class switch recombination (CSR) in B cells. Structure-function analysis of AID requires sensitive and biologically relevant methods to measure its various activities. Here we describe simple but effective methods to measure 1) the ability of AID to mutate the Escherichia coli genome, which provides an indication of its catalytic activity; 2) the capacity of AID to perform SHM by complementing a derivative of the DT40 chicken B cell line; 3) the ability of AID to perform CSR by complementing AID-deficient primary mouse B cells. The combination of the three methods, accompanied by the necessary analysis of AID subcellular localization and protein expression levels and stability, as controls, allows detailed structure-function interrogation of AID.
Keywords: Activation induced deaminase Mutation Class switch recombination Escherichia coli B-lymphocytes
Part I. Measuring mutagenic activity of AID in E. coli
The following procedure has been adapted from Petersen-Mahrt et al. (2002). It provides a measurement of the capacity of AID to mutate the Escherichia coli genome by selecting for those mutations in the rpoB gene that confer resistance to Rifampicin. It can be used as a proxy for the catalytic activity of the enzyme, although it involves deamination of a transcribed gene, which might influence the results. When comparing different AID variants or mutants, it provides a measurement of their mutagenic activity compared to the wt enzyme, which often but not always correlates with the enzymatic activity of the corresponding recombinant enzymes measured on DNA oligonucleotide substrates.
Materials and Reagents
Sterile multi-channel basin
Competent Δung E coli. We use the BW310 strain (Duncan, 1985) (a gift from Dr. Bernard Weiss Department of Pathology, Emory University School of Medicine, Atlanta)
Plasmids containing AID or AID variants cloned in an inducible prokaryotic expression vector. We use IPTG-inducible pTrcHis vectors (Life Technologies, catalog number: V360-20 )
Note: Currently, it is “Thermo Fisher Scientific, Invitrogen™, catalog number: V360-20”.
Tryptone (BioShop Canada, catalog number: TRP402 )
Yeast extract (BioShop Canada, catalog number: YEX401 )
Sodium Chloride (NaCl) (BioShop Canada, catalog number: SOD002 )
Agar (bacteriological grade) (BioShop Canada, catalog number: AGR001 )
Na2HPO4.7H2O (BioShop Canada, catalog number: SMP400 )
Potassium Phosphate Monobasic (KH2PO4) (BioShop Canadap, catalog number: PPM666 )
Ammonium chloride (NH4Cl) (Sigma-Aldrich, catalog number: A0171 )
Ampicillin (stock 100 mg/ml in ddH2O) (BioShop Canada, catalog number: AMP201 )
Carbenicillin (100 mg/ml in ddH2O) (BioShop Canada, catalog number: CAR666 )
Rifampicin (stock 100 mg/ml in DMSO) (Sigma-Aldrich, catalog number: R3501 )
IPTG (stock 1 M in ddH2O) (BioShop Canada, catalog number: IPT001 )
Transparent sterile 96-well plates, flat bottom (Corning, catalog number: 3595 )
LB media (see Recipes)
LB agar (see Recipes)
2x TY media (see Recipes)
5x M9 media (see Recipes)
Equipment
Bunsen burner
Sterile glass beads (for bacteria plating) (Genlantis, EZ-spread, catalog number: C400050 )
37 °C incubator (for bacterial plates)
37 °C incubator with shaker (for bacterial cultures)
42 °C water bath
Hand counter
Multichannel pipettor
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Litzler, L. C., Methot, S. P., Patenaude, A., Zahn, A. and Di Noia, J. M. (2016). Cell-based Assays to Monitor AID Activity. Bio-protocol 6(3): e1724. DOI: 10.21769/BioProtoc.1724.
Download Citation in RIS Format
Category
Immunology > Antibody analysis > Antibody function
Biochemistry > Protein > Activity
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,725 | https://bio-protocol.org/exchange/protocoldetail?id=1725&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Structured Illumination Microscopy (SIM) and Photoactivated Localization Microscopy (PALM) to Analyze the Abundance and Distribution of RNA Polymerase II Molecules on Flow-sorted Arabidopsis Nuclei
Klaus Weisshart
JF Jörg Fuchs
VS Veit Schubert
Published: Vol 6, Iss 3, Feb 5, 2016
DOI: 10.21769/BioProtoc.1725 Views: 12354
Edited by: Samik Bhattacharya
Original Research Article:
The authors used this protocol in Mar 2015
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Mar 2015
Abstract
RNA polymerase II (RNAPII) is the enzyme transcribing most of the eukaryotic protein-coding genes. Analysing the distribution and quantification of RNAPII can help understanding its function in interphase nuclei. Although several investigations in mammals indicate the organization of RNAPII in so-called ‘transcription factories’ (Jackson et al., 1993; Rieder et al., 2012; Papantonis and Cook, 2013), their existence is still controversially discussed (Zhao et al., 2014).
Recently, based on super-resolution microscopy the presence of transcription factories was also suggested in plants. Applying structured illumination microscopy (SIM) and photoactivated localization microscopy (PALM) the distribution and number of RNAPII molecules in Arabidopsis nuclei were analysed and a positive correlation between RNAPII abundance and endopolyploidy was found (Schubert, 2014; Schubert and Weisshart, 2015).
Here, we present a protocol describing the isolation of Arabidopsis thaliana interphase nuclei via flow-sorting according to their endopolyploidy level, followed by a double immunostaining using antibodies specific for different RNAPII modifications and the subsequent evaluation by spatial SIM and PALM to achieve results regarding the abundance, distribution and co-localization of single inactive and active RNAPII molecules.
Keywords: Super-resolution microscopy Cell nucleus Transcription RNA polymerase Single molecule localization
Part I. Flow sorting of Arabidopsis interphase nuclei
Materials and Reagents
22x22 mm high precision coverslips (170±5 µm, no. 1.5H) (Marienfeld-Superior) Rubber cement (Marabu Australia, catalog number: 290110000 )
5 ml Polystyrene Round-Bottom Tubes with 35 µm cell strainer cap (BD Biosciences, catalog number: 352235 ) or alternatively, 5 ml Polystyrene Round-Bottom Tube (BD Biosciences, catalog number: 352063 ) in combination with disposable filters CellTrics, 30 or 50 µm (Sysmex-Partec, catalog numbers: 04-0042-2316 or 04-0042-2317 )
Note: Currently, it is "Corning, Falcon®, catalog number: 352235” and "Corning, Falcon®, catalog number: 352063”.
0.22 µm filter
A. thaliana rosette leaves
Calibration beads [SpheroTM Rainbow Calibration Particles (8 peaks)] (BD Biosciences, catalog number: 559123 )
Accudrop Beads (BD FACSTM Accudrop Beads) (BD Biosciences, catalog number: 345249 )
Formaldehyde solution 37% (Carl Roth GmbH + Co, catalog number: 7398.1 )
4', 6-diamidino-2-phenylindole (DAPI) (Life Technologies, Molecular ProbesTM, catalog number: D-1306 )
Note: Currently, it is “Thermo Fisher Scientific, Molecular ProbesTM, catalog number: D-1306”.
Milli-Q water
NaCl
Na2HPO4.2H2O
NaH2PO4
Tris
Na2EDTA
Spermin
KCl
Triton X-100
NaOH
β-mercaptoethanol
MgCl2
Sucrose
Tween 20
HCl
BD FACSFlow sheath fluid (BD Biosciences, catalog number: 342003 ) or alternatively, 1 x PBS (see Recipes)
Formaldehyde fixative (see Recipes)
500 ml Tris-Buffer (see Recipes)
200 ml lysis buffer LB01 (Dolezel et al., 1989) (see Recipes)
100 µg/ml DAPI stock solution (see Recipes)
25 ml sucrose buffer (see Recipes)
Equipment
FACSAria IIu (BD Biosciences)
Software
FACSDiva software
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Weisshart, K., Fuchs, J. and Schubert, V. (2016). Structured Illumination Microscopy (SIM) and Photoactivated Localization Microscopy (PALM) to Analyze the Abundance and Distribution of RNA Polymerase II Molecules on Flow-sorted Arabidopsis Nuclei. Bio-protocol 6(3): e1725. DOI: 10.21769/BioProtoc.1725.
Download Citation in RIS Format
Category
Plant Science > Plant cell biology > Cell imaging
Plant Science > Plant cell biology > Organelle isolation
Cell Biology > Cell imaging > SIM
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,726 | https://bio-protocol.org/exchange/protocoldetail?id=1726&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Transfection of Embryoid Bodies with miRNA Precursors to Induce Cardiac Differentiation
Federica Pisano
MG Massimiliano Gnecchi
Published: Vol 6, Iss 3, Feb 5, 2016
DOI: 10.21769/BioProtoc.1726 Views: 8716
Reviewed by: Jingli Cao
Original Research Article:
The authors used this protocol in Apr 2015
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Apr 2015
Abstract
In recent years, the utilization of stem cell therapy to regenerate cardiac tissue has been proposed as a possible strategy to treat cardiac damage (Gnecchi et al., 2012, Aguirre et al., 2013; Sanganalmath and Bolli, 2013). Although encouraging results have been obtained in experimental models, the efficiency of cardiac regeneration is very poor and one of the major barriers to progress in the area of cell therapy for damaged heart is represented by the limited capacity of cells to differentiate into mature cardiomyocytes (CMC) (Laflamme and Murry, 2011). Cell manipulation and transfection represent versatile tools in this context (Melo et al., 2005; Dzau et al., 2005). Murine P19 embryonal carcinoma cells are a well-established cell line capable of differentiating in vitro into spontaneously beating CMC. This cell system with its limited cell culture requirements, protocol reproducibility and ease in uptake and subsequent expression of ectopic genetic materials render it ideal for the study of the cardiac differentiation process. P19 cells have been successfully used to gain important insights into the early molecular processes of CMC differentiation (van der Heyden and Defize, 2003; van der Heyden et al., 2003). P19 cells can also be maintained in an undifferentiated state in a monolayer culture when grown in adherence; this condition allows the enrichment of large cell numbers useful for cardiac differentiation protocols (McBurney, 1993). On the other hand, when cultured in bacterial dishes, P19 cells will grow in suspension and generate embryoid bodies (EB). When exposed to dimethyl sulfoxide (DMSO), EB differentiate into spontaneously beating cells, which can be defined as CMC. This definition is based on their gene and protein expression and their electrophysiological properties (Wobus et al., 1994; van der Heyden et al., 2003). In our laboratory, we used this in vitro model to verify whether the over-expression of a defined combination of miRNA can synergistically induce effective cardiac differentiation (Pisano et al., 2015). We used miRNA1, miRNA133 and miRNA499 alone or in combination. Here, we describe how we transiently transfect P19 cells to over-express a single or a combination of miRNA precursors (pre-miRNA).
Keywords: MicroRNA Embryoid bodies Cardiac differentiation
Materials and Reagents
Bacterial dishes (100 x 15 mm) (Corning, catalog number: 351006 )
Standard culture Petri dishes (100 x 15 mm) (Corning, catalog number: 70165-101 )
6 multiwell-plates (Corning, catalog number: 353224 )
50 ml tubes (Falcon®, catalog number: 352098 )
P19 cells (Izsler-Istituto Zooprofilattico Sperimentale, Lombardy and Emilia Romagna “Bruno Ubertini”, Brescia, Italy) (Izsler, catalog number: BS-TCL 206 , Passage 0)
Minimum Essential Medium alpha (α-MEM) (Sigma-Aldrich, catalog number: M8042 )
Penicillin-streptomycin 10,000 U/ml (Thermo Fisher Scientific, GibcoTM, catalog number: 15140-122 )
L-glutamine 2 nM (Thermo Fisher Scientific, GibcoTM, catalog number: 25030-081 )
Dimethyl sulfoxide (Sigma-Aldrich, catalog number: D4540-100 ml )
Fetal Bovine Serum (FBS) (Sigma-Aldrich, catalog number: F6178-50 ml )
Trypsin-EDTA (0.5%), no phenol red (Thermo Fisher Scientific, GibcoTM, catalog number: 15400-054 )
Optimem® (Thermo Fisher Scientific, GibcoTM, catalog number: 31985-070 )
siPORT® NeoFX transfection agent (Thermo Fisher Scientific, Invitrogen™, catalog number: AM4511 )
Pre-miRNA 1 (ID: 000385) (Thermo Fisher Scientific, Applied Biosystems®, catalog number: AM17100 ), Pre-miRNA 133 (ID: 000458) (Thermo Fisher Scientific, Applied Biosystems®, catalog number: AM17100), Pre-miRNA 499 (ID: 001045) (Thermo Fisher Scientific, Applied Biosystems®, catalog number: AM17100) molecules and scramble miRNA (negative control) (Thermo Fisher Scientific, Ambion™, catalog number: AM17110 )
Culture medium (see Recipes)
Standard differentiation medium (see Recipes)
Mix A (see Recipes)
Mix B (see Recipes)
Equipment
Pipetus® Pipettes
Laminar flow-hood (EuroClone S.p.A., model: S@feflow 1.8 )
Humidified cell culture incubator set at 37 °C, 5% CO2 (Panasonic Corporation, Sanyo, model: MCO-18AC )
Inverted bright light microscope equipped with a phase-contrast filter (ZEISS, model: Observer Z1 )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Pisano, F. and Gnecchi, M. (2016). Transfection of Embryoid Bodies with miRNA Precursors to Induce Cardiac Differentiation. Bio-protocol 6(3): e1726. DOI: 10.21769/BioProtoc.1726.
Download Citation in RIS Format
Category
Stem Cell > Embryonic stem cell > Maintenance and differentiation
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,727 | https://bio-protocol.org/exchange/protocoldetail?id=1727&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Calculation of Microorganism Lag Times as a Measure of Adaptative Capability between Different Growth Conditions
Brice Enjalbert
Published: Vol 6, Iss 3, Feb 5, 2016
DOI: 10.21769/BioProtoc.1727 Views: 6404
Edited by: Valentine V Trotter
Reviewed by: Disha Srivastava
Original Research Article:
The authors used this protocol in Oct 2015
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Oct 2015
Abstract
This protocol has been designed as a simple and efficient way to investigate microorganism adaptive capabilities (Enjalbert et al., 2015). It is performed using switch experiments in which cells are initially grown in the first condition (primary cultures), then rapidly switched to the second condition (secondary culture) without centrifugation or quenching. The measurement is based on the capacity of the secondary culture cells to resume growth. This protocol can be utilized for assessing metabolic or stress adaptation of microorganisms.
Keywords: Lag Switch Growth Adaptation
Materials and Reagents
Sterile Erlen-Meyer flask per switch
0.45 µm filter per switch (Minisart 0.45 μm filter) (Sartorius AG)
Plastic adapter per switch (Tube versilic 4 x 7 mm) (Saint-Gobain or equivalent)
Sterile syringe 5 ml (Terumo Medical Corporation)
Microorganism culture in condition 1
Medium for growth condition 2
Equipment
Shaker incubator
Spectrophotometer and cuvettes
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Enjalbert, B. (2016). Calculation of Microorganism Lag Times as a Measure of Adaptative Capability between Different Growth Conditions . Bio-protocol 6(3): e1727. DOI: 10.21769/BioProtoc.1727.
Download Citation in RIS Format
Category
Microbiology > Microbial physiology > Adaptation
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,728 | https://bio-protocol.org/exchange/protocoldetail?id=1728&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Design and Functional Analysis of Fluorescent Nitrate and Peptide Transporter Activity Sensors in Yeast Cultures
Cheng-Hsun Ho
WF Wolf B. Frommer
Published: Vol 6, Iss 3, Feb 5, 2016
DOI: 10.21769/BioProtoc.1728 Views: 10332
Edited by: Fanglian He
Reviewed by: Chong He
Original Research Article:
The authors used this protocol in Mar 2014
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Mar 2014
Abstract
This protocol describes the methods used to engineer and deploy genetically encoded fluorescence activity reporters for nitrate and peptide transporter activity in yeast cells. Fusion of the dual-affinity nitrate transceptor CHL1/AtNRT1.1/AtNPF6.3 or four different peptide transporters (AtPTR1, 2, 4, and 5) from Arabidopsis to a pair of fluorescent proteins with different spectral properties, enabled us to engineer the NiTracs (nitrate transporter activity tracking sensors) and the PepTracs (peptide transporter activity tracking sensors), ratiometric fluorescence activity sensors that monitor the activity of the plasma membrane nitrate transceptor or the peptide transporters in vivo (Ho et al., 2014). The NiTrac1 sensor responds specifically and reversibly to the addition of nitrate, while the PepTracs respond to addition of dipeptides, either by a reduction in donor and acceptor emission, while acceptor-excited emission remains unaltered, or by a change in ratio of the fluorophore emission. All sensors are suitable for ratiometric imaging. The similarity of the biphasic kinetics of the NiTrac1 sensor response [from µM to mM (Liu and Tsay, 2003)] and the nitrate transport kinetics of the native nitrate transceptor, intimates that NiTrac1 provides information on conformational rearrangements during the transport cycle, thereby reporting transporter activity over a wide range of external nitrate concentrations. Several variants of NiTrac have been engineered, which differ with respect to their affinity for nitrate (NiTrac1: CHL1; NiTracT101A: CHL1T101A). NiTrac also recognizes chlorate. Here we describe a simple method for the design, implementation, and detection of nitrate transceptor activity in yeast cells using a spectrofluorimeter.
Keywords: Biosensor Transporter Nitrogen FRET Genetically encoded sensor
Materials and Reagents
Monochromator-based spectrofluorimeter for 96 well plates [for instance: Safire or Infinite® M1000 (Tecan Trading AG)]
96 well microplates (flat bottom clear or black) (Greiner Bio-One GmbH, catalog numbers: 650101 and 650209 )
Note: Black plates are more expensive, but have lower background.
Multichannel (12) pipette (for 100 µl) (e.g., Sartorius AG, catalog number: 725240 )
50 ml sterile plastic tubes (for instance: Falcon®, or any other brand)
Yeast Strain: protease-deficient yeast strain BJ5465 [MATa, ura3–52, trp1, leu2Δ1, his3Δ200, pep4::HIS3, prb1Δ1.6R, can1, GAL+] (ATCC, catalog number: 208289TM ), which was obtained from the Yeast Genetic Stock Center (University of California, Berkeley, CA)
The nitrate transceptor CHL1/NRT1.1/NPF6.4 (Ho et al., 2009; Leran et al., 2013) or various PTR peptide transporters (Komarova et al., 2012; Tsay et al., 2007; Leran et al., 2013)
Note: they were used as sensory domains for creating the nitrate (NiTracs) and peptide (PepTracs) sensor constructs. For this full length ORFs of CHL1, CHL1T101A, PTR1, PTR2, PTR4, and PTR5 from Arabidopsis (The Arabidopsis Information Resource) were cloned in the pTOPO Gateway Entry vector.
Sensors: CHL1/PTRs
Note: it was sandwiched between a yellow acceptor [Aphrodite t9: Aphrodite is a codon diversified Venus gene; t9 corresponds to a deletion of the C-terminus of 9 amino acids (Deuschle et al., 2006) and cyan donor fluorophore (mCerulean) (Rizzo et al., 2006)]. This was achieved by inserting the sensory domain in the Gateway yeast expression vector pDRFlip30.
pDRFlip30-NiTrac1 (original dual-affinity sensor; Km ~ 75 μM and Km ~ 3.8 Mm) (Ho et al., 2014).
pDRFlip30-NiTrac1T101A (Variant with low-affinity; Km ~ 3.5 mM) (Ho et al., 2014).
pDRFlip30-PepTrac1 (PepTrac1 based on AtPTR1) (Ho et al., 2014)
pDRFlip30-PepTrac2 (PepTrac2 based on AtPTR2) (Ho et al., 2014)
pDRFlip30-PepTrac4 (PepTrac4 based on AtPTR4) (Ho et al., 2014)
pDRFlip30-PepTrac5 (PepTrac5 based on AtPTR5) (Ho et al., 2014)
Gly-Gly (Sigma-Aldrich, catalog number: G1002 ) or other di-/tri-peptides (Sigma-Aldrich)
Potassium nitrate (Sigma-Aldrich, catalog number: P8394 )
YNB, yeast nitrogen base w/o amino acids w/o ammonium sulfate (BD, Difco, catalog number: 233520 )
D-(+)-Glucose monohydrate (Fluka Analytical, catalog number: 49159 )
Agar (Sigma-Aldrich, catalog number: A1296 )
Agarose (Sigma-Aldrich, catalog number: 05066 )
MES hydrate (Sigma-Aldrich, catalog number: M2933 )
Sodium hydroxide (NaOH) (Sigma-Aldrich, catalog number: S5881 )
MilliQ or distilled water
1, 4-Dithiothreitol (DTT) (Sigma-Aldrich, catalog number: DTT-RO )
Carrier DNA [UltraPureTM Salmon Sperm DNA Solution (Thermo Fisher Scientific, InvitrogenTM, catalog number: 115632-011 )]
Ethylenediaminetetraacetic acid (EDTA) (Sigma-Aldrich, catalog number: E6758 )
KNO3
KCl
Stock
45% PEG4000
Lithium acetate
Tris-Cl (pH 7.5)
40x glucose solution
-ura DropOut medium (Takara Bio Company, Clontech, catalog number: 630416 ) (see Recipes)
Wash buffer (see Recipes)
Resuspension buffer (see Recipes)
Substrate addition (see Recipes)
PLATE mixture (see Recipes)
Equipment
Tube rack (any brand)
Orbital shaker, with temperature and velocity control (e.g., Eppendorf, New Brunswick Scientific, model: Innova 44 )
Incubator for 28-30 °C incubation of yeast cells (any brand, e.g., VWR International)
Centrifuge with swinging rotor for 50 ml tubes (Beckman Coulter, model: Allegra 25R )
Procedure
Sensor design
For yeast expression, CHL1/NRT1.1 or PTRs coding regions were inserted by Gateway LR reactions into the E.coli/yeast expression vectors pDRFlip30, a destination vector that sandwiches the sensory domain between Aphrodite t9 and mCerulean (Jones et al., 2014), following manufacturer’s instructions. The E. coli/yeast vector pDRFlip30 is used for expressing the NiTracs or PepTracs from a PMA1 (yeast proton ATPase) promoter fragment. pDRFlip30 contains the ADH (alcohol dehydrogenase) terminator, and the URA3 marker for auxotrophy selection in yeast (Figure 1). pDRFlip30 is a vector that allows us to sandwich the transporter of interest by translational fusion between an N-terminal Aphrodite t9 (AFPt9) variant (aphrodite is a codon-diversified gene producing Venus; Deuschle et al., 2006), lacking nine amino acids at its C-terminus and a C-terminal monomeric Cerulean (mCer; Rizzo et al., 2006).
Yeast transformation
The protease-deficient yeast strain BJ5465 [MATa ura352 trp1 leu2Δ1 his3Δ 200 pep4::HIS3 prb1Δ1.6R can1 GAL] is transformed with the pDRFlip30 vector containing the desired NiTracs and PepTracs by using the modified Lithium Acetate method from Gietz et al., 1992. In brief:
Inoculate cultures in YPD medium and grow at 30 °C overnight to OD600nm ~ 0.5.
Spin down (2,000 x g) 1 ml of cells in microfuge tube (15 sec) for each transformation.
Decant the supernatant and resuspend the cells in 100 μl of liquid medium by vortexing.
Add 2 μl of 10 mg/ml carrier DNA, vortex.
Add ~1 μg plasmid, vortex.
Add 20 μl 1 M DTT, vortex.
Add 0.5 ml of ‘PLATE mixture’ (100 ml stock containing 90 ml of 45% PEG4000, 10 ml of 1 M lithium acetate, 1 ml of 1 M Tris-Cl (pH 7.5), 0.2 ml of 0.5 M EDTA), vortex.
Incubate at RT for 6-8 h or overnight.
Heat-shock cells for 10 min at 42 °C.
Place pipet tip directly into bottom of tube, withdraw 50-100 μl of cells and plate cells on solid -ura DropOut medium. Plates are wrapped with plastic cling wrap to prevent dehydration.
Plates are incubated (lid down) at 30 °C for 2-3 days.
Detection of NiTrac and PepTrac responses in yeast using a fluorimeter
Single colonies are picked using sterile pipette tips and grown in a 50 ml tube containing 10 ml -ura DropOut liquid medium. Pick at least three independent colonies. Use fresh transformation; do not keep colonies for more than one week on plates to avoid mutations in yeast or plasmid.
Place tubes in a rack and incubate in an incubator for ~15 h under agitation (230 rpm) at 30 °C until the culture reaches OD600nm ~0.5.
Liquid cultures are subcultured after dilution to OD600nm 0.01 in the same liquid medium and grown at 30 °C until OD600nm reaches ~0.2.
Collect the cells by centrifugation at 4,000 x g, RT for 7 min, to sediment the cells.
Discard the supernatant and resuspend the sediment by vortexing in 10 ml ‘Wash buffer’, 15 sec, RT.
Centrifuge as described above (step B4).
Wash the sediment two more times as in step B4 to B6, to remove traces of growth medium.
Resuspend the sediment to OD600nm ~0.5 in ‘Resuspension buffer’.
Mix cells well and aliquot 100 µl of the culture into wells of a 96-well flat bottom plate.
Fluorescence is measured in a fluorescence plate reader, in bottom reading mode using 7.5 nm bandwidth for both excitation and emission. Typically, emission spectra are recorded with the following instrument settings: λem 470-570 nm for donor (mCer), step size 5 nm, gain: 75; and λem 520-570 nm for AFPt9, step size 5 nm, gain: 75. Fluorescence from cultures harboring pDRFlip30 (donor: mCer) is measured with excitation at λexc 428 nm; AFPt9 is measured with excitation at λexc 500 nm.
A single- or multichannel pipette is used to add 100 µl of the culture to wells (mix by pipetting up and down) and to add analyte solution to the cells. Set up at least three replicates per treatment. Try to add equal amounts of solutions to reduce variability and use well-calibrated pipettes since the assays are quantitative and sensitive to differences in volumes/ concentration of sensor and analyte.
Record the fluorescence immediately (as fast as possible) after substrate or control solution addition. It takes about 10 min to read a full 96 well plate with the parameters mentioned above. For highly accurate analyses, measure only a few wells at a time to reduce differences in analysis time. It is also possible to use instruments with injectors that allow for immediate recording; use rapid switching between wells to record over time.
Data analysis
Subtract background fluorescence of yeast (using cells transformed with vector only) from all fluorescence values (for both spectra as well as single point measurements).
For NiTracs
NiTracs expressed in yeast respond to nitrate addition by decreasing fluorescence intensity of donor and acceptor emission (obtained with excitation at 428nm). Aphrodite-t9 emission was unaffected and served as a control or reference for normalization (obtained at 500nm excitation Figure 2A & inset). Nitrate addition (5 mM) induced a reduction in the emission spectrum, while emission of the acceptor after direct excitation of the acceptor did not change (Figure 2B). Since the Aphrodite-t9 emission is unaffected by nitrate when excited directly, Aphrodite-t9 emission can be used as a control and for normalization by using ratios instead of absolute values to compare between different cultures (e.g. mutants) (peak fluorescence intensity of Aphrodite-t9 excited at 500 nm over every point in the emission spectrum obtained with excitation at 428 nm).
For PepTracs
PepTracs respond to dipeptide by decreasing fluorescence intensity of donor and acceptor emissions (PepTrac1, PepTrac2, and PepTrac5) or by a ratio change (Aphrodite-t9 emission intensity/mCer emission intensity obtained with excitation at 428nm) in the case of PepTrac4 (Figure 3). For PepTrac1, PepTrac2, and PepTrac5, Aphrodite-t9 emission when excited at 500nm was unaffected by peptide addition in PepTracs (Figure 3A, B, & C, insect). The emission ratio change induced by addition of dipeptide for PepTrac4 is shown in Figure 2D).
Representative data
Figure 1. Map of pDRFlip30-CHL1/PTRs plasmids. Main components and their sizes (base pair, bp): PMA promoter fragment 452 bp, ADH terminator 333 bp, 2 micron replication origin 1165 bp, URA3 804 bp, Ampicillin 1863 bp, pUC origin 654 bp, CHL1 1770 bp, PTRs: PTR1 1710 bp, PTR2 1755 bp, PTR4 1635 bp, PTR5 1710 bp, Aphrodite t9 688 bp, and mCerulean 714 bp.
Figure 2. Decrease in emission intensity for NiTrac1 expressed in yeast cells. A. Excitation at 428 nm: addition of 5 mM potassium nitrate (red; control 5 mM KCl, blue), led to a reduction in fluorescence intensity of donor and acceptor emission. Inset: emission intensity of Aphrodite-t9 in NiTrac1 when excited at 500 nm. Inset: Aphrodite-t9 emission was unaffected. AU: arbitrary units); B. Nitrate triggers a decrease in the emission from the donor, and consequentially a reduced meission from the accepted when exciting only the donor. Nitrate-induced ratio change (peak fluorescence intensity of Aphrodite-t9 excited at 500 nm over emission spectrum at 485 nm obtained with excitation at 428 nm). Data are normalized to KCl-treated buffer (as negative control, C). The data are from the same experiment as shown in (Ho et al., 2014), but are derived from a separate analysis of independent colonies.
Figure 3. Fluorescence response of PepTrac1 (A), PepTrac2 (B), PepTrac5 (C), and PepTrac4 (D) expressing yeast cells. Samples were excited at 428 nm: addition of 5 mM gly-gly (red; control: 5mM KCl, blue), led to a reduction of fluorescence intensity of donor and acceptor emission in the case of PepTrac1, 2, and 5. Inset: emission of Aphrodite-t9 in PepTracs when excited at 500 nm. Aphrodite t9 emission was unaffected in PepTrac1, 2, and 5. (D) Fluorescence ratio (excitation 428 nm; emission ratio 530nm/428 nm; corresponding to mCer and Aphrodite-t9 emission, respectively) for PepTrac4 before and after addition of 5mM gly-gly dipeptide. The data are from the same experiment as shown in (Ho et al., 2014), but are derived from a separate analysis of independent colonies.
Recipes
-ura DropOut medium
0.23 g/L -ura DropOut
1.7 g/L yeast nitrogen base w/o amino acids w/o ammonium sulfate
40% sterile filtrated glucose
Autoclave, 121 °C, 15 psi, 15 min
For liquid medium, when hand-warm, add glucose from 40% sterile filtrated stock to a final concentration of 2% under sterile hood (e.g., biosafety cabinet)
For solid medium, add 20 g/L agar before autoclaving. Add sterile filtrated glucose from 40% stock to a final concentration of 2% when medium is hand-warm before pouring plates
Adjust the pH of the -ura DropOut medium to pH 5.8 with NaOH before addition of agar and autoclaving
Wash buffer
50 mM MES buffer, adjust to pH 5.5 with NaOH
Resuspension buffer
Add agarose to final concentration 0.05% in wash buffer (Recipe 2), and then, microwave until the agarose dissolves completely and wait until medium cools to room temperature to delay sedimentation of the cells during the measurement.
Substrate addition
Add KNO3 or KCl from 1 M stock to resuspension buffer (Recipe 3) to generate analyte concentration for measurement
PLATE mixture
100 ml stock
90 ml of 45% PEG4000
10 ml of 1 M lithium acetate
1 ml of 1 M Tris-Cl (pH 7.5)
0.2 ml of 0.5 M EDTA
Acknowledgments
Methods were adapted from (Ho et al., 2014). Techniques were also adapted from other references as cited. This work has been supported by grants MCB-1021677 and MCB-1413254 from the National Science Foundation (to WBF).
References
Deuschle, K., Chaudhuri, B., Okumoto, S., Lager, I., Lalonde, S. and Frommer, W. B. (2006). Rapid metabolism of glucose detected with FRET glucose nanosensors in epidermal cells and intact roots of Arabidopsis RNA-silencing mutants. Plant Cell 18(9): 2314-2325.
Gietz, D., St Jean, A., Woods, R. A. and Schiestl, R. H. (1992). Improved method for high efficiency transformation of intact yeast cells. Nucleic Acids Res 20(6): 1425.
Ho, C. H. and Frommer, W. B. (2014). Fluorescent sensors for activity and regulation of the nitrate transceptor CHL1/NRT1.1 and oligopeptide transporters. Elife 3: e01917.
Ho, C. H., Lin, S. H., Hu, H. C. and Tsay, Y. F. (2009). CHL1 functions as a nitrate sensor in plants. Cell 138(6): 1184-1194.
Jones, A. M., Danielson, J. A., Manojkumar, S. N., Lanquar, V., Grossmann, G. and Frommer, W. B. (2014). Abscisic acid dynamics in roots detected with genetically encoded FRET sensors. Elife 3: e01741.
Komarova, N. Y., Meier, S., Meier, A., Grotemeyer, M. S. and Rentsch, D. (2012). Determinants for Arabidopsis peptide transporter targeting to the tonoplast or plasma membrane. Traffic 13(8): 1090-1105.
Leran, S., Varala, K., Boyer, J. C., Chiurazzi, M., Crawford, N., Daniel-Vedele, F., David, L., Dickstein, R., Fernandez, E., Forde, B., Gassmann, W., Geiger, D., Gojon, A., Gong, J. M., Halkier, B. A., Harris, J. M., Hedrich, R., Limami, A. M., Rentsch, D., Seo, M., Tsay, Y. F., Zhang, M., Coruzzi, G. and Lacombe, B. (2014). A unified nomenclature of NITRATE TRANSPORTER 1/PEPTIDE TRANSPORTER family members in plants. Trends Plant Sci 19(1): 5-9.
Liu, K. H. and Tsay, Y. F. (2003). Switching between the two action modes of the dual-affinity nitrate transporter CHL1 by phosphorylation. EMBO J 22(5): 1005-1013.
Rizzo, M. A., Springer, G., Segawa, K., Zipfel, W. R. and Piston, D. W. (2006). Optimization of pairings and detection conditions for measurement of FRET between cyan and yellow fluorescent proteins. Microsc Microanal 12(3): 238-254.
Tsay, Y. F., Chiu, C. C., Tsai, C. B., Ho, C. H. and Hsu, P. K. (2007). Nitrate transporters and peptide transporters. FEBS Lett 581(12): 2290-2300.
Copyright: Ho and Frommer. This article is distributed under the terms of the Creative Commons Attribution License (CC BY 4.0).
How to cite： Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Ho, C. H. and Frommer, W. B. (2016). Design and Functional Analysis of Fluorescent Nitrate and Peptide Transporter Activity Sensors in Yeast Cultures. Bio-protocol 6(3): e1728. DOI: 10.21769/BioProtoc.1728.
Ho, C. H. and Frommer, W. B. (2014). Fluorescent sensors for activity and regulation of the nitrate transceptor CHL1/NRT1.1 and oligopeptide transporters. Elife 3: e01917.
Download Citation in RIS Format
Category
Microbiology > Heterologous expression system > Saccharomyces cerevisiae
Cell Biology > Cell imaging > Live-cell imaging
Cell Biology > Cell imaging > Fluorescence
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,729 | https://bio-protocol.org/exchange/protocoldetail?id=1729&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Mouse Oocyte Isolation, Cultivation and RNA Microinjection
Anna Tetkova
Marketa Hancova
Published: Vol 6, Iss 3, Feb 5, 2016
DOI: 10.21769/BioProtoc.1729 Views: 16241
Original Research Article:
The authors used this protocol in Jan 2015
Download PDF
Ask a question
Favorite
Cited by
Original research article
The authors used this protocol in:
Jan 2015
Abstract
Mammalian oocyte is a highly specialized cell, characterized by synthesis and storage of maternal proteins and RNAs that contributes to the meiotic cell cycle and early embryo development. The fully grown oocyte is transcriptionally quiescent and utilizes only transcripts synthesized and stored during the growing phase. Mouse oocytes are often used as a mammalian model for the study of molecular biology of the cell or biomedical research. Microinjection technique is a useful tool to deliver RNA coding for fluorescently tagged proteins to determine their subcellular localization or function, delivering biosensors for the study of various metabolic pathways or downregulation of specific targets by RNAi or oligo morpholinos to study gene function. Here, we describe a protocol for isolation, cultivation and microinjection of oocytes that might contribute to research or educational purposes.
Keywords: Oocyte Microinjection RNA Meiosis
Materials and Reagents
Petri dishes (90 mm) (GAMA GROUP, catalog number: 400974 )
Needles Omnifix F Duo (B. Braun Melsungen AG, catalog number: 9161465V )
Petri dishes 3 ml, 8.8 cm2 (Thermo Fisher Scientific, catalog number: 153066 )
Holding micropipette (Microtech IVF, catalog number: 001-120-30 )
Borosilicate Thin Wall with Filament, 1.0 mm OD 0.78 mm ID, 150 mml (Harvard Apparatus, catalog number: 300039 )
Microloader TM, tip for filling Femtotips and other glass microcapillaries, Sterile, 0.5-20 µl, 100 mm (Eppendorf, catalog number: 5242956003 )
Cultivation medium M16 (Merck Millipore Corporation, catalog number: MR016D )
4 well cell culture plate (SPLLIFESCIENCES, catalog number: 30004 )
µ-Slide 4 Well Glass Bottom (Ibidi, catalog number: 80427 )
Nunc Lab-Tek II Chamber Slide System (Thermo Fisher Scientific, catalog number: 154534 )
Capillaries for oocyte manipulation with tip 100 µm in diameter
mMESSAGE mMACHINE Kit (Life Technologies, catalog number: AM1344 )
Note: Currently, it is “Thermo Fisher Scientific, Ambion™, catalog number: AM1344”.
Stimulated mouse (Mus musculus, CD1) at least 6 weeks old; stimulation via pregnant mare serum gonadotropin (PMSG)-Folligon (MSD Animal Health) and human chorionic gonadotropin (hCG) (Sigma-Aldrich)
3-isobutyl-1-methylxanthine (IBMX) (Sigma-Aldrich, catalog number: 28822584 )
Poly(A) Tailing Kit (Life Technologies, catalog number: AM1350 )
Note: Currently, it is “Thermo Fisher Scientific, Ambion™, catalog number: AM1350”.
RNeasy Mini Kit (QIAGEN, catalog number: 74104 )
Mineral oil (Sigma-Aldrich, catalog number: M8410 )
RNase-free water (Life Technologies, Ambion®, catalog number: AM9932 )
Note: Currently, it is “Thermo Fisher Scientific, Ambion™, catalog number: AM9932”.
Dyes for monitoring fluid injection into oocyte,
Fast Green (Sigma-Aldrich, catalog number: F1252 )
Tetramethylrhodamine isothiocyanate-Dextran (Sigma-Aldrich, catalog number: T1287 )
NaCl
KCl
CaCl2.2H2O
KH2PO4
MgSO4.7H2O
Glucose
4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES)
Polyvinyl alcohol (PVA)
Destilated water
Bovine serum albumin (BSA)
Transfer medium (see Recipes)
Equipment
Incubator Hera Cell 150 (Heraeus Holding)
Stereo microscope Stemi 2000 (ZEISS)
NanoDrop ND-1000 (Thermo Fisher Scientific)
Centrifuge 5418 (Eppendorf)
Pulling capillaries (Sutter Instrument Company, model: P-97 )
Microforge for bending capillaries (NARISHIGE Group, model: MF-79 )
Inverted microscope (OLYMPUS, model: CKX41 and Leica, model: DMI 6000B )
Channel Pressure Injector (MicroData Instrument, model: PM2000B 4 )
Joystick MIS-5000 Series Microinjection Manipulation Systems (Burleigh)
Pressurized nitrogen gas or FemtoJet (Eppendorf)
Confocal microscope (Leica, model: SP5 )
EMBL stage incubator
Water corrected objectives HCX PL APO 20x/0.7 IMM CORR λBL and HCX PL APO 40/1.1
Software
Image J (http://rsbweb.nih.gov/ij)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
Category
Cell Biology > Cell isolation and culture > Cell isolation
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
173 | https://bio-protocol.org/exchange/protocoldetail?id=173&type=1 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Dig RNA Probe Synthesis and Purification
LJ Lili Jing
Published: Jan 20, 2012
DOI: 10.21769/BioProtoc.173 Views: 29920
Download PDF
Ask a question
Favorite
Cited by
Abstract
In situ hybridization is an effective method to examine the expression level and location of a gene of interest in tissues or cells. To do this, RNA can be labeled with digoxigenin-UTP (DIG) by in vitro transcription with SP6 and T7 RNA polymerase. The method provided in this protocol is a detailed description of synthesizing an antisense DIG-labeled RNA probe for in situ hybridization using the DIG RNA labeling kit from Roche.
Materials and Reagents
CI (Chloroform: Isoamylalcohol = 24:1)
NaOAc
EtOH
LiCl
DEPC H2O
RNasin Plus Protease Inhibitor (Promega Corporation, catalog number: N2611 )
70% ethanol
PCI (Phenol: Chloroform: Isoamylalcohol = 25:24:1, volume, Sigma-Aldrich, catalog number: P3802 )
Glycogen (QIAGEN, catalog number: 158930 )
DIG RNA labeling kit (Roche Diagnostics, catalog number: 11175025910 )
Quick Spin Columns (Roche Diagnostics, catalog number: 1274015 )
Equipment
Standard tabletop centrifuges
RNase-free Eppendorf tube
NanoDrop
Falcon snap cap tube
Water bath
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2012 The Authors; exclusive licensee Bio-protocol LLC.
Category
Molecular Biology > RNA > RNA synthesis
Molecular Biology > RNA > RNA labeling
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,730 | https://bio-protocol.org/exchange/protocoldetail?id=1730&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Stable Isotope Resolved Metabolomics Studies in ex vivo TIssue Slices
TF Teresa W-M. Fan
AL Andrew N. Lane
RH Richard M. Higashi
Published: Vol 6, Iss 3, Feb 5, 2016
DOI: 10.21769/BioProtoc.1730 Views: 10224
Edited by: Masahiro Morita
Reviewed by: Justine Marsolier
Original Research Article:
The authors used this protocol in Jan 2014
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jan 2014
Abstract
An important component of this methodology is to assess the role of the tumor microenvironment on tumor growth and survival. To tackle this problem, we have adapted the original approach of Warburg (Warburg, 1923), by combining thin tissue slices with Stable Isotope Resolved Metabolomics (SIRM) to determine detailed metabolic activity of human tissues. SIRM enables the tracing of metabolic transformations of source molecules such as glucose or glutamine over defined time periods, and is a requirement for detailed pathway tracing and flux analysis. In our approach, we maintain freshly resected tissue slices (both cancerous and non- cancerous from the same organ of the same subject) in cell culture media, and treat with appropriate stable isotope-enriched nutrients, e.g., 13C6-glucose or 13C5, 15N2-glutamine. These slices are viable for at least 24 h, and make it possible to eliminate systemic influence on the target tissue metabolism while maintaining the original 3D cellular architecture. It is therefore an excellent pre-clinical platform for assessing the effect of therapeutic agents on target tissue metabolism and their therapeutic efficacy on individual patients (Xie et al., 2014; Sellers et al., 2015).
Keywords: Tissue slices SIRM Metabolic pathway tracing Preclinical testing Cancer metabolism
Materials and Reagents
25 ml T Flasks NC vent cap (SARSTEDT AG & Co, catalog number: 83.1810.002 )
Portable container for liquid nitrogen (Nalgene plastic dewar) (Thermo Fisher Scientific, catalog number: S34074C )
Sterile syringes and needles (Thermo Fisher Scientific, catalog number: 10142534 )
Disposable transfer pipets (Samco fine tip, 1 ml) (VWR International, catalog number: 16001192 )
Aerosol barrier tips for 1 ml and 1-200 μl (Thermo Fisher Scientific, catalog number: 02-707-42 )
Screw cap plastic vials (2 ml) color coded caps (yellow, blue, green and red) (USA Scientific, catalog number: 1420-8706 , 1420-8701 , 1420-8702 and 1420-9704 )
Snap top plastic vials (1.5 ml) (USA Scientific, catalog number: 1615-5510 )
15 ml Falcon tubes (SARSTEDT AG & Co, catalog number: 62.554.205 )
Dialyzed, sterile filtered fetal bovine serum (FBS) (free of serum metabolites),10-12 kDa (Atlanta Biochemical, catalog number: S12650 )
Tracer examples: 13C6-glucose, 13C2-1, 2-glucose, 13C5,15N2-glutamine
Sources: 13C6-glucose/D-glucose ([U-13C], 99%) (Cambridge Isotope Laboratories, catalog number: CLM-1396-CTM), 13C2-1, 2 glucose/D-glucose (1, 2-13C2, 99%) (Cambridge Isotope Laboratories, catalog number: CLM-504), 13C5, 15N2-glutamine/ L-glutamine (13C5, 99%; 15N2, 99%) (Cambridge Isotope Laboratories, catalog number: CNLM-1275 ) or
Isotec: D-13C6-glucose (Sigma-Aldrich, catalog number: 660663 ), 13C2-1, 2 glucose (Sigma-Aldrich, catalog number: 661422 ), L-Glutamine-13C5, 15N2 (Sigma-Aldrich, catalog number: 607983 )
Penicillin + Streptomycin: GE Healthcare PEN/STREP/FUNGIZONE 100 ml (Thermo Fisher Scientific, catalog number: SV3007901 )
ProtocolTM 10% Neutral buffered formalin (Thermo Fisher Scientific, catalog number: 032-059 )
25% (w/v) sterile filtered 13C glucose (0.2 μm) in PBS (Stock solution can be frozen, aliquoted, and stored at 4 °C)
Liquid nitrogen
70% ethanol (v/v)
60% acetonitrile in water (v/v) (Sigma-Aldrich, catalog number: L010400 )
Sodium chloride (NaCl) (Thermo Fisher Scientific, catalog number: S271-1 )
Potassium chloride (KCl) (Sigma-Aldrich, catalog number: P9541 )
Sodium phosphate dibasic (Na2HPO4) (Sigma-Aldrich, catalog number: S0876 )
Potassium phosphate monobasic (KH2PO4) (Sigma-Aldrich, catalog number: P9791 )
Amino acids: Glycine, L-Arginine, L-Asparagine, L-Aspartic acid, L-Cystine 2HCl, L-Glutamic Acid, L-Glutamine, L-Histidine, L-Hydroxyproline, L-Isoleucine, L-Leucine, L-Lysine hydrochloride, L-Methionine, L-Phenylalanine, L-Proline, L-Serine, L-Threonine, L-Tryptophan, L-Tyrosine disodium salt dehydrate, L-Valine
Vitamins: Biotin, Choline chloride, D-Calcium pantothenate, Folic Acid, i-Inositol, Niacinamide, Para-Aminobenzoic Acid, Pyridoxine hydrochloride, Riboflavin, Thiamine hydrochloride, Vitamin B12
Calcium nitrate [Ca(NO3)2.4H2O]
Magnesium sulfate (MgSO4)
Glutathione (reduced)
Phenol Red
Relevant medium (e.g. DMEM, RPMI, other defined medium) which lacks the tracer of interest:
a.Dulbecco′s Modified Eagle′s Medium (DMEM) is a powder formula, free of glucose, glutamine, pyruvate bicarbonate, and phenol red, giving considerable flexibility in formulation for SIRM studies (Sigma-Aldrich, catalog number: D5030 ) (see Recipes)
b.RPMI 1640 is a liquid medium free of glucose and glutamine, but contains bicarbonate and phenol red (MP Biomedicals, catalog number: 091646854 ) (see Recipes)
0.2 µm sterile filtered Phosphate Buffered Saline (PBS) (see Recipes)
Medium composition for 0.2% 13C6-glucose, 2 mM 12C-Gln (100 ml) (see Recipes)
Medium composition for 0.2% 12C glucose, 2 mM 13C5, 15N2-Gln (100 ml) (see Recipes)
Equipment
Class II Biosafety Hood
Trigas incubator with oxygen sensor and CO2 sensor (Thermo Fisher Scientific, model: Hera cell 150i )
Sterilized rocker (Rotoshake Genie) (Scientific Industries, model: SI-1100 )
Liquid nitrogen freezer for storage
K2-EDTA vacutainers (“purple top”) (BD, catalog number: 366643 )
Refrigerated centrifuge with swing out rotor that can accept vacutainers [e.g. Sorvall Legend X1R (Thermo Fisher Scientific, catalog number: 75-004-261 ) with a rotor (Thermo Fisher Scientific, catalog number: 75003181 )]
Pipettors (variable size ranges) (USA Scientific ErgoOne)
Weck Knife/Dermatome (George Tiemann & Co., catalog number: 222-5-523 )
Weigh boats (Thermo Fisher Scientific, catalog number: 08732113 and 08732115 )
4-place balance (Thermo Fisher Scientific, Mettler-Toledo, catalog number: 0133525 )
Ice bucket (Thermo Fisher Scientific, catalog number: 02-591-44 )
Sharp dissecting scissors (Thermo Fisher Scientific, catalog number: 08940 )
Excelta™ Plastic Tweezers (Thermo Fisher Scientific, catalog number: 17-456-066 )
Digital camera
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Fan, T. W., Lane, A. N. and Higashi, R. M. (2016). Stable Isotope Resolved Metabolomics Studies in ex vivo TIssue Slices. Bio-protocol 6(3): e1730. DOI: 10.21769/BioProtoc.1730.
Download Citation in RIS Format
Category
Cancer Biology > Cellular energetics > Tumor microenvironment
Cancer Biology > Cellular energetics > Animal models
Cell Biology > Cell metabolism > Carbohydrate
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,731 | https://bio-protocol.org/exchange/protocoldetail?id=1731&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
In vitro Flow Adhesion Assay for Analyzing Shear-resistant Adhesion of Metastatic Cancer Cells to Endothelial Cells
SK Shin-Ae Kang
SB Sandra Bajana
TT Takemi Tanaka
Published: Vol 6, Iss 4, Feb 20, 2016
DOI: 10.21769/BioProtoc.1731 Views: 13121
Edited by: Lee-Hwa Tai
Reviewed by: Shannon Ruppert
Original Research Article:
The authors used this protocol in Jun 2015
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jun 2015
Abstract
Hematogenous metastasis is a primary cause of mortality from metastatic cancer. The shear-resistant adhesion of circulating tumor cells to the vascular endothelial cell surface under blood flow is an essential step in cell extravasation and further tissue invasion. This is similar to a process exploited by leukocytes for adhesion to inflamed blood vessels (leukocyte mimicry). The shear resistant adhesion is mediated by high affinity interactions between endothelial adhesion molecules and their counter receptor ligand expressed on circulating cells. Thus, weak interaction results in a rapid detachment of circulating cells from endothelium. Despite the critical role of vascular adhesion of cancer cells in hematogenous metastasis, our knowledge regarding this process has been limited due to the difficulty of mimicking dynamic flow conditions in vitro. In order to gain better insight into the shear-resistant adhesion of cancer cells to the endothelium, we developed a protocol for measuring the shear resistant adhesion of circulating tumor cells to endothelial cells under physiologic flow conditions by adapting a well established flow adhesion assay for inflammatory cells. This technique is useful to evaluate 1) the shear resistant adhesion competency of cancer cells and 2) the endothelial adhesion molecules necessary to support cancer cell adhesion (Kang et al., 2015).
Materials and Reagents
Flow chamber: µ-Slide I 0.4 Luer (ibidi, catalog number: 80176 )
Figure 1. Flow chamber: µ-Slide I 0.4 Luer (modified the picture from www.ibidi.com)
Serial Connector for µ-Slides (ibidi, catalog number: 10830 )
Syringe (10 ml, 30 ml)
Silicone Tubing (0.8 mm ID) (ibidi, catalog number: 10841 )
50 ml tube with line connection (SARSTEDT AG & Co, catalog number: 60.596 )
Y tube fitting (ibidi, catalog number: 10828 )
Weight (SP Scienceware, Bel Art, catalog number: F183240000 )
Hose clips (ibidi, catalog number: 10821 )
Human microvascular endothelial cells (HMVEC) (Lonza, catalog number: CC2543 )
Cancer cells
Cell line or primary cancer cells [e.g., human breast cancer cell line, MDA-MB-231 (ATCC, catalog number: CRM-HTB-26 )]
Endothelial basal medium-2 (Lonza, catalog number: CC-3156 )
EGM SingleQuot Kit (Lonza, catalog number: CC-4133 )
Dulbecco's Modification of Eagle's Medium (DMEM) (Thermo Fisher Scientific, Mediatech, Cellgro®, catalog number: 13-013 ) supplemented with 1% fetal bovine serum (FBS)
Heat Inactivated Fetal Bovine Serum (FBS) (Life Technologies, catalog number: 10082-147 )
Note: Currently, it is “Thermo Fisher Scientific, GibcoTM, catalog number: 10082-147”.
Glutamax (Life Technologies, catalog number: 35050 )
Note: Currently, it is “Thermo Fisher Scientific, GibcoTM, catalog number: 35050 ”.
Antibiotic-antimycotic (Life Technologies, catalog number: 15240 )
Note: Currently, it is “Thermo Fisher Scientific, GibcoTM, catalog number: 15240 ”.
Collagen I, Rat Tail (Life Technologies, catalog number: A1048301 )
Note: Currently, it is “Thermo Fisher Scientific, GibcoTM, catalog number: A1048301”.
Fibronectin from human plasma (Sigma-Aldrich, catalog number: F0895 )
Cell culture medium for HMVEC (see Recipes)
Cell culture medium for Cancer cells (see Recipes)
Equipment
Glass beaker (1,000 ml)
Stir bar
37 °C, 5% CO2 cell culture incubator (NuAire, model: In-VitroCell ES NU-5800 )
Cell culture centrifuge (Eppendorf, model: 5702 )
Inverted Microscope with camera (Nikon, model: Eclipse TS100 )
Camera (McCrone, model: MicroPublisher 3.3 RTV )
KDS LegatoTM 200 syringe pump (KD Scientific)
Figure 2. KDS LegatoTM 200 syringe pump (modified picture from http://www.kdscientific.com/products/pumps/Legato200.asp)
Ibidi Heating System [Ibidi Temperature Controller ©ibidimodel (ibidi, model: Version 3.3)]
Figure 3. Ibidi Heating System (modified picture from http://ibidi.com/xtproducts/en/Instruments-Accessories/Heating-Incubation-Systems/ibidi-Heating-System-Universal-Fit)
Magnetic hot stir (Thermo Fisher Scientific, catalog number: 200-48SH)
Thermometer (Thermo Fisher Scientific, catalog number: 13-201-695 )
Level (Stanley Black & Decker, catalog number: 43-511)
Software
Q-capture pro 7.0 (Qimaging)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Kang, S., Bajana, S. and Tanaka, T. (2016). In vitro Flow Adhesion Assay for Analyzing Shear-resistant Adhesion of Metastatic Cancer Cells to Endothelial Cells. Bio-protocol 6(4): e1731. DOI: 10.21769/BioProtoc.1731.
Download Citation in RIS Format
Category
Cancer Biology > Invasion & metastasis > Cell biology assays
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,732 | https://bio-protocol.org/exchange/protocoldetail?id=1732&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Immunofluorescent Staining of Mouse Intestinal Stem Cells
Kevin P. O’Rourke
LD Lukas E Dow
SL Scott W Lowe
Published: Vol 6, Iss 4, Feb 20, 2016
DOI: 10.21769/BioProtoc.1732 Views: 32786
Edited by: Xuecai Ge
Original Research Article:
The authors used this protocol in Jun 2015
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jun 2015
Abstract
Immunofluorescent staining of organoids can be performed to visualize molecular markers of cell behavior. For example, cell proliferation marked by incorporation of nucleotide (EdU), or to observe markers of intestinal differentiation including paneth cells, goblet cells, or enterocytes (see Figure 1). In this protocol we detail a method to fix, permeabilize, stain and mount intestinal organoids for analysis by immunofluorescent confocal microscopy.
Figure 1. A schematic depicting a crypt-villus forming organoid, and visualization of Paneth cells by immunofluorescence staining. Left: Small intestinal organoids grow as crypt-villus structures that contain all of the multiple differentiated lineages of the intestine. Right: Immunofluorescent staining can be used to visualize individual cell types in the organoid. Here paneth cells are visualized by staining for lysozyme (“Lyso,” Green), which reveals Paneth cells located at crypt bases. F-Actin (Red) reveals crypt structure at the apical surface of the epithelium, and DAPI (Blue) reveals cell nuclei. Scale bar is 25 μm.
Keywords: Immunofluoresescence Staining Mouse Intestinal stem cells IF
Materials and Reagents
8 well chamber slides (Thermo Fisher Scientific, Lab-TekTM, catalog number: 154532 )
Cover Glass, Rectangular #1 (24 x 50 mm, 0.12-0.16 mm) (Corning, catalog number: 2975-245 )
Primary antibodies
Rabbit anti-KRT20 (1:200) (Cell Signaling Technology, catalog number: 13063 )
Rabbit anti-Lysozyme (1:200) (Dako, catalog number: EC 3.2.1.17 )
Rabbit anti-Muc2 (1:200)/ VHL Antibody (M-20) (Santa Cruz Biotechnology, catalog number: H-300, sc-1534 )
Villin Antibody (C-19) (1:200) (Santa Cruz Biotechnology, catalog number: sc-7672 )
Secondary antibodies:
Goat Anti-rabbit 568 (1:500) (Thermo Fisher Scientific, Molecular Probes, catalog number: 11036 )
Note: Currently, it is “Thermo Fisher Scientific, NovexTM, catalog number: 11036”.
Donkey Anti-goat 594 (1:500) (Thermo Fisher Scientific, Molecular Probes, catalog number: 11058 )
Note: Currently, it is “Thermo Fisher Scientific, NovexTM, catalog number: 11058”.
Goat Anti-rat 488 (1:500) (Thermo Fisher Scientific, Molecular Probes, catalog number: a11006 )
Note: Currently, it is “Thermo Fisher Scientific, NovexTM, catalog number: a11006”.
Phosphate Buffered Saline (PBS) (Thermo Fisher Scientific, InvitrogenTM, catalog number: 10010023 )
Note: Currently, it is “Thermo Fisher Scientific, GibcoTM, catalog number: 10010023”.
Paraformaldehyde (PFA) 16% Solution, EM Grade (Electron Microscopy Sciences, catalog number: 15710-S )
Freshly prepared 4% PFA in 1x PME Buffer
ProLong Gold Antifade Mountant (Thermo Fisher Scientific, Molecular Probes, catalog number: P10144 )
Note: Currently, it is “Thermo Fisher Scientific, ProLong®, catalog number: P10144”.
Clear Nail Polish (available at local drug store)
Optional
Click-iT EdU Alexa Fluor 647 for Cell Proliferation (Thermo Fisher Scientific, Invitrogen, catalog number: C10340 )
Note: Currently, it is “Thermo Fisher Scientific, Molecular ProbesTM, catalog number: C10340”.
Alexa Fluor 647 Phalloidin (Thermo Fisher Scientific, Molecular ProbeTM, catalog number: A22287 )
BCIP/NBT Substrate Kit (Vector Laboratories, catalog number: SK-5400 )
1 μg/ml DAPI for nucleic acid staining (Sigma-Aldrich, catalog number: D9542 )
Note: Materials and equipment to grow organoids prior to fixation (see Isolation, culture, and maintenance of mouse intestinal stem cells)
Tris(hydroxymethyl)aminomethane (Sigma-Aldrich, catalog number: 252859 )
Sodium chloride (NaCl) (Sigma-Aldrich, catalog number: S9888 )
PIPES (Sigma-Aldrich, catalog number: P6757 )
Magnesium chloride (MgCl2) (Sigma-Aldrich, catalog number: M8266 )
Ethylenediaminetetraacetic acid (EDTA) (Sigma-Aldrich, catalog number: E9884 )
TritonTM X-100 (Sigma-Aldrich, catalog number: X100 )
TWEEN® 20 (Sigma-Aldrich, catalog number: P2287 )
Bovine serum albumin (BSA) (Sigma-Aldrich, catalog number: A2058 )
Tris buffered saline (TBS) (see Recipes)
10x PME buffer (see Recipes)
IF buffer (see Recipes)
Blocking solution (see Recipes)
Permeabilization solution (see Recipes)
Equipment
Benchtop Multi-Purpose Rotator (Thermo Fisher Scientific, model: 2309 )
Leica Inverted Confocal SP8 equipped with a White Light Laser, a Leica HyD Detector and the Leica Application Suite software
Software
Leica Application Suite
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：O’Rourke, K. P., Dow, L. E. and Lowe, S. W. (2016). Immunofluorescent Staining of Mouse Intestinal Stem Cells. Bio-protocol 6(4): e1732. DOI: 10.21769/BioProtoc.1732.
Download Citation in RIS Format
Category
Stem Cell > Adult stem cell > Intestinal stem cell
Cell Biology > Tissue analysis > Tissue staining
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,733 | https://bio-protocol.org/exchange/protocoldetail?id=1733&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Isolation, Culture, and Maintenance of Mouse Intestinal Stem Cells
Kevin P. O’Rourke
SA Sarah Ackerman
LD Lukas E Dow
SL Scott W Lowe
Published: Vol 6, Iss 4, Feb 20, 2016
DOI: 10.21769/BioProtoc.1733 Views: 28238
Edited by: Xuecai Ge
Original Research Article:
The authors used this protocol in Jun 2015
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jun 2015
Abstract
In this protocol we describe our modifications to a method to isolate, culture and maintain mouse intestinal stem cells as crypt-villus forming organoids. These cells, isolated either from the small or large intestine, maintain self-renewal and multilineage differentiation potential over time. This provides investigators a tool to culture wild type or transformed intestinal epithelium, and a robust assay for stem cell tissue homeostasis in vitro.
Keywords: Organoid Lgr5 Intestine Colon Stem cell
Materials and Reagents
Cover glass (Corning, catalog number: 2998075X25 )
48-Well Tissue Culture Plate (Corning, Falcon®, catalog number: 351178 )
50 ml and 15 ml Conical centrifuge tubes (Corning, Falcon®, catalog number: 352098 and 352097 )
10 ml Syringe (BD, catalog number: 309604 )
21G Needle (BD, catalog number: 305165 )
Pipette Tips
70 μM Cell Strainer (Corning, Falcon®, catalog number: 352350 )
100 μM Cell Strainer (Corning, Falcon®, catalog number: 352360 )
Mice to be harvested for this protocol must be approved for use by the Institutional Animal Care and Use Committee (IACUC) at the institution, which sponsors the laboratory research
Phosphate Buffered Saline (PBS) (Invitrogen, catalog number: 10010023 )
Note: Currently, it is “ Thermo Fisher Scientific, GibcoTM, catalog number: 10010023”.
Growth Factor Reduced Matrigel (BD, catalog number: 356230 )
Note: Currently, it is “Corning, Matrigel®, catalog number: 356230”.
Fetal Bovine Serum (Thermo Fisher Scientific, GibcoTM, catalog number: 16000-044 )
Collagenase Type IV (Worthington, catalog number: LS004188 )
Bovine Serum Albumin (Sigma-Aldrich, catalog number: A2058 )
1% BSA-PBS (sterile)
Ethylenediaminetetraacetic acid (EDTA) (Sigma-Aldrich, catalog number: E9884 )
5 mM EDTA-PBS
Recombinant DNase I, RNase Free (which is provided at 10 U/μl) (Sigma-Aldrich, catalog number: 4716728001 )
Optional: 10 μM Rho Kinase Inhibitor Y-27632, provided as a 5 mM Solution (Merck Millipore Corporation, catalog number: 68801 )
Advanced DMEM F/12 (Thermo Fisher Scientific, GibcoTM, catalog number: 12634-010 )
Streptomycin (Gibco, catalog number: 15140-22 )
N-Acetylcysteine (Sigma-Aldrich, catalog number: A9165 )
HEPES (Sigma-Aldrich, catalog number: H3375 )
EGF 50 ng/ml (Invitrogen, catalog number: PMG8043 )
Note: Currently, it is “ Thermo Fisher Scientific, GibcoTM, catalog number: PMG8043”.
Recombinant Murine EGF 50 ng/ml (Invitrogen, catalog number: PMG8043)
Recombinant Murine Noggin 50 ng/ml (Peprotech, catalog number: 250-38 )
Recombinant Human R-Spondin 1,500 ng/ml (R&D Systems, catalog number: 3474-RS-050 )
Recombinant Murine Wnt-3A 100 ng/ml (Merck Millipore Corporation, catalog number: GF-160 )
10 mM Nicotinamide (Sigma-Aldrich, catalog number: N3376 )
Intestinal basal medium (see Recipes)
Small intestinal organoid growth media (see Recipes)
Large intestinal organoid growth media (see Recipes)
Equipment
Pipettes, Pipetaid and Micro-pipettes
Dissection Forceps and Scissors (Fine Science Tools, catalog number: 11150-10 and 14058-09 )
Centrifuge 5810R (Eppendorf, model: 5810R )
Brightfield inverted Microscope
Tabletop Roller in 4 °C Room (Bibby Scientific Limited, Stuart Equipment, model: SRT9D )
37 °C, 5% CO2 cell culture incubator
Biosafety cabinet (Tissue culture hood)
For mouse sacrifice by carbon dioxide asphyxiation, a carbon dioxide source, regulated dispenser, and euthanasia chamber, must be used in accordance with approved animal use protocols at the laboratory’s sponsoring institution.
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：O’Rourke, K. P., Ackerman, S., Dow, L. E. and Lowe, S. W. (2016). Isolation, Culture, and Maintenance of Mouse Intestinal Stem Cells. Bio-protocol 6(4): e1733. DOI: 10.21769/BioProtoc.1733.
Download Citation in RIS Format
Category
Stem Cell > Adult stem cell > Intestinal stem cell
Cell Biology > Tissue analysis > Tissue isolation
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,734 | https://bio-protocol.org/exchange/protocoldetail?id=1734&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Repeated Cross-fostering Protocol as a Mouse Model of Early Environmental Instability
AL Alessandra Luchetti
MB Marco Battaglia
FD Francesca R. D’Amato
Published: Vol 6, Iss 4, Feb 20, 2016
DOI: 10.21769/BioProtoc.1734 Views: 8223
Edited by: Soyun Kim
Reviewed by: Zhen ShiAna Perez-Villalba
Original Research Article:
The authors used this protocol in May 2015
Download PDF
Ask a question
Favorite
Cited by
Original research article
The authors used this protocol in:
May 2015
Abstract
Early life events have a crucial role in programming the individual phenotype indeed the exposure to traumatic experiences during infancy can increase later risks for a variety of neuropsychiatric conditions, including mood and anxiety disorders. Several studies in rodents demonstrated the impact of short and long sessions of separation/isolation from caregivers in developing pups, on the behavioral and hormonal response to stress during infancy and adulthood (D’Amato et al., 1998; Meaney et al., 2000; Luchetti et al., 2015). The repeated cross-fostering (RCF) is an early manipulation carried out in mouse pups during the first four postnatal days life. Differently from other early manipulations, hypotalamic-pituitary-adrenal (HPA) axis functioning is not altered in RCF treated subjects. This manipulation is used to model human early environmental instability, a risk factor for internalizing disorders including separation anxiety disorder, panic disorder and CO2 hypersensitivity (Kendler et al., 1992; Forman and Davies, 2003; Battaglia et al., 2009).
Keywords: Cross-fostering Early environment Mother-pups bond
Materials and Reagents
Note: See Figure 1.
Figure 1. Materials and equipment. a. paper towels for cage enrichment; b. clean cage; c. hot plate; d. balance; e. latex gloves; f. tags for mum and pups identification.
Paper towels for cage enrichment
Gloves to manipulate animals (latex)
Balance
10 females (minimum number) and 5 males of the same mouse strain (we use NMRI, C57BL6 and DBA, but it is possible to use this protocol in other strains) for mating
Equipment
Note: See Figure 1.
Clean cages to isolate pregnant females and to temporarily maintain pups on the hot plate during the manipulation, as described at point 2 of "procedure step by step" (washed transparent high temperature polysufone cages 26.7 x 20.7 x 14.0 cm, with clean bedding)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
Category
Neuroscience > Behavioral neuroscience > Animal model
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,735 | https://bio-protocol.org/exchange/protocoldetail?id=1735&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Synaptoneurosome Preparation from C57BL/6 Striata
Emma Puighermanal
AB Anne Biever
EV Emmanuel Valjent
Published: Vol 6, Iss 4, Feb 20, 2016
DOI: 10.21769/BioProtoc.1735 Views: 13025
Edited by: Oneil G. Bhalala
Reviewed by: Alka MehraMartin V Kolev
Original Research Article:
The authors used this protocol in Mar 2015
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Mar 2015
Abstract
Activity-dependent local mRNA translation endows synapses to remodel their structure and function (Bramham and Wells, 2007). This process is tightly controlled by the state of phosphorylation of several components of the translational machinery including initiation factors and ribosomal proteins (Buffington et al., 2014). The present protocol describes a method to prepare striatal synaptoneurosomes, from adult mice, containing both pre- and postsynaptic elements in which the level of synaptic phospho-proteins can be quantified (Biever et al., 2015).
Keywords: Synaptoneurosome Striatum Phospho-protein
Materials and Reagents
1 ml dounce tissue grinder (Capitol scientific, Wheaton®, catalog number: 357538 )
5 ml and 60 ml syringes (BD, Plastipak, catalog number: 309647 and 300866 , respectively)
Nylon net filters 100 μm (Merck Millipore Corporation, catalog number: NY1H02500 )
Mitex membrane filter 10 μm (Merck Millipore Corporation, catalog number: LCWP02500 )
1.5 ml Eppendorf tubes (Eppendorf, catalog number: 00 30120086 )
C57BL/6 mice (≥8 weeks old, male or female) (Mus musculus)
Calcium chloride (CaCl2) (Sigma-Aldrich, catalog number: C5670 )
Sodium chloride (NaCl) (Sigma-Aldrich, catalog number: S7653 )
Potassium chloride (KCl) (Sigma-Aldrich, catalog number: P9333 )
Potassium phosphate (KH2PO4) (Sigma-Aldrich, catalog number: P3786 )
Sodium bicarbonate (NaHCO3) (Sigma-Aldrich, catalog number: 71630 )
Magnesium chloride (MgCl2) (Sigma-Aldrich, catalog number: M8266 )
D-(+)-Glucose (Sigma-Aldrich, catalog number: 67528 / G6728 )
HEPES (pH 7.4) (Sigma-Aldrich, catalog number: H3375 )
Sodium orthovanadate (Sigma-Aldrich, catalog number: S6508 )
Sodium fluorate (Sigma-Aldrich, catalog number: S7920 )
Sodium pyrophosphate decahydrate (Sigma-Aldrich, catalog number: 221368 )
Glycerol phosphate disodium salt hydrate (Sigma-Aldrich, catalog number: G6501 )
Aprotinin (Sigma-Aldrich, catalog number: A1153 )
Leupeptin hydrochloride (Sigma-Aldrich, catalog number: L0649 )
Pepstatin (Sigma-Aldrich, catalog number: P4265 )
Phenylmethylsulfonyl fluoride (Sigma-Aldrich, catalog number: 78830 )
Phospho-S845-GluR1 [Anti-phospho-GluR1 (Ser845) Antibody, clone EPR2148, rabbit monoclonal] (Merck Millipore Corporation, catalog number: 04-1073 )
Phospho-T185/Y187-ERK2 [Phospho-p44/42 MAPK (Erk1/2) (Thr202/Tyr204)] (Cell Signaling Technology, catalog number: 9101 )
Phospho-S235/236-rpS6 (Cell Signaling Technology, catalog number: 2211 )
Phospho-S209-eIF4E (Cell Signaling Technology, catalog number: 9741 )
β-actin [AC-15] (Abcam, catalog number: AB6276 )
Synaptoneurosome buffer (see Recipes)
Equipment
Swinnex filter holder (Merck Millipore Corporation, catalog number: SX0002500 )
4 ºC Eppendorf table centrifuge
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
How to cite： Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Puighermanal, E., Biever, A. and Valjent, E. (2016). Synaptoneurosome Preparation from C57BL/6 Striata. Bio-protocol 6(4): e1735. DOI: 10.21769/BioProtoc.1735.
Biever, A., Puighermanal, E., Nishi, A., David, A., Panciatici, C., Longueville, S., Xirodimas, D., Gangarossa, G., Meyuhas, O., Herve, D., Girault, J. A. and Valjent, E. (2015). PKA-dependent phosphorylation of ribosomal protein S6 does not correlate with translation efficiency in striatonigral and striatopallidal medium-sized spiny neurons. J Neurosci 35(10): 4113-4130.
Download Citation in RIS Format
Category
Neuroscience > Cellular mechanisms > Synaptic physiology
Molecular Biology > Protein > Detection
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,736 | https://bio-protocol.org/exchange/protocoldetail?id=1736&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Isolation of Nippostrongylus brasiliensis Larvae from Mouse Lungs
MC Mali Camberis
TB Tiffany Bouchery
GG Graham Le Gros
Published: Vol 6, Iss 4, Feb 20, 2016
DOI: 10.21769/BioProtoc.1736 Views: 10888
Edited by: Ivan Zanoni
Reviewed by: Hongwei Han
Original Research Article:
The authors used this protocol in May 2015
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
May 2015
Abstract
The rodent parasite Nippostrongylus brasiliensis (N. brasiliensis) models the salient features of helminth infection including skin penetration, migration from tissues to lung, maturation and egg production in the gut. As a potent activator of systemic and mucosal Th2 immune responses, Nippostrongylus brasiliensis has been extensively used to study host protective immunity and in vivo regulation of Th2 immune response. Six to eight week old C57Bl/6J, Balb/c mice or any other strains are suitable, as all are susceptible to infection. Inocula of 150-650 L3 larvae can be administered by subcutaneous injection, but for greatest consistency a dose of 550 L3 larvae is routinely used for experimental purposes. We have optimized three different protocols for the isolation of larvae from the lungs of mice infected with the L3 stage of Nippostrongylus brasiliensis. Larvae can migrate to the lung between 18-60 h post inoculation from any site in the body. The numbers of larvae appearing in the lung peaks at 48 h after inoculation and it is recommended that isolation/harvesting be performed at 48 h for greatest consistency of each harvest method:
Isolation by thermal induced migration-allows for the recovery of viable larvae but not dead or moribund larvae.
Isolation by digestion of the lung-allows for the recovery of both dead and viable larvae.
Isolation by bronchoalveolar lavage (BAL) -allows for the assessment of the number of molt 4 larvae on their way to the gut.
These protocols can be used to follow the dynamics of worm migration during infection and the effect of the host immune system on worm viability and fecundity.
Part I. Isolation by migration
Materials and Reagents
Cheesecloth cut into 8 x 8 cm squares (any fabric store)
8 x 8 cm plastic disposable weigh boats (Medi'Ray-Laboratory, Runlab Archives, catalog number: RL33102 )
50 ml centrifuge tubes (Thermo Fisher Scientific, FalconTM, catalog number: 352070 / 14-432-22 ) and corresponding racks
Disposable Pasteur pipettes (Interab Supply, catalog number: KJ619-1 )
60 x 15 mm TC dish (Thermo Fisher Scientific, FalconTM, catalog number: 353002 / 08-772B )
N. brasiliensis infected mice (Camberis et al., 2003)
70% Ethanol
PBS (DPBS, no calcium, no magnesium) (Thermo Fisher Scientific, GibcoTM, catalog number: 14190-144 )
Equipment
Iris scissors (Medicon, catalog number: 202.20.11 )
Forceps (Medicon, catalog number 07.55.20 )
Water-bath set at 37 °C (Biolab, model: Grant SUB Aqua 18 ) with water set to a depth not exceeding 2 cm from the top of the 50 ml tubes
Stereo-microscope (Olympus, model: SZX16 )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Camberis, M., Bouchery, T. and Gros, G. L. (2016). Isolation of Nippostrongylus brasiliensis Larvae from Mouse Lungs. Bio-protocol 6(4): e1736. DOI: 10.21769/BioProtoc.1736.
Download Citation in RIS Format
Category
Immunology > Animal model > Mouse
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,737 | https://bio-protocol.org/exchange/protocoldetail?id=1737&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Dye Labeling of Live Nippostrongylus brasiliensis Larvae for Visualization in Host Tissue
TB Tiffany Bouchery
MC Mali Camberis
GG Graham Le Gros
Published: Vol 6, Iss 4, Feb 20, 2016
DOI: 10.21769/BioProtoc.1737 Views: 8428
Edited by: Ivan Zanoni
Reviewed by: Hongwei Han
Original Research Article:
The authors used this protocol in May 2015
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
May 2015
Abstract
Visualization of the interaction between parasitic nematodes and their host enables a better understanding of the development of the nematode during the infectious stages of its life cycle and of the effects of host response on nematode integrity in tissues. Appropriate live imaging of these nematode/host interactions, to date has been hindered by the lack of appropriate molecular tools or efficient labeling agents. Here, we present techniques for the live labeling of the nematode parasite Nippostrongylus brasiliensis (N. brasiliensis) that allows visualization of the parasite in the mouse host for up to 24 h. The external sheath can be labeled with CFSE allowing infective larvae to be identified and followed until the stage of exsheathment. The internal labeling of infective parasites can be performed by ingestion of NY microspheres. The worms can continue to be identified for up to 24 h following exsheathment. This should be applicable to other parasitic nematodes.
Keywords: Nippostrongylus brasiliensis Nematode Hookworm Intravital imaging Microscopy
Materials and Reagents
200 μl pipette tips (Corning, Axygen®, catalog number: T-300-L-R-S )
10 μl pipette tips (Corning, Axygen®, catalog number: T-300-R-S )
1 ml pipette tips (Corning, Axygen®, catalog number: T-1000-C-L-R-S )
1.7 ml MaxyClear Snaplock Microcentrifuge Tube (Corning, Axygen®, catalog number: MCT-175-C )
24-well Tissue culture plate (Thermo Fisher Scientific, FalconTM, catalog number: 353047/08-772-1 )
Insulin syringe 29 G, 0.3 ml ultrafine (BD, catalog number: 320431 )
15 ml Conical Centrifuge Tubes (Thermo Fisher Scientific, FalconTM, catalog number: 352096 / 14-959-49B )
Microscope slides (Thermo Fisher Scientific, catalog number: LBS2951RC )
Petri dish, 60 mm x 15 mm (In Vitro Technologies, catalog number: FAL351007 )
Tin-foil (any grocery store)
N. brasiliensis L3 infective larvae (iL3) (Camberis et al., 2003)
Note: Camberis et al. (2003) provides a detailed review on the preparation of N. brasiliensis.
Note: There are several labs that maintain the life cycle and can be contacted through their publication address.
C57Bl/6J Mouse (or strain of choice)
Fluoresbrite® YO Carboxylate Microspheres 0.50 µm (Polysciences, catalog number: 18720 )
5(6)-CFDA, SE; CFSE (5-(and-6)-Carboxyfluorescein Diacetate, Succinimidyl Ester), mixed isomers (Life Technologies, Molecular ProbesTM, catalog number: C1157 )
Note: Currently, it is “Thermo Fisher Scientific, Molecular ProbesTM, catalog number: C1157”.
DMEM, high glucose, pyruvate (Life Technologies, GibcoTM, catalog number: 11995-065 )
Note: Currently, it is “Thermo Fisher Scientific, GibcoTM, catalog number: 11995-065”.
PBS (DPBS, no calcium, no magnesium) (Life Technologies, GibcoTM, catalog number: 14190-144 )
Note: Currently, it is “Thermo Fisher Scientific, GibcoTM, catalog number: 14190-144”.
Penicillin/Streptomicin 10,000 U/ml (Life Technologies, GibcoTM, catalog number: 15140-122 )
Note: Currently, it is “Thermo Fisher Scientific, GibcoTM, catalog number: 15140-122”.
Gentamicin solution 10 mg/ml (Sigma-Aldrich, catalog number: G1272 )
Fetal Calf Serum, qualified, US origin (Life Technologies, GibcoTM, catalog number: 26140-079 )
Note: Currently, it is “Thermo Fisher Scientific, GibcoTM, catalog number: 26140-079”.
TWEEN® 20 (Sigma-Aldrich, catalog number: P2287 )
Dimethyl sulfoxide (DMSO) (Sigma-Aldrich, catalog number: D2650 )
Wash solution I (see Recipes)
Wash solution II (see Recipes)
Culture Solution (see Recipes)
CFSE (see Recipes)
Equipment
Stereo-microscope with fluorescence capabilities (Olympus, model: SZX16 )
Confocal microscope for detailed analysis (Olympus FV1200 Scanning Laser Confocal Microscope) (if required)
HeraCELL 150 CO2 Incubator set at 37 °C, 5% CO2 (Thermo Fisher Scientific, model: NC0689918 )
Pipettes (P10, P200 and P1000) (Gilson)
Iris scissors (Medicon, catalog number: 202.20.11 )
Forceps (Medicon, catalog number: 07.55.20 )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Bouchery, T., Camberis, M. and Gros, G. L. (2016). Dye Labeling of Live Nippostrongylus brasiliensis Larvae for Visualization in Host Tissue. Bio-protocol 6(4): e1737. DOI: 10.21769/BioProtoc.1737.
Download Citation in RIS Format
Category
Immunology > Animal model > Mouse
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,738 | https://bio-protocol.org/exchange/protocoldetail?id=1738&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
RAB21 Activity Assay Using GST-fused APPL1
Steve Jean
Amy A. Kiger
Published: Vol 6, Iss 4, Feb 20, 2016
DOI: 10.21769/BioProtoc.1738 Views: 7821
Edited by: Ralph Bottcher
Reviewed by: Vaibhav B Shah
Original Research Article:
The authors used this protocol in Mar 2015
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Mar 2015
Abstract
The Rab family of small GTPases are essential regulators of membrane trafficking events. As with other small GTPase families, Rab GTPases cycle between an inactive GDP- bound state and an active GTP-bound state. Guanine nucleotide exchange factors (GEFs) promote Rab activation with the exchange of bound GDP for GTP, while GTPase-activating proteins (GAPs) regulate Rab inactivation with GTP hydrolysis. Numerous methods have been established to monitor the activation status of Rab GTPases. Of those, FRET-based methods are used to identify when and where a Rab GTPase is activated in cells. Unfortunately, the generation of such probes is complex, and only a limited number of Rabs have been probed this way. Biochemical purification of activated Rabs from cell or tissue extracts is easily achievable through the use of a known Rab effector domain to pull down a specific GTP-bound Rab form. Although this method is not ideal for detailed subcellular localization, it can offer temporal resolution of Rab activity. The identification of a growing number of specific effectors now allows tests for activation levels of many Rab GTPases in specific conditions. Here, we described an affinity purification approach using GST fused APPL1 (a known RAB21 effector) to test RAB21 activation in mammalian cells. This method was successfully used to assay changes in RAB21 activation status under nutrient rich versus starved conditions and to test the requirement of the MTMR13 RAB21 GEF in this process.
Keywords: Membrane trafficking Rab GTPase Autophagy
Materials and Reagents
50 ml conical tube (Sarstedt AG & CO, catalog number: 62.547.004 )
100 mm Tissue Culture Dish (Corning, catalog number: 430167 )
0.22 µm filtering unit (Genesee Scientific Corporation, catalog number: 25-227 )
Cell lifter (Corning, catalog number: 3008 )
Escherichia coli BL21 (New England Biolabs, catalog number: C2530H )
pGEX-5X-3 (GE Healthcare, catalog number: 27-4586-01 )
pGEX5X3-Happl1 (aa 5-419) (self-made) (Jean et al., 2015)
pAcEGFP-C1 vector (Clontech, catalog number: 632470 )
pEGFP-C1:RAB21 wild type [human RAB21 cloned in pAcEGFP-C1 (this construct was used to generate the stable HeLa M cell line)] (self-made) (Jean et al., 2015)
EGFP:RAB21wt (wildtype) stably-transfected HeLa M cells (self-made) (Jean et al., 2015)
Isopropyl β-D-1-thiogalactopyranoside (IPTG) (Biopioneer, catalog number: c0012 )
Ampicillin Sodium Salt (Crystalline Powder) (Thermo Fisher Scientific, catalog number: BP176025 )
BD BactoTM Tryptone (Thermo Fisher Scientific, catalog number: DF0123173 )
Yeast Extract (Thermo Fisher Scientific, catalog number: 212750 )
Glutathione Sepharose 4B beads (GE Healthcare, catalog number: 17-0756-01 )
Protease inhibitor cocktail (Sigma-Aldrich, catalog number: P8340-5 )
Fetal Bovine Serum (Sigma-Aldrich, catalog number: F2442-500 ml )
Penicillin-Streptomycin solution (Life Technologies, catalog number: 15140-122 )
Note: Currently, it is “Thermo Fisher Scientific, GibcoTM, catalog number: 15140-122”.
Trypsin-EDTA (0.25%), phenol red (Life Technologies, catalog number: 25200-056 )
Note: Currently, it is “Thermo Fisher Scientific, GibcoTM, catalog number: 25200-056”.
0.4% Trypan-Blue (Life Technologies, InvitrogenTM, catalog number: 15250-061 )
Note: Currently, it is “Thermo Fisher Scientific, GibcoTM, catalog number: 15250-061”.
Guanosine 5’-triphosphate sodium salt hydrate (Sigma-Aldrich, catalog number: G8877-25 mg )
0.5 M liquid EDTA (Cell grow, catalog number: 45001-122 )
Note: Currently, it is “VWR International, catalog number: 45001-122 ”.
Earl’s Balanced Salt Solution (with sodium bicarbonate, without phenol red liquid, sterile-filtered) (Sigma-Aldrich, catalog number: E3024-500 ml )
Dithiothreitol (VWR International, catalog number: IB21040 )
HEPES (Thermo Fisher Scientific, Biotech, catalog number: BP310-100 )
IGEPAL CA-630 (Sigma-Aldrich, catalog number: I8896-100 ml )
Glycerol (Thermo Fisher Scientific, catalog number: BP229-1 )
Magnesium Chloride Hexahydrate (MgCl2.6H2O) (Thermo Fisher Scientific, catalog number: BP214-500 )
Sodium orthovanadate (Na3VO4) (Sigma-Aldrich, catalog number: S6508-10 g )
Triton X-100 (Sigma-Aldrich, catalog number: X100-500 ml )
Sodium Chloride (NaCl) (Thermo Fisher Scientific, catalog number: S671-3 )
Potassium Chloride (KCl) (VWR International, catalog number: BDH9258-500 g )
Sodium Phosphate Dibasic Anhydrous (Na2HPO4) (Thermo Fisher Scientific, catalog number: S374500 )
Potassium Phosphate Monobasic (KH2PO4) (Thermo Fisher Scientific, catalog number: P285-S500 )
Dubelcco Modified Eagle Medium with High glucose with 4 mM L-Glutamine and sodium pyruvate (GE Healthcare, HycloneTM, catalog number: SH30243.FS ) (see Recipes for complete DMEM)
Anti-GFP (B2) antibody (Santa Cruz Biotechnology, catalog number: sc-9996 )
Luria Broth (see Recipes)
LB/ampicillin (see Recipes)
Complete DMEM (see Recipes)
1x Phosphate Buffer Saline (PBS) (see Recipes)
1 M HEPES (pH 7.5) (see Recipes)
5 M NaCl (see Recipes)
1 M MgCl2 (see Recipes)
0.2 M Sodium Orthovanadate (see Recipes)
25 mM GTP (see Recipes)
Modified Magnesium Lysis Buffer (MLB) (see Recipes)
Equipment
Pipettes 10 μl, 100 μl and 1,000 μl (Eppendorf, catalog numbers: 3120000020 , 3120000046 and 31200000623 )
Sonifier® cell disrupters (VWR International, catalog number: CA33995-320 )
37 °C shaker [similar to New Brunswick Excella E25 (Eppendorf, New Brunswick Scientific, catalog number: M1353-0002 )]
30 °C shaker [similar to New Brunswick Excella E25 (Eppendorf, New Brunswick Scientific, catalog number: M1353-0002 )]
Tissue culture biosafety cabinet [similar to Thermo Scientific 1300 Series Class II (Thermo Fisher Scientific, catalog number: 1323 )]
Hemacytometer (VWR International, catalog number: 100498-470 )
Centrifuge (Eppendorf, catalog number: 5804R )
Table top centrifuge (Eppendorf, catalog number: 5415D )
Rotating wheel (Barnstead Thermolyne Lab Quake Shaker Rotisserie)
Sonicator, Branson sonifier S250A Analog Ultrasonic Cell Disruptor (Thermo Fisher Scientific, catalog number: 22309782 )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
How to cite： Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Jean, S. and Kiger, A. A. (2016). RAB21 Activity Assay Using GST-fused APPL1. Bio-protocol 6(4): e1738. DOI: 10.21769/BioProtoc.1738.
Jean, S., Cox, S., Nassari, S. and Kiger, A. A. (2015). Starvation-induced MTMR13 and RAB21 activity regulates VAMP8 to promote autophagosome-lysosome fusion. EMBO Rep 16(3): 297-311.
Download Citation in RIS Format
Category
Biochemistry > Protein > Activity
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,739 | https://bio-protocol.org/exchange/protocoldetail?id=1739&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
VAMP8-3xHA Uptake Assay in HeLa Cells
Steve Jean
Amy A. Kiger
Published: Vol 6, Iss 4, Feb 20, 2016
DOI: 10.21769/BioProtoc.1739 Views: 7684
Edited by: Ralph Bottcher
Reviewed by: Vaibhav B Shah
Original Research Article:
The authors used this protocol in Mar 2015
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Mar 2015
Abstract
Transmembrane proteins are rarely exclusively localized to a specific vesicle or an organelle. Most transmembrane proteins undergo complicated trafficking routes. Thus, transmembrane proteins are under constant flux, and at steady state, found on a variety of vesicles or organelles. This characteristic makes the study of their trafficking routes complex, since at any given moment, different molecules are often being trafficked in opposing directions. Pulse-chase experiments can temporally track a specific pool of a transmembrane protein of interest, allowing for the kinetic description of its trafficking route. This type of technique has been used extensively to follow a large array of plasma membrane localized proteins (Diril et al., 2006; Jean et al., 2010). Here, we describe a method that allows the study of VAMP8 trafficking from the plasma membrane to endolysosomal compartments. This method was used to describe a role for MTMR13 and RAB21 in the regulation of VAMP8 trafficking to endolysosomes (Jean et al., 2015).
Keywords: Membrane trafficking Endosomal sorting Autophagy
Materials and Reagents
Costar® 24 Well Clear TC-Treated Well Plates (Corning, catalog number: 3526 )
#1.5 round glass coverslip (Ted Pella, catalog number: 260368 )
100 mm Tissue Culture Dish (Corning, catalog number: 430167 )
0.22 µm filtering unit (Genesee Scientific Corporation, catalog number: 25-227 )
HeLa cells (ATCC, catalog number: CCL-2 )
JetPRIME (Polyplus-transfection, catalog number: 114-07 )
pCDNA3-VAMP8-3xHA expression plasmid (self-made) (Jean et al., 2015)
Dulbecco’s Modified Eagle Medium with High glucose with 4 mM L-Glutamine and sodium pyruvate (GE Healthcare, HycloneTM, catalog number: SH30243.FS ) (see Recipes for complete DMEM)
Fetal Bovine Serum (Sigma-Aldrich, catalog number: F2442-500 ml )
Penicillin-Streptomycin solution (Life Technologies, catalog number: 15140-122 )
Note: Currently, it is “Thermo Fisher Scientific, GibcoTM, catalog number: 15140-122”.
Trypsin-EDTA (0.25%) (Life Technologies, catalog number: 25200-056 )
Note: Currently, it is “Thermo Fisher Scientific, GibcoTM, catalog number: 25200-056”.
0.4% Trypan-Blue (Life Technologies, catalog number: 15250-061 )
Note: Currently, it is “Thermo Fisher Scientific, GibcoTM, catalog number: 15250-061”.
Rabbit anti-HA antibody (Abcam, catalog number: ab9110 )
Earl’s Balanced Salt Solution (with sodium bicarbonate, without phenol red, liquid, sterile- filtered) (Sigma-Aldrich, catalog number: E3024-500 ml )
Bovine Serum Albumin (Fraction V, Heat shock treated) (Thermo Fisher Scientific, catalog number: BP1600-100 )
Sodium Chloride (NaCl) (Thermo Fisher Scientific, catalog number: S671-3 )
Potassium Chloride (KCl) (VWR International, catalog number: BDH9258-500 g )
Sodium Phosphate Dibasic Anhydrous (Na2HPO4) (Thermo Fisher Scientific, catalog number: S374500 )
Potassium Phosphate Monobasic (KH2PO4) (Thermo Fisher Scientific, catalog number: P285-S500 )
Paraformaldehyde (Thermo Fisher Scientific, catalog number: AC41678-5000 )
Goat Serum (Life Technologies, catalog number: 16210-064 )
Note: Currently, it is “Thermo Fisher Scientific, GibcoTM, catalog number: 16210-064”.
Triton X-100 (Sigma-Aldrich, catalog number: X100-500 ml )
Mouse anti-human Lamp1 (Developmental Studies Hybridoma Bank, catalog number: H4A3 )
Mouse anti-EEA1 (BD Biosciences, catalog number: 610457 )
Goat anti-Mouse IgG (H+L) Secondary Antibody, Alexa Fluor® 488 conjugate (Life Technologies, catalog number: A-11029 )
Note: Currently, it is “Thermo Fisher Scientific, InvitrogenTM, catalog number: A-11029”.
Goat anti-Rabbit IgG (H+L) Secondary Antibody, Alexa Fluor® 546 conjugate (Life Technologies, catalog number: A11035 )
Note: Currently, it is “Thermo Fisher Scientific, InvitrogenTM, catalog number: A11035”.
[4’, 6-Diamidino-2-Phenylindole, Dihydrochloride] (DAPI) (Life Technologies, catalog number: D1306 )
Note: Currently, it is “Thermo Fisher Scientific, Molecular ProbesTM, catalog number: D1306”.
FluorSave reagent (Merck Millipore Corporation, Calbiochem®, catalog number: 345789 )
Complete DMEM (see Recipes)
1x Phosphate Buffer Saline (PBS) (see Recipes)
4% Paraformaldehyde solution (see Recipes)
Blocking buffer (see Recipes)
Antibody incubation buffer (see Recipes)
Equipment
37 °C, 5% CO2 cell culture incubator [similar to Thermo Scientific Heracell VIOS 160i CO2 incubator (Thermo Fisher Scientific, catalog number: 51030285 )]
Tissue culture biosafety cabinet [similar to Thermo Scientific 1300 Series Class II (Thermo Fisher Scientific, catalog number: 1323)]
Hemacytometer (VWR International, catalog number: 100498-470 )
Pipettes 10 μl, 100 μl and 1,000 μl (Eppendorf, catalog numbers: 3120000020 , 3120000046 and 31200000623 )
Vacuum Flask (self-made)
Note: Required to remove media from the 24 well plates during the immunofluorescence protocol.
Microcentrifuge (Eppendorf, catalog number: 5415D )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
How to cite： Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Jean, S. and Kiger, A. A. (2016). VAMP8-3xHA Uptake Assay in HeLa Cells. Bio-protocol 6(4): e1739. DOI: 10.21769/BioProtoc.1739.
Jean, S., Cox, S., Nassari, S. and Kiger, A. A. (2015). Starvation-induced MTMR13 and RAB21 activity regulates VAMP8 to promote autophagosome-lysosome fusion. EMBO Rep 16(3): 297-311.
Download Citation in RIS Format
Category
Cell Biology > Cell-based analysis > Transport
Cell Biology > Cell imaging > Confocal microscopy
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
174 | https://bio-protocol.org/exchange/protocoldetail?id=174&type=1 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Crosslinking and Immunoprecipitation in Zebrafish
LJ Lili Jing
Published: Jan 20, 2012
DOI: 10.21769/BioProtoc.174 Views: 14445
Download PDF
Ask a question
Favorite
Cited by
Abstract
Immunoprecipitation (IP) is a routine method to detect protein binding and interactions. But the weak binding between two proteins is often hard to detect during regular IP procedure. This protocol offers a crossliking and IP combination method to detect weak binding of proteins in zebrafish embryos.
Materials and Reagents
NaCl
KCl
CaCl2
Tris
EDTA
Glycerol
Triton X-100
TBST
Glycine
NP-40
Na deoxycholate
SDS
DTSSP (Thermo Fisher Scientific, catalog number: 21578 )
HEPES (Life Technologies, Invitrogen™, catalog number: 15630 )
Protease inhibitors (Sigma-Aldrich, catalog number: P2714 )
Anti-HA affinity matrix (Roche Diagnostics, catalog number: 11815016001 )
Anti-FLAG M2 affinity gel (Sigma-Aldrich, catalog number: A2220 )
Modified Ringer’s solution (see Recipes)
Lysis buffer (see Recipes)
RIPA (see Recipes)
Wash buffer (see Recipes)
Equipment
Kontes tubes
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2012 The Authors; exclusive licensee Bio-protocol LLC.
Category
Biochemistry > Protein > Immunodetection
Biochemistry > Protein > Interaction
Biochemistry > Protein > Interaction
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,740 | https://bio-protocol.org/exchange/protocoldetail?id=1740&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
A Novel Task for Studying Memory of Occasional Events in Rats
Marina Allerborn*
Alexandra Gros*
BM Belkacem Messaoudi
DG Damien Gervasoni
SG Samuel Garcia
MT Marc Thevenet
SL Serge Laroche
Alexandra Veyrac
Nadine Ravel
*Contributed equally to this work
Published: Vol 6, Iss 5, Mar 5, 2016
DOI: 10.21769/BioProtoc.1740 Views: 7965
Edited by: Soyun Kim
Reviewed by: Manuel SarmientoEdgar Soria-Gomez
Original Research Article:
The authors used this protocol in May 2015
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
May 2015
Abstract
Episodic memory has been defined in humans as the conscious recollection of unique personal past experiences often occurring singly during daily life, including remembrance of what happened, where and when it happened (Tulving, 1972). Here, we propose and describe in details a novel protocol we recently used to test the ability of rats to form and recollect episodic-like memory of previously encountered occasional episodes (Veyrac et al., 2015). During these episodes, the animals are briefly exposed to sets of specific odor–drink associations (what happened) encountered in specific locations (where it happened) within different multisensory enriched environments (in which context/occasion it happened). Memory of the episodes can be tested at relatively short (24 h) or much longer (24 d) delays in either a low or high interfering retrieval situation. This novel paradigm brought evidence for individual memory profiles of recall performance that might be correlated to different aspects of brain functional networks. More generally, it offers novel possibilities to explore cellular and network mechanisms that underlie memory of past events and memory dysfunction in brain pathologies.
Keywords: Episodic memory Animal model Olfaction Declarative memory Rodent
Materials and Reagents
Subjects
All experiments were conducted in accordance with European guidelines for care of laboratory animals (2010/63/EU) and received approval from the Lyon 1 University Ethics Committee (permission DR2015-46). Adult male Long-Evans rats (Charles River Laboratories) aged 7-8 weeks (~300-350 g) at the start of the water deprivation protocol, are housed in groups of 2-4 per cage and kept in an environment with controlled temperature and humidity under a 12/12 h light/dark cycle with food ad libitum. Experiments are conducted during the light period.
Note: So far these experiments have not been conducted with other strains of rats or mice, but we assume that usage of other strains shouldn’t introduce major difficulties to carry out the experiments. Nevertheless, according to the fact that contexts are characterized by visual stimulation, working with albinos rats might be more challenging. Regarding mice, some adjustments to the experimental device would be required.
Odorants
In order to be delivered in a fully controlled manner through a new generation of olfactometer (Sezille et al., 2013), each odorant is introduced in a U-shaped Pyrex® tube (volume: 10 ml; length: 50 mm; external diameter: 14 mm) (VS technologies) filled with microporous granules. All odors used in these experiments were obtained from Sigma-Aldrich, France (see a-f below).
Geraniol (Sigma-Aldrich, catalog number: 163333 ) 20% of saturated vapor pressure
Eugenol (Sigma-Aldrich, catalog number: E51791 ) 18% of saturated vapor pressure
(S)-(+)-Carvon (Sigma-Aldrich, catalog number: 435759 ) 35% of saturated vapor pressure = Odor A
Isoamylacetate (Sigma-Aldrich, catalog number: W205508 ) 15% of saturated vapor pressure = Odor B
Trans-Anethole (Sigma-Aldrich, catalog number: 117870 ) 30% of saturated vapor pressure = Odor C
Citral (cis+trans) (Sigma-Aldrich, catalog number: W230308 ) 20% of saturated vapor pressure = Odor D
Note: Before the start of experiments, between 2 and 4 ml of pure odor solution are introduced gradually on several consecutive days into the U Shaped Glass Tubes until the microporous granules appear saturated (Figure 1) (for the experiments, the odors should be at saturated vapor pressure in the tube, at the same time in order to prevent olfactometer pollution it is important to avoid the accumulation of liquid at the bottom of the tube). The percentage of saturated vapor pressure introduced into the airflow is adjusted for each odor individually by the experimenter. The objective is to obtain an intensity that is perceived by the animal but moderate enough to prevent any avoidance behavior. For the different odors used in pairs, we also try to equalize their perceived intensity. The choice of these particular odors and concentrations was mainly determined by previous experiments in the lab showing their easy discriminability and the absence of their natural attractiveness or repulsiveness to the rats at the concentrations used (Martin et al., 2004; Courtiol et al., 2014; Torquet et al., 2014).
Figure 1. A photo of the U-shaped Pyrex tube filled with microporous granules showing different levels of saturation with Carvon odor solution. From left to right: pure granules without any added odor solution; partly saturated granules; fully saturated granules as used for the experiments.
Drinking solutions
6% Sucrose in solution is used as positive reinforcement (Sigma-Aldrich, catalog number: number: 84097 )
0.06% Quinine hydrochloride dehydrate in solution is used as negative reinforcement (Sigma-Aldrich, catalog number: Q1125 )
Equipment
Apparatus (EPISODICAGE)
The experimental cage is a PVC rectangular box (60 x 35 x 40 cm) equipped with 4 devices for delivery of different odor and drinking solutions (Figure 2A) (Belkacem Messaoudi). On the two opposing walls, at 5 cm distance from each corner of the box, the cage contains an arrangement of odor and drinking ports. The odor port is a round indentation into the wall (5 x 5 cm in size), with a drinking port (small hole, 1 x 1 cm in size) placed 1cm below the odor port through which a drinking pipette can be inserted into the cage (Figure 1B).
Figure 2. The EPISODICAGE. A. General view of the experimental cage showing the four cameras installed above each of the four odor ports. B. Details of an odor port (OP) with associated drinking pipette (P), view from the inside (left figure) or the outside (right figure) of the cage: odor injection (OI) and odor extraction (OE), motor (M), which allows introducing and withdrawing the pipette from the cage. C. Each nose poke first triggers an odor delivery for 13 sec. Three seconds after odor initiation, a pipette containing various drinking solutions (water, sugar or quinine) is introduced into the cage for 10 sec until the odor stimulation switches off. Each lick on the pipette made by the rat is detected and recorded by the computer devoted to the control of the experimental cage. Each trial starts with the nose poke and ends with withdrawal of the pipette and odor switch off. D. On the left, appearance of the cage in the version used in routine sessions. The two other pictures illustrate how the appearance of the cage can be modified by projecting visual patterns on the ground (center picture) or introducing objects (right picture). Figure adapted from Veyrac et al. (2015).
Odor port
When a rat makes a nose poke into the port, a capacitance change is detected by the system that immediately triggers for 13 sec the introduction of odor-saturated vapor into a constant airflow (air flow overall: 1 liter/min). The proportion of odorized air and the quality of the odorant are controlled through a custom made olfactometer connected to the odor port (OI) (Figure 1B). In a given experimental session, five different odors can be delivered at each of the four odor ports. A venturi-based system of aspiration allows extraction of the odorized air through a separate channel, so that the odor remains limited to the port (OE) (Figure 1B). A permanent compensation of OI and OE prevents any change in overall air pressure due to odor switch.
Note: Rats are highly sensitive to changes in air pressure. To prevent any behavioral response to mechanical stimulation, air pressure must be kept at the same level during the presence and absence of odors.
Drinking port
Each movable drinking pipette is connected to a pump. The pipette is introduced into the cage 3 sec after the first nose poke of the animal and is withdrawn from the cage 10 sec later simultaneously with termination of odor release (Figure 1C). This ensures that the odor stimulation is delivered during the entire liquid consumption. A second capacitance change sensor integrated into the drinking pipette detects every single lick of the animal and triggers the pump which in turn delivers a calibrated amount of 8-9 µl of drinking solution. The licks made by the rats are recorded as text files for later analysis of the results.
Note: The amount of liquid delivered upon each lick from the drinking ports must be equal between the ports (the variation should be within 8±1 µl), in order to avoid any preference of the animals for a particular port.
Different drinking solutions can be delivered by the system, water, sucrose or quinine solutions according to the different phases of the protocol and the odor-port configurations. After each trial and retraction of the pipette, the drinking solution device is purged with the solution of the following trial.
Note: Purge duration is set in a way that allows the complete wash out of the drinking solution of the last trial. This was verified through addition of ink into the water before the start of experiments.
Items for contextual enrichment during episodes
Acoustic context
Different types of sounds can be played through two loudspeakers symmetrically placed above the experimental arena to enhance the discriminability of the episodes: nature sounds, bird songs, piano music …etc. The general guideline for choosing these sounds was their discriminability as validated in spectrograms and the animals/experimenter’s well-being.
Tactile and visual context
Different types of floors can be used with distinct tactile and visual characteristics (Figure 1D). As color vision in rats is poor, combinations of high-contrast black and white coloring of materials are preferred. Additionally, visual patterns can also be displayed on the floor by a video projector and various objects can be placed into the box.
Video recording
Five cameras are used to monitor precisely the behavior of the rats, one placed centrally above the experimental box and four others each placed above the four odor ports. The position of the rat is detected online via a video tracking software from the signal recorded from the central camera. When the animal approaches a port, the corresponding camera is selected for signal acquisition. This allows us to save space occupied by the video files.
Software
VOLCAN (Marc Thevenet)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
How to cite： Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Allerborn, M., Gros, A., Messaoudi, B., Gervasoni, D., Garcia, S., Thevenet, M., Laroche, S., Veyrac, A. and Ravel, N. (2016). A Novel Task for Studying Memory of Occasional Events in Rats. Bio-protocol 6(5): e1740. DOI: 10.21769/BioProtoc.1740.
Veyrac, A., Allerborn, M., Gros, A., Michon, F., Raguet, L., Kenney, J., Godinot, F., Thevenet, M., Garcia, S., Messaoudi, B., Laroche, S. and Ravel, N. (2015). Memory of occasional events in rats: individual episodic memory profiles, flexibility, and neural substrate. J Neurosci 35(19): 7575-7586.
Download Citation in RIS Format
Category
Neuroscience > Behavioral neuroscience > Learning and memory
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,741 | https://bio-protocol.org/exchange/protocoldetail?id=1741&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Measurement of 33P-PO4 Absorption Capacity and Root-to-leaf Transfer in Arabidopsis
MT Marie-Christine Thibaud
EM Elena Marin
Published: Vol 6, Iss 5, Mar 5, 2016
DOI: 10.21769/BioProtoc.1741 Views: 6869
Edited by: Tie Liu
Reviewed by: Michael O. Adu
Original Research Article:
The authors used this protocol in Apr 2015
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Apr 2015
Abstract
This method allows quantification of phosphate absorption capacity by Arabidopsis roots using very simple equipment, and can be scaled up or down.
Keywords: Phosphate absorption Phosphate root-to-leaf transfer Arabidopsis
Materials and Reagents
Plastic 12-well plates (Denmark, Nunc)
Note: One for the absorption step, one for the desorption step for each treatment (plant type or culture condition).
Plastic 20 ml vials for radioactivity measurement (Ratiolab GmbH, Dreieich)
Note: You will need one vial per plant, or 2 vials per plant if you want to quantify 33P in both roots and leaves. The vials should be numbered from 1 to N before you start the experiment. They also should be placed in order in appropriate racks (PerkinElmer) adapted to the beta counter.
Tips
Young in vitro plantlets
MES hydrate (Sigma-Aldrich, catalog number: M8250 )
CaCl2 (Sigma-Aldrich)
KH2PO4 (Sigma-Aldrich)
33P-PO4 5 mCi/ml (40-158 Ci/mg, 1.48-5.84 TBq/mg, >99% isotopically pure, less than 0.5 μM Pi) (PerkinElmer)
Scintillation cocktail (PerkinElmer, Ultima GoldTM)
MgSO4
NH4NO3
KNO3
NaH2PO4
KI
FeCl2
MnSO4
ZnSO4
CuSO4
CoCl2
Na2MoO4
Thiamine
Pyridoxine
Nicotinic acid
Inositol
Sucrose
Agar
MS/10 medium (see Recipes)
Stock solution (see Recipes)
Incubation medium (see Recipes)
Desorption medium (see Recipes)
Equipment
Experiments should be performed on a bench or under a hood illuminated with white light (150 -180 μE m-2 s-1) during the incubation step
Liquid scintillation counter (PerkinElmer, Packard Instrument Company, model: TRI-CARB )
Ice-containing large boxes for the desorption step (all 12-well plates will be placed horizontally on ice for 2 h)
Tweezers for handling the plantlets
If necessary, a razor to separate roots and aerial parts
Micropipets
Shield for protection against radiations (plexiglass)
Scanner or camera (Epson America, model: Perfection V850Pro or Canon, model: Powershot SX130 ), respectively but other devices from other manufacturers could suit perfectly
Software
ImageJ version 1.46r with NeuronJ plugin (http://imagej.nih.gov/ij)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
How to cite： Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Thibaud, M. and Marin, E. (2016). Measurement of 33P-PO4 Absorption Capacity and Root-to-leaf Transfer in Arabidopsis. Bio-protocol 6(5): e1741. DOI: 10.21769/BioProtoc.1741.
Ayadi, A., David, P., Arrighi, J. F., Chiarenza, S., Thibaud, M. C., Nussaume, L. and Marin, E. (2015). Reducing the genetic redundancy of Arabidopsis PHOSPHATE TRANSPORTER1 transporters to study phosphate uptake and signaling. Plant Physiol 167(4): 1511-1526.
Download Citation in RIS Format
Category
Plant Science > Plant physiology > Nutrition
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
1 Q&A
How to set Scale correctly for NeuronJ?
0 Answer
30 Views
Apr 26, 2023
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,742 | https://bio-protocol.org/exchange/protocoldetail?id=1742&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Measurement of 33P-PO4 Absorption Kinetic Constants in Arabidopsis
EM Elena Marin
MT Marie-Christine Thibaud
Published: Vol 6, Iss 5, Mar 5, 2016
DOI: 10.21769/BioProtoc.1742 Views: 6875
Edited by: Tie Liu
Reviewed by: Michael O. Adu
Original Research Article:
The authors used this protocol in Apr 2015
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Apr 2015
Abstract
Based on the Michaelis-Menten kinetics model (Hofstee, 1952), this method allows calculation of the kinetic parameters (Vmax, Km) of phosphate uptake by Arabidopsis roots. This method is based on the quantification of phosphate uptake by Arabidopsis roots as described in Thibaud and Marin (2016), except that a range of phosphate concentration is applied in the incubation medium.
Plants are grown in high or low Pi giving access to kinetic parameters corresponding to low and high affinity respectively. In high Pi, the high-affinity transporters are not induced giving access to the low-affinity transport only. When plants are grown in low Pi, high affinity transporters are active, and the corresponding kinetic parameters can be measured. The calculation of Km and Vmax values is based on the Michaelis-Menten kinetics model.
Keywords: Phosphate absorption Kinetic constants Arabidopsis
Materials and Reagents
Plastic 12-well plates (Denmark, Nunc)
Note: One for the absorption step, one for the desorption step for each treatment (plant type or culture condition).
Plastic 20 ml vials for radioactivity measurement (Ratiolab GmbH, Dreieich)
Note: You will need one vial per plant, or 2 vials per plant if you want to quantify 33P in both roots and leaves. The vials should be numbered from 1 to N before you start the experiment. They also should be placed in order in appropriate racks (PerkinElmer) adapted to the beta counter.
Tips
Young in vitro plantlets
MES hydrate (Sigma-Aldrich, catalog number: M8250 )
CaCl2 (Sigma-Aldrich)
33P-PO4 5 mCi/ml (185 MBq/ml, 1.48-5.84 TBq/mg, >99% isotopically pure, less than 0.5 μM Pi) (PerkinElmer)
Scintillation cocktail (PerkinElmer, Ultima GoldTM)
MgSO4
NH4NO3
KNO3
NaH2PO4
Kl
FeCl2
MnSO4
ZnSO4
CuSO4
CoCl2
Na2MoO4
Thiamine
Pyridoxine
Nicotinic acid
Inositol
Sucrose
Agar
MS/10 medium (see Recipes)
Stock solution (see Recipes)
1 M KH2PO4 (Sigma-Aldrich) (see Recipes)
Incubation medium (see Recipes)
Desorption medium (see Recipes)
Equipment
Liquid scintillation counter (PerkinElmer, Packard Instrument Company, model: TRI-CARB )
Ice-containing large boxes for the desorption step (all 12-well plates will be placed horizontally on ice for 2 h)
Tweezers for handling plantlets
Micropipets
Shield for protection against radiation (Plexiglas)
Scanner or camera (Epson America, model: Perfection V850Pro or Canon, model: Powershot SX130 ), respectively but other devices from other manufacturers could suit perfectly
Software
ImageJ version 1.46r with NeuronJ plugin (http://imagej.nih.gov/ij)
PRISM 6.0 software (GraphPad)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
How to cite： Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Marin, E. and Thibaud, M. (2016). Measurement of 33P-PO4 Absorption Kinetic Constants in Arabidopsis. Bio-protocol 6(5): e1742. DOI: 10.21769/BioProtoc.1742.
Ayadi, A., David, P., Arrighi, J. F., Chiarenza, S., Thibaud, M. C., Nussaume, L. and Marin, E. (2015). Reducing the genetic redundancy of Arabidopsis PHOSPHATE TRANSPORTER1 transporters to study phosphate uptake and signaling. Plant Physiol 167(4): 1511-1526.
Download Citation in RIS Format
Category
Plant Science > Plant physiology > Nutrition
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,743 | https://bio-protocol.org/exchange/protocoldetail?id=1743&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Actin Retrograde Flow in Permeabilized Cells: Myosin-II Driven Centripetal Movement of Transverse Arcs
Yee Han Tee
Alexander D. Bershadsky
Published: Vol 6, Iss 5, Mar 5, 2016
DOI: 10.21769/BioProtoc.1743 Views: 8416
Reviewed by: Lin FangRalph Bottcher
Original Research Article:
The authors used this protocol in Apr 2015
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Apr 2015
Abstract
Numerous biological functions such as cytokinesis, changes in cell shape and cell migration require actomyosin-driven cellular contractility. However, the detailed mechanism of how contractile forces drive cellular processes are difficult to decipher due to the complexity of the intracellular environment. In particular, the mesoscopic description of the myosin II-dependent actin retrograde flow in cell lamellum is missing. Here, we describe a methodology for detergent extraction of cell, which preserves integrity of the actin cytoskeleton. This semi-in vitro cell model allows for the observation, using light microscopy, and quantification of changes in the actin cytoskeleton resulting from the activation of cellular contractility upon addition of ATP. This assay also allows for the evaluation of the effects of actin-associated proteins and other related factors in the modulation of the actin contractile activities. Here, we demonstrate the retrograde flow of a well-known actin-based structures- transverse arcs, which are myosin IIA-containing structures that emerge at the boundary between lamellipodium-lamellum and move centripetally in myosin II-dependent fashion.
Keywords: Actin fibers Actin flow Actomyosin contractility Micropatterning Triton-insoluble cytoskeleton
Materials and Reagents
35-mm ibidi’s hydrophobic uncoated μ-dishes for cell culture (ibidi GmbH, catalog number: 80131 )
1 x 1 cm polydimethylsiloxane (PDMS) stamp containing microfeatures of circles (area, 1,800 μm2; center-to-center distance, 100 μm)
Note: For a detailed protocol on preparation of PDMS stamps and micro-contact printing see Théry and Piel (2009) and Tee et al., (2015).
NuncTM Cell Culture Treated Flasks with Filter Caps (Thermo Fisher Scientific, catalog number: 136196 )
Human foreskin fibroblast (ATCC, catalog number: SCRC-1041 )
Growth medium: Dulbecco’s modified Eagle’s medium (DMEM) high glucose (Thermo Fisher Scientific, catalog number: 11965-092 ), supplemented with
10% fetal bovine serum (Thermo Fisher Scientific, catalog number: 10438-026 )
1 mM sodium pyruvate (Thermo Fisher Scientific, catalog number: 11360-070 )
10 U/ml penicillin and streptomycin (Thermo Fisher Scientific, catalog number: 15140148 )
TrypLETM Express Enzyme (Thermo Fisher Scientific, catalog number: 12604013 )
PBS (1x), pH 7.4 (Thermo Fisher Scientific, catalog number: 10010-023 )
Fibronectin (Merck Millipore Corporation, catalog number: 341635 )
Imidazole (Sigma-Aldrich, catalog number: I15513 )
KCl (First BASE Laboratories Sdn Bhd, catalog number: BIO-1300 )
Magnesium chloride (MgCl2) (Sigma-Aldrich, catalog number: M8266 )
EDTA (First BASE Laboratories Sdn Bhd, catalog number: BIO-1050 )
Ethylene glycol-bis (2-aminoethylether)-N, N, N′, N′-tetraacetic acid (EGTA) (Sigma-Aldrich, catalog number: E3889 )
2-Mercaptoethanol (Sigma-Aldrich, catalog number: M6250 )
TritonTM X-100 (Sigma-Aldrich, catalog number: X100 )
Polye (ethylene glycol) MW35,000 (PEG) (Sigma-Aldrich, catalog number: 81310 )
Protease inhibitors cocktail (for use with mammalian cell and tissue extracts, DMSO solution) (Sigma-Aldrich, catalog number: P8340 )
N, N-Dimethylformamide (DMF) (Sigma-Aldrich, catalog number: 227056 )
Methanol (Thermo Fisher Scientific, catalog number: M/4000/17 )
Sterile Milli-Q water
Alexa Fluor® 488 Phalloidin (Thermo Fisher Scientific, catalog number: A12379 ) (see Recipes)
Dark phalloidin [Phalloidin from Amanita phalloides (≥90%)] (Sigma-Aldrich, catalog number: P2141 ) (see Recipes)
Adenosine 5’-triphosphate disodium salt hydrate (ATP) (Sigma-Aldrich, catalog number: A6419 ) (see Recipes)
Extraction buffer A (see Recipes)
Extraction buffer B (see Recipes)
Staining solution (see Recipes)
Contractility buffer (see Recipes)
Equipment
Confocal microscope equipped with 100x oil immersion objective
37 °C on-stage incubation chamber
Software
Image J software [National Institutes of Health (NIH)] (http://imagej.nih.gov/ij/)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Tee, Y. H. and Bershadsky, A. D. (2016). Actin Retrograde Flow in Permeabilized Cells: Myosin-II Driven Centripetal Movement of Transverse Arcs. Bio-protocol 6(5): e1743. DOI: 10.21769/BioProtoc.1743.
Download Citation in RIS Format
Category
Molecular Biology > Protein > Protein-protein interaction
Cell Biology > Cell imaging > Live-cell imaging
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,744 | https://bio-protocol.org/exchange/protocoldetail?id=1744&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Mouse Mammary Intraductal (MIND) Method for Transplantation of Patient Derived Primary DCIS Cells and Cell Lines
FK Frances Kittrell
KV Kelli Valdez
Hanan Elsarraj
Yan Hong
DM Daniel Medina
Fariba Behbod
Published: Vol 6, Iss 5, Mar 5, 2016
DOI: 10.21769/BioProtoc.1744 Views: 9645
Edited by: Guillermo Gomez
Reviewed by: Kristina Y. AguileraVivien Jane Coulson-Thomas
Original Research Article:
The authors used this protocol in May 2009
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
May 2009
Abstract
The MIND method involves intraductal injection of patient derived ductal carcinoma in situ (DCIS) cells and DCIS cell lines (MCF10DCIS.COM and SUM225) inside the mouse mammary ducts [Video 1 and Figure 1 in Behbod et al. (2009)]. This method mimics the normal environment of DCIS and facilitates study of the natural progression of human DCIS, i.e., their initial growth as carcinoma in situ within the ducts, followed by invasion into the stroma through the myoepithelial cell layer and basement membrane (Behbod et al., 2009; Valdez et al., 2011). In order to demonstrate that transplantation procedure is successful, the transplanted mammary glands may be excised as early as two weeks following intraductal injection of cells followed by Hematoxylin and Eosin (H&E) staining and/or immunofluorescence staining using human specific cytokeratin 5 and/or 19 [please see Figures 2-4 in Behbod et al. (2009)]. Additionally, the presence of trypan blue inside the mouse mammary ducts immediately following intraductal injection is the best indicator that the injection was successful (Video 1 starting at 4:33 sec).
Keywords: Intraductal Mouse mammary Mammary transplantation Human DCIS
Materials and Reagents
Hamilton syringe, 50 μl capacity, with a 30 gauge blunt-ended fixed 1/2-inch needle (Hamilton, catalog number: 80608 )
1 ml Tuberculin (TB) syringe (Benton Dickenson, catalog number: 309625 )
Wound clips (Becton Dickinson, catalog number: 427631 )
Animals: 8-12 week old female immunocompromised mice
Note: NSG, NOD scid gamma [NOD.Cg-Prkdcscid Il2rgtm1Wjl/SzJ (HE JACKSON LABORATORY, catalog number: 005557 )]. Alternatively, SCID/beige mice (Fox Chase SCID® Beige CB17.Cg-PrkdcscidLystbg-J/Crl) may be used for the injection of DCIS cell lines only. While a formal comparison has not been made, patient derived DCIS epithelial cells seem to grow more efficiently in the NSG mice.
Cells of interest [i.e., cell lines MCF10DCIS.COM and SUM225 (Behbod Lab, 2009 #329) or patient derived DCIS epithelial cells] in single cells
PBS (pH 7.4, 1x), sterile (Life Technologies, catalog number: 10010023 )
Note: Currently, it is “Thermo Fisher Scientific, catalog number: 10010023”.
Trypan blue 0.4%, sterile (Sigma-Aldrich, catalog number: T8154 )
70% ethanol
Sterile water
Nembutal Sodium Solution (Pentobarbital sodium injection, USP) (Akorn, Oak Pharmaceuticals, catalog number: NDC 7647850120 )
KetofenTM (Ketoprofen) (Patterson Veterinary Supply, catalog number: 10004029 )
Equipment
Scissors Small scale suitable for mice
Sharp-Blunt (Fine Science Tool, catalog number: 14028-10 )
Castroviejo Spring Scissors (Fine Science Tool, catalog number: 15017-10 )
Balled Scissors (Fine Science Tool, catalog number: 14086-09 )
Clippers (Fine Science Tool, catalog number: 1501710 )
Rounded end flat handle tweezers (ROBOZ, model: RS5095 )
Spring scissor (Fine Science Tool, catalog number: 1501710 )
Balled scissor (Fine Science Tool, catalog number: 1408609 )
Rounded end tweezers (Fine Science Tool, catalog number: 1105210 )
Rat tooth tweezers (Fine Science Tool, catalog number: 1105310 )
Clip applier (Becton Dickinson, catalog number: 427630 )
Heat pad (Sunbeam Products, model: PN126985900 )
Clip remover (Becton Dickinson, catalog number: 427638 )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Kittrell, F., Valdez, K., Elsarraj, H., Hong, Y., Medina, D. and Behbod, F. (2016). Mouse Mammary Intraductal (MIND) Method for Transplantation of Patient Derived Primary DCIS Cells and Cell Lines. Bio-protocol 6(5): e1744. DOI: 10.21769/BioProtoc.1744.
Download Citation in RIS Format
Category
Cancer Biology > Invasion & metastasis > Animal models
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,745 | https://bio-protocol.org/exchange/protocoldetail?id=1745&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Displacement-based ELISA: Quantifying Competition between Two Binding Partners for Interaction with a His-tagged Ligand Immobilized on a Ni2+-NTA Plate
AD Allexa Dow
SP Sladjana Prisic
Published: Vol 6, Iss 5, Mar 5, 2016
DOI: 10.21769/BioProtoc.1745 Views: 9153
Edited by: Valentine V Trotter
Original Research Article:
The authors used this protocol in Jul 2015
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jul 2015
Abstract
The displacement assay was designed to quantify the direct competition between two homologous ribosomal proteins from Mycobacterium tuberculosis, S18-1 and S18-2, for interaction with their cognate binding partner, ribosomal protein S6 (Prisic et al., 2015). The S18 proteins were dialyzed in two physiologically relevant conditions (i.e. in the presence of Zn2+ or with EDTA to chelate Zn2+) and then allowed to compete for binding to S6 which was maintained in limiting concentration. The result was obtained through an ELISA, where S6-His is first bound to a Ni2+-NTA plate, followed by addition of S18-2 in excess to S6, then by addition of increasing concentrations of S18-1. The percentage of S18-2 that remained bound to S6 was quantified with antibodies specific to the S18-2 protein and secondary antibodies, in chemiluminescent ELISA. In this way displacement of S18-2 protein by the S18-1 protein was reported as a percentage of the full strength signal achieved through saturation of S6 with S18-2. At its foundation, this method exploits a native protein-protein interaction and could be applied to other systems where two or more proteins compete for binding to a target ligand as above.
Keywords: ELISA His tag Protein-protein interaction
Materials and Reagents
HisPurTM Cobalt Spin Columns (Thermo Fisher Scientific, catalog number: 89969 )
Pierce™ Polyacrylamide Spin Desalting Columns, 7 K MWCO, 0.7 ml (Thermo Fisher Scientific, catalog number: 89849 )
5 PRIMETM Ni2+-NTA HisPrimeTM plates (Thermo Fisher Scientific, catalog number: 2400730 )
ProTEV Plus (Promega Corporation, catalog number: V6101 )
cOmplete His-Tag Purification Resin (Sigma-Aldrich, Roche Diagnostics, catalog number: 05893682001 )
BioRad Protein Concentration Assay (Bio-Rad Laboratories, catalog number: 5000002 )
Albumin, Bovine, Fraction V (pH 7) (BSA) (Affymetrix, catalog number: 10857 50 gm )
Rabbit Polyclonal Antibody raised to peptide antigen from competing protein (i.e. S18-2) (NeoPeptide, custom made against peptide PGQDRQRRAALCP)
Goat Anti-Rabbit IgG, Peroxidase Conjugated Secondary Antibody (Thermo Fisher Scientific, PierceTM, catalog number: 31460 )
SuperSignalTM West Pico Chemiluminescent Substrate (Thermo Fisher Scientific, catalog number: 34080 )
HEPES Sodium Salt (Thermo Fisher Scientific, Fisher BioReagents, catalog number: BP410-500 )
Potassium chloride (KCl) (Sigma-Aldrich, catalog number: 793590-500 g )
Tween® 20 (enzyme grade) (Thermo Fisher Scientific, Fisher BioReagents, catalog number: BP337-500 )
2-mercaptoethanol (Thermo Fisher Scientific, Fisher BioReagents, catalog number: BP176-100 )
EDTA disodium salt (Thermo Fisher Scientific, Fisher BioReagents, catalog number: BP120-500 )
ZnSO4.7H2O (Sigma-Aldrich, catalog number: Z4750-100 g )
5x HEPES/KCl (see Recipes)
Microscale Thermophoresis Buffer (MST) buffer (see Recipes)
MST with Zn2+ (see Recipes)
MST with EDTA (see Recipes)
Equipment
Multichannel pipettor (20-300 µl) (Gilson, model: FA10016 )
Microplate reader with absorbance and chemiluminescent capacity (BioTek Instruments, model: Synergy 2 )
Benchtop microplate shaker (IKA® Works, model: MS 3 digital )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Dow, A. and Prisic, S. (2016). Displacement-based ELISA: Quantifying Competition between Two Binding Partners for Interaction with a His-tagged Ligand Immobilized on a Ni2+-NTA Plate. Bio-protocol 6(5): e1745. DOI: 10.21769/BioProtoc.1745.
Download Citation in RIS Format
Category
Microbiology > Microbial biochemistry > Protein
Biochemistry > Protein > Interaction
Biochemistry > Protein > Interaction
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,746 | https://bio-protocol.org/exchange/protocoldetail?id=1746&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Laser Microirradiation and Temporal Analysis of XRCC1 Recruitment to Single-strand DNA Breaks
Anna Campalans
JR J. Pablo Radicella
Published: Vol 6, Iss 5, Mar 5, 2016
DOI: 10.21769/BioProtoc.1746 Views: 8500
Reviewed by: Nicoletta Cordani
Original Research Article:
The authors used this protocol in Mar 2013
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Mar 2013
Abstract
The DNA molecule is exposed to a multitude of damaging agents that can compromise its integrity: single (SSB) and double strand breaks (DSB), intra- or inter-strand crosslinks, base loss or modification, etc. Many different DNA repair pathways coexist in the cell to ensure the stability of the DNA molecule. The nature of the DNA lesion will determine which set of proteins are needed to reconstitute the intact double stranded DNA molecule. Multiple and sequential enzymatic activities are required and the proteins responsible for those activities not only need to find the lesion to be repaired among the millions and millions of intact base pairs that form the genomic DNA but their activities have to be orchestrated to avoid the accumulation of toxic repair intermediates. For example, in the repair of Single Strand Breaks (SSB) the proteins PARP1, XRCC1, Polymerase Beta and Ligase III will be required and their activities coordinated to ensure the correct repair of the damage.
Furthermore, the DNA is not free in the nucleus but organized in the chromatin with different compaction levels. DNA repair proteins have therefore to deal with this nuclear organization to ensure an efficient DNA repair. A way to study the distribution of DNA repair proteins in the nucleus after damage induction is the use of the laser microirradiation with which a particular type of DNA damage can be induced in a localized region of the cell nucleus. The wavelength and the intensity of the laser used will determine the predominant type of damage that is induced. It is important to note that other lesions can also be generated at the microirradiated site.
Living cells transfected with the fluorescent protein XRCC1-GFP are micro-irradiated under a confocal microscope and the kinetics of recruitment of the fluorescent protein is followed during 1 min. In our protocol the 405 nm laser is used to induce SSB.
Keywords: DNA damage Single-strand DNA breaks DNA repair Microirradiation Live imaging
Materials and Reagents
Glass bottom 35 mm Petri dishes (MatTek, catalog number: P35G-1.5-20-C )
HeLa adherent cells in culture
Plasmids coding for the fluorescent protein XRCC1-GFP
Note: The XRCC1 sequence (NCBI P18887) was cloned in the Clontech pEGFP-N1 Vector at the restriction sites EcoRI/ApaI.
Transfection agents (LipoFectamine 2000) (Life Technologies, catalog number: 11668027 )
Note: Currently, it is “Thermo Fisher Scientific, Invitrogen™, catalog number: 11668027”.
DMEM [DMEM(1x) + GlutaMAX™ (Thermo Fisher Scientific, Gibco™, catalog number: 31966-021 )] containing 10% of fetal bovine serum (Thermo Fisher Scientific, Gibco™, catalog number: 16000-044 )
Equipment
Cell incubator (Thermo Fisher Scientific, model: NAPCO 5400 )
Note: Currently, it is “BioSurplus, catalog number: NAPCO 5400 ”.
Nikon A1 inverted confocal microscope equipped with an environmental chamber allowing the control of temperature, humidity and gas mixture
Note: The lasers used are the following: 405 nm laser for the micro-irradiation, and a 488 nm Argon-laser to visualize the GFP fluorescence. The objective 63x was used.
Software
The NIS Software
Note: It was used for quantification of the fluorescence intensity at the microirradiation region during time, using the Time Measurement function.
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Campalans, A. and Radicella, J. P. (2016). Laser Microirradiation and Temporal Analysis of XRCC1 Recruitment to Single-strand DNA Breaks. Bio-protocol 6(5): e1746. DOI: 10.21769/BioProtoc.1746.
Download Citation in RIS Format
Category
Cancer Biology > General technique > Genetics
Cell Biology > Cell imaging > Confocal microscopy
Molecular Biology > DNA > DNA damage and repair
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,747 | https://bio-protocol.org/exchange/protocoldetail?id=1747&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Campylobacter jejuni γ-glutamyltranspeptidase Activity Assay
Anne-Xander van der Stel
Marc M. S. M. Wösten
Published: Vol 6, Iss 5, Mar 5, 2016
DOI: 10.21769/BioProtoc.1747 Views: 7585
Edited by: Valentine V Trotter
Reviewed by: Anna A. Zorina
Original Research Article:
The authors used this protocol in Jul 2015
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jul 2015
Abstract
The enzyme γ-glutamyltranspeptidase (GGT, EC 2.3.2.2) is highly conserved among eukaryotic and prokaryotic organisms (Heisterkamp et al., 2008) and has a key function in glutathione metabolism. Although the enzyme is highly conserved and found throughout organisms ranging from bacteria to plants and animals several major difference between eukaryotic and prokaryotic GGT can be noticed. They mainly concern the enzyme localization and posttranslational modification. Eukaryotic GGT is cell membrane anchored and highly glycosylated whereas prokaryotic GGT does not undergo this posttranslational modification and is a soluble periplasmic protein. GGT amino acids sequences of diverse origin exhibit high amino acid similarity (Ong et al., 2008). The prokaryotic GGT enzymes are produced as proenzyme, equipped with a typical prokaryotic signal sequence and transported through the inner membrane into the periplasm where the enzyme undergoes autocatalytic cleavage. This proteolysis yields a mature dimer which transfers the γ-glutamyl moieties from extracellular glutathione and related compounds to amino acids or peptides (Hanigan et al., 1998). The GGT enzyme activity can be easily measured as it catalyzes the transfer of a γ-glutamyl group from a colorless substrate, L-γ-glutamyl-3-carboxy-4-nitroanilide, to the acceptor, glycylglycine with leads to the production of yellow colored product, p-nitroaniline (Figure 1) which can be measured by a spectrophotometer (Figure 2). Here we describe a protocol to measure the GGT activity in the Gram-negative bacterium Campylobacter jejuni, with some minor modifications; this protocol also works for other Gram-negative bacterial species.
Figure 1. Yellow colored product, p-nitroaniline formed during the GGT enzyme assay
Figure 2. Spectral curve of pNA in Tris/HCl buffer, recorded on a Biodrop µLite (Isogen)
Keywords: Campylobacter Bacterial GGT assay Glutamyltranspetidase Periplasmic enzym assay Glutathione
Materials and Reagents
25 mm culture flasks with vent cap (Corning, catalog number: 430639 )
96 well plate flat bottom (Corning, Costar®, catalog number: 3599 )
Campylobacter culture
UltraPure™ Tris Buffer (powder format) (Thermo Fisher Scientific, Invitrogen™, catalog number: 15504-020 )
Lysozyme from chicken egg white (Sigma-Aldrich, catalog number: L-6876 )
L-Glutamic acid γ-(3-carboxy-4-nitroanilide) ammonium salt (Sigma-Aldrich, catalog number: 49525 )
Glycylglycine (Sigma-Aldrich, catalog number: G3915 )
Pierce™ BCA Protein Assay Kit (Thermo Fisher Scientific, Thermo Scientific™, catalog number: 23227 )
4-nitroaniline (Sigma-Aldrich, catalog number: 185310 )
Hearth Infusion medium (Thomas Scientific, Oxoid, catalog number: CM1032B )
Tris/HCl (pH 7.6 and pH 8.2)
Lysis buffer (see Recipes)
Reaction buffer (see Recipes)
pNA stock solution (see Recipes)
Equipment
Absorbance microplate reader (such as BMG Labtech GmbH, Fluorstar Omega or equivalent)
Vibra-Cell™ Sonicater (Sonics & Materials, model: VC40 )
Refrigerated table top centrifuge
The anoxomat system (MART Microbiology)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：van der Stel, A. and Wösten, M. M. S. M. (2016). Campylobacter jejuni γ-glutamyltranspeptidase Activity Assay. Bio-protocol 6(5): e1747. DOI: 10.21769/BioProtoc.1747.
Download Citation in RIS Format
Category
Microbiology > Microbial biochemistry > Protein
Biochemistry > Protein > Activity
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,748 | https://bio-protocol.org/exchange/protocoldetail?id=1748&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Immunogold Labeling Analysis of Cell Wall Polysaccharides with Special Reference to (1;3,1;4)-β-D-glucan in Rice Cell Walls
RY Ryusuke Yokoyama
NK Natsumi Kido
TY Tsuyoshi Yamamoto
JF Jun Furukawa
HI Hiroaki Iwai
SS Shinobu Satoh
KN Kazuhiko Nishitani
Published: Vol 6, Iss 5, Mar 5, 2016
DOI: 10.21769/BioProtoc.1748 Views: 8711
Edited by: Tie Liu
Reviewed by: Carsten AdeValérie Cornuault
Original Research Article:
The authors used this protocol in Feb 2015
Download PDF
Ask a question
Favorite
Cited by
Original research article
The authors used this protocol in:
Feb 2015
Abstract
Various types of cell wall compositions have evolved to fulfill a wide range of biological roles during the diversification of land plants. (1;3,1;4)-β-D-glucan (MLG) is a defining feature of the cell walls in the order Poales (Yokoyama and Nishitani, 2004), which has multiple functions associated with metabolic, growth, and defense systems. MLG is also a characteristic component of the matrix polysaccharides that undergo turnover and metabolism, depending on the tissue and the stage of development (Kido et al., 2015). Determining the extracellular localization of MLG is essential for elucidating its functions. Electron microscopy immunogold labeling analysis is a useful technique, which provides an accurate representation of the extracellular distribution of MLG. This strategy is also applicable to various kinds of cell wall polysaccharides, which have key roles in regulating growth and differentiation in each plant species.
Keywords: Electron microscopy Cell wall Immunogold labeling Rice Mixed-linkage glucan
Materials and Reagents
Gelatin capsule (HF capsule) (Matsuya Co.)
Rice plants (see Note)
Paraformaldehyde (Electron Microscopy Sciences, catalog number: 12300 )
Sodium cacodylate buffer solution (TAAB Laboratories BATCH, catalog number: 90760 )
Glutaraldehyde (Electron Microscopy Sciences, catalog number: 16220 )
Tannic acid (Sigma-Aldrich, catalog number: 403040 )
Phosphate buffer powder (Siyaku, Wako Pure Chemical Industries, catalog number: 167-14491 )
Ethanol (Siyaku, Wako Pure Chemical Industries, catalog number: 057-00456 )
LR White resin (Electron Microscopy Sciences, London Resin Company, catalog number: 14381-CA )
Monoclonal antibody against (1;3,1;4)-β-D-glucan (mouse IgG, Kappa Light) (Biosupplies, catalog number: 400-3 )
Note: It is named as (1-3;1-4)-β-D-glucan on Biosupplies’ website.
Goat Anti-mouse IgG pAb, Gold 15 nm, EM (BBI Solutions, catalog number: EM.GMHL15 )
Phosphate-buffered salts (Takara Bio Company, catalog number: T900 )
Bovine serum albumin (BSA) (Sigma-Aldrich, catalog number: A2058 )
Uranyl acetate (Siyaku, Wako Pure Chemical Industries, catalog number: 554-85072 )
Lead stain solution (Sigma-Aldrich, catalog number: 18-0875-2-25 ml-J )
Note: This reagent may not be available outside Japan, and can be replaced with alternative lead stains. For an alternative, readers are referred to a more general experimental manual for electron microscopy of plant cells (Hall and Hawes, 1991).
Molecular sieves (Sigma-Aldrich, catalog number: M6141 )
Fixative solution (see Recipes)
2% glutaraldehyde solution (see Recipes)
100% ethanol solution (see Recipes)
1x Phosphate-buffered saline (PBS) (see Recipes)
Equipment
Growth chamber (Nippon Medical & Chemical Instruments, model: LH220S )
Ultracut UCT Ultramicrotome (Leica Microsystems)
Diaphragm vacuum pump (Leybold-Heraus, model: Divac 2.2 L )
Desiccator (Sanplatec, model: PC-250K )
Grid mesh (Okenshoji, catalog number: 09-1079 )
Transmission electron microscope (JEOL USA, model: JEM-1400plus )
CCD camera (Olympus soft imaging solutions GmbH, model: Veleta )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
Category
Plant Science > Plant biochemistry > Carbohydrate
Biochemistry > Carbohydrate > Polysaccharide
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,749 | https://bio-protocol.org/exchange/protocoldetail?id=1749&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Experimental Design to Determine Drought Stress Response and Early Leaf Senescence in Barley (Hordeum vulgare L.)
Gwendolin Wehner
Christiane Balko
Frank Ordon
Published: Vol 6, Iss 5, Mar 5, 2016
DOI: 10.21769/BioProtoc.1749 Views: 16408
Edited by: Samik Bhattacharya
Reviewed by: Anna Дмитриевна KozhevnikovaMagdalena Migocka
Original Research Article:
The authors used this protocol in Jun 2015
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jun 2015
Abstract
Premature leaf senescence induced by drought stress is a main factor for yield losses in barley. Research in drought stress tolerance has become more important as due to climate change the number of drought periods will increase and tolerance to drought stress has become a goal of high interest in barley breeding. However, reliable screening for drought stress tolerance is still a difficult task. This protocol describes the experimental design for the phenotyping for drought stress tolerance and early leaf senescence in the juvenile stage of barley (A) and the determination of six physiological parameters involved in drought tolerance and leaf senescence (B to G) according to Wehner et al., (2015).
Keywords: Barley Drought stress Leaf senescence
A. Experimental design
Materials and Reagents
Sticks for labels (Hermann Meyer KG, catalog number: 180230 )
Plastic sticks (Hermann Meyer KG, catalog number: 180206 )
Rubber binder (Hermann Meyer KG, catalog number: 321234 )
Barley seeds
70% white peat
30% clay
N (nitrogen power)
P2O5
K2O
Mixed clay soil ED73 (H. Nitsch & Sohn GmbH & Co. KG) (see Recipes)
Equipment
Greenhouse facility
Movable greenhouse benches (80 x 100 cm)
Square pots (16 x 16 x 16 cm) (Hermann Meyer KG, catalog number: 720016 )
Beaker for watering (VWR International, catalog number: 213-3402 )
Labels (Baumann Industries, catalog number: 2.508.003 )
Weighing scale (KERN & SOHN GmbH)
Compartment dryer (Heratherm oven) (Thermo Fisher Scientific)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Wehner, G., Balko, C. and Ordon, F. (2016). Experimental Design to Determine Drought Stress Response and Early Leaf Senescence in Barley (Hordeum vulgare L.). Bio-protocol 6(5): e1749. DOI: 10.21769/BioProtoc.1749.
Download Citation in RIS Format
Category
Plant Science > Plant physiology > Abiotic stress
Plant Science > Plant physiology > Photosynthesis
Plant Science > Plant physiology > Plant growth
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
175 | https://bio-protocol.org/exchange/protocoldetail?id=175&type=1 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
pH3 Antibody Staining Protocol for Zebrafish
LJ Lili Jing
Published: Jan 20, 2012
DOI: 10.21769/BioProtoc.175 Views: 27108
Download PDF
Ask a question
Favorite
Cited by
Abstract
Phosphorylation of histone H3 is tightly correlated with chromosome condensation during both mitosis and meiosis. Staining for phosphor histone H3 is a good indicator for the proliferation of the interested cells. This protocol provides a method to stain p-Histone H3 in zebrafish embryos.
Materials and Reagents
PFA
Phosphate buffered saline (PBS)
Acetone
Alcohol
PBS-Tween 20
H2O2
DMSO
Maleic Acid
p-Histone H3 antibody, 200 μg/ml (Cell Signaling Technology, catalog number: 9701 )
Blocking regent (Roche Diagnostics, catalog number: 1096176 )
Diaminobenzidine (DAB) (Sigma-Aldrich, catalog number: D-5905 )
Peroxidase-conjugated Affinity Goat anti rabbit Ig (Promega Corporation, catalog number: W4011 )
Block solution (see Recipes)
DAB solution (see Recipes)
10x MAB buffer (see Recipes)
Equipment
Shaker
Parafilm
Cold-room
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2012 The Authors; exclusive licensee Bio-protocol LLC.
Category
Cell Biology > Cell staining > Reactive oxygen species
Cell Biology > Cell signaling > Phosphorylation
Cell Biology > Cell structure > Chromosome
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,750 | https://bio-protocol.org/exchange/protocoldetail?id=1750&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Analysis of T Cell Proliferating and Polarizing Potential of Murine Dendritic Cells in Allogeneic-mixed Leukocyte Reaction
Pawan Kumar
Sangeeta Bhaskar
Published: Vol 6, Iss 5, Mar 5, 2016
DOI: 10.21769/BioProtoc.1750 Views: 11309
Edited by: Ivan Zanoni
Reviewed by: Ramalingam BethunaickanBenoit Chassaing
Original Research Article:
The authors used this protocol in Mar 2015
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Mar 2015
Abstract
Dendritic cells (DCs) play a critical role in mounting the T cell response against different infectious agents. Nature and intensity of the induced T cell responses are defined by activation status of DCs. It is generally accepted that IL-12, IL-4/IL-5 and IL-23 producing DCs induce TH1, TH2 and TH17 type of immune responses, respectively (Kumar et al., 2015). Besides cytokines, levels of co-stimulatory molecules on DCs also influence the response of T cells.
The activation status of DCs can be determined by examining DC culture supernatants for different cytokines and by analyzing expression of co-stimulatory molecules on these cells. However, these approaches provide indirect information about T cell activating potential of DCs. Analysis of T cell responses in a co-culture system is a more direct approach to examine T cell proliferating and polarizing efficacy of DCs.
A protocol to analyze the T cell proliferating and polarizing potential of DCs in an allogeneic mixed leukocyte reaction (allo-MLR) is described here.
Materials and Reagents
RPMI-1640 medium (HiMedia Laboratories, catalog number: AT028 )
Dulbecco’s Phosphate Buffered Saline (HiMedia Laboratories, catalog number: TS1006 )
Heat-inactivated fetal bovine serum (Biological industries, catalog number: 04-121-1A )
Antibiotic-antimycotic (penicillin-streptomycin) solution, 100x (HiMedia Laboratories, catalog number: A002A )
Round bottom, 96-well cell culture plates (Corning, catalog number: 3799 )
Dendritic cells (derived by culturing mouse bone marrow cells in the presence of recombinant GM-CSF) (PeproTech, catalog number: 315-03 )
Untouched CD4+ and CD8+ T cells from allogeneic mouse strain (isolated from spleen of Balb/c mice using CD4 T cell enrichment kit and CD8 T cell enrichment kit (BD, catalog number: 558131 and 558471 , respectively)
Fluorochrome-conjugated FITC anti-mouse CD3, PE anti-mouse CD4 and PE anti-mouse CD8 antibodies (BD Pharmingen, catalog number: 555274 , 553730 and 553032 , respectively)
Concanavalin A (Sigma-Aldrich, catalog number: C5275 )
3H-thymidine (BARC)
Trypan Blue (Sigma-Aldrich, catalog number: T8154 )
RPMI-10 (see Recipes)
Equipment
Haemocytometer
Humidified CO2 incubator
Laminar air flow bio-safety cabinet
Centrifuge
Gamma-irradiator
Microscope
Flow-cytometer
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Kumar, P. and Bhaskar, S. (2016). Analysis of T Cell Proliferating and Polarizing Potential of Murine Dendritic Cells in Allogeneic-mixed Leukocyte Reaction. Bio-protocol 6(5): e1750. DOI: 10.21769/BioProtoc.1750.
Download Citation in RIS Format
Category
Immunology > Immune cell function > Dendritic cell
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,751 | https://bio-protocol.org/exchange/protocoldetail?id=1751&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Isolation of Genomic DNA from Mycobacterium Species
Pawan Kumar*
Soumitra Marathe*
Sangeeta Bhaskar
*Contributed equally to this work
Published: Vol 6, Iss 5, Mar 5, 2016
DOI: 10.21769/BioProtoc.1751 Views: 16168
Edited by: Ivan Zanoni
Reviewed by: Ramalingam BethunaickanBenoit Chassaing
Original Research Article:
The authors used this protocol in Mar 2015
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Mar 2015
Abstract
Isolation of genomic DNA from Mycobacterium species has been a tedious procedure. This can primarily be attributed to thick and waxy cell wall of mycobacteria which hampers lysis of the bacterial cell. We have tested various approaches to isolate mycobacterial DNA and based on this, an optimized protocol is presented here. This protocol involves initial incubation of mycobacteria with lysozyme, followed by SDS-proteinase K treatment to bring about cell disruption. In the case of slowly growing mycobacteria such as BCG (Bacillus Calmette–Guérin) or Mycobacterium tuberculosis (M. tuberculosis), an intermediate step of cell lysis by physical method results in significantly enhanced yield.
Materials and Reagents
Mycobacterium culture (50 to 100 ml)
Tris base (Sigma-Aldrich, catalog number: T1503 )
EDTA (HiMedia Laboratories, catalog number: MB011 )
Note: Prepare 0.5 M solution (pH 8) in double distilled water.
Liquid nitrogen
Proteinase K (HiMedia Laboratories, catalog number: RM2957 )
Note: Prepare the stock solution of 10 mg/ml in TE buffer (pH 8).
SDS (Bio Basic Canada, catalog number: SB0485 )
Note: Prepare 10% solution by dissolving in double distilled water.
Lysozyme (Sigma-Aldrich, catalog number: L6876 )
Note: Prepare the stock solution of 100 mg/ml in double distilled water.
Phenol (Sigma-Aldrich, catalog number: P4557 )
Note: Equilibrate with Tris-Hcl (pH 8).
Chloroform (HiMedia Laboratories, catalog number: AS041 )
Isoamyl alcohol (HiMedia Laboratories, catalog number: MB091 )
2-Propanol (HiMedia Laboratories, catalog number: MB063 )
Ethyl alcohol, Pure (Sigma-Aldrich, catalog number: 459844 )
Nuclease-free water (HiMedia Laboratories, catalog number: TCL016 )
TE buffer (see Recipes)
PCI mixture (see Recipes)
Equipment
Water bath
Centrifuge
Pestle and mortar
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Kumar, P., Marathe, S. and Bhaskar, S. (2016). Isolation of Genomic DNA from Mycobacterium Species. Bio-protocol 6(5): e1751. DOI: 10.21769/BioProtoc.1751.
Download Citation in RIS Format
Category
Microbiology > Microbial genetics > DNA
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,752 | https://bio-protocol.org/exchange/protocoldetail?id=1752&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Semi-thin Sectioning, Light and Fluorescence Microscopy of Floral Bud to Study Microspore Development in Arabidopsis
Min-Jung Kim
Jungmook Kim
Published: Vol 6, Iss 5, Mar 5, 2016
DOI: 10.21769/BioProtoc.1752 Views: 9362
Edited by: Samik Bhattacharya
Reviewed by: Vinay Panwar
Original Research Article:
The authors used this protocol in Mar 2015
Download PDF
Ask a question
Favorite
Cited by
Original research article
The authors used this protocol in:
Mar 2015
Abstract
Pollen grains are male gametophytes produced within the pollen sacs of the anthers of the flower. Recent genetic studies have revealed several components involved in microspore development (Borg et al., 2009; Berger and Twell, 2011), and yet many components controlling microspore development remain to be identified. Semi-thin sectioning of anthers and light and fluorescence microscopy of floral bud (Kim et al., 2015) are the initial key experiments to characterize Arabidopsis mutants and transgenic plants for understanding the roles of new genetic components during microspore development. Herein, we describe a protocol for semi-thin sectioning of anthers and light and fluorescence microscopy of floral bud in Arabidopsis.
Keywords: Pollen Anther Nuclei Bicellular Tricellular
Materials and Reagents
0.2 μm sterile syringe filter (Corning, catalog number: 431219 )
Microscope slide and coverslip
Needle (30 gauge)
3 mm Whatman filter paper (GE Healthcare, Dharmacon, catalog number: 1006090 )
Note: Currently, it is “Sigma-Aldrich, catalog number: 1006090”.
Mineral oil (Sigma-Aldrich, catalog number: M5904 )
Paraformaldehyde (Sigma-Aldrich, catalog number: F8775 )
25% glutaraldehyde (Junsei, catalog number: 273721250 )
Sodium carcodylate (Ted Pella, catalog number: 18851 )
Potassium phosphate monobasic (KH2PO4) (Sigma-Aldrich, catalog number: P5379 )
Ethanol (Merck Millipore Corporation, Calbiochem®, catalog number: 1.00983.1011 )
Sodium hydroxide (NaOH) (Sigma-Aldrich, catalog number: 30620 )
Osmium tetroxide (OsO4) (Ted Pella, catalog number: 96049 )
Spurr resin (Ted Pella, catalog number: 183004221 )
Double end mold (Ted Pella, catalog number: 10590 )
Toluidine blue O (Sigma-Aldrich, catalog number: T3260 )
EDTA (BioShop, catalog number: EDT001.500 )
Triton X-100 (Sigma-Aldrich, catalog number: T8532 )
Note: This product has been discontinued.
4’, 6-diamidino-2-phenylindole (DAPI) (Sigma-Aldrich, catalog number: 32670 )
Acetic acid (Merck Millipore Corporation, Calbiochem®, catalog number: 1.00063.1011 )
1/2 strength Karnovsky’s fixative solution (see Recipes)
Toluidine blue O solution (see Recipes)
Fixative solution (see Recipes)
DAPI solution for developing pollen (see Recipes)
DAPI solution for mature pollen grain (see Recipes)
Equipment
Ultramicrotome (Boeckeler Instruments, model: MT990 motorized precision microtome )
Hot plate
Water bath
Incubator
Fume hood
Light and fluorescence microscope (Leica Microsystems, model: DM2500 )
Vacuum pump and vacuum jar
Glass pipette
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
Category
Plant Science > Plant developmental biology > Morphogenesis
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,753 | https://bio-protocol.org/exchange/protocoldetail?id=1753&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Shoot Regenerative Capacity Assays in Arabidopsis and Tobacco
Tian-Qi Zhang
JW Jia-Wei Wang
Published: Vol 6, Iss 5, Mar 5, 2016
DOI: 10.21769/BioProtoc.1753 Views: 10153
Edited by: Marisa Rosa
Reviewed by: Yuan Chen
Original Research Article:
The authors used this protocol in Feb 2015
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Feb 2015
Abstract
Plant regeneration refers to a process through which an explant is differentiated to a whole plant under certain conditions. It has been shown that two plant hormones, auxin and cytokinin, play critical roles within this process (Duclercq et al., 2011). Cytokinin induces shoot regeneration, whereas auxin promotes root production. In addition to hormones, recent study has revealed that age cue serves as a common element behind plant cell totipotency (Toledano et al., 2012). Here we present an easy protocol to assess the shoot regenerative capacity of Arabidopsis and tobacco leaves of different ages.
Keywords: Shoot regeneration Cytokinin Auxin Plant age
Materials and Reagents
Surgical tape (3M, catalog number: 15300 )
Sterile petri dishes
Seeds: Arabidopsis thaliana (Col-0 ecotype) and tobacco (Nicotiana tabacum cv SR1)
Bacterial strain: Agrobacterium tumefaciens EHA105
Sodium hypochlorite (Sigma-Aldrich, catalog number: L099100 )
Note: The Pricing and availability are not currently available.
Kanamycin sulfate Streptomyces kanamyceticus (Sigma-Aldrich, catalog number: K0879 )
Timentin (Yeasen, catalog number: 60230ES07 )
Agar (Sangon Biotech, catalog number: A100637 )
Methylester sulfonate (Sangon Biotech, catalog number: MB0341 )
Sucrose (Sigma-Aldrich, catalog number: E001888 )
Glucose (Sigma-Aldrich, catalog number: G8270 )
Ethyl alcohol, Pure (Sigma-Aldrich, catalog number: 459844 )
Deionized water
Soil
Murashige and Skoog (MS) basal medium with vitamin powder (PhytoTechnology, Laboratories®, catalog number: 15B0519117B ) (1 L) (see Recipes)
1/2 MS medium (1 L) (see Recipes)
MS1 medium (1 L) (see Recipes)
MS2 medium (1 L) (see Recipes)
MS3 medium (1 L) (see Recipes)
Callus-inducing medium (1 L) (see Recipes)
Shoot-inducing medium (1 L) (see Recipes)
22 mM 2, 4-dichlorophenoxy (2, 4-D) stock solution (Sigma-Aldrich, catalog number: 31518 ) (see Recipes)
9 mM 3-indoleacetic acid (IAA) (Sigma-Aldrich, catalog number: I2886 ) stock solution (see Recipes)
20 mM Kinetin (Sigma-Aldrich, catalog number: K0753 ) stock solution (see Recipes)
50 mM 6-(γ, γ-Dimethylallylamino)purine (2-IP) (Sigma-Aldrich, catalog number: D5912 ) stock solution (see Recipes)
2 mg/ml 6-benzylaminopurine (6-BA) (Sigma-Aldrich, catalog number: B3408 ) stock solution (see Recipes)
1 M Potassium hydroxide (KOH) (Sigma-Aldrich, catalog number: P5958 ) (see Recipes)
15% bleach (see Recipes)
10% bleach (see Recipes)
Infection buffer (see Recipes)
Equipment
Clean bench (horizontal laminar flow)
Autoclave (ZEALWAY)
Incubator (25 °C/80 UML) (Percival-scientific, model: CU-41L4 )
Growth chamber
Glass culture bottles (130 mm x 100 mm x 62 mm)
Sterile 5 mm-hole punch
Scalpel (10 cm in length)
Forceps (20 cm in length)
Scissor (15 cm in length)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Zhang, T. and Wang, J. (2016). Shoot Regenerative Capacity Assays in Arabidopsis and Tobacco. Bio-protocol 6(5): e1753. DOI: 10.21769/BioProtoc.1753.
Download Citation in RIS Format
Category
Plant Science > Plant developmental biology > General
Plant Science > Plant physiology > Plant growth
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,754 | https://bio-protocol.org/exchange/protocoldetail?id=1754&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Quantification of Rae-1 Staining Intensity in Glomeruli
RS Roberto Spada
DB Domingo F. Barber
Published: Vol 6, Iss 5, Mar 5, 2016
DOI: 10.21769/BioProtoc.1754 Views: 6574
Edited by: Ivan Zanoni
Reviewed by: Yang Fu
Original Research Article:
The authors used this protocol in Mar 2015
Download PDF
Ask a question
Favorite
Cited by
Original research article
The authors used this protocol in:
Mar 2015
Abstract
NKG2D is expressed on all NK cells and on subsets of NKT, CD8, CD4 and γδ T cells. NKG2D is activated by NKG2D ligands, a stress-induced family of MHC-I-like proteins. These ligands are upregulated on stressed/infected cells and are not widely expressed on healthy adult tissue. NKG2D ligands have been widely studied as potential targets for immunotherapeutic approaches in cancer and auto-immune diseases such as Systemic Lupus Erythematosus. Here we describe a method for quantifying the expression levels of the Rae-1 NKG2D ligand in the glomeruli of healthy and diseased individuals via a novel algorithm. The MRL mouse was used as a positive control strain as it spontaneously generates a lupus-like phenotype, one of the main effects of which is severe glomerulonephritis. MRL/MpJ mice develop this phenotype spon¬taneously at ~12 months of age, whereas MRL/MpJlpr mice, which have the same genetic background but which generated a spontaneous homozygous mutation in the Fas allele, develop similar but more severe symptoms by ~3-4 months of age (Spada et al., 2015).
Keywords: NKG2D ligands Lupus Glomerulonephritis MRL/MpJlpr
Materials and Reagents
Standard Cryomold (Electron Microscopy Sciences, Tissue-Tek, catalog number: 4557 )
Female MRL/MpJ [3 months (healthy) and 12 months (diseased)] and MRL/MpJ-Faslpr/J [9 weeks (pre-disease) and 3 months (diseased)]
Peroxidase Block (Dako, catalog number: K4009 )
Goat anti-mouse Rae-1γ (R&D Systems, catalog number: AF1136 )
Goat Histofine Simple Stain kit (NICHIREI CORPORATION, catalog number: 414161F )
AEC + Substrate-Chromogen (Dako, catalog number: K3464 )
PBS (Sigma-Aldrich, catalog number: P5493 )
Aqueous mounting medium (Vector Labs, catalog number: H-5501 )
Acetone (Sigma-Aldrich, catalog number: 320110 )
Tissue-Freezing Medium (Leica Biosystems Nussloch GmbH, catalog number: 14020108926 )
Haematoxylin (Sigma-Aldrich, catalog number: H9627 )
Equipment
Leica Leitz DM RB Microscope (Leica Microsystems) with an adapted Olympus camera (Olympus Imaging America, model: DP70)
Macintosh or Windows PC
Software
Photoshop CS6 (Adobe)
Matlab v. 2013a (MathWorks)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
Category
Cancer Biology > Invasion & metastasis > Biochemical assays
Immunology > Immune cell staining > Immunodetection
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,755 | https://bio-protocol.org/exchange/protocoldetail?id=1755&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Testing the Effect of UV Radiation on the Survival of Burkholderia glumae
HK Hari Sharan Karki
Jong Hyun Ham
Published: Vol 6, Iss 5, Mar 5, 2016
DOI: 10.21769/BioProtoc.1755 Views: 9747
Edited by: Zhaohui Liu
Original Research Article:
The authors used this protocol in Dec 2014
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Dec 2014
Abstract
Burkholderia glumae (B. glumae) is becoming a serious threat in the major rice producing areas of the world. It was reported that Burkholderia spp., including B. glumae, are adapted to a wide range of ecological niches. Different bacterial strains show different levels of UV tolerance which may be due to the presence of different protection mechanisms. Previously we reported that pigment producing strains of B. glumae are more tolerant to UV radiation than non-pigmented strains. Here, we describe the protocol of UV tolerance assay for B. glumae in different exposure times. Using this protocol, we can calculate the survival rate of B. glumae strains, as well as other bacterial species, in exposure to UV radiation.
Materials and Reagents
Microcentrifuge tubes
Cuvettes (BrandTech Macro Methacrylate Cuvette) (Cole-Parmer, catalog number: 759081D )
Spreaders
Bacterial inoculation loops
A metal inoculation needle or sterile tooth picks
Strains of Burkholderia glumae (or other bacterial species)
Luria-Bertani broth (Sigma-Aldrich, catalog number: L3522 )
Bacteriological agar (Sigma-Aldrich, catalog number: A5306 )
Bacto Peptone (BD, DifcoTM, catalog number: 211677 )
Glucose (Sigma-Aldrich, catalog number: G5400 )
Casamino acid (Thermo Fisher Scientific, catalog number: BP1424 )
Nitrofurantoin (MP Biomedicals, catalog number: 155881 )
Luria-Bertani broth (LB) agar plates (see Recipes)
Casamino acid-peptone-glucose (CPG) agar plates (see Recipes)
Equipment
Laminar hood installed with a UV light bulb (The Baker Company, EdgeGard®)
Spectrophotometer (Thermo Fisher Scientific, model: BioMate3 )
Incubator (GMI, New Brunswick Scientific, model: Innova 4230 )
Germicidal fluorescent bulb, 15 W (General Electric Company, model: G15T8 )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Karki, H. S. and Ham, J. H. (2016). Testing the Effect of UV Radiation on the Survival of Burkholderia glumae. Bio-protocol 6(5): e1755. DOI: 10.21769/BioProtoc.1755.
Download Citation in RIS Format
Category
Microbiology > Antimicrobial assay > Antibacterial assay
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,756 | https://bio-protocol.org/exchange/protocoldetail?id=1756&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
In vitro Deneddylation Assay
Anna M. Köhler
Cindy Meister
Gerhard H. Braus
Published: Vol 6, Iss 6, Mar 20, 2016
DOI: 10.21769/BioProtoc.1756 Views: 9009
Edited by: Valentine V Trotter
Reviewed by: Manuela Roggiani
Original Research Article:
The authors used this protocol in Jul 2015
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jul 2015
Abstract
Nedd8 is a small ubiquitin-like protein (9 kDa) covalently attached to a conserved lysine residue of a cullin protein which is part of cullin-RING ligases (CRLs). CRLs are major E3 ligases important for protein ubiquitination in the ubiquitin-proteasome pathway (UPP). The activity of CRLs is regulated by cycles of neddylation (CulA-N8, ~98 kDa) and deneddylation (CulA ~89 kDa). The COP9 signalosome (CSN) and Deneddylase A (DenA) are capable of cleaving the isopeptide bond between Nedd8 and CullinA. In contrast to the single protein DenA, CSN is an eight subunit multiprotein complex. Protein crude extracts of different Aspergillus nidulans csn deletion strains were mixed with recombinant CSN subunits expressed and purified from Escherichia coli (E. coli). Western hybridization experiments using anti-CulA or anti-Nedd8 antibodies could show the ratio of neddylated vs. deneddylated CulA. Using the deneddylation assay, we could show that CsnE is the last subunit joining a 7-subunit pre-assembled CSN in vitro and only then CSN can perform cullin deneddylation by the metalloprotease subunit CsnE. This assay is a fast and non-expensive method, which visualizes enzyme activity for deneddylating proteins. It might be also useful for testing the activity of other isopeptidases removing post-translational modifications from substrates in Aspergillus nidulans (A. nidulans) or other organisms.
Keywords: Deneddylation COP9 signalosome (CSN) DEN1 Western hybridization Nedd8
Materials and Reagents
Recombinant protein overexpression and protein purification
1 ml cuvettes 10 x 10 x 45 mm (Sarstedt AG, catalog number: 67.742 )
Chromatography columns [e.g. GSTrap (GE Healthcare, catalog number: 17-5130-01 ), HisTrap (GE Healthcare, catalog number: 17-5255-01 ), Superdex 200 HR 10/300 GL (GE Healthcare, catalog number: 17-5175-01 ), HiPrep 16/60 Sephacryl S-300 HR (GE Healthcare, catalog number: 17-1167-01 )]
Amicon Ultra centrifugal filters (Merck Millipore Corporation) molecular weight cut off (MWCO) depends on protein size [e.g. 30 kDa (Merck Millipore Corporation, MWCO, catalog number: UFC903024 )]
MicronSep filter paper, 0.22, 47 mm (Carl Roth GmbH + Co., catalog number: A009.1 )
Escherichia coli (E. coli) strains suitable for protein overexpression (e.g. Rosetta DE3) transformed with overexpression plasmid including protein sequence of interest with N- or C-terminal Glutathione-S-transferase- (GST-) or Histidine- (His-) tag
Tryptone/Peptone from Casein (Carl Roth GmbH + Co., catalog number: 8952.2 ) used as 1% solution
Yeast extract (Oxoid, catalog number: LP0021 ) used as 0.5% solution
Sodiumchloride (NaCl) (Carl Roth GmbH + Co., catalog number: 9265.2 ) used as 1% solution
Antibiotics according to the E. coli strains used
Isopropyl β-D-1-thiogalactopyranoside (IPTG) (Carl Roth GmbH + Co., catalog number: 2316.4 ) used as 1 M solution, filter sterilized
99.5% denatured Ethanol with 1% MEK (VWR International, catalog number: 85033.460 ) used as 20% solution diluted in ddH2O, filter degassed
Imidazole
Glutathione
Lysogeny broth (LB) medium (see Recipes)
Lysis buffer (see Recipes)
Affinity buffer (see Recipes)
Elution buffer for HisTrap (see Recipes)
Elution buffer for GSTrap (see Recipes)
Size exclusion buffer (SEC) (see Recipes)
Preparation of protein crude extracts
Paper towels
Spores of Aspergillus nidulans strains
Miracloth (Merck Millipore Corporation, catalog number: 475855-1R )
Sodiumchloride (NaCl) (Carl Roth GmbH + Co., catalog number: 9265.2) used as 0.95 % solution
Liquid nitrogen (Air Liquid)
Minimal medium (see Recipes)
50x AspA (see Recipes)
Trace elements (see Recipes)
B* buffer (see Recipes)
Deneddylation assay
Gel blotting paper (Schleicher & Schuell BioScience GmbH, catalog number: 10426694 )
Blotting membrane AmershamTM ProtranTM 0.45 µm NC (GE Healthcare, catalog number: 10600002 )
Methanol (VWR International, catalog number: 20864.320 )
2-Propanol HiPerSolv CHROMANORM (VWR International, catalog number: 20880.320 )
Page ruler prestained protein ladder (Thermo Fisher Scientific, catalog number: 26616 )
Acrylamid Rotiphorese® Gel 30 (37, 5:1) (Carl Roth GmbH + Co., catalog number: 3029.1 )
Sucofin skimmed milk powder (TSI GmbH, catalog number: ST00227 )
α-CulA, α-Nedd8 antibodies (GenScript)
Monoclonal α-Tubulin antibody (Sigma-Aldrich, catalog number: T0926 )
α-Actin antibody (Novus Biologicals, catalog number: NB100-74340 )
α-goat rabbit secondary antibody (Thermo Fisher Scientific, InvitrogenTM, catalog number: G21234 )
α-goat mouse secondary antibody (Jackson ImmunoResearch, catalog number: 115-035-003 )
p-coumaric acid (Sigma-Aldrich, catalog number: C9008-5 G ) used as 400 mM stock solution dissolved in DMSO (protect from light, store at -20 °C)
Luminol (Carl Roth GmbH + Co., catalog number: 4203.1 ) used as 250 mM stock solution dissolved in DMSO (protect from light, store at -20 °C)
2-mercaptoethanol (Sigma-Aldrich, Fluka Chemika, catalog number: 63700 )
Sodium dodecyl sulfate (SDS) (Carl Roth GmbH + Co., catalog number: CN30.3 ) used as 7%, 0.1%, 1%, 0.2% solutions
Bromophenol blue (Sigma-Aldrich, Riedel-de Haën, catalog number: 32768 ) used as 0.3% solution
Ammoniumpersulfate (APS) (Sigma-Aldrich, Fluka Analytical, catalog number: 09913-100 G ) used as 10% solution
Tetramethylethylendiamine (TEMED) (Carl Roth GmbH + Co., catalog number: 2367.1 )
Tween-20 (Carl Roth GmbH + Co., catalog number: 9127.1 )
Tris-PUFFERAN® (Carl Roth GmbH + Co., catalog number: 4855.3 ) used as 250 mM solution
Glycine (Carl Roth GmbH + Co., catalog number: 3187.3 ) used as 2.5 M solution
30% Hydrogen peroxide (H2O2) (Merck Millipore Corporation, catalog number: 822287.2500 )
3x SDS sample buffer (see Recipes)
12% SDS gels (see Recipes)
2x resolving buffer (see Recipes)
2x stacking buffer (see Recipes)
10x SDS running buffer (see Recipes)
10x transfer buffer (see Recipes)
10x TBST (Tris-Buffered Saline Tween 20) buffer (see Recipes)
Blocking solution (see Recipes)
Detection solution A (see Recipes)
Detection solution B (see Recipes)
Others (material and reagents used for more than one method)
Micro tube 1.5 ml (Sarstedt AG, catalog number: 72.690.001 )
Micro tube 2.0 ml (Sarstedt AG, catalog number: 72.691 )
Tube 115 x 28 mm, PP (Sarstedt AG, catalog number: 62.559.001 )
5 ml test tube
2 L flasks
PPCO centrifuge bottles (Slaughte, Nalgene, catalog number: 525-2316 )
Oak-Ridge centrifugation tubes, 50 ml (Carl Roth GmbH + Co., catalog number: PK03.1 )
300 ml baffled flasks
Funnels
Crushed ice
1, 4- Dithiothreitol (DTT) (Carl Roth GmbH + Co., catalog number: 6908.2 ) used as 1 M solution
trans-Epoxysuccinyl-L-leucylamido(4-guanidino)butane, E-64 protease inhibitor (Sigma-Aldrich, catalog number: E3132 ) used as 1 M stock solution
Phenylmethylsulfonyl fluoride (PMSF) (Carl Roth GmbH + Co., catalog number: 6367.3 ) used as 100 mM solution in Isopropanol
Double destilled water (ddH2O)
Millipore water
Sodium chloride (NaCl) (Carl Roth GmbH + Co., catalog number: 9265.2) used as 2 M solution
Tris- hydrochloride (Tris-HCl) (Carl Roth GmbH + Co., catalog number: 9090.3 )
Note: Prepare a series of Tris-HCl solution with different concentrations and pH including 1 M solutions with pH 6.8, 7.5, 8.0 and pH 8.8; 0.75 M solution withpH 8.8; 100 mM solution with pH 8.0.
Ethylenediaminetetraacetic acid (EDTA) (Carl Roth GmbH + Co.) used as 0.5 mM solution
Nonoxinol-40 (NP-40) (Affymetrix, USB Corporation, catalog number: 19628 )
Glycerol (Carl Roth GmbH + Co., catalog number: 3783.1 )
Complete protease inhibitor cocktail (Roche Diagnostics, catalog number: 11873580001 ) (see Recipes)
Equipment
Biowave DNA Llife Science Spectrophotometer (Biochrom WPA, catalog number: 80-3004-70 )
Centrifuge Sorvall RC3B Plus (Thermo Fisher Scientific)
Centrifuge Sorvall RC5B Plus (Thermo Fisher Scientific)
Rotor Sorvall SS34 (Thermo Fisher Scientific)
ÄKTAexplorer 10 (GE Healthcare, catalog number: 18-1300-00 )
pH meter pH526 (Sigma-Aldrich, model: WTW )
Filter and degassing system (Satorius)
Vacuum pump (KNF NEUBERGER, catalog number: 2.03360238 )
Sonicator Sonoplus HD2070 (Bandelin)
Superloop 1/16’’ (GE Healthcare, catalog number: 18-1113-82 )
Sample loop 5 ml (GE Healthcare, catalog number: 18-1140-53 )
Mixer Mill MM 400 (Retsch)
Vortex Genie 2 (Scientific Industries)
Pipettes (1-5,000 µl) (Gilson)
Centrifuge Biofuge fresco (Heraeus Instruments GmbH)
Nanodrop Spectrophotometer (VWR International, Peqlab)
Mini-PROTEAN® Tetra Cell Casting Module (Bio-Rad Laboratories, catalog number: 1658008 )
Buffer Tank and Lid (Bio-Rad Laboratories, catalog number: 1658040 )
Mini Trans-Blot Module (Bio-Rad Laboratories, catalog number: 1703935 )
Autoradiography casette
FUSION SL-4 3500.WL (Chemiluminescence System) (PEQLAB)
CCD camera FUSION 4 MP (VWR International, Peqlab)
Orbital Shaker 3015 (GFL)
Shaker (INFORS AG)
Heating block (Gebr. Liebisch GmbH & Co. KG Labortechnik)
Software
Fusion BIO-1D software
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Köhler, A. M., Meister, C. and Braus, G. H. (2016). In vitro Deneddylation Assay. Bio-protocol 6(6): e1756. DOI: 10.21769/BioProtoc.1756.
Download Citation in RIS Format
Category
Microbiology > Microbial biochemistry > Protein
Microbiology > Microbial biochemistry > Protein
Biochemistry > Protein > Modification
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,757 | https://bio-protocol.org/exchange/protocoldetail?id=1757&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Dissection and Staining of Mouse Brain Ventricular Wall for the Analysis of Ependymal Cell Cilia Organization
PL Paul Labedan
CM Cédric Matthews
LK Laurent Kodjabachian
HC Harold Cremer
FT Fadel Tissir
CB Camille Boutin
Published: Vol 6, Iss 6, Mar 20, 2016
DOI: 10.21769/BioProtoc.1757 Views: 14050
Reviewed by: Pamela MaherOneil G. Bhalala
Original Research Article:
The authors used this protocol in Jul 2014
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jul 2014
Abstract
In the developing and mature central nervous system (CNS) the ventricular lumen is lined by the neuroepithelium and ependymal, respectively. These ventricular epithelia perform important functions related to the development, morphogenesis and physiology of the brain. In the mature CNS, ependyma constitutes a barrier between brain parenchyma and cerebro- spinal fluid (CSF). The most prominent feature of the apical surface of ependymal cells is the presence of multiple motile cilia that extend towards the ventricular lumen. The beating of cilia ensures the circulation of the CSF and its impairment leads to hydrocephalus. For an effective CSF flow, ciliary beating must be coordinated at the level of individual cells and at the tissue level. This coordination is achieved through the precise organization of cilia positioning within the plane of the ependyma. Two major features have been described regarding the planar organization of cilia in ependymal cells (Mirzadeh et al., 2010) and both have a cellular and tissular aspect (Boutin et al., 2014). The first one, rotational polarity, refers to the orientation of ciliary beating. At the cellular level, all cilia beat in the same direction (Figure 1B, black arrows). At the tissue level, each ependymal cell coordinates the direction of their beating with that of neighboring cells (Figure 1C, grey arrows). The second feature, translational polarity, is unique to ependymal cells and refers to the clustering of cilia in a tuft. At the cellular level, this tuft is displaced relative to the center of the ependymal cell (Figure 1B, red arrow). At the tissue level, the positioning of the ciliary tuft is coordinated between adjacent cells (Figure 1C). Alteration of any of these polarities at either level impairs CSF flow circulation (Mirzadeh et al., 2010; Boutin et al., 2014; Guirao et al., 2010; Hirota et al., 2010; Ohata et al., 2014). Cilia axonemes arise from basal bodies (BB) which are cylindrical structures anchored perpendicular to the sub-apical surface of the cells (Figure 1D). BBs are polarized by the presence of appendices such as basal foot or striated rootlets. The basal foot protrudes in a direction correlated with the direction of cilia beating, while the striated rootlet protrudes in the opposite direction of cilia beating (Marshall, 2008). The ‘en face view’ observation of BBs’ organization allows the visualization of ependymal polarities (Mirzadeh et al., 2010; Boutin et al., 2014). Here, we describe an immunofluorescence (IF) protocol for observation of ciliated cells in mouse brain ventricular lateral wall whole mounts (LWWM). This protocol can be used for classical confocal microscopy analysis. In addition, it is well suited for super-resolution STimulated Emission Depletion (STED) microscopy if observation of structures that have features which are smaller than the optical diffraction limit is needed. Finally, we describe a combination of antibodies that allow the concomitant observation, in a single sample, of ependymal polarities at the level of individual cilia, individual cells and at the tissue level.
Materials and Reagents
Microscope slide
Coverslips
Mice at desired stage [between postnatal day 1 (P1) and 21 (P21)]
1x PBS
Triton X-100
4% Paraformaldehyde (PFA) (prepared by dilution of powder in 1x PBS)
Bovine Serum Albumin (BSA) (Sigma-Aldrich, catalog number: A-8022 )
Hoechst 33258 solution (Sigma-Aldrich, catalog number: 94403 )
Mowiol (Merck Millipore Corporation, Calbiochem®, catalog number: 475904 )
Prolong Gold antifade reagent (Thermo Fisher Scientific, Molecular ProbeTM, catalog number: P36934 )
ZO1 (Thermo Fisher Scientific, InvitrogenTM, catalog number: 61-7300 )
γ-tubulin [GTU-88] (Abcam, catalog number: ab11316 )
FGFR1OP (FOP) (Abnova Corporation, catalog number: H00011116-M01 )
β-catenin (BD, catalog number: 610153 )
FoxJ1 (eBioscience, catalog number: 14-9965 )
Acetylated-α-tubulin (Sigma-Aldrich, catalog number: T6793 )
Secondary antibodies
Anti-Rabbit A647 (Invitrogen, catalog number: A21244 )
Anti-Mouse IgG1 A568 (Invitrogen, catalog number: A21124 )
Anti-Mouse IgG2b A488 (Invitrogen, catalog number: A21141 )
Anti-Mouse IgG1 A488 (Invitrogen, catalog number: A21121 )
Anti-Mouse IgG2b A568 (Invitrogen, catalog number: A21144 )
Primary and secondary antibodies (see Recipes)
Equipment
Dissection tools including forceps (Zillow, Dumont, model: 55 ) and Ultra Fine Micro Knives (Fine Science Tools, catalog number: 10316-14 )
Confocal microscope (OLYMPUS, model: Fluoview FV1000 )
STED microscope (Leica Microsystems, model: SP8 3x STED ) equipped with a 100x oil objective (HC-PL-APO; NA 1.40; STED white) and a 592 nm depletion laser
Software
Biotool software (Boutin et al., 2014)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Labedan, P., Matthews, C., Kodjabachian, L., Cremer, H., Tissir, F. and Boutin, C. (2016). Dissection and Staining of Mouse Brain Ventricular Wall for the Analysis of Ependymal Cell Cilia Organization. Bio-protocol 6(6): e1757. DOI: 10.21769/BioProtoc.1757.
Download Citation in RIS Format
Category
Neuroscience > Development > Explant culture
Neuroscience > Development > Immunofluorescence
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,758 | https://bio-protocol.org/exchange/protocoldetail?id=1758&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
In vitro Assessment of Immunological Synapse Formation by Flow Cytometry
Bo-Ra Na
Chang-Duk Jun
Published: Vol 6, Iss 6, Mar 20, 2016
DOI: 10.21769/BioProtoc.1758 Views: 16016
Edited by: Ralph Bottcher
Reviewed by: Martin V KolevAlka Mehra
Original Research Article:
The authors used this protocol in Apr 2015
Download PDF
Ask a question
Favorite
Cited by
Original research article
The authors used this protocol in:
Apr 2015
Abstract
In adaptive immune system, formation of immunological synapse between T cells and antigen presenting cells (dendritic cells, B cells, and macrophages) or target cells (tumor cells and viral-infected cells) is critical for the execution of T cell immune responses via cytokine secretion or direct killing activity. Here, we describe the practical methods that directly measure the number of conjugates as a result of immunological synapse formation between T cells and superantigen-loaded B cells or between cytotoxic T cells and antigen-loaded target cells by dual-color flow cytometry.
Keywords: T cells Antigen-presenting cells Immunological synapse Adhesion Conjugation
Materials and Reagents
15 ml and 50 ml conical tube
12 well cell culture plate
FalconTM Cell strainer (40 μm Nylon) (Corning, catalog number: 352340 )
1 ml syringe
FalconTM 5 ml Polystyrene Round-Bottom tube (Corning, catalog number: 352052 )
MACS MS column (Miltenyi Biotec, catalog number: 130-042-201 ) and MACS separator (Miltenyi Biotec)
Jurkat T cell (ATCC, catalog number: TIB-152 )
Raji B cell (ATCC, catalog number: CCL-86 )
EL4 cell (ATCC, catalog number: TIB-39 )
C57BL/6 mice (8-10 weeks)
OTI mice (8-10 weeks) (THE JACKSON LABORATORY, catalog number: 021773 )
Note: These mice have the transgenic T cell receptor designed to recognize ovalbumin residues 257-264 in the context of H2Kb.
Staphylococcus Enterotoxin E (SEE) (Toxin Technology, catalog number: ET404 )
Staphylococcus Enterotoxin B (SEB) (Toxin Technology, catalog number: BT202 )
OVA 257–264 peptide (InvivoGen, catalog number: vac-sin )
CellTracker Green CMFDA (Life Technologies, Molecular Probes®, catalog number: C7025 )
Note: Currently, it is “Thermo Fisher Scientific, Molecular ProbesTM, catalog number: C7025”.
CellTracker Orange CMRA (Life Technologies, Molecular Probes®, catalog number: C34551 )
Note: Currently, it is “Thermo Fisher Scientific, Molecular ProbesTM, catalog number: C34551”.
RBC lysis buffer (BioLegend, catalog number: 42030 )
Mouse CD3+ T cell enrichment column kit (R&D Systems, catalog number: MTCC535 )
Mouse B cell enrichment kit (STEMCELL Technologies, catalog number: 19754A )
CD8a (Ly-2) MicroBeads (Miltenyi Biotec, catalog number: 130-049-401 )
Recombinant human IL-2 (rhIL-2) (NIH AIDS Reagent Program, catalog number: 11697 )
RPMI1640 (Thermo Fisher Scientific, GibcoTM, catalog number: 31800 )
10% heat-inactivated fetal bovine serum (FBS) (Siyaku, Wako Pure Chemical Industries, AusGeneX, catalog number: FBSUS500 )
Penicillin/streptomycin (Thermo Fisher Scientific, GibcoTM, catalog number: 15140 )
Non-essential amino acids (Thermo Fisher Scientific, GibcoTM, catalog number: 11140 )
Sodium pyruvate (Thermo Fisher Scientific, GibcoTM, catalog number: 11360 )
2-Mercaptoethanol (Sigma-Aldrich, catalog number: M-7522 )
Complete RPMI1640 medium (see Recipes)
Mouse T cell medium (see Recipes)
Equipment
Water Jacketed CO2 incubator (37 °C, 5% CO2) (Thermo Fisher Scientific)
FACSCanto instrument (BD Bioscience)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
Category
Immunology > Immune cell staining > Flow cytometry
Immunology > Immune cell function > Lymphocyte
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,759 | https://bio-protocol.org/exchange/protocoldetail?id=1759&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
In vitro Microtubule Binding Assay and Dissociation Constant Estimation
CK Christopher Kesten
RS René Schneider
SP Staffan Persson
Published: Vol 6, Iss 6, Mar 20, 2016
DOI: 10.21769/BioProtoc.1759 Views: 14084
Edited by: Arsalan Daudi
Reviewed by: Marta BjornsonTamara Vellosillo
Original Research Article:
The authors used this protocol in Sep 2015
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Sep 2015
Abstract
Microtubules (MTs) support an astonishing set of versatile cellular functions ranging from cell division, vesicle transport, and cell and tissue morphogenesis in various organisms. This versatility is in large mediated by MT-associated proteins (MAPs). The neuronal MAP Tau, for example, is stabilizing MTs in axons of the vertebrate nervous system and thus provides the basis for enduring axonal transport and the long life span of neurons (Mandelkow et al., 1994). Tau has been shown to bind to MTs directly in vitro and also to promote their nucleation from α-/β-tubulin subunits (Goode et al., 1994). Recently, we identified a plant-specific protein family called “companion of cellulose synthase” (CC), which was shown to bind MTs and enhance dynamics of the cortical MT array in plant cells under salt stress (Endler et al., 2015). The CCs were therefore hypothesized to help plant cells cope with stress conditions and thereby maintain biomass production under adverse growth conditions. Here, we provide detailed experimental information on in vitro MT binding assays, which allow assessing whether a protein of interest is binding to MTs. The assay utilizes the high molecular weight of MTs in a spin down approach and enables the determination of the dissociation constant Kd, a measure for the protein’s binding strength to MTs.
Materials and Reagents
Tubes, with Snap-On Cap, Polypropylene (1.5 ml, 11 x 38 mm) Natural (Beckman Coulter, catalog number: 357448 )
Note: Any ultracentrifuge tubes can be used. Make sure the volume of the tubes does not exceed 1.5 to 2 ml. Otherwise handling of the assay is unfeasible.
PIPES (Sigma-Aldrich, catalog number: P6757 )
Trizma® base (Sigma-Aldrich, catalog number: T1503 )
Magnesium chloride (MgCl2) (Sigma-Aldrich, catalog number: M8266 )
Ethylene glycol-bis(2-aminoethylether)-N, N, N’, N’-tetraacetic acid (EGTA) (Sigma-Aldrich, catalog number: E3889 )
Glycerol (Sigma-Aldrich, catalog number: G5516 )
Bovine Serum Albumin (BSA) (Sigma-Aldrich, catalog number: A2153 )
Paclitaxel (Taxol) (Sigma-Aldrich, catalog number: T7402 )
Dimethyl sulfoxide (DMSO) (Sigma-Aldrich, catalog number: 276855 )
Guanosine 5’-triphosphate sodium salt hydrate (GTP) (Sigma-Aldrich, catalog number: G8877 )
Tubulin protein, bovine, lyophilized (> 99% pure) (Cytoskeleton Inc., catalog number: TL238 ) or Tubulin protein (> 99% pure): porcine brain (Cytoskeleton Inc., catalog number: TL240 )
Microtubule-associated protein rich fraction: bovine brain (Cytoskeleton Inc., catalog number: MAPF )
NuPAGE Novex 4-12% Bis-Tris Protein Gels, 1.0 mm, 15-well (Thermo Fisher Scientific, catalog number: NP0323PK2 )
Note: Any other 1D protein gel able to separate tubulin and the protein of interest works as well.
Brilliant Blue G (Sigma-Aldrich, catalog number: 27815 )
Aluminum sulfate-(14-18)-hydrate (Sigma-Aldrich, catalog number: 368458 )
85% Orthophosphoric acid (Sigma-Aldrich, catalog number: 345245 )
Sodium dodecyl sulfate (Sigma-Aldrich, catalog number: L3771 )
Bromophenol blue (Sigma-Aldrich, catalog number: B0126 )
2-mercaptoethanol (Sigma-Aldrich, catalog number: M6250 )
Brinkley buffer 1980 (BRB80) (see Recipes)
BRB80 Cushion buffer (see Recipes)
Taxol stocks (see Recipes)
GTP stocks (see Recipes)
Tubulin stocks (see Recipes)
MAP fraction stocks (see Recipes)
BSA stocks (see Recipes)
Colloidal Coomassie stain (see Recipes)
Laemmli buffer (see Recipes)
Equipment
Optima MAX-XP Ultracentrifuge (Beckman Coulter, catalog number: 393315 )
TLA-55 Rotor Package, Fixed-Angle (45° Angle), Aluminium (Beckman Coulter, catalog number: 366725 )
Note: Any combination of ultracentrifuge and rotor can be used.
BIO RAD ChemiDOC MP Imaging System (Bio-Rad Laboratories, catalog number: 1708280 )
Note: A normal document scanner can be used to scan protein gels instead. The scanner needs to be able to export scans in an uncompressed format.
SDS-PAGE system to separate protein in 1D
Vortex mixer
Software
ImageJ (Fiji)
Spreadsheet software (e.g., Microsoft Excel)
GraphPad Prism Version 6.01 (or higher) (GraphPad Software Inc)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Kesten, C., Schneider, R. and Persson, S. (2016). In vitro Microtubule Binding Assay and Dissociation Constant Estimation. Bio-protocol 6(6): e1759. DOI: 10.21769/BioProtoc.1759.
Download Citation in RIS Format
Category
Plant Science > Plant cell biology > Cell structure
Plant Science > Plant developmental biology > General
Cell Biology > Cell structure > Cell adhesion
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
176 | https://bio-protocol.org/exchange/protocoldetail?id=176&type=1 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Cell Culture Transfection for Production and Purification of Wnt Ligands
LJ Lili Jing
Published: Jan 20, 2012
DOI: 10.21769/BioProtoc.176 Views: 20494
Download PDF
Ask a question
Favorite
Cited by
Abstract
Wnt ligand proteins are extremely difficult to purify and enrich in vitro. This protocol uses Wnt11r protein as an example to illustrate how to use 293T cells to produce secreted Wnt11r and collect it in vitro for further biochemical experiments.
Materials and Reagents
293T cells
0.1 M glycine-HCl (pH 3.5)
0.5 M Tris-HCl
Fetal bovine serum (FBS) (Life Technologies, Invitrogen™, catalog number: 10438-026 )
Dulbecco's modified eagle medium (DMEM) (high glucose) (Life Technologies, Invitrogen™, catalog number: 11965 )
Trypsin EDTA (Life Technologies, Invitrogen™, catalog number: 15050-065 )
PBS buffer (Life Technologies, Invitrogen™, catalog number: 14040-182 )
Anti-FLAG M2 (Sigma-Aldrich, catalog number: A2220 )
Pen/Strep (Sigma-Aldrich, catalog number: P4333 )
Effectene transfection regent (QIAGEN, catalog number: 301425 )
Media (see Recipes)
Equipment
Standard tabletop centrifuges
37 °C, 5% CO2 incubator
Water bath
50 ml conical tubes
Nitrocellulose membrane
100 mm Petri dishes
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2012 The Authors; exclusive licensee Bio-protocol LLC.
Category
Developmental Biology > Cell signaling > Ligand
Cell Biology > Cell isolation and culture > Transformation
Biochemistry > Protein > Fluorescence
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,760 | https://bio-protocol.org/exchange/protocoldetail?id=1760&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Ustilago maydis Virulence Assays in Maize
Amey Redkar
Gunther Doehlemann
Published: Vol 6, Iss 6, Mar 20, 2016
DOI: 10.21769/BioProtoc.1760 Views: 12161
Edited by: Marisa Rosa
Reviewed by: Pablo Bolanos-VillegasDennis Nürnberg
Original Research Article:
The authors used this protocol in Apr 2015
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Apr 2015
Abstract
The basidiomycetous smut fungus Ustilago maydis (U. maydis) infects all aerial parts of its host plant maize (Zea mays L.). Infection symptoms are seen in the form of prominent tumors on all aerial parts of maize, after the establishment of a biotrophic interaction with the host usually around 5-6 days post infection (dpi). The fungus colonizes the various developmentally distinct aerial organs at different stages of development to form these prominent symptoms. Although being a biotrophic plant pathogen, U. maydis can easily be cultivated under axenic conditions to produce a standardized inoculum. The infections can be carried out under laboratory conditions by syringe inoculation on all the aerial organs of maize. This protocol has been successfully utilized to infect all the aerial organs of maize and formulate the virulence assays in U. maydis making it an excellent model system to study phyto-pathological investigations (Schilling et al., 2014; Redkar et al., 2015).
Keywords: Ustilago Maize Tumors Disease
Materials and Reagents
1 ml syringes (Henke Sass-Wolf, catalog number: 5100.200V0 )
Needles (16 G, 40 mm) (Premier Healthcare & Hygiene, BD microlance, catalog number: 300637 )
50 ml Falcon tubes (Sigma-Aldrich, catalog number: T2318 )
Glass test tubes (Carl Roth GmbH + Co, catalog number: HA79.1 )
Soil (Frühstorfer Pikiererde T type soil) and Pots
Ustilago maydis strains
Note: The U. maydis wild-type or any transgenic strains are maintained as glycerol stock in -80 °C for long term storage. Every strain can be retrieved on a PDA plate.
Maize seeds (e.g., variety Early Golden Bantam or Gaspe Flint)
Note: The maize variety Early Golden Bantam is a standard maize line that requires around 4 weeks for the floral switch and development of the male inflorescence. The maize variety Gaspe Flint is a mutant maize that completes its life cycle in 35-38 days and hence has an early floral switch with the development of male inflorescence around 15 days after sowing. Hence this variety is suitable for floral infections with U. maydis.
Yeast extract (BD, Difco, catalog number: 210934 )
Peptone (BD, Difco, catalog number: 211830 )
Sucrose (Carl Roth GmbH + Co, catalog number: 9097.2 )
Double distilled water
2.4% Potato Dextrose Broth (BD, Difco, catalog number: 254920 )
2% agar (BD, Difco, catalog number: 214010 )
YEPSL medium (modified from Tsukada et al., 1988) (see Recipes)
Potato Dextrose Agar (PDA) plates (see Recipes)
Equipment
Greenhouse
Erlenmeyer flasks (250 ml)
Disposable cuvettes (Carl Roth GmbH + Co, catalog number: Y195.1 )
Incubator [e.g., Certomat BS-1 (B. Braun Biotech International)]
Centrifuge (Thermo Fisher Scientific)
Spectrophotometer [e.g. Ultrospec 3000 proUV/Visible (GE Healthcare)]
Knife
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Redkar, A. and Doehlemann, G. (2016). Ustilago maydis Virulence Assays in Maize. Bio-protocol 6(6): e1760. DOI: 10.21769/BioProtoc.1760.
Download Citation in RIS Format
Category
Plant Science > Plant immunity > Disease bioassay
Microbiology > Microbe-host interactions > Fungus
Microbiology > Microbe-host interactions > In vivo model
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,761 | https://bio-protocol.org/exchange/protocoldetail?id=1761&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
EdU Based DNA Synthesis and Cell Proliferation Assay in Maize Infected by the Smut Fungus Ustilago maydis
Amey Redkar
Gunther Doehlemann
Published: Vol 6, Iss 6, Mar 20, 2016
DOI: 10.21769/BioProtoc.1761 Views: 9169
Edited by: Marisa Rosa
Reviewed by: Pablo Bolanos-VillegasDennis Nürnberg
Original Research Article:
The authors used this protocol in Apr 2015
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Apr 2015
Abstract
The basidiomycetous smut fungus Ustilago maydis (U. maydis) infects all aerial parts of its host plant maize (Zea mays L.). Infection is seen in the form of prominent tumorous symptoms after the establishment of a biotrophic interaction with the host, usually around 5-6 days after infection. The fungus colonizes the various developmentally distinct aerial organs at different stages of development. Formation of tumors is coupled with the induction of host cell division. Activation of cell division can be understood as a measure of DNA synthesis which is triggered to induce rapid divisions in host cell. This developed protocol helps in tracking tumor induction in U. maydis by monitoring of DNA synthesis in planta. Infected leaves were treated with 5-ethynyl-2-deoxyuridine (EdU) at several stages of infection in the seedling leaves and labeled. EdU incorporation in the S phase cells, was visualized by attaching a fluorescent tag and non-dividing maize nuclei were stained with propidium iodide (PI). This protocol helped to understand the tumor development in U. maydis by confocal laser scanning microscopy (Kelliher and Walbot, 2011; Redkar et al., 2015)
Keywords: DNA Synthesis EdU Quantification Maize Ustilago maydis
Materials and Reagents
1 ml Syringes (Henke Sass-Wolff, catalog number: 5100.200V0 )
Needles (16 G, 40 mm) (Premier Healthcare & Hygiene, BD microlance, catalog number: 300637 )
Note: A needle of different thickness can be used depending upon the maize variety.
Falcon tubes (15 ml)
Microcentrifuge tubes
Click iT EdU imaging kit (Life Technologies, catalog number: 10337 )
Note: Currently, it is “Thermo Fisher Scientific, Molecular ProbesTM, catalog number: 10337”.
5-ethynyl- 2’-deoxyuridine (EdU)
Wheat germ Agglutinin-Alexa Fluor 488 (WGA AF 488)
Dimethylsulfoxide (DMSO)
Click iT EdU reaction buffer
Copper sulphate (CuSO4)
Click iT EdU buffer additive
Hoechst 33342
Phosphate buffer saline (PBS, pH 7.4) (Thermo Fisher Scientific, GibcoTM, catalog number: 10010023 )
Permeabilization reagent [e.g. 0.5% Triton X-100 in PBS (Thermo Fisher Scientific, Molecular ProbesTM, catalog number: R37602 )]
Bovine Serum Albumin (BSA) (Sigma-Aldrich, catalog number: A8531 )
100% Ethanol
Propidium iodide (PI) (Thermo Fisher Scientific, Molecular ProbesTM, catalog number: P1304MP )
Note: PI is toxic and may cause skin and respiratory irritation. Hence it is good to handle PI in the fume hood with the personal safety protection.
Double distilled water
2% BSA in PBS (pH 7.4) (See Recipes)
Propidium iodide stock solution (see Recipes)
Equipment
EdU Labeling chambers
Note: These plastic chambers are custom made to fit in the desired sample). An image showing the details of this chamber is shown below (Figure 1B). As an alternative to the labeling chambers 50 ml Falcon Tubes can also be used to labeling the leaves by dipping the infected leaf in 10 µM EdU.
Confocal microscope (e.g. Leica Microsystems, model: TCS-SP5 )
Vacuum Pump
Rocker
Software
Leica Imaging Software (Leica)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Redkar, A. and Doehlemann, G. (2016). EdU Based DNA Synthesis and Cell Proliferation Assay in Maize Infected by the Smut Fungus Ustilago maydis. Bio-protocol 6(6): e1761. DOI: 10.21769/BioProtoc.1761.
Download Citation in RIS Format
Category
Plant Science > Plant immunity > Disease bioassay
Microbiology > Microbe-host interactions > In vivo model
Molecular Biology > DNA > DNA synthesis
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,762 | https://bio-protocol.org/exchange/protocoldetail?id=1762&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
In vivo Bioluminescence Imaging of Luciferase-labeled Cancer Cells
Marc Carceles-Cordon
Irene Rodriguez-Fernandez
Veronica Rodriguez-Bravo
CC Carlos Cordon-Cardo
Josep Domingo-Domenech
Published: Vol 6, Iss 6, Mar 20, 2016
DOI: 10.21769/BioProtoc.1762 Views: 34380
Reviewed by: Vivien Jane Coulson-Thomas
Original Research Article:
The authors used this protocol in Feb 2015
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Feb 2015
Abstract
Over the past decade, in vivo bioluminescent imaging has emerged as a non-invasive and sensitive tool for studying ongoing biological processes within living organisms (Contag et al., 1997; Contag et al., 1998). Based on the detection and quantitation of the photons produced by the oxidation of luciferin by luciferase enzymes (Harvey, 1927), this technique has proved to be particularly useful in analyzing cancerous cells and monitoring tumor growth (Edinger et al., 1999; Sweeney et al., 1999; Vidal et al., 2015), providing a cost-effective insight into how the disease progresses in vivo, without the need of serial sacrifice of animals. This protocol describes in detail the procedure of obtaining luciferase-tagged tumors in immunocompromised mice that can be studied by bioluminescent imaging through the use of an IVIS Spectrum imager.
Keywords: Bioluminescent imaging In vivo Mice Cancer cells Tumour
Materials and Reagents
FalconTM Standard 10 cm2 Tissue Culture Dishes (Corning, catalog number: 353003 )
Syringe Filter 0.45 μm strainer (Corning, catalog number: CLS431225 )
22Rv1 prostate cancer cells (ATCC, catalog number: CRL-2505 )
NOD.Cg-Prkdcscid Il2rgtm1Wjl/SzJ (NSGTM) mice (Jackson Lab, catalog number: 00557 )
Phoenix-Ampho cells (ATCC, catalog number: CRL-3213 )
pLenti CMV Puro LUC (w168-1) (Addgene, catalog number: 17477 )
Helper pCMV-VSV-G (Addgene, catalog number: 8454 ) and pMD2.G (Addgene, catalog number: 12259 )
One Shot Stbl3 Competent E. coli (Thermo Fisher Scientific, InvitrogenTM, catalog number: C7373-03 )
LB Broth Medium (Thermo Fisher Scientific, BioReagentsTM, catalog number: BP1426-2 )
Ampicillin (Sigma-Aldrich, catalog number: A9393 )
QIAprep Spin Miniprep Kit (QIAGEN, catalog number: 27106 )
RPMI 1640 Medium (Thermo Fisher Scientific, GibcoTM, catalog number: 11875119 )
Dulbecco’s Phosphate-Buffered Saline (DPBS) 1x (Corning, catalog number: 21-031 )
jetPEI® DNA Transfection Agent (Polyplus-transfection, catalog number: 101-10N )
Penicillin-Streptomycin antibiotic (Thermo Fisher Scientific, GibcoTM, catalog number: 15140122 )
Polybrene® (Santa Cruz Biotechnology, catalog number: 134220 )
Isoflurane (Baxter, catalog number: 1001936040 )
Matrigel® Growth Factor Reduced (GFR) Basement Membrane Matrix (Corning, catalog number: 354230 )
D-luciferin (PerkinElmer, catalog number: 770504 )
Equipment
Thermo-block (Thermo Fisher Scientific, model: IsotempTM Digital and Analog Dry Bath Incubator )
Shaker incubator (Eppendorf AG, New Brunswick Scientific, model: Innova 44R Incubator/Shaker )
Table-top microcentrifuge (Eppendorf AG, model: centrifuge 5415R )
Spectrophotometer (Thermo Fisher Scientific, model: SPECTRONICTM 200 Spectrophotometer )
Incubator (Thermo Fisher Scientific, model: Heracell 150i )
Vortex (Scientific Industries, model: Vortex Genie 2 )
IVIS Spectrum imager (PerkinElmer, model: IVIS Spectrum Preclinical In Vivo Imaging System )
Software
Caliper LifeScience Living Image® in vivo imaging software (PerkinElmer, catalog number: 128110) (Lumina/Kinetic/XR/100, Living Image V4.1)
Figure 1. Schematic representation of the steps required to successfully tag cells with luciferase and perform in vivo imaging
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Carceles-Cordon, M., Rodriguez-Fernandez, I., Rodriguez-Bravo, V., Cordon-Cardo, C. and Domingo-Domenech, J. (2016). In vivo Bioluminescence Imaging of Luciferase-labeled Cancer Cells. Bio-protocol 6(6): e1762. DOI: 10.21769/BioProtoc.1762.
Download Citation in RIS Format
Category
Cancer Biology > General technique > Tumor formation
Cancer Biology > Tumor immunology > Tumor formation
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,763 | https://bio-protocol.org/exchange/protocoldetail?id=1763&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Extraction and Measurement of Strigolactones in Sorghum Roots
KY Kaori Yoneyama
XX Xiaonan Xie
TN Takahito Nomura
KY Koichi Yoneyama
Published: Vol 6, Iss 6, Mar 20, 2016
DOI: 10.21769/BioProtoc.1763 Views: 10046
Edited by: Arsalan Daudi
Reviewed by: Laia Armengot
Original Research Article:
The authors used this protocol in Mar 2015
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Mar 2015
Abstract
Strigolactones (SLs) are carotenoid-derived signaling chemicals containing two lactone moieties in their structures and induce seed germination of root parasitic plants, Striga and Orobanche spp. In the rhizosphere, SLs are essential host recognition signals not only for root parasitic plants but also for arbuscular mycorrhizal fungi. In plants, SLs play important roles as plant hormones regulating shoot and root architecture. Plants produce only trace amounts of chemically unstable SLs, which makes it difficult to determine SL contents in plant tissues. Here, we describe how to extract and quantify sorgomol and 5-deoxystrigol, major SLs produced in sorghum roots.
Keywords: Strigolactone LC-MS/MS Sorgomol 5-deoxystrigol Quantification
Materials and Reagents
50 ml Screw cap bottles (MonotaRO Co., Duran, catalog number: 371-05-20-52 )
Filter paper (90 mm) (MISUMI Corporation, Toyo Roshi Kaisha Ltd, catalog number: 00011090 )
pH indicator paper (Merck Millipore Corporation, catalog number: 109526 )
Spin column (Merck Millipore Corporation, catalog number: UFC3 0HV 000 )
Vials and caps (Chromacol, catalog number: 1030-41201 and 1030-42473 ) for LC-MS/MS analysis
Sorghum (Sorghum bicolor) plants grown under P or N deficiency
Note: Striga-tolerant sorghum cultivars may be obtained from International Crops Research Institute for the Semi-Arid Tropics (ICRISAT). We examined several sorghum “Hybrid” cultivars for their SL production, and there were essentially no quantitative and qualitative differences in SL production among them.
Ethyl acetate (KANTO CHEMICAL, catalog number: 14029-70 )
500 pg of d6-5-deoxystrigol (Ueno et al., 2010) added to each sample in our experiments
Note: Internal standards if available.
Anhydrous MgSO4 (KANTO CHEMICAL, catalog number: 25035-00 ) or Na2SO4 (Kanto Chemical, catalog number: 37280-00 )
Acetonitrile (KANTO CHEMICAL, catalog number: 01031-2B )
0.2 M K2HPO4 (see Recipes)
Acetonitrile with 0.1% acetic acid for LC-MS/MS (see Recipes)
Water with 0.1% acetic acid for LC-MS/MS (see Recipes)
Equipment
Funnel (45 mm diameter) (MonotaRO Co., AGJ, catalog number: 233-09-11-04 )
Erlenmeyer flasks (50 ml) (Sansyo, Iwaki, catalog number: 4980FK50 )
Separatory funnel (100 ml) (Iwaki, catalog number: 6402FS100R )
Evaporator flasks (300 ml, 50 ml) (Sibata, catalog number: 371-13-68-34 and 371-13-68-21 )
Pasteur pipette (Thermo Fisher Scientific, catalog number: 13-678-20C )
Mini-benchtop centrifuge (IKA, catalog number: 969-65-03-01 )
LC-MS/MS (AB Sciex, model: QTRAP 5500 )
UHPLC system (Shimadzu Corporation, model: Nexera X2 )
18 column (ϕ 2.1 x 150 mm, 2.6 μm) (Phenomenex, model: Kinetex C18 )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Yoneyama, K., Xie, X., Nomura, T. and Yoneyama, K. (2016). Extraction and Measurement of Strigolactones in Sorghum Roots. Bio-protocol 6(6): e1763. DOI: 10.21769/BioProtoc.1763.
Download Citation in RIS Format
Category
Plant Science > Plant biochemistry > Plant hormone
Plant Science > Plant metabolism > Metabolite profiling
Plant Science > Plant physiology > Endosymbiosis
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,764 | https://bio-protocol.org/exchange/protocoldetail?id=1764&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Assay of Arabinofuranosidase Activity in Maize Roots
Liudmila V. Kozlova
PM Polina V. Mikshina
TG Tatyana A. Gorshkova
Published: Vol 6, Iss 6, Mar 20, 2016
DOI: 10.21769/BioProtoc.1764 Views: 8778
Edited by: Zhaohui Liu
Reviewed by: Dušan VeličkovićAgnieszka Zienkiewicz
Original Research Article:
The authors used this protocol in May 2015
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
May 2015
Abstract
Root is a perfect model for studying the mechanisms of plant cell growth. Along the root length, several zones where cells are at different stages of development can be visualized (Figure 1). The dissection of the root on these zones allows the investigation of biochemical and genetic aspects of different growth steps. Maize primary root is much more massive than the root of other Monocots and thus more convenient for such type of research. Plant cell wall, mainly consisting of polysaccharides, plays an important role in plant life. Therefore, measurement of plant carbohydrate content and glycoside-modifying enzyme activity in plant cells has become an important aspect in plant physiology. One of the well-documented changes of hemicelluloses molecules during elongation growth of monocots cells is the decrease of arabinose substitution of glucuronoarabinoxylans. This might be caused by changes in synthesis of this polysaccharide or by the action of arabinofuranosidases. Here, we describe the protocol of spectrophotometric measuring of arabinofuranosidase activity in maize root by the rate of hydrolysis of chromogenic substrate (4-nitrophenyl α-L-arabinofuranoside).
Figure 1. Scheme of plant material collection for further arabinofuranosidase assay. Four-day-old dark-grown maize seedling (left panel). Different zones of primary maize root and corresponding stages of cell development, according to Kozlova et al. (2012) (right panel).
Materials and Reagents
Microcentrifuge tubes 1.5-2 ml
CarboPac PA1 analytical column (4 x 250 mm) (Thermo Fisher Scientific, catalog number: 035391 )
CarboPac PA1 guard column (4 x 50 mm) (Thermo Fisher Scientific, catalog number: 043096 )
Maize seedlings
4-nitrophenyl α-L-arabinofuranoside (4NPA) (Sigma-Aldrich, catalog number: N3641 )
4-nitrophenol (NP) (spectrophotometric grade) (Sigma-Aldrich, catalog number: 1048 )
DL-Dithiothreitol (Sigma-Aldrich, catalog number: D0632 )
Quick StartTM Bradford 1x Dye (Bio-Rad Laboratories, AbD Serotec®, catalog number: 5000205 )
Sodium Acetate Anhydrous (NaOAc) (Sigma-Aldrich, catalog number: W302406 )
Sodium hydroxide (NaOH) (Sigma-Aldrich, catalog number: 306576 )
L-(+)-ARABINOSE (Sigma-Aldrich, catalog number: W325501 )
NaN3
Na2CO3
NaOCl
Glacial acetic acid
Ice
MilliQ water (18 MΩ-cm)
5% (w/w) solution of NaOCl (see Recipes)
0.03% (w/w) NaN3 (see Recipes)
50 mM NaOAc buffer (pH 6.0) with 3 mM of dithiothreitol on 0.03% (w/w) NaN3 (see Recipes)
10 mM 4NPA (see Recipes)
1 M Na2CO3 (see Recipes)
Calibration solutions for NP (see Recipes)
50% (w/w) NaOH solution (see Recipes)
15 mM NaOH (buffer A for HPAEC) (see Recipes)
1 M NaOAc in 0.1 M NaOH (buffer B for HPAEC) (see Recipes)
Calibration solutions for arabinose (see Recipes)
Equipment
Spectrophotometer (required wavelength is 405 nm)
Thermostat (required temperature is 27 °C)
Microcentrifuge (required spin rate is 10,000 x g)
Thermoshaker (required temperature and spin rate are 37 °C and 600 rpm, correspondingly)
Note: Thermoshaker should be appropriate for incubation of microcentrifuge tubes.
Mini centrifuge/vortex
Analytical balance with 0.1 mg readability
Ion chromatography system DX-500 (Thermo Fisher Scientific, Dionex) equipped by electrochemical detector ED40, gradient pump GP40 and chromatography oven LC 30
Refrigerator (required temperature is -20 °C)
Automatic pipettes (100-1,000, 20-200 and 2-20 μl)
Mortar and pestle
Plastic grid and the tray of proper size
Note: The cell of grid should be approximately 1 cm2 or slightly bigger.
Software
PeakNet software (Thermo Fisher Scientific, Dionex, model: version 5.21)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Kozlova, L. V., Mikshina, P. V. and Gorshkova, T. A. (2016). Assay of Arabinofuranosidase Activity in Maize Roots. Bio-protocol 6(6): e1764. DOI: 10.21769/BioProtoc.1764.
Download Citation in RIS Format
Category
Plant Science > Plant biochemistry > Carbohydrate
Biochemistry > Carbohydrate > Polysaccharide
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,765 | https://bio-protocol.org/exchange/protocoldetail?id=1765&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Detection of Nitric Oxide and Determination of Nitrite Concentrations in Arabidopsis thaliana and Azospirilum brasilense
Noelia Foresi*
Natalia Correa-Aragunde*
Melina Amenta
Andrés Arruebarrena
Cecilia Creus
Lorenzo Lamattina
*Contributed equally to this work
Published: Vol 6, Iss 6, Mar 20, 2016
DOI: 10.21769/BioProtoc.1765 Views: 20056
Edited by: Tie Liu
Original Research Article:
The authors used this protocol in Jun 2015
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jun 2015
Abstract
There is now general agreement that nitric oxide (NO) is an important and almost ubiquitous signal in plants. Nevertheless, there are still many controversial observations and differing opinions on the importance and functions of NO in plants. Partly, this may be due to the difficulties in detecting and quantifying NO. Here, we summarize protocols for detecting NO and quantifying nitrite concentration in Arabidopsis seedlings. We also present a method to measure NO in biofilms formed by the plant growth promoting rhizobacteria Azospirillum brasilense (A. brasilense). NO in oxygen-containing aqueous solutions has a short half-life that is often attributed to a rapid oxidation to nitrite. Here we detail the use of the fluorescent probe DAF-FM DA and the electrochemical method for directly detecting and quantifying NO, respectively, and the Griess reagent to indirectly detect NO through its oxidized nitrite form. These protocols could be useful in a variety of cell types and plant tissues, as well as for microorganisms.
Keywords: Nitric oxide Nitrite Plants Rhizosphere microorganisms
Part I. In vitro determination of nitrite concentration
Materials and Reagents
Square Petri dishes (Deltalab, catalog number: 200204 )
Multi-well plates (96 well) (Deltalab, catalog number: 900010 )
10-day-old Arabidopsis ecotype Columbia Col-0
Murashige and Skoog Basal Salt Mixture (MS) (Sigma-Aldrich, catalog number: M5524 )
Sodium choride (NaCl) (Sigma-Aldrich, catalog number: S9888 )
Sulfanilamide (Sigma-Aldrich, catalog number: S9251 )
Note: The working solution is 1% (w/v) Sulfanilamide in 5% (v/v) phosphoric acid. Store at 4 ºC in the dark.
N-(1-Naphthyl)ethylenediamine dihydrochloride (NED) (Sigma-Aldrich, catalog number: 33461 )
Note: The working solution is 0.1% (w/v) NED in H2O. Store at 4 ºC in the dark.
Standard nitrite solution (Sigma-Aldrich, catalog number: 237213 )
Note: The working solution is 100 µM sodium nitrite in Milli Q water.
Sodium phosphate dibasic (Sigma-Aldrich, catalog number: S0876 )
Sodium phosphate monobasic (Sigma-Aldrich, catalog number: 0751 )
Buffer A (100 mM phosphate buffer, pH 7.4) (see Recipes)
Equipment
Centrifuge (Thermo Fisher Scientific, model: Sorvall Legend Micro 17R )
Elisa plate reader (Metrolab 980 microplate reader)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Foresi, N., Correa-Aragunde, N., Amenta, M., Arruebarrena, A., Creus, C. and Lamattina, L. (2016). Detection of Nitric Oxide and Determination of Nitrite Concentrations in Arabidopsis thaliana and Azospirilum brasilense. Bio-protocol 6(6): e1765. DOI: 10.21769/BioProtoc.1765.
Download Citation in RIS Format
Category
Plant Science > Plant physiology > Nutrition
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,766 | https://bio-protocol.org/exchange/protocoldetail?id=1766&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Detection of Protein Oxidative Activity Using Reduced RNase A
MG Magdalena Grzeszczuk
KB Katarzyna Bocian-Ostrzycka
AL Anna Lasica
E. Katarzyna Jagusztyn-Krynicka
Published: Vol 6, Iss 6, Mar 20, 2016
DOI: 10.21769/BioProtoc.1766 Views: 6739
Edited by: Valentine V Trotter
Reviewed by: Kristin Shingler
Original Research Article:
The authors used this protocol in Jul 2015
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jul 2015
Abstract
This assay allows to determine whether proteins possess oxidative activity-the ability to introduce disulfide bond in vitro. The substrate for potential oxidases is a ribonuclease A which, for its activity, needs 4 properly formed disulfide bonds (Raines, 1998).
RNase A activity can be detected by:
Monitoring the digestion of RNA (Lambert and Freedman, 1983);
Methylene Blue assay (Greiner-Stoeffele et al., 1996);
Analyzing the cleavage of the cyclic CMP (Lyles and Gilbert, 1991; Lyles and Gilbert, 1991).
We here describe method for measurements of oxidative activity, based on the cleavage of cCMP.
Oxidative activity will be tested by measuring spectrophotometrically RNase A cleavage of cyclic-2’, 3’-cytidinemonophosphate (cCMP) to 3’-cytidinemonophosphate (3’ CMP), which results in an increase in absorption at 296 nm.
The reaction equation: RNase A +2’ 3’-cCMP→RNase A + 3’ CMP.
Keywords: Thiol oxidoreductases Disulfide bonds Oxidative folding
Materials and Reagents
Flat-bottomed clear 96-well microplates (Optimum Line, catalog number: GP700 )
Ribonuclease A from bovine pancreas (RNase A) (store -20 °C) (Sigma-Aldrich, catalog number: R6513-10 mg )
Desalting columns-Biorad Econo-Pac 10DG Desalting Columns, 30 units (Bio-Rad Laboratories, catalog number: 7322010 )
Bio-Scale Mini Profinity IMAC Cartridges (Bio-Rad Laboratories, catalog number: 7324614 )
ENrichTM SEC 70 size exclusion columns (Bio-Rad Laboratories, catalog number: 7801070 )
PierceTM Protein Concentrators, 9K MWCO (7 ml) (Thermo Fisher Scientific, catalog number: 89884A ) or Amicon Ultra-4 Centrifugal Filter Unit with Ultracel-10 membrane (EMD Millipore Corporation, catalog number: UFC801008 )
Proteins of interest (purified to homogeneity proteins, concentration approx 7-8 mg/ml)
Phosphate buffered saline (PBS) (Sigma-Aldrich, catalog number: P4417-50TAB )
L-Glutathione oxidized disodium salt (GSSG) (Sigma-Aldrich, catalog number: G4626-100 mg )
L-Glutathione reduced (GSH) (Sigma-Aldrich, catalog number: G6529-1 g )
DL-Dithiothreitol (DTT) (AppliChem GmbH, catalog number: 3483-12-3 ; Sigma-Aldrich, catalog number: 43815-1 G )
Guanidine hydrochloride (Gdn-HCl) (AppliChem GmbH, catalog number: A11061000 )
1 M Tris (pH 8.0) (Eurx, catalog number: E0273-01 )
0.5 M EDTA (pH 8.0) (Eurx, catalog number: E240-01 )
DTNB (Ellman’s Reagent) (5, 5-dithio-bis-(2-nitrobenzoic acid) (Thermo Fisher Scientific, catalog number: 22582 )
Sodium phosphate dibasic (pH 8.0) (Sigma-Aldrich, catalog number: S3264-250 G )
Cytidine 2’:3’-cyclic monophosphate monosodium salt (cCMP) (store -20 °C) (Sigma-Aldrich, catalog number: C9630-100 mg )
2x Reaction buffer (see Recipes)
Reduction buffer (see Recipes)
Equipment
Plate reader (Tecan, Infinite®, model: 200 PRO series )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Grzeszczuk, M., Bocian-Ostrzycka, K., Lasica, A. and Jagusztyn-Krynicka, E. K. (2016). Detection of Protein Oxidative Activity Using Reduced RNase A. Bio-protocol 6(6): e1766. DOI: 10.21769/BioProtoc.1766.
Download Citation in RIS Format
Category
Microbiology > Microbial biochemistry > Protein
Biochemistry > Protein > Activity
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,767 | https://bio-protocol.org/exchange/protocoldetail?id=1767&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Sample Preparation for X-ray Micro-computed Tomography of Woody Plant Material and Associated Xylem Visualisation Techniques
NB Nicholas J. B. Brereton
Published: Vol 6, Iss 6, Mar 20, 2016
DOI: 10.21769/BioProtoc.1767 Views: 9517
Edited by: Samik Bhattacharya
Reviewed by: Pengpeng LiArsalan Daudi
Original Research Article:
The authors used this protocol in May 2015
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
May 2015
Abstract
Variation in the tissue structure of short rotation coppice (SRC) willow is a principle factor driving differences in lignocellulosic sugar yield yet much of the physiology and development of this tissue is unknown. Traditional sectioning can be both difficult and destructive in woody tissue; however, technology such as three dimensional X-ray micro-computational tomography (μCT) scanning can be used to move biological researchers beyond traditional two dimensional assessment of tissue variation without having to destructively cut cells. This technology does not replace classical microscopic techniques but rather can be carefully integrated with traditional methods to improve exploration of the world of plant biology in three dimensions. The procedures below outline preparation of willow for 3D X-ray μCT and associated xylem staining and visualisation techniques, in particular secondary xylem programmed-cell-death (PCD) delay during gelatinous fibre (g-fibre) development. Many of the staining techniques here are transferable to other woody species such as poplar and Eucalyptus.
Keywords: Micro-computed tomography Tension wood Cell wall staining Xylem visualisation Plant histology
Materials and Reagents
Glass slides
Cover slips
48 well plates
Razor blades
Short rotation coppice (SRC) willow trees [cultivar Resolution-pedigree: {S. viminalis. x (S. viminalis. x S. schwerinii SW930812)] x [S. viminalis. x (S. viminalis. x S. schwerinii ‘Quest’)]}
37% Formaldehyde (36.5-38% in H2O) (Sigma-Aldrich, catalog number: F8775 )
Acetic acid (≥ 99.7%) (Sigma-Aldrich, catalog number: 320099 )
Ethanol
FAA: 3.7% formaldehyde, 5% acetic acid and 47.5% ethanol
Oasis® floral foam (OASIS Floral Products) (http://oasisfloralproducts.com/)
Safranin-O solution (Sigma-Aldrich, catalog number: HT90432 )
DPX Mountant for histology (Sigma-Aldrich, catalog number: 06522 )
Note: This product is named “Slide mounting medium (p-Xylene-bis(N-pyridinium bromide))” at Sigma-Aldrich.
Distilled water
β-D-glucosyl Yariv reagent (Biosupplies Australia Pty Ltd., catalog number: 100-2 )
Histoclear clearing agent (National Diagnostics, catalog number: HS-200 )
Chlorazol black E/direct black 38 (Sigma-Aldrich, catalog number: C1144 )
Equipment
Reichert Sliding Microtome
Tweezers (for handling section)
Light microscope
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Brereton, N. J. B. (2016). Sample Preparation for X-ray Micro-computed Tomography of Woody Plant Material and Associated Xylem Visualisation Techniques. Bio-protocol 6(6): e1767. DOI: 10.21769/BioProtoc.1767.
Download Citation in RIS Format
Category
Plant Science > Plant cell biology > Tissue analysis
Plant Science > Plant physiology > Tissue analysis
Cell Biology > Tissue analysis
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,768 | https://bio-protocol.org/exchange/protocoldetail?id=1768&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Mouse Auditory Brainstem Response Testing
Omar Akil
AO A. E. Oursler
Kevin Fan
Lawrence R. Lustig
Published: Vol 6, Iss 6, Mar 20, 2016
DOI: 10.21769/BioProtoc.1768 Views: 16635
Edited by: Oneil G. Bhalala
Reviewed by: Pascal Fossat
Original Research Article:
The authors used this protocol in Feb 2015
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Feb 2015
Abstract
The auditory brainstem response (ABR) test provides information about the inner ear (cochlea) and the central pathways for hearing. The ABR reflects the electrical responses of both the cochlear ganglion neurons and the nuclei of the central auditory pathway to sound stimulation (Zhou et al., 2006; Burkard et al., 2007). The ABR contains 5 identifiable wave forms, labeled as I-V. Wave I represents the summated response from the spiral ganglion and auditory nerve while waves II-V represent responses from the ascending auditory pathway. The ABR is recorded via electrodes placed on the scalp of an anesthetized animal. ABR thresholds refer to the lowest sound pressure level (SPL) that can generate identifiable electrical response waves.
This protocol describes the process of measuring the ABR of small rodents (mouse, rat, guinea pig, etc.), including anesthetizing the mouse, placing the electrodes on the scalp, recording click and tone burst stimuli and reading the obtained waveforms for ABR threshold values. As technology continues to evolve, ABR will likely provide more qualitative and quantitative information regarding the function of the auditory nerve and brainstem pathways involved in hearing.
Keywords: Mouse Inner ear Cochlea Hearing ABR
Materials and Reagents
1 ml insulin syringe (Thermo Fisher Scientific, BD, catalog number: 22-253-260 )
Precision Glide Needles (30 G x 1/2) (BD, catalog number: 305106 )
Disposable monopolar needle electrodes for electromyography (Rochester Electro-Medical, catalog number: 016386-0 )
Ketamine hydrochloride
Ketaset (Ketamine HCl Injection) (Drugs, catalog number: NDC-0856-2013-01 )
Henry Schein (100 mg/ml solution) (NSN, catalog number: 304401 )
Xylazine hydrochloride (Sedative and Analgesic solution) (20 mg/ml solution) (LLOYD, AnaSed INJECTION, catalog number: 139-236 )
Sterile bi-distilled water
Povidone-iodine 5% (Betadine) antiseptic-Microbicide solution (purchased from any pharmacy)
Dexamethasone ophthalmic ointment (TobraDex) (Alcon)
70% Ethanol (Surface disinfectant)
Mixture of ketamine hydrochloride and xylazine hydrochloride (see Recipes)
Equipment
Disposable monopolar needle electrodes for electromyography (Rochester Electro Medical, catalog number: 016386-0)
Computer with BioSig32 Windows Application Installed
TDT BioSigIII system (TDT)
TD speakers (TDT)
Sound proof chamber (Industrial Acoustics Company, Controlled Acoustical Environment)
Non-Electric Heating Pad (to maintain animal body temperature during the test) (Braintree Scientific, Deltaphase Isothermal Pad, model: 39DP )
CONAIR Moist Electric Heating Pad (to maintain animal body temperature during the recovery) (Amazon)
Rectal Probe for body temperature monitoring (Physitemp Instruments, model: Thermalert TH-5 physitemp )
Clean empty cages
Tweezers style 5 (Ted Pella, catalog number: 5665 )
Software
BioSig32 software (coming with the TDT BioSig III system)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
How to cite： Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Akil, O., Oursler, A. E., Fan, K. and Lustig, L. R. (2016). Mouse Auditory Brainstem Response Testing. Bio-protocol 6(6): e1768. DOI: 10.21769/BioProtoc.1768.
Akil, O., Sun, Y., Vijayakumar, S., Zhang, W., Ku, T., Lee, C. K., Jones, S., Grabowski, G. A. and Lustig, L. R. (2015). Spiral ganglion degeneration and hearing loss as a consequence of satellite cell death in saposin B-deficient mice. J Neurosci 35(7): 3263-3275.
Download Citation in RIS Format
Category
Neuroscience > Sensory and motor systems
Neuroscience > Neuroanatomy and circuitry > Animal model
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,769 | https://bio-protocol.org/exchange/protocoldetail?id=1769&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
In vitro Fluorescent Matrix Degradation Assay for Entamoeba histolytica
Merlyn Emmanuel
SD Sunando Datta
Published: Vol 6, Iss 6, Mar 20, 2016
DOI: 10.21769/BioProtoc.1769 Views: 8306
Edited by: Fanglian He
Original Research Article:
The authors used this protocol in Feb 2015
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Feb 2015
Abstract
Fluorescent matrix degradation assay is a popular and widely used assay in the field of invadopodium biology (Artym et al., 2009). Matrix remodeling and degradation can be observed under both physiological and pathological conditions. Cancer cells extensively remodel and degrade the underlying matrix by employing actin-rich protrusive structures called invadosomes. Similar structures are formed by the protozoan parasite Entamoeba histolytica (E. histolytica), upon coming in contact with fibronectin, a major component of the host (extracellular matrix) ECM. Here, we describe a similar assay to measure matrix degradation by Entamoeba histolytica.
Materials and Reagents
Sterile disposable pipettes (10 ml and 5 ml)
Aluminum foil
Four well tissue culture plates (Thermo Fisher Scientific, NuncTM, catalog number: 176740 )
Round Glass coverslips (12 mm) (Bellco Glass, catalog number: 1943-10012A )
Parafilm
Entamoeba histolytica HM1:IMSS strain (a kind gift from Prof. Alok Bhattacharya, School of Life Sciences, Jawaharlal Nehru University, New Delhi, India)
Fluorescently labeled fibronectin (CYTOSKELETON, catalog number: FNR02 )
Glutaraldehyde (25% stock solution in dH2O, EM grade) (Sigma-Aldrich, catalog number: G5882 )
Sodium Borohydride (NaBH4) (Sigma-Aldrich, catalog number: 452882 )
Poly-L-lysine (Sigma-Aldrich, catalog number: P8920 )
70% ethanol (Merck Millipore Corporation)
Alexa 568 Phalloidin (Thermo Fisher Scientific, Molecular ProbesTM, catalog number: A12380 )
1% BSA (Sigma-Aldrich, catalog number: A-7906 ) in PBS
Mowiol mounting medium (Sigma-Aldrich, catalog number: 81381 )
Complete BI medium (incomplete supplemented with 15%, Adult Bovine Serum)
GasPakTM EZ Anaerobe Pouch System (BD Biosciences, catalog number: 260683 )
Sterile dH2O
Sodium chloride (NaCl) (Sigma-Aldrich, catalog number: S7653 )
KCl
Potassium phosphate monobasic (Na2HPO4) (Sigma-Aldrich, catalog number: P5655 )
Potassium phosphate dibasic trihydrate (KH2PO4) (Sigma-Aldrich, catalog number: P5504 )
NaOH
Hilyte 488 Fibronectin
Biosate peptone BBL (BD Biosciences, catalog number: 211862 )
Glucose (Dextrose) (Sigma-Aldrich, catalog number: D9434 )
L-cysteine (Sigma-Aldrich, catalog number: C1276 )
L-ascorbic acid (Sigma-Aldrich, catalog number: A5960 )
Ferric ammonium citrate (Sigma-Aldrich, catalog number: F5879 )
10x phosphate-buffered saline (PBS) (see Recipes)
0.01% poly-L-lysine solution (see Recipes)
0.5% glutaraldehyde solution (see Recipes)
5 mg/ml sodium borohydride (see Recipes)
4% paraformaldehyde (PFA) (see Recipes)
1% BSA in PBS (see Recipes)
0.1% Triton-X-100 (see Recipes)
100 μg/ml Hilyte488 Fibronectin (FNR02) (see Recipes)
Basal incomplete medium (see Recipes)
Complete medium (see Recipes)
Equipment
Laminar air flow hood
37 °C incubator
Forceps
Moist chamber
Vacuum Pump and glass Pasteur pipettes with tubings
Table top centrifuge with swinging bucket rotor
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Emmanuel, M. and Datta, S. (2016). In vitro Fluorescent Matrix Degradation Assay for Entamoeba histolytica. Bio-protocol 6(6): e1769. DOI: 10.21769/BioProtoc.1769.
Download Citation in RIS Format
Category
Microbiology > Microbe-host interactions > In vivo model
Cell Biology > Cell imaging > Fluorescence
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
177 | https://bio-protocol.org/exchange/protocoldetail?id=177&type=1 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
A General Protocol for GST Pull-down
LJ Lili Jing
Published: Jan 20, 2012
DOI: 10.21769/BioProtoc.177 Views: 75328
Download PDF
Ask a question
Favorite
Cited by
Abstract
GST-Pull down assay is an effective way to examine the direct binding of two proteins in vitro. This protocol is based on GST pull down system from GE healthcare, and uses the binding of unplugged/MuSK receptor and Wnt ligand as an example to illustrate the detailed procedure.
Materials and Reagents
pGEX plasmid (GE Healthcare Dharmacon)
IPTG
PBS
Isoproponal
Ethanol
TritonTM X-100
SDS-PAGE
Tryptone
NaCl
NaOH
Agar
Tris-HCl
PMSF
NaVO3
NP-40 w
Sodium-deoxycholate
Commassive blue staining (Ezblue gel staining reagent) (Sigma-Aldrich, catalog number: G1041 )
lysozyme (Sigma-Aldrich, catalog number: L7651 )
Glutathione sepharose 4B (GE Healthcare Dharmacon, catalog number: 17-0756-01 )
Protease inhibitors (Sigma-Aldrich, catalog number: P2741 )
Phosphatase inhibitors (Sigma-Aldrich, catalog number: P2850 / P5726 )
2x YTA (see Recipes)
Elution buffer (see Recipes)
Lysis buffer (see Recipes)
Equipment
Standard tabletop centrifuges
Shaker
Ultra Centrifugal Filter (EMD Millipore, catalog number: UFC900308 )
Water bath
Sonicator
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2012 The Authors; exclusive licensee Bio-protocol LLC.
Category
Biochemistry > Protein > Immunodetection
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,770 | https://bio-protocol.org/exchange/protocoldetail?id=1770&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
In vitro Differentiation of Murine Innate Lymphoid Cells from Common Lymphoid Progenitor Cells
CS Corey Seehus
JK Jonathan Kaye
Published: Vol 6, Iss 6, Mar 20, 2016
DOI: 10.21769/BioProtoc.1770 Views: 9388
Edited by: Ivan Zanoni
Reviewed by: Kathrin SutterMarielle Cavrois
Original Research Article:
The authors used this protocol in May 2015
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
May 2015
Abstract
Subtypes of innate lymphoid cells (ILC), defined based on their cytokine secretion profiles and transcription factor expression, are important for host protection from pathogens and maintaining tissue homeostasis. ILCs develop from common lymphoid progenitors (CLP) in the bone marrow. Using the methods described here, we have previously shown that loss of the transcriptional regulator TOX (Thymocyte-selection associated HMG-box protein) leads to specific changes in ILC development and differentiation. Here, we describe how to obtain ILCs from in vivo isolated CLP grown in vitro.
Materials and Reagents
5 ml Syringe (BD biosciences, catalog number: 309646 )
25 G x 5/8 Needle (BD biosciences, catalog number: 305122 )
15 ml Conical Tubes (Corning, Falcon, catalog number: 352097 )
50 ml Conical Tubes (USA Scientific, catalog number: 1500-1811 )
60 x 15 mm culture dish (Corning, Falcon, catalog number: 351007 )
Sterile 48 well plates, tissue culture treated (Greiner Bio-One GmbH, catalog number: 677180 )
5 ml and 10 ml serological pipets
OP9-DL1 cells (not commercially available, must privately request from Dr. J. C. Zuniga-Pflucker, University of Toronto, Sunnybrook Research Institute)
OP9-DL1 stromal cells (OP9-DL1 made by and obtained from Dr. J. C. Zuniga-Pflucker)
Antibodies (all purchased from eBiosciences, Affymetrix)
Blocking antibody Anti-CD16/CD32 Functional Grade Purified (clone 93) (eBioscience, Affymetrix, catalog number: 16-0161 )
Anti-mouse lineage antibodies (concentrations as per vendor instructions), Fluorochromes were conjugated to FITC or APC (Lineage markers), APC-Cy7 (IL7Rα), PerCP eFluor® 710 (Flt-3) and PE-Cy7 (Ly6A/E)
CD4 (clone 6K1.5)
CD8α (53-6.7)
CD3ε (145-2C11)
CD11b (M1/70)
CD11c (N418)
CD19 (1D3)
B220 (RA3-6B2)
Gr-1 (RB6-8C5)
Nk1.1 (PK136)
Ter-119 (TER-119)
Thy1.2 (30-H12)
Common lymphoid progenitor defining cell surface antibodies (concentrations as per vendor instructions)
Flt3 (A2F10)
IL7Rα (A7R34)
Ly6A/E (Sca-1) (D7)
Dulbecco’s Phosphate Buffered Saline (DPBS) (Thermo Fisher Scientific, GibcoTM, catalog number: 14190-144 )
Dulbecco’s Modified Eagle Medium, High Glucose (DMEM) (Thermo Fisher Scientific, GibcoTM, catalog number: 11965-092 )
Minimum Essential Media (MEM) alpha, No Nucleosides (Thermo Fisher Scientific, GibcoTM, catalog number: 12561-049 )
Fetal Bovine Serum (FBS) (Omega Scientific, catalog number: FB-01 )
100x Penicillin-Streptomycin (PSA) (Thermo Fisher Scientific, GibcoTM, catalog number: 10378-016 )
Sodium Azide (Sigma-Aldrich, catalog number: S2002 )
2-mercaptoethanol (Sigma-Aldrich, catalog number: M7522 )
Sodium pyruvate (Thermo Fisher Scientific, GibcoTM, catalog number: 11360-070 )
MEM nonessential amino acids (Mediatech, Corning® glutagroTM, catalog number: 25-025-CI )
HEPES (Thermo Fisher Scientific, GibcoTM, catalog number: 15630 )
Trypsin-EDTA (0.05%), phenol red (Thermo Fisher Scientific, GibcoTM, catalog number: 25300-054 )
Bovine Serum Albumin (BSA) (Sigma-Aldrich, catalog number: A8022 )
Recombinant mouse Interleukin 7 (IL-7) carrier free (Biolegend, catalog number: 577802 )
Recombinant mouse Stem Cell Factor (SCF) carrier free (Biolegend, catalog number: 579702 )
Recombinant mouse IL-33 carrier free (Biolegend, catalog number: 580504 )
Mitomycin C (Santa Cruz Biotechnology, catalog number: sc-3514 )
Phosphate buffered saline (PBS)
NaN3
FACS Buffer (see Recipes)
Sterile Sorting Buffer (see Recipes)
Innate lymphoid cell media (ILC media) (see Recipes)
OP9-DL1 media (see Recipes)
Equipment
Sterile Biosafety cabinet
Incubator set at 37 °C, 5% CO2
Vortex Genie 2 (Thermo Fisher Scientific, catalog number: 12-812 )
Sterile FACS Tubes
Cell sorter (BD Biosciences, model: FACS aria III )
Reichert Bright-Line Hemocytometer (Sigma-Aldrich, catalog number: Z359629 )
Dissection scissors (Roboz Surgical Instrument Co., catalog number: RS-5912 )
Forceps (Roboz Surgical Instrument Co., catalog number: RS-5137 )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Seehus, C. and Kaye, J. (2016). In vitro Differentiation of Murine Innate Lymphoid Cells from Common Lymphoid Progenitor Cells. Bio-protocol 6(6): e1770. DOI: 10.21769/BioProtoc.1770.
Download Citation in RIS Format
Category
Immunology > Immune cell isolation > Maintenance and differentiation
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
Subsets and Splits
No saved queries yet
Save your SQL queries to embed, download, and access them later. Queries will appear here once saved.