article
stringlengths 0
682k
| abstract
stringlengths 146
3.69k
|
|---|---|
(sun tzu, the art of war, c.500 bc) the challenge of conducting high - quality clinical studies in the critically ill population is widely recognised. heterogeneity in patient populations and clinical practice, diagnostic uncertainty, concerns with consent, and the overlapping nature of the presenting illnesses are amongst the inherent difficulties. influential studies in this population therefore increasingly involve multicentre, collaborative efforts using rigorously defined inclusion criteria and outcome measures such projects aim to obviate the aforementioned difficulties and to reduce the influence of individual intensive care units (icus) and case - mix variations on the findings. ultimately, the quality of the data justifies the logistical challenge involved. for this reason, the recent article from the newly - formed irish critical care trials group is a welcome announcement of a further such alliance. the data presented describe 1,029 patients admitted to icu services in a 10-week period in 2006, covering a slight majority of all icu beds in ireland. the data include national specialist centres and university teaching hospitals, as well as regional units. the overall pattern depicts a busy service, with 78% of admissions being emergent in nature, a mean sequential organ failure assessment score of 5.4, and 70% of patients needing mechanical ventilation. previous research in ireland showing an icu bed occupancy rate of 97%, an unscheduled discharge rate of 23%, and frequent cancellation of elective surgery is consistent with this pattern. the icu readmission rate of 7.5% is perhaps attributable to these service realities as indeed may be the failure to collect data in four of the 14 units that entered the study, including 23% of relevant patients. while accepting that the missing patient data compromise the validity of the findings, the outcomes nonetheless appear compatible with international standards and indeed are broadly indicative of the success of modern intensive care medicine. the outcomes in the subgroups are more striking : over 75% of readmitted patients survived and, of the 93 patients with five or six systems failing on admission, just over one - half survived. compatibility with international outcomes is perhaps most evident from those diagnostic categories where standard, consensus definitions are established. for severe sepsis, the icu mortality of 24% compares with a reported 35% in england, wales and northern ireland for severe sepsis in the first 24 hours. for acute lung injury / acute respiratory distress syndrome, the irish mortality was 32% and the irish critical care trials group has previously shown that this is consistent with modern international studies in the protective ventilation era. although the numbers are relatively small (n = 289), an icu mortality of 38% for renal failure compares unfavourably with the hospital mortality of 26.3% reported by hoste and colleagues using the same criteria. nonetheless, the study arguably further validates these rifle (risk - injury - failure - loss - end stage) descriptors as outcome predictors in acute renal dysfunction. seasonal and regional variations can not be detected as data from a short collection period are pooled together. the use of icu mortality alone as a measure of outcome is not ideal, and more meaningful outcome assessment tools including hospital mortality should be utilised in future projects ; for example, patients who were refused readmission and who might have gone on to die in hospital wards will appear as survivors in such a crude analysis. future scientific publications should also avoid the irritation of new data introduction in the discussion of the findings. the value of the present data will be more fully realised when the irish critical care trials group produces further, hypothesis - testing studies. having taken advice from the anzics critical care trials group, the irish critical care trials group set out to achieve this epidemiological study to provide baseline information for research planning. the data provide insight into disease prevalence (for example, of acute respiratory distress syndrome), and enable planning for the study duration and resource allocation once power analysis has indicated the size of the study population required. the demonstration of the willingness of team members to cooperate and of the capacity of information systems to gather and collate such information is a further key to such studies and collaborations. the authors identify an urgent requirement for audit resources to maintain the ambition shown by this study. participation in the uk 's intensive care national audit and research centre would be one option, opening up the possibility of a uk / irish database. the ability demonstrated by the irish critical care trials group study to establish a research ethos that straddles the relatively contentious border linking the irish republic with the united kingdom is scientifically encouraging. icu : intensive care unit ; rifle : risk - injury - failure - loss - end stage. | quality research, requiring large numbers of participants, in the intensive care unit (icu) population requires multicentre collaboration. although logistically challenging, this methodology reduces the influence of individual units and has greater validity and broader relevance to patients and practitioners. the nascent irish critical care trials group opens additional such opportunities. in the accompanying epidemiologic study, the group present data gathered over 10 weeks of 2006 describing 1,029 patients, from 10 irish icus representing over one - half of ireland 's critical care bed capacity. the data depict a busy service, with 78% of admissions being emergent and with a moderately high (7%) readmission rate. while recognising that there were missing data, the outcomes in organ failure and sepsis where international definitions exist and the icu survival rate (83%) were consistent with international standards. the achievement of this planned first epidemiological step lays the foundation for the conduct of prospective scientific studies. these studies might occur in ireland or in cooperation with other audit / scientific groups such as the uk 's intensive care national audit and research centre, the european critical care research network, or others. this brings us a small step closer to the prospect of global, high - volume studies in critical care. |
we performed the pituitary gland biopsy and histochemical examination glucocorticoid therapy in a subject with igg4-related hypophysitis. this case report provides the possibility that igg4 level is decreased spontaneously or with a physiological dose of glucocorticoid therapy. we reported the clinical course of igg4-related hypophysitis without a high - dose glucocorticoid treatment, although there were a few reports about the retrospective examination. although the patient had still higher igg4 level compared to normal range, his clinical symptom disappeared and his laboratory data were improved. we should keep in mind the possibility of igg4-related hypophysitis when we examine one of the uncertain causes of a hypopituitarism including adrenal insufficiency, hypogonadism and hypothyroidism. igg4-related disease is a multi- or single - organ disorder accompanied by the increase of serum igg4 level (1). recently, clinical characteristics of igg4-related hypophysitis have emerged as a part of systemic igg4-related disease (2). to diagnose igg4-related disease, histopathology is the key, and one of the major features of this disease is a dense lymphoplasmacytic infiltrate rich in igg4-positive plasma cells. the recent reports showed that igg4-related hypophysitis might be detected in 30% of hypophysitis cases and 4% of all hypopituitarism and/or diabetes insipidus (di) cases (3). however, the pathogenesis of igg4-related hypophysitis remains unclear due to the limited number of case reports because of certain limitations in this technique. generally, it has been thought that a high - dose glucocorticoid treatment is effective for igg4-related diseases, and thus, many clinicians have started the therapy with prednisolone in a dose of 0.61.0 mg / kg daily. after 24 weeks, the dose is tapered by 5 mg every 12 weeks according to clinical responses (4). a 76-year - old man was hospitalized due to persistent general fatigue and appetite loss since approximately 2 months before. on admission, his vital signs were normal (temperature : 36.6c ; blood pressure was 98/50 mmhg and heart rate was 62 beats / min). he had eosinophilia (1098/l, 19.1%) and hyponatremia (na : 129 meq / l (reference range : 137146 meq / l)), and his fasting plasma glucose level was 69 mg / dl. laboratory analyses showed this patient had a hypopituitarism including adrenal insufficiency (acth : 13.2 pg / ml (7.263.3 pg / ml), cortisol : 1.2 g / dl (4.521.1 g / dl)), hypogonadism (lh < 0.10 iu / ml (0.795.72 iu / ml), fsh : 2.13 iu / ml (2.008.30 iu / ml), testosterone 0.03 ng / ml (1.318.71 ng / ml)), hypothyroidism (tsh : 0.036 iu / ml (0.4006.000 iu / ml), ft4 : 0.56 ng / ml (0.801.60 ng / dl)) and elevated prolactin level (prl : 19.3 ng / ml (3.612.8 ng / ml)). the posterior pituitary hormone antidiuretic hormone (adh) level (1.0 pg / ml (0.04.2 pg / ml)), the passage of volumes (1900 ml/24 h), the urine osmolality (264 mosmol / kg) and the serum osmolality (291 mosmol / kg) were within normal range, and he did not have diabetes insipidus. cortisol response to crh was also not preserved in this subject although acth response to crh was observed (fig. in addition, in ghrp-2 test, gh response was also poor in this subject (peak gh level : 4.55 ng / ml). serum igg and igg4 levels were markedly elevated : 2800 mg / dl (10001800 mg / dl) and 1030 mg / dl (4.8105.0 mg / dl) respectively. furthermore, pituitary - enhanced magnetic resonance imaging (mri) showed swelling of the stalk and anterior lobe of his pituitary (fig. next, we performed a biopsy from the pituitary gland via the sphenoid sinus 2 weeks after admission. immunohistochemical staining of the two part specimens of anterior gland revealed abundant igg4-positive plasma cell infiltration (fig. 3a and b), although we failed to evaluate the specimens of dura mater due to tissue degradation during the process of sample collection. based on such findings any other organ was not involved in igg4-related disease including autoimmune pancreatitis, mikulicz s disease and there was not any other autoimmune disease (ana < 5.0 (), rheumatoid factor < 15 iu / ml, anti - tpo antibodies 9.9 iu / ml, anti - thyroglobulin antibodies < 10.0 iu / ml, ss - a / ro antibodies < 1.0 u / ml, ss - b / la antibodies < 1.0 u / ml and serum pituitary cell antibody negative). (a) swelling of the stalk and anterior lobe of patient pituitary on admission. (a) the hematoxylin and eosin staining of the pituitary gland (magnification 20). there was about 30% of igg4-positive plasma cells, which were accounted for igg - positive cells. (a) responses of trh to i.v. injection of trh (500 g). injection of crh (100 g). enhanced magnetic resonance imaging (mri) with t1-weighted image. (a) swelling of the stalk and anterior lobe of patient pituitary on admission. (b) the improvement of such swelling of them 3 months later. (a) the hematoxylin and eosin staining of the pituitary gland (magnification 20). there was about 30% of igg4-positive plasma cells, which were accounted for igg - positive cells. in general, clinical manifestations of igg4-related disease therefore, glucocorticoid dose is usually tapered after a few days according to clinical response in each patient. to the best of our knowledge, however, no randomized treatment trials have been done yet, although there were a few reports about the retrospective examination. therefore, we do not have enough information about the best therapy for igg4-related hypophysitis as well as the clinical course of pituitary function and image in igg4-related hypophysitis. in this case, his clinical symptoms (general fatigue and appetite loss) were markedly reduced, and some laboratory data were normalized as follows : fasting plasma glucose, 91 mg / dl and na, 138 meq / l. therefore, although this subject showed hypopituitarism including adrenal insufficiency, it seemed that the symptoms were markedly reduced before starting steroid therapy. these data suggest the possibility that the symptoms of igg4-related hypophysitis are spontaneously reduced without steroid therapy. in consideration of such improvement, we started 10 mg / day of hydrocortisone as physiological replacement and 25 g / day of levothyroxine and continued the same dose for 3 months. serum igg and igg4 levels were decreased as follows : igg : 2800 mg / dl ; igg4 : 1030 mg / dl (at the beginning) ; igg : 1778 mg / dl ; igg4 : 527 mg / dl (1 month later) ; igg : 1924 mg / dl ; igg4 : 674 mg / dl 2 months later) ; igg : 2013 mg / dl and igg4 : 580 mg / dl (3 months later). consequently, as shown in table 1, various endocrine hormone levels such as acth, cortisol, tsh, ft4 and prl levels were normalized, although lh, fsh and testosterone levels remained low. furthermore, as shown in fig. 1a, tsh response to trh table 1endocrine hormone levels on admission and 3 months later.on admission3 months laternormal rangeacth, pg / ml13.221.07.263.2cortisol, g / dl1.212.04.521.1tsh, iu / ml0.0360.8320.4006.000ft4, ng / dl0.560.920.801.60lh, iu / ml<0.10<0.100.795.72fsh, iu / ml2.130.632.008.30testosterone, ng / ml<0.03n.d.1.318.71gh, ng / ml0.830.27<0.13igf-1, ng / ml406850181prl, ng / ml19.37.03.612.8adh, pg / ml1.01.00.04.2 endocrine hormone levels on admission and 3 months later. herein we report a case of igg4-related hypophysitis that we diagnosed with the pituitary gland biopsy. in this case, the anterior pituitary response to trh was improved, and serum igg and igg4 levels were decreased. the response of cortisol to crh also became better 3 months later, although the response was not completely normalized. indeed, cortisol level at 90 min was increased to 18.0 g / dl, but cortisol level at 30 or 60 min was < 18.1 g / dl, suggesting that this subject still had mild adrenal insufficiency (5). first, we performed the pituitary gland biopsy and histochemical examination in a subject with igg4-related hypophysitis. second, we reported the clinical course of igg4-related hypophysitis without a high - dose glucocorticoid treatment. three month later, serum igg and igg4 levels were decreased, and pituitary size was normalized. most of the cases with igg4-related hypophysitis are accompanied by complications of pituitary insufficiency. on the other hand, hattori. reported a case of igg4-related hypophysitis without pituitary insufficiency (6). in this case, he had a hypopituitarism including adrenal insufficiency, hypogonadism and hypothyroidism ; however, 3 months later, his igg4 level was decreased spontaneously or with a physiological dose of glucocorticoid therapy. we think that our case shows the time course of igg4-related hypophysitis from the beginning to the improvement. third, although the patient had still higher igg4 level compared with normal range, his clinical symptoms disappeared and his laboratory data were improved. we think that after the disappearance of symptoms it is difficult to diagnose igg4-related hypophysitis. in fact, the case reports of hattori and coworkers showed that he had higher igg4 levels without pituitary insufficiency (6). this case report provides the possibility that igg4 level is decreased spontaneously or with a physiological dose of glucocorticoid therapy. therefore, when we examine subjects with central adrenal insufficiency and/or thyroid insufficiency after the normalization of serum igg4 level, it would be very difficult to diagnose igg4-related hypophysitis. first, although we did not perform a high - dose glucocorticoid treatment, we used a physiological dose of glucocorticoid. therefore, we can not exclude the possibility that such treatment with a physiological dose of glucocorticoid facilitated the decrease in igg4 level. we think it is possible that igg4 level was not spontaneously recovered in this subject. second, although igg4 level was markedly decreased during the process, it was still higher compared to its normal range. therefore, we can not conclude at this point that igg4-related disease in this subject was completely recovered. further observation and/or evaluation for a longer period would be necessary to conclude our hypothesis. in conclusion, we should keep in mind the possibility of igg4-related hypophysitis when we examine one of the uncertain causes of a hypopituitarism including adrenal insufficiency, hypogonadism and hypothyroidism. h k has received honoraria for lectures and received scholarship grants from sanofi, novo nordisk, lilly, boehringer ingelheim, msd, takeda, ono pharma, daiichi sankyo, sumitomo dainippon pharma, mitsubishi tanabe pharma, pfizer, kissei pharma, astrazeneca, astellas, novartis, kowa, chugai and taisho pharma. k k has been an advisor to, received honoraria for lectures from and received scholarship grants from novo nordisk pharma, sanwa kagaku kenkyusho, takeda, taisho pharmaceutical co., ltd, msd, kowa, sumitomo dainippon pharma, novartis, mitsubishi tanabe pharma, astrazeneca, nippon boehringer ingelheim co., ltd, chugai, daiichi sankyo and sanofi. this research did not receive any specific grant from any funding agency in the public, commercial or not - for - profit sector. f k, m t, r s and y k researched data and contributed to discussion. h k, t m, k k and n o wrote and reviewed the manuscript. | a 76-year - old man had a hypopituitarism including adrenal insufficiency, hypogonadism and hypothyroidism. based on various findings including the swelling of the pituitary gland, increase of serum igg4 level and abundant igg4-positive plasma cell infiltration in immunostaining of the pituitary gland, we diagnosed this subject as igg4-related hypophysitis. in general, a high - dose glucocorticoid treatment is effective for igg4-related disease. his clinical symptom, laboratory data and adrenal insufficiency were almost improved without any therapy. the serum igg4 level was decreased and pituitary size was normalized with hydrocortisone as physiological replacement. this case report provides the possibility that igg4 level is decreased spontaneously or with physiological dose of glucocorticoid therapy.learning points : we performed the pituitary gland biopsy and histochemical examination glucocorticoid therapy in a subject with igg4-related hypophysitis.this case report provides the possibility that igg4 level is decreased spontaneously or with a physiological dose of glucocorticoid therapy. we reported the clinical course of igg4-related hypophysitis without a high - dose glucocorticoid treatment, although there were a few reports about the retrospective examination.although the patient had still higher igg4 level compared to normal range, his clinical symptom disappeared and his laboratory data were improved.we should keep in mind the possibility of igg4-related hypophysitis when we examine one of the uncertain causes of a hypopituitarism including adrenal insufficiency, hypogonadism and hypothyroidism. |
this prospective, cross - sectional study had ethical approval from the north west london research ethics committee (rec number 10/h0720/21). a total of 110 patients with afd (60 heterozygous females, 50 hemizygous males) were recruited between april 2011 and february 2012 from the lysosomal storage disorders unit at the royal free london hospital. diagnosis was confirmed by molecular genetic analysis in all patients except one female (genetic data available on request). fifty - seven controls, matched to patients for age and ethnicity, were identified from volunteers and nonmedical staff at the hospital. controls were required to have a negative family history for lysosomal storage disorders and had no clinical signs of afd. all participants were assessed by the same movement disorders specialist (m.l.) and underwent a structured interview and detailed clinical screening for motor and nonmotor prodromes of neurodegenerative diseases as explained below. disease severity in patients with afd was rated with the mainz severity score index (mssi). the presence of white matter abnormalities, lacuna, and territorial infarctions on latest cerebral mri scans was used to document cerebrovascular sequelae of afd. renal involvement was assessed by serum creatinine, serum urea, glomerular filtration rate estimated by cr - edta clearance, and presence of proteinuria. cardiac manifestations were assessed by the interventricular septal diameter measured by the latest transthoracic echocardiography. three tests were performed for quantitative assessment of motor function : (1) the timed up and go, which is a basic measure of gait and transfer speed ; (2) the purdue pegboard, a test of fine manual dexterity, motor speed, and finger - eye coordination ; and (3) a shortened, 30-second version of the alternate tap test, used for the assessment of motor speed in the hands with a moderate requirement of coordination and accuracy. extrapyramidal motor symptoms were evaluated with the activities of daily living and motor subscales of the movement disorders society revised version of the unified parkinson s disease rating scale (mds - updrs parts ii and iii). the nih stroke scale (nihss), a graded neurologic examination rating speech and language, cognition, visual field deficits, motor and sensory impairments, and ataxia, was used to identify potential focal neurologic deficits due to cerebrovascular disease. cognitive function was assessed with the mini - mental state examination (mmse) and the montreal cognitive assessment (moca). the moca has been shown to be more sensitive for the detection of mild cognitive impairment or dementia in pd than other scales, with optimal cut - off scores of 10 points indicating significant sleepiness. quality of life was assessed with the eq-5d-5l and the 36-item short - form health survey (sf-36). statistical analyses were performed with spss software, version 21.0 (spss, chicago, il). since we expected sex differences due to x - linked inheritance in afd, statistical comparisons were initially carried out separately for female and male participants with the unpaired t test or mann - whitney u test (continuous variables) and the or fisher exact test (discrete variables), as appropriate. for comparison of continuous variables between all participants, we used a general linear model with disease and sex as fixed factors and age as covariate, which was valid in all outcome parameters. the spearman correlation was used to assess the association of clinical outcomes and the mssi. pairwise deletion was used for missing data. unless stated otherwise, values are displayed as unadjusted means sd. this prospective, cross - sectional study had ethical approval from the north west london research ethics committee (rec number 10/h0720/21). a total of 110 patients with afd (60 heterozygous females, 50 hemizygous males) were recruited between april 2011 and february 2012 from the lysosomal storage disorders unit at the royal free london hospital. diagnosis was confirmed by molecular genetic analysis in all patients except one female (genetic data available on request). fifty - seven controls, matched to patients for age and ethnicity, were identified from volunteers and nonmedical staff at the hospital. controls were required to have a negative family history for lysosomal storage disorders and had no clinical signs of afd. all participants were assessed by the same movement disorders specialist (m.l.) and underwent a structured interview and detailed clinical screening for motor and nonmotor prodromes of neurodegenerative diseases as explained below. disease severity in patients with afd was rated with the mainz severity score index (mssi). the presence of white matter abnormalities, lacuna, and territorial infarctions on latest cerebral mri scans was used to document cerebrovascular sequelae of afd. renal involvement was assessed by serum creatinine, serum urea, glomerular filtration rate estimated by cr - edta clearance, and presence of proteinuria. cardiac manifestations were assessed by the interventricular septal diameter measured by the latest transthoracic echocardiography. three tests were performed for quantitative assessment of motor function : (1) the timed up and go, which is a basic measure of gait and transfer speed ; (2) the purdue pegboard, a test of fine manual dexterity, motor speed, and finger - eye coordination ; and (3) a shortened, 30-second version of the alternate tap test, used for the assessment of motor speed in the hands with a moderate requirement of coordination and accuracy. extrapyramidal motor symptoms were evaluated with the activities of daily living and motor subscales of the movement disorders society revised version of the unified parkinson s disease rating scale (mds - updrs parts ii and iii). the nih stroke scale (nihss), a graded neurologic examination rating speech and language, cognition, visual field deficits, motor and sensory impairments, and ataxia, was used to identify potential focal neurologic deficits due to cerebrovascular disease. cognitive function was assessed with the mini - mental state examination (mmse) and the montreal cognitive assessment (moca). the moca has been shown to be more sensitive for the detection of mild cognitive impairment or dementia in pd than other scales, with optimal cut - off scores of 10 points indicating significant sleepiness. quality of life was assessed with the eq-5d-5l and the 36-item short - form health survey (sf-36). statistical analyses were performed with spss software, version 21.0 (spss, chicago, il). since we expected sex differences due to x - linked inheritance in afd, statistical comparisons were initially carried out separately for female and male participants with the unpaired t test or mann - whitney u test (continuous variables) and the or fisher exact test (discrete variables), as appropriate. for comparison of continuous variables between all participants, we used a general linear model with disease and sex as fixed factors and age as covariate, which was valid in all outcome parameters. the spearman correlation was used to assess the association of clinical outcomes and the mssi. pairwise deletion was used for missing data. unless stated otherwise, values are displayed as unadjusted means sd. a total of 110 patients with afd (60 heterozygous females, 50 hemizygous males) and 57 controls (29 female, 28 male) were included in our cross - sectional study. mean age, age range, and ethnic background were similar between patients and controls (table 1). patients with afd were less likely to have university education and to be employed and more likely to be medically retired than controls. hyperlipidemia and hypertension had been diagnosed more often in patients, whereas other cardiovascular risk factors were similar between groups. cerebrovascular events were more often reported by patients with afd, of whom 13.6% reported tias or strokes in the past. antidepressants were more frequently found in the concomitant medication of patients with afd, whereas other cns medications were not different. female and male patients with afd examined in this study had been diagnosed a mean of 9.6 and 11.8 years ago, respectively (table e-1 on the neurology web site at neurology.org). male patients were less likely to have a positive family history for afd at the time of diagnosis than their female counterparts, indicating that diagnosis in male patients had been made more frequently following prior organ involvement. clinical disease severity rated with the mssi was higher in male than in female patients. in keeping with higher disease severity, male patients with afd were treated more often with enzyme replacement therapy (ert), which had been initiated in 88% of male and 60% of female patients. the difference in total mssi scores between sexes was due to higher renal and cardiac subscores in male participants, whereas general and neurologic mssi subscores as well as the point distribution in individual components of the neurologic subscore were not different. accordingly, male patients showed more pronounced renal and cardiac involvement on laboratory markers of renal function and transthoracic echocardiography, respectively, whereas cerebral mri reports did not indicate significant differences in cerebrovascular manifestations between female and male patients. all participants were interviewed for motor and nonmotor symptoms frequently observed in neurodegenerative diseases (table e-2). in brief, patients with afd did not report extrapyramidal motor features more often than controls. when asked for nonmotor symptoms, patients more frequently noted orthostatic problems, urinary dysfunction, constipation, depression, neuropathic pain, and impaired hearing, whereas hyposmia, visual disturbances, and sleep problems were not reported differently in patients and controls. quantitative assessments of motor function in patients with afd demonstrated lower gait and transfer speed on the timed up and go test and poorer fine manual dexterity and hand speed on the purdue pegboard and the alternate tap test, respectively (table 2 and figure 1). interestingly, these impairments were still evident when we used the nihss as covariate instead of age in order to correct for potential focal neurologic deficits due to cerebrovascular disease (results not shown). evaluation of extrapyramidal motor function with the mds - updrs parts ii and iii revealed higher scores in patients with afd compared to controls, indicating more impairment in motor experiences of daily living and extrapyramidal motor function. evaluation of extrapyramidal symptoms demonstrated more asymmetric motor slowing and a trend for more postural instability in patients with afd, whereas frequencies of tremor, rigidity, and reduced arm swing during gait were similar between groups (figure 2). assessment for focal neurologic deficits with the nihss demonstrated very low scores in all groups, although mean nihss scores were slightly higher in patients with afd, as expected in a disease with known potential cerebrovascular manifestations. motor function worsened with increasing age, which we used as covariate in our statistical model. female participants performed better on the purdue pegboard test, whereas male participants performed better on the alternate tap test ; otherwise, there were no significant differences between sexes. importantly, we did not observe a combined effect of disease and sex on motor function, arguing for similar disease effects in female and male patients with afd. evaluation with mmse and moca did not reveal significant cognitive deficits in patients with afd, although mean moca scores were slightly lower than in controls (figure 1) due to reduced performance in abstraction and delayed recall (table 3). depressive symptoms on the bdi were more frequent and severe in patients with afd, who had significant and severe depression in 26.8% and 8.2% of cases, respectively. testing with the ss-16 did not show differences in olfactory function between patients and controls, which was also illustrated by similarly low frequencies of hyposmia in all groups. during orthostatic challenge, patients with afd did not show more evidence for orthostatic hypotension than age - matched controls. bpi assessments revealed higher severity and functional interference of pain in patients with afd than in age - matched controls, which upon visual inspection of the questionnaires was frequently due to a combination of joint problems and neuropathic pain. evaluation with the ess revealed significantly higher scores for daytime sleepiness in patients, whereas screening with the rbdsq provided no evidence for a higher frequency of rbd in afd. although most patients were treated with ert, both female and male patients with afd had a markedly reduced quality of life, as documented by the eq-5d - vas and the sf-36 total scores (table 3). similar to motor function, age also affected several nonmotor outcomes in patients and controls (table 3). higher age was associated with cognitive decline on the mmse and moca, a reduction of olfactory function on the ss-16, a lower drop of blood pressure and reduced compensatory increase of heart rate upon standing up, higher pain severity and interference indices on the bpi, more daytime sleepiness on the ess, and a lower quality of life on both eq-5d - vas and sf-36 (not shown). sex effects were only identified during olfactory testing, where female participants performed significantly better than male participants (table 3). in keeping with our observations on motor function, we did not identify any differences in nonmotor outcomes between female and male patients with afd, again indicating that the disease similarly affected both sexes. in order to assess whether neurologic symptoms would also correlate with disease severity in afd, we performed bivariate correlations of all outcome parameters with the mmsi (table e-3). significant and moderate correlations were found for all motor scales, depression (bdi - ii), pain (bpi), and quality of life (euroqol visual analogue scale, sf-36 score). a total of 110 patients with afd (60 heterozygous females, 50 hemizygous males) and 57 controls (29 female, 28 male) were included in our cross - sectional study. mean age, age range, and ethnic background were similar between patients and controls (table 1). patients with afd were less likely to have university education and to be employed and more likely to be medically retired than controls. hyperlipidemia and hypertension had been diagnosed more often in patients, whereas other cardiovascular risk factors were similar between groups. cerebrovascular events were more often reported by patients with afd, of whom 13.6% reported tias or strokes in the past. antidepressants were more frequently found in the concomitant medication of patients with afd, whereas other cns medications were not different. female and male patients with afd examined in this study had been diagnosed a mean of 9.6 and 11.8 years ago, respectively (table e-1 on the neurology web site at neurology.org). male patients were less likely to have a positive family history for afd at the time of diagnosis than their female counterparts, indicating that diagnosis in male patients had been made more frequently following prior organ involvement. clinical disease severity rated with the mssi was higher in male than in female patients. in keeping with higher disease severity, male patients with afd were treated more often with enzyme replacement therapy (ert), which had been initiated in 88% of male and 60% of female patients. the difference in total mssi scores between sexes was due to higher renal and cardiac subscores in male participants, whereas general and neurologic mssi subscores as well as the point distribution in individual components of the neurologic subscore were not different. accordingly, male patients showed more pronounced renal and cardiac involvement on laboratory markers of renal function and transthoracic echocardiography, respectively, whereas cerebral mri reports did not indicate significant differences in cerebrovascular manifestations between female and male patients. all participants were interviewed for motor and nonmotor symptoms frequently observed in neurodegenerative diseases (table e-2). in brief, patients with afd did not report extrapyramidal motor features more often than controls. when asked for nonmotor symptoms, patients more frequently noted orthostatic problems, urinary dysfunction, constipation, depression, neuropathic pain, and impaired hearing, whereas hyposmia, visual disturbances, and sleep problems were not reported differently in patients and controls. quantitative assessments of motor function in patients with afd demonstrated lower gait and transfer speed on the timed up and go test and poorer fine manual dexterity and hand speed on the purdue pegboard and the alternate tap test, respectively (table 2 and figure 1). interestingly, these impairments were still evident when we used the nihss as covariate instead of age in order to correct for potential focal neurologic deficits due to cerebrovascular disease (results not shown). evaluation of extrapyramidal motor function with the mds - updrs parts ii and iii revealed higher scores in patients with afd compared to controls, indicating more impairment in motor experiences of daily living and extrapyramidal motor function. evaluation of extrapyramidal symptoms demonstrated more asymmetric motor slowing and a trend for more postural instability in patients with afd, whereas frequencies of tremor, rigidity, and reduced arm swing during gait were similar between groups (figure 2). assessment for focal neurologic deficits with the nihss demonstrated very low scores in all groups, although mean nihss scores were slightly higher in patients with afd, as expected in a disease with known potential cerebrovascular manifestations. motor function worsened with increasing age, which we used as covariate in our statistical model. female participants performed better on the purdue pegboard test, whereas male participants performed better on the alternate tap test ; otherwise, there were no significant differences between sexes. importantly, we did not observe a combined effect of disease and sex on motor function, arguing for similar disease effects in female and male patients with afd. evaluation with mmse and moca did not reveal significant cognitive deficits in patients with afd, although mean moca scores were slightly lower than in controls (figure 1) due to reduced performance in abstraction and delayed recall (table 3). depressive symptoms on the bdi were more frequent and severe in patients with afd, who had significant and severe depression in 26.8% and 8.2% of cases, respectively. testing with the ss-16 did not show differences in olfactory function between patients and controls, which was also illustrated by similarly low frequencies of hyposmia in all groups. during orthostatic challenge, patients with afd did not show more evidence for orthostatic hypotension than age - matched controls. bpi assessments revealed higher severity and functional interference of pain in patients with afd than in age - matched controls, which upon visual inspection of the questionnaires was frequently due to a combination of joint problems and neuropathic pain. evaluation with the ess revealed significantly higher scores for daytime sleepiness in patients, whereas screening with the rbdsq provided no evidence for a higher frequency of rbd in afd. although most patients were treated with ert, both female and male patients with afd had a markedly reduced quality of life, as documented by the eq-5d - vas and the sf-36 total scores (table 3). similar to motor function, age also affected several nonmotor outcomes in patients and controls (table 3). higher age was associated with cognitive decline on the mmse and moca, a reduction of olfactory function on the ss-16, a lower drop of blood pressure and reduced compensatory increase of heart rate upon standing up, higher pain severity and interference indices on the bpi, more daytime sleepiness on the ess, and a lower quality of life on both eq-5d - vas and sf-36 (not shown). sex effects were only identified during olfactory testing, where female participants performed significantly better than male participants (table 3). in keeping with our observations on motor function, we did not identify any differences in nonmotor outcomes between female and male patients with afd, again indicating that the disease similarly affected both sexes. in order to assess whether neurologic symptoms would also correlate with disease severity in afd, we performed bivariate correlations of all outcome parameters with the mmsi (table e-3). significant and moderate correlations were found for all motor scales, depression (bdi - ii), pain (bpi), and quality of life (euroqol visual analogue scale, sf-36 score). we report a prospective, cross - sectional study on prodromal symptoms of neurodegeneration in a large cohort of patients with afd aiming to evaluate the clinical relevance of neuronal glycosphingolipid accumulation in this rare disease. we found that afd is associated with impaired motor function and various nonmotor symptoms, but unlike gd does not lead to a pattern of extrapyramidal symptoms, significant cognitive problems, hyposmia, or rbd commonly preceding neurodegenerative diseases, in particular pd and dementia with lewy bodies. aside from cardinal neurologic manifestations, such as stroke and small fiber neuropathy, previous studies have described depression, pain, and daytime sleepiness in 46%, 53%, and 68% of patients with afd, respectively. our study was able to reproduce these findings, but prevalence of these nonmotor symptoms was lower in our cohort, possibly due to ongoing symptomatic treatment or ert in the majority of cases. nevertheless, it is noteworthy that 4 out of 9 severely depressed patients did not receive treatment with antidepressants, reemphasizing the need for recognition of depressive symptoms in this disease. afd was not associated with cognitive impairment or autonomic dysfunction, which is in keeping with previous, smaller studies. moreover, we were able to show that afd does not result in hyposmia or rbd, which are prodromal for later neurodegenerative disease. in addition, our study suggests that afd does not lead to extrapyramidal symptoms or parkinsonian motor features but instead is associated with motor impairments during gait and transfer and poorer fine manual dexterity and hand speed. these deficits in motor function correlated to clinical disease severity similar to depression and pain, which emphasizes that motor impairments are an integral part of the disease. the pathophysiologic reasons for poorer motor performance in afd can not be answered by our clinical study and remain to be elucidated. although cerebrovascular manifestations of afd may lead to motor impairment, it must be noted that frequency and burden of cerebrovascular symptoms in our afd cohort was very low and that disease effects on motor function were still evident when results were corrected for the presence of focal neurologic deficits. none of our patients complained about sensory loss, which is in agreement with previous neurophysiologic studies demonstrating that small fiber dysfunction predominates in the disease and argues against peripheral neuropathy as the main reason for impaired motor function. interestingly, former neuropathologic studies have shown that glycosphingolipid accumulation in afd is not limited to the vasculature but can be found in neurons of various brain regions, in particular the brainstem. recently, a study has demonstrated alp disruption and focused presence of phosphorylated -synuclein - containing lesions in the pons of -gal - deficient mice, which were colocalized with large axonal spheroids indicating axonal degeneration. we therefore speculate that neuronal glycosphingolipid storage and alp disruption in afd lead to focused brainstem pathology, which results in a distinct clinical phenotype with mild motor impairment and nonmotor symptoms such as depression, pain, daytime sleepiness, and hearing loss, but is not associated with cardinal clinical prodromes of neurodegenerative diseases, such as parkinsonian motor signs and impairments of cognition and olfaction that are found in gd. however, we would not completely rule out a contribution of -gal deficiency to the development of neurodegenerative disease based on the lack of clinical prodromes, especially as neuropathologic brainstem involvement has also been demonstrated in presymptomatic stages of pd. another interesting observation of our study is the similarity of neurologic manifestations in female and male patients with afd, which is in keeping with other studies showing significant organ involvement in female heterozygotes despite x - chromosomal inheritance. skewed inactivation of the x - chromosome was suspected to explain disease manifestations in female patients, which is supported by recent research demonstrating correlations between x - inactivation and clinical disease severity in female patients. molecular interference by the mutant enzyme protein exerting a dominant negative effect on the normal gene product has also been suggested, but this explanatory theory remains to be proven. while the reasons for sex parity of disease manifestations in afd remain to be elucidated, our study should raise physicians awareness for symptoms in female patients with afd, who are often considered as carriers of but not patients with the disease. strengths of our study in this rare disease include its size, range, and complexity of clinical testing, and the use of age - matched controls to enhance external validity of the results. due to its observational and cross - sectional design, our study has some limitations, which may have influenced its outcome. first, the majority of patients in our afd cohort were treated with ert, which may have partly altered the natural phenotype of the disease and explain lower severity of peripheral nonmotor symptoms, such as pain. however, ert is unlikely to influence neurologic symptoms caused by central manifestations of afd, such as motor features, hyposmia, or rbd, since it can not cross the blood brain barrier. secondly, it must be acknowledged that blinded examination was not possible due to facial stigmata and skin manifestations in afd, which may have subconsciously influenced our assessments, although we applied well - established and highly standardized clinical tests to minimize observer bias. third, sex comparison in our study may not entirely reflect natural conditions in afd carriers, since our cohort was recruited from a university - based specialty center, in which more severely affected female patients may be overrepresented. moreover, patients perception of having afd may have contributed to worse outcomes on questionnaires in comparison to controls. taken together, our study argues for a distinct neurologic phenotype in afd that lacks classical prodromal features of neurodegeneration that have been demonstrated in gd. unlike functional loss of glucocerebrosidase in gd, which has been shown to be involved in accumulation of -synuclein and results in neurotoxicity, afd - linked deficiency of -gal | objectiveto estimate the prevalence of prodromal clinical features of neurodegeneration in patients with anderson - fabry disease (afd) in comparison to age - matched controls.methodsthis is a single - center, prospective, cross - sectional study in 167 participants (60 heterozygous females and 50 hemizygous males with genetically confirmed afd, 57 age - matched controls) using a clinical screening program consisting of structured interview, quantitative tests of motor function, and assessments of cognition, depression, olfaction, orthostatic intolerance, pain, rem sleep behavior disorder, and daytime sleepiness.resultsin comparison to age - matched controls (mean age 48.3 years), patients with afd (mean age 49.0 years) showed slower gait and transfer speed, poorer fine manual dexterity, and lower hand speed, which was independent of focal symptoms due to cerebrovascular disease. patients with afd were more severely affected by depression, pain, and daytime sleepiness and had a lower quality of life. these motor and nonmotor manifestations significantly correlated with clinical disease severity. however, patients with afd did not reveal extrapyramidal motor features or signs of significant cognitive impairment, hyposmia, orthostatic intolerance, or rem sleep behavior disorder, which commonly precede later neurodegenerative disease. in our cohort, there were no differences in neurologic manifestations of afd between heterozygous females and hemizygous males.conclusionsaside from cerebrovascular manifestations and small fiber neuropathy, afd results in a distinct neurologic phenotype comprising poorer motor performance and specific nonmotor features. in contrast to functional loss of glucocerebrosidase in gaucher disease, -galactosidase deficiency in afd is not associated with a typical cluster of clinical features prodromal for neurodegenerative diseases, such as parkinson disease. |
steroid hormones are molecules, mainly produced by endocrine glands such as the adrenal gland, gonads and placenta, involved in the control of many physiological processes mainly in the periphery, from reproductive behaviour to stress response. in 1981, baulieu and co - workers were the first to demonstrate steroid production within the nervous system itself. they showed that the level of some steroids, such as dehydroepiandrosterone (dhea), was even four times higher in the anterior brain of rats than in plasma and nearly 18 times higher than in the posterior brain with regard to its sulphated form (dheas). of note, the level of this steroid remained elevated in the brain even after adrenalectomy and castration. in the following decades, other steroids were identified to be synthetized in situ in the brain, and enzymatic activities of proteins involved in steroidogenesis have been shown in many regions of the central and peripheral nervous system, in neurons as well as in glial cells [25 ]. thus, this category of molecules is now called neurosteroids and defines neuroactive steroids that are synthetized within the nervous system, independently of peripheral endocrine glands. while steroid hormones act at a distance from their glands of origin in an endocrine way, neurosteroids are synthetized by the nervous system and act on the nervous system in an auto / paracrine configuration. because of their lipophilic nature, peripheral steroid hormones can freely cross cell membranes, including the blood brain barrier, and play an important role in the development, maturation and differentiation of the central and peripheral nervous system. however, since some steroids are also synthetized within the nervous system, their blood levels do not necessarily correspond to their brain concentrations. intra - cerebral steroid synthesis seems to play a role in cognition, anxiety, depression, neuroprotection and even nociception. the ability to cross cellular membranes allows them to act on nuclear receptors exhibiting genomic action by regulating gene transcription. this action seems to be important during neonatal life where it has been shown that neurosteroids, such as progesterone (prog) or oestradiol, are able to promote dendritic growth, spinogenesis, synaptogenesis and cell survival, particularly in the cerebellum. some studies already demonstrated the role of neurosteroids, particularly oestrogens, in the regulation of glucose homeostasis and lipid metabolism as well as in neuroprotection. risk for alzheimer 's disease (ad) is associated with age - related loss of sex steroid hormones in both women and men [10, 11 ]. on the one hand, in post - menopausal women, the precipitous depletion of oestrogens and progestogens is hypothesized to increase susceptibility to ad pathogenesis, a concept largely supported by epidemiological evidence but refuted by some clinical findings, above all, by results from the woman 's health initiative memory study (whims) (please see detailed discussion in the conclusion section). on the other hand, a growing body of evidence indicates a more gradual age - related decline in testosterone in men similarly associated with increased risk to several diseases including ad. since testosterone is at least in part aromatized in the brain to 17-oestradiol, a loss of it may also affect oestrogen - mediated neuroprotective pathways. but also, the difference between how rapidly and significantly the female versus male primary sex hormones decline might partially contribute to higher ad incidences in women than in men. ad is a neurodegenerative brain disorder and the most common form of dementia among the elderly as shown by the worldwide prevalence of the disease which was 26.6 million people in 2006. clinical symptoms are characterized by severe and progressive loss of memory, language skills as well as spatial and temporal orientation. from a cellular point of view, the pathological hallmark of ad is the presence of extracellular senile plaques composed of aggregated amyloid- peptide (a)and intracellular neurofibrillary tangles (nft)consisting of aggregates of abnormally hyperphosphorylated tau protein. a lot of efforts have been made during the last years to understand the pathogenesis of the disease, particularly the role of ad key proteins, a and tau, in oxidative stress and mitochondrial dysfunction. epidemiological and observational studies demonstrated a higher prevalence and incidence of ad in women even after adjusting for age about two thirds of ad patients are female as well as a greater vulnerability to the disease. thus, at early stages of neurofibrillary tangle development, women exhibit greater senile plaque deposition than men, and ad pathology is more strongly associated with clinical dementia in female patients than in male. the drop of oestrogen levels after menopause was proposed to be one explanation to this phenomenon. however, there is little information concerning changes of steroid levels in the human brain during ageing and under dementia conditions. as steroids present in nervous tissues originate from the endocrine glands (steroid hormones) and from local synthesis (neurosteroids), changes in blood levels of steroids with age do not necessarily reflect changes in their brain levels. the concentrations of a range of neurosteroids have recently been measured in various brain regions of aged ad patients and aged non - demented controls including both genders by the very sensitive gc / ms methods. schumacher and colleagues showed a general trend towards lower level of steroids including oestrogen in ad patients compared to controls. notably, neurosteroid levels were negatively correlated with a and phospho - tau in some brain regions. another study using radioimmunoassay for steroid quantification demonstrated a decrease in oestrogen level in post - mortem brain from female ad patients aged 80 years and older but no significant difference in the 6079-year age range compared to non - demented women. however in men, an age - dependent decrease of androgen level was observed in the brain of non - demented subjects, which was even more pronounced in the brain of male ad patients. whereas large studies investigating systematically gender differences with respect to a and or tau pathology in post - mortem brain tissue from ad patients are missing, broad evidence emerged from transgenic mice models of ad indicating an increased a load burden and plaque number in the female brain compared to age - matched male mouse brain [11, 18 ]. of note, consistent findings on greater a burden in females were found in different animal ad models : tg2576 (appswe) mice, app / ps1, app23, as well as in triple transgenic mice, like 3xtg - ad mice [18, 22 ] and ad mice (, with respect to gender differences : unpublished observations). on the basis that the estrous cycle in female mice is constantly repeated until approximately 11 months of age and becomes irregular between 12 and 14 months, the data demonstrating a significant enhancement of a load in important brain regions like the hippocampus from the female after the age of 11 months are striking. regarding tau pathology, no gender differences have been observed in the latter triple ad models. in agreement, nft formation in a-injected tau transgenic mice (p301l) did not vary with gender. even though one single publication reported an enhanced neurofibrillary pathology in female tapp mice, all together, these results point to the involvement of the a pathway, rather than the tau pathway, in the higher risk of ad in women. previous research of our group demonstrated a gender - specific partial up - regulation of antioxidant defence in post - mortem brain regions from female compared to male ad patients further indicating that oxidative damage is caused rather by overproduction from reactive oxygen species (ros) than by insufficient detoxification of ros. since mitochondria represent the major source of ros, the findings from lloret and co - workers are of specific interest showing that brain mitochondria from old female rats produce higher levels of ros after exposure to a than age - matched brain mitochondria from male rats. a selection of studies attested neuroprotective effects of neurosteroids against ad - related cellular and mitochondrial injury, but the underlying mechanisms are still poorly understood. findings of our group corroborated that ad key proteins and oxidative stress are themselves able to modify neogenesis of neurosteroids in a cellular ad model [28, 29 ] (fig. 1) in fact, treatment of human sh - sy5y neuroblastoma cells with h2o2 for 24 or 48 h led to a decrease of oestradiol synthesis. this was paralleled by an increased cell death compared to untreated controls and a down - regulation of the expression of aromatase, an enzyme responsible for oestradiol formation from testosterone. interestingly, cell death was also observed after inhibition of aromatase by treatment with letrozole, suggesting that endogenous oestradiol formation plays a critical role in cell survival. furthermore, if cells were pre - treated with oestradiol, it was possible to protect them against h2o2 and letrozole - induced cell death. in agreement, a similar protective effect of oestradiol was observed in stress condition experiments treating the same cell line with heavy metals, such as cobalt and mercury.fig. boxes represent neurosteroids which are sensitive to modulation by ad key proteins, a and/or tau. preg pregnenolone, prog progesterone, 17oh - preg 17-hydroxypregnenolone, 17oh - prog 17-hydroxyprogesterone, dhea dehydroepiandrosterone, dhp dihydroprogesterone, allopreg allopregnanolone, dht dihydrotestosterone, p450scc cytochrome p450 cholesterol side chain cleavage, p450c17 cytochrome p450c17, 3-hsd 3-hydroxysteroid dehydrogenase, 5-r 5-reductase, arom. boxes represent neurosteroids which are sensitive to modulation by ad key proteins, a and/or tau. preg pregnenolone, prog progesterone, 17oh - preg 17-hydroxypregnenolone, 17oh - prog 17-hydroxyprogesterone, dhea dehydroepiandrosterone, dhp dihydroprogesterone, allopreg allopregnanolone, dht dihydrotestosterone, p450scc cytochrome p450 cholesterol side chain cleavage, p450c17 cytochrome p450c17, 3-hsd 3-hydroxysteroid dehydrogenase, 5-r 5-reductase, arom. aromatase, 21-ohase 21-hydroxylase, 3-hsor 3-hydroxysteroid oxydoreductase, 17-hsd 17-hydroxysteroid dehydrogenase in addition, modulation of neurosteroid production was observed in sh - sy5y cells overexpressing the human amyloid processor protein (app) or human tau protein. indeed, overexpression of human wild - type tau (htau 40) protein induced an increase in the production of prog, 3-androstanediol and 17-hydroxyprogesterone, in contrast to overexpression of the abnormally hyperphosphorylated tau bearing the p301l mutation which led to a decrease in the production of these neurosteroids. in parallel, a decrease of prog and 17-hydroxyprogesterone production was observed in cells expressing human wild - type app (wtapp), whereas 3-androstanediol and oestradiol levels were increased. these results provided first evidence that ad key proteins are able to modulate, directly or indirectly, the biological activity of the enzymatic machinery producing neurosteroids. these findings were further confirmed by in vitro experiments using native sh - sy5y cells treated with aggregated a1 - 42 peptide for 24 h. since appwt sh - sy5y cells secrete a levels within nanomolar concentration range, treatment of native sh - sy5y cells using a non - toxic concentration range (1001,000 nm, non - cell death - inducing a1 - 42 concentrations) revealed an increase in oestradiol production, whereas toxic a142 concentrations within the micromolar range, leading to cell death, strongly reduced oestradiol levels. modulation of steroid production was also shown in other cell lines, for example in oligodendrocytes, where dhea production is up - regulated under oxidative stress condition induced by treatment with a peptide or fe. interestingly, similar results were found in alzheimer patients where dhea was significantly elevated in brain and cerebrospinal fluid when compared to control subjects. finally, several reports propose the role of allopregnanolone (3, 5-thp) as a plasmatic biomarker for ad, since it was shown that the level of this neurosteroid is decreased by 25 % in the plasma of demented patients compared with control subjects [34, 35 ]. the fact that the ability to produce neurosteroids is conserved in the vertebrates ' evolution suggests that this category of molecules is important for living beings. thus, we could speculate that the modulation of their biosynthesis plays an important role in the pathophysiology of neurodegenerative disorders, such as ad. neuroprotective effects of neurosteroids against a variety of brain injuries have already been described for many years. numerous studies with the focus on oestrogens showed that these molecules are able to enhance cerebral blood flow, prevent atrophy of cholinergic neurons, and modulate the effects of trophic factors in the brain. oestrogens are a group of compounds known for their importance in the estrous cycle including oestrone (e1), oestradiol (e2), and oestriol (e3). oestradiol is about ten times as potent as oestrone and about 80 times as potent as oestriol in its oestrogenic effect. oestradiol is also present in males, being produced as an active metabolic product of testosterone. the serum levels of oestradiol in males (1455 pg / ml) are roughly comparable to those of post - menopausal women (< 35 pg / ml). oestradiol in vivo is interconvertible with oestrone, oestradiol to oestrone conversion being favoured ; however, evidence of metabolism is mainly derived from the periphery. animal studies, especially in rodents and transgenic mice models for ad, seem to confirm positive effects of oestrogen treatment. it has been shown that a treatment with oestrogen in mice expressing mutations in human app (swedish and indiana mutation) had an impact on app processing decreasing a levels and so its aggregation into plaques. mechanisms underlying this action of oestrogen are still poorly understood, but as discussed by pike., it seems that oestrogen amongst others is able to promote the -secretase pathway (non - amyloidogenic, meaning non - a producing) via activation of extracellular - regulated kinase 1 and 2 (erk 1 and 2) and through the protein kinase c (pkc) signalling pathway. in triple transgenic ad mice, depletion in sex steroid hormones induced by ovariectomy in adult females increased significantly a accumulation and had a negative impact on cognitive performance [18, 38 ]. treatment of these ovariectomized mice with oestrogens was able to prevent these effects vice versa. of note, when prog was administrated in combination with oestrogens, the beneficial effects on a accumulation were blocked but not on cognitive performance. however, oestrogen and prog both can modulate kinase and phosphatase activity involved in tau phosphorylation, especially the glycogen synthase kinase-3 (gsk-3). thus, oestrogen can induce the phosphorylation of gsk-3 which inactivates the enzyme and reduces tau phosphorylation, whereas prog can decrease the expression of tau and gsk-3 [11, 39 ]. this suggests that oestrogen and prog not only can interact to regulate app processing and tau phosphorylation but can also act independently on different ad pathways. cognitive effects of prog were confirmed in mice bearing the swedish double mutation of app and mutant preseniline 1 (appswe+psen19 mutant mice) which showed decreased hippocampally mediated cognitive performances compared to non - transgenic littermates. in this ad mouse model, prog was able to improve the cognitive performance in tasks involving the cortex but not in those involving the hippocampus. besides, appswe+psen19 mice presented decreased 3, 5-thp levels (metabolite of prog) in the hippocampus, compared to wild - type mice, suggesting that deficits in hippocampal function may be due, at least in part, to reduced capacity to form 3, 5-thp in the hippocampus. furthermore, a more recent study supported the role of 3, 5-thp in triple transgenic mice model of ad (3xtgad) by showing reduced a generation in the hippocampus, cortex and amygdala, coupled with an increased cellular regeneration after treatment with 3, 5-thp. at the cellular level, oestrogen binds to nuclear receptors, such as oestrogen receptor and (er /), and acts as transcription factor. it enhanced the expression of anti - apoptotic proteins, such as bcl-2 and bcl - xl, and down - regulated the expression of bim, a pro - apoptotic factor, preventing the initialisation of cell death programme by mitochondria [11, 41 ]. another way that oestrogen can protect cells from apoptosis is the activation of antioxidant defence systems by up - regulating the expression of manganese superoxide dismutase (mnsod) and glutathione peroxidase. thus, oestrogen can have direct antioxidant effects by increasing reduced glutathione levels and decreasing oxidative dna damage in mitochondria, as observed in a study using ovariectomized female rats. of note, oestrogen can also modulate the redox state of cells by intervening with several signalling pathways, such as mitogen - activated protein kinase (mapk), g protein - regulated signalling, nfb, c - fos, creb, phosphatidylinositol-3-kinase, pkc and ca influx [41, 44 ]. on the basis of this complex mode of action, oestrogens not only seem to be able to decrease oxidative stress markers, including lipid peroxidation, protein oxidation and dna damage, but can also directly act on the regulation of mitochondrial function. mitochondria are the powerhouses of the cell, providing the main part of cellular energy via atp generation, which is accomplished through oxidative phosphorylation from nutritional sources. they control cell survival and death by regulating both energy metabolism and apoptotic pathways and contribute to many cellular functions, including intracellular calcium homeostasis, alteration of the cellular reduction mitochondrial dysfunction has been proposed as an underlying mechanism in the early stages of ad [47, 48 ]. we recently summarized evidence from ageing and alzheimer models showing that the harmful trio ageing, a and tau protein triggers mitochondrial dysfunction through a number of pathways, such as impairment of oxidative phosphorylation, elevation of reactive oxygen species production and interaction with mitochondrial proteins, contributing to the development and progression of the disease [13, 49 ]. mitochondria and neurosteroidogenesis are also closely linked since mitochondria contain the first enzyme involved in steroidogenesis, the cytochrome p450 cholesterol side chain cleavage enzyme (p450scc) located at the inner side of the mitochondrial membrane which is responsible for the conversion of cholesterol to pregnenolone (preg). the first step of neurosteroidogenesis is the transfer of cholesterol from the outer to the inner mitochondrial membrane. it is also the rate - limiting step in the production of neurosteroids because the ability of cholesterol to enter into mitochondria to be available to the p450scc will determine the efficiency of steroidogenesis. free cholesterol accumulates outside of mitochondria and binds to the steroidogenic acute regulatory protein, a hormone - induced mitochondria - targeted protein that initiates cholesterol transfer into mitochondria. then, molecules are transported inside mitochondria by a protein complex including translocator proteins (tspo), a cholesterol - binding mitochondrial protein also known under the name of peripheral - type benzodiazepine receptor, which permits cholesterol transfer into mitochondria and subsequent steroid formation. it has been shown that tspo is up - regulated in the post - mortem brain of ad patients, resulting in an increased level of preg in the hippocampal region of those brains. interestingly, the level of 22r - hydroxycholesterol, a steroid intermediate in the conversion of cholesterol to preg, was found at lower levels in the ad brain compared to the control, which suggests that tspo does not function normally in alzheimer patients [33, 51 ]. from an energetic point of view, it is known that steroids such as oestrogen can regulate mitochondrial metabolism by increasing the expression of glucose transporter subunits and by regulating some enzymes involved in the tricarboxylic acid cycle (tca cycle) as well as glycolysis, such as the hexokinase, phosphofructokinase, pyruvate and malate dehydrogenase [41, 52 ], which leads to improved glucose utilization by cells [11, 44 ] (fig.. 2modulation of mitochondrial function by a, hyperphosphorylated tau and oestradiol. in ad, mitochondrial dysfunction was found to be a central pathological mechanism which occurs already at early stages of the disease. on one hand, studies showed that amyloid- peptide (a) can be responsible of metabolic impairments, such as the decrease of glucose consumption observed in the ad brain as well as the calcium - induced excitotoxicity in neurons. it has been found that hyperphosphorylated tau and a are able to impair mitochondrial respiration by inhibiting the etc ci and civ, respectively, inducing decreased oxygen consumption, decreased atp production and increased ros level. this oxidative stress induced by etc dysfunction can surpass cellular and mitochondrial scavenger (mnsod, cu / znsod) and impacts on mmp as well as mitochondrial dna (mtdna). on the other hand, it has been shown that oestradiol can increase glucose utilization by cells as well as etc activity, stabilize the mmp and prevent ros production and calcium - induced excitotoxicity. in the graph, e2 designates where oestradiol potentially acts on mitochondria to compensate a-induced toxicity. in turn, a seems to be able to impact oestradiol metabolism in mitochondria, since it can be directly linked to the mitochondrial enzyme abad and possibly modulates its enzymatic activity (such as the reversible conversion of oestradiol to oestrone) and non - enzymatic activity (mitochondrial rnase p). abad a-binding alcohol dehydrogenase, ci complex i, cii complex ii, ciii complex iii, civ complex iv, cv complex v, cyt c cytochrome c, cu / zn sod copper / zinc superoxide dismutase, mnsod manganese superoxide dismutase, tca tricyclic acid, e2 oestradiol, ros reactive oxygen species, mtdna mitochondrial dna, er oestrogen receptor modulation of mitochondrial function by a, hyperphosphorylated tau and oestradiol. in ad, mitochondrial dysfunction was found to be a central pathological mechanism which occurs already at early stages of the disease. on one hand, studies showed that amyloid- peptide (a) can be responsible of metabolic impairments, such as the decrease of glucose consumption observed in the ad brain as well as the calcium - induced excitotoxicity in neurons. it has been found that hyperphosphorylated tau and a are able to impair mitochondrial respiration by inhibiting the etc ci and civ, respectively, inducing decreased oxygen consumption, decreased atp production and increased ros level. this oxidative stress induced by etc dysfunction can surpass cellular and mitochondrial scavenger (mnsod, cu / znsod) and impacts on mmp as well as mitochondrial dna (mtdna). on the other hand, it has been shown that oestradiol can increase glucose utilization by cells as well as etc activity, stabilize the mmp and prevent ros production and calcium - induced excitotoxicity. in the graph, e2 designates where oestradiol potentially acts on mitochondria to compensate a-induced toxicity. in turn, a seems to be able to impact oestradiol metabolism in mitochondria, since it can be directly linked to the mitochondrial enzyme abad and possibly modulates its enzymatic activity (such as the reversible conversion of oestradiol to oestrone) and non - enzymatic activity (mitochondrial rnase p). abad a-binding alcohol dehydrogenase, ci complex i, cii complex ii, ciii complex iii, civ complex iv, cv complex v, cyt c cytochrome c, cu / zn sod copper / zinc superoxide dismutase, mnsod manganese superoxide dismutase, tca tricyclic acid, e2 oestradiol, ros reactive oxygen species, mtdna mitochondrial dna, er oestrogen receptor oestrogens seem to be able to up - regulate genes coding for some electron transport chain components present in nuclear and in mitochondrial dna [53, 54 ]. in fact, an oestrogen - induced increased expression of some subunits of mitochondrial complex i (ci), cytochrome c oxidase (complex iv or civ) and f1 subunit of atp synthase was observed [41, 42, 52 ]. furthermore, treatment of ovariectomized female rats with oestradiol induced an increase of mitochondrial respiratory function in the brain with regard to an enhancement of o2 consumption coupled to an increased activity of cytochrome c oxidase. thus, oestrogen seems to enhance the general metabolism in cells, but besides, it seems also able to directly protect mitochondria against oxidative stress - induced injury. thus, incubation of isolated mitochondria from the rat brain with oestradiol leads to a decrease of h2o2 production by this organelle coupled with an increase of the mitochondrial membrane potential (mmp). furthermore, it has been proposed that its phenolic a ring could allow oestradiol to intercalate into the mitochondrial membrane and to avoid lipid peroxidation occurring in stress condition, which could be responsible for the stabilization of the mmp. moreover, oestradiol seems to prevent the release of cytochrome c by mitochondria (a mechanism known to induce apoptosis of cells by activating the caspase cascade in the cytoplasm), a mechanism increasing the efficiency of the respiratory chain. finally, another oestrogen signalling pathway avoiding the negative effects of oxidative stress is the one regulating calcium homeostasis by inducing mitochondrial sequestration of cytosolic calcium [42, 54 ]. in fact, an imbalance of calcium regulation can lead to an increase of ros production by activating the enzyme nitric oxide synthase, which can in turn sensitize neural cells to oxidative damage. it has been shown that an oestradiol treatment of primary hippocampal neurons was able to potentiate glutamatergic response via nmda receptor which resulted in an increased influx of calcium in cells. this effect was coupled to an induction of mitochondrial sequestration of cytosolic calcium and an increase of the mitochondrial calcium load tolerability thereby avoiding calcium - induced excitotoxicity as well as promoting cell survival. taken together, all those different findings indicate that oestrogen might be able to compensate deficits and injuries that occur in ad, namely mitochondrial respiration impairments, enhanced ros production, excitotoxicity and, more generally, metabolic deficits (fig. 2). more recently, new light has been shed on a mitochondrial enzyme that is able to directly bind a peptide and in which one of the main substrate is 17-oestradiol. this enzyme is known under the name of 17-hydroxysteroid dehydrogenase type 10 (17-hsd) or a-binding alcohol dehydrogenase (abad). abad belongs to the alcohol dehydrogenase family, and it is responsible for the reversible oxido / reduction of several substrates including linear alcohols and steroids, such as 17-oestradiol, using nad as cofactor. under normal conditions (without a), this enzyme plays a role in the regulation of metabolic homeostasis, and its overexpression improved cell viability and atp content. it has been shown that abad is up - regulated in brains of ad mice as well as ad patients [57, 58 ], and it has been suggested that the binding of a changes the conformation of the enzyme, which seems to exacerbate mitochondrial dysfunction induced by a. more recently, studies performed in transgenic mice models of ad showed that behavioural stress or depletion of ovarian hormones by ovariectomy exacerbated mitochondrial dysfunction, aggravated plaque pathology and increased abad expression in the brain [59, 60 ]. furthermore, double transgenic mice overexpressing mutant app and abad present an earlier onset of cognitive impairment and histopathological changes when compared to app mice, suggesting that aabad interaction is an important mechanism underlying a toxicity. this hypothesis is supported by a study from yao and collaborators who recently showed that inhibition of aabad interaction by a decoy peptide can restore mitochondrial deficits (activity of mitochondrial respiratory complexes, ros level) and improve neuronal and cognitive function. new interesting findings of our group seem to go in the same way with regard to the use of a novel small abad - specific compound inhibitor (ag18051) by investigating the role of this enzyme in a toxicity in human sh - sy5y cells treated for 5 days with a142 0.5 um. the crystal structure of human abad in presence of ag18051 showed that the inhibitor formed a covalent link with the nad cofactor and occupied the substrate - binding site of the enzyme. thus, the inhibitor was able to prevent a-induced cell death and significantly normalized metabolic functions impaired by a, such as cytosolic and mitochondrial ros as well as mitochondrial respiration. furthermore, it was able to restore oestradiol levels which were reduced after treatment with a [31, 61 ]. what is interesting to note is that the apparent protective effects of the abad inhibitor seem to be independent on its interaction with a. in fact, a 24-h pre - treatment with ag18051, before the incubation of cells with a1 - 42, was sufficient to prevent cell death, normalize ros production and restore mitochondrial respiration. regarding oestradiol level, we previously showed that it decreased in the cytosol and increased in isolated mitochondria of sh - sy5y cells after 5 days of treatment with a. the abad inhibitor normalized the oestradiol level in the cytosol, and preliminary data of our group suggest a similar effect in isolated mitochondria (unpublished data). thus, we propose the following model of mode of action : abad inhibitor is able to block a toxicity by changing abad configuration, which disables the binding of a thus preventing its toxic effects (fig. 3). the action of abad on the electron transport chain (etc) is still unclear, but the potential role of abad as mitochondrial rnase p directly links abad to the production of mitochondrial etc proteins and ros generation. notably, ag18051 was able to normalize also this function of abad since mitochondrial respiration was restored, but the underlying mechanisms still remain unclear.fig. a under normal conditions, abad is responsible of the reversible oxido / reduction of linear alcohols and steroids, such as the reversible conversion from oestradiol to oestrone. its potential function as an rnase p could also be important for the good functioning of the mitochondrial etc. b under ad - relevant pathological conditions, a can directly bind the mitochondrial enzyme abad, changing the configuration of the enzyme which seems to inhibit its activity and creates an imbalance between oestradiol and oestrone. a-induced abad misfolding can impact etc functioning and increase, directly or indirectly, ros production, which lead to cell death. c in the presence of ag18051 (ag), the binding of a to abad is inhibited, normalizing oestradiol level, ros production, etc activity, and improves cell survival. abad a-binding alcohol dehydrogenase, imm inner mitochondrial membrane, omm outer mitochondrial membrane a, abad and mitochondria : modes of interactions. a under normal conditions, abad is responsible of the reversible oxido / reduction of linear alcohols and steroids, such as the reversible conversion from oestradiol to oestrone. its potential function as an rnase p could also be important for the good functioning of the mitochondrial etc. b under ad - relevant pathological conditions, a can directly bind the mitochondrial enzyme abad, changing the configuration of the enzyme which seems to inhibit its activity and creates an imbalance between oestradiol and oestrone. a-induced abad misfolding can impact etc functioning and increase, directly or indirectly, ros production, which lead to cell death. c in the presence of ag18051 (ag), the binding of a to abad is inhibited, normalizing oestradiol level, ros production, etc activity, and improves cell survival. abad a-binding alcohol dehydrogenase, imm inner mitochondrial membrane, omm outer mitochondrial membrane thus, the interplay between abad, oestradiol and mitochondria may be a very interesting lead to follow in the future to decode a-induced mitochondrial toxicity and explore therapeutic strategies of abad inhibition. neuroprotective effects of neurosteroids against a variety of brain injuries have already been described for many years. numerous studies with the focus on oestrogens showed that these molecules are able to enhance cerebral blood flow, prevent atrophy of cholinergic neurons, and modulate the effects of trophic factors in the brain. oestrogens are a group of compounds known for their importance in the estrous cycle including oestrone (e1), oestradiol (e2), and oestriol (e3). oestradiol is about ten times as potent as oestrone and about 80 times as potent as oestriol in its oestrogenic effect. oestradiol is also present in males, being produced as an active metabolic product of testosterone. the serum levels of oestradiol in males (1455 pg / ml) are roughly comparable to those of post - menopausal women (< 35 pg / ml). oestradiol in vivo is interconvertible with oestrone, oestradiol to oestrone conversion being favoured ; however, evidence of metabolism is mainly derived from the periphery. animal studies, especially in rodents and transgenic mice models for ad, seem to confirm positive effects of oestrogen treatment. it has been shown that a treatment with oestrogen in mice expressing mutations in human app (swedish and indiana mutation) had an impact on app processing decreasing a levels and so its aggregation into plaques. mechanisms underlying this action of oestrogen are still poorly understood, but as discussed by pike., it seems that oestrogen amongst others is able to promote the -secretase pathway (non - amyloidogenic, meaning non - a producing) via activation of extracellular - regulated kinase 1 and 2 (erk 1 and 2) and through the protein kinase c (pkc) signalling pathway. in triple transgenic ad mice, depletion in sex steroid hormones induced by ovariectomy in adult females increased significantly a accumulation and had a negative impact on cognitive performance [18, 38 ]. treatment of these ovariectomized mice with oestrogens was able to prevent these effects vice versa. of note, when prog was administrated in combination with oestrogens, the beneficial effects on a accumulation were blocked but not on cognitive performance. however, oestrogen and prog both can modulate kinase and phosphatase activity involved in tau phosphorylation, especially the glycogen synthase kinase-3 (gsk-3). thus, oestrogen can induce the phosphorylation of gsk-3 which inactivates the enzyme and reduces tau phosphorylation, whereas prog can decrease the expression of tau and gsk-3 [11, 39 ]. this suggests that oestrogen and prog not only can interact to regulate app processing and tau phosphorylation but can also act independently on different ad pathways. cognitive effects of prog were confirmed in mice bearing the swedish double mutation of app and mutant preseniline 1 (appswe+psen19 mutant mice) which showed decreased hippocampally mediated cognitive performances compared to non - transgenic littermates. in this ad mouse model, prog was able to improve the cognitive performance in tasks involving the cortex but not in those involving the hippocampus. besides, appswe+psen19 mice presented decreased 3, 5-thp levels (metabolite of prog) in the hippocampus, compared to wild - type mice, suggesting that deficits in hippocampal function may be due, at least in part, to reduced capacity to form 3, 5-thp in the hippocampus. furthermore, a more recent study supported the role of 3, 5-thp in triple transgenic mice model of ad (3xtgad) by showing reduced a generation in the hippocampus, cortex and amygdala, coupled with an increased cellular regeneration after treatment with 3, 5-thp. at the cellular level, oestrogen binds to nuclear receptors, such as oestrogen receptor and (er /), and acts as transcription factor. it enhanced the expression of anti - apoptotic proteins, such as bcl-2 and bcl - xl, and down - regulated the expression of bim, a pro - apoptotic factor, preventing the initialisation of cell death programme by mitochondria [11, 41 ]. another way that oestrogen can protect cells from apoptosis is the activation of antioxidant defence systems by up - regulating the expression of manganese superoxide dismutase (mnsod) and glutathione peroxidase. thus, oestrogen can have direct antioxidant effects by increasing reduced glutathione levels and decreasing oxidative dna damage in mitochondria, as observed in a study using ovariectomized female rats. of note, oestrogen can also modulate the redox state of cells by intervening with several signalling pathways, such as mitogen - activated protein kinase (mapk), g protein - regulated signalling, nfb, c - fos, creb, phosphatidylinositol-3-kinase, pkc and ca influx [41, 44 ]. on the basis of this complex mode of action, oestrogens not only seem to be able to decrease oxidative stress markers, including lipid peroxidation, protein oxidation and dna damage, but can also directly act on the regulation of mitochondrial function. mitochondria are the powerhouses of the cell, providing the main part of cellular energy via atp generation, which is accomplished through oxidative phosphorylation from nutritional sources. they control cell survival and death by regulating both energy metabolism and apoptotic pathways and contribute to many cellular functions, including intracellular calcium homeostasis, alteration of the cellular reduction mitochondrial dysfunction has been proposed as an underlying mechanism in the early stages of ad [47, 48 ]. we recently summarized evidence from ageing and alzheimer models showing that the harmful trio ageing, a and tau protein triggers mitochondrial dysfunction through a number of pathways, such as impairment of oxidative phosphorylation, elevation of reactive oxygen species production and interaction with mitochondrial proteins, contributing to the development and progression of the disease [13, 49 ]. mitochondria and neurosteroidogenesis are also closely linked since mitochondria contain the first enzyme involved in steroidogenesis, the cytochrome p450 cholesterol side chain cleavage enzyme (p450scc) located at the inner side of the mitochondrial membrane which is responsible for the conversion of cholesterol to pregnenolone (preg). the first step of neurosteroidogenesis is the transfer of cholesterol from the outer to the inner mitochondrial membrane. it is also the rate - limiting step in the production of neurosteroids because the ability of cholesterol to enter into mitochondria to be available to the p450scc will determine the efficiency of steroidogenesis. free cholesterol accumulates outside of mitochondria and binds to the steroidogenic acute regulatory protein, a hormone - induced mitochondria - targeted protein that initiates cholesterol transfer into mitochondria. then, molecules are transported inside mitochondria by a protein complex including translocator proteins (tspo), a cholesterol - binding mitochondrial protein also known under the name of peripheral - type benzodiazepine receptor, which permits cholesterol transfer into mitochondria and subsequent steroid formation. it has been shown that tspo is up - regulated in the post - mortem brain of ad patients, resulting in an increased level of preg in the hippocampal region of those brains. interestingly, the level of 22r - hydroxycholesterol, a steroid intermediate in the conversion of cholesterol to preg, was found at lower levels in the ad brain compared to the control, which suggests that tspo does not function normally in alzheimer patients [33, 51 ]. from an energetic point of view, it is known that steroids such as oestrogen can regulate mitochondrial metabolism by increasing the expression of glucose transporter subunits and by regulating some enzymes involved in the tricarboxylic acid cycle (tca cycle) as well as glycolysis, such as the hexokinase, phosphofructokinase, pyruvate and malate dehydrogenase [41, 52 ], which leads to improved glucose utilization by cells [11, 44 ] (fig. 2modulation of mitochondrial function by a, hyperphosphorylated tau and oestradiol. in ad, mitochondrial dysfunction was found to be a central pathological mechanism which occurs already at early stages of the disease. on one hand, studies showed that amyloid- peptide (a) can be responsible of metabolic impairments, such as the decrease of glucose consumption observed in the ad brain as well as the calcium - induced excitotoxicity in neurons. it has been found that hyperphosphorylated tau and a are able to impair mitochondrial respiration by inhibiting the etc ci and civ, respectively, inducing decreased oxygen consumption, decreased atp production and increased ros level. this oxidative stress induced by etc dysfunction can surpass cellular and mitochondrial scavenger (mnsod, cu / znsod) and impacts on mmp as well as mitochondrial dna (mtdna). on the other hand, it has been shown that oestradiol can increase glucose utilization by cells as well as etc activity, stabilize the mmp and prevent ros production and calcium - induced excitotoxicity. in the graph, e2 designates where oestradiol potentially acts on mitochondria to compensate a-induced toxicity. in turn, a seems to be able to impact oestradiol metabolism in mitochondria, since it can be directly linked to the mitochondrial enzyme abad and possibly modulates its enzymatic activity (such as the reversible conversion of oestradiol to oestrone) and non - enzymatic activity (mitochondrial rnase p). abad a-binding alcohol dehydrogenase, ci complex i, cii complex ii, ciii complex iii, civ complex iv, cv complex v, cyt c cytochrome c, cu / zn sod copper / zinc superoxide dismutase, mnsod manganese superoxide dismutase, tca tricyclic acid, e2 oestradiol, ros reactive oxygen species, mtdna mitochondrial dna, er oestrogen receptor modulation of mitochondrial function by a, hyperphosphorylated tau and oestradiol. in ad, mitochondrial dysfunction was found to be a central pathological mechanism which occurs already at early stages of the disease. on one hand, studies showed that amyloid- peptide (a) can be responsible of metabolic impairments, such as the decrease of glucose consumption observed in the ad brain as well as the calcium - induced excitotoxicity in neurons. it has been found that hyperphosphorylated tau and a are able to impair mitochondrial respiration by inhibiting the etc ci and civ, respectively, inducing decreased oxygen consumption, decreased atp production and increased ros level. this oxidative stress induced by etc dysfunction can surpass cellular and mitochondrial scavenger (mnsod, cu / znsod) and impacts on mmp as well as mitochondrial dna (mtdna). on the other hand, it has been shown that oestradiol can increase glucose utilization by cells as well as etc activity, stabilize the mmp and prevent ros production and calcium - induced excitotoxicity. in the graph, e2 designates where oestradiol potentially acts on mitochondria to compensate a-induced toxicity. in turn, a seems to be able to impact oestradiol metabolism in mitochondria, since it can be directly linked to the mitochondrial enzyme abad and possibly modulates its enzymatic activity (such as the reversible conversion of oestradiol to oestrone) and non - enzymatic activity (mitochondrial rnase p). abad a-binding alcohol dehydrogenase, ci complex i, cii complex ii, ciii complex iii, civ complex iv, cv complex v, cyt c cytochrome c, cu / zn sod copper / zinc superoxide dismutase, mnsod manganese superoxide dismutase, tca tricyclic acid, e2 oestradiol, ros reactive oxygen species, mtdna mitochondrial dna, er oestrogen receptor oestrogens seem to be able to up - regulate genes coding for some electron transport chain components present in nuclear and in mitochondrial dna [53, 54 ]. in fact, an oestrogen - induced increased expression of some subunits of mitochondrial complex i (ci), cytochrome c oxidase (complex iv or civ) and f1 subunit of atp synthase was observed [41, 42, 52 ]. furthermore, treatment of ovariectomized female rats with oestradiol induced an increase of mitochondrial respiratory function in the brain with regard to an enhancement of o2 consumption coupled to an increased activity of cytochrome c oxidase. thus, oestrogen seems to enhance the general metabolism in cells, but besides, it seems also able to directly protect mitochondria against oxidative stress - induced injury. thus, incubation of isolated mitochondria from the rat brain with oestradiol leads to a decrease of h2o2 production by this organelle coupled with an increase of the mitochondrial membrane potential (mmp). furthermore, it has been proposed that its phenolic a ring could allow oestradiol to intercalate into the mitochondrial membrane and to avoid lipid peroxidation occurring in stress condition, which could be responsible for the stabilization of the mmp. moreover, oestradiol seems to prevent the release of cytochrome c by mitochondria (a mechanism known to induce apoptosis of cells by activating the caspase cascade in the cytoplasm), a mechanism increasing the efficiency of the respiratory chain. finally, another oestrogen signalling pathway avoiding the negative effects of oxidative stress is the one regulating calcium homeostasis by inducing mitochondrial sequestration of cytosolic calcium [42, 54 ]. in fact, an imbalance of calcium regulation can lead to an increase of ros production by activating the enzyme nitric oxide synthase, which can in turn sensitize neural cells to oxidative damage. it has been shown that an oestradiol treatment of primary hippocampal neurons was able to potentiate glutamatergic response via nmda receptor which resulted in an increased influx of calcium in cells. this effect was coupled to an induction of mitochondrial sequestration of cytosolic calcium and an increase of the mitochondrial calcium load tolerability thereby avoiding calcium - induced excitotoxicity as well as promoting cell survival. taken together, all those different findings indicate that oestrogen might be able to compensate deficits and injuries that occur in ad, namely mitochondrial respiration impairments, enhanced ros production, excitotoxicity and, more generally, metabolic deficits (fig. 2). more recently, new light has been shed on a mitochondrial enzyme that is able to directly bind a peptide and in which one of the main substrate is 17-oestradiol. this enzyme is known under the name of 17-hydroxysteroid dehydrogenase type 10 (17-hsd) or a-binding alcohol dehydrogenase (abad). abad belongs to the alcohol dehydrogenase family, and it is responsible for the reversible oxido / reduction of several substrates including linear alcohols and steroids, such as 17-oestradiol, using nad as cofactor. under normal conditions (without a), this enzyme plays a role in the regulation of metabolic homeostasis, and its overexpression improved cell viability and atp content. it has been shown that abad is up - regulated in brains of ad mice as well as ad patients [57, 58 ], and it has been suggested that the binding of a changes the conformation of the enzyme, which seems to exacerbate mitochondrial dysfunction induced by a. more recently, studies performed in transgenic mice models of ad showed that behavioural stress or depletion of ovarian hormones by ovariectomy exacerbated mitochondrial dysfunction, aggravated plaque pathology and increased abad expression in the brain [59, 60 ]. furthermore, double transgenic mice overexpressing mutant app and abad present an earlier onset of cognitive impairment and histopathological changes when compared to app mice, suggesting that aabad interaction is an important mechanism underlying a toxicity. this hypothesis is supported by a study from yao and collaborators who recently showed that inhibition of aabad interaction by a decoy peptide can restore mitochondrial deficits (activity of mitochondrial respiratory complexes, ros level) and improve neuronal and cognitive function. new interesting findings of our group seem to go in the same way with regard to the use of a novel small abad - specific compound inhibitor (ag18051) by investigating the role of this enzyme in a toxicity in human sh - sy5y cells treated for 5 days with a142 0.5 um. the crystal structure of human abad in presence of ag18051 showed that the inhibitor formed a covalent link with the nad cofactor and occupied the substrate - binding site of the enzyme. thus, the inhibitor was able to prevent a-induced cell death and significantly normalized metabolic functions impaired by a, such as cytosolic and mitochondrial ros as well as mitochondrial respiration. furthermore, it was able to restore oestradiol levels which were reduced after treatment with a [31, 61 ]. what is interesting to note is that the apparent protective effects of the abad inhibitor seem to be independent on its interaction with a. in fact, a 24-h pre - treatment with ag18051, before the incubation of cells with a1 - 42, was sufficient to prevent cell death, normalize ros production and restore mitochondrial respiration. regarding oestradiol level, we previously showed that it decreased in the cytosol and increased in isolated mitochondria of sh - sy5y cells after 5 days of treatment with a. the abad inhibitor normalized the oestradiol level in the cytosol, and preliminary data of our group suggest a similar effect in isolated mitochondria (unpublished data). thus, we propose the following model of mode of action : abad inhibitor is able to block a toxicity by changing abad configuration, which disables the binding of a thus preventing its toxic effects (fig. 3). the action of abad on the electron transport chain (etc) is still unclear, but the potential role of abad as mitochondrial rnase p directly links abad to the production of mitochondrial etc proteins and ros generation. notably, ag18051 was able to normalize also this function of abad since mitochondrial respiration was restored, but the underlying mechanisms still remain unclear.fig. a under normal conditions, abad is responsible of the reversible oxido / reduction of linear alcohols and steroids, such as the reversible conversion from oestradiol to oestrone. its potential function as an rnase p could also be important for the good functioning of the mitochondrial etc. b under ad - relevant pathological conditions, a can directly bind the mitochondrial enzyme abad, changing the configuration of the enzyme which seems to inhibit its activity and creates an imbalance between oestradiol and oestrone. a-induced abad misfolding can impact etc functioning and increase, directly or indirectly, ros production, which lead to cell death. c in the presence of ag18051 (ag), the binding of a to abad is inhibited, normalizing oestradiol level, ros production, etc activity, and improves cell survival. abad a-binding alcohol dehydrogenase, imm inner mitochondrial membrane, omm outer mitochondrial membrane a, abad and mitochondria : modes of interactions. a under normal conditions, abad is responsible of the reversible oxido / reduction of linear alcohols and steroids, such as the reversible conversion from oestradiol to oestrone. its potential function as an rnase p could also be important for the good functioning of the mitochondrial etc. b under ad - relevant pathological conditions, a can directly bind the mitochondrial enzyme abad, changing the configuration of the enzyme which seems to inhibit its activity and creates an imbalance between oestradiol and oestrone. a-induced abad misfolding can impact etc functioning and increase, directly or indirectly, ros production, which lead to cell death. c in the presence of ag18051 (ag), the binding of a to abad is inhibited, normalizing oestradiol level, ros production, etc activity, and improves cell survival. abad a-binding alcohol dehydrogenase, imm inner mitochondrial membrane, omm outer mitochondrial membrane thus, the interplay between abad, oestradiol and mitochondria may be a very interesting lead to follow in the future to decode a-induced mitochondrial toxicity and explore therapeutic strategies of abad inhibition. it is still debated whether oestrogen treatment after menopause could result in improved cognitive function in women. this debate is based on many animal and cell culture data showing that oestrogens can positively affect the ageing and ad brain. it was recognized from former studies that oestrogen depletion in post - menopausal women represents a significant risk factor for the development of ad and that an oestrogen replacement therapy may decrease this risk and even delay disease progression [64, 65 ]. however, large treatment trials showed negative effects of long - term treatment with oestrogens in older women. above all, results from the whims including 4,532 post - menopausal woman aged over 68 years indicated a twofold increase in dementia after 4.2 years of hormonal treatment (p.o. in addition, the study indicated potential risks for breast cancer, pulmonary embolism and stroke [66, 67 ]. some attribute this failure to the synthetic nature of the hormones used in the whims trial, since in vitro studies support a beneficial role of oestradiol and progesterone, but not of medroxyprogesterone used in the whims [68, 69 ]. of note, medroxyprogesterone is not metabolized to 3, 5-thp and can inhibit conversion of prog to 3, 5-thp. similarly, oestradiol, prog or 3, 5-thp, but not medroxyprogesterone, showed beneficial effects in ageing, seizure, cortical contusion, ischaemia and diabetic neuropathy models. another theory which tries to explain trial failure is the critical window hypothesis, asking for the critical period where oestrogen might exert a neuroprotective effect. this hypothesis is substantiated by animal research, e.g. mice which have undergone ovariectomy, but in which oestrogen treatment was delayed substantially by months (the equivalent of years in human terms), did not benefit by this, as the animals did which received treatment immediately after ovariectomy. however, a recent meta - analysis indicated, contrary to expectations, that age of women and duration of time relapsed when treatment was initiated since menopause did not significantly affect treatment outcome. thus, natural oestradiol (e2) without a progestagen should represent the preferred treatment. furthermore, the oral route of drug delivery, being non - invasive in nature, is by far the most convenient and preferred route of administration in any acute or chronic treatment. though oestradiol itself from conventional oral oestradiol formulations has the ability to cross the blood brain barrier (bbb) and reach the brain, but a large oral dose is required to achieve therapeutic levels of oestradiol due to its non - specificity for the brain. this non - specificity increases the peripheral drug burden and subsequently potentiates the risk of peripheral adverse effects. furthermore, with specific regard to the brain - specific action of oestradiol as a neurosteroid, independently of its action in the periphery, other modes of administration (cyclical, nasal, polymer nanoparticles for oral delivery) need to be sought and investigated. alternatively, the true potential of phyto - oestrogens, like the soy isoflavones genistein, daidzein and glycitein, which activate the same neuroprotective pathways than oestrogens but with weak oestrogenic cellular effects that might be responsible for the lower prevalence of ad in japanese living in their ethnic homeland compared to japanese living in the usa, to beneficially modify disease processes should be studied in clinical trials. in addition, the field could strongly benefit from the successful development of oestrogen derivates that have no unfavourable oestrogenic side effects. the successful use of oestrogen or oestrogen - analogue therapies to delay, prevent and/or treat ad will require additional research to optimize key parameters of therapy. in this context, the interplay between abad, oestradiol and mitochondria and accordingly abad inhibition might represent a further interesting lead to follow in the future. knowledge acquired from these studies will eventually be applied to unravel the pathophysiology and to inform prevention and intervention strategies of ad. | hormonal deficit in post - menopausal women has been proposed to be one risk factor in alzheimer 's disease (ad) since two thirds of ad patients are women. however, large treatment trials showed negative effects of long - term treatment with oestrogens in older women. thus, oestrogen treatment after menopause is still under debate, and several hypotheses trying to explain the failure in outcome are under discussion. concurrently, it was shown that amyloid - beta (a) peptide, the main constituent of senile plaques, as well as abnormally hyperphosphorylated tau protein, the main component of neurofibrillary tangles, can modulate the level of neurosteroids which notably represent neuroactive steroids synthetized within the nervous system, independently of peripheral endocrine glands. in this review, we summarize the role of neurosteroids especially that of oestrogen in ad and discuss their potentially neuroprotective effects with specific regard to the role of oestrogens on the maintenance and function of mitochondria, important organelles which are highly vulnerable to a- and tau - induced toxicity. we also discuss the role of a-binding alcohol dehydrogenase (abad), a mitochondrial enzyme able to bind a peptide thereby modifying mitochondrial function as well as oestradiol levels suggesting possible modes of interaction between the three, and the potential therapeutic implication of inhibiting aabad interaction. |
nerve injury and specifically trigeminal nerve injury is known as a potential risk of many surgical procedures in the oral cavity in general [17, 23, 30 ]. usually after oral implant rehabilitation, the patient expects and experiences significant improvements, not only regarding jaw function, but also in relation to dental, facial, and even overall body image. one can perfectly understand that the patient does not accept neural side effects, which might compromise his well - being. following the definitions of the subcommittee on taxonomy of the international association for the study of pain 1986, the types of sensorial disturbances are principally anesthesia, paresthesia, or dysesthesia. sensory disturbances in the maxillofacial region could be associated with different surgical procedures, like placement of endosseous implants [3, 36, 37 ]. with regard to immediately loaded implants, the presence of postoperative sensory disturbances was not documented. branemark. developed a new approach for immediate loading using fixed prosthesis of prefabricated standard components in the edentulous mandible. this technique involves a flattening of the jaw crest, followed by the placement of the implants by means of prefabricated and thus not individualized surgical guides. thus the distances (but not the depth of drilling) between the implants were always the same, considerably reducing the variation of the surgical procedure. sometimes the distal implants were positioned near the mental foramen. damage to the mental nerve may result in loss of tactility and thus biting on the tongue or lip, drooling, painful sensations, and also interference with several jaw functions such as mastication, speech, hygiene maintenance, and social or psychosexual well - being. different methods were used to evaluate such sensory disturbances after the placement of dental implants. ellies in 1992 and ellies and hawker in 1993 published two retrospectives studies based on the analysis of questionnaires. applied in a prospective study a self - administrated questionnaire and the somatic questionnaire, the hopkins symptoms checklist (hscl). the latter is a questionnaire routinely used in psychology to estimate a patient s psychoneurological and/or psychosomatic discomfort. the somatic score of the hscl was oriented on physical complaints and shows the level of a patient s perception of his / her physical state. the higher the somatic score (i.e., 25% in the study of wismeijer.), the more the patient tends to exaggerate physical complaints, but the risk of a sensory disturbance of the lower lip is a possible complication after implant surgery. analyzed the neurosensory disturbances in a population of patients after oral implant placement, using a combination of psychophysical methods like soft brush, two - point discrimination, pain perception, and temperature sensitivity. a small number (8/94) of patients experience altered sensation after the placement of mandibular endosseous implants, but no permanent alteration was found. walton published a prospective study of 75 subjects using one objective (the light touch sensation) test, associated with a subjective analysis (questionnaire) ; both methods were used before and after placement of two implants in the anterior mandible. in this study, 24% of subjects reported neurosensory disturbances in the short term after implant surgery in the anterior mandible, but the problem appears to be a transient one with only about 1% experiencing sensation changes 1 year after implant surgery. after reviewing the related literature, it is clear that the proportion of patients with sensory disturbances varies among publications. it is therefore essential to assess if neurosensory changes take place after the immediate loading of oral osseointegrated implants in the edentulous mandible in patients who received a fixed prosthetic construction on the day of implant insertion or the next day. distinguishing between dysesthesia, an unpleasant abnormal tactile sensation, and paresthesia, an abnormal (not painful) and often decreased sensation, is the first step in defining the character of the neurosensory disturbance reported by a patient. further differentiation between paresthesia and hypoesthesia, which is a reduction in the level of sensation, and finally anesthesia, the complete absence of any sensation, is important from all viewpoints. in the presence of dysesthesia, the differentiation must be established between spontaneous and a stimulus - induced unpleasant sensation. the clinical approach and sometimes legal implications of these different conditions besides clinical evaluation, it must be understood that evaluation of nerve injuries such as demyelinization due to compression (neuropraxia), distal wallerian degeneration with intact cell tubes (axonotmesis), or proximal and distal wallerian degeneration with disparate schwann cell tubes (neurotmesis) is an impossible mission for the clinician. nevertheless, if no spontaneous return of tactile sensibility is noted within 36 months, the permanent loss of continuity of some or all the elements of the nerve trunk should be expected [11, 27 ]. some observations indicate that the return to normal tactile sensibility may even occur after 2 to 3 years. such methodology is clinically helpful and is a good basis for more detailed and objective evaluations. immediate loading of oral implants was proposed as an alternative protocol in the rehabilitation of partially or fully edentulous patients. surprisingly enough, no study has yet referred to the possible different neural sensibility when loading is imposed immediately after or together with the placement of the implants. this tactile sense aspect is relevant especially if we consider that the prosthetic rehabilitation (implying by example a full occlusal contact) is functional within one or a few hours after the implant placement. thus, the patient s awareness of the load imposed on the implants can be a key issue to avoid undue load transfer on the implant bone interface. the overall aim of the present research is to objectively evaluate the neurosensory disturbances and/or function occurring after placement of oral implants in the anterior region of the mandible. this study comprised a total of 65 patients (age range 3084 years, mean age 58 years ; 30 women). all patients were treated by means of immediately loaded implants in the anterior mandible with the brnemark novum system approach. surgery took place at the department of periodontology, catholic university leuven (55 patients, 3 surgeons), and at the department of oral and maxillofacial surgery, erasmus hospital, free university of brussels (10 patients, 2 surgeons). selection criteria included (1) placement of implants in the anterior mandible using brnemark novum system (nobelbiocare ab, gothenburg, sweden) ; and (2) no history of neurological disorder. an ad hoc multiple choice questionnaire (13 questions) was designed to record past and present neurosensory disturbances in these patients. the clinical history of the patient was used, and according to the selection criteria, a self - administered questionnaire was sent out to the 65 patients. the questionnaire was sent by mail to the patients with the request to complete it and return it to the clinic. the questionnaire was designed by experienced periodontologists, prosthodontists, and one psychologist (see appendix for the questionnaire). the answers to the questions were analyzed and data were collected by this same team. an objective evaluation took place after analysis of the questionnaire. during this evaluation the clinical evaluation of trigeminal nerve injuries suggested by zuniga and essick in 1992 was used as basis in the test and control population. a psychological test : the scl-90-r (symptom checklist-90-revised) was applied. the scl-90-r is different from the hscl because it considers a broader area of psychopathology. it reveals the global level of recent psychological and also physical dysfunction. in the present study, the scl-90-r scale reveals complaints, loaded with a general feeling of physical dysfunction, as a result from functional problems. after completion of the questionnaire, each patient was interviewed using a standardized series of key questions on altered feeling in the chin, lips, tongue, and cheek. each time a distinction was made between the right and left sides of the face. typical questions were as follows : how would you describe the altered feeling?do you notice the altered feeling constantly or only when touching the area, or chewing, or talking?is it painful ? where ? transient or constant?does it start spontaneously or is it evoked by touching, chewing, or speaking?what exacerbates the pain?what relieves the pain ? do you notice the altered feeling constantly or only when touching the area, or chewing, or talking ? does it start spontaneously or is it evoked by touching, chewing, or speaking ? what exacerbates the pain ? what relieves the pain ? after thorough questioning about the patient s general and oral medical history, an extra- and intraoral clinical examination took place, including palpation and/or percussion, to detect eventual provoked pain at the site of injury. finally, inspection of the oral cavity was performed to find eventual evidence of nerve injury, self - induced trauma, etc. in the present study three psychophysical tests were selected : two - point perception at the lower lip, both left and right side (fig. 1) ; thermal sensitivity at the lower lip and gingiva of the anterior lower jaw, both left and right side (fig. 2) ; and light touch sensation at the lower lip and gingiva of lower jaw, both left and right side (fig. 3light touch sensation (semmes - weinstein aesthesiometer) instrument two - point discrimination instrument thermal sensitivity instrument light touch sensation (semmes - weinstein aesthesiometer) instrument psychophysical tests demand a thorough consciousness and active participation of the patients and a quiet environment. a combination of both psychophysical tests with testing tools adapted to the intraoral and perioral sites were used. the light touch sensation on the other hand was tested using the original semmes - weinstein aesthesiometer (stoeling company, wood dale, usa) device. to determine the threshold level the staircase method was applied. in the light touch sensation and static two - point discrimination, finally, in the thermal sensitivity test, all subjects were tested with ten trials. for a more detailed methodology of the procedures for sensory testing, see jacobs.. the collected data were statistically analyzed using the statistica for windows 5.1 (stat soft, tulsa, ok, usa). a mann whitney u test was applied to the threshold levels in the test and the control groups. fifty - eight of the 65 patients (89%) completed the questionnaire and returned it to the hospital. systemic diseases like cardiac, respiratory, endocrine, and renal diseases, allergic reactions, and psychological (depression) problems were detected in 46% (n=30) of the patients. the mean time between the placement of the implants and the reception of the questionnaire was 20 months (range 840 months). the analysis of the questionnaire showed that 33% (n=19) of patients reported a kind of neurosensory disturbance after the placement of the implants (range 824 months). the age range of this subpopulation was between 30 and 71 years (mean age 56, 13 women). the duration of this postsurgical neurosensory disturbance after the implant surgery was less than 3 months in 58% (n=11) of the patients. the most commonly affected sites in the 19 patients were the gingiva only (6 patients), the inferior lip only (4 patients), and the chin (4 patients). one of the patients did not remember or could not determine the affected zone. speaking and drinking (five patients) an important part of the affected population group (12 patients) did nt complain about problems with oral function or daily activity. the most common reported sensation was numbness (nine patients), followed by cutting, beating, and itching reported by two patients. only one patient considered that the benefits of a fixed prosthesis did not outweigh the disadvantages that she had experienced as a result of disturbances in sensation of the lower jaw. she considered that she would not have done this surgery again, if she had been informed beforehand about the potential sensory changes in the orofacial region. from the 19 patients, 9 volunteered to participate in the objective evaluation (test group). the test group was 3071 years old (mean age 56 years, seven women). their age ranged from 49 to 71 years (mean age 63 years, all women). the mean observation time in this group since the surgery (two implants placed in the anterior mandible after a two - stage protocol) was 18 months (range 1122 months). as psychological test, the scl-90-r test was applied for symptom measurement of patient treatment outcomes and their degree of somatization of the symptoms. the psychophysical tests included three neurosensory evaluations : two - point discrimination, thermal sensitivity, and light touch sensation. an age- and gender - matched group of patients who had undergone similar surgery (two implants in the symphyseal region) in the same area, but without reporting sensory disturbances, served as control. as mentioned above, each of the 19 patients of the self - declared affected population was invited for a clinical evaluation and 9 of the 19 patients accepted to participate. the time span between surgery and psychophysical evaluation was on average 29 months (range 1949 months). during the clinical interview, before the actual objective testing took place, none of the nine patients had remaining complaints or clinical symptoms such as drooling or tongue bite wounds that could indicate a sensory disturbance. however, at the reception of the questionnaire, which had to be mailed after the examination session, five of the nine patients with self - declared neurosensory disturbances still reported having them. in the remaining four patients the scores of the scl-90-r of the test (n=9) and control group (n=10) revealed no statistic differences, neither on the global scale of neuroticism, nor on the dimension of somatic complaints. after clinical examination and considering the negative interview for unpleasant dysesthesia and pain, it was concluded that only potential signs of paresthesia were currently present in the affected patients. two - point discrimination, thermal sensation, and light touch sensation at the gingival level show no significant difference between test and control groups (table 1) [14, 16, 26, 28 ]. table 1overview of psychophysical tests scores between test group, control group, and reference valuestype test / regiontest groupcontrol groupreference valuesreference numberts / llls0.8 (cr)0.9 (cr)0.8 (cr)18ts / llrs0.9 (cr)0.9 (cr)0.8 (cr)18ts / lgls0.8 (cr)0.8 (cr)0.8 (cr)18ts / lgrs0.8 (cr)0.8 (cr)0.8 (cr)182pd / llls3.4 mm4.5 mm6.13.1 mm193.31.6 mm2024 mm21, 222pd / llrs3.4 mm4.8 mm6.13.1 mm193.31.6 mm2024 mm21,22lts / lgls7 nf6 nf4 (2.83) nf 19lts / lgrs7 nf7 nf4 (2.83) nf19ts thermal sensation, llls lower lip left side, llrs lower lip right side, lgrs lower gingiva right side, lgls lower gingiva left side, cr correct ratio, 2pd two - point discrimination, mm millimeters, lts light touch sensation, and nf the number of the filamentmean value of von frey hair overview of psychophysical tests scores between test group, control group, and reference values ts thermal sensation, llls lower lip left side, llrs lower lip right side, lgrs lower gingiva right side, lgls lower gingiva left side, cr correct ratio, 2pd two - point discrimination, mm millimeters, lts light touch sensation, and nf the number of the filament mean value of von frey hair the light touch sensation of the lower lip was significantly impaired in the test group (mann whitney u test). there was a statistical difference for both sides (p0.03) between test and control groups. systemic diseases have a significant effect on the outcome of the light touch testing at the lower lip. the light touch sensation of the lower lip revealed a statistical difference (p0.04) for both sides. the anterior region of the mandible was always considered as a safe zone for the use of oral implants. nevertheless, there is an important difference between the reported implant success rate with specific surgical technique and the postsurgical changes to function, sensory mechanisms, and the physiological integration in the human body. anatomical considerations in the anterior region of the mandible and the skills and experience of the surgeon are also important. it is surprising to note that the present methodology allowed us to observe a very high percentage of subjective postoperative complaints. these results are in agreement with others, i.e, ellies with 37% and ellies and hawker with 36%. this high degree of concordance for the percentages of incidence is interesting, considering the different surgical techniques used and cultural and sometimes ethnic differences between the three involved populations (canada, australia, and belgium). it was not possible, based on the subjective data, to establish any correlation between the systemic diseases presented in the study population and the reported sensory disturbances (i.e., impairment of perception in a patient with diabetes) [2, 4 ]. it is interesting to know that eight patients had the impression to be affected by some kind of persistent neurosensory disturbance, most probably paresthesia or hypoesthesia, more than 12 months after the surgery. nevertheless, besides these results, a majority of these affected patients considered that the benefits outweigh this kind of transient or permanent disadvantages, and consider that they would accepted an implant surgery again even if they knew about the present complication. as expected from the neuroanatomical knowledge recently collected, neurosensory disturbances regularly occur in the anterior region of the mandible after surgery. anatomical factors like the presence of an anterior loop, handling of the mental nerve during surgery, or the perforation of the incisive nerve canal can all provoke such disturbances. as mentioned above this procedure can be considered rather invasive and can damage, in severely resorbed jaws, the incisive canal or the mental nerve emerging at the crestal level. the relationship between a reduction of the crestal jawbone and neurosensory disturbances could not be traced in the literature. however, bone chin grafting procedures present some similarities. von arx. recently reported 8.1% of neurosensory disturbances after 6 months in patients who underwent such procedures. for some systemic conditions, it was reported that persons can be more prone to sensory disturbances. peripheral neuropathy in people with scleroderma is thought to be rare, however, nerve conduction studies showed abnormalities in patients with a mean disease duration of 10 years or longer. polyneuropathies in mild or severe diabetic patients often cause subclinical damage of the trigeminal nerve. moreover, their sensory complaints in the perioral area often remain unnoticed and the dysfunction undiagnosed. the younger the subject, the greater the degenerative response but the quicker and more complete the overall recovery. tactile threshold assessment reveals that detection of monofilaments up to 0.023 g (monofilament number 2) can be considered normal in the orofacial region [14, 37 ]. neurophysiological recordings of the masseter reflex, the mental nerve blink reflex, or evoked potentials are all useful in evaluating trigeminal nerve damage. this was specifically shown for damage of the inferior alveolar nerve [19, 32, 33 ]. however, evaluation of nerve damage in the symphyseal region was not reported in the literature. the number of nerves innervating this region, the vicinity of interfering structures (e.g., tongue, saliva, and labial muscles), and anatomical variations make this a difficult but challenging task. in humans, several reports show that during the stimulation of peripheral sensory limb nerve examined after surgical repair (time span between 5 and 20 years), the sensory function remained deficient and often included abnormal sensory disorders. it must also be considered that the loss of tactile sensitivity after surgery is not always reflected in abnormal psychophysical test results. furthermore, it is also possible, as shown by the collected data in this study, that an abnormal test result, particularly the light touch sensation test, does not reflect clinical reality. in other words, it should be stressed that the selection of a control group of patients treated by means of two implants in the symphyseal region was principally motivated by the intent to have an age- and gender - matched group. the selection of a control group among patients treated with the novum system but without neurosensory complaints would not have allowed this. it must also be considered that sometimes thresholds of the psychophysical test are not easy to reach in the oral cavity ; the devices were not originally designed for this region, particularly light touch sensation. not less important is the fact that 95% (n=17) of the affected population considers that the treatment benefits outweigh the transient disadvantages, and that 18/19 of the patients consider that they would follow an implant surgery again if they knew beforehand the changes in sensation after the surgery. there are no data in literature to compare neurosensory disturbances after immediate loading with those after the two - stage protocol. it is clear that it is difficult for the patient to distinguish between postoperative inconveniences, early functional adaptation, and real neurosensory dysfunction. a meticulous preoperative planning of the surgery, even in an improperly so - called safe region of the jaws, like the symphyseal region, might avoid many neural disturbances. in this perspective, the use of cross - sectional images and the transfer of the planning to the operative field may be considered. the use of a questionnaire to determine the presence or absence of a problem after a medical procedure is easy and inexpensive ; but to clarify the type, magnitude, extension, and eventual persistence of the neurosensory disturbance, the use of objective methods (i.e., psychophysical methods) in the evaluation of a population affected by any sensory disturbance, when complaints are detected, is highly recommended. the objective follow - up revealed that patients are often not impaired by, and even not aware of, neurosensory dysfunctions after implant surgery in the anterior mandible. none of the patients suffering from this impaired tactile function seems to have functional deficits resulting from it. based on these data, proper preoperative planning using cross - sectional imaging can be advised even for surgical procedures in the symphyseal region. in the next pages you can find several questions about your implant surgery in the lower jaw. the objective of these questions is to evaluate if you have or had an alteration of sensibility after the placement of the implants in the lower jaw. put an x before the correct answer. please try to complete this questionnaire to the very best.1) after your implant surgery, did you experience a change in feeling or sensation of your lower lip, chin or gums?__yes__noif yes, please indicate _ _ lower lip _ _ chin _ _ gums if your answer was no, it is nt necessary to follow with the questionnaire. thank you very much for your cooperation. if your answer for the question number 1 was yes 2) if you have experienced a changed sensation in an area of the lower jaw was it temporary (one day to several months) or is it still present?__temporary__persistent 3) if the change was temporary, how long did it last?__(more) 1 year, please state how long _ _ _ _ _ _ _ _ _ _ 13 months__36 months 4) did the change in sensation of your lower jaw affect your ability to continue your daily routine?__yes__no 5) did the changed sensation affect your ability to perform any of the following activities?__speaking__tasting__eating__whistling__drinking__kissing__swallowing__other, please specify _ _ _ _ _ _ _ _ _ _ _ _ 6) which side of your lower jaw is (was) affected?__right__both right and left sides__left__i do nt remember which side 7) which of the following words best describes the change in sensation you have experienced (please select onlyoneword!))?__burning__tickling__hot__itching__prickling__numb__penetrating__frozen__cutting__prurience__tearer__electric__ardent__palpitation if you have selected one word of the left column please continue with this questionnaire. if you have selected one word of the right column go to the question 12. describing a pain or you have a word on the left side and a word on the right side. between the words you have a line. on the line you put a littlex[eks ] (x) in the zone most representative, in other words take the next question like a thermometer to measure the intensity of rain.8) the type of pain is (or was):insupportable_________________________________________supportable 9) is this region disturbing during the night?__yes__no 10) do you occasionally take painkillers (i.e. aspirins, paracetamol) to control this pain ? attention : the analgesics you took immediately after the placement of the implants must not be considered.__yes__noif so, which painkillers do you take ? _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ if your answer to question 10 was no do nt fill in the question 11.11) do these painkillers relieve your pain?__yes__no 12) did you feel that the benefits to your implant surgery outweigh the disadvantages you have experienced as a result of changes in sensation of your lower jaw?__yes__no 13) would you go through implant surgery again if you knew you would have the changes in sensation that you have experienced?__yes__no you have finished the questionnaire ; now please return the questionnaire by mail in the envelope that we have prepared for you | the aim of the study was to assess past and present neurosensory disturbances using a questionnaire and a psychophysical approach in patients treated with immediate loaded implants in the edentulous anterior mandible. a group of 65 patients (age range 3084 years, mean 58 years, 30 women) was enrolled. all were treated by means of three immediately loaded implants (branemark novum system). a self - designed questionnaire was used for data collection. the response rate was 89%. of the 58 responders, 33% (n=19) reported neurosensory disturbances after implant surgery. nine of these patients (mean age 56 years, seven women) participated in an objective evaluation and were subjected to a psychological and several psychophysical tests. at the moment of the evaluation none of the nine patients still had clinical complaints. psychological testing revealed no statistical differences between the patients, who had previously experienced subjective complaints, and the control group. two - point discrimination and thermal sensation tests revealed no sensory lesions. the light touch sensation test at the lower lip indicated a more frequent reduction of tactility for the test group (p0.03). neurosensory disturbances can occur in the anterior region of the mandible after implant surgery. |
the longevity of a ceramic restoration appears to be linked to its physical and mechanical properties, as well as reliable bonding between the restoration and the tooth. in order to obtain effective bonding between feldspathic ceramics and the tooth substrate, surface treatment is necessary for both the internal aspect of the ceramic and the tooth structure. the use of methods to pretreat the ceramic surface, such as mechanical (burs and aluminum oxide sandblasting), chemical (2.5 - 10% hydrofluoric acid etch and silane) or a combination of both (silicon oxide sandblasting) optimize adhesion between the ceramic and the resin cement. the combination of hydrofluoric acid and silane on the internal surface of the ceramic has been the most recommended method to increase bond strength between the ceramic and the tooth substrate when using resin cements. however, it has been demonstrated that following hydrofluoric acid removal from the ceramic surface, considerable amounts of deposits are formed, which can affect bond strength. some studies have proposed cleaning techniques for ceramic surface aiming at removing the residues left by hydrofluoric acid etching, including the use of ultrasonic bath, 37% phosphoric acid smear, rinsing under running wateror a combination of 37% phosphoric acid smear and ultrasonic bath. considering the lack of an established protocol to remove residues created by hydrofluoric acid etching of the ceramic surface, the aims of this study were to evaluate : a) the micro - shear bond strength and failure mode between the feldspathic ceramic and the adhesive system following pretreatment of the ceramic surface with different cleaning methods to remove particles generated by hydrofluoric acid etching ; b) the feldspathic ceramic surface micromorphology after using different cleaning methods to remove hydrofluoric acid etching residues by scanning electron microscopy (sem). forty six feldspathic ceramic discs (super porcelain ex-3, noritake kizai co., ltd, nishi - ku, nagoya, japan, batch 011906, shade a3,5b) were made, 6 of which were used to assess micromorphology and 40 were used for micro - shear bond strength testing. the ceramic discs were obtained from 12.5 mm diameter by 3.6 mm thick wax patterns using lost wax casting, which gave room to the feldspathic ceramic. the ceramic powder / liquid ratio was used as instructed by the manufacturer and the mixture was placed into the plaster mold using a specific brush provided in the ceramic kit. the investment plaster and ceramic set were placed in a furnace for sintering at the temperature specified by the manufacturer. as the ceramic shrinks by approximately 20% during sintering, the final disc dimensions were close to 10 mm in diameter and 3 mm thick. forty ceramic discs were included in pvc cylinders using polyester resin (hobby automotivo, 3 m do brasil, sumar, sp, brazil). the surfaces of the ceramic discs were sequentially polished using silicium carbide sandpaper (lixa d'gua, 3 m, sumar, sp, brazil) of grades 400, 600 and 12005, mounted on a running water - cooled electric polisher (aropol 2v, arotec s / a, so paulo, sp, brazil). the discs were randomly divided into 5 experimental groups of 8 discs (n=8). the surface of all ceramic discs was treated with 10% hydrofluoric acid (villevie, joinville, santa catarina, brazil) for 2 minutes, followed by water and water spray rinse for 30 seconds. then, the discs were treated according to the experimental groups as follows : group c : no additional surface treatment ; group s : water spray + air for 1 minute, using the 3-in-1 syringe ; group us : ultrasonic bath (usc1400, unique ind. ltda, so paulo, sp, brazil) with distilled water for 5 minutes ; group f : 37% phosphoric acid smear (acid gel, villevie, joinville, sc, brazil), using a disposable brush (disposable micro - applicators, microbrush, rio de janeiro, rj, brazil) for 1 minute, followed by rinsing under running water for 1 minute ; group f+us : 37% phosphoric acid smear (acid gel, villevie, joinville, sc, brazil), using a disposable brush (disposable micro - applicators, microbrush, rio de janeiro, rj, brazil) for 1 minute, followed by rinsing under running water for 1 minute, combined with ultrasonic bath (usc1400, unique ind e com de prod elet. ltda, so paulo, sp, brazil) with distilled water for 5 minutes. five 0.8 mm diameter x 4 mm high composite resin (filtek z100, 3 m espe, st. therefore, a layer of silane (dentsply, petrpolis, rj, brazil) was previously applied to bond the resin onto the ceramic. a layer of adhesive (adper scotchbond - adhesive, 3 m espe, st. paul, mn, usa) was applied and light - cured using halogen light (demetron, lc kerr corporation, orange, ca, usa) for 10 seconds. then, silicone tubes 4 mm high x 0.8 mm diameter were placed on the ceramic surface to be filled with resin composite. after filling the tubes, the resin cylinders were light - cured for 40 seconds (demetron, lc kerr corporation, orange, ca, usa) with the light source placed at the upper end of the cylinders, thus light - curing all of them simultaneously. the light - curing equipment was set at 499 mw / cm (from 491 mw / cm to 507 mw / cm) with the aid of a radiometer (radimetro digital, newdent, ribeiro preto, sp, brazil) and reviewed after every five light - curing cycles. immediately after light - curing, the silicone tubes were cut using a scalpel blade 12 and disposed of in order to obtain 4 mm high x 0.8 mm diameter composite resin cylinders bonded to the ceramic surface, with a bonding area of 0.5 mm. the specimens were stored in a bacteriological incubator (ecb 1.3 digital, odontobrs ind. ltda, ribeiro preto, sp, brazil) at 37c for 24 hours until the bond strength tests were performed. the ceramic discs were fixed to a device attached to the universal testing machine (dl2000, emic ind e com ltda, so jos dos pinhais, pr, brazil). a 0.3 mm diameter stainless steel wire looped around both the extremity of the loading cell and the composite resin cylinder, simultaneously. the wire maintained contact with the inferior semicircle of the cylinders, as close as possible to the area bonded to the ceramic. the test was carried out at a speed of 0.5 mm / min, until bonding failure, for each cylinder sequentially, that is, one at a time. the failure mode was assessed using a stereoscopic lens (ek3st model, eikonal, so paulo, so paulo, brazil) at 20x magnification. the failure modes were classified as adhesive failure, ceramic or resin cohesion failure, or mixed. cohesion failure was defined as a fracture in the body of the ceramic or the resin, adhesive failure when there was a fault at the junction between the ceramic and the resin, and mixed when there was both adhesive and cohesion failure, simultaneously. one of the six ceramic discs used to evaluate surface micromorphology did not receive any surface treatment, including hydrofluoric acid. the specimens were then stored in an incubator at 50c for 3 hours to remove any water particles, 24 hours prior to sem assessment. the samples were then placed in airtight glass jars containing silica gel and sealed to ensure moisture elimination. the discs were positioned in the sem (jsm 5600lv, jeol, tokyo, japan) and images were obtained at 500x and 2,500x magnification. for each ceramic disc, the mean micro - shear bond strength value for the resin cylinders was considered. after exploratory analysis, the data were tested using one - way analysis of variance (p<0.05) on sas statistical software (release 9.2, 2008, institute inc., forty ceramic discs were included in pvc cylinders using polyester resin (hobby automotivo, 3 m do brasil, sumar, sp, brazil). the surfaces of the ceramic discs were sequentially polished using silicium carbide sandpaper (lixa d'gua, 3 m, sumar, sp, brazil) of grades 400, 600 and 12005, mounted on a running water - cooled electric polisher (aropol 2v, arotec s / a, so paulo, sp, brazil). the discs were randomly divided into 5 experimental groups of 8 discs (n=8). the surface of all ceramic discs was treated with 10% hydrofluoric acid (villevie, joinville, santa catarina, brazil) for 2 minutes, followed by water and water spray rinse for 30 seconds. then, the discs were treated according to the experimental groups as follows : group c : no additional surface treatment ; group s : water spray + air for 1 minute, using the 3-in-1 syringe ; group us : ultrasonic bath (usc1400, unique ind. ltda, so paulo, sp, brazil) with distilled water for 5 minutes ; group f : 37% phosphoric acid smear (acid gel, villevie, joinville, sc, brazil), using a disposable brush (disposable micro - applicators, microbrush, rio de janeiro, rj, brazil) for 1 minute, followed by rinsing under running water for 1 minute ; group f+us : 37% phosphoric acid smear (acid gel, villevie, joinville, sc, brazil), using a disposable brush (disposable micro - applicators, microbrush, rio de janeiro, rj, brazil) for 1 minute, followed by rinsing under running water for 1 minute, combined with ultrasonic bath (usc1400, unique ind e com de prod elet. ltda, so paulo, sp, brazil) with distilled water for 5 minutes. five 0.8 mm diameter x 4 mm high composite resin (filtek z100, 3 m espe, st. therefore, a layer of silane (dentsply, petrpolis, rj, brazil) was previously applied to bond the resin onto the ceramic. a layer of adhesive (adper scotchbond - adhesive, 3 m espe, st. paul, mn, usa) was applied and light - cured using halogen light (demetron, lc kerr corporation, orange, ca, usa) for 10 seconds. then, silicone tubes 4 mm high x 0.8 mm diameter were placed on the ceramic surface to be filled with resin composite. after filling the tubes, the resin cylinders were light - cured for 40 seconds (demetron, lc kerr corporation, orange, ca, usa) with the light source placed at the upper end of the cylinders, thus light - curing all of them simultaneously. the light - curing equipment was set at 499 mw / cm (from 491 mw / cm to 507 mw / cm) with the aid of a radiometer (radimetro digital, newdent, ribeiro preto, sp, brazil) and reviewed after every five light - curing cycles. immediately after light - curing, the silicone tubes were cut using a scalpel blade 12 and disposed of in order to obtain 4 mm high x 0.8 mm diameter composite resin cylinders bonded to the ceramic surface, with a bonding area of 0.5 mm. the specimens were stored in a bacteriological incubator (ecb 1.3 digital, odontobrs ind. ltda, ribeiro preto, sp, brazil) at 37c for 24 hours until the bond strength tests were performed. the ceramic discs were fixed to a device attached to the universal testing machine (dl2000, emic ind e com ltda, so jos dos pinhais, pr, brazil). a 0.3 mm diameter stainless steel wire looped around both the extremity of the loading cell and the composite resin cylinder, simultaneously. the wire maintained contact with the inferior semicircle of the cylinders, as close as possible to the area bonded to the ceramic. the test was carried out at a speed of 0.5 mm / min, until bonding failure, for each cylinder sequentially, that is, one at a time. the failure mode was assessed using a stereoscopic lens (ek3st model, eikonal, so paulo, so paulo, brazil) at 20x magnification. the failure modes were classified as adhesive failure, ceramic or resin cohesion failure, or mixed. cohesion failure was defined as a fracture in the body of the ceramic or the resin, adhesive failure when there was a fault at the junction between the ceramic and the resin, and mixed when there was both adhesive and cohesion failure, simultaneously. one of the six ceramic discs used to evaluate surface micromorphology did not receive any surface treatment, including hydrofluoric acid. the specimens were then stored in an incubator at 50c for 3 hours to remove any water particles, 24 hours prior to sem assessment. the samples were then placed in airtight glass jars containing silica gel and sealed to ensure moisture elimination. the discs were positioned in the sem (jsm 5600lv, jeol, tokyo, japan) and images were obtained at 500x and 2,500x magnification. for each ceramic disc, the mean micro - shear bond strength value for the resin cylinders was considered. after exploratory analysis, the data were tested using one - way analysis of variance (p<0.05) on sas statistical software (release 9.2, 2008, institute inc., cary, nc, usa). table 1 describes the mean values of micro - shear bond strength and shows no significant difference between the surface treatment methods (p=0.3197). table 2 shows the frequency of failure modes following micro - shear bond strength testing. mean and standard deviation for bond strength (mpa) for the different ceramic surface treatments (p=0.3197) mean followed by same letter indicates no significant difference failure mode for the different ceramic surface treatments when inspecting the sem images, the ceramic surface that received no treatment appeared smooth without porosity, as a result of the polish obtained when the ceramic disc was prepared (figure 1a). regarding the control group (c) and the spray group (s), which had the hydrofluoric acid rinsed with water and water - air spray, respectively, irregular micrometric structures were observed, which probably consisted of products from the acid etch step (figures 1b and 1c). such structures were not encountered on the surfaces of the other groups. regarding groups us, f and f+us, no significant difference was observed in terms of surface micromorphology (figures 1d, 1e and 1f). photomicrographs of the ceramic surfaces as seen using a scanning electron microscope (sem) at 500x magnification. a - unetched ceramic surface ; b - ceramic surface of group c ; c - ceramic surface of group s ; d ceramic surface of group f ; e - ceramic surface of group us ; f - ceramic surface of group f+us. the arrows show residues left following cleaning at higher magnification (2,500x), groups us and f+us (figures 2e and 2f) showed no debris or acid etch residue, whereas, in the two groups in which no ultrasound was used, some debris were still present. a curious observation was noticed when the phosphoric acid smear was used. at lower magnification, some darkened areas were observed, which could have been remains of the phosphoric acid itself, which was not completely removed under running water only. at higher magnification, it is obvious that this surface is different from the other groups. it is likely that some form of over - etching may have occurred on the ceramic surface, when phosphoric acid was applied. as no ultrasonic treatment was used in this group, the products from over - etching were not efficiently removed. photomicrographs of the ceramic surfaces as seen using a scanning electron microscope (sem) at 2,500x magnification. a - unetched ceramic surface ; b - ceramic surface of group c ; c - ceramic surface of group s ; d - ceramic surface of group f ; e ceramic surface of group us ; f ceramic surface of group f+us. resin cements and internal ceramic surface treatment are used to promote bonding between ceramic surface and tooth. such treatments are necessary to modify the surface of these structures, because they are usually smooth and with low surface energy, which prevents the penetration of the bonding agents that create satisfactory chemical or micromechanical retention. dental ceramics have a crystalline microstructure containing large amounts of loose crystals or granules, which form their microtopography. feldspathic ceramic is composed of feldspath (65%), quartz (25%) and metal oxides (10%). sodium and alkaline earth oxides are added as bivalent glass modifiers to improve its translucent properties. potassium oxide (k2o) is one of the main components of feldspathic ceramics, which is used to provide the material with a coefficient of thermal dilation as similar as possible to the metal alloys used in metal - ceramic restorations. the large quantity of glass matrix optimizes the materials vulnerability to acid etching, which allows the formation of microporosities that improve adhesion. aluminium oxide sandblasting and hydrofluoric acid etching promote an increase of ceramic surface area, creating an irregular topography and increasing surface energy for micromechanical retention of the resin cement. hydrofluoric acid etching is widely used to pretreat feldspathic ceramic surfaces, because it acts selectively on the silica glass matrix, forming hexafluorosilicates, thus creating a porous surface to facilitate micromechanical interlocking with the resin cement. for feldspathic ceramics, surface etching with hydrofluoric acid was used at a concentration of 9% to 10%, and the etching time ranged between one and two minutes. however, studies comparing etching times reported no difference among the times used, as long as the minimum etching time was one minute. following etching of silica - based ceramics, it has been observed that hydrofluoric acid leads to the formation of insoluble byproducts, such as silica and fluoride salts, which may remain on the ceramic surface. these particles may interfere with the bond strength between the ceramic and the substrate onto which it is cemented. in the present study, the control groups sem images (which only underwent etching with hydrofluoric acid), revealed large quantities of residues when compared to the untreated ceramic and to the groups that received some form of surface cleaning. however, phark,.(2009) reported that shear bond strength is not affected by contamination or cleaning procedures, as shown in this study. in order to remove byproducts following hydrofluoric acid etching, some authors used ultrasonic washing, 37% phosphoric acid smear, rinsing with running water, or a combination of 37% phosphoric acid smear and ultrasonic washing. the present study demonstrated no significant difference in bond strength using different methods of ceramic surface cleaning, despite the presence of byproducts observed by sem following surface cleaning with water spray, unlike in groups us and f+us, in which ultrasonic bath was used. at 2,500x magnification, ultrasonic washing improved the removal of debris, when compared with the group in which phosphoric acid was used, where residue was observed after rinsing under running water. however, the longterm effect of this interference has not yet been evaluated. in this study, the main failure mode was resin cohesion followed by adhesive failure, thus showing that the hydrofluoric acid residue did not affect bond strength. (2009) also observed no influence on bond strength from the contaminants left by the etching agent on the ceramic surface. in addition, fabianelli,.(2010) demonstrated that the silane application technique is more important than hydrofluoric acid etching. other studies also have shown increase in bond strength following silane application, regardless of the surface etching technique. therefore, the residue does not seem to interfere with bond strength, as shown in this study. regardless of the cleaning technique used on the ceramic surface, the presence or absence of residue following hydrofluoric acid etching did not influence the bond strength between ceramic and resin. the post - hydrofluoric acid etching cleaning method may simply consist of spraying with water for 90 seconds. the micro - shear bond strength between the feldspathic ceramic and adhesive system was not influenced by different ceramic cleaning techniques, following hydrofluoric acid etching. micromorphological evaluation of the ceramic surface revealed little to no residue following hydrofluoric acid etching, when combined with ultrasonic washing. | objective the aim of this study was to evaluate the effect of feldspathic ceramic surface cleaning on micro - shear bond strength and ceramic surface morphology. material and methods forty discs of feldspathic ceramic were prepared and etched with 10% hydrofluoric acid for 2 minutes. the discs were randomly distributed into five groups (n=8) : c : no treatment, s : water spray + air drying for 1 minute, us : immersion in ultrasonic bath for 5 minutes, f : etching with 37% phosphoric acid for 1 minute, followed by 1-minute rinse, f+us : etching with 37% phosphoric acid for 1 minute, 1-minute rinse and ultrasonic bath for 5 minutes. composite cylinders were bonded to the discs following application of silane and hydrophobic adhesive for micro - shear bond strength testing in a universal testing machine at 0.5 mm / min crosshead speed until failure. stereomicroscopy was used to classify failure type. surface micromorphology of each treatment type was evaluated by scanning electron microscopy at 500 and 2,500 times magnification. results one - way anova test showed no significant difference between treatments (p=0.3197) and the most common failure types were cohesive resin cohesion followed by adhesive failure. micro - shear bond strength of the feldspathic ceramic substrate to the adhesive system was not influenced by the different surface cleaning techniques. absence of or less residue was observed after etching with hydrofluoric acid for the groups us and f+us. conclusions combining ceramic cleaning techniques with hydrofluoric acid etching did not affect ceramic bond strength, whereas, when cleaning was associated with ultrasound, less residue was observed. |
the ccc study (n = 1423), established in 2003, is an open prospective cohort of hiv - hcv coinfected individuals recruited from 19 centers across canada and represents approximately 23% of the coinfected population under care. at visits every 6 months, sociodemographic, medical, and behavioral information is collected using validated questionnaires, along with plasma specimens, serum specimens, and peripheral blood mononuclear cells (pbmcs). for this analysis, we included data collected up until january 2015. to be included in the ccc study, patients must be 16 years old, give informed consent, be infected with hiv (confirmed via enzyme - linked immunosorbent analysis [elisa ] with western blot), and have hcv infection or evidence of hcv exposure, defined as follows : hcv antibody positive elisa results, using the recombinant immunoblot assay ii (riba ii) or an enzyme immunoassay, or, if results of serological tests are false negative, hcv rna positive test results. the study has been approved by research ethics boards at each of the participating institutions. positive participants free of fibrosis, end - stage liver disease, and chronic hepatitis b at baseline were eligible. hcv rna levels were tested using qualitative tests (cobas amplicor hcv test, version 2.0 ; roche diagnostics, hoffmann la roche [laval, canada ] ; lower limit of detection, 17 years on average. the majority of the study participants were canadian - born white males (median age, 44 years), and 83% had a history of injection drug use. most were receiving hiv antiretroviral therapy and had well - controlled hiv, with a good cd4 t - cell recovery (median cd4 t - cell count at baseline, > 350 cells/l) and an undetectable hiv load. the distribution of the responder ifn- genotypes was somewhat lower in the study population, compared with that among ccc study subjects as a whole. alleles at each snp were in hardy - weinberg equilibrium (p >.05). table 1.baseline characteristics of the canadian co - infection cohort (ccc) and study populationcharacteristicstudy population (n = 485)ccc (n = 1423)follow - up time, y5 (36)3 (16)age at baseline, y44 (3849)45 (3950)male sex335 (69)1026 (72)white369 (76)1054 (74)born in canada420 (91)1114 (90)history of injection drug use403 (83)1143 (81)current alcohol drinker234 (48)744 (52)apri0.52 (0.370.78)0.63 (0.391.24)undetectable hiv load280 (59)876 (63)receiving hiv - associated art382 (79)1178 (83)cd4 t - cell count, cells/l381 (260550)398 (250575)hcv infection duration, y17 (1025)18 (1026)hcv genotype 1 infection313 (77)852 (74)ifn- genotype rs12979860cc202 (42)437 (48) rs8099917tt297 (61)599 (65) rs8103142tt214 (44)451 (50)data are no. (%) of subjects or median value (interquartile range).abbreviations : art, antiretroviral therapy ; hcv, hepatitis c virus ; hiv, human immunodeficiency virus ; ifn-, interferon. the aspartate aminotransferase (ast) level to platelet count ratio index (apri) was calculated as [(patient 's ast level, in iu / l)/(upper limit of normal ast level, in iu / l)]/[platelet level, 10/l ] 100. limit of detection, 50 copies / ml. baseline characteristics of the canadian co - infection cohort (ccc) and study population data are no. (%) of subjects or median value (interquartile range). abbreviations : art, antiretroviral therapy ; hcv, hepatitis c virus ; hiv, human immunodeficiency virus ; ifn-, interferon. the aspartate aminotransferase (ast) level to platelet count ratio index (apri) was calculated as [(patient 's ast level, in iu / l)/(upper limit of normal ast level, in iu / l)]/[platelet level, 10/l ] 100. limit of detection, 50 copies / ml. one hundred twenty - five participants developed fibrosis over 1595 person - years of risk (7.84 cases per 100 person - years ; 95% confidence interval [ci ], 6.589.34). those who developed significant liver fibrosis were more likely to be female, to be white, and to be injection drug users, compared with subjects who never developed fibrosis (table 2). they also were more likely to drink alcohol and to have poorer hiv control, as evidenced by the higher proportion with interruptions in antiretroviral treatment and lower cd4 t - cell counts at baseline. individuals who developed fibrosis were also more likely to carry rs8099917 tt (ie, the responder genotype), but not rs12979860 cc or rs8103142 tt. at baseline, participants with fibrosis already had higher median apri scores, compared with those who never reached an apri of > 1.5. table 2.baseline characteristics of patients who did or did not develop fibrosis in follow - upcharacteristicfibrosis (n = 125)no fibrosis (n = 360)age, y43(3748)44 (3849)female sex42 (34)103 (29)ethnicity white100 (80)269 (75) black3 (2)14 (4) other4 (3)12 (3) aboriginal18 (14)65 (18)history of injection drug use111 (89)292 (81)current alcohol use69 (55)165 (46)baseline apri0.73 (0.450.98)0.49 (0.350.71)cd4 t - cell count 350 cells/l62 (50)214 (60)hiv - associated art interruption11 (9)20 (6)hcv infection duration, y18 (1224)17 (925)hcv genotype 3 infection18 (17)45 (15)ifn- genotype rs12979860 cc53 (42)149 (41) ct52 (42)160 (44) tt20 (16)51 (14) rs8099917 tt84 (67)213 (59) gt37 (30)117 (33) gg4 (3)30 (8) rs8103142 tt56 (45)158 (44) ct47 (38)159 (44) cc22 (18)43 (12)data are no. (%) of subjects or median value (interquartile range).abbreviations : art, antiretroviral therapy ; hcv, hepatitis c virus ; hiv, human immunodeficiency virus ; ifn-, interferon. the aspartate aminotransferase (ast) level to platelet count ratio index (apri) was calculated as [(patient 's ast level, in iu / l)/(upper limit of normal ast level, in iu / l)]/[platelet level, 10/l ] 100. baseline characteristics of patients who did or did not develop fibrosis in follow - up data are no. abbreviations : art, antiretroviral therapy ; hcv, hepatitis c virus ; hiv, human immunodeficiency virus ; ifn-, interferon. the aspartate aminotransferase (ast) level to platelet count ratio index (apri) was calculated as [(patient 's ast level, in iu / l)/(upper limit of normal ast level, in iu / l)]/[platelet level, 10/l ] 100. in univariate analysis, rs8099917 had the strongest association. since both rs12979860 and rs8103142 are very close together and tightly linked (r = 0.81 among whites in our cohort and r0.85 in other studies [6, 21 ]), their effect estimates were almost identical and thus were analyzed separately. none of the other product terms between the snps and age, sex, hcv genotype, or ethnicity indicated effect measure modification (p >.05). as with the individual snps, the results from the haplotype analysis indicated that participants with a haplotype with the major alleles from all 3 snps (tct) had a higher risk of fibrosis than those lacking the haplotype, regardless of the mode of inheritance. the log likelihood values are very similar (table 3), but based on the dominant model, those with 1 or 2 copies of tct had a 14% higher risk of fibrosis than those with no copies (hazard ratio, 1.14 ; 95% ci,.731.77). table 3.haplotype analyses with interferon single - nucleotide polymorphisms (snps) and significant liver fibrosismode of inheritancehazard ratio (95% ci)p valuelog likelihooddominant1.14 (0.731.77).566246.57additive1.05 (0.831.33).666246.65recessive1.04 (0.721.48).856246.73codominant1.15 (0.711.86).576246.570.86 (0.411.79).69 abbreviation : ci, confidence interval. haplotype containing the major allele at all 3 snps (tct corresponds to t at rs8103142, c at rs12979860, and t at rs8099917), adjusted for ethnicity. haplotype analyses with interferon single - nucleotide polymorphisms (snps) and significant liver fibrosis abbreviation : ci, confidence interval. haplotype containing the major allele at all 3 snps (tct corresponds to t at rs8103142, c at rs12979860, and t at rs8099917), adjusted for ethnicity. other than ifn- genotype, log - transformed ggt level, which is a marker of oxidative stress, and baseline apri had the strongest effects, with each log increase associated with a tripling of risk. being female or of younger age was associated with a higher risk of fibrosis, after accounting for hcv duration. being infected with hcv genotype 3 or currently drinking alcohol also raised risk of fibrosis by > 40%, compared with infection with hcv genotypes 1, 2, or 4 or no current drinking of alcohol, respectively. those with well - controlled hiv, evidenced by cd4 t - cell counts of 350 cells/l, were 30% less likely to develop significant fibrosis than those with cd4 t - cell counts of 1.5. a large study involving 3129 patients without hiv infection (and 1500 fibrotic outcomes) reported that rs12979860cc and rs8099917tt were associated with a > 60% increase in risk of fibrosis. in this study, ifn- genotypes were predictive of fibrosis independent of disease etiology, as they were equally predictive in individuals with hcv infection, as well as in those with hepatitis b virus infection or nonalcoholic fatty liver disease. this suggests that even with clearance of hcv after therapy, individuals with the ifn- responder genotypes may remain at higher risk for fibrosis, especially in the presence of other hepatotoxic behaviors or insults, many of which exist in drug - using or coinfected populations. thus, these individuals may warrant closer follow - up after treatment for liver disease outcomes. ifn-3 is a type iii interferon effective against viruses such as hcv and hiv [22, 23 ]. additionally, ifn-s turn on ifn - stimulated genes needed for viral control. some variants that have been proposed as the causal mechanism include rs368234815 (ifnl4), which affects ifn-3 responsiveness, or rs8103142, which leads to amino acid substitutions in ifn-3 and could affect interactions with other unknown factors involving viral control [12, 24 ]. in populations where there is strong correlation (ie, linkage disequilibrium) between these causal snps and markers such as rs12979860 and rs8099917, there is a higher likelihood of hcv clearance, indicating a strong and responsive immune mechanism. it is difficult to untangle the effects of these snps on protein function or fibrosis development without a functional study, although our findings are consistent with several possible mechanisms. the genotypes linked with higher fibrosis risk in our study could be serving as markers for inflammatory pathways, because fibrosis progression is caused by heightened inflammation rather than by hcv replication. for example, several studies have shown that the responder ifnl3 polymorphisms are predictors of elevated histological inflammatory activity [9, 18 ]. in addition, responder alleles at rs12979860 turn on genes involved in natural killer cell activation, resulting in apoptosis of infected hepatocytes and a proinflammatory environment. although these events are potent for clearing hcv, in the presence of viral persistence, as seen in the patients included in our analysis, they can also cause and exacerbate liver injury. results from a few in vitro studies [24, 26 ] indicate that the function of ifn-3 is unaffected by the k70r (lysine - arginine) amino acid substitution tagged by rs8103142. however, one of the studies only examined this in a single experimental model within a short time frame (24 hours), and thus the authors did not rule out a major role for the lys70arg variant in treatment or immune response. nevertheless, it is also possible that the alleles from rs8103142 or rs12979860 are linked with other causal variant(s) in the ifnl3 region, such as rs368234815, which encodes ifn-4. the antiviral activity of ifn-3 and ifn-4 is linked with higher levels of interferon - stimulated gene expression, and although this has been linked with improved hcv clearance, it is not known whether this vigorous immune response contributes to fibrosis progression. it is also possible that, as the snp at rs8099917 is less tightly bound to both ifn-3 and ifn-4 (r = 0.39 among white individuals in our cohort and approximately 0.40 in other studies), it could be tagging the effect of other causal variants from fibrogenic pathways. our study population was selected from one of the largest prospective cohorts of hiv - hcv coinfected individuals in the world and one that was representative of the canadian coinfected population, including marginalized groups such as people who inject drugs and aboriginal people. because of regular longitudinal follow - up, we were able to measure risk factors of fibrosis progression that could potentially be combined into a progression index and investigated in future studies. by including individuals who acquired hcv remotely, we were also able to avoid the referral bias of previous retrospective studies. those studies overestimated the severe outcomes of hcv infection (cirrhosis, hepatocellular carcinoma, and death) and did not allow for the examination of those who spontaneously recover from their infection or have milder forms of the disease. our study thus has characteristics of a prospective cohort but allows long - term follow - up that rarely can be achieved in prospective studies. our study population was very similar to that in the ccc study overall, so our results should be reasonably generalizable to coinfected individuals receiving care in canada. however, although the ccc study attempts to recruit from diverse populations, including patients with various risk factors and who are marginalized, persons not accessing care may differ from those included in our analyses. a potential limitation in our study is the possibility of selection bias induced through the exclusion of individuals with spontaneous hcv clearance and prevalent liver disease, who are more likely to have the genotypes of interest. however, results from an analysis in data sets with limited or no exclusions were very similar to those reported in table 4, indicating that any selection bias was likely negligible (results not shown). another important issue is the possibility of residual confounding by ethnicity because of the diverse ancestries of our participants. furthermore, after restricting analyses to white individuals only or stratifying for ethnicity in sensitivity analysis, the effect estimates obtained were similar to those in table 4 although less precise (not shown), suggesting that such confounding is unlikely to have been great. another possible limitation in our study is the use of the apri to measure the outcome. liver biopsy, the gold standard for measuring liver fibrosis, is invasive, risky, and subject to measurement error, thus making it impractical for longitudinal research purposes. without biopsy samples, we were also unable to assess the degree of hepatic necroinflammation. however, an apri cutoff at 1.5 (corresponding to f2 in the metavir scoring system) has been validated in our study population for detecting significant liver fibrosis, with a sensitivity of 52%, a specificity and positive predictive value of > 99%, and a mean area under the curve (sd) of 0.85 0.06. in addition, apri cutoffs of 1.5 and 2 have also been shown to be associated with cirrhosis, other adverse liver and clinical outcomes, and death in our cohort, as well as in other studies [30, 31 ]. using an apri of 1.5 also allowed us to potentially capture the etiologically relevant transition to fibrosis stage f2, as ifn- genotypes were reportedly more important in earlier fibrosis transitions (f0f1 and f1f2), rather than later ones (f2f3 and f3f4). alternative noninvasive markers such as fib-4 (> 3.25) correspond to more - advanced fibrosis stage (f3 and higher), missing the f1f2 transition. applying fib-4 to these analyses therefore resulted in a lower sample size and less precise estimates, with the strongest association at rs8103142 (adjusted hazard ratio, 1.14 ; 95% ci,.711.83). finally, measurement error in apri is likely independent of ifn- genotype (the main exposure group) and would be nondifferential and thus potentially underestimate a true causal effect. there was uncertainty in the estimate of the date of hcv acquisition, which was approximate in most instances and used as the origin. because this date preceded cohort entry by many years, it also led to left truncation, which we addressed by using delayed entry in our analysis. moreover, results from the sensitivity analyses using age as a time axis were very similar to those in table 4 (data not shown). finally, while other risk factors in our results, such as alcohol use and hcv genotype 3 infection, are consistent with other studies [14, 15, 33, 34 ], we lacked the power to detect the interaction of ifn- genotypes with sex, age, hcv genotypes, or ethnicity [9, 19 ]. in conclusion, our results suggest that the homozygous genotypes at the ifn- snps rs8099917, rs12979860, and rs8103142 individually increased the risk of significant liver fibrosis in hiv - hcv coinfected canadians. our findings are consistent with a heightened inflammatory profile and could help identify higher - risk individuals who would benefit the most from expensive hcv direct - acting antiviral agents before liver disease advances to the point of no return. the ccc study investigators (ctn222) are drs jeff cohen, windsor regional hospital metropolitan campus, windsor, canada ; brian conway, vancouver infectious diseases research and care centre, vancouver, canada ; curtis cooper, the ottawa hospital research institute, ottawa, canada ; pierre ct, clinique du quartier latin, montral, canada ; joseph cox, montral general hospital, montral ; john gill, southern alberta hiv clinic, calgary, canada ; shariq haider, mcmaster university, hamilton, canada ; marianne harris, st. paul 's hospital, vancouver ; david haase, capital district health authority, halifax, canada ; mark hull, bc centre for excellence in hiv / aids, vancouver ; julio montaner, st. paul 's hospital, vancouver ; erica moodie, mcgill university, montreal ; neora pick, oak tree clinic, children 's and women 's health centre of british columbia, university of british columbia, vancouver ; anita rachlis, sunnybrook & women 's college health sciences centre, toronto, canada ; danielle rouleau, centre hospitalier de luniversit de montral, montral ; roger sandre, haven program, sudbury, canada ; joseph mark tyndall, department of medicine, infectious diseases division, university of ottawa, ottawa ; marie - louise vachon, centre hospitalier universitaire de qubec, qubec, canada ; sharon walmsley, university health network, toronto ; and david wong, university health network, toronto. | background. liver fibrosis progresses faster in individuals coinfected with human immunodeficiency virus (hiv) and hepatitis c virus (hcv). interferon 3 (ifn-3) has both antiviral and proinflammatory properties. genotypes at ifnl single - nucleotide proteins (snps ; rs12979860cc and rs8099917tt) are linked to higher hcv clearance, potentially via rs8103142. we examined the relationship between ifn- genotypes and significant liver fibrosis in hiv - hcv coinfection.methods. from the prospective canadian co - infection cohort (n = 1423), hcv rna positive participants in whom ifn- genotypes were detected and who were free of fibrosis, end - stage liver disease, and chronic hepatitis b at baseline (n = 485) were included. time to significant fibrosis (defined as an aspartate transaminase level to platelet count ratio index [apri ] of 1.5) by ifn- genotypes was analyzed using cox proportional hazards, with adjustment for age, sex, ethnicity, alcohol use, cd4 + t - cell count, hcv genotype, -glutamyl transferase level, and baseline apri. haplotype analysis was performed, with adjustment for ethnicity.results. a total of 125 participants developed fibrosis over 1595 person - years (7.84 cases/100 person - years ; 95% confidence interval [ci ], 6.589.34 cases/100 person - years). each genotype was associated with an increased fibrosis risk, with adjusted hazard ratios of 1.37 (95% ci,.942.02) for rs12979860cc, 1.34 (95% ci,.911.97) for rs8103142tt, and 1.79 (95% ci, 1.242.57) for rs8099917tt. haplotype tct was also linked with a higher risk (hazard ratio, 1.14 [95% ci,.731.77]).conclusions. ifn- snps rs12979860, rs8099917, and rs81013142 were individually linked to higher rates of fibrosis in individuals with hiv - hcv coinfection. ifn- genotypes may be useful to target hcv treatments to people who are at higher risk of liver disease. |
malaria is the most important and common parasitic disease in the world caused by a protozoan of the genus plasmodium. four species including plasmodium falciparum, p. vivax, p. ovale and p. malariae cause the disease in human (1). more recently p. knowlesi is supposed to be the fifth species of human malaria (2). according to the report of world health organization (who), 216 million new cases with 655000 deaths were reported in 2010. moreover, transmission of malaria takes place in 99 countries and the disease is reported from 106 countries (3). many factors mostly genetic disorders such as thalassemia, sickle cell anemia (hbs), g6pd (gloucose-6-phosphate dehydrogenase) deficiency and duffy blood groups in human can be involved in the process, severity and non - severity of the disease (4). distribution of g6pd deficiency usually accompanies with low level of malaria distribution in the world (5). so this hypothesis may be considered that the g6pd deficiency could be protective against malaria. deficiency of g6pd enzyme is the most common enzymatic disorders in human with about 400 million cases in the world (5, 6). this disorder is an x - linked inherited phenomenon (4, 5). according to the who report, 7.5 percent of the world population has one or two genes for g6pd deficiency and 2.9% suffers from the enzyme deficiency (7). g6pd enzyme catalyzes the first reaction in pentose phosphate pathway and causes convert g6p (gloucose-6-phosphate) to 6-phosphogluconolactone and simultaneously reduces nadp (nicotinamide adenine dinucleotide phosphate) to nadph. nadph is the reduced form of nadp and is necessary to protect red blood cells from hydrogen peroxide and other oxidative damages (5, 6).there are different varieties of g6pd deficiency in the world. gd a is most distributed variant in africa and distribution of this defect is very similar to falciparum malaria distribution and is thought that falciparum malaria causes a natural selection of the maintenance and retention of g6pd deficiency gene in this region (4). in the most mediterranean countries, including iran, mediterranean variety is more frequent than other mutations (6, 7, 9). although the relationship between g6pd deficiency and falciparum malaria has been proven in some studies but relationship between vivax malaria and g6pd deficiency needs further studies. particularly if we know primaquine, a deleterious drug for g6pd deficient individuals, is administered to prevent the relapse in p. vivax infection. vivax malaria is in the majority outside of africa with a global burden approximately 71 - 391 million clinical cases per year (10). malaria is an endemic infection in southeast of iran including sistan and baluchistan, hormozgan and kerman provinces. eighty five percent of malaria infection in iran is reported from the provinces with the majority of vivax malaria cases (1). the average incidence of g6pd deficiency is estimated between 10 - 21% in iran (6). this study was proposed to survey the situation of g6pd deficiency within vivax malaria infected cases comparing with non - infected individuals in hormozgan province, located at the north coast of persian gulf in iran. a total of 160 vivax malaria suspected and non - suspected individuals were enrolled for this study. at the enrollment time clinical sign of fever was measured as probable malaria infected case. from each enrolled individuals a five ml blood for determination of g6pd enzyme deficiency, pcr examination and preparing thin and thick smears were deposited into test tubes. three ml of the blood was poured into edta treated test tube and stored at -20 c for pcr processes, and the rest of the collected blood was deposited into the acid citrate dextrose - a (acd - a) predosed test tube for g6pd examination and refrigerated at 4 c but not more than 21 days (11). methods of fluorescent spot test (fst) and dichlorophenol indophenol (dpip) can be used to determine situation of g6pd based on the qualitative measurement as described by farhud and yazdanpanah (7), but in this study the quantitative measurement method has been employed using baharafshan kit(baharafshan co., iran). a rapid dna extraction method was conducted to extract dna of the isolated parasites (12), using roche extraction kit. the 18ssrrna gene with 350 - 500 bp bearing low repeatability reaction was used to minimize homology of p. vivax with other plasmodium species. dna was amplified using primers 5 - agtgtgtatcaatcgagtttc - 3 (plf) as a forward primer and 5 - aggacttccaagccgaagc - 3 (vir) as a reverse primer. a reverse primer 5 - agttcccctagaatagttaca - 3 was employed for p. falciparum as a positive control. out of 80 malaria suspected individuals 36 (45%) cases were microscopically detected as vivax malaria infection and the rest using both microscopical and semi - nested multiplex pcr methods were diagnosed as non - infected cases. three (8.3%) cases out of 36 vivax malaria infected individuals were found as g6pd deficient cases, while among the 124 non - infected individuals 30 (24.2%) cases were revealed to suffer from g6pd deficiency disorder (table 1). parasite counting showed a range of 200 - 800 parasitaemia per micro liter of blood. the bio - data obtained from the enrolled individuals indicated that 76.9% and 23.1% were male and female respectively (table 1). in vivax malaria suspected group 36 (45%) cases were positive and the rest 44 (55%) were detected as negative cases using microscopical examination. thirty nine out of eighty vivax malaria suspected individuals were iranian and the rest were afghani people. in control group also 66 and 14 individuals were iranian and afghani respectively (table 1). all microscopical negative samples were confirmed by semi - nested multiplex pcr method (fig 1). this study was conducted in hormozgan province a malaria endemic area with dominant infection of p. vivax. according to the treatment guideline of vivax malaria in iran primaquine, a member of 8-aminoquinoline group is administrated 0.25 mg / kg as an antirelapse for 14 successive days or 0.75 mg / kg once per week for 8 weeks. primaquine is listed among the adverse substances for g6pd deficient individuals due to its hemolytic and destructive effect on the red blood cells. therefore, g6pd deficiency poses an important impediment for primaquine to be used as a powerful antirelapse among the g6pd deficient vivax malaria infected patients. on the other hand, detecting the rate of p. vivax infection within g6pd deficient cases will help the malaria policy makers for correct managing the treatment and control of the infection. a study shows a rate of 10 - 21% g6pd deficiency including mostly mediterranean varieties in iran (6). although relation between g6pd deficiency and falciparum malaria in some studies has been proven (13, 14), few studies have tried to consider the relation between g6pd deficiency and p. vivax infection. in a serological survey conducted by edrissian and colleagues in 1983 as a pioneer study about relation between g6pd deficiency and malaria infection in iran they did not found any significant relation between g6pd deficiency and infectivity of falciparum malaria in hormozgan province (15). in another study one afghani immigrant falciparum malaria infected case with g6pd deficient this study is the first study conducted in the field of relation between vivax malaria and g6pd deficiency in iran. the results of this study showed no significant difference between male and female in prevalence of g6pd deficiency with 20.32% and 21.62% respectively in both p. vivax infected and non - infected individuals. prevalence of the deficiency based on the gender more or less is similar to prevalence level reported by rebholz and colleagues from tajikistan (16). the results of this study indicated that g6pd deficiency assumes to be a preventive factor against vivax malaria infection in the most of studied individuals, similar to those results obtained by rebholz and colleagues in tajikistan (16) and matsuoka., from indonesia (17). in impact phenotypic and genotypic studies conducted previously by leslie and colleagues within some afghani refugees in pakistan, more or less, as similar as our results had been collected (4). conversely, shimizu and colleagues in a molecular based study in the field of g6pd deficiency, southeast asian ovalocytosis (sao) and p. vivax resulted that there was not apparent effect of g6pd deficiency on malaria protection within the studied population, but low parasitaemia was found in the p. vivax infected individuals (18). low parasitaemia density with the malaria infected individuals in our study confirms the results of shimizu and colleagues results. although g6pd deficiency is assumed to be an vivax malaria - resistant genetic trait, more studies are needed to confirm such specialty for more strains of p. vivax in the malaria endemic areas. | backgroundone of the most important enzymatic disorders that interact with malaria is deficiency of g6pd (gloucose-6-phosphate dehydrogenase). this enzyme protects red blood cells from hydrogen peroxide and other oxidative damages. distribution of this enzyme deficiency usually accompanies with low level distribution of malaria disease in most malarious areas. so this hypothesis may be considered that the g6pd deficiency could be protective against malaria.methodstotally 160 samples were taken from vivax malaria infected and non - infected individuals. preparing blood smears and quantitative test for g6pd deficiency were employed for all of the samples. to ensure accuracy of the malaria in negative samples besides using microscopical examination, semi - nested multiplex pcr was also performed for the two groups.resultsin microscopical examination 36 and 124 samples were vivax malaria positive and negative respectively. out of 36 p.vivax positive cases 3 (8.3%) cases were detected to be g6pd deficient versus 30 (24.2%) cases out of 124 p. vivax negative cases. the results showed a significant differentiation between p. vivax positive and p. vivax negative cases in the rate of g6pd deficiency (3/36 in positive cases versus 30/124 in negative cases) (p<0.05).conclusionvivax malaria positive individuals with g6pd deficiency showed too mild symptoms of malaria or even asymptomatic. |
differential diagnoses for the relatively rare nasopharyngeal cysts include tornwaldt s disease, rathke s cleft cyst, intra - adenoid cyst, branchial cysts, and pseudocysts.1 here we report a case in which the presence of nasopharyngeal cysts was indicated as hampering nasal continuous positive airway pressure (ncpap) treatment of refractory obstructive sleep apnea syndrome (osas). nasopharyngeal cysts are comparatively rare, and most do not exhibit themselves but are found incidentally. however, various symptoms, such as nasal congestion, apnea, and hearing loss, may be exhibited depending on the developing site due to increasing cyst diameter.1 diagnosis is often difficult and is comprehensively determined by the site of occurrence, characteristics of the cyst surface, and tissue findings. tornwaldt s disease, rathke s cleft cyst, pharyngeal tonsil central fossa cyst, branchial cysts, and pseudocysts are raised as differential diagnosis.2 the frequency of occurrence of nasopharyngeal cysts has not been previously mentioned, but in one report it was observed that this occurs in 1.4%3.3% cases of tornwaldt s disease by autopsy.3 moreover, according pathophysiological findings, nasopharyngeal cysts can be classified as congenital when occurring in the pharyngeal bursa vestigial remnant or rathke s pouch, or as acquired as a result of infection or surgery.4 we recently encountered a case that suggested nasopharyngeal cysts as the cause of treatment - resistant osas. here, we report it including bibliographic considerations. a woman in her 50s was referred to the otorhinolaryngology department, kyorin university, with the chief complaint of nasal congestion and pharyngeal discomfort. her weight and height were 70.0 kg and 153 cm, respectively, with a bmi of 29.9 kg / m. the patient had been experiencing nasal congestion for approximately 20 years, but had opted against seeking treatment. a local internist diagnosed the patient with sas in june 2010, and initiated ncpap therapy. consequently, the patient experienced exacerbation of her nasal congestion, and chose to visit a local otolaryngologist. a tumor lesion was discovered in the patient s nasopharynx, and the doctor referred her to our department. the initial clinical findings following nasopharyngeal fiberscopy included the presence of an oval tumor with a grooved surface in the nasopharynx, which was not associated with the eustachian orifice (fig. the results of laboratory blood analyses revealed no evidence of an inflammatory reaction. in order to examine the cause of the hypertension, serum levels of thyroid - stimulating hormone (tsh), free thyroxine, free tri - iodothyronine, epinephrine, norepinephrine, dopamine, aldosterone, and renin were analyzed. cytological results of an aspiration biopsy indicated ciliated columnar epithelial cells with mildly enlarged nuclei. a culture of the cyst contents resulted in the detection of coagulase - negative staphylococci of 1 +, and staphylococcus aureus (mssa) of 1 +. noncontrast computed tomography (ct) imaging findings included the detection of a partially fluid - filled cystic lesion in the nasopharynx that had its base on the median part. a cystic lesion was detected by magnetic resonance imaging (mri), the contents of which were hypointense and relatively hyperintense on the t1- and t2-weighted images, respectively (fig. extirpation of the lesion was performed under general anesthesia. because no clear contents of the tumor lesion could be aspirated by centesis, the anterior wall of the tumor was dissected by forceps to allow removal of the contents. after debridement using a ktp laser to control the bleeding, the cyst was totally extirpated. the histopathological findings following hematoxylin eosin (h&e) staining included the detection of lymphoid tissue accompanied by expansion of the crypt, as well as inflammatory cell infiltration and follicular hyperplasia (fig. the expression of cd4, cd8, cd20, bcl-2, and ckae1ae3 was evaluated using immunohistochemistry, and the results indicated the presence of cd20-positive b cells in the follicles, cd4-positive helper t cells in the interfollicular region, and cytokeratin in the lymphoepithelial symbiosis aspect of the crypt. also, the expression of cd8 and bcl-2 was detected, which indicated continued immune function of the pharyngeal tonsils in an individual over the age of 50 (fig. 3c, d, e, f, and g). nonetheless, the association with the sacculation was unclear. thirty - three months following the operation, the patient s nasal congestion disappeared and she was able to get sound sleep. in addition, the patient s systolic blood pressure improved from 140160 to 120140 mmhg. however, her body weight and bmi increased to 72.3 kg and 30.9 kg / m, respectively. a polysomnography (psg) showed an apnea hypopnea index (ahi) of 26.6 before the operation.. however, ahi was still 26.4, and we could not see any improvement. nasopharyngeal cysts are comparatively rare, and most do not exhibit themselves but are found incidentally. however, various symptoms, such as nasal congestion, apnea, and hearing loss, may show up depending on the developing site due to increasing cyst diameter.1 diagnosis is often difficult and comprehensively determined by the occurring site, characteristics of the cyst surface, and tissue findings.2 differential diagnoses for nasopharyngeal cysts include rathke s cleft cysts, pseudocysts, tornwaldt s disease, branchial cysts, intra - adenoid cyst, abscesses, and retention cysts (table 1).2 a rathke s cleft cyst is a benign growth in the rathke s pouch, which is the opening of the craniopharyngeal duct to the pharynx during the embryonic period. rathke s cleft cyst is usually completely occluded by the second month of embryonic development. in most cases, the site of development is localized to the intrasellar region of the sella turcica, or the intrasellar and suprasellar regions, of which the latter accounts for 70%. further, the development of a rathke s cleft cyst in the suprasellar region is rare. ct findings have shown low attenuation areas in a majority of the cysts and capsular enhancement in nearly half of the cysts. however, calcification of the cysts is rare. mri findings have indicated that two - thirds of the cysts are hyperintensive, while the remaining one - third are hypointensive on the t1-weighted image, whereas about 50% are hyperintensive on t2-weighted images. however, many cases are asymptomatic, and the overall incidence is approximately 0.4%.5 pseudocysts are caused by brain hernias, teratomas, and meningiomas that escape from the persistent craniopharyngeal duct. pseudocysts can be differentiated from other cysts by using diagnostic imaging to confirm the contents. tornwaldt s disease is characterized by the presence of inflammation or an abscess of the embryonic remnant cyst in the area between the front end of the notochord and the nasopharyngeal epithelium between the bilateral anterior vertebral muscles on the posterior median nasopharyngeal wall. according to previous reports, tornwaldt s disease is more prevalent in individuals aged between 20 and 30 years, with overall incidence ranging from 0.2% to 5.0%.3 the lesion is located on the medial aspect of the nasopharynx and has a smooth surface. ct scans of the lesion reveal high attenuation areas because the cyst s contents often include blood and an elevated protein concentration. the lesion is hyperintensive on t1- and t2-weighted mri images, but gd contrast agents show no contrast effect. histopathologically, the lesion is covered with a respiratory epithelium without lymphoid tissue, and ranges in size from 2 to 30 mm in diameter.2 branchial cysts develop from remnants of the second branchial groove and are usually unilateral but occasionally bilateral. the difference between branchial cysts and other nasopharyngeal cysts bailey classified the cysts into four types based on the relative position of the cyst : sternocleidomastoid muscle, internal jugular vein, jugular vein, and the pharynx. among the different classes of branchial cysts, type iv is designated as a nasopharyngeal cyst.6 histopathologically, the lesions exhibit lymphocytic infiltration and the formation of lymph follicles. further, the lesion is hypointensive and hyperintensive on the t1-and t2-weighted mri images, respectively, but gd contrast agents show no contrast effect. intra - adenoid cysts are caused by mechanical or inflammatory occlusion of an embryonic groove (central fossa) on the pharyngeal tonsil before lymphoid tissues appear. histopathologically, crypts possess lymphoid tissue, and are characterized by columnar as well as squamous and columnar epithelium. in mri without contrast, the crypts appear hypointensive and hyperintensive on the t1- and t2-weighted images, respectively, whereas gd contrast agents exhibit no contrast. nevertheless, in many cases the intra - adenoid cysts are difficult to distinguish from tornwaldt s disease. for that reason, tornwaldt s syndrome, including intra - adenoid cyst and tornwaldt s disease, was proposed in a previous report.7 different types of nasopharyngeal cysts can be ascertained from the site of their development (fig. 4). rathke s cleft cysts are located in the cranial area. beneath them are intra - adenoid cysts, followed by tornwaldt s disease, and branchial cysts are located in the lowermost area among them. the cysts are characterized by their development on the medial wall of the nasopharynx, except for branchial cysts which develop on the lateral wall. in the present case, because the lesion was nasopharyngeal and cystic, and the contents were hypointensive on the t1- weighted mri images and relatively hyperintensive on the t2-weighted images, we ruled out rathke s cleft cysts. branchial cysts were also excluded because the basal portion of the cyst was located on the median of the nasopharynx, and a grooved surface was present according to the nasopharyngeal fiberscopy and ct findings. pseudocysts, tornwaldt s disease, and retention cysts were eventually ruled out because, according to the histopathological findings, the lesion possessed lymphoid tissue with follicular hyperplasia. therefore, we diagnosed the lesions as crypts in the nasopharynx. regarding the relationship between sas and nasopharyngeal tumors, the latter are detected at a rate that is approximately four times more frequent in sas patients than in the general population. furthermore, according to a previous report, a tumor or cystic disease causes complications in the upper respiratory tract in 0.24% of sas patients.8 as a clinical condition of hypertension accompanying sleep apnea, sympathetic nerve stimulation due to hypoxemia is considered to be related,9 but no abnormality was observed in the preoperative serum hormone concentration (e and en). however, since blood pressure decreased postoperatively, a cystectomy was performed for ncpap function, and this is thought to have contributed to a decrease in blood pressure. however, sas was caused not only by obstructions but also by a central nervous system factor. in addition, ahi unfortunately did not improve in our patient because there was no change in her body weight. investigation of a possible nasopharyngeal lesion is considered particularly useful for the ncpap treatment of refractory osas. we treated a case in which a cyst occupied the nasopharyngeal space and caused nasal congestion. histopathologically, the cyst was located on the median of the nasopharyngeal space and showed hyperplasia of lymph follicles. therefore, we diagnosed it as an intra - adenoid cyst, which resulted in continued immune function of the pharyngeal tonsils in an individual over the age of 50. finally, the presence of a nasopharyngeal cystic disease was determined as the cause that hampered ncpap treatment of refractory osas. | a woman in her 50s was referred to our department with the chief complaint of nasal congestion and pharyngeal discomfort. the patient had been diagnosed with sleep apnea at the department of internal medicine, and had undergone nasal continuous positive airway pressure (ncpap) therapy, but her response to the treatment was poor. a cystic lesion occupying the nasopharynx, which was detected by nasopharyngeal fiberscopy, computed tomography, and magnetic resonance imaging, was thought to be the cause of the nasal congestion, pharyngeal discomfort, and obstructive sleep apnea syndrome (osas). consequently, the patient underwent extirpation of the lesion under general anesthesia for the purpose of obtaining a definitive diagnosis as well as for treatment of the nasopharyngeal tumor. the diagnosis of intra - adenoid cyst was eventually made based on the pathological findings, which revealed lymphoid tissue accompanied by expansion of the crypt, as well as inflammatory cell infiltration with follicular hyperplasia. after the operation, the patient reported subjective improvement of her symptoms, and began to respond to the ncpap therapy for her sleep apnea syndrome. nasopharyngeal cysts, in particular adult intra - adenoid cyst, are relatively rare. the outcomes of the current case indicated that the presence of a nasopharyngeal cystic disease was hampering the ncpap treatment of refractory osas. |
rna molecules are not merely simple carriers of genetic information but can assemble into complex tertiary structures and even catalyze reactions. in fact, the existence of catalytic rna molecules (ribozymes) has led to the proposition of the rna world hypothesis. in modern cells, rna molecules catalyze just two classes of chemical reactions : modifications of phosphodiester bonds (dna and rna cleavage, rna splicing) and peptide bond formation. artificially designed ribozymes, however, are known to catalyze a wide range of chemical reactions. in some ribozymes, the slow opening and closing of tertiary structure (rna breathing) this latter process is hierarchical, first proceeding on the secondary structure level via formation of fairly stable watson crick base pairs. subsequently, secondary structure elements fold into a compact, three - dimensional structure. the folding of rna into the native tertiary fold may proceed via a complex sequence of secondary structures. formation of compact tertiary structures may require the presence of counterions, particularly divalent cations such as mg, which screen the intrinsic negative charges on the rna phosphate groups and, thereby, stabilize certain tertiary motifs. even small modifications of single nucleotides may result in different tertiary structures and hence different energy landscapes. indeed, rna sequence, structure, and function interact in a complex, not yet fully understood fashion, and the characterization of rna folding kinetics, including the pathways of secondary and tertiary structure changes, remains an intricate problem. in this work, we have investigated the conformational equilibrium and the folding pathway of the 49mer single - stranded rna ribozyme diels alderase (dase) using a novel hidden markov model (hmm) analysis of single - molecule fret data. dase catalyzes a diels alder reaction, i.e., the [4 + 2 ] cycloaddition reaction between anthracene dienes and maleimide dienophiles. dase is a true multiple - turnover catalyst and shows remarkable enantioselectivity (> 95% enantiomeric excess). it has a well - defined folded structure, as revealed by x - ray crystallography. the folded state consists of three helices arranged around a pseudoknot region, in which the catalytic pocket of the ribozyme is located (figure 1b). a continuous sequence of stacking interactions runs from the bottom of helix ii to the top of helix iii and has been termed the spine of the folded structure. the tertiary fold is held together by a pseudoknot, in which the 5-g1-g2-a3-g4 segment bridges the unpaired strands of the asymmetric bulge (figure 1a). the precise hydrogen - bond pattern in the pseudoknot region is known to be crucial both for thermal stability of the overall fold as well as for the shape of the catalytic pocket. recent experimental and computational evidence showed that cations specifically bind to certain sites that stabilize the tertiary fold, without interfering with the catalytic reaction. low mg concentrations were found to destabilize the folded conformation and to dramatically decrease the catalytic activity of the ribozyme. diels solid lines, secondary structure base pairs ; dotted lines, tertiary structure base pairs. attachment sites of the fret labels are marked by green (donor dye cy3 at u6 in construct i and at the 5 end in construct ii) and orange (acceptor dye cy5 at u42 in construct i and at u30 in construct ii) arrows. color - coding of the secondary structure elements as in panel a. attachment sites of the fret labels are indicated by green (cy3, donor) and red (cy5, acceptor) spheres. (the figure has been adapted from figure 1 in ref (9).) single - molecule frster resonance energy transfer (smfret) is a powerful tool to follow conformational fluctuations of biomolecules on length scales of a few nanometers in real time. smfret measurements with surface - immobilized molecules revealed that dase is highly dynamic and can exist in substantially different conformations, which were found to interconvert on time scales of hundreds of milliseconds. the concentration of mg influences the shape or population of the accessible conformational states, as indicated by the mg dependence of the fret efficiency histograms and the apparent folding rates. consistent with conformational fluctuations, a poor resolution of dase spectra was found in subsequent nmr studies. the mg - dependent fret efficiency histograms revealed at least two conformational ensembles : (i) a high fret state, attributed to the folded conformation, whose population increases with increasing mg concentration, and (ii) a distribution of intermediate fret efficiencies, whose population decreases with increasing mg concentration. the intermediates were observed to spread out over a wide range of fret efficiency values and, presumably, comprise multiple conformations with different secondary and tertiary structures. in practice, only two or three states with significantly different fret efficiencies can be distinguished in a histogram - based analysis. consequently, stochastic fluctuations of the number of photons within a time bin (shot noise) significantly contribute to the widths of the fret distributions and prevent the separation of states with similar mean fret efficiencies. it completely neglects the time sequence of events in the single - molecule trajectories and, thus, discards a substantial part of the available information. in contrast, hidden markov models can distinguish states in the data by using both the differences in fret efficiency and the time sequence of events, and, thus, can decompose states with similar fret efficiencies but different kinetic properties. recent studies on single - molecule protein and rna data sets have demonstrated the power of hmms to resolve a multitude of states. hmm analysis has its intrinsic challenges, however, because (i) the results depend on the number of states used, (ii) the hmm optimization may get stuck in local minima, (iii) models with many states are difficult to validate, and (iv) the quality of the model depends crucially on the validity of the underlying likelihood function (i.e., the stochastic model of the measured process). here, we present an hmm analysis scheme that addresses these problems. at the core of this scheme is the idea that the number of states required to describe the kinetics in a hierarchical energy landscape is not fixed but depends on the time scales of interest (figure 2). directly estimating hmms with a few states often yields wrong kinetics, as they tend to prefer models whose states have clearly different fret efficiency. however, in real data, distinct and slowly interconverting conformations may have strongly overlapping fret efficiency distributions, which are difficult to separate. therefore, we construct an initial hmm with many states (corresponding to a fine discretization of conformational space). the initial number of states is determined by a validation scheme, which tests reproducibility and consistency of the model with the underlying data set. the initial states are subsequently coarse - grained on the basis of their kinetics. this approach allows us to model (coarse) states even when they strongly overlap in their fret efficiencies and have very irregular (e.g., non - gaussian) fret distributions. our hmm uses a poissonian likelihood function to model the physical process of photon emission. this approach is preferable over using gaussian likelihood functions of the fret efficiency. for a detailed discussion, see the supporting information. in addition, we have developed an approach to account for the trace - specific background noise. (a) hierarchical free energy landscape with various minima (conformations) interconverting on different time scales. (b) a fret efficiency versus distance curve, with the five conformations in panel a assigned to certain fret efficiencies (distances). conformations with suitably long lifetimes can be distinguished by hmm analysis of fret traces but may have overlapping fret efficiencies even when they are distinct. (c) probability density function of finding the system at a certain value of the distance parameter. (d) the states found in the hmm analysis are depicted as disks located in a two - dimensional space of efficiency (abcissa) and lifetime (ordinate). (e, f) some states kinetically merge on longer observation time scales indicated by the blue and red areas in panels e (= 10 ms) and f (= 100 ms). for example, state pairs (i, ii) and (iv, v) each merge into a single apparent state for times longer than 10 ms. independent hmm analyses were carried out on two differently labeled dase constructs, referred to as constructs i and ii. altogether, four different data sets were analyzed (dase construct i at mg concentrations of 0.0, 5.0, and 40.0 mm and dase construct ii at mg concentration 5.0 mm), yielding hmms with seven to nine conformational states. these hmms provide comprehensive models of the dynamics on millisecond time scales. we also determined relaxation times, identified the associated conformational transitions by an eigenvector / eigenvalue analysis of the transition matrix, and computed the ensemble of rna folding pathways. on the basis of their kinetics, the original states were lumped together to effective five - state (on time scales of tens of milliseconds) and three- or four - state models (on time scales of hundreds of milliseconds). most notably, we identified consistent, characteristic features of the kinetic network of dase in all four data sets. to the best of our knowledge, these results represent the most detailed rna folding models obtained from single - molecule measurements to date. furthermore, they reveal that the transition rates in this landscape change substantially as the mg concentration is varied, while the general topology of the landscape (position of minima, relative height of energy barriers) is not affected. at all mg concentrations, the observed kinetic processes can be attributed to either secondary or tertiary structure rearrangements. by using a combinatorial strategy, we had earlier synthesized a set of nine dase fret constructs with dyes attached at different nucleotide positions. construct i was chosen for in - depth studies because it showed the most pronounced changes in its fret histogram with varying mg concentration. here we have also performed surface - immobilized measurements on a second variant, construct ii, because (1) its fret histogram was multimodal, suggesting that multiple states could be distinguished by the hmm, and (2) it was not too different from construct i and, therefore, could serve for validation (see below). single - molecule fluorescence time traces of surface - immobilized dase were obtained for construct i (cy3 at u6 and cy5 at u42) at mg concentrations of 0, 5, and 40 mm and for construct ii (cy3 at the 5 end and cy5 at u30) at a mg concentration of 5 mm. details on the data, the experimental procedures, and the effects of surface immobilization are included in the supporting information, tables s1 and s2 and figures s2 and s3. for each trace, the rates of the background noise, ka, bg an kd, bg, in the acceptor and donor channel, respectively, as well as the amount of spectral crosstalk,, from the donor into the acceptor channel were estimated, as described in the supporting information. we have developed an hmm analysis and associated optimization algorithms for single - molecule fret. the hmm analysis scheme has the following features:the hmm works with discrete photon counts, which are assumed to obey poissonian statistics (figure s4, supporting information).background noise levels of measured photon traces are taken into account explicitly by employing an appropriate emission probability.the reproducibility of the hmms is tested.the number of states of the hmm is maximized under a number of constraints, which ensures that the model reproduces physically and chemically relevant quantities.the final hmm represents a fine discretization into states that, depending on the time scale, are lumped into larger states according to kinetic proximity. the hmm works with discrete photon counts, which are assumed to obey poissonian statistics (figure s4, supporting information). background noise levels of measured photon traces are taken into account explicitly by employing an appropriate emission probability. the number of states of the hmm is maximized under a number of constraints, which ensures that the model reproduces physically and chemically relevant quantities. the final hmm represents a fine discretization into states that, depending on the time scale, are lumped into larger states according to kinetic proximity. a workflow diagram of the hmm analysis scheme is shown in figure 3. the algorithms are described in full detail in the supporting information, and the salient characteristics of the workflow are discussed in the following sections. workflow diagram used for our hmm analysis of single - molecule fret data. consider the hypothetical energy landscape with five minima in panel a in figure 2. each minimum corresponds to a conformational state and is associated with a mean fret efficiency, ei (figure 2b), and a fractional population in equilibrium, i (figure 2c), where i denotes the number of the state. using hmm analysis, these five states can be extracted from smfret traces of a molecule diffusing in this free energy landscape. we represent the main characteristics of the states of the hmms by scatter plots (figure 2d) : each state is marked by a disc, the position of which encodes the mean fret efficiency of the state and its lifetime, i. the area of the disc is proportional to the stationary probability i of the state, as computed from the hmm. the hmm transition matrix has eigenvalues corresponding to time scales of transitions and eigenvectors denoting states that interconvert on these time scales., states i and ii interconvert on time scales of 10 ms (figure 2a). thus, when computing a fret histogram with an averaging window much longer than 10 ms, these two states merge into a single apparent state. likewise, states iv and v kinetically merge for time scales longer than 10 ms, as depicted by the red and blue regions in figure 2e. states i and ii kinetically merge with state iii for time scales above 100 ms (figure 2f). complete equilibration occurs for times longer than 1 s. in a high - dimensional energy landscape, kinetic merging may not necessarily involve only neighboring states along the fret efficiency axis. in fact, high fret efficiency states can merge kinetically with low fret efficiency states even if there are states with intermediate fret efficiencies in between. hidden markov models (hmms) are stochastic models, = (t, e), of the observed (measured) trace, o = (o1,..., on), with oi = (na, i, nd, i) containing the number of photons observed in the acceptor and donor channels at each time step i. in the construction of hmms, it is assumed that the observation is generated by a hidden markov chain with transition matrix t, whose states represent regions in the conformational space of the molecule. at every time step in the markov chain, an additional stochastic process, the emission probability,, describes the conditional probability of observing the signal, oi, given that the molecule is currently in conformation (hidden state) si. one typically chooses the same functional form of for all hidden states but uses a parameter ej to adapt it to a specific hidden state. the parameters ej form a vector e and are part of the model. the hmm optimization problem maximizes the likelihood (i.e., the conditional probability of observing the measured trace o, given that the molecule is accurately described by the model = (t, e)):1over all values of (t, e) and all possible hidden paths. for a given number of states, n, the model consists of an n n transition matrix, t, and of a vector of observation parameters e, of length n. hmm classes differ by the way that the hidden process and the measurement process are modeled and by the way that the corresponding parameters are optimized. it is crucial to choose an emission probability,, that models the measurement process as accurately as possible. the arrival times of the photons are assumed to obey poissonian statistics, which is validated in figure s4 (supporting information). n) is a poisson distribution of variable n with rate coefficient k. the acceptor and donor photon count rates, ka and kd, are given as3where ei is the apparent fret efficiency of the current hidden state si and kmol is the detection rate of photons emitted by the labeled molecule (through either the donor or the acceptor). a problem inherent in the experimental data is the presence of trace - dependent background noise, which may cause identical conformational states to display different apparent fret efficiencies in different time traces. the trace specific background rates, ka, bg and kd, bg, can be estimated from the bleached phase of the measured photon traces. given these rates, we derive a likelihood of observing (na, nd) photons during a time step, t, in the acceptor and donor channels, respectively (see the supporting information). the emission probability has the functional form given in eq 2, but the photon count rates are now given as4we assume that background noise may vary from trace to trace but that all other measurement errors, including spectral cross - talk and differences in the quantum yield of the chromophores, depend on the conformational state but are identical for different traces. then, e contains the apparent fret efficiencies (without background noise) of the hidden states. these apparent fret efficiencies can be corrected for spectral cross - talk a posteriori to obtain the true fret efficiencies (see the supporting information). hmm optimization is done by using the expectation - maximization algorithm, which finds a local maximum of from an initial guess of the parameters (t, e). to facilitate finding the global optimum, the hmms presented here are obtained by first running 100 explorations that optimize random starting values of (t, e) for a few steps only. subsequently, the parameter set with the largest likelihood is optimized to full convergence. nonetheless, the hmm algorithm might find different local maxima for different initial parameters. hence, for each mg concentration, we compute 10 hmms in the described way to test for reproducibility. two hmms are accepted as identical if their log - likelihoods differ by less than 1.0. by a heuristic criterion, an hmm optimization is reproducible if identical maximum likelihood hmms are found in at least 2 out of the 10 trials. the number of states, n, is an input parameter for the hmm optimization algorithm. as argued in the supporting information, information - criteria - based choices of the number of states are inadequate for the present data. to determine the number of hidden states, we instead adopt a viewpoint for the construction of direct markov models that is well established in the community : rather than finding the ideal number of states to statistically classify the data consequently, the resulting discretization of state space will be fine enough that the hmms can reproduce the stationary and long - time kinetic behavior of the data. the resulting states can subsequently be grouped according to kinetic connectivity given by t, as described in refs (31 and 32) and illustrated in figure 2. following this approach, we build hmms for a varying number of states, n = 2, 3,..., and choose the largest number of states for which hmms can be constructed reproducibly. different tests were used to check whether the hmms are consistent with the data set from which they were parametrized, and whether the hidden paths obtained from the hmms are consistent with markovian dynamics. the consistency of the hmm with the underlying data set was tested by comparing fret efficiency histograms obtained from the data with histograms estimated from the hmms. for this test, we used time windows between 10 and 100 ms. as previously discussed, this approach tests both the stationary and kinetic properties of the model. the data - based distributions were obtained using the likelihood from eq 2, as described in the supporting information. the hmm - based distributions were obtained by sampling hidden trajectories of the time window length from an equilibrium distribution, and then generating artificial photon counts using poisson statistics with the appropriate output rates (figure 4a and figures s6a, s7a, and s8a, supporting information). the markovianity of individual states was tested by inspecting their lifetime distributions, which can be computed from the maximum - likelihood hidden paths, (t), of the hmm. a single exponential decay in these distributions is consistent with markovian dynamics (figure 4b). states that failed this test were split using a newly developed bayesian model selection algorithm (supporting information). the overall markovianity of the hmms was tested using the implied time scales test that is frequently used for simulation - based markov state models. to this end, the relaxation time scales, tihmm = t / ln ihmm, were computed, where ihmm are the eigenvalues of the hmm transition matrix t. these are compared to the implied time scales of a markov model t() constructed from the maximum likelihood hidden paths, (t), for different lag times. if the overall dynamics is markovian, these time scales should be independent of the lag time used to compute them, hence yielding constant functions in figure 4c. as an additional test, they should agree with the hmm time scales, tihmm. figure s9 (supporting information) shows fret traces colored according to the hidden states in the final model. (a) dependence of the fret efficiency histograms on the lengths of the time windows (10, 50, and 100 ms). dashed colored lines, prediction from the hidden markov model ; gray areas / dotted black lines, estimation from the smfret data set (bootstrapping mean/95% confidence interval). (b) lifetime distributions of the individual states calculated from the maximum - likelihood paths. (c) implied time scales, indicating that the long - time kinetics of the hidden paths is markovian and converges to time scales similar to those found in the hmm. the divergence of the shortest time scales at larger lag times is expected and due to numerical problems. we analyzed three sets of smfret traces of dase construct i (chromophores attached to residues 6 and 42, see figure 1), measured at different mg concentrations, 0.0, 5.0, and 40.0 mm. background - corrected fret efficiency distributions were calculated from these data sets by using the likelihood (eq 2) and a bootstrapping procedure to estimate the uncertainty in the data (dotted gray lines and gray areas in figure 4a). two ensembles of states can be visually distinguished : a broad intermediate state in the fret efficiency range 0.40.8 and a putative native state at efficiency values of 0.91.0. with increasing mg concentration, the populations shift to states with high fret efficiency. in ref (9), it was already hypothesized that the broad ensemble at intermediate fret efficiencies may consist of multiple conformational states with overlapping fret efficiency distributions. hmms were constructed for the smfret data sets as described in the materials and methods section. the largest number of states for which hmms could be reproducibly obtained was eight (0 mm mg), eight (5 mm mg), and seven (40 mm mg) states, where we used the optimization protocol described in the materials and methods section. the eight - state models for 0 and 5 mm mg passed the validation test (figure 4). a single, weakly populated state with fret efficiency e 0, which was assigned to an acceptor blinking state, was removed from these models a posteriori. the seven - state model at 40 mm mg required an intermediate step, in which non - markovian states were split and regrouped according to kinetic proximity, yielding a nine - state model. (see the supporting information for a detailed description of the protocol employed.) to test whether the remaining nonexponentiality came from an actual non - markovianity of the discrete state dynamics or just from spurious transitions generated from the estimation of the maximum likelihood, we conducted the implied time scale test as described in the materials and methods section. the results shown in figure 4c demonstrate that the maximum likelihood hidden paths, (t), are non - markovian in all models at short time scales but then converge to approximately constant time scale estimates at lag times of 1030 ms. the time scales agree with the time scales estimated from the hmm transition matrix, indicating that the kinetics of all three hmms are consistent with the data. note that the hmms for the three different mg concentrations were constructed independently of each other. therefore, when similar or consistent features are found across all three mg concentrations, this is a two - fold validation of an observation. the scatter plots in figure 5a (upper row) show the main characteristics of the (hidden) states of the hmms : each state is represented by a disc whose position indicates the mean fret efficiency of the state and its lifetime i = t / ln tii, where t is the time step of the hmm transition matrix and tii are the diagonal elements of this matrix. the area of the disc is proportional to the stationary probability i of the state as computed from the hmm. the states that consistently appear in construct i at different mg concentrations are depicted in the same color (i.e., black, blue, red, and green states). the purple state at 0.0 mm mg could not be matched to any state at higher mg concentrations. conformational states and subensembles found by the hmm analysis of construct i and construct ii. (a) first row : state parameters of the hidden markov models which are for each state i : the fret efficiency ei (abcissa), the state lifetime i (ordinate), and the equilibrium population i (disc size). second and third rows : state decomposition for time scales of 10 and > 100 ms. (b) fret histograms of the subensembles of the states shown in the second row of panel a. a feature found for all mg concentrations is the black high - fret efficiency state. it has a relatively small stationary probability but a long lifetime at all mg conditions. the region of intermediate fret efficiencies is populated mostly by short - lived states (blue, red), and a few long - lived states with low fret efficiencies (green). remarkably, the states appearing at multiple mg concentrations show only rather subtle changes. there are two cooperative effects upon mg increase : (i) all states shift to slightly higher fret efficiencies, indicating that mg causes these conformations to become more compact, (ii) the intermediate - efficiency purple state is depopulated with increasing mg, while some substates with higher fret efficiencies (light red state, which is split into an orange and a dark red state at 40 mm mg, as well as the dark blue state) become more populated at high mg concentrations. the populations of the other red and blue states, as well as the black state, show surprisingly little dependence on the mg concentration, indicating that the associated conformations do not experience stabilization by mg ions. to better understand the nature of the conformational states of the hmms, we have investigated their kinetics. detailed information is presented by the networks plotted in figures s10s13 (supporting information). alternatively, an eigenvector / eigenvalue analysis of the transition matrix t allows conformational states interconverting faster than the time scale of interest to be grouped (figures s10s13, supporting information). the second row of figure 5a shows a striking feature found independently for the hmms at all mg concentrations : at a few tens of milliseconds, the substates of the red subensemble as well as the substates of the blue subensemble interconvert. consequently, kinetic proximitiy and proximity on the fret axis are, in general, unrelated properties. this finding is emphasized by the fret efficiency histograms of the corresponding subsembles in figure 5b, which were constructed by partitioning the photon traces according to the associated hidden states. the blue and red subensembles are doubly peaked because they are composed of multiple hidden states. in addition, these subensembles overlap strongly, clearly showing why the present single - molecule fret data were difficult to model kinetically, and emphasizing the usefulness of a detailed hmm analysis for dissecting them. for all mg concentrations, the high - efficiency peak in the fret histograms of the blue subensemble overlaps with the high - efficiency black state, indicating that the high - fret - efficiency peak identified in ref (9) consists of two states, one of which rapidly interconverts with a state of intermediate fret efficiency (blue) and is stabilized by mg, and a long - lived high - efficiency state (black), which is insensitive to mg. in figure 5a, the third row shows that, on time scales of a few hundred ms, the long - lived state (black) interconverts with the blue subsemble. the mixing time for all subensembles is on the order of seconds (see figure 6). these results indicate the presence of a hierarchical energy landscape, with different processes occurring on very different time scales, ranging from a few milliseconds to 1 s. free energy landscape and folding pathways. states are indicated by bars or discs with the same colors used in figure 5. gray bullets indicate transition states facilitating that states or sets of states kinetically merge at longer time scales. (b) the complete ensemble of folding pathways from the least compact states (green / yellow) to the most compact state (black). the states are positioned depending on their mean fret efficiency (abcissa) and the probability of folding (committor, q, ordinate). the thickness of an arrow is proportional to the probability that a green / yellow state will fold along this pathway. on the basis of the processes depicted in figure 5, we find fast interconversion between the open (e 0.5) and closed (e > 0.7) states within the blue and red subensembles, while the exchange dynamics between these subensembles happens much slower. we propose that the states within each subensemble (with a given color in figure 5) have similar secondary structures yet different tertiary structures, interconverting rapidly without breaking large strands of watson crick base pairs. this proposition is supported by the fact that, at high mg concentrations, the compact parts of the red and blue subensemble are stabilized. different subensembles are proposed to correspond to different secondary structures because they are long - lived, suggesting that the stable watson crick base pairs need to be broken in order to transit to another subensemble. the connectivity between different subensembles (and, thus, presumably different secondary structures) is similar at all mg concentrations. the high - efficiency (black) state is connected to the blue subensemble in the presence of mg (5 and 40 mm) directly and, at 0 mm mg, via the purple intermediate. figure 6a illustrates this connectivity, and the free energies of these conformations as well as the transition states (see the materials and methods section). this connectivity suggests an ordering of subensembles from the least compact (lowest fret efficiencies) to the most compact (highest fret efficiencies) which can be found at all mg concentrations : (1) green, (2) red, (3) blue, and (4) black. the fact that they have high lifetimes and fret efficiencies that are much greater than zero suggests that they still have some secondary structure, although probably not the native one. they are therefore called misfolded. this ordering suggests to study the transition pathways from the misfolded states (green) to the most compact state (black). transition path theory provides the basis for calculating the pathways between two subensembles. we use the protocol and equations described in ref (36) employing the implementation in the emma software. a transition pathway is defined as a series of transitions that lead from the misfolded to the native state without returning to the misfolded state. figure 6b locates the states by their fret efficiency, and by the committor value (vertical axis), i.e., the probability of the system, when being in this state, to move forward and fold toward the black state, rather than misfold back to the green state. the committor value q = 0.5 designates states in which the molecule is equally likely to go either way. note that there is a continuous shift of these transition states with increasing mg concentration. at 0 mm mg, the transition state lies between the green and red subensembles. once a molecule has reached the red subensemble, it is likely to continue folding to the black state. with increasing mg concentration, the red and blue subensembles become more and more kinetic intermediates, and lie at committor values around 0.5 for 40 mm mg. figure 6b shows the probability fluxes of transition pathways from misfolded states to the folded state. the size of the arrows indicates the probability flux, which is related to the folding rate. without mg, the folding rate kab is about 0.09 s, and increases to 0.28 s for 5 mm and 0.17 s for 40 mm mg. the strong increase in folding rate from 0 to 5 mm mg is mainly due to a lowering of the transition state energy, while the decrease in folding rate from 5 to 40 mm mg is mainly due to an increased stability of the dark blue intermediate state (compare figure 6a and b). moreover, it is apparent that addition of mg increases the number of accessible pathways, making the folding process more parallel. two main mechanisms are observed at all mg concentrations : a compact folding mechanism, in which the green misfolded state refolds via the higher fret efficiency substates of red and blue toward the black state, and an close open close mechanism, in which the green state folds via the open substates, or via successive closing, opening, and closing, i.e., involving tertiary unfolded states. both types of pathways have similar weights, with some preference for close open close pathways at low mg concentrations and a slight preference for compact pathways at high mg concentrations. to further confirm our findings, we performed a fourth independent measurement on a dase (construct ii) with a different set of label positions. if they do not introduce major energetic conflicts, the state probabilities, time scales, and the kinetic connectivity should remain comparable. single - molecule fret data were recorded, and an hmm was computed using the same approach as above. a seven - state model was found to pass the validation test (see figure s14a and s14b, supporting information). open states at efficiencies of 0.40.6 and high - fret, closed states at efficiencies above 0.8. as for construct i, two pairs of rapidly interconverting states, each with a low- and a high - fret state, were found. additionally, a single stable state with high efficiency was also identified. consequently, the red, blue, and black subensembles of construct ii match the corresponding subensembles in construct i and, thus, can be identified in all experimental data with high confidence (see figure 5a). moreover, the time scales found in constructs i and ii are in qualitative agreement (see figure s14c in the supporting information). open and closed states of the red and blue subensembles interconvert at time scales of a few milliseconds (10 ms in construct i, 3 ms in construct ii). at time scales of 100 ms to seconds, (i) the blue ensemble merges with the black state and (ii) the red and blue ensembles kinetically merge. at low mg concentrations, the blue black interconversion is several 100 ms faster than the blue red interconversion, while, at 40 mm mg, the two processes happen at about the same time scales (figure s14c, supporting information). the gray states in construct ii and the green / yellow states in construct i do not have clear corresponding states in the other construct. for example, the presence of a label in a particular position may prevent certain structures from forming. in the following discussion, we will thus concentrate on those states that can be safely matched across all data sets (red, blue, and black). note that, due to the reduced state lifetimes in construct ii, the partitioning of the photon traces resulted in subtraces which were too short for a histogram analysis. hence, the subensemble fret histograms could not be generated (see figure 5b). a kinetic pattern is found consistently for different mg ion concentrations and for different attachment points of the chromophores : (i) a long - lived, high - fret - efficiency state (black), (ii) two ensembles of states (red, blue) comprising rapidly interconverting open and closed states, the ratio of which depends on mg, and (iii) a linear connection between the three subensembles (red, blue, black). the long interconversion times along this linear connection suggest that these transitions involve breaking and reforming of watson crick base pairs. to investigate whether there are secondary structures consistent with this pattern, minimum energy secondary structures of the dase were calculated using the vienna rna webserver (see the supporting information). the algorithm correctly identified the secondary structure of the known folded state (excluding the pseudoknot connectivity) as the lowest free - energy structure. two alternative secondary structures with low free energies (g 9.5 kj / mol with respect to structure 1. proposed folding mechanism. the red set of states has a non - native secondary structure but includes both open (low - fret) tertiary structures and compact (high - fret) tertiary structures. the blue set of states has the native secondary structure but also includes both open and compact tertiary structures. in contrast to the compact blue state, it is additionally stabilized by the tertiary watson crick pairs that form the pseudoknot. in the absence of stabilizing tertiary interactions, secondary structures 1, 2, and 3 facilitate transitions between open and compact states, associated with large fluctuations in the donor therefore, they have properties matching those found for the blue and red subensembles in the hmm analysis. the black state displays exclusively high fret efficiencies in all constructs under all conditions and its long lifetime and the fact that its population does not vary strongly with the mg concentration suggest that it is stabilized by base - pairing rather than mg ions. therefore, we propose that the black state represents the tertiary folded structure including the pseudoknot topology. the pseudoknot base pairs (g1c26, g2c25, a3u45, g4c44 ; see figure 1) are consistent with stable interactions that do not depend on mg. their formation stabilizes an already compact structure with the correct secondary fold so as to acquire a well - defined tertiary structure. this proposal is supported by computer simulations which show that the active site of dase is distorted if mg is removed (explaining the loss in catalytic activity) but the overall lambda - shaped tertiary structure stays intact. since the blue subensemble acts as a precursor to the black tertiary folded structure (linearly connected folding path, figure 6), it is only logical to match the blue state with the secondary structure of the folded state (structure 1). the native secondary structure still facilitates extended and compact states. like the fully native black state, the high - efficiency blue states are compact and possess the correct native secondary structure, but in contrast to the black state, they lack the pseudoknot base pairs, which stabilize the native tertiary fold. consistently, the probability of extended versus compact blue states depends on the concentration of mg ions that are required to stabilize the compact state in the absence of tertiary base pairs. consequently, the red ensemble contains structures 2 and/or 3, i.e., extended and compact states with non - native secondary structure. the proposed assignment is consistent not only with the kinetic connectivity and the mg - dependent equilibrium populations but also with the observed time scales. the fluctuation between open and compact conformations within the blue and red ensembles involves no or little secondary structure change, consistent with relatively short transition time scales (figures 5 and 6). in contrast, a transition from the red to the blue subensemble involves rupture of watson crick pairs, which is consistent with slower transition time scales of hundreds of milliseconds (figures 5 and 6). likewise, the change of tertiary base - pairing is consistent with long transition time scales between the blue and black states and the long lifetime of the black native state. the kinetic model found here and our proposed folding mechanism exhibits a number of features consistent with previous findings or hypotheses for other rna systems. in particular, secondary and tertiary structure formation has been proposed to be kinetically decoupled, such that secondary structure elements can exist without further stabilization by specific tertiary interactions. for the tetrahymena thermophila ribosome, metastable structures with a partially misfolded secondary structure have been described, lending credibility to the present assignment of the red subensemble to structures 2 and/or 3. in addition, other rnas have been proposed to fold via multiple parallel pathways. to the best of our knowledge, we have presented the most detailed experimentally derived model of an rna folding mechanism, providing a kinetic model connecting different secondary and tertiary stabilized structures, and showing how they are orchestrated during the folding pathways. the multitude of time scales found in the data provide direct evidence that the rna folding landscape is hierarchical and that secondary and tertiary structure formation occur on different time scales. the techniques described here also facilitate detailed kinetic models to be derived for other macromolecular systems. as yet, the field is still lacking an experiment that could simultaneously resolve kinetics and the structures of the individual states in detail. unfortunately, computational approaches can not step in here. with folding times on the order of seconds, the dynamics are as yet out of reach for direct molecular dynamics (md) simulation. over time, however, enhanced sampling strategies may help access these processes. however, molecular modeling and md simulation may be useful for exploring the local dynamics within individual states, and by using new biophysical techniques, the distribution of measurable fret values can be computed and compared to the subensemble distributions shown in figure 5b. on the experimental side, using multicolor - fret or the systematic reconciliation of multiple dual - color - fret experiments may provide distance constraints to resolve the structures in more detail. finally, the combination of fret and site - specific fluorescence quenching may also be employed to disentangle the tertiary dynamics from secondary structure formation. | we have developed a hidden markov model and optimization procedure for photon - based single - molecule fret data, which takes into account the trace - dependent background intensities. this analysis technique reveals an unprecedented amount of detail in the folding kinetics of the diels alderase ribozyme. we find a multitude of extended (low - fret) and compact (high - fret) states. five states were consistently and independently identified in two fret constructs and at three mg2 + concentrations. structures generally tend to become more compact upon addition of mg2 +. some compact structures are observed to significantly depend on mg2 + concentration, suggesting a tertiary fold stabilized by mg2 + ions. one compact structure was observed to be mg2 + -independent, consistent with stabilization by tertiary watson crick base pairing found in the folded diels alderase structure. a hierarchy of time scales was discovered, including dynamics of 10 ms or faster, likely due to tertiary structure fluctuations, and slow dynamics on the seconds time scale, presumably associated with significant changes in secondary structure. the folding pathways proceed through a series of intermediate secondary structures. there exist both compact pathways and more complex ones, which display tertiary unfolding, then secondary refolding, and, subsequently, again tertiary refolding. |
increasing evidence suggests that inflammation plays an important role in the development of insulin resistance. the inflammatory status of the liver and adipose tissue, the main insulin - resistance - related organs, is critical for insulin sensitivity of the whole body [3, 4 ]. during development of inflammation in the liver, hepatocytes are exposed to the increasing cytokines such as tumor necrosis factor- (tnf-), interleukin-6 (il-6), and monocyte chemoattractant protein-1 (mcp-1). these cytokines were regulated by nuclear factor kappa - b (nf-b) [6, 7 ]. a number of studies demonstrated that hepatic nf-b activation was linked to the development of the whole body inflammation, resulting in insulin resistance [8, 9 ]. additionally, adipose tissue is an active endocrine organ that secretes numerous inflammation - related adipokines, cytokines, and chemokines. the expression of tnf-, il-6, mcp-1, and leptin is upregulated in the adipose tissue of obese mice which is closely associated with insulin resistance [1012 ]. interestingly, some studies reported that oxidative stress could induce inflammation during development of insulin resistance [13, 14 ]. oxidative stress which is induced by excess reactive oxygen species (ros) could activate nf-b. antioxidants have been reported to potently suppress the activation of nf-b in the liver [1618 ]. furthermore, increased oxidative stress in adipocytes causes dysregulation of cytokines and adipokines, including adiponectin, mcp-1, il-6, and plasminogen activator inhibitor-1 (pai-1) [19, 20 ]. accordingly, antioxidants have been also reported to decrease inflammation in adipose tissue and ultimately ameliorate insulin resistance [21, 22 ]. apocynin (4-hydroxy-3-methoxy - acetophenone) is a constituent of the himalayan herb picrorhiza kurrooa royle (scrophulariaceae) which is regarded as an inhibitor of nicotinamide adenine dinucleotide phosphate (nadph)-oxidase and is widely used as an antioxidant in research. in addition, apocynin also exhibits anti - inflammatory effects in previous studies [23, 24 ]. tnf- protein expression in coronary arteries, decreased vascular cell adhesion molecule-1 (vcam-1) induced by tnf- in vein endothelial cells, reduced polymorphonuclear granulocyte chemotaxis, inhibited peroxynitrite in airway lumen in mice, attenuated inflammation - mediated cartilage destruction activity in human articular cartilage, and reduced cyclooxygenase (cox)-2 expression in human monocytes. since the critical role of inflammation in genesis of insulin resistance, it is reasonable to speculate that apocynin could improve insulin resistance through suppressing inflammation. however, no studies were conducted to examine the effects of apocynin on inflammation and its subsequent effects on insulin resistance. in this study, c57bl/6 mice were fed with high - fat diet (hfd) to establish insulin resistance for investigating the effects of apocynin on the expression of inflammatory factors in blood, liver, and adipose tissue, and then evaluating the improvement of insulin sensitivity with apocynin treatment. four - week - old male c57bl/6 mice used in this study were purchased from animal center, yangzhou university (yangzhou, jiangsu, china). the mice were fed either with high - fat diet (60% kcal fat, 20% kcal carbohydrates, 20% kcal protein, guangzhou animal experiment center, guangzhou, china), or with normal chow diet (10% kcal fat, 70% kcal carbohydrates, 20% kcal protein) after one week 's acclimation period. mice were kept on a 12-hour light, 12-hour dark cycle and fed ad libitum. after 12 weeks of feeding, the hfd - fed mice showed obvious phenotypes of insulin resistance compared to the normal diet control group (nd - con). one group received normal water (hfd control group, hfd - con), while the other group received apocynin (2.4 g / l) dissolved in drink water (apocynin group, hfd - apo) for another five weeks with hfd. after given ketamine - xylazine (130/8.8 mg / kg), their tissues were harvested, weighed, snap frozen in liquid nitrogen, and stored at 80c until use. dietary intake and body weight were recorded every week. mice were fasted for 12 hours, and blood samples were collected from the orbital sinus under anesthesia. after centrifugation at 15,000 g for 1 min, the supernatants of the blood samples were separated and subjected to measurements of leptin, tnf-, and il-6 levels with the elisa kits (raybiotech, norcross, ga, usa). plasma insulin was determined with mouse insulin elisa assay kit (linco, charles, mo, usa). glucose was injected intraperitoneally with the concentration of 1 g / kg body weight. blood glucose measurement were obtained from the tail at 0, 30, 60, and 120 min. blood glucose levels were determined at indicated intervals with one touch profile glucose meter (johnson & johnson, new brunswick, nj, usa). total rna was extracted from the liver and epididymal adipose tissue of mice by trizol (takara bio, shiga, japan). synthesis of cdna was performed by m - mlv reverse transcriptase (toyobo, osaka, japan). quantitative real - time pcr was performed with sybr premix ex taq (takara bio, shiga, japan), using the stepone real - time pcr system according to the manufacturer 's instructions (applied biosystems, foster city, ca, usa). nuclear protein extracts were prepared from liver tissue with the nuclear extract kit (active motif, carlsbad, ca) according to the manufacturer 's instructions. protein concentrations were then quantified with a bradford assay, and equal amounts of protein were used in a colorimetric nf-b assay specific for the activated form of p65 subunit of nf-b (trans am nf-b p65 kit ; active motif, carlsbad, ca). p values were determined by one - way anova followed by lsd and differences were considered significant if p.05) and significantly higher than that in the nd - con group until 3 weeks after the treatment of apocynin (p.05, figure 1(c)). ipgtts were performed before the sacrifice of the mice to assess glucose tolerance (figure 2(a)). area under the curve (auc) parameter was employed as the index of glucose tolerance (figure 2(b)). auc was significantly higher in the hfd - con group compared to the nd - con group (p.05) (figure 4(e)). in the liver, gene expression tnf-, il-6, and mcp-1 were significantly lower in the hfd - apo than the hfd - con group (p <.05, resp.) (figures 5(a)5(c)). we further tested nf-b activity in liver nuclear extract samples from the mice of three experiment groups. we found that significantly less nf-b activity was derived from apocynin - treated mice than those derived from untreated hfd - fed mice (p <.05) (figure 5(d)). our present study indicates that apocynin administration in hfd - fed c57bl/6 mice can improve insulin sensitivity, reduce the diverse plasma inflammatory cytokines, suppress gene expression of inflammation - related molecules in both liver and adipose tissue, and decrease the activity of transcription factor nf-b in liver tissue. these results suggest that apocynin could ameliorate insulin resistance through the suppression of inflammation in hfd - fed c57bl/6 mice. to reflect modern dietary conditions, we employed c57bl/6 mice fed with hfd (60% kcal from fat) for 12 weeks which is a simple insulin resistance model. hfd - fed mice exhibited higher body weight than normal diet mice. although food and energy intakes were not significantly different, the body weight of the hfd - con group was increased, whereas that of the hfd - apo group was decreased and close to nd - con group. the hfd - fed mice exhibited significantly higher fasting glucose, fasting insulin levels, and auc of ipgtt than normal control mice. recently, there have been a few studies that implicated that apocynin may improve insulin resistance which are consistent with the results of the present study. winiarska and colleagues found that apocynin could inhibit renal gluconeogenesis action by suppressing oxidative stress, resulting in hypoglycaemic response in diabetic rabbits. another study indicated that apocynin administration decreased lipid peroxidation and hydrogen peroxide in adipose tissue which led to the improvement of plasma glucose and insulin resistance in kkay mice, a transgenic animal model of type 2 diabetes. also, the antioxidative effect of apocynin was protective in diabetic nephropathy [34, 35 ], in diabetic endothelial dysfunction [36, 37 ], and in diabetic mitochondrial dysfunction in skeletal muscle. however, none of the previous studies focused on the anti - inflammatory effect of apocynin on insulin resistance. in contrast, suppressing inflammatory factors may ameliorate insulin resistance [39, 40 ]. the molecular pathways that link inflammation and insulin resistance include a variety of cytokines and adipocytokines such as tnf-, il-6, mcp-1, leptin, and adiponectin. high circulating levels of tnf-, il-6, and leptin are recognized as markers of insulin resistance [10, 41, 42 ]. the inflammatory status of the liver and adipose tissue could directly impact the systemic inflammatory status that accompanies insulin resistance. inflammation - related transcription factor nf-b in the liver is regarded as an important factor for inducing insulin resistance. increased hepatic nf-b activity could cause profound hepatic insulin resistance and moderate systemic insulin resistance. furthermore, as a transcription factor, nf-b regulates expression of many kinds of cytokines in the liver. once nf-b is activated, the gene expression of tnf-, il-6, and mcp-1 is inordinately increased [6, 7 ]. the endocrine function of adipose tissue and the association of obesity result in chronic low - grade inflammation and reinforce the concept of the central role of adipose tissue in mediating obesity - linked insulin resistance. it has been discovered that the adipose tissue in fact contributes 1535% of the body 's basal circulating il-6 and a large rate of whole body tnf-. adipose tissue macrophages (atms) are proved to be predominantly responsible for the elevated production of tnf- and il-6 during obesity. mcp-1 could contribute macrophage infiltration into adipose tissue and affect the number of atms in adipose tissue, which in turn impacts the expression of tnf- and il-6. so gene expression of leptin in adipose tissue directly affects leptin level in the blood. however, hart and his colleagues found that apocynin could reduce inflammation as well as superoxide anion. afterwards, a number of studies have demonstrated that apocynin could modulate the production of inflammatory factors production both in vitro [2731 ] and in vivo [25, 33, 48 ]. in the present study, we investigated the effect of apocynin on the inflammatory status through hfd - induced insulin resistance in c57bl/6 mice. our results show that the gene expression of tnf-, il-6, and mcp-1 in the liver and the gene expression of tnf-, il-6, mcp-1, and leptin in adipose tissue were upregulated after hfd feeding in mice. apocynin administration suppressed the expression of these inflammatory agents, resulting in the reduction of circulating tnf-, il-6, and leptin levels that normally accompany insulin resistance. furthermore, we found that apocynin could reduce the activity of hepatic nf-b which contributes to the improvement of insulin resistance both in the liver and whole body. there is compelling evidence that in many cell types, ros such as hydrogen peroxide and superoxide anion have a major effect on the release and nuclear translocation of the nf-b complex and on the induction of nf-b target genes [49, 50 ]. nadph oxidase, a major source of ros, triggers the production of superoxide anion [51, 52 ]. hence, it is reasonable that apocynin, an inhibitor of nadph oxidase, suppresses nf-b activity. our results are in agreement with a study conducted by pechanova and his colleagues who used apocynin in spontaneously hypertensive rats. after six weeks of treatment, apocynin significantly decreased the activity of nf-b in the left ventricle. although in the present study, we have proved that apocynin could ameliorate inflammatory status and suppress the activity of nf-b in the liver, changes in other inflammatory signaling pathways and insulin signaling remain unknown. apocynin has the potential to improve insulin sensitivity through ameliorating inflammatory status in the blood, liver, and adipose tissue of the c57bl/6 mice in which insulin resistance was induced by hfd. | we investigated the effects of apocynin on high - fat diet- (hfd-) induced insulin resistance in c57bl/6 mice. after 12 weeks of hfd, the mice that exhibited insulin resistance then received 5 weeks of apocynin (2.4 g / l, in water). following apocynin treatment, fasting glucose, insulin, and glucose tolerance test showed significant improvement in insulin sensitivity in hfd - fed mice. we demonstrated that serum levels of tumor necrosis factor- (tnf-), interleukin-6 (il-6), and leptin were remarkably reduced with apocynin treatment. we also found that mrna expression of tnf-, il-6, and monocyte chemoattractant protein-1 (mcp-1) in the liver and mrna expression of tnf-, il-6, mcp-1, and leptin in adipose tissue were suppressed by apocynin. furthermore, the activity of transcription factor nf-b in the liver was significantly suppressed with apocynin treatment. these results suggest that apocynin may reduce inflammatory factors in the blood, liver, and adipose tissue, resulting in amelioration of insulin resistance in hfd - fed mice. |
acquired hemophilia a (aha) is a relatively rare and life - threatening bleeding disorder caused by spontaneous development of autoantibodies against factor viii (fviii). the reported annual incidence of aha is of the order of 1.5 individuals per million (1). the disease most commonly presents as spontaneous excessive hemorrhage in muscles, skin or soft tissues, or uncontrolled bleeding during surgery. to date there is no apparent underlying cause in ~50% of the reported cases ; other cases are typically associated with autoimmune disorders, malignancy, adverse drug reactions and various skin diseases (2). in 1993, a 78-year old male patient developed generalized lymphadenopathy accompanied with a disproportionately elevated serum igg4 level. in addition to the elevated igg4 levels, the disease is characterized by lymph node involvement due to lymphoplasmacytic infiltration with igg4-positive plasma cells, marked interstitial fibrosis, eosinophilic infiltration and obliterative phlebitis of the terminal venules (4). igg4-related disease is a fibroinflammatory systemic disease which affects multiple organs, including the biliary system, salivary glands, lymph nodes, pancreas, retroperitoneum, periorbital tissue, lungs, meninges, aorta, breast, prostate, thyroid gland, pericardium, skin and kidney (3,512). owing to multisystemic involvement, clinical manifestation of igg4-related disease varies widely, and depends on the severity of the affected organs. an extensive literature search revealed only two documented cases of aha with co - existing igg4 related disease (13,14). herein, a rare case of igg4 -related aha with multisystemic involvement is described that presented with a myriad of clinical characteristics. the clinical relevance of aha has been discussed to provide a better understanding of this rare disorder. a 55-year - old chinese male, who provided written informed consent, presented at shanxi dayi hospital of shanxi medical university (shanxi, china) in november 2014 with a history of chronic cough since half a year ago with no obvious cause. there was progressive aggravation of cough, which could be induced by cooking fumes or pungent odor. six days prior to admission, the patient caught a cold with further aggravation of cough, but without fever, hemoptysis, chest pain, palpitations and sweating. the patient did not respond to antibiotic therapy prescribed at a local health clinic. on examination, the patient was not febrile (36.5c), and his vitals were stable with a systolic blood pressure of systolic 141 mmhg and diastolic 94 mmhg. his systemic examination was unremarkable except for the presence of a small palpable submandibular lymph node and an enlarged left inguinal lymph node measuring 31 cm. his abdomen was soft, non - tender with non - palpable liver and spleen. the result of bronchial provocation test was positive and the patient was diagnosed as having bronchial asthma. the patient had a significant past medical history, including hospitalization for autoimmune hepatitis with serum alanine aminotransferase (alt) 421 iu / ml and aspartate aminotransferase (ast) 600 iu / ml. anti - smooth muscle antibody was positive (titre, 1:100). abdominal computed tomography (ct) showed multiple enlarged lymph nodes in the ligament of liver and stomach, around the abdominal aorta and bilateral inguinal regions, with the left inguinal region being more affected. the upper pancreatic bile duct was widened, indicating a possibility of cholecystitis or cholangitis. furthermore, there was thickening and consolidation in the wall of left ureter, indicating a possibility of a space occupying lesion (sol) of the ureter, accompanied with an inflammatory response in the renal pelvis and the upper ureter. magnetic resonance cholangiopancreatography revealed multiple gallbladder and bile duct calculi, intra- and extrahepatic bile duct dilation, and abnormal signals in caput pancreatis accompanied with multiple enlarged small lymph nodes around the abdominal artery. based on these findings, the patient was diagnosed with gallbladder and cystic duct calculi, acute cholecystitis and acute pancreatitis. the symptoms of the patient improved with anti - inflammatory drugs and supportive treatment, with restoration of normal serum alt (25.2 iu / ml) and ast (19.4 iu / ml) levels. to rule out the possibility of sol in the left ureter positron emission tomography (pet)/ct performed three months prior to admission showed abnormal hypermetabolic signals in multiple organ systems (including bone marrow, multiple lymph nodes, parotid gland, lung, gallbladder, bile duct, pancreas, prostate and testis), left hydronephrosis and dilatation of the upper left ureter. assays for serum lupus anticoagulant combination, antinuclear antibody, antineutrophil cytoplasmic antibodies, immunoglobulin and complement levels were all negative. three days after admission, the patient developed subcutaneous hemorrhages and pain in the right hip (fig. ultrasound examination revealed a subdermal hematoma over the right hip measuring 93x5 cm. on detailed enquiry, the patient revealed a past history of spontaneous bleeding in bilateral upper extremities 2 months prior to admission. chest ct showed multiple diffuse nodular lesions with thickening of bronchovascular bundles, and multiple scattered high density spots in both lung lobes. in addition, there was multiple lymph node enlargement in the mediastinum and pulmonary hila (fig. laboratory investigations at admission showed activated partial prothrombin time (aptt) of 120.0 sec (normal range, 24.040.0 sec), but with normal prothrombin time, thrombin time and fibrinogen levels. coagulation factor assay revealed a markedly decreased factor viii (fviii) activity at 0.5% (normal range, 60150%), and a high - titer of fviii inhibitor at 27.2 bethesda units / ml (bu / ml) (normal range, 00.6 bu / ml). g / l). left inguinal lymph node biopsy revealed capsular thickening, marked lymphoplasmacytic infiltration with irregular fibrosis and obliterative phlebitis (fig. further positive immunostaining for human herpes virus type 8, lambda and kappa light chains showed reactive lymphoid hyperplasia in the nodular lesion (fig., immunohistochemical staining for igg4 revealed numerous igg4-positive plasma cells [> 100 cells / human plasma fibronectin (hpf) ] in the nodular lesion, with an increased igg4/igg ratio of > 40% (fig. 5). the patient was treated with oral prednisone (initial dose, 40 mg / day ; maintenance dose, 15 mg / day ; cat. after 2 weeks of treatment, the activated partial thromboplastin time was within the normal range. furthermore, one month after treatment, chest ct scan showed clearing of the nodular lesions and lymph nodes. there was no instance of relapse during follow - up (table i) after one and three months. since the first reported case of igg4-related disease in 1993 (3), there have been numerous reports of complicated diseases overlapping this clinical entity (14,15). although the understanding of igg4-related disease has rapidly increased, its etiology remains elusive. according to the clinicopathological characteristics of igg4-related disease, its proposed comprehensive diagnostic criteria consists of the following (14,16) : i) diffuse or localized swelling or masses in single or multiple organs on clinical examination ; ii) elevated serum igg4 level (135 mg / dl) ; and iii) marked lymphocyte and plasmacyte infiltration, fibrosis and infiltration of igg4-positive plasma cells with a ratio of igg4/igg positive cells > 40%, and > 10 igg4-positive plasma cells / hpf on histopathological examination. aha is a rare but life - threatening hemorrhagic disorder caused by the presence of spontaneous antibodies against fviii (17). although igg4-related disease can potentially affect any organ besides co - existence with other complicated diseases ; it is extremely rare for this condition to overlap aha disease. only two documented cases of aha overlapping with igg4 related disease have been identified in the literature (13,14). in the present case, the patient was diagnosed with aha based on the laboratory findings that included markedly increased aptt, markedly decreased factor viii (fviii) activity, and a high - titer of fviii inhibitor. notably, the clinicopathological characteristics of the patient fulfilled all the diagnostic criteria of igg4-related disease described above. a review of the patient 's past history revealed multiple organ diseases, including gallbladder and cystic duct calculi, acute cholecystitis, acute pancreatitis, urticaria, diabetes and low t3 syndrome. considering that igg-4-related disease could affect any organ and can present with myriad manifestations, it is suggested that the multiple organ disease identified in this patient was caused by igg4-related aha. the specific treatment of igg4-related aha resulted in the following response : i) the manifestations of igg4-related aha, such as cough, nausea, abdominal pain and subcutaneous hemorrhage, were completely resolved ; ii) blood glucose level and thyroid function were restored to normal range and remained stable, unlike that in igg4-related disease only, which frequently involves the pancreas and thyroid gland, causing diabetes and low t3 syndrome ; iii) the specific serological markers of igg4-related aha, such as igg, aptt, fviii and fviii inhibitor were within normal range ; iv) the abnormal hypermetabolic signals in multiple organ systems identified by pet / ct were alleviated. igg4-related disease is a glucocorticoid - responsive disorder (18), and this was well manifested in the present case. the initial findings of multiple diffuse nodular lesions with thickening of bronchovascular bundles and scattered high - density spots were markedly diminished in both lung lobes, and there was a decrease in the lymph nodes. the patient 's symptoms further improved and there was no relapse on follow - up. the efficacy of glucocorticoid treatment in multiple organ diseases in this patient was consistent with the diagnosis of igg4-related aha. however, the serum igg4 level remained high even after glucocorticoid treatment, which was not consistent with most of the other documented cases. although igg4-related disease typically demonstrates high serum igg4 levels, approximately 20% of patients with biopsy - proven igg4-related disease may have normal serum igg4 level (15,19,20). a review of the literature revealed a case report wherein a patient was diagnosed with igg4-related sclerosing disease, despite serum igg4 levels remaining normal. the patient responded to corticosteroid treatment (prednisolone) with alleviation of pulmonary lesions and improved renal function ; however, the serum igg4 level increased (6). a plausible explanation for the seronegativity of the patient may be that active synthesis blocked igg4 secretion, and then corticosteroid treatment suppressed the synthesis, which restored igg4 secretion from the plasma cells. thus, igg4-related disease may have various pathological features, and is likely to be associated with a variable response to treatment. the current patient is currently being followed - up with monitoring of serological markers, including igg4. in conclusion, the present study describes the first reported case of igg4-related aha in a 55-year - old male who presented with unusual clinical features and systemic manifestations. awareness of such an entity is necessary as it is a curable disease, and timely treatment could be life - saving. documentation of such rare cases will help in further characterizing the pathogenesis of this rare disorder. | acquired hemophilia a (aha) is a relatively rare and life - threatening bleeding disorder whose pathogenesis is not completely understood. the present study reports a rare case of immunogubulin (igg)4-related aha with multisystemic involvement. a 55-year old male patient presented with symptoms of bronchial asthma and multiple subdermal hematomas. chest computed tomography showed multiple diffuse nodular lesions with thickening of bronchovascular bundles, and scattered high - density spots in both lung lobes. laboratory investigations showed increased activated partial prothrombin time (120.0 sec), a markedly decreased factor viii (fviii) activity (0.5%), a high - titer of fviii inhibitor (27.2 bethesda units / ml) and a marked increase in serum igg4 (> 4.03 g / l) level. left inguinal lymph node biopsy revealed capsular thickening with marked lymphoplasmacytic infiltration, occlusive phlebitis and irregular fibrosis. immunostaining revealed numerous igg4-positive plasma cells (> 100 cells / human plasma fibronectin) in the nodular lesions, with an igg4/igg ratio of > 40%. the symptoms were markedly alleviated following corticosteroid therapy. the current study presents the first reported case of a rare igg4-related aha that presented with unusual clinical features and multisystemic involvement. the patient responded well to corticosteroid therapy. documentation of such rare cases will help in characterizing the pathogenesis, and prompt recognition and timely treatment of this rare disorder. |
kinesin is a molecular motor that transports organelles along a microtubule (mt) using the energy of atp hydrolysis. conventional kinesin is highly processive and can move across hundreds of tubulin dimers (> 1 m) without dissociating from the mt (howard., 1989 ; block., 1990). this processive movement has been explained by a hand - over - hand model in which the two heads of a kinesin alternately interact with the mt (schnapp., 1990 ; hackney, 1994 ; howard, 1996). a nucleotide - dependent conformational change in the neck - linker, a small peptide emerging from the cooh terminus of the catalytic core, is considered crucial for the walking mechanism of two - headed kinesin (rice., 1999). the model attributes the movement to structural change in the kinesin, whereas mts are regarded as merely a passive track. on the other hand, in actomyosin, the motor system in muscle, several reports have indicated that the structure and dynamics of actin filaments may play an active role in motility. when actin filaments interact with heavy meromyosin in the presence of atp, a rapid and significant bending motion or accelerated diffusion of actin filaments was observed, indicating that some kind of conformational change may be occurring in actin filaments (yanagida. moreover, an experiment using intrastrand cross - linked actin demonstrated that the velocity of actin filaments in an in vitro motility assay was reduced with an increase in actin cross - linking, whereas the rigor myosin subfragment (s1) binding to actin filaments and the acto - s1 atpase activity were virtually unaffected by the cross - link (kim., 1998). this indicated that the dynamic property of actin filaments that is essential for motility might be inactivated by the intrastrand cross - link. these results in the actomyosin system raise the possibility that in the corresponding mt kinesin system, mts are more than simply a passive track. to study the dynamic properties of mts during motility, we directly observed the binding and motility of kinesin - coated beads along a single mt. we find that in the presence of atp, a kinesin - coated bead binds to a mt in a cooperative manner with a large cooperative range, in the order of micrometers in length. the result suggests that the mt has both high and low affinity states for kinesin, and binding of kinesin induces the high affinity state over an extended range. in contrast to this cooperative binding in the presence of atp, in the presence of adp or 5-adenylylimidodiphosphate (amp - pnp), binding was random along the mt, indicating that this state transition is closely related to motility. mt interactions, native kinesin purified from bovine brain was first coated onto the surface of fluorescent latex beads (0.2 m in diameter) at a molar ratio of 17 to 1. these kinesin - coated beads were then combined with rhodamine - labeled mts in the presence of atp, and their binding to a mt was directly observed by conventional fluorescence microscopy. in this experimental condition, the kinesin beads bound to the mt at an average binding frequency of 0.018 m s and moved toward the mt plus end at a velocity of 0.90 0.15 m / s (mean sd). due to the high density of bound kinesin, most of the beads that had bound to the mt (97 4%) did not dissociate from the mt until reaching the plus end (block., 1 a shows sequential images of kinesin beads moving on a single mt, taken at 1-s intervals. new bindings quite unexpectedly, the binding of kinesin beads was not completely random, but occurred preferentially in the vicinity of beads that were already moving along the mt. consequently, a cluster of kinesin beads was formed over several micrometers of mt filament, and longer observation times revealed new clusters being repeatedly formed (video 1, available at http://www.jcb.org/cgi/content/full/jcb.200409035/dc1). interaction of kinesin - coated beads with a mt in various nucleotide conditions. (a) sequential images of kinesin beads interacting with a mt in the presence of 1 mm atp, taken at 1-s intervals. (b) diagrams illustrating how the windows (represented by rectangles of various colors) were defined for the statistical analysis of the binding frequency. the example is taken from the images shown in a. starting from the position of the preexisting kinesin beads (yellow dots), a window of 1 m was shifted along a mt in both plus- and minus - end directions until the entire length of mt was covered. (c) the binding frequency calculated as a function of distance from the preexisting kinesin beads. binding was measured in the presence of 1 mm atp (blue dot), amp - pnp (gray dot), and adp (green dot) at a kinesin - bead concentration of 90 pm. total number of binding events, number of mts, and total observation time were 934 binding events, 5 mts (length = 12.9018.55 m), 61 min for atp ; 734 binding events, 65 mts (length = 11.9418.10 m), 114 min for adp ; and 669 binding events, 72 mts (length = 12.1818.87 m) and 115 min for amp - pnp, respectively. when the position of the kinesin bead was recorded at a higher temporal resolution (10 frame / s), the binding frequency was not affected, indicating that the temporal resolution of 3 frames / s is adequate. to test the statistical validity of the observed preferential binding, the binding frequency of kinesin beads first, the positions of the beads interacting with a single mt were determined using the image analysis software, nih image, at 0.33-s intervals (at a rate of 3 frame / s) over an observation period of 815 min, which corresponded to between 159 and 205 new binding events. based on the instantaneous position of each preexisting, moving kinesin bead, a 1-m window was shifted along the mt in both the plus- and minus - end directions (fig. 1 b, colored rectangles), and for each window with a distinct color, the total number of new binding events, n, and the total length of mt, l, was measured. n and l were thus measured in five randomly selected mts and the results were combined. finally, the frequency of new binding events in each window was obtained by dividing the combined n by the product of combined l and t (= n/(lt)), where t is the observation time (0.33 s). 1 c is a result of such a calculation, showing that binding was actually enhanced in the vicinity of preexisting kinesin beads except for the area immediately surrounding the preexisting kinesin bead. in that area (within 1 m distance), the binding was slightly suppressed due to physical obstruction of the binding site by the preexisting bead. statistical significance of the preferential binding was confirmed by the kolmogorov - smirnov test of probability density distributions (pdds ; fig. this calculation of binding frequency does not depend on any statistical assumptions, because it simply divides the mt into zones depending on the distance from the moving kinesin beads, and calculates the binding frequency in each zone. binding was less frequent and random along the mt in the presence of both adp and amp - pnp (fig. 1 c). it should be noted that the kinesin concentration used here (1.5 nm) was significantly lower than that used previously (610 m) to examine the cooperative binding of kinesin dimers in the presence of amp - pnp (vilfan., 2001). the cooperative binding observed in the previous study was most likely a result of attractive interaction between kinesin molecules. although the binding frequencies were similar for adp and amp - pnp, the behavior of the kinesin beads after the binding event was different, reflecting the weak and strong binding states in adp and amp - pnp conditions, respectively (crevel., 1996). in the presence of adp, the position of the kinesin beads changed slightly with time along the mt (diffusion coefficient = 380 nm / s), and in some rare occasions, they even dissociated from the mts (koff = 0.004/s). in contrast, in the presence of amp - pnp, the kinesin beads neither changed their position (diffusion coefficient 26 nm / s) nor dissociated from the mt once bound. we next wished to determine if there is any bias in the direction of cooperative binding. in the analysis of binding frequency described above, directionality was not explicitly considered because in situations where multiple beads were simultaneously moving along a mt, it was difficult to determine whether it was the forward or the rear bead that facilitated the new binding. to simplify the analysis, directionality was examined only in cases where a single kinesin bead was moving on the mt before the analysis (fig. the distribution of subsequent new binding events relative to the position of the moving beads was then examined. to guarantee equal opportunity for new binding in either direction, new bindings were included in the statistics only when the available area of mt exceeded 6 m in length on both sides of the moving kinesin beads. situation was relatively rare, records obtained over a total observation period of 4 h (corresponding to 20 mts) were scrutinized and 76 new bindings were counted (fig. the result revealed a biased distribution in the plus - end direction ; within a 6-m distance, binding in the plus - end direction was 2.2 times higher than the binding in the minus - end direction (52 plus - end events vs. 24 minus - end events). assuming no particular preference in the direction of cooperative binding, the probability of such an uneven distribution within statistical fluctuation is 6 m of free mt on either side of the reference bead were analyzed. a homodimer of e236a showing no atpase activity (table s1) was used as a control to coat the reference bead. first, to validate the usage of wt / e236a, we measured the distribution of binding frequency along the mts with a bound wt / e236a - bead. the result showed that binding of the test beads was enhanced in the vicinity of the wt / e236a - bead, most prominently in the plus - end direction (fig. in contrast, for mts with a bound e236a / e236a - bead, the binding frequency was low and no significant bias was detected (fig. 3 c). when the binding frequency averaged for 10 mts was compared between the two groups, the frequency was significantly higher for mts with a wt / e236a - bead (fig.. 1 c, which indicated atp hydrolysis is essential for cooperative binding. now to evaluate the directionality of cooperative binding, based on the same binding data, only those new bindings occurring in the absence of any other beads moving on the mt were counted. although the experimental conditions were optimized here to increase the chance of lone bindings occurring, the value for total bindings shown in fig. 3 b may still include those bindings that are facilitated by the presence of other test beads on the mt (fig. 4 a). the distribution of the lone bindings revealed that for mts with a bound wt / e236a - bead, the binding was significantly higher in the plus - end than the minus - end direction (205 plus - end events and 115 minus - end events, p 6 m of mt length on either side of the reference bead were imaged for 20 min. for binding assays in the presence of adp or amp - pnp for mts with a bound wt / e236a - bead, the protocol was same as above except that the nucleotide included in the final test - bead solution was 1 mm adp or amp - pnp. because the test beads only showed minimal dissociation from the mts in the presence of these nucleotides, we counted only one lone binding from a single mt. in each experiment, after the observation of the initial binding event, test - bead solution including 1 mm atp was freshly introduced into the chamber and the polarity of this single mt was determined by the direction of the movement of the beads. s1 showing statistical analysis of kinesin - bead binding ; table s1 showing kinetic and motile properties of heterodimeric and homodimeric e236a kinesin ; and videos 1 and 2, corresponding to data in figs. 1 a and 2 b, respectively. tetramethylrhodamine - labeled mts were prepared as described previously (miyamoto., 2000). to prepare kinesin - coated beads, fluorescent latex beads (carboxylate modified, 0.2 m in diameter, 10% wt / vol ; f-8811 ; molecular probes) were first incubated with an equal volume of casein solution (5 mg / ml in 10 mm tris, 0.1 m nacl) for 30 min on ice. casein mixture was subsequently combined with a 0.63 m kinesin solution and 1 m nacl at a volume ratio of 2:1:0.3, and incubated for 4 h on ice. using this protocol, virtually all the kinesin molecules in solution were adsorbed onto the surface of the latex beads (determined by folin ; lowry., 1951), and thus the molar stoichiometry of kinesin to bead was estimated to be 17 molecules per bead. for binding assays in the presence of atp, mts (10 g / ml) in buffer a (20 mm pipes, 10 mm k - acetate, ph 6.8, 4 mm mgso4, 2 mm egta, 0.2 mm edta) supplemented with 10 m taxol (t-7402 ; sigma - aldrich) were introduced to a flow chamber made of two coverslips (dimensions 10 mm 10 mm 110 m). the bottom coverslip was pretreated with sigmacote (sl2 ; sigma - aldrich) and the mts tended to stick to its surface for their entire length. in the following procedure, after a 3-min incubation with the mt solution, 20 l of casein solution was introduced to the chamber. after another 5-min incubation, the chamber was extensively washed with 40 l of buffer a and loaded with 20 l of kinesin - bead solution (kinesin - coated beads prepared as above and diluted to a concentration of 90 pm in buffer a including 1 mm atp and an oxygen scavenger [miyamoto., 2000 ]). the flow chamber was sealed with vaseline and observed under an inverted fluorescence microscope (tmd-300 ; nikon) equipped with an oil immersion objective lens (neofluar, 100, na = 1.3 ; carl zeiss microimaging, inc.) and a sit camera (c2400 - 8 ; hamamatsu photonics). the observation was made at 26 1c and the image was recorded using a digital video recorder (dsr20 ; sony). for binding assays in the presence of adp or amp - pnp, as kinesin beads are difficult to dissociate once bound to mts in these nucleotide conditions, the number of kinesin beads on the mt increased with time. to observe this process from the start, mts were first allowed to attach to the bottom of the flow chamber, and then viewed under a fluorescence microscope. the kinesin - bead solution including 1 mm adp or amp - pnp was subsequently introduced to the chamber so that the process of their binding to the mts could be monitored in real time by fluorescence microscopy. images of the binding were recorded until the average bead density on the mt approached 0.58 beads/m, which was the maximum bead density achieved in the experiment in the presence of atp. in the case of amp - pnp, the solution was supplemented with apyrase (a-6132, 1 u / ml ; sigma - aldrich). statistical significance of cooperativity was examined by comparing the pdd expected for random binding and the pdd of actual binding by the kolmogorov - smirnov test (fig. if the binding was random along the mts, n should be a linear function of l in each window. then, the pdd of actual binding, \documentclass[10pt]{article } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{pmc } \usepackage[euler]{upgreek } \pagestyle{empty } \oddsidemargin -1.0 in \begin{document } \begin{equation}{n_{i}}/{{{\sum^{9}_{i=2}}}n_{i}}{\mathrm{,}}\end{equation}\end{document}is expected to coincide with the pdd of the mt length, \documentclass[10pt]{article } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{pmc } \usepackage[euler]{upgreek } \pagestyle{empty } \oddsidemargin -1.0 in \begin{document } \begin{equation}{l_{i}}/{{{\sum^{9}_{i=2}}}l_{i}}{\mathrm{,}}\end{equation}\end{document}where ni and li are the total number of bindings and the total length of mt in the ith window from the preexisting kinesin bead, respectively. the window closest to the preexisting kinesin bead (i = 1) was omitted from the calculation, because in this area, binding was suppressed due to physical obstruction of the binding site. the homodimeric and heterodimeric e236a mutants were prepared as described previously (kaseda., 2002). steady - state mt - activated atpase was measured using malachite green (kodama., 1986). to make the wt / e236a- and e236a / e236a - beads, carboxylated fluorescent latex beads with a diameter of 0.5 m (l-5261 ; molecular probes) were coated with streptavidin and subsequently incubated with wt / e236a or e236a / e236a as described previously (kaseda., 2003). labeling stoichiometry of the reference beads, estimated from their probability of movement in optical nanometry (kojima., 1997), was 100 homodimers and 25 heterodimers to a bead on average. to prepare test beads for the binding assay, 0.2-m diam fluorescent latex beads were coated with native kinesin as described previously (binding assay under various nucleotide conditions), except that the stoichiometry of kinesin to a bead was 12 and the final concentration of the beads used in the binding assay was 80 pm. for the binding assay, mts were made attached to the bottom of the flow chamber and 20 l of casein solution including 10 m taxol was introduced to the chamber, and incubated for 10 min. in the following procedure, 10 m taxol was always included. the chamber was washed with 30 l of buffer a and then loaded with 20 l of wt / e236a- or e236/e236a - bead solution (3 pm). after an 8-min incubation, the chamber was extensively washed with 60 l of buffer a to remove the beads not bound to mts. finally, 15 l of test - bead solution including 1 mm atp and an oxygen scavenger was introduced into the chamber, and the binding was observed under fluorescence microscope. mts with only one reference bead attached and having > 6 m of mt length on either side of the reference bead were imaged for 20 min. for binding assays in the presence of adp or amp - pnp for mts with a bound wt / e236a - bead, the protocol was same as above except that the nucleotide included in the final test - bead solution was 1 mm adp or amp - pnp. because the test beads only showed minimal dissociation from the mts in the presence of these nucleotides, we counted only one lone binding from a single mt. in each experiment, after the observation of the initial binding event, test - bead solution including 1 mm atp was freshly introduced into the chamber and the polarity of this single mt was determined by the direction of the movement of the beads. s1 showing statistical analysis of kinesin - bead binding ; table s1 showing kinetic and motile properties of heterodimeric and homodimeric e236a kinesin ; and videos 1 and 2, corresponding to data in figs. 1 a and 2 b, respectively. | interaction of kinesin - coated latex beads with a single microtubule (mt) was directly observed by fluorescence microscopy. in the presence of atp, binding of a kinesin bead to the mt facilitated the subsequent binding of other kinesin beads to an adjacent region on the mt that extended for micrometers in length. this cooperative binding was not observed in the presence of adp or 5-adenylylimidodiphosphate (amp - pnp), where binding along the mt was random. cooperative binding also was induced by an engineered, heterodimeric kinesin, wt / e236a, that could hydrolyze atp, yet remained fixed on the mt in the presence of atp. relative to the stationary wt / e236a kinesin on a mt, wild - type kinesin bound preferentially in close proximity, but was biased to the plus - end direction. these results suggest that kinesin binding and atp hydrolysis may cause a long - range state transition in the mt, increasing its affinity for kinesin toward its plus end. thus, our study highlights the active involvement of mts in kinesin motility. |
since antibiotics were first discovered in 1928, they have been widely used in human and animal medicine. however, most antibiotics are excreted and enter the soil or water environments through wastewater and fertilization with manure (kmmerer, 2003). antibiotic contamination of the natural environment has been documented in many countries, including those of europe, north america, and east asia, and areas of antibiotic contamination are widespread throughout the region (segura., 2009). the pathways whereby residual antibiotics enter the environment are varied and include wastewater effluent discharge and runoff and leaching from land fertilized with agricultural or human waste. an increasing number of reports show a rise in the occurrence and distribution of antibiotics in surface waters in europe (hirsch., 1999 ;, 2001 ; kolpin., 2002 ; kim and carlson, 2007), and canada (metcalfe., 2004). cases of antibiotic contamination of wastewater are also well - known (gbel., 2005 ; and others). some antibiotics can be found in ground water (baquero., 2008). in china, antibiotics have been found in animal wastewater, pond water, animal farm effluents, and rivers. the most frequently detected antibiotics in china include sulfamethazine (75%), oxytetracycline (64%), tetracycline (60%), sulfadiazine (55%), and sulfamethoxazole (51%), which were found at maximum concentrations of 211, 72.9, 10.3, 17.0, and 63.6 ppb, respectively (wei., 2011). in korea, environmental contamination with tetracyclines and sulfonamides was reported at the ppb level (ok., 2011). recent excellent reviews by kmmerer (2009a, b) summarize contamination of the environment with antibiotics and the spread of antibiotic resistance. this manuscript will focus on indochina environment having unique situation as following. unlike the socioeconomic - unified continents of europe and north america, asia is more geographically and culturally disjunct, and can not be readily grouped as a single geopolitical entity. it therefore remains difficult to obtain a generalized theory of antibiotic and antibiotic resistance contamination across all asian countries. this manuscript focuses specifically on the region of indochina and the major antibiotics in this area, including quinolones, sulfonamides, and tetracyclines. countries of indochina include vietnam, thailand, cambodia, lao pdr, and myanmar. of these, vietnam and thailand have particularly become a center of rapid industrial development and economic growth ; however this growth has far outpaced investment in public infrastructure, leading chemical pollution and sanitary issues. although indochina is globally one of the most active regions of industrial growth and development, there remains few studies on antibiotic contamination relative to their western and east asian counterparts (le and munekage, 2004 ; nhiem., 2008 ; zhang., 2009 ; hoa., 2011 ; takasu., contamination levels are highly variable, ranging from scales of ppm to ppt (le and munekage, 2004 ; managaki., 2007 ;, 2008 ; hoa., 2011 ; takasu., 2011). table 1 summarizes the various antibiotic contaminants that have been detected in indochina aquatic environments. until now for antibiotic resistance in this area, major reports consisted of studies on salmonella isolates (ogasawara., 2008 ; sirichote., 2010 ; and others)., not quantifiable due to overlapped interfering peak. large amounts of antibiotics are used for human medicine, livestock farming, and aquaculture in southeast asia. in addition, we observed that antibiotics are used as additives in ice to prevent decay of harvested fish in fish markets. it is believed that high concentrations of antibiotics applied in this manner will remain in the fish, and will then be taken in by people upon consumption. such widespread antibiotic contamination of the environment and food supply likely promotes the development of antibiotic - resistant bacteria, both in the environment and within the human intestine. prior to the early 2000s, few studies addressed antibiotic contamination in indochina (le and munekage, 2004), although the occurrence of antibiotic - resistant bacteria in the region was reported (kim., 2004 ; le., 2005 ; zhang., 2009 however, recent studies on drug contamination, combined with detection of antibiotic - resistant bacteria and/or resistance genes, have provided a clearer picture of the problem in this area of asia (hoa., 2011 ; takasu., aquaculture farming system known as vac (vegetation, aquaculture, and cage) is common. the vac system is a recycling farm, typically consisting of a vegetable field, an aquaculture pond, and caged animals, and has been practiced since the 1980s. in the vac system, livestock manure (usually from pigs, chickens, and ducks) is directly transported to fish ponds and to vegetable and rice fields. this untreated sewage and wastewater from the livestock operations is used for fish culture and for fertilization of the vegetable fields. the animal manure contributes to the eutrophication of pond water, which enhances phytoplankton growth. the vac system is considered a very economical method of recycling farming (hop, 2003) ; however, the heavy use of antibiotics in livestock increases the prevalence of enteric antibiotic - resistant bacteria and the potential for antibiotic - resistant pathogenic bacteria to arise. subsequent discharge of antibiotic residues in farm waste likely increases the number of antibiotic - resistant bacteria in the environment, which in turn promotes the further selection and transfer of antibiotic resistance genes within the microbial community in the surrounding environment (petersen and dalsgaard, 2003 ; heuer and smalla, 2007). (2011) reported that enteric bacteria of pigs in vac showed high resistance to nalidixic acid and enrofloxacin, which would be dispersed to water environment. that is, the abundance of antibiotic - resistant bacteria and genes initially increases in the intestinal tracts of livestock as a result of exposure to high concentrations of various antibiotics. next, horizontal gene transfer occurs among various bacteria in the environment surrounding the vac operation. finally, the antibiotic resistance genes move to other environments via water use and the food supply. the antibiotic resistance genes are brought together, exchanged, and spread in vac systems. if the antibiotic - resistant bacteria come into contact with human pathogens and commensal bacteria, the risk to human health may increase significantly. although there are many snapshot reports of antibiotic resistance (reviewed in zhang., 2009), further dynamic study is needed to evaluate the risks posed by the presence of antibiotic resistance genes in the aquatic environments of developing countries in asia. fluoroquinolones (fqs) are fully synthetic antibiotics that are widely used in humans, animals, and fish (grave., 1999 ; le and munekage, 2004 ; samanidou., 2005 ; the antibacterial mechanism of fqs is based on inhibition of bacterial dna gyrase or topoisomerase iv, which are enzymes essential for dna replication. first - generation fqs are piromidic acid, oxolinic acid, and nalidixic acid, which were widely used in aquaculture in the 1970s in japan. in tropical asian countries, oxolinic acid still appears to be one of the major drugs used (grslund. second - generation (ciprofloxacin, cip and norfloxacin, nor) and third - generation (levofloxacin, lev and its enantiomer ofloxacin, ofl) compounds are used in hospitals and animal husbandry in indochina (takasu., the fqs are photo - degradable, with a half - life in pure water of 105 and 90 min for nor and cip, respectively (burhenne., 1997). however, fqs in the environment are relatively stable in water and sediment (kmmerer, 2004 ; le and munekage, 2004), which might be due to sorption onto particulates (nowara., 1997). lai and lin (2009) reported that oxolinic acid and flumequine could be retained in sediment for 9.515 and 3.66.4 days, respectively. such long half - lives in the environment pose a selective pressure for environmental bacteria. although the bioavailability of antibiotics is suspected to decrease upon adsorption on clay and humic substances, no supporting evidence has been reported. (2003) reported that 74% of thailand shrimp aquaculture farmers use antibiotics, primarily nor. le and munekage (2004) reported detecting nor at 0.53.5 ppm in the water column and 2001500 ppm in the sediment of intensive ponds and improved extensive ponds in vietnam. oxolinic acid could be detected in the water column at a concentration similar to that of nor, but not in the sediment. the water column concentration indicates present inflow, while the sediment concentration indicates the value integrated over time (takasu., 2011). the presence of antibiotics in both samples suggests that the compounds being used at present and are retained in the sediment. ciprofloxacin is commonly used with other drugs, such as griseofulvin, rifampicin, and oxytetracycline for shrimp larvae in vietnam (thuy., 2011). the most recent quantification of fqs in indochina aquatic environments showed that the average concentrations were higher in thailand (ofl, 7400 ppb ; nor, 209 ppb ; cip, 328 ppb ; lom, 67.4 ppb) than in vietnam (ofl, 255 ppb ; nor, 41.1 ppb ; cip, 162 ppb ; lom, 25.3 ppb ; takasu. both ofl and nor were confirmed as major environmental contaminants in both countries ; however, contamination at aquaculture sites was lower than at vac farms and city canals in both countries. a recent decrease in drug application and/or dilution effects may explain the improved contamination situation in aquaculture settings. since fqs are not natural compounds, it is believed that bacteria do not possess fq resistance genes. several resistance mechanisms have been reported, including mutation of dna gyrase (fukuda., 1990), impermeability to fqs due to loss of porins, and extrusion by overexpressed efflux pumps (hirai., 1986, 1987). a number of plasmid - mediated quinolone resistance (pmqr) genes (qnra, qnrb, and qnrs) have also been identified (robicsek., 2006). these pmqr genes are transferred horizontally among bacteria and encode a protein of the pentapeptide repeat family that has been shown to block the actions of fqs on purified dna gyrase and topoisomerase iv (robicsek., 2006). the origin of these genes is thought to be chromosomes in aquatic bacteria (poirel. thus, the aquatic environment is hypothesized to be a natural reservoir of fq - resistant bacteria and resistance genes. as mentioned above, the environmental concentration of fqs was found to be much higher in thailand than in vietnam. despite the lower level of contamination, the occurrence rate of fq - resistant bacteria was found to be higher in vietnam than thailand (takasu., 2011). (2011) demonstrated that there is no relationship between the concentration of fqs in the environment and the rate of bacterial resistance. kmmerer (2003) reported that exposure to a sub - inhibitory concentration induces the emergence of resistant bacteria in aquatic environments. it was reported that fqs at concentrations 10100 times lower than the mic induce the expression of a functional gene (herold., 2005), mutations (gillespie., 2005), and morphological changes (loubeyre., 1993) at the single - cell level. low concentrations are thus effective inducers of drug - resistant bacteria. the effect of disinfectants on bacteria is considerably reduced in the presence of organic matter (kawamura - sato., 2008), suggesting that the actual active concentration in the environment might be lower than analysis suggests. the importance of low concentrations of fqs to the development of antibiotic resistance should not be ignored, and additional research involving both instrumental analyses and bioassays is needed to estimate the actual concentration of fqs acting upon environmental bacteria. a broad range of bacteria can acquire resistance to fqs, including enteric bacteria (escherichia coli), pathogenic bacteria (e.g., acinetobacter), and aquatic bacteria (e.g., brevundimonus). proteobacteria and actinobacteria are the major taxa of fq - resistant bacteria (takasu., 2011), indicating that fq - resistant bacteria are not limited to specific groups. it was hypothesized that bacteria from humans and animals as well as natural aquatic bacteria are potential reservoirs of fq resistance genes. a number of resistance genes have been identified in fq - resistant bacteria, including qnra, qnrb, qnrs, and aac(6)-ib - cr (takasu., 2011). since qnra, qnrb, and qnrs are thought to have originated from the chromosomes of water - dwelling bacteria (poirel., 2005a, b), it is possible that these genes can be transferred from aquatic bacteria to human bacteria (hernndez., 2011). to date, pmqr genes including aac (6)-ib - cr, which are linked with other drug resistance genes and are transferable, have only been discovered in gammaproteobacteria such as vibrio (poirel., 2005a), shewanella (poirel., 2005b), and aeromonas (cattoir., 2008 ; picao., the number of fq - resistant salmonella enterica isolates found in thailand increased in the late 1990s, and the resistant isolates possessed the same gyra region, suggesting rapid spread of the resistant bacteria (hakanen., 2001). the gyra mutation is located on the chromosome, but recent research indicates that gyra can also be transferred (ferrandiz. spreading of both resistant bacteria and chromosomal resistance genes might be a cause of the observed widespread drug resistance in asia. however, precisely how fq resistance genes are spread among various environments is not known, although mutation - based resistance and transferable genes should be considered. the dynamics of fq resistance genes are of interest and importance from the viewpoints of human clinical and gene evolution studies. sulfonamides, which are also synthetic antibiotics, have been widely used to treat bacterial and protozoan infections in humans, domestic animals, and aquaculture species since their introduction to clinical practice in 1935 (perreten and boerlin, 2003 ; le and munekage, 2004 ; blahna., 2006). sulfonamides inhibit folate biosynthesis by competing with the natural substrate p - amino - benzoic acid for binding to dihydropteroate synthase (dhps), an enzyme in the folic acid synthesis pathway. while the use of sulfonamides in humans has decreased in developed countries, they are still frequently used in developing asian countries due to their low cost (macrolides are 13 $ /tablet, whereas sulfonamides are 2 cent / tablet in vietnam). sulfamethoxazole (smx), a commonly used sulfonamide analog, was detected at ppm levels in shrimp ponds in vietnam in the late 1990s (le and munekage, 2004). although such levels are extremely high, smx levels in rivers in japan and vietnam are typically around 100 ppt in recent years (managaki., 2007). this was confirmed in various locations in vietnam (hoa., 2011), where concentrations were in the 6004000 ppt range throughout the year in a city canal. trimethoprim was detected in the 201800 ppt range as well, probably because it is often used with smx. in livestock farm wastewater, the concentration of smx was lower, in the 68600 ppt range, whereas that of sulfamethazine was much higher (4006000 ppt). other sulfonamides were either not detected or found at trace levels, suggesting that smx and sulfamethazine are the major sulfonamides in use in vietnam at present. since sulfonamides inhibit the formation of dihydrofolic acid (perreten and boerlin, 2003), bacterial resistance to sulfonamides can occur through mutations in the chromosomal dhps gene (folp) or through acquisition of an alternative dhps gene (sul) whose product has a low affinity for sulfonamides (perreten and boerlin, 2003). acquisition of sulfonamide resistance through sul genes is the most prevalent mechanism (enne. sulfonamide resistance is globally prevalent among human and animal pathogens (kerrn., 2002 ; perreten and boerlin, 2003 ; antunes., 2005) ; however, the presence of sul genes is not equally distributed among bacterial populations (kerrn., 2002 ; antunes., 2005 ; hammerum., the sul2 gene, which is related to class i integron, is common in acinetobacter isolated from fish farms and chicken manure in thailand (agers and petersen, 2007). however, hoa. (2008) reported that sul1 was the major sul gene among smx - resistant bacteria isolated from vac farms, city canals, and aquaculture sites in vietnam. most of these reports were based on isolated bacteria, which may bias interpretation of results due to the processes of isolation ; therefore, we can not obtain an accurate assessment of the distribution of antibiotic resistance genes from culturable bacteria alone. a direct quantification approach indicated that sul1 is the major sulfonamide resistance gene in lagoon and river waters in the usa (pruden., 2006). it is likely that such non - culture monitoring of antibiotic resistance genes will increase in the near future (for example, pei., 2006). a culture - dependent study of smx - resistant bacteria revealed that acinetobacter is one of the major reservoirs of sul genes in asian aquatic environments (agers and petersen, 2007 ; hoa., 2011). since acinetobacter, especially a. baumannii, is known to be an important opportunistic pathogen with multi - drug resistance (vila and pachn, 2011), the risk posed by environmental a. baumannii to human health should be examined further. low concentration of smx can affect on bacterial nitrate metabolism and select bacterial species (underwood., 2011), suggesting importance of trace contamination by smx. tetracyclines are a family of broad - spectrum antibiotics that includes tetracycline, oxytetracycline (otc), chlortetracycline, doxycycline, and minocycline (chopra and roberts, 2001). these antibiotics inhibit protein synthesis in gram - positive and gram - negative bacteria by preventing the binding of aminoacyl - trna molecules to the 30s ribosomal subunit (geigenmuller and nierhaus, 1986 ; ross., 1998). owing to their broad - spectrum activity and low toxicity, tetracyclines are used in the treatment of a number of human skin and dental diseases. tetracyclines are also used in agriculture as growth promoters in farm animals and are used widely as prophylaxes in plant agriculture and aquaculture around the world (chopra and roberts, 2001), including southeast asia (thuy., 2011). the first - generation tetracyclines include otc, chlorotetracycline, and 6-demethylchlorotetracycloine, which were developed in the 1940s. minocycline and doxycycline were launched as second - generation drugs in the 1960s (thaker., 2010). a new glycylcycline derivative, tigecycline, which is active against most otc - resistant bacteria, acinetobacter, mrsa, and extended - spectrum -lactamase (esbl) producers, was licensed in 2005 (livermore, 2005). despite the variety of available analogs, otc is still commonly used in animal production and aquaculture (holmstrm., 2003 ; nonaka., 2007 ; and others), although use as growth promoters has been banned in eu until 2006 (castanon, 2007). as tetracycline - resistant bacteria, high occurrence of tetracycline - resistant salmonella from human (50%) and animals (pig 34% and poultry 76%) are reported in vietnam (vo., 2010), as well as enterococcus and e. coli (both 80% < ; dang., 2011). similar results are known in thailand, e.g., chicken (42%) and chicken meat (45%), and pork (11%) and pork meat (20% ; ogasawara., 2008). tetracycline resistance genes, tet series, from the resistant bacteria have been well - studied (roberts, 2005 ; and others). studies have indicated that some tet genes are persistent in aquaculture site without selective pressure (tamminen., 2011), pristine environments and in animals (gilliver., 1999 ; rahman. tracking of tet genes in aquatic environments, including pristine areas, has been examined in the usa (pruden., 2006 ; storteboom., 2010a, b), japan (kim., 2004 ; nonaka., 2007), and other countries (zhang and zhang, 2011) ; however, similar research in indochina aquatic environments is limited (kobayashi., 2007a ; suzuki., 2008) monitoring and phylogenetic analyses are needed if we are to obtain a thorough understanding of the origin and spread dynamics of tet genes. kobayashi. (2007a) detected tet(m), tet(s), and tet(w) genes throughout the mekong river delta. they found that tet(s) and tet(w) have only one genotype each, while tet(m) has at least two genotypes. one tet(m) genotype is identical to the gene encoded in various plasmids and transposons of gram - positive and gram - negative bacteria, and another is similar to a gene encoded in tn1545 of enterococcus faecalis (99% identity in pcr product, 170 bp/171 bp). since the two types could be found in the same sample, it was assumed that more than one source of the gene exists. this hypothesis was partly confirmed by microbial diversity analysis using denatured gradient gel electrophoresis analysis, which indicated a positive relationship between the shannon index (h) value and the tet gene detection- and otc - resistant bacteria occurrence - rates across a wide area, ranging from the mekong river and tonle sap lake, cambodia to the south china sea (suzuki., 2008). gene exchange and horizontal transfer among various bacterial species in natural environments have been demonstrated (smets and barkay, 2005). ribosomal protection protein (rpp) genes, including tet(m), tet(s), and tet(w), are transferred among bacteria (chopra and roberts, 2001), and this phenomenon was experimentally confirmed using combinations of marine bacteria (gene donors) and e. coli (neela., 2009). (2007b), which holds that the rpp genes were derived through duplication and divergence of an ancient gtpase before the divergence of the three domains. the rpps may have originally provided ribosomal protection against other chemical substances in the environment. it is known that exposing microbial assemblages to one toxicant can result in indirect selection for bacteria with resistance to multiple, chemically unrelated toxicants (baker - austin., 2006 ; baker., 2006). for example, exposure to cd, ni, ampicillin, and tetracycline significantly increases the frequency of bacterial resistance to multiple, chemically unrelated metals and antibiotics (stepanauskas., 2006). metals and antibiotics are known not only for being associated to similar efflux pumps, but also for inducing co - resistance (baker - austin. aquatic environments in indochina are highly contaminated with many kinds of persistent organic pollutants, metals (suzuki and takada, 2009), and antibiotics (managaki., environmental bacteria can acquire drug resistance naturally over time as well as through horizontal gene transfer. both transferable paralogous resistance genes and canonical resistance genes might be present in natural environments. from the viewpoint of both drug resistance and evolutionary biology, rpp genes are thus of considerable interest (kobayashi., 2007b). indochina aquatic environments are particularly vulnerable to the development of antibiotic - resistant bacteria due to pollution with antibiotics and other chemicals in the absence of adequate wastewater treatment systems. recent important findings concerning antibiotic resistance are as follows : (1) sub - lethal concentrations of antibiotics accelerate the development of antibiotic resistance (yeh., 2009 ; gullberg., 2010), and (2) chemicals other than antibiotics can promote development of antibiotic resistance (alonso. both of these scenarios are suspected to occur in natural environments, especially in asian countries. correlation between the number of antibiotic drugs detected and the occurrence of multi - drug - resistant bacteria in vietnam was found (hoa., 2011), indicating that multi - drug contamination is almost certain to result in an increase in the prevalence of multi - drug - resistant bacteria in aquatic environments. it is important to note that contamination with various antibiotics correlates strongly with induction of multi - drug resistance, even if the contaminant concentration is low. multi - drug resistance is a serious issue, particularly in asia, and is likely to become of even greater concern in the future. furthermore, contamination of antibiotics with trace concentrations can alter microbial ecosystem in terms of metabolism and diversity (underwood., 2011), indicating the importance to consider unexpectedly effect than antimicrobial resistance. there is still a considerable gap in knowledge regarding the environmental chemistry and microbiology in the environment. the authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest. | southeast asia has become the center of rapid industrial development and economic growth. however, this growth has far outpaced investment in public infrastructure, leading to the unregulated release of many pollutants, including wastewater - related contaminants such as antibiotics. antibiotics are of major concern because they can easily be released into the environment from numerous sources, and can subsequently induce development of antibiotic - resistant bacteria. recent studies have shown that for some categories of drugs this source - to - environment antibiotic resistance relationship is more complex. this review summarizes current understanding regarding the presence of quinolones, sulfonamides, and tetracyclines in aquatic environments of indochina and the prevalence of bacteria resistant to them. several noteworthy findings are discussed : (1) quinolone contamination and the occurrence of quinolone resistance are not correlated ; (2) occurrence of the sul sulfonamide resistance gene varies geographically ; and (3) microbial diversity might be related to the rate of oxytetracycline resistance. |
there is a growing body of evidence that the endocrine, nutritional and metabolic milieu during the fetal period may have lifelong programming effects.[14 ] therefore, it is possible to propose that newborns of the women with polycystic ovary syndrome (pcos) are exposed to an abnormal metabolic milieu during fetal life, and consequently to chronic diseases in later life. based on national institute of health (nih) criteria, its prevalence is 7% among women of reproductive age in our community in iran. it is suggested that an insulin resistance and compensa - tory hyperinsulinemia are key pathologic factors in pcos.[710 ] this disorder appears to be associated with an increased risk of metabolic alterations including an insulin resistance, type ii diabetes mellitus, and dyslipidemia. thus, women with pcos may be at risk for pregnancy complications such as gestational diabetes and hypertension. an insulin may act directly and/or indirectly through the pituitary, to stimulate an ovarian androgen production. serum levels of the androgens may be elevated. the free testosterone level is thought to be the best measure, with elevated levels found in most of pcos patients.[1214 ] this study aimed to assess the metabolic parameters and androgen concentration in the cord blood of newborns, of mothers with pcos in comparison with controls. this cross - sectional study was conducted in 2010 - 2011 in isfahan, iran. the study was approved by research and ethics committee, faculty of medicine, isfahan university of medical sciences, isfahan, iran (project number:289181). the study comprised 80 mother - neonate pairs including 40 newborns from the mothers with pcos, and an equal number of newborns from healthy mothers, referred to the same hospital. diagnosis of pcos was made according to the criteria of national institutes of health (nih), i.e. chronic olygomenorrhea or amenorrhea and hirsutism or serum testosterone concentration of > 0.6 ng / ml and/or free androgen index (fai) > 5.0, androstenedione concentration > 3.0 ng / ml. those patients with hyperprolactinemia, androgen secreting neoplasms, cushing 's syndrome and late - onset 21- hydroxylase deficiency and thyroid disease were not recruited. for control group, we selected 40 healthy women with singleton pregnancy and history of regular menstrual cycles ; without hirsutism, any other manifestations of hyperandrogenism, galactorrhea, thyroid dysfunction, gestational diabetes, hypertension, and history of any chronic medication use. they were matched with the pco group in terms of age, socio - economic levels and body mass index (bmi). it is suggested that the serum lipid levels differ in during vaginal delivery from those during elective cesarean section, and it may be a consequence of elevated glucocorticoid activity. newborns with preterm delivery, malformation or genetic disorders were not included into the study. after delivery, physical examination of newborns was performed by a pediatrician ; weight, length and head circumference were measured by calibrated instruments and under standard protocols. we collected umbilical mixed arterial - venous cord blood immediately after delivery, and were centrifuged, serum was kept frozen at -70c until analysis. serum insulin, triglycerides (tg), cholesterol, high density lipoprotein (hdl) cholesterol and low density lipoprotein cholesterol (ldl - c), total testosterone, free testosterone and dehydroepiandrosterone sulfate were measured. cord blood lipid profile was determined by standard colorimetric assays (pars azmoon, iran), serum insulin and testosterone were determined by chemiluminescent immunoassay (diasorin, saluggia, italy). the student 's t or mann - whitney u - tests were used, when applicable. this cross - sectional study was conducted in 2010 - 2011 in isfahan, iran. the study was approved by research and ethics committee, faculty of medicine, isfahan university of medical sciences, isfahan, iran (project number:289181). the study comprised 80 mother - neonate pairs including 40 newborns from the mothers with pcos, and an equal number of newborns from healthy mothers, referred to the same hospital. diagnosis of pcos was made according to the criteria of national institutes of health (nih), i.e. chronic olygomenorrhea or amenorrhea and hirsutism or serum testosterone concentration of > 0.6 ng / ml and/or free androgen index (fai) > 5.0, androstenedione concentration > 3.0 ng / ml. those patients with hyperprolactinemia, androgen secreting neoplasms, cushing 's syndrome and late - onset 21- hydroxylase deficiency and thyroid disease were not recruited. for control group, we selected 40 healthy women with singleton pregnancy and history of regular menstrual cycles ; without hirsutism, any other manifestations of hyperandrogenism, galactorrhea, thyroid dysfunction, gestational diabetes, hypertension, and history of any chronic medication use. they were matched with the pco group in terms of age, socio - economic levels and body mass index (bmi). it is suggested that the serum lipid levels differ in during vaginal delivery from those during elective cesarean section, and it may be a consequence of elevated glucocorticoid activity. newborns with preterm delivery, malformation or genetic disorders were not included into the study. after delivery, physical examination of newborns was performed by a pediatrician ; weight, length and head circumference were measured by calibrated instruments and under standard protocols. we collected umbilical mixed arterial - venous cord blood immediately after delivery, and were centrifuged, serum was kept frozen at -70c until analysis. serum insulin, triglycerides (tg), cholesterol, high density lipoprotein (hdl) cholesterol and low density lipoprotein cholesterol (ldl - c), total testosterone, free testosterone and dehydroepiandrosterone sulfate were measured. cord blood lipid profile was determined by standard colorimetric assays (pars azmoon, iran), serum insulin and testosterone were determined by chemiluminescent immunoassay (diasorin, saluggia, italy). after delivery, physical examination of newborns was performed by a pediatrician ; weight, length and head circumference were measured by calibrated instruments and under standard protocols. we collected umbilical mixed arterial - venous cord blood immediately after delivery, and were centrifuged, serum was kept frozen at -70c until analysis. serum insulin, triglycerides (tg), cholesterol, high density lipoprotein (hdl) cholesterol and low density lipoprotein cholesterol (ldl - c), total testosterone, free testosterone and dehydroepiandrosterone sulfate were measured. cord blood lipid profile was determined by standard colorimetric assays (pars azmoon, iran), serum insulin and testosterone were determined by chemiluminescent immunoassay (diasorin, saluggia, italy). data were analyzed by spss software version 15.0 (spss inc., chicago, il. the student 's t or mann - whitney u - tests were used, when applicable. the clinical characteristics of the pcos and control groups are presented in table 1. according to the study design, the age and the initial bmi of the mothers were not significantly different between groups. the mean weight gain during pregnancy was higher in women with pcos than in controls (16.02 4.39 vs. 9.10 2.20 kg, respectively, p < 0.0001). characteristcs of pregnant women with pcos and controls table 2 presents the clinical characteristics of newborns of both the groups studied. the mean birth weight of newborns of mothers with pcos was lower compared with controls (2905.25 415.59 vs. 3223.25 425.02 grams, respectively, p = 0.001). as presented in table 3, mean tg and ldl - c levels were lower in cord blood of newborns born from pcos women than in controls (p = 0.001), whereas testosterone was higher in cord blood of newborns of pcos women than in controls (p = 0.0001). clinical characteristics of newborns of pcos mothers and controls metabolic parameters and androgen concentration in cord blood of pcos mothers and controls the birth weight of newborns of pcos women had a weak negative correlation with mother 's bmi (r = -0.29, p = 0.03), but the corresponding figure was positive in controls (r = 0.33, p = 0.01). moreover, the birth weight in newborns of pcos mothers was negatively correlated to free testosterone of the cord blood (r = -0.26, p = 0.04). we found that the cord blood ldl - c and tg mean levels were significantly lower in pcos than in control group ; whereas the corresponding figure was not significantly different for the mean insulin, total - cholesterol and hdl - c. it is well - documented that an intrauterine environment and fetal programming can have long - term impact on chronic diseases in later life.[1416 ] in cord blood, total cholesterol level is lower than in adults, with a relatively higher proportion of hdl - c. in addition to genetic factors, ethnic differences, gestational age, fetal size, and mode of delivery influencing the composition of cord blood lipoproteins in normal pregnancies.[1720 ] fetal metabolism changes during pregnancy pathologies, for instance, while fat deposit is exaggerated in gestational diabetes, it is limited in fetal growth restriction. limited experience exists about the metabolic changes in cord blood of neonates of pcos women. the findings of our study on an alteration in the fetal lipid profile may be due to the changes in transplacental transport, which may be an appropriate physiological response to an adverse in utero environment in pcos mothers. however, a study in chile did not confirm the changes in the cord blood lipid profile of pcos women. the difference in the findings of these two studies might be because of the ethnic differences in cord blood lipid profile, and in part because of the mode of delivery, because we had recruited only those mothers who underwent elective cesarean section. in view of increasing evidence about fetal programming of chronic non - communicable diseases, the factors influencing cord blood lipids of pcos mothers are suggested as an important area for further research. in our study, androgen concentration was significantly higher in the cord blood of pcos women than in controls. women with pcos have a significant increased androgen concentration, which would provide a placenta source of androgen to the fetus, and might have a long - term impact. a recent experimental study showed that elevated plasma maternal testosterone levels may cause low birth weight and then a rapid catch - up growth and hypertension in female offspring. the high testosterone level may be associated with decreased activity and expression of enos, which may alter endothelium - dependent vascular responses. in our study, the elevated testosterone levels in cord blood of newborns of pcos mothers may be a predictor of endothelial dysfunction and high blood pressure in the future of these infants ; this hypothesis should be verified in long - term longitudinal studies. in the present study, although weight gain during pregnancy was higher in women with pcos than in controls, the birth weight of their offspring was significantly lower than in controls. this may be because of the fetal exposure to elevated testosterone levels, as documented by some experimental studies.[2527 ] a growing body of evidence supports the fetal programming of adult diseases and the crucial role of intrauterine growth retardation in this regard.[2832 ] therefore, the lower birth weight of pcos women 's offspring may increase the risk of chronic non - communicable diseases in later life. the beneficial effects of metformin use during pregnancy on reducing maternal complications are documented in some studies ; however, the possible adverse effects has limited its use during pregnancy. it can be suggested that metformin use by pcos pregnant women may also have long - term beneficial effects for their offspring ; its safety should be confirmed in longitudinal studies. in addition to favorable effects for women, controlling pcos may have long - term effects for their offspring in terms of primordial prevention of chronic non - communicable diseases. the main limitation of this study is its cross - section nature ; therefore, the cause - effect can not be assessed. the strength is the study novelty and adding information to the limited experience in this field. the main limitation of this study is its cross - section nature ; therefore, the cause - effect can not be assessed. the strength is the study novelty and adding information to the limited experience in this field. the metabolic aberration and hyperandrogenemia in pcos might influence fetal serum lipid and birth weight. these disorders may be caused by an exposure to elevated testosterone level during fetal life. the offspring of pcos women may be at higher risk for chronic diseases in later life. | background : this study aimed to assess the metabolic parameters and androgen concentration in the cord blood of newborns of mothers with polycystic ovary syndrome (pcos) in comparison with controls.materials and methods : this cross - sectional study was conducted in 2010 - 2011 in isfahan, iran. biochemical tests were conducted on 40 infants, born from singleton pregnancies in women with pcos and an equal number of controls.results:the mean weight gain during pregnancy was higher in women with pcos than in controls (16.02 4.39 vs. 9.10 2.20 kg, respectively, p < 0.0001). the mean birth weight was lower in newborns of mothers with pcos than in controls (2905.25 415.59 vs. 3223.25 425.02 vs. grams, respectively, p = 0.001). the mean testosterone was higher in cord blood of newborns of pcos women than in controls (5.58 3.20 vs. 2.28 0.62 pg / ml, p < 0.0001). triglycerides and ldl - c were lower in cord blood of newborns, born from pcos women than in controls (p = 0.001). the birth weight of the newborns of pcos mothers was negatively correlated to free testosterone of cord blood (r = -0. 26, p = 0.04).conclusion : the metabolic aberration in pcos might influence fetal birth weight and cord blood lipid profile. these disorders may be caused by an exposure to elevated testosterone level during fetal life. the offspring of pcos women may be at higher risk for chronic diseases in later life. the clinical impact of our findings should be confirmed in future longitudinal studies. |
white sponge nevus (wsn) is a rare autosomal dominant genodermatosis affecting the oral mucosa in the majority of the cases. other less frequently affected sites include the nasal, esophageal, rectal and vaginal mucosa. wsn was first reported by hyde in 1909, and cannon coined the term white sponge nevus in 1935. a defect in the normal keratinization process of the oral mucosal epithelium results in this disorder. the genes responsible for production of cytokeratins (cks) 4 and 13, which are specifically expressed in the spinous cell layer of oral mucosal epithelium, have been found to be mutated in this disorder. this genetic disorder affects about one in 200,000 people, and the condition often shows variable expressivity and irregular penetrance. a 13-year - old female child reported to the outpatient department of the dental college, with a chief complaint of pain in her mandibular right posterior region. intraoral examination revealed grossly carious tooth # 46, which was tender on percussion and had periapical radiolucency, consistent with periapical inflammatory disease. a striking incidental finding that was also noted upon performing her intraoral examination was the presence of diffuse, soft, thickened white plaques with a corrugated surface affecting the buccal mucosa bilaterally. the plaques extended from the retro - commissural area anteriorly to retromolar region posteriorly and also involved the soft palate [figure 1 ]. lesions were also noticed on the dorsal surface of the tongue [figure 2 ], lower labial mucosa and even the mucosa of the hard palate. the patient was referred to the departments of ophthalmology and obstetrics / gynecology to rule out the presence of any conjunctival and genital lesion, respectively. a cytologic preparation from the lesion failed to reveal any fungal hyphae when stained with periodic acid - schiff (pas) method. no other contributing factors, such as tobacco use or chemical burn, could be elicited. a biopsy was advised to rule out other lesions. clinical image showing diffuse, soft and thickened white plaque with corrugated surface on left buccal mucosa clinical image showing lesions on the dorsal surface tongue, right buccal mucosa and parts of the palatal mucosa the patient 's past history revealed that the lesions were present since early childhood. the family history revealed that similar lesions were present in the father (aged 56 years) and the eldest brother (aged 31 years) of the four siblings. the father had bilateral lesions on buccal mucosa [figure 3 ] while the brother had scattered lesions on the buccal mucosa bilaterally [figure 4 ]. clinical image showing lesions on right buccal mucosa of the father clinical image showing scattered lesions on right buccal mucosa of the brother histopathologic examination of the lesional tissue revealed hyperplastic keratinized squamous epithelium, with prominent hyperparakeratosis, marked acanthosis and spongiosis [figure 5 ]. cells showing clearing of the cytoplasm with perinuclear eosinophilic condensation, a characteristic feature of wsn, were noticed [figures 6 and 7 ]. based on the clinical features, past history, family history and the characteristic histopathological findings, the lesions were diagnosed as wsn. histopathological picture showing hyperplastic keratinized squamous epithelium with prominent hyperparakeratosis, marked acanthosis and spongiosis (h&e stain, 50) histopathological picture showing cells with clearing of the cytoplasm and perinuclear eosinophilic condensation (h&e stain, 200) high power view of the section shows cells with clearing of the cytoplasm and perinuclear eosinophilic condensation (h&e stain, 400) wsn is a rare hereditary disease that is transmitted as an autosomal dominant disorder. in the present case, the disease was transmitted from the affected father to two of his four children, consistent with an autosomal dominant mode of inheritance. historically, this condition has also appeared in the medical literature under a variety of names, including cannon disease, familial white folded hypertrophy of the mucous membranes, hereditary leukokeratosis, white gingivostomatitis and exfoliative leukoedema.. both of ck 4 and ck 13 may be affected, or no abnormalities may be detected in the ck 4 gene as reported by martelli. described a new mutation in ck 4 genes and an amino acid insertion in 1a alpha helical domain of ck 4 that was responsible for the condition in some individuals. disruption of the stability of the keratin filament as a result of mutation in the 2b domain of ck 4 gene has also been described in an affected taiwanese patient by chao. several similar investigations have been carried out to ascertain the specific genetic mutation in ck 4 and ck 13 which is responsible for the development of wsn. recently, cai. found a point mutation in the ck 13 gene that may cause abnormal degradation of ck 13 protein which could probably be associated with abnormal ubiquitination process. the lesions of wsn usually appear at birth or in early childhood ; however, sometimes, the condition develops during adolescence. in most instances, the lesions are seen bilaterally as symmetrical, thickened, white, corrugated or velvety, diffuse plaques that affect the buccal mucosa as observed in the present case. the affected mucosa appears folded with a soft or spongy texture and a peculiar white opalescent hue. ragged white areas may also be present that can be removed sometimes by gentle rubbing, without any associated bleeding. the other less common intraoral sites of involvement include the tongue, labial mucosa, soft palate, alveolar mucosa and floor of the mouth. the clinical expression of the lesions, such as size of the plaques, the affected areas and their distribution, may change with the time. all the three cases in the present report had bilateral lesions of the buccal mucosa. extraoral mucosal sites, such as the nasal, esophageal, laryngeal and anogenital mucosa, also may be affected in some cases though less common. the plaques in our patient were confined to the oral mucosa and were not found to occur elsewhere. prominent hyperparakeratosis and marked acanthosis with clearing of the cytoplasm of the cells in the spinous layer are common features. an eosinophilic perinuclear condensation of the cells in the superficial layers of the epithelium may be seen as observed in the present case. this feature is unique to wsn, and this eosinophilic material has been ultrastructurally identified as tangled masses of keratin tonofilaments. in many cases, an exfoliative cytologic preparation that is stained with the papanicolaou method will show the eosinophilic perinuclear condensations more readily than histopathological sections will. wsn may superficially appear clinically similar to several other oral white lesions that have varied clinical behaviors and treatment protocols. it is important that the condition is distinguished from the other entities to avoid unnecessary treatment. however, exfoliative cytologic preparations or biopsy can aid in the diagnosis and may be performed to rule out other lesions. a positive family history and histopathological or cytopathological features can distinguish wsn from the other lesions. wsn may resemble a wide spectrum of oral disorders that may present as diffuse white plaques. hereditary benign intraepithelial dyskeratosis should be considered in the differential diagnosis which can be excluded from the absence of bilateral limbal conjunctival plaques. leukoplakia though not a reasonable consideration has been discussed by some reports in differential diagnosis of wsn. however, leukoplakia particularly, verrucous leukoplakia and proliferative verrucous leukoplakia, will have sharply defined margins in at least some areas compared to diffuse and blending margins of wsn. further, a negative history of tobacco use, age of onset of the lesions and histopathological features rule out leukoplakia. hyperplastic candidiasis, plaque type lichen planus and lupus erythematosus can be considered if wsn lesions are mild and not diffuse as in case 2 and 3. however, the latter two lesions typically have a few areas of striae formation at the periphery of the white plaques. wsn on the tongue rarely can be mistaken for syphilitic glossitis which can be ruled out by history and symptoms. pachyonychia congenita, darier 's disease and dyskeratosis congenita can be ruled out by characteristic nail and skin lesions. rare differentials include chronic cheek biting, tobacco pouch keratosis, verrucous carcinoma and squamous cell carcinoma which can be excluded from the history and unilateral clinical presentation as well as characteristic histopathological features. in case of suspicion of infection by candida albicans, wsn can have superimposed candida infection, which may cause it to be symptomatic at times. no treatment is required since wsn is a harmless condition with no potential for malignant transformation. no treatment was done for the cases as none of them had any symptoms or clinical complaints. various attempts to reduce the clinical presentation of wsn have been made but without any success. these include vitamins (beta - carotene, local applications of retinoic acid), antihistamines, tetracycline mouth rinses, antibiotics (penicillin, azithromycin) and laser ablation. recently, with the report of new cases of wsn with associated mutations, gene - based diagnosis and gene therapy for wsn may become available in the near future and could provide a reference and instruction for the treatment of other keratin - associated diseases. in conclusion, this case report is presented for its rarity and also for the striking resemblance of the lesions to other lesions that present themselves more commonly in the oral cavity. | white sponge nevus (wsn) is an interesting hereditary oral mucosal disorder that commonly manifests as bilaterally symmetrical, thickened white, corrugated or velvety, diffuse plaques that predominantly affects the buccal mucosa. the lesions may develop at birth or later in childhood or adolescence. because it is asymptomatic and benign, wsn requires no treatment. recognition of this disorder is important due to its potential confusion with other lesions that may be found in the oral cavity. emphasis should be given to the early and correct diagnosis of this disorder to avoid unnecessary treatment. this report presents three affected members of a single family. |
complete formation of the root and closure of the apical foramen continues for up to 3 years following eruption of the tooth. if the pulp of young permanent teeth is damaged before the closure of the apical foramen, pulp necrosis may occur. in immature teeth, dentinal tubules are wide and allow the penetration of bacteria and their irritants. hence, root resorption occurs instantly after trauma in these teeth. root canal treatment should be done as soon as possible to inhibit the root resorption. the purpose of the apexification therapy used in nonvital immature teeth is to induce the formation of a hard tissue barrier at the root apex or the completion of apical development., synthetic apical barriers with a variety of materials have been proposed as alternatives to the traditional apexification treatment method with calcium hydroxide. mta has been suggested to create an apical plug at the root - end and helps to prevent the extrusion of the filling materials. the material consists of fine hydrophilic particles of tricalcium silicate, silicate oxide and tricalcium oxide. when mta is mixed with sterile water, it forms a colloidal gel, and its setting time is 3 - 4 hours in the presence of moisture. root canal treatment and follow - ups of three nonvital immature permanent upper central incisors are presented. a 14-year - old boy with no general health problems was referred to the faculty of dentistry of selcuk university on august 14, 2007. the patient and his mother reported that the permanent maxillary left incisor was traumatized 4 years ago when he fell down. the clinical examination revealed a labial sinus tract in the area of the upper left incisor which was accompanied by swelling. periapical radiographic examination revealed an immature tooth with a wide open apex and a radiolucent area in the apical region of the maxillary left incisor [figure 1a ]. in the clinical tests, tooth was not tender to percussion and approximate working length was established with both radiographic method and the apex locator (root zx, j morita mfq corp., the root canal was lightly mechanically cleaned using hedstroem - files under irrigation with 2.5% sodium hypochlorite (naocl ; caglayan kimya, konya, turkey). then the root canal was dried with sterile paper points and a solid mix of calcium hydroxide (sultan healthcare inc., usa) with distilled water was placed into the root canal. after placing a sterile cotton pellet, the access cavity was closed with a temporary filling material (cavit, 3 m espe, seefeld, germany). (a) a preoperative radiograph of maxillary left central incisor with an open apex in the first case of the case reports, (b) radiographic evaluation of mineral trioxide aggregate level in the first case of the case reports, (c) follow - up after 6 months of the first case of the case reports, (d) follow - up at 18 months of the first case of the case reports after a 2-week interval the sinus tract disappeared and there were no other symptoms. the calcium hydroxide dressing was removed by instrumentation and irrigation with 2.5% naocl and 17% ethylenediaminetetraacetic acid (edta ; wizard, rehber kimya san, istanbul, turkey). mta (pro - root mta, dentsply maillefer, ballaigues switzerland) was mixed according to manufacturer 's instructions and was placed with a small amalgam carrier to the canal orifice. the mta mixture was then adapted to the canal walls using a thick gutta - percha cone which was tightened 3 millimeters shorter than the working length. the correct position of the mta mixture was controlled with a periapical radiograph [figure 1b ]. a wet sterile paper point was then placed in the coronal part of the root canal and access cavity was closed with a temporary filling material for the setting of the mta. the temporary filling material and paper point was removed after two days and the set of the mta was gently tested. the rest of the canal was obturated with lateral condensation technique of the gutta - percha in association with a root canal sealer ah plus (dentsply, detrey, konstanz, germany). coronal restoration was completed with a hybrid composite resin (clearfil st, kuraray medical co., japan). the clinical follow - up at 6 months and 18 months exhibited an adequate clinical function, and absence of clinical symptoms and any sinus tract. the radiographic follow - up at six months revealed a decrease of the periapical lesion [figure 1c ], and at eighteen months showed a complete healing of the periapical radiolucency with regeneration of the periradicular tissue and new cement formation at end of the root [figure 1d ]. a 15-year - old girl presented with a buccal sinus tract accompanied by swelling in the area of the maxillary left incisor. at 8 years of age a crown fracture had occurred and it was restored with composite resin. the patient and the patient did not experience any discomfort, except for an occasional bad taste in his mouth. the tooth was asymptomatic, and the clinical examination revealed physiological mobility and slight discoloration. radiographic examination of tooth showed an immature tooth with a wide open apex and a radiolucent area at the end of the root - canal system [figure 2a ]. after removing the temporary filling material the method for the creation of an apical plug with mta mixture was applied as in case 1 [figure 2b ]. the remaining part of the root canal was filled with warm vertical condensation technique of the gutta - percha and root canal sealer, and the crown was restored with a hybrid composite resin. (a) a preoperative radiograph of maxillary left central incisor with an open apex in the second case of the case reports, (b) radiographic evaluation of mineral trioxide aggregate level in the second case of the case reports, (c) follow - up after 6 months of the second case of the case reports, (d) follow - up at 18 months of the second case of the case reports the clinical examination after 6 and 18 months showed the absence of buccal sinus tract. the periapical radiograph at 6 months revealed the reduction of the radiolucent area at the apical region [figure 2c ] and after 18 months, radiographic examination showed a further reduction of the radiolucency [figure 2d ]. a 12-year - old girl with no general health problems was referred to our clinic on march 14, 2008. the patient and her father reported that the permanent maxillary left incisor was traumatized 2 years ago when she fell down. there was a buccal sinus tract on the gingival region of the upper left incisor. the clinical examination revealed an enamel - dentin crown fracture and the pulp of the tooth was open. radiographic examination of teeth revealed an immature permanent tooth with an open apex and radiolucent lesion at the periapical area [figure 3a ]. after disinfecting the root canal with calcium hydroxide during two weeks, mta was placed to the apical part of the canal. the protocol for the creation of an apical plug with mta was implemented as in case 1. figure 3b shows the radiographic appearance of the mta filling in the apical 3 millimeters of the root. the remaining root canal filling was completed with gutta - percha and root canal sealer, with vertical condensation technique of the gutta - percha. the coronal third of the root was restored with a ribbond fiber (washington, the usa) and fluid composite (point4, kerr, bioggio, switzerland). (a) a preoperative radiograph of maxillary left central incisor with an open apex in the third case of the case reports, (b) radiographic evaluation of mineral trioxide aggregate level in the third case of the case reports, (c) follow - up at 1 year of the third case of the case reports at 1 year follow - up [figure 3c ], the sinus tract had disappeared and healing of the radiolucent area and absence of clinical symptoms was registered. a 14-year - old boy with no general health problems was referred to the faculty of dentistry of selcuk university on august 14, 2007. the patient and his mother reported that the permanent maxillary left incisor was traumatized 4 years ago when he fell down. the clinical examination revealed a labial sinus tract in the area of the upper left incisor which was accompanied by swelling. periapical radiographic examination revealed an immature tooth with a wide open apex and a radiolucent area in the apical region of the maxillary left incisor [figure 1a ]. in the clinical tests, tooth was not tender to percussion and approximate working length was established with both radiographic method and the apex locator (root zx, j morita mfq corp., the root canal was lightly mechanically cleaned using hedstroem - files under irrigation with 2.5% sodium hypochlorite (naocl ; caglayan kimya, konya, turkey). then the root canal was dried with sterile paper points and a solid mix of calcium hydroxide (sultan healthcare inc., usa) with distilled water was placed into the root canal. after placing a sterile cotton pellet, the access cavity was closed with a temporary filling material (cavit, 3 m espe, seefeld, germany). (a) a preoperative radiograph of maxillary left central incisor with an open apex in the first case of the case reports, (b) radiographic evaluation of mineral trioxide aggregate level in the first case of the case reports, (c) follow - up after 6 months of the first case of the case reports, (d) follow - up at 18 months of the first case of the case reports after a 2-week interval the sinus tract disappeared and there were no other symptoms. the calcium hydroxide dressing was removed by instrumentation and irrigation with 2.5% naocl and 17% ethylenediaminetetraacetic acid (edta ; wizard, rehber kimya san, istanbul, turkey). mta (pro - root mta, dentsply maillefer, ballaigues switzerland) was mixed according to manufacturer 's instructions and was placed with a small amalgam carrier to the canal orifice. the mta mixture was then adapted to the canal walls using a thick gutta - percha cone which was tightened 3 millimeters shorter than the working length. the correct position of the mta mixture was controlled with a periapical radiograph [figure 1b ]. a wet sterile paper point was then placed in the coronal part of the root canal and access cavity was closed with a temporary filling material for the setting of the mta. the temporary filling material and paper point was removed after two days and the set of the mta was gently tested. the rest of the canal was obturated with lateral condensation technique of the gutta - percha in association with a root canal sealer ah plus (dentsply, detrey, konstanz, germany). coronal restoration was completed with a hybrid composite resin (clearfil st, kuraray medical co., japan). the clinical follow - up at 6 months and 18 months exhibited an adequate clinical function, and absence of clinical symptoms and any sinus tract. the radiographic follow - up at six months revealed a decrease of the periapical lesion [figure 1c ], and at eighteen months showed a complete healing of the periapical radiolucency with regeneration of the periradicular tissue and new cement formation at end of the root [figure 1d ]. a 15-year - old girl presented with a buccal sinus tract accompanied by swelling in the area of the maxillary left incisor. at 8 years of age, she suffered a trauma to this area. the patient did not experience any discomfort, except for an occasional bad taste in his mouth. the tooth was asymptomatic, and the clinical examination revealed physiological mobility and slight discoloration. radiographic examination of tooth showed an immature tooth with a wide open apex and a radiolucent area at the end of the root - canal system [figure 2a ]. after removing the temporary filling material the method for the creation of an apical plug with mta mixture was applied as in case 1 [figure 2b ]. the remaining part of the root canal was filled with warm vertical condensation technique of the gutta - percha and root canal sealer, and the crown was restored with a hybrid composite resin. (a) a preoperative radiograph of maxillary left central incisor with an open apex in the second case of the case reports, (b) radiographic evaluation of mineral trioxide aggregate level in the second case of the case reports, (c) follow - up after 6 months of the second case of the case reports, (d) follow - up at 18 months of the second case of the case reports the clinical examination after 6 and 18 months showed the absence of buccal sinus tract. the periapical radiograph at 6 months revealed the reduction of the radiolucent area at the apical region [figure 2c ] and after 18 months, radiographic examination showed a further reduction of the radiolucency [figure 2d ]. a 12-year - old girl with no general health problems was referred to our clinic on march 14, 2008. the patient and her father reported that the permanent maxillary left incisor was traumatized 2 years ago when she fell down. there was a buccal sinus tract on the gingival region of the upper left incisor. the clinical examination revealed an enamel - dentin crown fracture and the pulp of the tooth was open. radiographic examination of teeth revealed an immature permanent tooth with an open apex and radiolucent lesion at the periapical area [figure 3a ]. after disinfecting the root canal with calcium hydroxide during two weeks, mta was placed to the apical part of the canal. the protocol for the creation of an apical plug with mta was implemented as in case 1. figure 3b shows the radiographic appearance of the mta filling in the apical 3 millimeters of the root. the remaining root canal filling was completed with gutta - percha and root canal sealer, with vertical condensation technique of the gutta - percha. the coronal third of the root was restored with a ribbond fiber (washington, the usa) and fluid composite (point4, kerr, bioggio, switzerland). (a) a preoperative radiograph of maxillary left central incisor with an open apex in the third case of the case reports, (b) radiographic evaluation of mineral trioxide aggregate level in the third case of the case reports, (c) follow - up at 1 year of the third case of the case reports at 1 year follow - up [figure 3c ], the sinus tract had disappeared and healing of the radiolucent area and absence of clinical symptoms was registered. it has had a high success rate when used for apexification treatment in several studies.[68 ] however, there are some disadvantages of this material. one of them is that the treatment requires a very long time which is from 3 to 21 months. the required time is dependent on the diameter of the open apex, the rate of tooth displacement and the tooth repositioning method after trauma. during a long period of time the success rate decreases by 10% in teeth with poor coronal filling. hence, performing a permanent treatment is better, as it avoids the reinfection of the root canal. also there is possibility of fracture of the weakened teeth. after leaving calcium hydroxide in the root for more than 30 days, the fracture resistance reduces. the patient 's motivation is also one of the critical factors. multiple appointments and esthetic problems may be a reason of patient complaint in the calcium hydroxide apexification treatment. in recent times, creating mta apical plug in one visit is suggested for the treatment of the nonvital immature permanent teeth as an alternative to long - term apexification treatment. mta is a material which has less leakage, better antibacterial properties, high marginal adaptation, short setting time (~ 4 hours), a ph of 12.5 and is more biocompatible. mta can be used in teeth with pulp necrosis and inflamed periapical lesions because it may set in moist environments. in mta plug technique, root canals must be disinfected with temporary calcium hydroxide dressing before placing mta for two weeks. this is because performing chemo - mechanical preparation alone is not effective for the complete elimination of microorganisms. the clinician should not push mta to the apical tissues for the treatment to be successful. using surgical microscope after calcium hydroxide medication, we placed mta to the apical parts of the canals with a fitted gutta - percha cone under radiographic evaluation. in erdem and sepet 's clinical report, one of the cases in which mta was extruded did not exhibit complete healing. according to their opinion reasons of the failure are width and unusual shape of the canal, difficulties at disinfecting the canal and dentinal tubules and the porous structure of the apical calcified barrier. although mta was extruded in our third case, healing of the periradicular area of the left central incisor can be seen at 1 year follow up on the radiograph [figure 3c ]. in these three cases, 6 months, 1 year and 18 months radiographic and clinical follow - ups revealed the supreme healing of the apical lesions and the regeneration of periradicular tissues. the clinical examination of these cases confirmed the suitability of this method and our results are similar to other cases where the mta plug technique was used for the endodontic treatment of nonvital immature teeth with an open apex. mta apical plug method is effective because of the less requirement of treatment time, appointments and radiographs, and better fracture resistance after the treatment of nonvital immature permanent teeth. | treatment of nonvital immature permanent teeth with calcium - hydroxide is associated with some difficulties such as weakened tooth fracture, root canal reinfection and long treatment time. mineral trioxide aggregate (mta) apical plug method is an alternative treatment option for open apices, and has gained popularity in the recent times. in this case report, we have attempted to present successful treatment of three maxillary incisors with open apices and periapical lesions with mta. after preparing the access cavity, the working length was determined. the root canals were irrigated with 2.5% sodium hypochlorite (naocl) and disinfected with calcium - hydroxide for two weeks. mta was then placed in the apical 3 millimeters of the root canal. the remaining part of the root canal was filled with gutta - percha and the coronal restoration was finished with composite resin. after six months the radiographic examination showed a decrease of periapical lesions. at a 1-year and 18-months follow up, radiological and clinical successful healing of the incisor teeth was seen. mta seems as an effective material for the apical plug method for the treatment of nonvital immature permanent teeth with open apices. |
one of the most daunting complications of cardiac catheterization is a cerebrovascular event (cve). stroke after cardiac catheterization procedures occurs mostly in older patients with vascular comorbidities, undergoing complicated invasive procedures. the incidence of stroke following percutaneous coronary intervention (pci) has been variably reported between 0.3% and 0.4%. the aim of our study was to assess the reallife incidence, etiology, risk factors, and temporal trends of cardiac catheterizationrelated acute cves (ischemic stroke ; transient ischemic attack ; intracerebral hemorrhage) in a large cohort of patients treated in a single center. all authors take responsibility for all aspects of the reliability and freedom from bias of the data presented and their discussed interpretation. the study population consists of all patients undergoing coronary angiography and/or a coronary intervention over the period 19922011 at the shaare zedek medical center, jerusalem, israel. all noncoronary procedures were excluded, particularly peripheral interventions (including carotid), structural heart procedures, and right heart catheterizations. the data were derived from the electronic medical record of the cardiology department, based on clicks software (roshtov software industries ltd). this record contains data including demographics, diagnoses, risk factors, angiographic and procedural details, medications, hospitalization course, ancillary tests, and outpatient followup for all patients undergoing cardiac catheterization. data collection was performed using computerized queries, retrieving all angiographic and procedural details and discharge summaries. cve patients were identified by searching for any of the terms cerebrovascular accident or c.v.a. or t.i.a. or stroke or intracranial hemorrhage in the diagnoses of discharge summaries and in the complications recorded in the angiographic summaries. in addition hospitalization courses after the procedure were searched for keywords such as neurologic consultation, ct referral, weakness or paralysis of one side of the body, all files with one of these diagnoses or keywords were reviewed by an experienced neurologist (ilk), including computed tomography (ct) scans. events with an onset time within 24 hours from procedure completion were included and defined as cve group. due to the specific local health fund system, readmissions of patients discharged in less than 24 hours from the index procedure the study was approved by the ethics committee of the shaare zedek medical center, jerusalem, israel. as the considered risk period was 24 hours, the assessment unit used was procedural days. if a patient underwent both a diagnostic and an interventional procedure within the same 24hour period, this was considered an interventional procedural day. stroke was diagnosed according to world health organization criteria, which defines a stroke as a focal deficit that lasts for more than 24 hours. transient ischemic attack (tia) was defined as focal neurological signs lasting fewer than 24 hours. ischemic strokes (is) and intracerebral hemorrhages (ich) were differentiated by the findings on brain ct, performed between day 1 and day 2 after the onset of the stroke. anatomical localization of stroke was performed based upon clinical subtypes of ischemic stroke using the oxfordshire community stroke project classification. onset time was defined as the first appearance of abnormal signs that were noticed by the treating team during the cardiac catheterization or after, while hospitalized in the cardiology department. the principal outcome of this study was periprocedural cve (cve that occurred within 24 hours of the procedure). the following explanatory variables were assessed : (1) patient demographics : gender, ethnicity, and age ; (2) clinical characteristics and risk factors : hypertension, diabetes mellitus, smoker, hyperlipidemia, prior myocardial infarction (mi), prior coronary arteries bypass surgery (cabg), prior stroke, renal disease, peripheral vascular disease (pvd), previously diagnosed carotid artery disease, atrial fibrillation (af), and acute coronary syndrome (acs) ; (3) procedural characteristics and findings : puncture site, performance of ventriculography, percutaneous coronary intervention (pci), stent implantation, drug eluting stent (des), number of catheters, use of eptifibatide or bivalirudin, vessel treated, triple vessel disease, bifurcation lesion, chronic lesion, and coronary artery thrombus. categorical variables were compared using chisquare test or fisher exact test and continuous variables using unpaired student t test. a multivariate forward, stepwise logistic regression analysis was performed to determine independent predictors for periprocedural stroke. the criterion for entrance into the model was a univariate probability value of p0.10 for removal from the model. the discriminatory power of the model was examined using c statistics, whereas c value ranges from 0.5 (the model 's predictions are not better than chance) to 1.0 (the model always assigns higher probabilities to correct cases than to incorrect cases). c values of 0.7 to 0.8 are considered to show acceptable discrimination, values of 0.8 to 0.9 to indicate excellent discrimination, and values of 0.9 to show outstanding discrimination. the statistical tests were 2 sided. a p value 0.10 for removal from the model. the discriminatory power of the model was examined using c statistics, whereas c value ranges from 0.5 (the model 's predictions are not better than chance) to 1.0 (the model always assigns higher probabilities to correct cases than to incorrect cases). c values of 0.7 to 0.8 are considered to show acceptable discrimination, values of 0.8 to 0.9 to indicate excellent discrimination, and values of 0.9 to show outstanding discrimination. the statistical tests were 2 sided. a p value < 0.05 was considered as statistically significant. analyses were carried out using spss version 15.0 statistical package (spss, inc). over the study period 43 350 procedures were performed on 30 907 procedure days. on these days, 17 150 diagnostic and 13 757 interventional procedures (comprising 1314 interventional only and 12 443 combined procedures) were performed. from this total cohort, 110 patient admission files were individually assessed based upon the predetermined keywords in the search. fifty inhospital cves were identified. of these, 1 occurred prior to the index catheterization and 2 others appeared to not be related to the index procedure and were beyond the predetermined 24hour window. fortyseven (0.15%) procedurerelated cves were identified with 37 ischemic strokes (is), 6 tias, 3 ich intracerebral hemorrhages, and 1 undetermined stroke (ct not performed) (figure 1). cve indicates cerebrovascular event ; ich, intracerebral hemorrhage ; tia, transient ischemic attack. twentyseven ischemic strokes were located in the anterior circulation (right hemisphere 15 ; left hemisphere 12) while 10 strokes were within the posterior circulation. of the 47 cves occurring in the entire cohort, 31 occurred related to a pci and 16 related to a diagnostic coronary angiogram. the cve rate for the entire cohort was 0.15%, while the rates for pci and diagnostic coronary angiography were 0.23% and 0.09%, respectively. baseline patient and procedural characteristics of the patients undergoing cve and those of the remaining population are presented in table 1. when compared with patients not suffering a cve, those experiencing cves were older (71.311.3 years versus 63.311.8 years, p<0.0001), more likely to suffer from hypertension (74% versus 51%, p=0.008), had prediagnosed carotid artery disease (6% versus 1%, p=0.002), had suffered a previous stroke (51% versus 5%, p<0.0001), had prior or current af (15% versus 6%, p=0.021), were admitted with acs (55% versus 35%, p=0.014), were nonsmokers (81% versus 62%, p=0.003), and were undergoing an intervention (66% versus 44% p=0.003). there was a trend to increased risk for a cve in patients with known pvd (0.34% with pvd versus 0.15% without pvd, p=0.08). no increased risk for cves was associated with female gender, ethnicity, presence of diabetes mellitus, hyperlipidemia, obesity, previous mi, prior cabg, congestive heart failure, left ventricular dysfunction, or use of intraortic balloon pump. patients ' baseline and procedural characteristics acs indicates acute coronary syndrome ; af, atrial fibrillation ; cabg, coronary artery bypass graft surgery ; cve, cerebrovascular event ; cx, circumflex ; lad, left anterior descending ; lima, left internal mammary artery ; lm, left main ; mi, myocardial infarction ; pvd, peripheral vascular disease ; rca, right coronary artery ; svg, saphenous vein graft. multiple procedural characteristics were assessed for relationships with cves (table 1). these included, but were not limited to, access site, performance of ventriculography, the number of catheters used, extent of coronary disease (single, double, or triple vessel), presence of a coronary artery thrombus, intervened vessel, chronic or bifurcation lesions, and treatment with eptifibatide or bivalirudin. at univariate analysis, the presence of coronary artery thrombus and triple vessel disease were the only procedural variables found to be significant and a trend to increased risk was found in patients treated with eptifibatide or bivalirudin. forward, stepwise logistic regression analysis was used to assess associations of all background demographics, risk factors, and procedural characteristics with catheterizationrelated cve adjusted for other significant risk factors. a total of 5 significant predictors were thus defined : prior stroke (or=15.09, 95% ci [8.11 to 28.08 ], p<0.0001), the presence of coronary arterial thrombus (or=2.79, 95% ci [1.25 to 6.22 ], p=0.012), age greater than 75 years (or=3.33, 95% ci [1.79 to 6.19 ], p<0.0001), triple vessel disease (or=2.24, 95% ci [1.20 to 4.18 ], p=0.011), and the performance of an intervention (or=2.21, 95% ci [1.12 to 4.33 ], p=0.021). this logistic regression is presented in table 2 model a. predictors for cve after cardiac catheterization : multiple logistic regression ci indicates confidence interval ; cve, cerebrovascular event ; or, odds ratio ; pci, percutaneous coronary intervention ; tvd, triple vessel disease. although in the first half of the study period the rate of cve was 0.08% and rose to 0.22% over the next 10 years, this did not achieve statistical significance. this is despite the numerical increase of strokes noted since 2005 (chisquare analysis p=0.264) (figure 2). temporal analyses of patients ' and procedural characteristics revealed significant increase rates of almost all variables found to be independent risk factors. rates of prior stroke increased from 2% to 7%, presence of thrombus rose from 4% to 10%, percent of elderly population (age over 75 years) undergoing procedure increased from 10% to 24% and finally percent of interventional procedures performed over the study period changed from 14% in 1992 to over 50% since 2005 (p<0.0001 for all) (figure 3). temporal variation of procedurerelated cve risk factors over the study period. in order to assess its impact as a possible cofounder, the year of procedure was forced into the model developed from the previous stepwise method as an additional step and referred to as model b. this further step did not reduce the strength nor the statistical significance of the independent stroke predictors that were identified in model a (table 2, model b). the c statistic was 0.866, still indicating an excellent discriminatory power of the model. all were treated with aspirin, clopidogrel, and heparin, with 2 patients treated with additional eptifibatide and 1 with bivalirudin. the first case was a 78yearold male that presented with an acute anterior wall myocardial infarction. he had no known coronary disease but had a history of paroxysmal af treated with amiodarone and had suffered an ischemic stroke 4 months prior. at catheterization he was treated with iv heparin and eptifibatide and underwent stent implantation to the midleft anterior descending (lad) artery. at the completion of the procedure, he became nonresponsive and urgent ct revealed severe left occipital intraparenchymal and subarachnoid bleeding with mass effect on the left lateral ventricle. the second patient was a 48yearold male that presented with an acute anterior wall mi. he had a past history of ischemic heart disease, hypertension, smoking, and hyperlipidemia. he was pretreated with aspirin, clopidogrel, and heparin and received intravenous (iv) eptifibitide following the diagnostic study. six hours following the procedure, he became noncommunicative and was found to have a right hemiplegia with facial palsy. urgent ct scan demonstrated a left parieto temporo hemorrhage with mass effect on the left lateral ventricle intraparenchymal and subarachnoid. twelve hours later he became bradycardic and repeat ct revealed intraventricular extension of the bleed. the third patient was a 55yearold woman with no significant past history that presented with an acute anterior wall mi. she underwent successful primary pci to lad while being treated periprocedurally with aspirin, clopidogrel, and bivalirudin. supportive therapy only was instituted and at 6month followup her vision had returned to normal. although in the first half of the study period the rate of cve was 0.08% and rose to 0.22% over the next 10 years, this did not achieve statistical significance. this is despite the numerical increase of strokes noted since 2005 (chisquare analysis p=0.264) (figure 2). temporal analyses of patients ' and procedural characteristics revealed significant increase rates of almost all variables found to be independent risk factors. rates of prior stroke increased from 2% to 7%, presence of thrombus rose from 4% to 10%, percent of elderly population (age over 75 years) undergoing procedure increased from 10% to 24% and finally percent of interventional procedures performed over the study period changed from 14% in 1992 to over 50% since 2005 (p<0.0001 for all) (figure 3). temporal variation of procedurerelated cve risk factors over the study period. in order to assess its impact as a possible cofounder, the year of procedure was forced into the model developed from the previous stepwise method as an additional step and referred to as model b. this further step did not reduce the strength nor the statistical significance of the independent stroke predictors that were identified in model a (table 2, model b). the c statistic was 0.866, still indicating an excellent discriminatory power of the model. all were treated with aspirin, clopidogrel, and heparin, with 2 patients treated with additional eptifibatide and 1 with bivalirudin. the first case was a 78yearold male that presented with an acute anterior wall myocardial infarction. he had no known coronary disease but had a history of paroxysmal af treated with amiodarone and had suffered an ischemic stroke 4 months prior. at catheterization he was treated with iv heparin and eptifibatide and underwent stent implantation to the midleft anterior descending (lad) artery. at the completion of the procedure, he became nonresponsive and urgent ct revealed severe left occipital intraparenchymal and subarachnoid bleeding with mass effect on the left lateral ventricle. the second patient was a 48yearold male that presented with an acute anterior wall mi. he had a past history of ischemic heart disease, hypertension, smoking, and hyperlipidemia. he was pretreated with aspirin, clopidogrel, and heparin and received intravenous (iv) eptifibitide following the diagnostic study. six hours following the procedure, he became noncommunicative and was found to have a right hemiplegia with facial palsy. urgent ct scan demonstrated a left parieto temporo hemorrhage with mass effect on the left lateral ventricle intraparenchymal and subarachnoid. twelve hours later he became bradycardic and repeat ct revealed intraventricular extension of the bleed. the third patient was a 55yearold woman with no significant past history that presented with an acute anterior wall mi. she underwent successful primary pci to lad while being treated periprocedurally with aspirin, clopidogrel, and bivalirudin. supportive therapy only was instituted and at 6month followup her vision had returned to normal. over the past 2 decades interventional cardiology has made enormous strides in progressing from balloon angioplasty to relatively simple lesions through early stenting with anticoagulants and subsequently antiplatelets through to drug eluting stents and multiple ancillary devices with powerful intravenous antiplatelet agents. with the progression of interventional hardware and escalation of the interventionalist 's capabilities leading to a reduction in intraprocedural and improved longterm outcomes, a concomitant change has occurred in the patient profile being treated. whereas in the initial period, relatively simple patients were treated, the lesion and patient complexity has developed such that primary pci in many centers can reach 30% of their patient load, multivessel disease and intervention is a matter of course as well as the routine treatment of octogenarians with diffuse atherosclerosis. our findings of low cve rate (0.15%) have been relatively stable over the entire study period with the benefits of improved hardware and techniques being offset by a far more challenging population as demonstrated by our temporal analysis. our principal findings demonstrate, similar to previously reported analyses, that age greater than 75 years, prior stroke and triple vessel disease all are strongly associated with a procedurerelated cve. the increased risk in this population has been attributed in part to the increased incidence of aortic plaques, particularly if mobile, that are present in this population. this has been further substantiated by the finding of atherosclerotic debris derived from the aorta in catheter aspirates. interestingly in our study we failed to find a correlation with the number of catheters used or previous cabg, both of which would have increased the amount of aortic passages and intraaortic manipulations, likely increasing stroke risk if this was the predominant mechanism. the additional 2 independent predictors that we found (undergoing an intervention and the presence of coronary artery thrombus) suggest that an alternative source for embolic material is present. in distinction to previously published analyses we have shown that the presence of an intracoronary thrombus is independently associated with a periprocedural cve. hoffman found at univariate analysis that intracoronary thrombus was more frequent in the post pci cves, however this remained only as a trend (p=0.0734) when introduced into the multivariate model. in a most recent study demonstration of significantly higher rates (1.3%) of interventionrelated cves in a primary pci population that by definition must have an elevated thrombus burden it would be extremely interesting to attempt to determine the mechanism of action of this association, particularly if the thrombus is a marker for a prothrombotic state or whether itself is the source of the subsequent embolus. unfortunately, as our assessable end point (a clinically manifest neurological event) may be delayed by several hours, making temporal association analyses potentially misleading. although it is clear that intervention represents a higher risk there were 2 specific reasons that we analyzed diagnostic studies in conjunction with the interventions. the first was that in the current environment of ad hoc intervention, the staff and patient facing a procedure should be aware of the potential cve risk with a diagnostic study alone as well as that of a followon intervention. second, following controlling for all other variables including, atherosclerotic burden as manifested by multiple features such as previously diagnosed carotid artery disease, pvd, and triple vessel disease, the intervention introduces the possibility of extraction of embolic material either associated with aspiration devices, on balloons or stent platforms. based on the or of 2.35 related to an intervention, this appears to represent a very significant mechanism of pcirelated stroke. this is supported by multiple reports of thrombi or other filling defects having been displaced to more proximal branches or other coronary arteries following withdrawal of intracoronary devices such as aspiration catheters, balloons, and atherectomy devices. interestingly the use of eptifibatide or bivalirudin was not protective, possibly due to the intracoronary extraction mechanism not being dependent on thrombus alone as well as the ability of these agents intraprocedurally to only partially reduce the load of thrombus, often with a significant residual thrombus burden. unfortunately, due to the retrospective nature of this study we were unable to reliably dissect out the exact timing of administration in the total cohort severely limiting our ability to elucidate a relationship with cves. encouragingly, despite the broad adoption of these powerful intravenous antiplatelet agents that were progressively introduced over the study period, the incidence of intracerebral hemorrhage has remained remarkably low. two of the 3 episodes were associated with the use of eptifibatide or bivalirudin, with devastating outcomes. in the third instance bivalirudin was used with a much less dramatic presentation and better outcome. when compared to publications assessing stroke incidence postcoronary intervention in the united states such as the single center experience from the washington hospital center (0.38%) and more recently the mayo clinic (0.37%), including data from the 1990s we conjecture that this may be due to the relatively early transfer from 8 and 7 french guiding catheters to a 6 french system that occurred in our center several years prior to the united states. the report from the national cardiovascular data registry that studied stroke incidence in enrolling centers between the years 20042007 found an incidence (0.22%) similar to that in our center over the entire study period. due to the relatively small number of large catheters we found no impact of catheters smaller than 6f when compared with 6f, however it should be noted that the majority of 5f guiding catheters were used in conjunction with the radial approach presenting a confounding influence. we chose to limit the cves to those occurring with 24 hours of the procedure. we assessed all inhospital cves in patients undergoing catheterizations and found an additional 3 cves in the entire population, one prior to the procedure and clearly not related. the additional 2 were postprocedure and also could not be clearly related to the procedure, although this can not be excluded. in spite of this, the impact of these 2 additional cases on our results would be negligible and so an additional analysis was not performed. this study is a singlecenter, retrospective analysis of clinically evident cves occurring within 24 hours of a coronary cardiac catheterization. in spite of this, due to the advantage of having access to all the patients ' complete records furthermore, the access to a large number of procedural characteristics not available in large multicenter registries may offset to some degree the limitation of a singlecenter analysis. the retrospective analysis of a large number of relatively standard procedures (cardiac catheterization) precludes the inclusion of clinically silent cves that would provide stronger statistical power to elucidate risk factors and potential mechanisms of action. nonetheless, the principal concern of physicians and their patients are those events that are clinically evident. the relatively small number of cves limits the ability to adequately assess subgroups with any statistical power. it further can be assumed that many subclinical or very minor events were not identified. subgroups although in themselves may be of questionable clinical relevance. in all but one instance, urgent brain imaging was performed. this has been the standard over the study period and in spite of the increasing use worldwide of mri scanning it is not routinely performed for stroke assessment in israel. moreover recent reports state that the sensitivity of dwi for the diagnosis of ischemic stroke is now estimated to be only 80% to 90%. this study is a singlecenter, retrospective analysis of clinically evident cves occurring within 24 hours of a coronary cardiac catheterization. in spite of this, due to the advantage of having access to all the patients ' complete records furthermore, the access to a large number of procedural characteristics not available in large multicenter registries may offset to some degree the limitation of a singlecenter analysis. the retrospective analysis of a large number of relatively standard procedures (cardiac catheterization) precludes the inclusion of clinically silent cves that would provide stronger statistical power to elucidate risk factors and potential mechanisms of action. nonetheless, the principal concern of physicians and their patients are those events that are clinically evident. the relatively small number of cves limits the ability to adequately assess subgroups with any statistical power. it further can be assumed that many subclinical or very minor events were not identified. subgroups although in themselves may be of questionable clinical relevance. in all but one instance, urgent brain imaging was performed. this has been the standard over the study period and in spite of the increasing use worldwide of mri scanning it is not routinely performed for stroke assessment in israel. moreover recent reports state that the sensitivity of dwi for the diagnosis of ischemic stroke is now estimated to be only 80% to 90%. in a singlecenter retrospective assessment over nearly 20 years, cves postcardiac catheterization were very rare and nearly exclusively ischemic. the independent predictors for these events were found to be, not surprisingly, the performance of an intervention and those associated with increased atherosclerotic burden, specifically older age, triple vessel disease and prior stroke. our findings however, identified an additional highrisk group with more acute coronary disease as manifest by the presence of coronary artery thrombus. | backgroundone of the most daunting complications of cardiac catheterization is a cerebrovascular event (cve). we aimed to assess the reallife incidence, etiology, and risk factors of cardiac catheterizationrelated acute cves in a large cohort of patients treated in a single center.methods and resultswe undertook a retrospective analysis of 43 350 coronary procedures performed on 30 907 procedure days over the period 19922011 and compared patient and procedural characteristics of procedures complicated by cves with the remaining cohort. cves occurred in 47 cases : 43 were ischemic, 3 intracerebral hemorrhages, and 1 undetermined. the overall cve rate was 0.15%, with percutaneous coronary intervention (pci) and diagnostic coronary angiography rates 0.23% and 0.09%, respectively. using a forward stepwise multivariate logistic regression model including patient demographic and procedural characteristics, a total of 5 significant predictors were defined : prior stroke (or=15.09, 95% ci [8.11 to 28.08 ], p 75 years (or=3.33, 95% ci [1.79 to 6.19 ], p<0.0001), triple vessel disease (or=2.24, 95% ci [1.20 to 4.18 ], p=0.011), and performance of intervention (or=2.21, 95% ci [1.12 to 4.33 ], p=0.021). an additional analysis excluded any temporal change of cve rates but demonstrated a significant increase of all highrisk patient features.conclusionin a singlecenter, retrospective assessment over nearly 20 years, cardiac catheterizationrelated cves were very rare and nearly exclusively ischemic. the independent predictors for these events were found to be the performance of an intervention and those associated with increased atherosclerotic burden, specifically older age, triple vessel disease, and prior stroke. the presence of intracoronary thrombus appears also to raise the risk of procedurerelated cve. |
fournier 's gangrene is a rare and often fulminant necrotising fasciitis of the perineum and genital region frequently due to a synergistic polymicrobial infection. the condition was first described as a disease of young adults of unknown cause by fournier in 1888. others are local conditions like perianal suppurations and urinary tract infection (uti) complicating obstructive uropathy. the study reviewed fournier 's gangrene in relation to aetiology, presentation, management, and outcome. the study reviewed all patients managed for fournier 's gangrene in umth over a 6-year period between january 2007 and december 2012. a written informed consent was obtained from all patients, and written permission was given by the hospital medical and ethical committee. the diagnosis of fournier 's gangrene (figures 1 and 2) was made on clinical assessment. patients were resuscitated where necessary with antibiotics (metronidazole and ceftriaxone), intravenous fluids, analgesics, and antitetanus prophylaxis, blood transfusions were also given. investigations carried out included packed cell volume, urinalysis, blood sugar and chemistry, wound swab and biopsy for microbial culture, and hiv screening. wound debridement was done for all patients (some more than once) under general or spinal anaesthesia. the definitive management took the form of healing by secondary intention, by secondary closure, skin grafting, and skin flap rotation. a total of 43 patients were seen over the study period with five excluded on account of incomplete data, leaving 38 for detailed analysis. all patients were males aged 2 weeks to 80 years, with a mean of 37.82 years. clinical features at presentation were scrotal pain and swelling in 36 (94.74%), fever in 19 (50.00%), scrotal wound discharge in 19 (50.00%), vomiting in 5 (13.16%), and dysuria in 4 (10.53%). table 2 showed predisposing conditions, with uti secondary to obstructive uropathy (bph / urethral stricture) in 11 (28.95%) patients, peri - anal suppuration, and hiv, in 8 (21.05%) each. eleven (28.95%) patients were anaemic at presentation (pcv < 30%). wound biopsy and culture revealed mixed organisms (aerobe and anaerobe) in 27 (71.05%), single isolates in 6 (15.79%), and sterile cultures in 5 (13.16%). twenty - six (68.42%) had blood transfusions, 1 or 2 units in 16 (42.11%) patients, while 10 (26.32%) patients had 3 or 4 units transfused. twenty - eight patients (73.68%) had wound debridement once or twice while 9 (23.68%) patients had 3 or more serial debridements. twenty (52.63%) had flap rotation for skin cover, 4 (10.53%) had skin graft, while in 12 (31.58%) patients skin was covered by secondary closure, and 2 (5.26%) were allowed to heal by secondary intention. the average hospital stay was 4 weeks with a range of 1 to 7 weeks. there were 6 (15.79%) mortalities of which 4 (10.53%) were hiv positive, 1 (2.63%) was diabetic, while 1 (2.63%) was both diabetic and hiv positive. the causes of death were septicaemia and shock in 4 (10.53%), diabetic ketoacidosis, and acute renal failure in 1 (2.63%) each. fournier 's gangrene is a rare and often fulminant necrotising fasciitis of the perineum and genital region frequently due to a synergistic polymicrobial infection. all patients are males with peak age group 3039 years. clinical features of scrotal pain and swelling, fever, and scrotal discharge and sloughing were in keeping with similar studies. systemic diseases associated with fournier 's gangrene were diabetes, hiv, and alcoholism ; however, this study did not find alcoholism to be associated with fournier 's. local conditions like peri - anal suppuration and uti the management of this condition requires urgent and aggressive resuscitative methods with broad spectrum antibiotics, which covers both aerobes and anaerobes, as well as fluids, which may include blood transfusion if necessary. all patients had serial wound debridement in keeping with the standard in the management of this condition. some authors advocate suprapubic cystostomy and diverting colostomy to prevent wound contamination, and in this we had no cause to undertake such procedures. wound closure is advocated once the wound is clean and this reduced hospital stay. in this study the majority of the patients had wound closure (in keeping with the previous principle), by secondary closure, skin grafting, and flap rotation. the prognosis is good especially in children and young adults [1214 ] ; however, when it is associated with systemic diseases such as hiv (figure 3) and uncontrolled diabetes, the prognosis is dismal as evidenced by high mortality rate in this study among hiv and diabetic patients, as opposed to findings by other authors that diabetes [1518 ] has no adverse effect on survival in the disease. | background. fournier 's gangrene is uncommon but increasingly being seen over the last two decades probably due to increasing socioeconomic problems including an upsurge in hiv infection especially in the tropics. patients and methods. the study retrospectively reviewed all patients with fournier 's gangrene managed in umth between january 2007 and december 2012. results. thirty - eight males aged 2 weeks to 80 years (mean 37.82) were reviewed, with most aged 3039 years (13 (34.21%)). clinical features were scrotal pain and swelling, 36 (94.74%), fever, 19 (50.00%), and discharging scrotal wound, 19 (50.00%). the predisposing conditions were uti secondary to obstructive uropathy in 11 (28.95%), perianal suppuration, and hiv, in 8 (21.05%) patients each. wound biopsy culture revealed mixed organisms in 27 (71.05%). twenty - six (68.42%) had blood transfusions. thirty - seven (97.37%) patients had wound debridement. twenty (52.63%) had flap rotation for skin cover. there were 6 (15.79%) mortalities, of which 4 (10.53%) were hiv positive, 1 (2.63%) was diabetic, and 1 (2.63%) was both diabetic and hiv positive. conclusion. fournier 's gangrene is a fulminant synergistic necrotising fasciitis of the perineum and genitalia with poor prognosis especially when associated with hiv and diabetes, requiringprompt and aggressive management for good outcome. |
grid laser treatment was performed in both eyes seven months ago. in spite of seven months of follow - up after grid laser with good systemic control, persistent csme was found in both the eyes with central macular thickness (cmt) of 311 m and 452 m in the right and left eye respectively [figs. intravitreal bevacizumab was given in the left eye and the right eye was kept under observation. four weeks after bevacizumab injection, cmt was reduced to 355 m in the left eye with persistent csme observed with maximum macular thickness (mmt) of 461 m [fig. intravitreal dexamethasone implant was injected in the right eye whereas second bevacizumab injection was given in the left eye. at six weeks of follow - up 1e ] whereas cmt and mmt were 306 m and 420 m respectively in the left eye [fig. persistent macular edema (me) in the right eye after 7 months follow - up of grid laser with central macular thickness (cmt) 311m. intervention - none. (b) persistent me in the left eye after 7 months of grid laser. (c) right eye macular sd - oct after 4 weeks of follow - up (me worsened and cmt increased to 350 m). (d) left eye macular sd - oct after 4 weeks of 1st intravitreal avastin (me improved and cmt and mmt reduced to 355 m and 461 m respectively). (e) right eye macular sd - oct after 6 weeks of implant (me subsided and cmt became 261m). (f) left eye macular sd - oct after 6 weeks of 2nd intravitreal bevacizumab. persistent me with cmt 306 m and mmt 420 m (sd - oct - spectral domain optical coherence tomography) high intraocular pressure was recorded in the right eye (26 mmhg) and patient was kept on antiglaucoma medications. in the present case, dexamethasone sustained - release implant was able to successfully bring down the cmt to the normal level in refractory csme within six weeks whereas persistent csme was observed even after using two bevacizumab injections in the other eye. as this is a single case with a very short follow - up, it is very difficult to comment on the efficacy of dexamethasone implant per se but comparison with fellow eye (bevacizumab) in similar systemic metabolic conditions makes it an interesting observation even at short term. it is important to evaluate the efficacy of dexamethasone sustained - release implant for the long term because that will give a clue towards its cost - effectiveness compared to the existing therapies. it should not be concluded with this report that dexamethasone sustained - release implant is a better therapeutic option than bevacizumab because there was difference in the nature of macular edema in both the eyes i.e. right eye had early edema in comparison to left eye and both the therapies caused reduction in the macular thickness. recent results of resolve and read 2 study have shown successful use of ranibizumab in cases of dme. as far as the frequency of ranibizumab is concerned, the read 2 study has shown reduction in the frequency of ranibizumab injection to 2.9 when it is combined with laser, compared to 5.3 and 4.4 in ranibizumab and laser alone patients respectively during 18 months of follow - up. future comparative clinical studies with a large sample size and long - term follow - up after fda approval of dexamethasone sustained - release implant for dme will be able to provide better results and guidelines. | we report on the significant improvement of central macular thickness in a case of clinically significant macular edema after dexamethasone 0.7 mg sustained - release intravitreal implant (ozurdex ; allergan, inc, irvine, ca, usa). patient presented to us with persistent clinically significant macular edema (csme) in both eyes. right eye received dexamethasone implant and left eye received two intravitreal bevacizumab injections 1.25 mg/0.05 ml (avastin ; genentech inc., south san francisco, ca, usa) with an interval of four weeks. after six weeks of follow - up, dexamethasone implant in the right eye showed normal macular thickness whereas persistent macular edema (me) was found even after second intravitreal bevacizumab injection in the left eye. |
common fragile sites (cfss) tend to break upon replication stress and have been suggested to be hot spots for genomic instability. recent evidence, however, implies that in the wake of dna damage, ww domain - containing oxidoreductase (wwox, the gene product of the fra16d fragile site), associates with ataxia telangiectasia - mutated (atm) and regulates its activation to maintain genomic integrity. |
|
isolated nuclei from mammalian cells contain a calcium - dependent endonuclease. the produced dna fragmentation is a necessary step in the sequence of events resulting in apoptosis (programmed cell death). we report here that zinc and cadmium inhibit the calcium - dependent endonuclease. the essential metal ion zinc may counterbalance the calcium - mediated apoptosis. in contrast to zinc, cadmium alone stimulates the endonuclease by replacing calcium. thus cadmium exerts a dual effect : micromolar concentrations inhibit the apoptotic endonuclease in the presence but activate the enzyme in the absence of calcium.imagesfigure 2. |
|
local analgesia, which allows a virtually pain - free treatment, plays a crucial role in paediatric dental practice. articaine is a commonly used local analgesic that was introduced to the german market in 1976. experts have said that it may be the analgesic of choice in children over 4 years of age (nizharadze. 2011). for younger children, a current meta - analysis could not find recommendations for its use, since no data supporting such were found (katyal 2010). to avoid the risk of toxicity, especially when treating small children, a body weight - based dosage has to be calculated (ahmed and martinez 2009) and the use of a vasoconstrictor is recommended (lipp. the vasoconstrictor of choice in most cases is epinephrine (paxton and thome 2010). for articaine, it was shown that adverse reactions occur mainly due to the amount of epinephrine in the analgesic solution (santos. it may lead, especially at sites with increased resorption of the local analgesic or in cases of intravascular injection, to an increased heart rate, ejection volume, blood pressure, body temperature and blood supply of the skeletal muscles. further systemic side - effects of the vasoconstrictor may be nausea, agitation, dizziness and tremor. a higher amount of epinephrine is equated with an increased analgesic duration (kmmerer. 2011). as result of the longer loss of sensation after dental analgesia especially in smaller children, self - induced lesions of the soft tissues such as biting of the tongue, the lips and the cheeks may occur (ram and amir 2006 ; adewumi. there are no special recommendations about the vasoconstrictor concentration for the treatment of children and it has been demonstrated that even a low concentration of epinephrine (1:400,000) leads to a significant prolongation of the systemic absorption of a local analgesic solution (hansen. the systemic as well as local risks may increase (kmmerer. 2011). altogether, a limitation of the amount of epinephrine in combination with articaine in paediatric patients should be discussed. an adaption of local analgesia to the respective treatment time may enhance the child s wellbeing. articaine, with the minor adjunct of epinephrine 1:400,000, has already been shown to be safe and effective in short dental procedures in adult patients (daublnder. therefore, the aim of this study was to conduct a non - interventional, multi - centre assessment of an articaine solution with reduced epinephrine concentration in dental paediatric practice. a prospective clinical study was performed at a dental clinic (university of giessen) and four private dental practices for paediatric or general dentistry (munich and herrsching) between 2009 and 2010. a non - interventional study is defined as a study where the respective product is used in the usual manner and the assignment of the patient to a particular therapeutic strategy falls within current practice. this type of trial usually reflects normal clinical practice with a quality close to those from clinical and interventional trials (worz and hundt 2011). the study was conducted with the approval of the ethics committee of the medical association of rhineland - palatinate and in accordance with the declaration of helsinki. after taking the medical history of the patient, the procedures, possible discomforts or risks, as well as possible benefits were explained fully to the patients and their legal guardians. the legal guardians of the patients signed an informed consent prior to the initiation of the dental treatment. inclusion criteria were : patients aged 417 years requiring routine dental treatment under local analgesia. exclusion criteria were the following : contra - indications for one of the components of the analgesic solution (articaine, epinephrine, or sodium sulphite), limited activity of plasma cholinesterases, patients with american society of anaesthesiologists classification > 2, lack of compliance and infections in the area of injection. if the respective criteria were met, each patient attending at one of the study centres for treatment was included in the study. the local analgesic solution was supplied in 1.7 ml carpules by 3 m espe (seefeld, germany) containing 4 % articaine plus epinephrine 1:400,000 (ubistesin lite 1:400,000). it was used in the technique chosen by the dentist (infiltration, nerve block, periodontal ligament injection (pdl), combinations) with the instrument chosen by the dentist. routine dental treatment (cavity preparations, extractions, endodontic treatment), was performed, mostly on primary teeth. the main indication for the epinephrine - reduced solution was for a shorter treatment time. additional sedation was performed if and when needed in accordance to the normal and everyday routine procedures of the clinic or practices. if needed, the dentist used nitrous oxide as an inhalation technique or orally administered midazolam and/or additional analgesics. prior treatment, affected teeth, region as well as the respective indication were documented. if there were more than one area to be treated, the region that was treated first was documented. for each patient, the duration of the treatment as well as the achieved analgesia (complete, sufficient, insufficient, none) after a period of 57 min was noted. if the analgesia was rated in addition, the injection technique as well as dosage of the local analgesic (primary and secondary injection as well as total dose) were documented. if sedation was needed, the character of the sedation as well as the special drug and its concentration were recorded. complete, sufficient, insufficient and no rating possible. if insufficient or no rating possible, failed analgesia was documented. one day after treatment, a structured telephone interview with the patient or the parents was conducted to examine the duration of subjective soft tissue analgesia recorded in minutes by the patients and/or legal guardians while touching the tissues as well as potential side - effects. the patients remained on a follow - up schedule for 14 days after treatment. all patients (respectively, legal guardians) that gave informed consent and were treated with ubistesin 1:400,000 were evaluated in the study. a prior power calculation showed a sample size of n = 918 patients to be sufficient to reveal potential side - effects with an incidence of 0.5 % or more with a likeliness of 99 %. to find possible associations between side - effects and age and to obtain information about the influence of prior sedation on duration of soft tissue analgesia, students t tests were conducted. to assess an association between side - effects and injection technique as well as prior sedation, tests were used. a difference between the groups was seen to be statistically significant if p 2, lack of compliance and infections in the area of injection. if the respective criteria were met, each patient attending at one of the study centres for treatment was included in the study. the local analgesic solution was supplied in 1.7 ml carpules by 3 m espe (seefeld, germany) containing 4 % articaine plus epinephrine 1:400,000 (ubistesin lite 1:400,000). it was used in the technique chosen by the dentist (infiltration, nerve block, periodontal ligament injection (pdl), combinations) with the instrument chosen by the dentist. routine dental treatment (cavity preparations, extractions, endodontic treatment), was performed, mostly on primary teeth. the main indication for the epinephrine - reduced solution was for a shorter treatment time. additional sedation was performed if and when needed in accordance to the normal and everyday routine procedures of the clinic or practices. if needed, the dentist used nitrous oxide as an inhalation technique or orally administered midazolam and/or additional analgesics. prior treatment, affected teeth, region as well as the respective indication were documented. if there were more than one area to be treated, the region that was treated first was documented. for each patient, the duration of the treatment as well as the achieved analgesia (complete, sufficient, insufficient, none) after a period of 57 min was noted. if the analgesia was rated in addition, the injection technique as well as dosage of the local analgesic (primary and secondary injection as well as total dose) were documented. if sedation was needed, the character of the sedation as well as the special drug and its concentration were recorded. complete, sufficient, insufficient and no rating possible. if insufficient or no rating possible, failed analgesia was documented. one day after treatment, a structured telephone interview with the patient or the parents was conducted to examine the duration of subjective soft tissue analgesia recorded in minutes by the patients and/or legal guardians while touching the tissues as well as potential side - effects. the patients remained on a follow - up schedule for 14 days after treatment. all patients (respectively, legal guardians) that gave informed consent and were treated with ubistesin 1:400,000 were evaluated in the study. a prior power calculation showed a sample size of n = 918 patients to be sufficient to reveal potential side - effects with an incidence of 0.5 % or more with a likeliness of 99 %. to find possible associations between side - effects and age and to obtain information about the influence of prior sedation on duration of soft tissue analgesia, students t tests were conducted. to assess an association between side - effects and injection technique as well as prior sedation, tests were used. a difference between the groups was seen to be statistically significant if p 45 kg. concomitant diseases were known in 18 patients (1.8 %) ; (in detail : neurodermatitis n = 3, attention deficit hyperactivity disorder n = 2, asthma n = 2, thyroid hypofunction n = 2, diabetes type i n = 1, allergic coryza n = 1, sore throat n = 1, slight cough n = 1, purpura anaphylactoids n = 1, congenital heart disorder n = 1, mucopolysaccharidosis n = 1, cardiac dysrhythmia n = 1, photodermatosis n = 1). in all patients, no prior allergic reactions towards local analgesic agents were recorded. in nine patients (0.9 %), a prior pain medication (ibuprofen n = 6, paracetamol (acetaminophen) n = 2, talvosilen (codeine and paracetamol) n = 1) was self - prescribed. in 795 patients primary teeth and in 204 patients permanent teeth were treated. in 816 cases (81.7 %) dental cavity preparation and treatment with intra - coronal restorations were undertaken, in 230 cases (23 %) simple extractions of primary teeth and in 60 cases (6.4 %) endodontic treatments (pulpectomy, pulpotomy) on primary teeth were conducted. in 29 cases (2.9 %), other indicated treatment had a frequency of less than 3 % (fig. 1). in 602 patients (60.3 %) one tooth, in 357 patients (35.7 %) two teeth and, in 40 patients (4 %) three teeth were treated.fig. n = 999) pie chart showing the different indications for treatment in % (n = 999) two hundred seventy six patients (27.6 %) received sedation prior to treatment [nitrous oxide n = 119 (11.9 %), midazolam + analgesics + other sedative n = 102 (10.2 %), midazolam + analgesic n = 31 (3.1 %) ]. in 93.5 % of cases (n = 934) the initial local analgesia was complete or at least sufficient to perform the planned treatment. a second injection was necessary in 3.4 % (n = 34) before, in 2.7 % (n = 27) during treatment and in 0.4 % of cases (n = 4) at both times. the major technique used was infiltration (50.2 %, n = 501), followed by a combination with pdl (25.8 %, n = 258), block analgesia (14.3 %, n = 143), pdl only (9.3 %, n = 93) as well as block analgesia and pdl (0.4 %, n = 4) (fig. 2). the mean volume of the initial injection was 1.1 ml (sd 0.43), the mean additional volume was 0.9 ml 0.46. the mean body weight - based dosage was 1.5 0.69 mg / kg ; in very young and frail children an increase up to 3.43 mg / kg was documented. between first injection and start of treatment a mean time of 6 4 min elapsed, and between first injection and second injection a mean time of 16 9 min was measured. 2pie chart showing the frequency of each injection technique in the study in % (n = 999) pie chart showing the frequency of each injection technique in the study in % (n = 999) in 99 % of cases (n = 989) the planned treatment could be completed. only 1 % of the patients (n = 10) were either non - compliant (n = 7) or very anxious (n = 1) or had insufficient response to repeated local analgesia (n = 1) or sedation (n = 1). in 98.7 % of cases, the quality of local analgesia was rated to be at least sufficient (fig. 3).fig. 3bar charts showing the quality of local analgesia rated by the dentist. a subdivision into the different injection techniques is given bar charts showing the quality of local analgesia rated by the dentist. a subdivision into the different injection techniques is given fifty five unwanted side - effects occurred in 42 (4.3 %) of patients. a possible or likely coherence with the solution was stated in 3.1 % (n = 31). of these, 71 % were light and all were transient. the main side - effects were unspecific systemic [nausea (1.1 %, n = 11), exhaustion (0.9 %, n = 9) and headache (0.5 %, n = 5) ]. post - operative soft tissue injury occurred in four patients (0.4 %) ; all were younger than 7 years (mean 5.4 1.2). side - effects were evaluated significantly more often in the group of children younger than 6 years of age (p = 0.001). neither an association between side - effects and injection technique (p = 0.53) nor between side - effects and prior sedation (p = 0.78) was observed. for n = 997 patients (drop - out rate was 0.2 %), a mean duration of soft tissue analgesia of 2.19 1.01 h (total time from injection to end of numbness) was measured. the longest duration was seen for block analgesia with 2.43 0.55 h, the shortest for pdl with 1.22 0.47 h only. it could be shown that for infiltration, the duration of soft tissue analgesia tended to ascend with increasing volume of the local analgesic solution (pearson s correlation coefficient 0.26 ; fig. sedation increased the duration of analgesia in a small amount for all techniques, statistically relevant only in the infiltration plus pdl group (p = 0.049).fig. 4scatter plot showing the weak correlation between the amount of local analgesic solution and the duration of soft tissue analgesia after infiltration scatter plot showing the weak correlation between the amount of local analgesic solution and the duration of soft tissue analgesia after infiltration the study recruited 999 patients (50.5 % male, 49.5 % female) with a mean age of 7.9 2.34 years that were treated between 04/2009 and 04/2010 in five study centres. contrary to the treatment protocol, five children under 4 years of age (0.5 %) were treated as well. accordingly, 101 patients (10.1 %) weighed less than 20 kg, 496 patients (49.6 %) 20 to 45 kg. concomitant diseases were known in 18 patients (1.8 %) ; (in detail : neurodermatitis n = 3, attention deficit hyperactivity disorder n = 2, asthma n = 2, thyroid hypofunction n = 2, diabetes type i n = 1, allergic coryza n = 1, sore throat n = 1, slight cough n = 1, purpura anaphylactoids n = 1, congenital heart disorder n = 1, mucopolysaccharidosis n = 1, cardiac dysrhythmia n = 1, photodermatosis n = 1). in all patients, no prior allergic reactions towards local analgesic agents were recorded. in nine patients (0.9 %), a prior pain medication (ibuprofen n = 6, paracetamol (acetaminophen) n = 2, talvosilen (in 795 patients primary teeth and in 204 patients permanent teeth were treated. in 816 cases (81.7 %) dental cavity preparation and treatment with intra - coronal restorations were undertaken, in 230 cases (23 %) simple extractions of primary teeth and in 60 cases (6.4 %) endodontic treatments (pulpectomy, pulpotomy) on primary teeth were conducted. in 29 cases (2.9 %), other indicated treatment had a frequency of less than 3 % (fig. 1). in 602 patients (60.3 %) one tooth, in 357 patients (35.7 %) two teeth and, in 40 patients (4 %) three teeth were treated.fig. 1pie chart showing the different indications for treatment in % (n = 999) pie chart showing the different indications for treatment in % (n = 999) two hundred seventy six patients (27.6 %) received sedation prior to treatment [nitrous oxide n = 119 (11.9 %), midazolam + analgesics + other sedative n = 102 (10.2 %), midazolam + analgesic n = 31 (3.1 %) ]. in 93.5 % of cases (n = 934) the initial local analgesia was complete or at least sufficient to perform the planned treatment. a second injection was necessary in 3.4 % (n = 34) before, in 2.7 % (n = 27) during treatment and in 0.4 % of cases (n = 4) at both times. the major technique used was infiltration (50.2 %, n = 501), followed by a combination with pdl (25.8 %, n = 258), block analgesia (14.3 %, n = 143), pdl only (9.3 %, n = 93) as well as block analgesia and pdl (0.4 %, n = 4) (fig. 2). the mean volume of the initial injection was 1.1 ml (sd 0.43), the mean additional volume was 0.9 ml 0.46. the mean body weight - based dosage was 1.5 0.69 mg / kg ; in very young and frail children an increase up to 3.43 mg / kg was documented. between first injection and start of treatment a mean time of 6 4 min elapsed, and between first injection and second injection a mean time of 16 9 min was measured. 2pie chart showing the frequency of each injection technique in the study in % (n = 999) pie chart showing the frequency of each injection technique in the study in % (n = 999) in 99 % of cases (n = 989) the planned treatment could be completed. only 1 % of the patients (n = 10) were either non - compliant (n = 7) or very anxious (n = 1) or had insufficient response to repeated local analgesia (n = 1) or sedation (n = 1). in 98.7 % of cases, the quality of local analgesia was rated to be at least sufficient (fig. 3bar charts showing the quality of local analgesia rated by the dentist. a subdivision into the different injection techniques is given bar charts showing the quality of local analgesia rated by the dentist. fifty five unwanted side - effects occurred in 42 (4.3 %) of patients. a possible or likely coherence with the solution was stated in 3.1 % (n = 31). of these, 71 % were light and all were transient. the main side - effects were unspecific systemic [nausea (1.1 %, n = 11), exhaustion (0.9 %, n = 9) and headache (0.5 %, n = 5) ]. post - operative soft tissue injury occurred in four patients (0.4 %) ; all were younger than 7 years (mean 5.4 1.2). side - effects were evaluated significantly more often in the group of children younger than 6 years of age (p = 0.001). neither an association between side - effects and injection technique (p = 0.53) nor between side - effects and prior sedation (p = 0.78) was observed. for n = 997 patients (drop - out rate was 0.2 %), a mean duration of soft tissue analgesia of 2.19 1.01 h (total time from injection to end of numbness) was measured. the longest duration was seen for block analgesia with 2.43 0.55 h, the shortest for pdl with 1.22 0.47 h only. it could be shown that for infiltration, the duration of soft tissue analgesia tended to ascend with increasing volume of the local analgesic solution (pearson s correlation coefficient 0.26 ; fig. 4). sedation increased the duration of analgesia in a small amount for all techniques, statistically relevant only in the infiltration plus pdl group (p = 0.049).fig. 4scatter plot showing the weak correlation between the amount of local analgesic solution and the duration of soft tissue analgesia after infiltration scatter plot showing the weak correlation between the amount of local analgesic solution and the duration of soft tissue analgesia after infiltration in paediatric dentistry, local analgesia offers virtually pain - free treatment, providing comfort for children and increasing their cooperation. to reduce plasma levels of the local analgesic and to enhance the analgesic effect, 1994 ; yagiela 1995), although, the vasoconstrictor may produce its own adverse side - effects (meechan. 2001 ; santos. 2007). to minimise those and to balance risk and benefit, therefore, the aim of this non - intervention clinical study was an evaluation of efficacy, tolerance and safety of 4 % articaine with an adjunct of 1:400,000 epinephrine in dental treatment of children aged 417 years. for adult patients, our group could prove in a similar clinical setting that epinephrine - reduced articaine is safe and effective in short dental treatments (daublnder. 2012). though, to the best of our knowledge, this is the first study evaluating 4 % articaine with 1.400,000 epinephrine in paediatric dentistry. with a primary analgesia success rate of 93.5 % of cases, 99 % of all treatments were completed, although no self - reporting by the patients was included in the analysis. for latency with 4 % articaine with 1.200,000 epinephrine, a shorter time has been reported (ram and amir 2006). the influence of the vasoconstrictor concentration on analgesic diffusion due to a slower absorption rate may explain this difference (lima - junior. 2012), although, this effect was not seen in infiltration analgesia (moore. 2006). the volumes used in this study (mean = 1.1 ml) were generally very low ; however, in smaller children, dosages up to 3.46 mg / kg of articaine were recorded. those could be potentially dangerous when using a local analgesic without vasoconstrictor (lipp. altogether, we could demonstrate that with the low concentration of the vasoconstrictor used in the present study, efficacy as well as mean duration of analgesia was sufficient in nearly all cases. efficacy and safety of 4 % articaine with the higher epinephrine concentrations of 1:100,000 and 1:200,000 in dental treatment of children have been studied before ; showing a safe and efficient effect of the respective solution. there was also no higher incidence of adverse reactions following 4 % articaine with epinephrine 1:100,000 in children under the age of 4 years, although the manufacturer does not recommend this use (wright. a study on the pharmacokinetics of articaine with epinephrine 1:200,000 in children (312 years old) showed drug serum levels comparable to adults and no relevant differences between the 2 and 4 % solution. the maximum plasma levels were distinctly earlier and the plasma clearance increased in comparison to adult subjects (jakobs. a major disadvantage of local analgesia in children is the prolonged numbness after treatment, which may increase the chance of self - inflicted soft tissue lesions. the effect of numbness has been reported to be longer after articaine use than other local analgesics such as lidocaine (ram and amir 2006). as described by adewumi. nevertheless, due to the small number of such side - effects in the present study, this result may be seen controversial. we recommend further trials with narrower age limits, basing the studies on the younger age group. within the limitations of the present study (phone call 24 h later with an increased chance of recall bias), the mean duration of soft tissue analgesia was 2.19 h. compared to adults using the same epinephrine - reduced articaine solution, the duration was approximately 20 min shorter in the paediatric population (daublnder. ram and amir (2006) reported for 4 % articaine with epinephrine 1:200,000 a mean duration of total soft tissue analgesia of 3.43 h. accordingly, the reduction of vasoconstrictor results in a shorter time of numbness. this may explain the smaller number of soft tissue injuries in our study (0.4 %) compared to the 14 % reported by adewumi. similar to prior studies, the duration of soft tissue numbness for local infiltration was shorter than the duration of nerve block injections (malamed. we also found a weak but clinical relevant correlation with the injected volume when using infiltration. after administration of 4 % articaine with different epinephrine concentrations (1:100,000 and 1:200,000), no severe adverse effects in children were observed. therefore, our data concerning the safety of 4 % articaine with 1:400,000 epinephrine tested in 999 children with a low rate of minor side - effects reflect the already known risk benefit profile of articaine solution. due to a high efficacy, tolerance and safety, articaine 4 % solution with reduced epinephrine concentration (1:400,000) is a safe and suitable drug in paediatric dentistry for routine treatment. for longer and very painful procedures and in treatments that require ischaemia, solutions with higher concentrations of epinephrine are preferable. | aimin paediatric dentistry, epinephrine may contribute to systemic and local side - effects. on the other hand it is necessary to provide good and safe local analgesia. therefore, an articaine solution with reduced epinephrine concentration was tested in a clinical setting.methodsin a non - interventional clinical study, dental treatment was performed in children and adolescents (417 years). for local analgesia, articaine 4 % plus epinephrine 1:400,000 was used in the technique chosen by the dentist. efficacy and tolerance as well as duration of soft tissue analgesia and side - effects were evaluated.results999 patients (50.5 % male, 49.5 % female) with a mean age of 7.9 (sd 2.34) years were treated. two hundred seventy six patients (27.6 %) received sedation prior to treatment. the mean treatment time was 15 min (sd 10). in 93.5 % of cases, initial local analgesia was sufficient to perform the planned treatment. in 99 % of cases (n = 989) the planned treatment could be completed. a second injection was necessary in 6.5 % of cases. a mean duration of soft tissue analgesia of 2.19 h (sd 1.01) was seen. slight side - effects occurred in 3.1 % of subjects.conclusionsdue to high efficacy, tolerance and safety, the articaine 4 % solution with the reduced epinephrine concentration (1:400,000) was a safe and suitable drug for paediatric routine treatment. |
however, predictors used in those models are often not actionable, as they are typically based on demographic (e.g., age, race / ethnicity) or clinical data (e.g., medical history, billing or laboratory data). in our previous work, we aimed to identify a subset of high - risk patients with reversible risk factors, as our goal was to prevent their readmission by connecting those patients to appropriate interventions. since psychosocial factors might be a root cause for cardiac decompensation, we set ourselves to develop a multivariable logistic regression model based on psychosocial predictors. in that work, we identified 5 psychosocial predictors dementia, depression, adherence, declining / refusal of services, and missed clinical appointments as significant predictors of readmission. similarly, patient - reported symptoms and other factors collected by a telemonitoring system could potentially serve as reversible predictors to eventually strengthen our original model. in fact, body weight gain among heart failure patients is already a known factor linked to early readmissions. telemonitoring is a promising innovation that allows clinicians to monitor patients with heart failure remotely for signs of clinical deterioration, enabling timely and effective intervention by the physician. there are a range of technologies that collect and transmit real - time patient data such as physical symptoms, blood pressure, weight changes, and electrocardiogram readings to a central location for evaluation [4, 5 ]. by monitoring symptoms that reflect a patient 's physiological struggle to remain euvolemic, telemonitoring holds promise in reducing hospital readmissions and significantly improves patient morbidity and mortality, as well as quality of life. a recent meta - analysis found that telemonitoring of heart failure patients reduced both all - cause mortality and heart failure - related hospitalizations by 44% and 21%, respectively [6, 7 ]. at the same time, other studies highlight that telemonitoring has no positive impact on readmissions, suggesting that the benefits of telemonitoring are not universally observed. as a result, telemonitoring remains a costly and limited resource, which hospitals must utilize carefully and responsibly. it will thus be increasingly critical to be able to identify scenarios where telemonitoring contributes to improved clinical outcomes for different populations of patients. telemonitoring systems are producing increasing amounts of information that require the use of sophisticated algorithms to process, filter, and prioritize. going forward, these algorithms will play a key role in integrating data from multiple sources, evaluating a patient 's clinical condition, and identifying patients at increased risk for hospitalization [810 ]. in summary, we had 3 goals in mind with this study. first, we aimed to validate the heart failure readmission model based on psychosocial factors we previously developed. this step was necessary to ensure that our previous model was applicable to the study population. second, we set forth to develop a new predictive model based on patient - reported symptoms from a telemonitoring program. finally, we planned to assess the impact of weight fluctuations on hospital readmission (weight fluctuation was used as a proxy to weight gain secondary to hypervolemia because our telemonitoring program intervened on weight gain). the partners connected cardiac care program (cccp) is a joint telemonitoring effort between partners center for connected health and partners home care designed to help patients better manage their heart failure and avoid rehospitalization. enrolled patients are provided with bosch 's vitalnet suite of devices, consisting of a weight scale, blood pressure cuff, and pulse oximeter, to send their data and symptom information to the vitalnet portal via telephone line every day, at the same time each day, where telemonitoring nurses view the data and follow up accordingly. failure to upload would generate a reminder phone call to the patients by the telemonitoring nurses. if patients uploaded data outside parameters, nurses would follow standing orders given by the cardiologists, or if necessary, send the cardiology team a clinical message. we selected 100 patients enrolled in the cccp who completed the 4-month program between july 2008 and november 2011 following a hospitalization. the enrolled population included english - speaking men and women over the age of 18 years who were patients from massachusetts general hospital (mgh) with a diagnosis of heart failure. using patient names and medical record numbers, relevant telemonitoring, readmission, and clinical data was extracted from the vitalnet portal data warehouse, as well as from the mgh longitudinal medical record (lmr) electronic medical record system. telemonitoring data recorded from the vitalnet portal included daily weight, blood pressure, pulse, o2 saturation, and severity of symptoms for each patient. we also recorded whether patients received a reminder call for their data, or any other clinical intervention by the nursing staff. a previously developed hospital readmission prediction model using psychosocial factors was validated on the patient population in the current study. a receiver operating characteristic (roc) curve was generated for a range of probability threshold values, with readmission status for each patient based on whether the calculated readmission probabilities exceeded a given threshold value. a cutpoint of 0.3 was used to determine the model 's impact on selecting and enrolling patients into the cccp, and additional calculations were performed for sensitivity, specificity, positive predictive value, negative predictive value, and area under the roc curve (auc). the probability of readmission within 30 days of index admission was separately modeled with logistic regression using ten candidate predictors representing physical symptoms or factors reported by heart failure patients : shortness of breath, cough, pain, dizziness, tired, rapid heart rate, swollen ankles and feet, swollen abdomen, diet, and missed medications adjusted weight standard deviation was used to assess the association of weight fluctuations with patient readmission risk, calculated as the standard deviation of all weights for each patient during the 4-month enrollment period adjusted by the mean weight. two - sample t - tests were used to evaluate potential differences in adjusted weight standard deviation by readmission status. the multivariable logistic regression model included all predictors initially, and a p value of 0.05 for all). with 4 covariates rapid heart rate, swollen abdomen, swollen feet, and missed medication combined, the telemonitoring - based readmission model yielded an auc of 0.21, along with a sensitivity of 0.5, a specificity of 0.81, a positive predictive value of 0.61, and a negative predictive value of 0.72 at a cutoff value of 0.35. when stratified by admission status, there was no difference between the adjusted weight standard deviation of patients readmitted to the hospital within 30 days for heart failure compared to those who were not readmitted (2.05 1.53 versus 1.74 1.03 lbs, p = 0.133). using the physical symptoms reported by cccp patients as a starting point, a regression model using 30-day readmission risk as a continuous outcome (not shown) was developed, and readmission risk was graphed as a function of standardized changes in weight for each patient (figure 2). no correlation was found between the frequency of reported weight changes and likelihood of 30-day hospital readmission for heart failure (p = 0.83). in summary, no significant association between fluctuations in weight and risk for hospital readmission for heart failure could be detected in the telemonitoring patient population studied. the development of prediction models to identify patients at increased risk for hospital readmission can be a useful way of describing and prioritizing the severity of a patient 's condition, particularly for those in telemonitoring programs for heart failure. this study describes a systematic process of integrating data acquired daily through telemonitoring in order to validate existing algorithms or develop new ones applicable to this important patient population. our results showed a wide variety of positive symptoms reported by patients in the study. the top five symptoms included such factors as fatigue (tiredness) and shortness of breath, which have been known to be strongly associated with congestive heart failure. other findings can also be found in the literature and highlight the importance and utility of patient - reported symptoms in models to assess patient status. by understanding which factors are commonly reported by patients, the most relevant subset of covariates can be selected even within the context of highly constrained prediction model development. the validation of a previously developed model on patients in the cccp a completely different population than the earlier study but with similar clinical needs highlights the importance of developing models that can be applied to new populations. while the auc of the validated algorithm suggested only moderate discriminatory power, it was actually comparable to several other published prediction algorithms [2, 13, 14 ]. additional studies support the development of real - time clinical prediction models capable of risk - stratifying patients along multiple dimensions, including patient - centric factors and the utilization of health services. the use of patient - reported symptoms as potential predictors may provide an additional dimension to our psychosocial model for assessing readmission risk for heart failure patients enrolled in telemonitoring programs. to achieve this goal, we developed an independent telemonitoring model based on patient - reported symptoms. there were two main reasons why we decided to develop a predictive model based on patient - reported symptoms. first, we wanted to find out whether variables based on patient - reported symptoms are significant predictors of early readmission in and of themselves. second, we suspected that certain symptoms might be precursors of poor psychosocial behaviors for heart failure patients. the telemonitoring model identified two symptoms that, while statistically significant, only marginally changed the odds of readmission. the results of our study are thus likely not sophisticated enough in their current form to associate patient - reported symptoms and early heart failure readmissions. interestingly, the telemonitoring model with a auc of 0.21 identified heart failure patients who are less likely to get readmitted. one likely explanation is that the telemonitoring program was intervening appropriately on patients reporting symptoms, thereby minimizing their likelihood for readmission. in addition to patient - reported symptoms, we were also interested in assessing if weight fluctuations could serve as a proxy to weight gain to predict readmission. unfortunately, fluctuations in weight were not strongly associated with readmission risk. the results of our study are thus likely not sophisticated enough in their current form to be used as the sole criteria for enrolling patients into telemonitoring. however, our findings support the idea that the trigger for hospital readmissions among heart failure patients originates from multiple, complex factors both intrinsic and extrinsic to the patient, and current algorithms that use only a portion of these variables may not suffice. telemonitoring has the potential to prolong life and improve the quality of care, especially when combined with transitional care shown to decrease the risk of hospital readmission [6, 16, 17 ]. a more comprehensive predictive model for readmission should integrate the psychosocial and patient - reported characteristics described in our study, clinical and demographic factors, and relevant data about hospital operations. first, validation of an existing predictive model and development of new prediction models using a small number of patients in a single telemonitoring program may not be generalizable, and more comprehensive studies will be needed. second, all patients in the study were enrolled in the cccp by design, and thus all were being treated by physicians actively trying to minimize readmissions, which may have contributed to the low discriminatory ability of the prediction models. finally, our study focused on a specific telemonitoring technology that may not be available in other institutions. however, the data collected and used to develop these models are likely commonly collected by numerous telemonitoring systems or available from related systems. regardless, we believe that our use of a well - described patient population with a single, clear telemonitoring modality provides a good approach to developing more robust prediction algorithms in the future. in summary, hospital readmission models based on psychosocial characteristics, standardized changes in weight, or patient - reported symptoms can be developed and validated in heart failure patients participating in an institutional telemonitoring program. however, more robust models will need to be developed that use a comprehensive set of factors (clinical, behavioral, psychosocial, and operational) in order to have a significant impact on population health. | the purpose of this study was to validate a previously developed heart failure readmission predictive algorithm based on psychosocial factors, develop a new model based on patient - reported symptoms from a telemonitoring program, and assess the impact of weight fluctuations and other factors on hospital readmission. clinical, demographic, and telemonitoring data was collected from 100 patients enrolled in the partners connected cardiac care program between july 2008 and november 2011. 38% of study participants were readmitted to the hospital within 30 days. ten different heart - failure - related symptoms were reported 17,389 times, with the top three contributing approximately 50% of the volume. the psychosocial readmission model yielded an auc of 0.67, along with sensitivity 0.87, specificity 0.32, positive predictive value 0.44, and negative predictive value 0.8 at a cutoff value of 0.30. in summary, hospital readmission models based on psychosocial characteristics, standardized changes in weight, or patient - reported symptoms can be developed and validated in heart failure patients participating in an institutional telemonitoring program. however, more robust models will need to be developed that use a comprehensive set of factors in order to have a significant impact on population health. |
acinar cell carcinoma (acc) of the pancreas is a rare tumor that is estimated to account for 12% of all pancreatic exocrine tumors [1, 2 ]. because of the lack of clinical experience with acc, its pathophysiology is not well understood. according to previous reports, acc generally shows expansive growth without invasion into the plexus, portal vein, bile duct and pancreatic duct [3, 4 ]. to our knowledge, no previous reports have described hepatic metastasis from acc primarily in the form of a tumor thrombus. we encountered a very rare case of hepatic metastasis with an unusual clinical presentation : a bile duct tumor thrombus (bdtt) from pancreatic acc. a 66-year - old woman had undergone total pancreatectomy due to pancreatic acc (t3n0m0, stage iia) 7 years prior to clinical presentation. computed tomography (ct) imaging showed a tumorous lesion measuring 7 cm in length and 1 cm in diameter and extending along the intrahepatic bile duct (b6). during ct imaging, the lesion showed mild enhancement in the early phase and modest washout in the late phase (fig. ct arteriography (cta) showed early enhancement, which corresponded to the tumorous lesion detected by ct(fig. f - fluorodeoxyglucose positron emission tomography / ct (fdg - pet / ct) showed high fdg uptake within the corresponding area (fig. the tumor was primarily confined to the intrahepatic bile duct (b6) without definitive mass formation in the hepatic parenchyma. tumor markers, including cea, ca19 - 9 and dupan - ii, were all within normal limits. since pathological evaluation of the fine needle biopsy specimen from the bdtt revealed histological features that were compatible with those of the patient 's acc resected 7 years before, the lesion was diagnosed as a hepatic metastasis primarily in the form of a bdtt originating from the prior acc. we initiated chemoradiation therapy (crt), consisting of a total radiation dose of 50 gy and the intravenous administration of gemcitabine (1,000 mg / m) concurrently on days 1, 8, and 15 during each 4-week cycle. although a modest effect was observed 13 weeks after the initiation of crt, with a decrease in blood flow and size of the bdtt (fig. 2a), the lesion showed an increase in size 19 weeks after the initiation of crt (fig. thus, surgical resection, including subsegmentectomy (s6) of the liver and complete removal of the bdtt, was performed. pathological evaluation of the resected specimen confirmed a hepatic metastasis primarily consisting of a bdtt that originated from an acc of the pancreas (intraductal polypoid growth variant). the detailed pathological evaluation of the bdtt and the comparison of this tumor 's characteristics with those of the primary pancreatic lesion that was resected 7 years before are presented in a separate report. although our experience is only anecdotal, the case reported here provides several novel observations in regard to the clinical features associated with pancreatic acc. first, it underscores the need for a long - term follow - up for pancreatic acc cases, even after curative resection. this case involved a liver metastasis that was detected more than 5 years postoperatively, which is unique as hepatic metastases normally occur within a relatively short period following resection of the primary lesion [7, 8 ]. second, aggressive surgical resection combined with crt for hepatic metastasis from pancreatic acc should be considered as a treatment option in selected cases. however, the treatment strategy for metastatic or recurrent acc remains controversial even though various treatment options, including chemotherapy, crt and surgical resection, have been reported [7, 8, 10, 11, 12 ]. reported a case of hepatic metastasis from acc that was successfully treated with an aggressive surgical approach. the advantage of crt prior to surgical resection for hepatic metastasis from acc is unclear. however, a preoperative crt strategy might be beneficial especially in marginally resectable cases because a partial response to crt was observed in the case presented here. third, although multimodal approaches may be useful for selected acc cases [10, 11, 12 ], careful repeated re - evaluations during the preoperative treatment period are necessary to improve the chances for a curative resection as demonstrated by our current case, in whom the bdtt showed regrowth after a partial response to crt. further studies with a larger number of patients are required to fully understand the pathophysiology of acc and to evaluate the benefits of multimodal treatment strategies for recurrent acc. | pancreatic acinar cell carcinoma (acc) is a rare tumor, and its pathophysiology has not been well understood. treatment strategies for hepatic metastasis originating from acc remain controversial. we report the case of a 66-year - old woman who had undergone total pancreatectomy from acc 7 years prior to clinical presentation. contrast - enhanced computed tomography imaging revealed a tumorous lesion measuring 7 cm in length and 1 cm in diameter and extending along the intrahepatic bile duct (b6), which showed mild enhancement in the early phase and modest washout in the late phase. this lesion was diagnosed as hepatic metastasis primarily in the form of a bile duct tumor thrombus originating from the prior acc by the pathological evaluation of the fine needle biopsy specimen. the patient underwent preoperative gemcitabine - based chemoradiation therapy followed by subsequent surgical resection, which included subsegmentectomy (s6) of the liver and complete removal of the bile duct tumor thrombus. the patient has had no recurrence during the past 8 months since her last surgery. multimodal treatment including preoperative chemoradiation therapy might be beneficial especially for marginally resectable cases of acc. |
partial or complete portal vein thrombosis (pvt) complicates 5 - 26% of liver cirrhosis cases, and is primarily related to stagnant portal venous blood flow in the setting of portal hypertension. the presence of pvt negatively impacts liver transplant patients ; not only are auxiliary (intraoperative thrombectomy or jump graft creation) or advanced (renoportal anastomosis, cavoportal hemitransposition, and multivisceral transplantation) maneuvers required at the time of surgery depending on the extent of clot formation, but posttransplant mortality risk is also increased. preoperative management of pvt and prevention of clot propagation is thus of paramount importance in liver transplant candidates. while systemic anticoagulation may result in portal recanalization in 40 - 70% of cases, it does not improve portal hemodynamics ; thus contributing to thrombus progression in a small percentage of cases, and its use may be precluded in cirrhotic individuals with gastroesophageal variceal bleeding risk. by establishing a low pressure outflow pathway for splanchnic blood volume, transjugular intrahepatic portosystemic shunt (tips) creation can increase portal venous flow, and therefore represents an emerging approach for the dissolution of pvt in cirrhotic patients. herein, we present a series of cases highlighting the utility of tips in producing and preserving portal venous patency in liver transplant candidates. institutional review board approval is not required for small retrospective case studies at the authors hospital. four patients with liver cirrhosis and partial pvt underwent tips creation for preservation of portal venous patency for potential liver transplantation between june 2010 and january 2012. three of four patients were formally listed with the united network for organ sharing (unos) ; one patient underwent tips in anticipation of future listing. the indications for proactive early liver transplantation listing consisted of clinical signs of liver decompensation, namely occurrence of ascites and/or anasarca, in registered patients. the study cohort consisted of one man and three women of mean age 58 11 (range : 45 - 69) years. causes of underlying liver disease included nonalcoholic steatohepatitis (nash) (n = 2), nonalcoholic fatty liver disease (n = 1), autoimmune hepatitis (n = 1). child - pugh class included a (n = 2), b (n = 1), and c (n = 1) ; and mean model for end - stage liver disease (meld) score was 14 4. pvt was associated with nonocclusive superior mesenteric vein (smv) thrombus in one case and partial splenic vein clot in one case. none of the patients were on systemic anticoagulation due to grade 2 esophageal varices diagnosed endoscopically in all cases. all patients were referred to interventional radiology (ir) for tips for the specific indication to preserve portal venous patency. next, a rsch - uchida transjugular liver access set (cook medical co., bloomington in) was used to access the right portal vein. after portal vein catheterization and direct portal vein pressure measurement, balloon dilation of the hepatic parenchymal tract was performed. subsequently, an 8 (n = 1) or 10 mm (n = 3) viatorr covered stent grafts (w.l. gore and associates, flagstaff, az) were deployed across the liver tract. balloon angioplasty was performed using a 6 - 8 mm balloon. after measurement of final portal and right atrial pressures, clot dissolution techniques, including catheter - directed thrombolysis and mechanical thrombectomy, were not employed. mean initial portosystemic pressure gradient (psg) was 18 7 (range : 9 - 26) mmhg, and mean final psg was 8 1 (range : 7 - 9) mmhg. mean psg reduction was 10 8 (range : 0 - 19) mmhg. one patient developed mild hepatic encephalopathy (west haven classification system grade 1) after tips. following tips creation, patients underwent cross - sectional imaging at approximately 1-month post - procedure and then at 3 - 4 month interval to assess clot clearance and venous patency. after tips, doppler ultrasound imaging performed at median 27 79 (mean : 63) days post - procedure showed mean portal venous velocity increase from 13.5 6.7 (range : 5.521.8) cm / s to 84.9 22.2 (range : 68.0 - 116.8) cm / s, or an increase of 71.5 28.5 (range : 46.2 - 111.3) cm / s. pvt and concomitant smv or splenic vein thrombus spontaneously fully cleared in all cases within mean 79 47 (range : 16 - 124) days post - tips [figures 1 and 2 ]. although no patient has yet undergone liver transplantation to date, as only 19% of liver transplantations occur in patients with meld scores < 15 in the geographic region of our transplant center, no recurrence of pvt has been identified after mean 460 199 (range : 185 - 609) days of imaging follow - up. one patient died 620 days after tips due to sepsis. the other three patients remain alive at mean 489 123 (range : 358 - 602) days after tips. (a and b) contrast - enhanced axial magnetic resonance images reveal left intrahepatic portal vein thrombosis (arrowhead) and nonocclusive superior mesenteric vein clot (arrowhead). (c) digital subtraction venogram performed after 10 mm transjugular intrahepatic portosystemic shunt creation demonstrates widely patent shunt. (d and e) contrast - enhanced magnetic resonance images taken 4-months later displays complete recanalization of left portal vein and superior mesenteric vein (white arrowheads). (a) contrast -enhanced axial computed tomography image reveals nonocclusive thrombus at portal confluence (white arrowhead) and within splenic vein (black arrowhead). (b) digital subtraction venogram performed after 10 mm transjugular intrahepatic portosystemic shunt creation demonstrates patent shunt, and shows presence of filling defect at portal confluence (arrowhead). (c) contrast enhanced magnetic resonance images taken 6-months later displays complete recanalization of portal vein (white arrowhead) and splenic vein (black arrowhead). four patients with liver cirrhosis and partial pvt underwent tips creation for preservation of portal venous patency for potential liver transplantation between june 2010 and january 2012. three of four patients were formally listed with the united network for organ sharing (unos) ; one patient underwent tips in anticipation of future listing. the indications for proactive early liver transplantation listing consisted of clinical signs of liver decompensation, namely occurrence of ascites and/or anasarca, in registered patients. the study cohort consisted of one man and three women of mean age 58 11 (range : 45 - 69) years. causes of underlying liver disease included nonalcoholic steatohepatitis (nash) (n = 2), nonalcoholic fatty liver disease (n = 1), autoimmune hepatitis (n = 1). child - pugh class included a (n = 2), b (n = 1), and c (n = 1) ; and mean model for end - stage liver disease (meld) score was 14 4. pvt was associated with nonocclusive superior mesenteric vein (smv) thrombus in one case and partial splenic vein clot in one case. none of the patients were on systemic anticoagulation due to grade 2 esophageal varices diagnosed endoscopically in all cases. all patients were referred to interventional radiology (ir) for tips for the specific indication to preserve portal venous patency. next, a rsch - uchida transjugular liver access set (cook medical co., bloomington in) was used to access the right portal vein. after portal vein catheterization and direct portal vein pressure measurement, balloon dilation of the hepatic parenchymal tract was performed. subsequently, an 8 (n = 1) or 10 mm (n = 3) viatorr covered stent grafts (w.l. gore and associates, flagstaff, az) were deployed across the liver tract. after measurement of final portal and right atrial pressures, completion shunt venography was performed. clot dissolution techniques, including catheter - directed thrombolysis and mechanical thrombectomy, were not employed. mean initial portosystemic pressure gradient (psg) was 18 7 (range : 9 - 26) mmhg, and mean final psg was 8 1 (range : 7 - 9) mmhg. mean psg reduction was 10 8 (range : 0 - 19) mmhg. one patient developed mild hepatic encephalopathy (west haven classification system grade 1) after tips. following tips creation, patients underwent cross - sectional imaging at approximately 1-month post - procedure and then at 3 - 4 month interval to assess clot clearance and venous patency. after tips, doppler ultrasound imaging performed at median 27 79 (mean : 63) days post - procedure showed mean portal venous velocity increase from 13.5 6.7 (range : 5.521.8) cm / s to 84.9 22.2 (range : 68.0 - 116.8) cm / s, or an increase of 71.5 28.5 (range : 46.2 - 111.3) cm / s. pvt and concomitant smv or splenic vein thrombus spontaneously fully cleared in all cases within mean 79 47 (range : 16 - 124) days post - tips [figures 1 and 2 ]. although no patient has yet undergone liver transplantation to date, as only 19% of liver transplantations occur in patients with meld scores < 15 in the geographic region of our transplant center, no recurrence of pvt has been identified after mean 460 199 (range : 185 - 609) days of imaging follow - up. the other three patients remain alive at mean 489 123 (range : 358 - 602) days after tips. (a and b) contrast - enhanced axial magnetic resonance images reveal left intrahepatic portal vein thrombosis (arrowhead) and nonocclusive superior mesenteric vein clot (arrowhead). (c) digital subtraction venogram performed after 10 mm transjugular intrahepatic portosystemic shunt creation demonstrates widely patent shunt. (d and e) contrast - enhanced magnetic resonance images taken 4-months later displays complete recanalization of left portal vein and superior mesenteric vein (white arrowheads). (a) contrast -enhanced axial computed tomography image reveals nonocclusive thrombus at portal confluence (white arrowhead) and within splenic vein (black arrowhead). (b) digital subtraction venogram performed after 10 mm transjugular intrahepatic portosystemic shunt creation demonstrates patent shunt, and shows presence of filling defect at portal confluence (arrowhead). (c) contrast enhanced magnetic resonance images taken 6-months later displays complete recanalization of portal vein (white arrowhead) and splenic vein (black arrowhead). the success of tips in the management of portal hypertensive complications has prompted translation of this procedure from traditional indications, such as medically refractory gastroesophageal variceal hemorrhage and intractable ascites or hepatic hydrothorax, to newer indications, such as early use in variceal bleeding patients. in this vein, the application of tips for the treatment of pvt represents another developing indication for this procedure, and may enhance the care of liver transplant candidates by ensuring conventional operative approaches to transplantation, which may be significantly complicated or even precluded in the setting of partial or complete pvt, as well as optimizing posttransplant survival, which is negatively impacted by pvt. in the current case series, partial pvt was successfully cleared from the portal venous system as well as the superior mesenteric and splenic veins using tips to enhance portal venous flow. although the biochemistry of fibrinolysis is well - described, the role of hemodynamic factors in this process is often neglected. originally described by virchow, flow stasis contributes to vascular thrombosis by reducing laminar clearance of local thrombin and fibrin monomer. experimental and mathematical models have demonstrated that the shear forces exerted by circulating blood promote mechanical dissolution of nonocclusive thrombi. higher velocity blood flow results in increased rates of mechanical degradation, as well as increased deposition of physiologic fibrinolytic agents. in the cases herein, portal venous flow was increased more than five - fold after tips to a mean of greater than 80 cm / s ; normal portal venous flow velocity approximates 16 - 40 cm / s. the increased portal venous flow following tips creation may resolve any extant thrombus and obviate the need for concomitant use of anticoagulation and/or mechanical or thrombolytic techniques. as a final note, because complete pvt may damage vascular endothelium and increase probability for recurrent clot formation, early tips intervention should be considered while pvt is partial or nonocclusive to avert this risk. our experience with flow - enabled pvt dissolution is corroborated by other series describing the effectiveness of tips in promoting portal venous patency. two studies have addressed the specific application of tips for maintenance of portal venous patency in liver transplant patients. in 2012, davola., reported 100% portal vein patency in 15 patients with main trunk or branch vessel partial pvt who underwent tips followed by orthotopic liver transplantation (olt) at median 185 days postprocedure. in that study, a control group of eight patients with similar nonocclusive pvt who did not undergo tips showed 50% portal vein patency at olt performed at median 213 days after pvt diagnosis. in 2006,, reported nearly 90% improvement in portal venous patency 2 - 45 months post - tips for treatment of varying degrees of nonocclusive pvt. the findings of these studies are further supported by report of at least one individual case describing use of tips to keep the portal vein open for liver transplantation. other large studies have confirmed the utility of tips in treating pvt in cirrhotic patients without specific intent as a bridge to liver transplantation. in 2011, luca., described 87% patency improvement (complete recanalization in 57%) among 70 patients with nontumoral pvt who underwent tips. in 2011, han., reported 100% portal venous patency after tips in 43 patients with varying degrees of pvt. once a contraindication to tips creation, pvt may now represent an unequivocal procedural indication for tips given the efficacy demonstrated in such investigations. the benefits of tips for clearance of pvt must be weighed against possible risks. when performed by experienced operators in properly selected candidates tips complications that particularly affect subsequent transplantation are uncommon, and the presence of tips does not typically impact operative technique or result in detrimental effects on posttransplant patient clinical outcomes. as a matter of caution, ir operators should take great care in proper stent length selection as well as device deployment, as shunt extension into the portal vein or hepatic level inferior vena cava (ivc) and right atrium, either due to device misplacement or migration, may leave inadequate room for vascular cross - clamping at the time of surgery. in conclusion, we describe four cases of partial pvt in liver transplant candidates successfully cleared after tips creation. in all cases, portosystemic shunting of blood resulted in rapid and effective flow - enabled clearance of clot and intermediate to long - term preservation of vessel patency. while our clinical observations are made on the basis of a small sample size and should thus not be overstated, the findings herein are corroborated by other studies presenting similar findings, and affirm the utility of tips for maintenance of portal venous patency prior to liver transplant and highlight this application as an emerging indication for tips. | maintenance of portal venous patency is vital to liver transplant candidates, as the presence of portal vein thrombosis (pvt) adversely impacts clinical outcomes by increasing surgical complexity and decreasing postoperative survival. by enhancing portal venous blood flow, transjugular intrahepatic portosystemic shunt (tips) creation may enable clearance of pvt and preservation of portal venous patency in cirrhotic patients. herein, we describe four cases in which tips produced and sustained an open portal venous system in liver transplant candidates with partial pvt. all patients demonstrated rapid and effective flow - enabled clearance of clot and intermediate to long - term preservation of portal venous flow. on this basis, we propose that maintenance of portal venous patency in liver transplant candidates with partial pvt represents a developing indication for tips. |
lung abscess literally means a collection of pus within a destroyed portion of the lung. therefore, the basic treatment of lung abscess consists of drainage and antibiotic therapy, which are the cornerstones of appropriate nonoperative management, with surgery reserved for special circumstances. bronchoscopy has proved a most valuable adjunct in the diagnosis and treatment of pulmonary cavitary disease. in 1936, goldman, and a few years later jackson and judd reiterated the value of bronchoscopy in the treatment of lung abscess. they, using a rigid bronchoscope, showed that bronchoscopic measures were considered to play an indispensible role in diagnosis and to constitute an integral part of both the nonsurgical and surgical treatment of pulmonary abscess. allen and blackman, in a collective review of 1086 cases of medically treated abscesses, found some 650 cases treated primarily by repeated bronchoscopic aspirations with a cure rate of 61%. metras and chapin reported a 72.5% success rate with frequent bronchoscopic drainage and direct antibiotic instillation into the abscess cavity. the methods of bronchoscopic drainage in lung abscess have been either simple conventional aspiration through a connecting bronchus or the recently introduced transbronchial catheter drainage via a rigid bronchoscope. there have been debates on the usefulness and potential hazard of performing fiberoptic bronchoscopy in lung abscess, but the application of fiberoptic bronchoscopy is widened by virtue of improved skill and instrumentation. we have recently adopted a technique which involves the introduction of a flexible polyethylene catheter through a fiberoptic bronchoscope into the bronchus of the involved bronchial segment. the aim of this article is to review the technique, to evaluate the therapeutic efficacy in clinical practice and to determine its safety. among 39 patients in whom fiberoptic bronchoscopy was performed from march 1986 through october 1988, with cavitary pulmonary lesions on roentgenograms and a discharge diagnosis of lung abscess at seoul national university hospital, 11 patients were analyzed in this article. those abscesses occurring in potential spaces of the pleural cavity, such as blebs or bullae, and in congenitally sequestered lung were excluded. similary, cavitary carcinoma (lung carcinoma with central necrosis) and lung abscess occurring distal to an obstructing endobronchial tumor or foreign body were also excluded. on admission to the hospital, all patients had chest roentgenograms (posteroanterior and lateral) and cultures of expectorated sputum for bacteria, fungi and acid - fast bacilli were performed. after cultures, various antimicrobial combination therapies with penicillin, clindamycin, aminoglycoside or cephalosporin were empirically started with postural drainage and chest physiotherapy according to the location of lung abscess by chest roentgenograms. subsequently, the selection of antibiotics was optimally changed on the basis of the identification of the offending organism and its in vitro antibiotic susceptibility patterns. the body temperature and other clinical manifestations were checked daily and chest roentgenograms were followed at 24 or 48 hour intervals. among 39 patients, we tried transbronchial catheterization in 11 patients with intractable lung abscess. intractable lung abscess was arbitrarily defined as a cavitary lesion with poor clinical and radiological response in spite of aggressive attempts at postural drainage, chest physiotherpy and adequate antibiotic therapy for a week or more. the remaining 28 patients underwent bronchoscopy after clinical and radiological improvements for the purpose of ruling out malignancy or associated tuberculosis. following local anesthesia by spraying the nasal mucosa and oropharynx with 4% lidocaine, transnasal insertion of a two - channeled olympus bf-2t10 bronchoscope was introduced into each subsegment of the involved segment which was determined by radiological localization before the procedure, two patients needed biplane fluoroscopy for the confirmation of correct catheter position, but 8 did not. then, aspiration by a 30cc syringe attached to the external opening of the catheter was done. if aspiration was inadequate, we tried the catheterization repeatedly up to three or four times with to and fro movements. the aspirated material was sent to the laboratories for cultures of bacterial and acid - fast bacilli, and for cytology. after the bronchoscopy, chest roentgenograms were checked within 12 hours and the patients were carefully observed as to whether hemoptysis or respiratory failure occurred as a complication of the bronchoscopic procedure. the antimicrobial therapy was continued until radiographic changes were cleared or there was only a small stable lesion. the cavity sizes of these patients were more than 8 cm in diameter while those of the others were less than 6 cm. the air - fluid levels in the former were higher than two - thirds of the cavity. age and the location of abscess were not related to the efficacy of this procedure. as shown in table 2, prolonged antibiotic therapy after the catheter drainage was necessary even in the successful group, suggesting that antibiotic therapy without drainage is ineffective in lung abscess. in regard to complications, minute hemoptysis occurred in 5 patients and stopped spontaneously within 48 hours. hemoptysis was not related to the amount of aspirated pus but might have been due to irritation of the abscess wall by the catheter tip. aside from the therapeutic results, 1 was chocolate - colored and he was diagnosed as having lung abscess secondary to the rupture of amebic liver abscess which had not been suspected. although significant improvements in the curability rate have been achieved with the introduction of penicillin and other antibiotics, lung abscess still constitutes a serious illness with a significant morbidity and mortality rate, and therapeutic effects are lost unless the cavity is adequately evacuated. the percutaneous needle drainage of lung abscess is now rarely used because it carries a risk of contaminating the pleural space, resulting in empyema. however, it is probably indicated in an elderly debilitated patient who is unresponsive to the usual medical measures and is too acutely ill to withstand any other procedure. accurate localization of the involved bronchial segment can be made, thereby assuring good postural drainage. in patients with hemoptysis in addition, underlying obstructing lesions, such as tumors or foreign bodies, can be ruled out. the advantage afforded by precise identification of the infectious agent followed by initiation of proper systemic antibiotic therapy makes bronchoscopy a vital component of the treatment regimen. but, if drainage is not adequate with these maneuvers, the patient should be bronchoscoped. both the fiberoptic and rigid bronchoscope are effective in the treatment of lung abscess. however, in spite of widespread use, there has been no well described report of successful drainage through a flexible fiberoptic bronchoscope in the patients with lung abscess. the reason may be that the bronchoscopic procedure in lung abscess has been considered to be relatively contraindicated due to the risk of endobronchial dissemination of evacuated pus or life - threatening hemoptysis. stated that patients with a very large abscess and those with hemoptysis ideaslly should be bronchoscoped with the rigid instrument because this assured satisfactory evacuation of a large amount of expectorated infected material and blood. but, when compared with the flexible fiberoptic bronchoscope, the rigid bronchoscope has a number of significant disavantages including discomfort to the patient when performed under local anesthesia, increased cost and risk when a general anesthetic is employed, limited range of vision, and unusability in patients being mechanically ventilated or when disease or trauma involves the skull, jaw or cervical spine. connors, groff, and their associates have utilized coronary angiocatheters threaded through the rigid bronchoscope into the involved bronchial segments under topical or general anesthesia. they suggested that it was particularly useful in occasional patients with edematous and deformed bronchial orifices which are difficult, or even impossible, to enter with suction apparatus. connors had tried this technique with the use of a fiberoptic bronchoscope in pulmonary abscess, but he said it was disappointing. not all of our trials were successful, but without great difficulty we could introduce the instrument through a fiberoptic bronchoscope into an appropriate site within the bronchus to provide satisfactory drainage. except in 2 cases, we did not use fluoroscopy or portable chest roentgenograms routinely for confirmation of the correct catheter position. however, both precise localization by chest roentgenograms prior to the bronchoscopy and the return of a large amount of purulent material on aspiration usually indicated that the catheter was correctly positioned. our overall results show that transbronchial catheter drainage through a fiberoptic bronchoscope in lung abscess can be applied to cases of a) persisting fever and significant toxicity without response to combined postural drainage and appropriate antibiotic therapy after at least 1 week, and b) the very large and toxic lung abscess with a high air - fluid level in the cavity. | the use of the fiberoptic bronchoscope as a drainage procedure for lung abscess has become more and more widespread. we have recently adopted the technique of inserting a simple polyethylene catheter through the flexible fiberoptic bronchoscope into the abscess cavity of 11 patients with lung absess. all cases had not responded to aggressive postural drainage and adequate antibiotic therapy for at least a week. the results were as follows : among 11 patients, the therapeutic response was dramatic in 6 patients.in the successful group, the abscess sizes were greater than 8 cm in diameter and the air - fluid levels were higher than two - thirds of the cavity.additional diagnoses, other than bacterial lung abscess, could be made in 2 cases when otherwise the diagnosis would have remained in doubt.the authors suggest that catheter drainage via fiberoptic bronchoscpope is an effective treatment modality in the large lung abscess with a high air - fluid level which is intractable to other medical approaches, and it is also a safe procedure. |
a parotid fistula is a rare and extremely unpleasant complication following surgery in the maxillofacial region. parotid fistulae have been reported following surgery in the temporomandibular joint (tmj) region, parotidectomy or secondary to drainage of facial / parotid abscess, and the incidence reported is as high as 14%. other causes of parotid fistulae include mandibular osteotomy,[13 ] use of external pin fixation and as a complication of facial fractures. although there is consensus in the literature that acute parotid injury must be explored primarily and all injured structures be repaired accurately, the treatment of the chronic injury is controversial. numerous methods of treatment, conservative as well as aggressive, have been described with varying success and morbidity. management options include pressure dressings and use of antisialagogues, total parotidectomy, tympanic neurectomy, intraoral transposition of parotid duct, radiation therapy, use of botulinum toxin a,[1012 ] and use of fibrin glue. in this paper we describe a simple but effective method of treating this complication with the use of hot hypertonic saline. a 38-year - old man reported to the department of oral and maxillofacial surgery with a history of fall. he was thoroughly investigated and open reduction and internal fixation was done under general anesthesia. a mini - retromandibular approach was used for the fixation of the subcondylar and angle fracture, while parasymphysis fracture was reduced intraorally. on the seventh postoperative day, a diffuse swelling was observed in the left parotid region and on compressing the swelling ; a watery, odorless discharge was seen from the sutured surgical wound [figure 1 ]. lateral view of parotid fistula swelling (a), frontal view of the parotid fistula swelling (b), frontal view of the parotid fistula swelling (c), collection from the parotid fistula swelling (d), disappearance of the swelling 12 days after hypertonic saline therapy (e) a diagnosis of parotid fistula was made on the basis of history, location of swelling and clinical inspection of the discharge. the pressure dressing was applied for first four days after the aspiration along with antisialagogues and antibiotics. a 3% hypertonic saline was poured in a clean steel bowl and was heated to a temperature of 60 degree in an autoclave previously set at the required temperature. five milliliter of this hypertonic solution was injected into the parotid through fistulous opening, followed by pressure dressing. the patient did not show any signs of swelling or salivary leak as the fistula closed spontaneously. pressure dressings and use of antisialagogues cause fibrosis of the gland in 2 to 3 weeks ; hence closure of fistula in 4 days was attributed to warm hypertonic saline injections. a 27-year - old male was treated with orif for right subcondylar fracture via retromandibular approach. again discharge of colorless, odorless watery fluid from right parotid region was noticed after second postoperative day, diagnosis of parotid fistula was made and treated with hypertonic saline injections. warm hypertonic saline (60c) was injected after flushing with betadine followed by pressure dressing and antisialagogue drugs were given for 5 days. on the fifth day of this course the fistulous tract healed spontaneously and there were no associated complications. patient is on continuous follow - up since 3 months and there are no complications reported till date [figure 2 ]. one week post op parotid fistula (a), four week postoperative picture with complete healing (b) a 20-year - old patient who was treated for subcondylar fracture via retromandibular approach reported to the department with chief complaint of watery discharge in preauricular region, which increased while having food. it was diagnosed with parotid fistula on right side. the same treatment protocol of using hypertonic saline was followed. hypertonic saline was injected everyday for four days, after flushing with betadine, pressure dressing was applied. on the fifth day fifth day postop with the draining fistula (a), 8 weeks postoperative picture with complete healing (b) a 38-year - old man reported to the department of oral and maxillofacial surgery with a history of fall. he was thoroughly investigated and open reduction and internal fixation was done under general anesthesia. a mini - retromandibular approach was used for the fixation of the subcondylar and angle fracture, while parasymphysis fracture was reduced intraorally. on the seventh postoperative day, a diffuse swelling was observed in the left parotid region and on compressing the swelling ; a watery, odorless discharge was seen from the sutured surgical wound [figure 1 ]. lateral view of parotid fistula swelling (a), frontal view of the parotid fistula swelling (b), frontal view of the parotid fistula swelling (c), collection from the parotid fistula swelling (d), disappearance of the swelling 12 days after hypertonic saline therapy (e) a diagnosis of parotid fistula was made on the basis of history, location of swelling and clinical inspection of the discharge. the pressure dressing was applied for first four days after the aspiration along with antisialagogues and antibiotics. a 3% hypertonic saline was poured in a clean steel bowl and was heated to a temperature of 60 degree in an autoclave previously set at the required temperature. five milliliter of this hypertonic solution was injected into the parotid through fistulous opening, followed by pressure dressing. the patient did not show any signs of swelling or salivary leak as the fistula closed spontaneously. pressure dressings and use of antisialagogues cause fibrosis of the gland in 2 to 3 weeks ; hence closure of fistula in 4 days was attributed to warm hypertonic saline injections. a 27-year - old male was treated with orif for right subcondylar fracture via retromandibular approach. again discharge of colorless, odorless watery fluid from right parotid region was noticed after second postoperative day, diagnosis of parotid fistula was made and treated with hypertonic saline injections. warm hypertonic saline (60c) was injected after flushing with betadine followed by pressure dressing and antisialagogue drugs were given for 5 days. on the fifth day of this course the fistulous tract healed spontaneously and there were no associated complications. patient is on continuous follow - up since 3 months and there are no complications reported till date [figure 2 ]. one week post op parotid fistula (a), four week postoperative picture with complete healing (b) a 20-year - old patient who was treated for subcondylar fracture via retromandibular approach reported to the department with chief complaint of watery discharge in preauricular region, which increased while having food. it was diagnosed with parotid fistula on right side. the same treatment protocol of using hypertonic saline was followed. hypertonic saline was injected everyday for four days, after flushing with betadine, pressure dressing was applied. on the fifth day fifth day postop with the draining fistula (a), 8 weeks postoperative picture with complete healing (b) the surgical techniques can be classified as those that divert parotid secretions into the mouth and those that depress parotid secretion either by ductal ligation or nerve sectioning. conservative approaches include attempts to depress secretion by antisialagogues or radiotherapy [table 1 ]. management of parotid sialoceles and fistulae - a classification of reported methods in the literature (parekh 1989) the major problem with techniques attempting to divert secretions into mouth with reconstructive surgery has been the difficulty in identifying the proximal duct in the extensive scarring that forms around the fistula with its associated significant risk of damage to the facial nerve. parotidectomy has also been discouraged as a treatment modality as postoperative facial palsy is seen in 75% of cases. low - dose radiotherapy for the treatment of parotid fistula is validated because parotid secretions are reduced after radiotherapy but because of its long - term ill effects it is not the preferred method of treatment. tympanic neurectomy appears to be a satisfactory method of dealing with selected parotid duct fistulas, and glandular fistulas are best treated by tympanic neurectomy. suppression of parasympathetic activity by the use of tympanic neurectomy has been said on some occasions to be transient (for example, frey 's syndrome). pressure dressings lead to atrophy of the gland as the lobules of the gland are contained in relatively inelastic capsule. the sustained rise in ductal pressure leads to compression of capillaries and veins, resulting in decrease in secretion and atrophy of gland. absence of reflex stimulation from mastication and chemical stimuli minimizes parotid secretions and allows healing of injured duct, but this method requires maximum patient compliance for prolonged time. anticholinergic drugs are unlikely to be useful if used alone and are associated with numerous side effects like urinary retention, xerostomia, nausea, vomiting, vision disturbances etc. botulinum toxin a has been used nowadays but it has a latency period and requires repeated injections for desired effects and the effects may not last long enough to bring about complete remission of disease. moreover it is a costly procedure. fibrin glue has also been used recently ; however, it is said that fibrin glue is rendered inactive by saliva leading to recurrence of fistula. it has also been used for the treatment of varicose veins as an alternative to surgery ; and in the head and neck region for treatment of venous malformations with good results. thermodynamic and physicochemical calculations suggest that these solutions work by causing conformational denaturation of the cell membrane proteins in situ and saline can be diluted to a point where there will be no cellular toxicity. the temperature of the saline can be raised above body temperature (60 degree) to enhance the fibrosing property of physiologic saline. hot hypertonic saline can be used for the purpose of fistula closure because it is cost effective, causes no foreign body reaction or hypersensitivity reaction to the patients, easily available, non - toxic and non - irritant to the surrounding structures. there are no chances of inadvertent injury to facial nerve and its branches and serves the purpose of causing fibrosis of gland parenchyma and spontaneous closure of fistula with no complications. | parotid fistula is a very rare, unpleasant and painful complication following surgery in the maxillofacial region. although there is consensus in the literature that acute parotid injury must be explored primarily and all injured structures be repaired accurately, the treatment of the chronic injury is controversial. numerous methods of treatment, conservative as well as aggressive, have been described with varying success and morbidity. this paper presents a simple but effective and conservative method of treating this complication with the use of hot hypertonic saline. |
figure 6 outlines the fabrication process of our devices. we start with a commercial silicon on insulator (soi, from soitec) substrate with a 340 nm p - type (7 10 cm) si layer on top of a 2 m buried oxide (box). first, a 100 nm sin mask is deposited by plasma enhanced chemical vapor deposition (pecvd, oxford plasmalab100) onto the soi substrate at 300 c (figure 6b). next, a si photonic waveguide and the pd area are defined by electron beam lithography (ebl, raith eline 150) using positive e - beam resist (zep 520a). the ebl pattern is subsequently transferred to sin by reactive ion etching (rie) (oxford plasmalab 100) with a chf3/o2 gas mixture. then the soi substrate is locally oxidized (wet, 1000 c) to grow a sio2 layer only in localized patterns defined by ebl where si is exposed to o2, while at the same time a sin mask prevents o2 diffusion into the si in protected areas (figure 6c). after oxidation, the sacrificial sin mask layer is etched in hot phosphoric acid (h3po4, 180) followed by sio2 removal in a buffered oxide etch (boe) solution. the ohmic contact to si is realized by al evaporation followed by metal lift - off and thermal alloying at 460 c in a forming gas (h2/n2, 5%/95%) environment. this fabrication process is based on the technique of local - oxidation of si (locos) in which a si waveguide is defined by oxide spacers rather than rie. the locos process enables the realization of low - loss (0.3 db / cm) si photonic waveguides coupled to a schottky pd using the same fabrication step. fabrication process of si slg schottky pds integrated with photonic waveguides. (a) planar soi substrate ; (b) pecvd deposition and patterning of sin mask ; (c) local oxidation ; (d) etching of sin and sio2 al ohmic contact to si ; (e) slg transfer ; (f) formation of schottky contact and consequent slg etching. slg is grown on a 35 m cu foil following the process described in ref (98). the substrate is annealed in hydrogen atmosphere (h2, 20 sccm) up to 1000 c for 30 min. the substrate is subsequently cooled in vacuum (1 mtorr) to room temperature and removed from the chamber. after growth, the quality and uniformity of slg are monitored by raman spectroscopy using a renishaw invia equipped with a 100 objective (numerical aperture na = 0.85). the raman spectrum of slg on cu at 514 nm is shown in figure 7b (green curve). the 2d peak is a single sharp lorentzian with full width at half - maximum, fwhm(2d) 29 cm, a signature of slg. different (20) point measurements show similar spectra, which indicate uniform quality. the position of the g peak, pos(g), is 1589 cm, with fwhm(g) 13 cm. the 2d peak position, pos(2d) is 2698 cm, while the 2d to g peak intensity and area ratios, i(2d)/i(g) and a(2d)/a(g), are 2.6 and 5.8, respectively, indicating a p - doping 300 mev, which corresponds to a carrier concentration 5 10 cm. (a) raman spectra of (red curve) si substrate and (black curve) slg transferred on si. (b) raman spectra of (green curve) slg on cu, and (blue curve) after normalized, point - to - point subtraction of the si substrate spectrum (shown in (a), red curve) from the spectrum of slg transferred on si (shown in (a), black curve). a 500 nm thick layer of poly(methyl methacrylate) (pmma) is spin coated on the slg / cu sample and then placed in a solution of ammonium persulfate (aps) in di water until cu is completely etched. after cu etching, the pmma membrane with attached slg is transferred to di water for cleaning aps residuals. to obtain a schottky interface between the si waveguide and slg without the native oxide layer, we perform the transfer in diluted hydrofluoric acid (hf) and di water (1:100). after cleaning from aps residuals, a slg / pmma membrane is placed on a plastic beaker containing 5 ml/500 ml hf and di water. next, the target soi chips are first dipped in boe for 5 s to etch the si native oxide and then used to lift the floating slg / pmma membrane from diluted hf. as a result, during drying, the presence of hf at the slg / si interface prevents si oxidation and allows formation of oxide free slg / si schottky contacts. after drying, pmma is removed in acetone, which leaves slg to entirely cover the soi. we also transfer slg from the same cu foil with the same transfer procedure onto si. the raman spectrum of slg transferred on si is shown in figure 7a (black line). this is measured at 514.5 nm and with laser power below 300 w to avoid possible heating effects or damage. the d peak region overlaps the bands at 12001500 cm, attributed to third order raman scattering from to phonons in the si substrate. the peaks at 1550 and 2330 cm in the raman spectrum of si substrate (red line) arise from molecular vibrations of ambient oxygen (o2) and nitrogen (n2). the raman spectra of the transferred slg film (black line) and reference si substrate (red line) are acquired using identical exposure time and laser power. after the intensity of the third order si peak at 1450 cm in the si reference spectrum (red line) is normalized to the same peak in the spectrum of the transferred slg film (black line), a point - to - point subtraction is implemented (figure 7b, blue line). the 2d peak retains its single - lorentzian line - shape with fwhm(2d) 33 cm, validating that slg has been successfully transferred. pos(g) 1584 cm, fwhm(g) 17 cm, and pos(2d) 2687 cm, while i(2d)/i(g) and a(2d)/a(g) are 3.2 and 5.9, respectively, suggesting a p - doping 4 10 cm (200 mev). after slg transfer, we use an additional ebl step followed by o2 plasma etching to selectively remove slg from the substrate area containing five waveguides and dedicated to the reference m si devices. then a schottky contact is prepared by evaporation and liftoff of an 3 nm/100 nm cr / au metal strip intersecting the si waveguide with slg on top (figure 6f) (or without slg for reference devices) and forming a schottky interface for photodetection. finally, the samples are placed in a reactive o2 plasma to remove superfluous slg. the tfe current is given by1where a is the effective richardson constant, k is the boltzmann constant, t is the temperature, and q is the electron charge. the contribution of tfe to charge injection across the m si interface can be evaluated by comparing the thermal energy kt to e00, defined as2where is the reduced planck constant, n is the si doping, m is the effective mass of the charge carriers in si, and s is the dielectric permittivity of si. when kt e00, the tfe process mainly contributes to charge carriers injection across the schottky interface. the parameters e0 and are analytically defined as34 in our case, for si doping 7 10 cm using eq 2, we get e00 45 mev, comparable to the thermal energy at room temperature of 26 mev, reflecting a significant tfe contribution to carriers injection at the schottky interface. | we report an on - chip integrated metal graphene silicon plasmonic schottky photodetector with 85 ma / w responsivity at 1.55 m and 7% internal quantum efficiency. this is one order of magnitude higher than metal silicon schottky photodetectors operated in the same conditions. at a reverse bias of 3 v, we achieve avalanche multiplication, with 0.37a / w responsivity and avalanche photogain 2. this paves the way to graphene integrated silicon photonics. |
ischemic stroke is a disease with substantial etiologic heterogeneity, including large artery atherothrombotic disease, small artery atherothrombotic disease, cardioembolism, and other subtypes. hmg - coa reductase inhibitors, or statins, are established therapeutic agents for the prevention of atherosclerotic - based large or small vessel vascular events. indeed, in a randomized trial assessing the impact of statin use on recurrent vascular events of atherosclerotic origin, the stroke prevention by aggressive reduction in cholesterol levels (sparcl) study, high dose atorvastatin significantly reduced the risk of recurrent stroke as well as recurrent major vascular events. however, in order to target recent stroke patients with atherosclerotic disease, sparcl excluded patients with atrial fibrillation. based on published data, it remains unclear as to whether statin therapy should be applied to the substantial numbers of ischemic stroke patients who have atrial fibrillation as an identified potential mechanism of their event, including patients with and without hypercholesterolemia and patients with and without evidence of tandem large or small vessel atherosclerotic disease. as far as we are aware, there are no ongoing clinical trials designed to address this issue. clarifying whether statins are beneficial in atrial fibrillation patients with ischemic stroke would assist with a common management dilemma. among ischemic stroke patients in the taiwan stroke registry, 16.5% had atrial fibrillation, and 49.4% had dyslipidemia, with 8% of these patients having both atrial fibrillation and hypercholesteremia. beside their effect of lowering cholesterol to mitigate symptomatic atherosclerosis, statins have pleiotropic antithrombotic, anti - inflammatory, and additional actions that also may be beneficial in lowering vascular risk in patients with atrial fibrillation. for instance, atrial fibrillation upregulates cd40 expression and platelet adhesion to the endocardium, and simvastatin is effective in modulating this expression, potentially reducing the risk of intra - atrial thrombus formation. also, a randomized controlled trial enrolling 34 elderly patients with atrial fibrillation showed that intensive cholesterol lowering with atorvastatin significantly reduced inflammation and was accompanied by reduced thrombin generation. to investigate whether statin therapy can influence the prognosis, such as recurrent stroke and mortality, in recent ischemic stroke patients with atrial fibrillation, we conducted a retrospective cohort study in taiwan using the national health insurance research database (nhird). taiwan implemented a single - payer, compulsory national health insurance program in 1995, which includes reimbursement of outpatient visits, hospital admissions, and prescriptions for 99% of the taiwanese population. all contracted institutions must file claims according to standard formats, which later are archived in the nhird. we identified all hospitalized patients (18 years) who were admitted with a primary diagnosis of ischemic stroke (international classification of diseases, ninth revision (icd-9) codes 433, 434, 436) for the first time between 2001 and 2011. only patients who had atrial fibrillation (icd-9 code 427.31) documented prior to the index stroke or in a list of hospitalization diagnoses during the index stroke admission were included in our analysis. in order to show the effect of statin therapy, patients were excluded if they had a recurrent stroke 90 days after the index stroke or follow - up 90 days. we also excluded patients who undergo hemodialysis because it is still unclear whether statin is benefit for these patients. patients receiving at least 30 days of statin therapy within 90 days after the index stroke were categorized in the statin group, whereas patients not receiving any statin therapy within 90 days were categorized in a comparison group. patients receiving some statin therapy, but less than 30 days, within 90 days after index stroke were excluded. during the study period, the national reimbursement policy for statin prescriptions supported statin prescriptions for patients with total cholesterol 200 mg / dl or low - density lipoprotein cholesterol 130 mg / dl. comorbidities were identified using icd-9 codes based on coding of concomitant diagnoses during the index stroke admission and on coding for outpatient visit before the index stroke. heart failure was diagnosed solely from the hospitalization diagnoses since coding for this diagnosis is less reliable in the outpatient setting in taiwan. the stroke severity index, which was developed specifically to evaluate the severity of strokes in taiwan nhird, was used to generate an estimated national institutes of health stroke scale (e - nihss) score for the index stroke. the pearson correlation coefficient between the e - nihss and the nihss real scores was 0.742 (95% ci : 0.736, 0.747). patients not treated with statins in the first 90 days after the index stroke were matched to patients treated with statins in the first 90 days in a 2:1 ratio on the basis of age, sex, hypertension, diabetes mellitus, ischemic heart disease, heart failure, e - nihss, use of anticoagulant (warfarin, dabigatran, and rivaroxaban) in the first 90 days after index stroke, and year of their entry into the cohort. the study protocol was approved by the institutional review boards of chang gung memorial hospital. the primary outcome of this study was the first event of recurrent stroke (combined endpoint of ischemic and hemorrhagic stroke), validated by the use of brain computed tomography or magnetic resonance imaging. the requirement for imaging served to exclude stroke patients who were hospitalized solely for rehabilitation during chronic stage. the leading secondary outcome was in - hospital death, defined as any death during a hospitalization during the follow - up period. additional outcomes were hemorrhagic stroke (icd-9 codes 430432), ischemic stroke (icd-9 codes 433434, 436), fatal stroke, myocardial infarction (icd-9 code 410), and major adverse cardiovascular events (comprised of any ischemic or hemorrhagic stroke, and myocardial infarction). causes of death were defined according to the primary diagnosis of the hospitalization during which the death occurred. fatal stroke was defined as in - hospital death during the first recurrent ischemic or hemorrhagic stroke. cardiovascular death was defined as in - hospital death caused by stroke (icd-9 codes 430438), ischemic heart disease (icd-9 codes 410414), cardiac arrhythmia (icd-9 codes 425427), or heart failure (icd-9 code 428). noncardiovascular death was defined as in - hospital death with primary diagnosis other than cardiovascular death. we also analyzed the subgroup of patients not having diabetes mellitus at baseline to see whether statin therapy was associated with increased incident diabetes mellitus. the follow - up period for outcome events started from the date of index stroke to the date of last medical claim, stroke recurrence, death during any hospitalization, or the end of 2012, whichever came first. the association between statin therapy and recurrent stroke in stroke patients with atrial fibrillation was analyzed using the cox proportional hazards model and presented as hazard ratios (hr) with 95% confidence intervals (95% ci), and so did subgroups and interactions. all statistics analyses were performed with sas statistical software, version 9.2 (sas institute inc., cary, nc). a 2-sided p value 15) in 28%. the baseline characteristics were not different between the 2 groups as the result of matching. in the early statin group, 3.8% of subjects had received 2 or more statins during the first 90 poststroke days. the follow - up period was from 0.3 year to 12 year (median 2.4 years ; interquartile range 1.34.1 years). during this period the results revealed no difference in stroke recurrence between early as far as statin - users and early nonusers (hr = 1.01, 95% ci 0.881.15, p = 0.92). for the secondary endpoint, early statin use was associated with lower frequency of death during any hospitalization throughout the long - term follow - up period (hr = 0.74, 95% ci 0.610.89, p < 0.01) (table 2). this difference was due to a reduced rate of noncardiovascular death (hr = 0.70, 95% ci 0.560.86, p < 0.01) causes of noncardiovascular death in the 2 groups are shown in table 3. the effects of statin therapy were similar across the additional endpoints, including ischemic stroke, intracerebral hemorrhage, fatal stroke, myocardial infarction, and major adverse cardiovascular events. among patients not having diabetes mellitus at baseline, early post - stroke statin therapy cox proportional hazard models for primary and secondary end points by statin group vs comparison group. the effects of early statin therapy were consistent across subgroups of age, sex, calendar year, chads2 score, and presenting stroke severity (fig. no subgroup was identified that either differentially benefitted from statins in preventing recurrent stroke or differentially failed to benefit from statins in preventing in - hospital death. subgroup analysis for recurrent stroke (a) and in - hospital death (b) between statin and comparison groups. in this analysis of a nationwide cohort study of stroke patients with atrial fibrillation, we found that statin therapy within 3 months of index stroke failed to reduce recurrent stroke risk in the average 3-year follow - up period. however, statin therapy was associated with reduced risk of future in - hospital death, especially of noncardiovascular death. prior randomized trials and observational studies that have shown a benefit of statin therapy in reducing recurrent stroke have focused upon patients whose index ischemic stroke was due to large or small artery atherosclerosis. in sparcl, statin therapy was associated with a reduction in recurrent stroke risk among patients with index ischemic stroke presumed to have occurred owing to atherosclerotic causes. meta - analyses of statin therapy have also confirmed a beneficial effect of statin therapy in atherosclerotic ischemic stroke patients with regard to stroke recurrence. however, these studies generally excluded patient with atrial fibrillation. in this study, we focused on ischemic stroke patient with atrial fibrillation and found no significant difference between the early statin and nonstatin groups in stroke recurrence. in patients with previous stroke or transient ischemic attack, 2.4% annual recurrent stroke or systemic embolism occurred in the apixaban group, whereas 9.2% annual recurrent stroke or systemic embolism occurred in the aspirin group in a randomized controlled trial. about 40% patients in this study received anticoagulant therapy, mostly warfarin, at baseline and the annual recurrent stroke risk was 8.0%. it was not unreasonable that the annual recurrent stroke risk in this study was higher than patients receiving apixaben in a randomized controlled trial. our findings of an association of statin use with reduced mortality are consonant with some prior studies. several observational studies found that statin treatment is associated with reduced overall mortality in patients with ischemic stroke. also, a cohort study indicated that statins were associated with lower mortality among patients with atrial fibrillation with or without stroke who were less than 80 years old. recently, the results of 2 hospital - based studies showed that statin treatment was independently associated with reduced mortality specifically in patients with atrial fibrillation - related stroke. the mechanisms by which statins may reduce all - cause mortality have not been investigated in detail. prior studies reporting reduced mortality in atrial fibrillation patients with initial ischemic stroke did not explore whether the effect was mediated by reductions in cardiovascular death, noncardiovascular death, or both. choi and colleagues reported that statins did not reduce the rate of recurrent stroke among atrial fibrillation patients, suggesting that the reduced mortality was not due to reduction in fatal recurrent strokes. we found that lower in - hospital death in the statin therapy group was largely driven by lower noncardiovascular death (e.g., respiratory complication). one prior study has found a reduced risk of pneumonia in thrombolyzed stroke patients when statins are administered. studies have suggested a link between statin use and diabetes in the general population. also, a prior study suggested that statin therapy may increase hemorrhagic stroke risk among ischemic stroke patients. in this study, however, statin therapy was not associated with an increased incidence of future diabetes or hemorrhagic stroke for ischemic stroke patients with atrial fibrillation. one caveat is that the exposure time and cumulative dosage of statin in this study were lower than that in the above clinical trials. a limitation of the current study is that the reasons for use or nonuse of statins early after the ischemic stroke were not directly available from the analyzed administrative data. based on a reimbursement regulation in taiwan, patients were covered to receive statins if they had documented hypercholesterolemia. however, the taiwan national health insurance administration also suggested that physicians stop or reduce statin dosage when the nation goal cholesterol was reached (total cholesterol<160 mg / dl or low - density lipoprotein cholesterol < 100 mg / dl). patients in the statin group had higher baseline cholesterol levels and only 52% continued statin therapy for more than 1 year. the cholesterol levels of patients with statin discontinuation may return to higher levels, thus increasing the risk of recurrent stroke and showing no benefit of statin therapy in stroke prevention. several established stroke risk factors, such as smoking, lifestyle, and laboratory results, such as cholesterol level, were not available in the claims database. the diagnosis of acute ischemic stroke using the administrative data has high, but not perfect, reliability. in one study of the nhird administrative database against the gold standard of the taiwan stroke registry another study, comparing the nhird to detailed diagnoses from review of original hospital medical records, found that 94.5% of acute ischemic stroke patients were assigned we could only use in - hospital mortality in the analysis because encrypted nhird were not linked to the national death registry. furthermore, the accuracy of the recorded primary cause of in - hospital death in nhird is not well validated ; thus, this result should be cautiously interpreted. the effect of different statins in preventing recurrent stroke was not analyzed. in conclusion, statin therapy initiated during the acute to subacute stage of ischemic stroke was not associated with a reduced risk of stroke recurrence in stroke patients with atrial fibrillation. however, statin use was associated with a decreased risk of in - hospital death during follow - up period. | abstractit remains unclear whether statin therapy should be applied to ischemic stroke patients with atrial fibrillation. the objective of this study was to clarify whether statin therapy can influence the prognosis in recent ischemic stroke patients with atrial fibrillation.we identified ischemic stroke patients with atrial fibrillation between 2001 and 2011 from taiwan national health insurance database. patients not treated with statins during the first 90 days after the index stroke were matched to patients treated with statins in the first 90 days in a 2:1 ratio on the basis of age, sex, hypertension, diabetes mellitus, ischemic heart disease, heart failure, estimated national institutes of health stroke scale, use of anticoagulant, and year of their entry into the cohort. the primary outcome was the first event of recurrent stroke, and the secondary outcome was in - hospital death.a total of 1546 atrial fibrillation patients with statin therapy in the first 90 days poststroke and 3092 matched atrial fibrillation nonstatin controls were enrolled for this analysis. during the median 2.4-year follow - up, the risk of recurrent stroke was not different between subjects receiving versus not receiving statin therapy (hazard ratios = 1.01, 95% confidence interval 0.88 to 1.15). however, patients with atrial fibrillation receiving statin therapy had a reduced risk for death during any hospitalization throughout the long - term follow - up period (hazard ratios = 0.74, 95% confidence interval 0.61 to 0.89).among ischemic stroke patients with atrial fibrillation, statin therapy initiated during the acute to subacute poststroke stage did not alter the rate of stroke recurrence but was associated with a decreased rate of in - hospital death. |
extravasation refers to the unintended leakage of a liquid formulation of a drug from blood vessels into surrounding tissues. extravasation of anticancer drugs administered by intravenous infusion constitutes a serious adverse event associated with chemotherapy. in particular, the extravasation of drugs with vesicants, such as anthracyclines, can cause necrosis of the surrounding tissues, often requiring surgical procedures. in addition to careful observation during treatment, a better understanding of the risks of tissue damage triggered by extravasation is essential to ensure the safety of patients who receive cancer chemotherapy. the package insert of doxil (pegylated - liposomal doxorubicin) cautions that this preparation is an irritant. however, medical procedures for the management of extravasation reactions and their actual outcomes have not been well documented. we describe here a patient in whom extravasation of a large volume of doxil was successfully treated by an immediate subcutaneous corticosteroid injection. a massive extravasation of a doxil injection (janssen pharmaceutical, tokyo, japan) accidently occurred during an intravenous infusion of the drug in a 54-year - old woman with heavily treated metastatic ovarian cancer. the patient was scheduled to receive an intravenous infusion of 75 mg of doxil in a 250 ml 0.9% nacl solution, delivered via a 24-gauge cannula (surflo i. v. catheters, terumo, tokyo, japan) placed in the right forearm. before and at the beginning of the infusion, oncology nurses in the outpatient chemotherapy unit confirmed good patency of the vein by checking the blood backflow ; a free flow of the infusion solution was also confirmed. the patient reported a swelling (10 x 20 cm) with mild erythema gradually spreading around the infusion cannula placed in the right forearm (fig. 1). she experienced no pain, but did feel numbness. in accordance with the institutional guidelines for the management of the extravasation of vesicant drugs, the infusion was terminated immediately, and less than 0.1 ml of the infusion solution and a small amount of blood were slowly aspirated back through the original cannula with the use of a disposable syringe. after removal of the original cannula, 200 mg of corticosteroid (solu - cortef, pfizer, tokyo, japan) and 50 mg of lidocaine (1% xylocaine, astrazeneca, tokyo, japan) diluted with 0.9% nacl solution to a total volume of 20 ml were injected subcutaneously via a 27-gauge needle into the extravasation site and surrounding tissues. the affected site was then topically applied with clobetasol propionate (dermovate ointment, glaxosmithkline, tokyo, japan) and cooled with an icepack for 30 minutes. immediately after the extravasation of doxil. three days after extravasation the swelling decreased, and erythema of the extravasation site became faint. four weeks after extravasation, the erythema had faded, and a mild epithelial desquamation remained around the extravasation site (fig. the erythema had resolved, and the wound had healed with no apparent sequela. there were no serious complications such as tissue necrosis or ulceration. this case report provides valuable information on the characteristics and successful management of extravasation reactions caused by doxil, an intravenous anticancer drug used to treat refractory ovarian cancer. in contrast to conventional liposomes, the introduction of this novel delivery system allows pegylated - liposomal doxorubicin to evade detection and destruction by the body s immune system. the drug thus remains in the systemic circulation for a prolonged period, with an elimination half - life of approximately 55 hours. though doxorubicin is thought to be preferentially released from the pegylated - liposomes into tumor tissues, the exact mechanism involved is not fully understood. owing to a modification of the formulation, extravasated doxil is categorized as an irritant, even though doxorubicin per se is a well - known vesicant. although the package insert states that doxil is an irritant, we took all necessary precautions and administered all the treatments currently available in japan because the extravasation was massive, and doxorubicin per se is classified as a vesicant. other antidotes, such as dimethyl sulfoxide (dmso), hyaluronidase, or dexrazoxane, have been used to treat extravasation reactions, but they are not currently approved in japan. although the mechanism by which corticosteroids ameliorate extravasation reactions remains unclear, these drugs have been used to manage extravasation injury caused by various drugs. in our patient, an immediate subcutaneous corticosteroid injection apparently contributed to preventing tissue necrosis and other potentially serious complications. | abstracta massive extravasation of pegylated - liposomal doxorubicin (doxil) accidentally occurred, affecting the right forearm of a 54-year - old woman with metastatic ovarian cancer who was receiving an intravenous infusion of the drug. in accordance with the institutional guidelines for vesicant drugs, a corticosteroid preparation was immediately injected subcutaneously into the surrounding tissues. clobetasol propionate and an ice pack were then topically applied to the affected region. there were no serious complications at the extravasation site, such as tissue necrosis or severe pain, and only a transient erythema of the skin and desquamation remained after 2 months. |
the celiac trunk (ct) is the first ventral branch of abdominal aorta and arises at the level of t12/l1. the main branches of ct include left gastric, common hepatic, and splenic arteries. ct supplies the primary organs of the supracolic abdominal compartment. after arising from ct, the common hepatic artery runs downward and to the right to reach the first part of the duodenum. at this level the hepatic artery proper ascends in the right free margin of lesser omentum and divides into right and left hepatic arteries. presence of collateral branches, complete absence of the trunk, and bifurcation of the trunk are the reported variations of ct. very few reports pertaining to the unusual course of rha have been reported in the literature. knowledge of arterial variations of ct and its branches is useful in planning and executing the radiological interventions and surgeries in supracolic abdominal compartment. the present case is of tremendous importance because the loop of the rha might get injured during laparoscopic cholecystectomy. during the routine dissection classes for first - year undergraduate medical students, we observed concurrent arterial variations in the supracolic abdominal compartment. these variations were found in a male cadaver of indian origin, aged approximately 60 years. the left gastric artery arose from the abdominal aorta, very close to the origin of ct, at the level of twelfth thoracic vertebra. the common hepatic artery was tortuous and it terminated in front of the portal vein by dividing into right and left hepatic arteries [figures 1 and 2 ]. the rha gave origin to gda in front of the bile duct and then made a characteristic loop around the bile duct with convexity to the right side, and then entered the liver by passing through the porta hepatis behind the bile duct [figure 2 ]. the splenic artery passed along the upper border of the pancreas to reach the spleen. dissection of the supracolic compartment of the abdominal cavity showing the origin of celiac trunk (ct) in the form of hepatosplenic trunk and origin of left gastric artery (lga) directly from abdominal aorta, close to the origin of ct. origin of right hepatic artery (rha) and left hepatic artery (lha) is also seen. note the origin of gastroduodenal artery (gda) from the right hepatic artery (rha) in front of bile duct (bd). [splenic artery (sa), common hepatic artery (cha), portal vein (pv), stomach (s), pancreas (p) ] dissection of the supracolic compartment of the abdominal cavity showing the characteristic loop of right hepatic artery (rha) around the bile duct with convexity to the right side, before entering into porta hepatis and detached portion of gastroduodenal artery (gda) from the right hepatic artery (rha). [celiac trunk (ct), splenic artery (sa), common hepatic artery (cha), right hepatic artery (rha), left hepatic artery (lha), portal vein (pv), bile duct (bd), pancreas (p), stomach (s) ] the variations in the ct are due to unusual embryological development of the ventral splanchnic branches of the aorta. usually, ct branches into the splenic, common hepatic, and left gastric arteries. all the three of its branches might come directly from the abdominal aorta as independent branches. additional branches of the ct other than its usual branches are commonly referred to as collaterals. mburu. have reported the prevalence of collateral branches from ct, in 20.3% cases. a study conducted on the branching pattern of ct in kenyan population observed that the ct trifurcated in 61.7% and bifurcated in 17.9% of cases. different patterns of bifurcation of the ct such as gastrophrenic, hepatosplenic, hepatogastric, and lienogastric trunks have been reported. chitra have reported the incidence of hepatosplenic trunk in 13.1% and 2% cases, respectively. in the present case, we observed the hepatosplenic trunk with left gastric artery arising from the abdominal aorta, close to the origin of ct. computerized tomographic angiography is usually used to reveal the vascular variations of the upper abdomen. a sound knowledge of possible existence of vascular variations, as observed in the present case, is essential for radiologists and surgeons to prevent iatrogenic injuries in this region. earlier, a cadaveric study documented the origin of gda from the ct, in 3.61% of cases. gda may also arise from the superior mesenteric artery and right or left hepatic artery. nishida. have reported a case of gda steal syndrome during liver transplantation. this syndrome is characterized by low arterial flow towards the graft caused by a shift of flow into gda. therefore, awareness of possible existence of aberrant origin of gda is important for recognition and successful ligation of gda to prevent such consequences. in the procedure of hepatic arterial infusion pumps in hepatic arterial chemotherapy and also for liver and/or colon resection, hence, the knowledge of varied origin of gda from the rha, as in our case, is important for radiologists and surgeons for successful cannulation. the variations in the course of rha, in relation to the bile duct, are very rare. earlier, few reports have showed the presence of the tortuous rha forming the caterpillar hump which is also called as moynihan 's hump. in their study, the loop was formed around the common hepatic duct. in the present case, we report a rare case of tortuous common hepatic artery and the tortuous rha forming caterpillar hump, winding around the bile duct. the characteristic sinuousness of the rha is more susceptible to injury following the surgical procedures such as resection of tumor of the pancreatic head and other invasive interventions such celiacography and chemoembolisation of pancreatic and liver tumors and during cholecystectomy. further, gda arose from this artery close to its loop. while performing hepatic arterial chemotherapy, the aberrant origin of gda from the looped course of rha invites injury unless it is carefully recognized and dissected. though hepatosplenic trunk is not a rare finding, tortuous course of both the cha and rha is not common. further, the origin of gda from the rha close to the looped course has immense importance in the procedure of hepatic arterial chemotherapy. | celiac trunk usually trifurcates and supplies the organs in the supracolic compartment. the vascular variations are common in this region. there are reports on the variant course of right hepatic artery (rha). the tortuous rha forming a caterpillar hump is a rare finding and also its providing origin to gastroduodenal artery (gda) is an important observation. during routine dissection of abdomen of approximately 60-year - old male cadaver, concurrent arterial variations were observed. the celiac trunk bifurcated into splenic and common hepatic arteries. the left gastric artery arose from the abdominal aorta. the common hepatic artery was tortuous and divided into right and left hepatic arteries in front of portal vein. the rha gave origin to gda and then made a characteristic loop around the bile duct with the convexity to the right side. knowledge of arterial variations of celiac trunk and its branches is useful in planning and executing the radiological interventions and surgeries in the supracolic abdominal compartment. |
approximately 20% of undescended testes are truly impalpable, and laparoscopy is actually regarded as the gold standard for their localization ; none of the currently available imaging techniques (ultrasound, computerized tomography, or magnetic resonance imaging) has proven to be 100% reliable in predicting the presence or absence of a testis. in this respect, not only can laparoscopy be considered the most reliable tool to provide information on the location of the testis but also to confirm its absence. however, although normal and abnormal pelviscopic anatomy has been extensively described, some anatomical variants not corresponding to the actual anatomy have been reported over the years. although these cases are seen rather infrequently, they might have significant implications both from a clinical and a legal point of view because they may lead to missing a gonad. the records of all patients with impalpable testis (it) who underwent diagnostic laparoscopy from january 1993 to december 2000 were retrospectively reviewed. only testes that failed to be appreciated both during clinical examination and while the patient was anesthetized were considered truly impalpable. no diagnostic tests were deemed necessary for localization before the procedure ; however, 83 patients had had a sonogram performed upon a pediatrician 's request, and 41 had undergone a human chorionic gonadotropin (hcg) test. this was defined as a marked (2ds) increase in testicular size as assessed by prader orchidometer. testes with a marked increase in consistency according to 2 independent examiners, whether or not coupled with an increase in size, were also considered hypertrophied. laparoscopy was performed in all instances with the hasson technique through the umbilicus with the exception of the first 11 cases in which a veress needle was used to obtain pneumoperitoneum. all patients with laparoscopic evidence of spermatic vessels and normal contralateral gonads were operated upon. surgery consisted in all instances of exploration of the inguinal region ; whenever present, testes were brought down. vessels and gonads were defined as normal or hypotrophic, depending on the examiner 's personal experience. the gonad was immediately visualized in 95 cases (43.7%) ; in the remaining 124 cases, no gonad was seen while entering the abdomen with the laparoscope. of the 95 cases in which the testis was immediately visualized, 76 were truly abdominal and 19 were peeping. laparoscopic findings in the 124 cases in which a testis could not be demonstrated are shown in table 1. the patient with absent vas and vessels underwent surgical exploration for associated cystic dysplasia of the kidney ; a severely dysmorphic gonad, not identified on ultrasound, was found at the lower renal pole and was removed. twelve patients had vasa, vessels, or both of these, exiting an open inguinal ring (ir). insertion of the lens into the processus vaginalis allowed visualization of gonads in 5 patients (4 were normal and 1 was hypotrophic)., 6 normal testes in an ectopic position and 1 remnant were found. of the ectopic testes, 3 were in a preperitoneal position, above the anterior iliac spine, and 3 had an interstitial location (figures 1 and 2). in the 84 cases of vasa, vessels, or both exiting the ir, laparoscopy revealed a closed processus vaginalis. spermatic cord vessels were deemed normal in 21 cases. on exploration, testicular atrophy was found in 18 patients, normal testes with preperitoneal ectopia in 2, and a canalicular gonad in one. a normal contralateral gonad was palpated in the scrotum, and in the other 33, ch was found. atrophy was found in 29 cases and a canalicular testis in one, which was brought down into the scrotum. one testis was reported to be subsequently palpated by a primary care provider. regarding blind ending vas and vessels, in 7 patients only vas was present, and both structures were found in the remaining 20. seven patients were explored when positioning a testicular implant, and a scrotal nubbin was found and excised at the same time. although the laparoscopic approach to it is still controversial, near general agreement exists that its diagnostic accuracy is far superior to that of any other modality both in localizing the testis and in confirming its absence. using this procedure, we were able to visualize 95 gonads immediately and a further 5 by inserting the lens into a patent processus vaginalis. of interest, in 3 of these cases, although these findings can be easily explained by the different embryological origins of cord structures, they caution against laparoscopic closure of processus vaginalis, whether or not amenable to lens insertion. regarding the cases in which the testis was seen neither immediately nor after inspection of the processus vaginalis, surgical exploration revealed 11 additional testes. as previously mentioned, in 1 case, the laparoscopic appearance was that of absent vas and vessels ; however, the association with multicystic dysplastic kidney allowed us to surgically explore the retroperitoneal region where the gonad was found at the lower renal pole and removed. the management of such patients is still a matter of contention and literature reports are scant. failure to locate vas and vessels laparoscopically has been reported to be associated with an intraabdominal testis in 2 of 3 cases, while in another report the patient suffered from praderwilli syndrome where excess adiposity in the abdomen made spermatic vessels nondemonstrable on laparoscopy. our policy of surgically exploring all cases without clear evidence of a testis on laparoscopy led us to trace 10 gonads, 6 in which vas and vessels were exiting an open ir and 4 in which the ir was closed. however, in a tertiary referral center, evaluation of ch can be a useful adjunct to the diagnosis of inguinal testicular atrophy ; in our experience, this was particularly helpful in cases with hypotrophic vessels and closed ir. evaluation by experienced pediatric urologists as well as no previous hormone treatment are obvious prerequisites. the problem of whether or not surgically exploring the inguinal region in it cases with cord structures in such anatomical situations has also received much attention in the literature. some have questioned such a necessity especially in thin children ; other authors did not find any testicular tissue in spermatic cord structures removed during exploration. on the contrary, plotzker advocate surgical exploration on the grounds of microscopic islands of viable tubular epithelium within the small nubbins of tissue residing in the inguinal canal. in our series, of the 10 testes discovered with vas and vessels exiting the ir, only 2 were inguinal while the remaining 8 were in a very unusual ectopic position interestingly enough, in 4 cases, we found a preperitoneal ectopia, with the testis residing above the anterior iliac spine, a region which is infrequently palpated while evaluating a patient for it. in the other 4 cases, the testes were located in an interstitial position, which had rendered them rather flattened, thus easily missed on palpation also in thin boys. regarding the 2 other inguinal testes that would have been missed without exploration, our data are consistent with that of other authors series, of somewhere less than 5% of missed intraabdominal testes. in addition, we believe that the finding of inguinal, blind ending vas and vessels is not, per se, an indication for surgery because risk of future malignancy is negligible and no cases have been reported so far. more importantly, in our country, this problem is easily overcome by the patients request to have a testicular implant positioned in early adolescence, when inguinal exploration can be carried out with the same anesthetics. concerning blind ending vas and vessels, we found 7 cases of vas only and 20 cases with both structures. a scrotal nubbin was present in the scrotum in the 7 patients in whom a testicular implant was positioned. these data confirm the view of belman who considers this situation a scrotal event, with perinatal torsion occurring after descent but before fixation of tunica vaginalis. eleven testes would have been missed in our series with laparoscopic findings consistent with absent / vanished testis. therefore, we fully agree with ng who considers vasa and vessels blind ending above the ir as the only finding that would benefit from laparoscopy only. all other anatomical situations would ultimately require a surgical exploration in order to avoid significant clinical and legal complications at long - term follow - up. it is carried out by well - trained laparoscopists with extensive knowledge of cryptorchidism and orchiopexy. whether or not open surgical procedures may in the future be completely replaced by laparoscopic orchiopexy is still to be determined. | the diagnostic accuracy of laparoscopy for impalpable testis is well recognized. however, in some cases, laparoscopic findings may be misleading, and a viable gonad may be missed with significant medico - legal implications. from january 1993 to december 2000, 202 patients with 219 impalpable testes were evaluated. in 95 cases, the gonad was immediately visualized, and in 5, the presence of a testis was documented by inserting the scope into the processus vaginalis. in the 119 remaining cases, no gonad was seen while entering the abdomen with the laparoscope. all patients with documented vas and vessels exiting the inguinal ring were surgically explored. ten testes were found, 8 ectopic, with significant changes in shape and position, and 2 were canalicular. in the absence of hormone stimulation, no testes were found while exploring patients with cord structures coursing a closed inguinal ring and with contralateral hypertrophy. in 1 patient with absent vas and vessels, the testis was found at the lower renal pole while removing a dysplastic kidney. despite technical refinements and an increase in clinical practice, a small percentage of viable testes may be missed with laparoscopic findings consistent with absent / vanished inguinal testis. therefore, inguinal exploration is mandatory in all these cases. |
the significance of low - level laser in clinical medicine began with the important works of endre mester. in recent years, the various clinical applications of low - level laser therapy (lllt) have mainly been based on previous scientific works concerning the effect of low - level lasers, which exert a positive influence on fibroblast1 and collagen synthesis2 at the cellular - molecular level. as far as discogenic back pain is concerned, most orthopedic surgeons use non - steroidal anti - inflammatory medications and conventional physical therapy consisting of ultrasonic therapy, traction therapy, trans - cutaneous electrical therapy, and short - wave therapy. these forms of conservative treatment modalities represent symptomatic treatment only, without the biomodulation effects offered by low - level lasers ; for instance, ultrasound treatment affords neither anti - inflammatory nor biomodulation effects at the cellular - molecular level. although there have been numerous clinical studies on the use of lllt in various forms of arthritis, there is a relative paucity of clinical studies of lllt on discogenic back pain. the objective of this paper is to report the clinical result of a study on the efficacy of lllt therapy in the management of discogenic back pain. the study population consisted of a series of consecutive unselected 5 0 patients with documented one - level discogenic back pain, with a prior discogram confirming the abnormal level as seen by magnetic resonance imaging being the pain generator. the research represents a prospective cohort study into whether lllt therapy has any clinical efficacy in managing discogenic back pain and, if so, whether the benefit is short - term or long - term. exclusion criteria included patients presenting as late as more than 6 months after disease onset, as centralization of pain may have occurred in such situations ; patients above age 60 years ; and patients who had concomitant other spinal pathologies on magnetic resonance imaging, such as degenerative facet joints or spondylolisthesis. in addition, patients with prior spinal operations were excluded, as were subjects who had potential contraindications for the use of laser treatment, such as a previous history of tumor, ongoing sepsis, or pregnancy. all patients signed informed consent detailing that they would be treated by lllt and that only us food and drug administration - approved devices would be used. each subject was clinically examined and followed up by the same orthopedic surgeon to minimize interobserver error. all the low - level laser pain treatments were also performed by the same orthopedic surgeon. during the initial visit, extra care was taken to document the spinal range of motion, presence of neurological deficit, sites of tenderness, and presence of spinal deformity. we employed the well - known and validated oswestry disability index (odi) to score the level of disability in the initial and all subsequent follow - ups in the ensuing years. the odi assesses aspects including : pain intensity, personal care, lifting, walking, sitting, standing, sleeping, social and sex life, and ambulation ability. a score of 0 % 20% represents minimal disability, 2 1%40% represents moderate disability, 41%60% severe disability, 61%80% crippled, and 81%100% bed bound. lllt of a wavelength of 810 nm emitted from a gaaias semiconductor laser device, with 5.4 j per point and a power density 20 mw / cm, was employed. the treatment regimen consisted of three sessions of treatment per week for 12 consecutive weeks. we did not add on any other conventional therapy during each treatment session, as all the subjects had had these therapeutic interventions before but had failed to respond. no medications were prescribed to the subjects under study, as all of these patients had also failed to respond to oral anti - inflammatory agents provided by other clinicians before receiving treatment at our tertiary referral pain center. the mean age of the 50 subjects was 45 (range : 3657) years, all having had one - level disc disease documented by prior discography injection to confirm that the affected disc was the pain generator. the l5/s1 level was the level affected in 60% of subjects, while the others had l4/5-level disc disease. the study period lasted from 2008 to the end of 2014. upon entry to the study, if the subject had had their last magnetic resonance imaging more than 1 year ago, a new set of images were taken to ensure there were no newer undetected pathologies that may affect the result of treatment, such as multilevel disc pathology. all 50 subjects in the study population completed the treatment regimen with good compliance ; there were no defaults. only one patient failed to positively respond to the laser treatment and eventually required surgery ; however, even this patient s odi score was reduced by 10% after treatment, making her more comfortable while awaiting for inter - vertebral disc replacement surgery. for the remaining 49 patients, there was a statistically significant reduction in odi score, from a mean of 50% at the commencement of the study (range : 45%55%) with a standard deviation of 3.8 to a mean of 10% at the end of treatment after 12 weeks (range : 5%15%) with a standard deviation of 3.9 with an outlier which represents the nonresponder. the improvement was found maintained at the 1-year follow - up, with the mean odi score being 10% (range : 5%15%) and even at the 5-year follow - up, when the mean odi score remained at a satisfactory level of 15% (range : 10%20%). in this study, the mean was used instead of the median, as analysis of the data revealed near normal distribution. table 1 summarizes the pre- and posttreatment odi scores of the patients and includes their demographic details. statistical significance was confirmed using student s t - test, wherein the marked difference in the pre- and post - treatment odi scores after lllt rejected the null hypothesis that the difference could have occurred by chance, with a p - value < 0.05. the mean clinical follow - up of this patient cohort was 5 years (range : 4.56.0 years). a reasonably long follow - up was required to reveal whether lllt therapy alone could provide any lasting benefits in patients, as well as any incipient side effects. in this study, no side effect was observed and there was no discomfort felt by patients during therapy. over the past years, more than 100 double - blind placebo - controlled studies have been published on the effects of lllt. these articles also showed the favorable anti - inflammatory effect of lllt.35 however, despite the fact that there have been many published studies on lllt in the treatment of painful peripheral joints, there is a relative paucity of studies on discogenic back pain, aside from the double - blind controlled study on acute back pain with radiculopathy published by konstantinovic.6 one recent study by malliapoulos confirmed the short - term efficacy of lllt in treating discogenic back pain, but there was no mention that the researchers had confirmed prior to commencement of the study that the affected disc was the pain generator in each case. ip8 previously pointed out that there is more medical literature on the treatment of painful peripheral joints with lllt than on its treatment of back pain, thus patients are sometimes being subjected to unnecessary disc surgery, such as intra - discal heating, radiofrequency treatment for dorsal root ganglion, or open procedures like disc replacement or even spinal fusion. traditional treatments of painful discogenic back pain syndrome involve nonsteroidal anti - inflammatory agents as well as conventional physiotherapy such as ultrasound therapy and electrical stimulation therapy. none of these therapies confers the biomodulation effects that lllt does, such as improvement in microcirculation or the upregulation of several genes involved in energy metabolism and oxidative phosphorylation, which stimulates an increase in adenosine triphosphate production, which in turn regulates other cellular processes and leads to the normalization of biological functions at the cellular level.9 this is in sharp contrast to the biophysical effects of therapeutic ultrasound devices that do not even have anti - inflammatory effects biomodulation effects.10 in general, for any conservative treatment for discogenic back pain to be meaningful, the treatment modality must have lasting effects and benefits for the patient, rather than providing transient pain relief, such as the administration of painkillers does. we are not aware of any clinical study reporting on the long - term efficacy of lllt in the management of back pain. in the study reported here, lllt showed evidence of lasting benefit and represents a viable option to surgery. in the prospective study reported here of a patient cohort of 50 patients with documented single - level discogenic back pain, a significant positive clinical response of patients to lllt was demonstrated, as evidenced by the marked lowering of patients odi scores not only in the short - term but also in the long - term, as the mean clinical follow - up in this prospective study was 5 years. further large - scale studies will be worthwhile to further explore the use of lllt, not only in the treatment of discogenic back pain but also in other painful orthopedic conditions. | objectivethe aim of the study reported here was to investigate the possible clinical role of low - level laser therapy (lllt) in discogenic back pain patients who failed to respond to a conventional physical therapy program to avoid recourse to operative intervention.methodsthe paper reports on the long - term mean 5-year prospective follow - up of a patient cohort of 50 unselected patients visiting our tertiary referral pain center for discogenic back pain who had had a single - level lesion documented by magnetic resonance imaging followed by subsequent discography to confirm the affected disc being the pain generator. all of the patients who entered the study had failed response to a combination of nonsteroidal anti - inflammatory agents and had had not less than 3 months of conventional physical therapy. lllt, at a wavelength of 810 nm wavelength emitted from a gaaias semiconductor laser device with 5.4 j per point and a power density of 20 mw / cm2, was employed. the treatment regimen consisted of three sessions of treatment per week for 12 consecutive weeks.resultsall but one patient had significant improvement in their oswestry disability index score, from a mean of 50% score to a mean of 10% score, at the end of treatment at 12 weeks. in addition, surprisingly, the improvement was found maintained at follow - up assessments 1 year and 5 years later. the one patient among the 50 patients who failed to respond eventually required surgery, while the others did not require surgery.conclusionwe conclude that lllt is a viable option in the conservative treatment of discogenic back pain, with a positive clinical result of more than 90% efficacy, not only in the short - term but also in the long - term, with lasting benefits. |
intravenous thrombolysis using a recombinant tissue plasminogen activator (rtpa) and, more recently, endovascular mechanical thrombectomy has been shown to improve the clinical outcomes of patients presenting acute ischemic stroke when it is used within the first 4.5- 6 h after the onset of the symptoms. however, stroke trials did not include patients with either non - witnessed strokes or wake - up strokes. patients presenting stroke with symptoms that began at an unknown time represent around 30% of patients with acute stroke, while around 20% of stroke admissions are for wake - up stroke. although acute reperfusion treatment has not yet been proven effective and safe for wake - up stroke, a large proportion of these patients share similarities with patients admitted within 3 - 6 h of stroke onset when judged by baseline clinical and brain imaging data. some patients with wake - up stroke may thus benefit from recanalization treatments. however, it is not known how patients with wake - up stroke should best be managed. in this study, we aimed to assess the opinions of stroke experts about the management of patients with wake - up stroke using an international multicenter electronic survey. this study was an international electronic survey on the treatment of wake - up stroke. the experts selected included equal portions of stroke neurologists and interventional neuroradiologists who had at least one publication on the acute treatment of ischemic stroke between 2012 and 2015. first authors, corresponding authors, authors who had publications in journals with higher impact factors, or authors who had published the most recently were given priority for invitation to participate in the survey. descriptive statistical analyses were conducted using statistics software (spss version 20.0, ibm, chicago, ill. variables were reported as means, confidence intervals at the 95% confidence level, standard deviations, and standard errors. this study was an international electronic survey on the treatment of wake - up stroke. the experts selected included equal portions of stroke neurologists and interventional neuroradiologists who had at least one publication on the acute treatment of ischemic stroke between 2012 and 2015. first authors, corresponding authors, authors who had publications in journals with higher impact factors, or authors who had published the most recently were given priority for invitation to participate in the survey. descriptive statistical analyses were conducted using statistics software (spss version 20.0, ibm, chicago, ill. variables were reported as means, confidence intervals at the 95% confidence level, standard deviations, and standard errors. fifty - nine invitees started the survey, 4 dropped out of the survey before completing it, and 55 completed the full questionnaire. to complete the 8 questions, participants spent a mean of 3 min. the 8 questions of the survey and the rates of various responses are listed in table 2. around 20% of acute stroke admissions are for patients who wake up with a stroke, and according to international guidelines for the management of acute stroke, patients presenting with wake - up stroke are not eligible to receive revascularization treatments. there are currently 8 prospective trials enrolling patients to receive recanalization treatments who present with a stroke at an unknown time after the onset of their symptoms or after a stroke where symptoms began more than 4.5 h earlier. in a recent review, thomalla and gerloff described these ongoing trials in detail and discussed emerging perspectives about this subject. in the present study, we designed a simple questionnaire about the management of wake - up stroke and invited stroke experts, including stroke neurologists and interventional neurologists in equal proportions, to respond. the positive results obtained in that study for stentrievers and intravenous rtpa for treating large blood vessel occlusions where thus already known to our participants. in the first question, we found that around 70% of participants would recommend a revascularization treatment for patients presenting with wake - up stroke outside a clinical trial. this finding invites discussion of whether we should recommend nonstandard treatments in our daily practice. a high level of evidence is not always available to guide decisions during daily clinical practice, but doctors must still make these decisions. although 70% of our survey participants would treat a patient presenting with wake - up stroke outside a trial, this survey did not assess the reasons for this response. in the second, third, and fourth questions, stroke experts were asked about the best treatment strategies and brain imaging methods for use with wake - up stroke patients., we described a common clinical case ; a patient presenting with wake - up stroke due to a distal blood vessel occlusion. this example represents a patient who would benefit from intravenous treatment with rtpa from the time of the onset of their symptoms up to 4.5 h afterwards. as for the first question of this survey, around 65% of participants would treat the patient. in questions 7 and 8, we described a case of a patient presenting with wake - up stroke due to a large blood vessel occlusion (left m1). in this case, around 83% recommended a revascularization treatment. in this study, the fact that stroke experts agreed in their responses to questions 1, 5 and 7 indicates that most of them are inclined to treat patients with wake - up strokes. however, the considerable disagreement among experts in their responses to questions 2, 3, 4, 6, and 8 showed that stroke experts have not reached consensus on the best brain imaging method and on the best treatment strategy for patients with wake - up stroke. the limitations of the study are the small size of the sample of experts and the limited number of questions asked. moreover, most of the experts (72.5%) who were invited to participate in the survey did not respond. the low rate of response obtained on this survey might be due to e - mail spam blockers, because the first 100 invitations were sent collectively and not individually. in this study, most of stroke experts recommended a recanalization treatment for wake - up stroke. however, there was considerable disagreement among experts regarding the best brain imaging method and the best recanalization treatment. | backgroundpatients who wake up having experienced a stroke while asleep represent around 20% of acute stroke admissions. according to international guidelines for the management of acute stroke, patients presenting with wake - up stroke are not currently eligible to receive revascularization treatments. in this study, we aimed to assess the opinions of stroke experts about the management of patients with wake - up stroke by using an international multicenter electronic survey.methodthis study consisted of 8 questions on wake - up stroke treatment.resultstwo hundred invitations to participate in the survey were sent by e - mail. fifty - nine participants started the survey, 4 dropped out before completing it, and 55 completed the full questionnaire. we had 55 participants from 22 countries.conclusionsin this study, most stroke experts recommended a recanalization treatment for wake - up stroke. however, there was considerable disagreement among experts regarding the best brain imaging method and the best recanalization treatment. the results of ongoing randomized trials on wake - up stroke are urgently needed. |
incisional (postoperative ventral) hernia is an iatrogenic abdominal wall defect that occurs at the site of previous incision following breakdown in the continuity of the fascia closure. it has been described as a bulge visible and palpable when the patient is standing and often requiring support and repair. it is a very common complication of abdominal surgeries and is associated with considerable morbidity and mortality [3, 4 ]. as many as 11% of laparotomies are complicated by the development of incisional hernias [57 ]. the figure rises to 26% in those who develop wound infection. despite increased understanding of abdominal wound closure, it is worrisome that the frequency has not diminished appreciably in the past 75 years [9, 10 ]. an incisional hernia occurs due to biochemical failure of the acute fascial wound early in the healing process when wound tensile strength is very low or absent (days 030). it is during this time, when wound strength depends entirely on suture integrity, that recovering patients start returning to increased levels of activity and thereby place increasing loads across their acute wounds [11, 12 ]. however, the hernia may not be obvious for days or even years [13, 14 ]. various factors have been identified to be responsible for the failure, including obesity and wound infection ; other contributory factors include initial closure of fascia with catgut, drainage tube through the index incision, senility, early wound dehiscence, immunosuppressant therapy, anaemia, diabetes mellitus, malnutrition, jaundice, and azotaemia, [1517 ]. occurrence of incisional hernia has also been attributed to the disturbance of collagen metabolism at the microscopic level. this entails the use of mesh, either open or laparoscopic [15, 21 ], but this material is not available in most poor countries such as ours. this study was carried out to identify the factors associated with incisional hernia in our region as well as factors affecting recurrence. forty - four women who presented with ventral incisional hernia at obafemi awolowo university teaching hospital (o.a.u.t.h.c), ile - ife, osun state, nigeria, between january 1996 and december 2005 were included in the study. o.a.u.t.h.c is a tertiary health facility located in southwest nigeria and serves as the referral hospital for patients from osun, ondo, ekiti and part of oyo state of nigeria. people from these areas are mostly farmers and the others are either self - employed or government workers. a standard form was used during the initial evaluation of the patient to obtain the indication for the pre - hernia operations and the possible predisposing factors. surgeons ' skill and level of experience for the pre - hernia surgery were not assessed because most were patients referred from other hospitals. all hernias were in the midline of the abdomen, but they were characterised as being supraumbilical, periumbilical or infraumbilical. wound infection as a risk factor was arrived at if the patient gave a history of a pussy discharge from the wound after the pre - hernia surgery. this was corroborated by the length of hospital stay and the scar of the pre - hernia operation. prolonged ileus was defined as delay of return of the bowel sound 72 hours after surgery. all patients with body mass index of > 25 kg / m whose weight was the same or greater before the pre - hernia surgery were considered overweight or obese. scars with no sutures in the wound were assumed to have been repaired with absorbable sutures (chromic catgut is a common absorbable suture used in our region). the operation notes of the few patients who were operated on in this hospital were also reviewed. all the patients had general anaesthesia. either mayo 's or keel 's repair were offered to the patient ; mayo 's repair was used for the smaller defects. a relaxing incision was made on the rectus sheath to relieve tension on the repair. post - operative complications were classified as superficial or deep wound infection, seroma, or haematoma. superficial wound infection was defined as the presence of signs or symptoms of inflammation at the wound, which was treated with antibiotics ; this may or may not have included the development of systemic evidence of infection or the presence of purulent discharge from the wound. deep wound infection was defined as the presence of a sub - fascial collection of purulent fluid that may or may not have been associated with systemic or local evidence of inflammation. seroma was defined as the presence of a symptomatic prefascial collection of sterile fluid requiring drainage. categorical data was compared with recurrence using chi square (pearson chi square and fischer 's exact test) where appropriate. two - tailed student 's t - test was used to compare the continuous data with recurrence. about three - quarters of the incisional hernias (34, 77.4%) occurred within the first year of pre - hernia surgery. most patients (32, 72.7%) had mayo 's repair and the remainder had keel 's repair. only four patients (8.2%) had recurrence of the lesion within the study period. ten patients (22.7%) had other complications, including superficial wound infection (3, 6.8%), deep wound infection (2, 4.5%), haematoma (2, 4.5%), seroma (1, 2.3%), hypertrophic scar (3, 6.8%) and cough (1, 2.3%). age distribution and the outcome of surgery in the 44 women with incisional hernia the pre - hernia (index) operations of the patients are as shown in table 2. by using the chi square test, we found that the index operation was significantly associated (p < 0.0001) with the nature of the surgery : emergency or elective. twenty - eight patients (63.6%) had caesarean section, 26 of whom were on emergency basis. obstructed labour (18, 69.2%) was the most common indication for emergency caesarean sections, followed by foetal distress (4, 15.4%) and eclampsia (4, 15.4%). the six emergency exploratory laparotomies were done for two typhoid perforations, one appendiceal abscess, and three uterine perforations from septic abortion. the elective surgeries included total abdominal hysterectomy with bilateral salpingoophorectomy, herniorrhaphies cholecystectomy, bilateral truncal vagotomy with pyloroplasty, and right hemicolectomy. only six hernias were periumbilical (13.6%) and two (4.5%) were supraumbilical. prehernia (index) operations among incisional hernia patients p 0.0001 - the incidence of incisional hernia are more common in patients who had emergency surgeries than elective surgeries. tah - bso = total abdominal hysterectomy and bilateral salpingoophorectomy recurrent i.h. recurrent inguinal hernia the sizes of the hernias ranged from 2.5 to 15 cm long with a median of 10.0 cm, and from 2.5 to 12 cm wide with a median of 6.0 cm. the area of the defect ranged from 6.25 to 180 cm2 with a median of 75 cm2. the major predisposing factors included midline incision (44, 100.0%), wound sepsis (35, 71.4%), absorbable suture (34, 69.4%), overweight (12, 24.5%), and prolonged post operative ileus (10, 20.4%) (table 4). other factors included multiparity, wound attrition from old age, drain from original wound, cough, haematoma, difficult extubation, diabetes mellitus, cigarette smoking, and cancer. patients were followed up for 18 to 60 months. of the four patients with recurrence, two were overweight and had wound infection, and the other two had difficult extubation associated with wound infection. recurrence was significantly affected by the pre - hernia surgery (p = 0.012). recurrence was seen in the repair of incisional hernia resulting from umbilical hernia and emergency caesarean section. pre - hernia surgeries were pregnancy - related in 28/44 (63.6%) cases. this age group is always subjected to prolonged or repeated stretching and weakness of the abdominal muscular tendinous structure. it is therefore not surprising that incisional hernia was more prevalent in this group twenty - six patients (59.1%) had emergency caesarean section before the incisional hernia. this is in agreement with previous observations [13, 23 ] ; the pregnant abdomen, attendant obesity, and emergency nature of surgery can all predispose to incisional hernia. the major possible predisposing factors identified in this study (tables 2, 3, 4) are not much different from those reported elsewhere [13, 18, 23, 24 ]. thirty - two patients (72.7%) had emergency operations, where nothing could have been done about the weight of overweight patients. hence, obesity as a causative factor was prominent in 12 (27.3%) of our patients. surgeons ' lack of experience and inappropriate surgical technique could also be factors leading to incisional herniation. this could not be ascertained in many of our patients who had presented from various hospitals, without access to their previous operation records. anatomical location of hernia defect factors associated with incisional hernia in 44 patients wound sepsis has continued to be an important risk factor. perhaps the usual reduced immune state of pregnancy and the occasional undetected gestational diabetes, combined with the emergency nature of the surgeries could account for this frequent involvement of sepsis. the constant mutations of the contaminating genital microbes and consequent development of antibiotic resistance do not make matters any better. the least resistance to stress by intra - abdominal forces is offered by vertical incision, which transversely divides the oriented fascia fibers of the anterior abdominal wall [1, 13 ]. incisional hernia is expected in patients who have absorbable suture for fascia repair [1, 26 ]. midline abdominal fascia is poorly vascularised and hence is slow to heal, consolidate and regain its tensile strength [1, 27, 28 ]. it therefore requires suture materials whose tensile strength will still hold until the fascia heals. as noted by previous workers [24, 29 ], herniation through this is anatomical, due to the thinner anterior sheath with virtually no posterior sheath support of the linea alba. it has also been attributed to the orientation of the incision, which is parallel to the line of forces acting on it. the sizes of our patients ' hernial defects allowed re - apposition without significant tension. hence two main techniques (mayo 's and keel) were employed [30, 31, 32 ]. this suture has been used successfully by other workers [8, 23, 27, 33 ]. surgical treatment of incisional hernia include suture repair (which may incorporate relaxing incision), internal suture retention techniques, muscle flap rotation, autodermal hernioplasty, and prosthetic implantation using onlay and sublay techniques [5, 34 ]. concluded that suture repair was safe for small incisional hernias ; both autoplastic and alloplastic hernia repair yielded comparably low recurrence rates, but led to a high rate of wound infection. laparascopic herniorrhaphy is a promising technique with all the advantages of minimally - invasive surgery [5, 22, 36, 37 ]. incisional hernia repair is associated with high cumulative rates of re - operative repairs ; and important measures of adverse outcomes have not improved. the recurrence rate among the 44 patients was 4/44 (9.1%), after a period of follow - up ranging from 18 to 60 months. this should not be discouraging because two of the cases are thought to have been due to wound sepsis and overweight. therefore, we suggest that whenever possible, reduction of weight should be encouraged before laparotomies and incisional hernia repair in overweight patients. transverse incisions, unless contraindicated, should be used more frequently. judicious use of perioperative antibiotics in all emergency laparatomies, particularly caesarean section, with meticulous attention to asepsis at all times should be encouraged. there is a need to continue insisting on appropriate nonabsorbable suture materials in closure of abdominal wounds during laparatomy. the well - established surgical principles remain valid : wound closure should be free of excessive tension, the sutures should be placed in healthy tissue, and strong suture material should be used to support the wound through the critical period of healing. despite the relatively small number of patients, we confidently conclude that the major clinical attributes with possible risk factors for incisional hernia are using the wrong type of sutures, midline incisions, wound sepsis, and overweight. a further study of a large population to compare patients with similar attributes but no incisional hernia would be shed light on this. however, we recommend that whenever possible, reduction of overweight be encouraged before laparatomies and that transverse or oblique incision be used instead of vertical incision when practicable. prophylactic antibiotics should be used in all emergency laparatomies, especially caesarean sections for obstructed labour. absorbable sutures (especially chromic catgut) should not have a place in repair of fascia of midline incision. if these suggestions are adhered to, the incidence and morbidity of incisional hernia will definitely diminish. it is noteworthy that in our centre we started repairing incisional hernias and other defects with mesh. this forms the thrust of an ongoing prospective study on the management of fascial defects. | background / aim : incisional hernia is still relatively common in our practice. the aim of the study was to identify risk factors associated with incisional hernia in our region. the setting is the obafemi awolowo university teaching hospitals complex, ile - ife, nigeria during a period when prosthetic mesh was not readily available. patients and methods : all the women who presented with incisional hernia between 1996 and 2005 were prospectively studied using a standard form to obtain information on pre - hernia (index) operations and possible predisposing factors. they all had open surgical repair and were followed up for 1860 months. results : forty - four women were treated during study period. the index surgeries leading to the hernias were emergency caesarian section 26/44 (59.1%), emergency exploratory laparotomy 6/44 (13.6%), and elective surgeries 12/44 (27.3%). major associated risk factors were the use of wrong suture materials for fascia repair, midline incisions, wound sepsis, and overweight. conclusion : for elective surgeries, reduction of weight should be encouraged when appropriate, and transverse incisions are preferred. absorbable sutures, especially chromic catgut, should be avoided in fascia closure. antibiotics should be used for complicated obstetric cases. |
primary disorders of tendons are common and account for a high proportion of referrals to rheumatologists and orthopaedic surgeons. the most commonly involved tendons are the rotator cuff (particularly supraspinatus) in the shoulder, the forearm extensor (tennis elbow) and flexor tendons (golfers elbow) in the forearm, the patella tendon in the knee, the achilles tendon in the lower leg, and the tibialis posterior tendon in the ankle and foot. the intrinsic pathogenetic mechanisms underlying the development of tendinopathies are largely unknown however proinflammatory cytokines, apoptosis, and mechanical stress have recently been functionally implicated in several model systems [2, 3 ]. increasing evidence is emerging that repetitive tissue trauma and its associated damage in stromal tissues are recognized at the cell level via receptor - mediated detection of intracellular proteins released by necrotic cells. the term alarmin is proposed to categorise such endogenous molecules that function to mobilise and activate immune cells after interaction with their specific receptors during host defence and tissue repair. heat shock proteins (hsps), a type of stress molecules involved in protein folding, are implicated as important tissue alarmins. hsp activation can directly affect both innate and adaptive immunity, although controversial studies and opinions exist in the field [68 ]. the innate immune responses induced by hsps include cytokine and chemokine release and activation of nk cells. their expression in response to stress also has an important function in protection against apoptosis and in regulation of apoptotic cell signaling. thus, their evolutionary conservation and the upregulation during stress and binding to pattern recognition proteins make it logical that hsps can act directly as danger signals in tendinopathy. in this paper we summarize recent findings of heat shock proteins in inflammatory and tendon disease and highlight our key findings which may be important in understanding the pathogenesis of primary tendon diseases. hsps are expressed both constitutively (cognate proteins) and under stressful conditions (inducible forms). additionally, a variety of stressful situations including environmental, pathological, or physiological stimuli induce a marked increase in hsp synthesis, known as the stress response and upon necrotic cell death, hsps are leaked into the extracellular compartment. in addition, hsps can be released extracellularly independent of necrosis in response to a number of stressful conditions [13, 14 ]. hsps are present in the circulation of normal individuals, and their circulating levels decrease with age and increase in a number of pathological conditions such as hypertension, atherosclerosis, and rheumatoid arthritis. the principal hsps range in molecular mass from ~15 to 110 kda and are divided into groups based on both size and function. they are present in the cytosol, mitochondria, endoplasmic reticulum, and nucleus, although these locations vary depending on the particular protein. the most well - studied and understood hsps in mammals are those with molecular masses of ~60, 70, 90, and 110 kda. these hsps are expressed at normal body temperatures (~37c) and in conditions of stress. the primary function of the hsps appears to serve as molecular chaperones in which they recognize and bind to nascent polypeptide chains and partially folded intermediates of proteins, preventing their aggregation and misfolding, or as molecules that directly mediate protein folding [22, 23 ]. several important cytoprotective functions (the folding and unfolding of proteins, translocation of proteins across membranes, and the prevention of protein aggregation have been attributed to hsps, in particular, the hsp70 family [2426 ]. interestingly, it has also been noted that hsps can play a role in apoptosis with hsp27, hsp70, and hsp90 proteins predominantly antiapoptotic, while hsp60 is proapoptotic. moreover, it appears that these hsps function at multiple points in the apoptotic signalling pathway to elicit this response. thus their relevance to tendon disease is made all the more important due to the strong association of apoptosis in human tendon pathology [28, 29 ]. although the primary focus of research on hsps has been directed toward their functions and accumulation inside the cell in response to a physiological stress, there is emerging recognition that hsps serve as key modulating signals for immune and inflammatory responses. one area of investigation pertinent to the topic of stress tolerance has dealt with the potential role of hsps in cytokine production. elevations in intracellular hsp levels have been shown to improve cell tolerance to inflammatory cytokines such as tnf- and interleukin-1 [23, 31 ]. hsp accumulation within a cell produces both transcriptional inhibition and a decrease in tnf- and interleukin-1 secretion.. demonstrated that heat conditioning and the resultant increase in intracellular hsp70 levels protected animals from an endotoxin dose that was lethal in unconditioned rats. moreover, this paradigm was associated with a decrease in serum tnf- levels after administration of endotoxin in the heat - conditioned animals. these results suggest that intracellular hsp accumulation may contribute to a reduction in inflammatory cytokine production with cellular challenge. hsps have become increasingly associated with rheumatic disease. in animal studies using freund 's adjuvant transfer of an autoreactive t cell clone recognising a determinant on the mycobacterial 65 kda antigen was arthritogenic while prior immunisation with the 65 kda heat shock protein abrogated this effect. human investigations have revealed that 49% of patients with ankylosing spondylitis have antibodies against hsp63 while patients with systemic lupus erythematosus have serum igg antibodies to hsp90 and both igm and igg to hsp70. more recently various groups have highlighted elevated levels of hsps in rheumatoid arthritis [19, 3840 ] with the rheumatological community considering their merit as small molecular targets. thus hsps released in response to tissue injury / stress seem capable of straddling the divide between tissue survival versus tissue death mechanisms in inflammatory diseases (figure 1). overuse tendon injuries, namely, tendinopathies pose a significant, highly prevalent problem in musculoskeletal medicine with shoulder tendon injuries alone amounting to an annual cost of $ 3 billion to the us healthcare system. the intrinsic pathogenetic mechanisms underlying the development of tendinopathies are largely unknown however excessive cellular load and repetitive stress have been shown to be functionally important. thus the pathological process of repetitive microtrauma / stress lends itself well to the investigation of heat shock proteins which are so inextricably linked to tissue stress. tendinopathy is an overuse injury characterized by pain with movement, local tenderness, weakness, and decreased mobility at the injured site. these symptoms are the result of deviation from the tendon 's normal physiology. in healthy tendon, 95% of tendon tissue is collagen i, residing within fibroblast - like tenocytes, glycoproteins, and glycosaminoglycans. collagen iii is mainly produced during tendon healing and remodelling and is biomechanically weaker then type i collagen. in addition to mucoid, hyaline, hypoxic, or fibrinoid degeneration, collagen iii is observed in symptomatic tendons at a higher percentage than uninjured tendons. microscopically, collagen fibrils are disorganized with decreased tropocollagen cross - linking, glycosaminoglycan production is increased, both of which contribute to increased water retention and ultimate decrease in tensile strength (table 1). this increased neural volume is posed to cause pain in tendinopathy [48, 49 ]. one of the major limitations of human studies is that tendon biopsies are usually obtained when patients are symptomatic and therefore biopsy material likely represents chronic, rather than early phase disease. medical intervention at this early stage may offer considerable therapeutic advantage over later surgical approaches. we previously demonstrated that matched subscapularis tendon from patients with full thickness rotator cuff tears represents a model of early human tendinopathy based on histological appearances and significantly increased levels of cytokines and apoptotic markers in these tissues (figure 2(a)). these studies established a human model of early tendinopathy for the first time and have been confirmed by an independent group. this model has now not only allowed us to elucidate a role for hsps in tendinopathy but also has finally allowed the targeted mechanistic investigation into key molecular events in early tendon disease. animal investigations have provided helpful insight. pan and halper described the effects of increased temperature, mechanical stress, and growth factors on hsp47 and their data showed that transforming growth factor 1 (tgf-1) was a key regulator of hsp47 expression as the addition of tgf-1 led to a moderate increase in the expression of hsp47 mrna. induction of hsp47 protein expression by heat shock, mechanical stress and tgf-1 was likely achieved through activation and translocation of heat shock transcription factor 1 into the nucleus. jagodzinski. examined the expression of hsp72 in tendon fibroblasts subjected to mechanical stress. they showed that hsp72 accumulates in the nucleus with an associated transient upregulation after cyclic longitudinal stretching suggesting a role as a tissue repair mechanism. investigated the influence of repetitive cyclic longitudinal stress patterns on proliferation, apoptosis, and expression of hsp72 in tenocytes. stress patterns applied during two days resulted in a reduced proliferation and apoptosis rate whereas the expression of hsp72 showed a significant increase. this study suggested that inhibition of proliferation and apoptosis occurred through increased hsp72 activity and may implicate it in tendon tissue reparation and tissue engineering. based on reports of excessive apoptosis in torn supraspinatus tendon and mechanically loaded tendon cells, we hypothesized heat shock proteins may be present in rodent and human models of tendinopathy due to their central role in caspase - dependent apoptotic cell signaling. we utilized a running rat supraspinatus tendinopathy overuse model with custom microarrays to investigate the process at a genetic level. additionally torn supraspinatus tendon and matched intact subscapularis tendon samples (early pathology) were collected from patients undergoing arthroscopic shoulder surgery. overall, 91 genes were found to be significantly upregulated, and 37 significantly downregulated. the differential expression of apoptotic - related genes represented 6% (5 genes) of the significantly upregulated genes and 8% (3 genes) of significantly downregulated genes. upregulation (p < 0.01) of hsp27 (3.4) and 70 (2.5), cflip (2.2) receptor and caspase 8 (3.1) occurred in degenerative rat supraspinatus tendon subjected to daily treadmill running for 4weeks. we further confirmed increased levels of heat shock protein and apoptotic regulatory genes in human supraspinatus and subscapularis tendon at the rna and protein level (figures 2(b) and 2(c)). overexpression of hsp27 is essential in preventing cells from undergoing apoptosis, a switch that may be redox - regulated. hsp27 inhibits specifically the cytochrome c and atp - triggered activity of caspase 9 on the apoptotic pathway. furthermore, hsp27 indirectly interferes with cell death because of its ability to modulate intracellular glutathione, a parameter that is also regulated by exercise. cytochrome c also triggers the oligomerization of apaf-1, which in turn recruits pro - caspase 9 and pro - caspase 3 into the apoptosome (the caspase activation multiprotein complex). hsp70 also protects cells from heat stress, from the cytotoxic effects of tnf, and from nitric oxide. based on these observations it would appear that heat shock proteins act as a check rein to apoptotic cell damage in tendinopathy. in conclusion, heat shock proteins are components of nature 's immune response that can act in a positive or negative way to the host immune system during the course of disease. these molecules seem to act as early regulators of the decision of a tissue / cell towards a reparative versus degenerative / inflammatory pathological process in joint related diseases. repetitive microtrauma / stresses are now considered as one of the main pathophysiological causes of tendinopathy. our investigations in early tendon damage have revealed a role for a heat shock proteins along with other investigators. we propose that when these molecules are released from stressed tenocytes they act as orchestrators of both the tissue healing response and subsequent inflammatory reaction with a fine balance between reparative versus degenerative change (figure 3). further work is ongoing within our institute to further elucidate their mechanistic role and possible therapeutic targeting. | tendon disorders tendinopathies are the primary reason for musculoskeletal consultation in primary care and account for up to 30% of rheumatological consultations. whilst the molecular pathophysiology of tendinopathy remains difficult to interpret the disease process involving repetitive stress, and cellular load provides important mechanistic insight into the area of heat shock proteins which spans many disease processes in the autoimmune community. heat shock proteins, also called damage - associated molecular patterns (damps), are rapidly released following nonprogrammed cell death, are key effectors of the innate immune system, and critically restore homeostasis by promoting the reconstruction of the effected tissue. our investigations have highlighted a key role for hsps in tendion disease which may ultimately affect tissue rescue mechanisms in tendon pathology. this paper aims to provide an overview of the biology of heat shock proteins in soft tissue and how these mediators may be important regulators of inflammatory mediators and matrix regulation in tendinopathy. |
iatrogenic injury of the lumbar arteries after spinal surgery is a rare complication5 - 9). it may result in the formation of a pseudoaneurysm and consequent acute or delayed retroperitoneal hemorrhage. because pseudoaneurysm develops gradually from a focal arterial wall disruption however, this condition may lead to a sudden and massive retroperitoneal hemorrhage and hypovolemic shock. we recently treated a patient who showed a large retroperitoneal hematoma caused by pseudoaneurysm that arose nine days after posterolateral fusion (plf). a 55-year - old female patient with lower back pain and neurogenic intermittent claudication, who previously underwent l4-l5 plf due to spinal stenosis, was presented to our hospital. she experienced small thalamic infarction 5 years ago, and since then, she started antiplatelet and antihypertensive medications. there was minimal bleeding during the surgery, and post - operative complaints only include mild back pain. however, on the 9th post - operative day, the patient complained of a sudden onset of severe abdominal pain and distension. moreover, the patient was hemodynamically unstable (8.5 g / dl hemoglobin concentration ; 90/60 mm hg blood pressure ; and 120/minute pulse rate). a late abdominal complication was suspected, and an emergency computed tomography (ct) scan of the abdomen with contrast enhancement was performed. the patient was resuscitated with blood transfusion, intravenous fluids for hypovolemic shock and an interventional radiologist was urgently consulted. lumbar spinal angiography showed the delayed hematoma due to rupture of the 2nd lumbar artery pseudoaneurysm (fig. after we confirmed the successful embolization through the final angiogram, the patient was sent to the ward. since then, the patient 's postoperative progress proceeded normally with recovery of the hemodynamic parameters. two weeks after the embolization, follow - up abdominal ct showed the decreased retroperitoneal hematoma (fig. a few authors reported iatrogenic lumbar artery pseudoaneurysm as a consequence of spinal surgery4 - 8). moreover, there were some reports about lumbar artery pseudoaneurysm after trauma1 - 3,11). however, there were few reports about lumbar artery pseudoaneurysm after plf. in 1953, watkins12) first introduced posterolateral intertransverse fusion and the indications for the use of this technique have been broadened to include degenerative disc disease and low back pain. nowadays, this technique is supplemented by the provision of a transpedicular fixation device and is widely used in lumbosacral spinal surgery. preparation of the bone fusion bed, which is the most important step in plf, was done through decortications of the transverse process by drilling. in the present case, the fracture of the right l3 transverse process was connected, thus the injury of the lumbar artery may have occurred close to the transverse process during drilling. we believe that this iatrogenic arterial wall injury was responsible for the formation of the lumbar artery pseudoaneurysm with the consequent delayed retroperitoneal hemorrhage. the lumbar arteries of l1 to l4 are small paired vessels that originate from the dorsal aspect of the abdominal aorta at the level of the transverse processes. the lower lumbar arteries can occasionally originate from a common trunk near the midline of the posterior aorta (fig. these vessels run laterally along the bodies of the lumbar vertebrae and divide into anterior and posterior branches at the medial border of the psoas muscle and anterior of the transverse process1). in the present case, we thought that the lumbar artery was injured at the anterior of the transverse process (fig. lee.4) reported the case of a lumbar artery injury combined with a transverse process fracture after a fall. thus if the patient showed retroperitoneal hemorrhage along with a transverse process fracture, the clinician should consider the possibility of a lumbar artery injury. in case of retroperitoneal hemorrhage due to lumbar artery injury, endovascular embolization is effective in controlling hemorrhage as it avoids the risks associated with another anesthesia, surgical incision, and the locating and controlling the bleeding1,7,9,10). in our case, a transcatheter embolization has successfully stopped retroperitoneal hemorrhage due to rupture of lumbar artery pseudoaneurysm. although plf is a safe and widespread surgical technique, major complications are possible if proper attention is not given to the preparation of fusion bed such as drilling or decortication of a transverse process. | a 55-year - old female patient presented with lower back pain and neurogenic intermittent claudication and underwent l3-l4 posterolateral fusion. to prepare the bone fusion bed, the transverse process of l3 and l4 was decorticated with a drill. on the 9th post - operative day, the patient complained of a sudden onset of severe abdominal pain and distension. abdominal computed tomography revealed retroperitoneal hematoma in the right psoas muscle and iatrogenic right l3 transverse process fracture. lumbar spinal angiography showed the delayed hematoma due to rupture of the 2nd lumbar artery pseudoaneurysm and coil embolization was done at the ruptured lumbar artery pseudoaneusyrm. since then, the patient 's postoperative progress proceeded normally with recovery of the hemodynamic parameters. |
the goal of platelet transfusion is to stop or prevent bleeding in thrombocytopenic patients or those with platelet dysfunction [1 - 3 ]. bleeding is a relatively uncommon cause of death in non - trauma patients but can be a significant morbid event at worst and, at best, quite upsetting for patients, families, and providers. thus, traditionally, with the view that platelet transfusion is essentially benign, the impetus has been to transfuse platelets aggressively to prevent rather than treat bleeding. whole blood platelets, which are derived from four to five whole blood donations, pooled, leukoreduced, bacterially tested, and irradiated, used to be the standard transfusion product but now are less frequently used in the us. apheresis platelets derived from donors who spend a couple of hours on a cell separator have become the most commonly used product in the us. the usual doses have been in the range of 3 10 to 5 10 platelets per transfusion but one - quarter to one - half of these doses has been shown to be equivalent in preventing bleeding in a recent but as yet unpublished large national randomized trial (prophylactic platelet dose on transfusion outcomes, or plado). whole blood pooled and apheresis platelets are considered by most experts to be interchangeable in terms of efficacy and safety. patients receiving pheresis platelets are likely to have a higher risk of hemolytic reactions if they are abo - mismatched [5 - 7 ] and a higher risk of acute lung injury (transfusion - related acute lung injury) due to having larger amounts of plasma from a single donor, but carry a lower risk of infectious disease transmission due to fewer donor exposures. earlier studies have demonstrated that alloimmunization and refractoriness to transfusion (inability to raise the platelet count with transfusion) are common in recipients of non - leukoreduced transfusions and abo - mismatched platelet transfusions. thus, almost everyone agrees that platelet transfusions should always be leukoreduced and that every effort should be made to use only abo - identical platelets whenever possible. for patients who have severe or repeated fever, rigors, or allergic or pulmonary complications with transfusion (about 1 - 5% of patients ; mostly fever, rigors, and/or urticaria), saline - washed platelets are available in some hospitals. these require about 2 hours of additional preparation time and contain about 20% fewer platelets than unwashed platelets. one study suggests that clinical outcomes (survival) are improved with the use of washed platelets in adult patients with acute leukemia and that post - transfusion fever, rigors, and urticaria can be almost completely eliminated. traditionally, platelet transfusions in hematology - oncology have been given prophylactically as serious bleeding is fortunately uncommon in these patients. the safe threshold for prophylactic transfusion in a clinically stable patient who does not have serious bleeding (e.g., that requiring red cell transfusion or representing serious or life - threatening morbidity) is considered to be a platelet count of 10,000/l [12 - 14 ]. there is reasonable consensus that for patients who are bleeding, septic, or hemodynamically unstable, the threshold for transfusion should be raised to 15,000 - 20,000/l. patients with life - threatening bleeding in the chest or head are usually transfused at higher platelet count thresholds (30,000 - 50,000/l). despite the evidence that a platelet count of more than 10,000/l is adequate to prevent spontaneous hemorrhage and that serious bleeding is quite rare at counts above 20,000/l, many interventionalists and surgeons nonetheless insist on platelet counts of at least 25,000/l for multi - lumen catheter insertion and 50,000/l for invasive procedures such as major surgery or liver or lung biopsy. the evidence in support of these practices is nil, but traditional practices do not change without convincing evidence demonstrating that they are unnecessary or even counterproductive, and these practices may well be both. an uncommon indication for platelet transfusion is a platelet dysfunction (due to disease or a commonly employed drug such as aspirin) that is associated with serious bleeding or that accompanies the need for major surgery or another high - risk invasive procedure such as liver biopsy. one reason that strategies for platelet transfusion have been difficult to study and change is that the effectiveness of platelet transfusion is not easily evaluated. if the transfusion is therapeutic, then the amount and rate of bleeding are the only really important measures of response. there are no laboratory tests that adequately measure the efficacy of platelet transfusion, thus clinical evaluation is the only appropriate approach. in the case of prophylactic platelet transfusions, the increase in platelet count is the only available response measure other than the absence of bleeding. the general goal has been to achieve a platelet count above 20,000/l, but the post - transfusion platelet count is usually not measured except in hematology - oncology patients and, in any case, platelet count correlates very poorly with bleeding. typically, platelet counts are performed each morning and if the count is below 10,000/l, a platelet transfusion is given. in patients with bleeding or requiring invasive procedures, post - transfusion platelet counts can be performed at any time after the transfusion, from a few minutes to a few hours. because increments are often transient in acutely ill patients, the transfusion should be performed just prior to any invasive procedure, not the day before or several hours before. a common practice, albeit one based on common sense rather than data, is to infuse platelets during the procedure to ensure that additional platelets are present during the time of maximal challenge to hemostasis. if refractoriness to platelet transfusion (poor post - transfusion platelet count increments) is suspected, this is evaluated primarily by immediate post - transfusion count increments (approximately 10 - 60 minutes after completion of the transfusion). hla antibody - mediated immune refractoriness is further differentiated from other causes such as sepsis, hypersplenism, and drug - related causes by measurement of anti - platelet / anti - hla antibodies and failure to raise the platelet count post - transfusion. in other causes, there is often a short - lived (a few hours) rise in count but poor platelet survival post - transfusion. the most common cause of severe refractoriness is allosensitization, the formation of igg antibodies to hla - a, b (class i major histocompatibility complex) antigens in the transfusion recipient due to prior pregnancy or transfusion or both. donor alloimmunization to hla class i and ii or granulocyte antigens (i.e., antibody in the platelet product) can be an etiology for transfusion - related acute lung injury in the recipient. recipient alloimmunization to hla class i in previous non - sensitized patients is almost entirely prevented by using leukoreduced red cells from which the platelets and white cells have been removed by filtration and leukoreduced platelets from which the white cells have been removed. unfortunately, not all hospitals in the us practice universal leukoreduction of blood components, thus patients may come to referral centers with recent prior transfusion sensitization. women, particularly those with multiple pregnancies, are more likely to experience this complication than men are. unfortunately, once refractoriness has developed, it portends a poor overall prognosis. in the refractory patient, anti - hla class i antibody tests using panel reactivity that employs a cytotoxicity method are often used. an enzyme - linked immunosorbent assay or immunofluorescent assay that detects anti - platelet - specific antibodies (very rare) and hla class i antibodies is also used in some instances. if specificities can be determined, selecting platelet donors who lack the class i hla antigens to which the recipient has antibody is the simplest and fastest approach to dealing with immune refractoriness. two other strategies have some success : hla - a, b - matched platelets and crossmatched platelets. both strategies have a good but not great success rate of about 50 - 75% if a grade a or b hla match or crossmatched platelet apheresis unit is available. a grade a or b hla match is when the donor platelets carry no hla - a, b antigens that are not identical with or serologically cross - reactive with those of the recipient. sometimes, a family member, particularly an hla - matched sibling who served as the donor for a stem cell transplant, can be the best donor as they tend to be closely matched. many cases of clinical refractoriness currently are due to drug - related anti - platelet antibodies, with common offending drugs being vancomycin, amphotericin, and other anti - microbials (rarely quinidine or other drugs). tests for drug - related antibodies are not routinely available, and the primary approach is discontinuing the drug and observing whether transfusion responsiveness returns within a few days to a week of continuing platelet transfusion. the goal of platelet transfusion is to stop or prevent bleeding in thrombocytopenic patients or those with platelet dysfunction [1 - 3 ]. bleeding is a relatively uncommon cause of death in non - trauma patients but can be a significant morbid event at worst and, at best, quite upsetting for patients, families, and providers. thus, traditionally, with the view that platelet transfusion is essentially benign, the impetus has been to transfuse platelets aggressively to prevent rather than treat bleeding. whole blood platelets, which are derived from four to five whole blood donations, pooled, leukoreduced, bacterially tested, and irradiated, used to be the standard transfusion product but now are less frequently used in the us. apheresis platelets derived from donors who spend a couple of hours on a cell separator have become the most commonly used product in the us. the usual doses have been in the range of 3 10 to 5 10 platelets per transfusion but one - quarter to one - half of these doses has been shown to be equivalent in preventing bleeding in a recent but as yet unpublished large national randomized trial (prophylactic platelet dose on transfusion outcomes, or plado). whole blood pooled and apheresis platelets are considered by most experts to be interchangeable in terms of efficacy and safety. patients receiving pheresis platelets are likely to have a higher risk of hemolytic reactions if they are abo - mismatched [5 - 7 ] and a higher risk of acute lung injury (transfusion - related acute lung injury) due to having larger amounts of plasma from a single donor, but carry a lower risk of infectious disease transmission due to fewer donor exposures. earlier studies have demonstrated that alloimmunization and refractoriness to transfusion (inability to raise the platelet count with transfusion) are common in recipients of non - leukoreduced transfusions and abo - mismatched platelet transfusions. thus, almost everyone agrees that platelet transfusions should always be leukoreduced and that every effort should be made to use only abo - identical platelets whenever possible. for patients who have severe or repeated fever, rigors, or allergic or pulmonary complications with transfusion (about 1 - 5% of patients ; mostly fever, rigors, and/or urticaria), saline - washed platelets are available in some hospitals. these require about 2 hours of additional preparation time and contain about 20% fewer platelets than unwashed platelets. one study suggests that clinical outcomes (survival) are improved with the use of washed platelets in adult patients with acute leukemia and that post - transfusion fever, rigors, and urticaria can be almost completely eliminated. traditionally, platelet transfusions in hematology - oncology have been given prophylactically as serious bleeding is fortunately uncommon in these patients. the safe threshold for prophylactic transfusion in a clinically stable patient who does not have serious bleeding (e.g., that requiring red cell transfusion or representing serious or life - threatening morbidity) is considered to be a platelet count of 10,000/l [12 - 14 ]. there is reasonable consensus that for patients who are bleeding, septic, or hemodynamically unstable, the threshold for transfusion should be raised to 15,000 - 20,000/l. patients with life - threatening bleeding in the chest or head are usually transfused at higher platelet count thresholds (30,000 - 50,000/l). despite the evidence that a platelet count of more than 10,000/l is adequate to prevent spontaneous hemorrhage and that serious bleeding is quite rare at counts above 20,000/l, many interventionalists and surgeons nonetheless insist on platelet counts of at least 25,000/l for multi - lumen catheter insertion and 50,000/l for invasive procedures such as major surgery or liver or lung biopsy. the evidence in support of these practices is nil, but traditional practices do not change without convincing evidence demonstrating that they are unnecessary or even counterproductive, and these practices may well be both. an uncommon indication for platelet transfusion is a platelet dysfunction (due to disease or a commonly employed drug such as aspirin) that is associated with serious bleeding or that accompanies the need for major surgery or another high - risk invasive procedure such as liver biopsy. one reason that strategies for platelet transfusion have been difficult to study and change is that the effectiveness of platelet transfusion is not easily evaluated. if the transfusion is therapeutic, then the amount and rate of bleeding are the only really important measures of response. there are no laboratory tests that adequately measure the efficacy of platelet transfusion, thus clinical evaluation is the only appropriate approach. in the case of prophylactic platelet transfusions, the increase in platelet count is the only available response measure other than the absence of bleeding. the general goal has been to achieve a platelet count above 20,000/l, but the post - transfusion platelet count is usually not measured except in hematology - oncology patients and, in any case, platelet count correlates very poorly with bleeding. typically, platelet counts are performed each morning and if the count is below 10,000/l, a platelet transfusion is given. in patients with bleeding or requiring invasive procedures, post - transfusion platelet counts can be performed at any time after the transfusion, from a few minutes to a few hours. because increments are often transient in acutely ill patients, the transfusion should be performed just prior to any invasive procedure, not the day before or several hours before. a common practice, albeit one based on common sense rather than data, is to infuse platelets during the procedure to ensure that additional platelets are present during the time of maximal challenge to hemostasis. if refractoriness to platelet transfusion (poor post - transfusion platelet count increments) is suspected, this is evaluated primarily by immediate post - transfusion count increments (approximately 10 - 60 minutes after completion of the transfusion). hla antibody - mediated immune refractoriness is further differentiated from other causes such as sepsis, hypersplenism, and drug - related causes by measurement of anti - platelet / anti - hla antibodies and failure to raise the platelet count post - transfusion. in other causes, there is often a short - lived (a few hours) rise in count but poor platelet survival post - transfusion. the most common cause of severe refractoriness is allosensitization, the formation of igg antibodies to hla - a, b (class i major histocompatibility complex) antigens in the transfusion recipient due to prior pregnancy or transfusion or both. donor alloimmunization to hla class i and ii or granulocyte antigens (i.e., antibody in the platelet product) can be an etiology for transfusion - related acute lung injury in the recipient. recipient alloimmunization to hla class i in previous non - sensitized patients is almost entirely prevented by using leukoreduced red cells from which the platelets and white cells have been removed by filtration and leukoreduced platelets from which the white cells have been removed. unfortunately, not all hospitals in the us practice universal leukoreduction of blood components, thus patients may come to referral centers with recent prior transfusion sensitization. women, particularly those with multiple pregnancies, are more likely to experience this complication than men are. unfortunately, once refractoriness has developed, it portends a poor overall prognosis. in the refractory patient, anti - hla class i antibody tests using panel reactivity that employs a cytotoxicity method are often used. an enzyme - linked immunosorbent assay or immunofluorescent assay that detects anti - platelet - specific antibodies (very rare) and hla class i antibodies is also used in some instances. if specificities can be determined, selecting platelet donors who lack the class i hla antigens to which the recipient has antibody is the simplest and fastest approach to dealing with immune refractoriness. two other strategies have some success : hla - a, b - matched platelets and crossmatched platelets. both strategies have a good but not great success rate of about 50 - 75% if a grade a or b hla match or crossmatched platelet apheresis unit is available. a grade a or b hla match is when the donor platelets carry no hla - a, b antigens that are not identical with or serologically cross - reactive with those of the recipient. sometimes, a family member, particularly an hla - matched sibling who served as the donor for a stem cell transplant, can be the best donor as they tend to be closely matched. many cases of clinical refractoriness currently are due to drug - related anti - platelet antibodies, with common offending drugs being vancomycin, amphotericin, and other anti - microbials (rarely quinidine or other drugs). tests for drug - related antibodies are not routinely available, and the primary approach is discontinuing the drug and observing whether transfusion responsiveness returns within a few days to a week of continuing platelet transfusion. recent data suggest the efficacy and safety of transfusing fewer and lower doses of platelet transfusions. the clearest indication for platelet transfusion is the presence of serious bleeding in the setting of severe thrombocytopenia or platelet dysfunction. a strategy of transfusing only those patients with evidence of bleeding is called a therapeutic as opposed to a prophylactic strategy. this was supported by a recent randomized trial, and a larger trial is currently under way in the uk. the evidence is that this strategy leads to fewer transfusions and no greater incidence of serious bleeding than a prophylactic strategy. there is obviously more minor bleeding (petechia, purpura, mild epistaxis, and so on). current opinion is moving toward a therapeutic rather than a prophylactic strategy as practitioners become more comfortable in foregoing transfusions in asymptomatic thrombocytopenic patients with ever lower platelet counts. the potential advantage is that platelet transfusion is far from benign, being associated in recent studies with multi - organ failure, acute lung injury, bacterial sepsis, and even earlier recurrence of leukemia. platelets are clearly an important component of the innate immune system, perhaps explaining their postulated pro - inflammatory and pro - thrombotic effects after storage and transfusion. preliminary studies raise the possibility that abo - mismatched platelet and plasma transfusions predispose the patient to bleeding and mortality. recent reports suggest that platelet transfusions are immunomodulatory, pro - inflammatory, and pro - thrombotic [21,25 - 28 ]. with increasing evidence of previously undetected serious and even life - threatening effects of platelet transfusion, an enthusiastically prophylactic approach to transfusion prophylactic platelet transfusions need not be given for counts above 10,000/l or prior to many invasive procedures for counts above 25,000/l. therapeutic platelet transfusions for bleeding are usually effective if the count can be raised above 20,000 - 30,000/l, although many experts continue to advocate a threshold of at least 50,000/l for major surgery and even at least 100,000/l for some surgeries. there are no data supporting these numbers but this is the standard of practice and what is found in textbooks. the society for interventional radiology specifies 25,000/l platelets as the transfusion threshold for tunneled catheters but some physicians request even higher counts (unpublished annual meeting syllabi). liver biopsy and other major procedures require thresholds of 50,000/l but there is little or no evidence to suggest that this is optimal practice. achieving these thresholds in acutely ill patients is often difficult and sometimes impossible. our advice is to give one platelet transfusion and if the count is still suboptimal, determine whether the radiologist, surgeon, or anesthesiologist will accept platelets transfusing during the procedure as an alternative to multiple boluses of platelets in a vain attempt to achieve an arbitrary number. there are a number of cases in our institutions in which infusion of three to seven doses of platelets has been associated with multi - organ failure after surgery, and there are similar reports in the literature. platelet transfusions are likely pro - thrombotic and pro - inflammatory, and transfused platelets are highly activated. there are very few or no situations, in our view, in which a second or third platelet transfusion will accomplish what a single platelet transfusion can not. platelet transfusion should not be considered benign and should be withheld unless there are compelling clinical indications, and these usually involve current serious bleeding accompanied by thrombocytopenia below 50,000/l or platelet dysfunction. serious bleeding is almost never explained primarily by thrombocytopenia with a platelet count that is between 50,000 and 100,000/l in our clinical experience. nb and jmh have served as consultants to manufacturers of leukoreduction filters or products to reduce bleeding, including pall corporation (port washington, ny, usa), fenwal blood technologies, inc. (lake zurich, il, usa), caridianbct (lakewood, co, usa), and bayer (leverkusen, germany). | over the last half century, platelet transfusion has been an effective therapy for the prevention and treatment of bleeding, particularly in patients with hematologic malignancies. recent randomized trials have demonstrated that current practices may be suboptimal in a number of ways. the rationale for parsimony in the use of this powerful therapy includes previously described severe and fatal adverse outcomes (including refractoriness, hemolysis from abo - mismatched transfusions, acute lung injury, and bacterial sepsis), newly described serious potential risks (including thrombosis and earlier leukemic recurrence), difficulty in maintaining adequate supplies of platelets, the need to place volunteer donors on cell separators to provide the product, and cost. recent findings demonstrate that the platelet count threshold for prophylactic transfusion can be as low as 10,000/l, and a therapeutic rather than a prophylactic strategy of transfusion for bleeding manifestations only may be equally safe for most patients. another recently completed study suggests that very low doses of platelet transfusions (the equivalent of half a unit of apheresis platelets or two to three units of whole blood - derived platelets) are as effective at preventing bleeding as much higher doses. one question for which there are no randomized trial data is at what threshold prophylactic platelet transfusion should be given before invasive procedures or major surgery. the typically recommended threshold of 50,000/l is based only on expert opinion, and substantial observational data indicate that this threshold leads to many transfusions that are likely unnecessary and therefore represent risk with little or no additional benefit. |
hepatitis b virus (hbv) is a hepatotrophic virus that causes a major global health problem. an estimated 2 billion individuals have been infected with hbv and approximately 350 million have the chronic disease. although the mechanism of hbv pathogenesis remains elusive, host genetic factors are proposed to govern the pathology of disease progression or regression, along with viral and environmental factors. nk cells are activated in the early response to infection, and there is substantial population variability in the rates of hbv infection. killer cell immunoglobulin - like receptors (kirs) are members of the group of cell - surface molecules that activate or inhibit nk cell interaction with hla class i molecules on the surface of target cells. although detailed genetic and functional analyses exploring kir influences on hbv in large cohorts are lacking, accumulating evidence supports that nk cell activation contributes to inflammation and liver injury during hbv infection both in hbv transgenic mice and in hbv infected patients [58 ]. kirs are members of the immunoglobulin superfamily of receptors and are encoded on chromosome 19q13.4. the kir gene cluster comprises up to 16 highly homologous and closely linked genes and pseudogenes. fourteen of them encode receptors triggering either inhibition (3dl13, 2dl13, 2dl5) or activation (3ds1, 2ds15) and/or both (2dl4), and 2 pseudogenes (2dp1 and 3dp1) do not encode cell - surface receptors. encode for cell - surface receptors, while the remaining alleles, 2ds4 003/4/6/7/8/9, carry a 22-base pair deletion in exon 5, which causes a frame shift, yielding a truncated kir2ds4 protein with loss of the transmembrane and cytoplasmic domains of the full - length kir2ds4 protein. additionally, different combinations of kir genes generate inherited haplotypes that can be divided into 2 basic groups a and b on the basis of their gene content. polymorphic kirs, which interact with hla class 1, are largely inhibitory and exhibit substantial genetic diversity. the result is a significant variation of nk cell repertoire between individuals and also between populations. as each kir - ligand interaction may have differential effects on nk cell activation and inhibition, this diversity has important potential influences on the host response to infections. genetic studies have demonstrated associations between specific kir - ligand combinations and the pathogenesis and progression of diverse viral infectious diseases [1217 ]. there is still limited data on the relationship of kir genes and chronic hbv infection in the literature. additionally, to our knowledge, no analogous study has been performed in our population thus far. the aim of this study was to analyze whether inhibiting or activatory kir genes and different kir genotypes have an association in the progression of hbv infection in a turkish population. this may help to explore some of the possible immune genes that could be important in predisposition to chronic hbv infection. the patient groups consisted of 37 patients (17 male, 20 female) with chronic hbv infection and 36 patients (15 male, 21 female) in spontaneous remission state of hbv infection diagnosed at the department of infectious diseases of the cukurova university, balcal hospital. the diagnostic criterion for chronic hbv adopted in this study the control group consisted of 85 healthy subjects (38 males and 47 females). the ages ranged from 18 to 70 years (mean, 43 years) for the patients with chronic hbv, from 19 to 78 years (mean, 42.6 years) for the patients with spontaneous remission, and from 19 to 74 years (mean, 42.5 years) for the control group. all individuals included in this study were from the cukurova region of turkey and they were all matched for ethnicity. all the enrolled subjects had no serological evidence of hepatitis c virus, hepatitis d virus, and hiv infections, and had no other diseases such as diabetes, malignant tumor, or autoimmune diseases. samples were collected after informed written consent that was obtained from all participants, and the study was approved by the cukurova university ethics committee. diagnosis of chronic hbv infection was based on seropositivity for anti - hbv antibody using electrochemiluminescence immunoassay (roche diagnostics, gmbh, mannheim, germany) and the confirmation of hbv dna using light cycler 2.0 real - time polymerase chain reaction (roche diagnostics, gmbh, mannheim, germany). dna from a venous blood sample of each subject was extracted by dna isolation kit (qiaamp dna blood mini kit, cat no : 51104, qiagen vertriebs gmbh, vienna, austria). genotyping of kir genes was performed using the multiplex kir - sso typing kit from tepnel lifecodes corporation (ref : 545110r, ct, usa). this product consists of a mixture of locus - specific oligonucleotide probes coupled to color - coded microspheres (luminex corp) and 2 pcr reactions for the amplification of kir - exons 4, 5, 7, 8, and 9. to type each sample, pcr was performed and the product was hybridized with the sso - probe mixture using the manufacturer s protocol. frequencies of group - a and -b kir haplotypes were deduced from the genotype data. in individuals carrying only kir3dl3, 2dl3, 2dl1, 2dp1, 3dp1, 2dl4, 3dl1, 2ds4 and 3dl2, a fixed - gene content characteristic of group - a haplotypes was considered carrying 2 copies of group - a kir haplotypes (aa genotypes). if any of genes kir2dl2, 2dl5, 3ds1, 2ds1, 2ds2, 2ds3 and/or 2ds5 were present, then the genotype was considered as having b haplotype (bx). the percentage of each kir gene in the patient and control groups was determined by direct counting (individuals positive for the gene / individuals tested per population100). differences between 2 groups in the distribution of each kir gene were estimated by 2-tailed fisher s exact test and p0.05). additionally, there were no statistically significant differences between the rate of aa and bx genotypes of chronic hbv patients and patients with spontaneous remission and the control group (p>0.05). framework genes kir2dl4, 3dl2, 3dl3, and 3dp1 were present in all of the samples (figure 1). among inhibitory kir genes, 2dl1 and 3dl1 had higher frequencies in all samples of chronic hbv patients, which were more than 78.4%. with the exception of kir2ds4, frequencies of the remaining activating genes were all lower than 54.1% (table 1). the most frequent genotype, found in 13.5% of patients, was aa180 genotype, which consists of only 1 activating gene other patients demonstrated the presence of more than 1 activating gene and thus were considered as bx (67.6%). two different aa genotypes aa180 (13.9%) and aa1 (8.3%) were found in the spontaneous remission group, which consists of only one activating gene kir2ds4 (figure 2). other individuals in this group demonstrated the presence of more than 1 activating gene and thus were considered as bx (76.8%). framework genes kir2dl4, 3dl2, 3dl3, and 3dp1 were also present in all of the samples (figure 2). among inhibitory kir genes, 2dl1 and 3dl1 had higher frequencies in all samples of chronic hbv patients, which were more than 80.6%. with the exception of kir2ds4, frequencies of the remaining activating genes were all lower than 63.9% (table 1). in the first step, frequencies of individual kir genes were compared between chronic hbv patients and patients with spontaneous remission (table 1). there were no statistically significant differences between these 2 groups. in the second step, frequencies of individual kir genes were compared between the control group and the group composed of chronic hbv patients and patients with spontaneous remission (table 2, figure 3). the rate of inhibitory kir2dl3 (p=0.0) and 3ds1 (p=0.0) were higher in the healthy group than the group composed of chronic hbv patients and patients with spontaneous remission. since the methods used for kir genotyping permitted distinguishing groups of alleles of activating kir2ds4, we found that there were no statistically significant differences for 2ds4 001 (full - length exon 5) and 2ds4 003/4/6/7/8/9 (deletion in exon 5) alleles between the 2 groups (p>0.05). additionally, there were no statistically significant differences between the rate of aa and bx genotypes of chronic hbv patients and patients with spontaneous remission and the control group (p>0.05). nk cells express multiple cell surface receptors, and during different infections different receptors are likely to be important. kirs have a variegated expression pattern, and their complex genetics indicate that they are involved in generating population diversity in antiviral immune response. previous studies have demonstrated several associations between various kir genes and/or their hla class i ligands in clinical progression of hbv infection [2022 ] and in the progression of this infection to hepatocellular carcinoma. these associations could be due to the capacity of interactions of hla class i molecules -especially hla - c and hla - b- with kirs and activation of nk cells. in the present study, we examined the genes encoding kir receptors and kir genotypes in chronic hbv patients, patients with spontaneous remission, and healthy controls in a turkish cohort. our results showed that the frequencies of both kir2dl3 and kir3ds1 genes were much higher in healthy controls than in chronic hbv patients and patients with spontaneous remission. this might indicate that the inhibitory kir2dl3 and activating kir3ds1 were possibly protector genes for hbv infection. similarly, gao, in their study comparing 182 chronic hbv patients with 140 healthy controls, reported that kir2dl3 : hla - c1 homozygosity was protective against hbv infection and that kir2dl1 : hla - c2 was associated with susceptibility to hbv infection. in contrast, zhi - ming showed that kir2ds2 and kir2ds3 are hbv - susceptive genes, whereas kir2ds1, kir3ds1, and kir2dl5 may be protective genes that facilitate the clearance of hbv in a han chinese population. population genetic analyses have revealed that the frequency and distribution of kir genes and haplotypes vary with ethnicity. although zhi - ming s study and ours were done in different populations, the kir3ds1 gene was found as a protector gene in both studies. in a wider study, lu analyzed kir genes in 150 patients with chronic hbv infection, 251 spontaneous resolvers, and 451 healthy controls. they found a lower frequency of the a haplotype and higher frequency of the b haplotype in patients exposed to hbv infection compared with healthy controls, implying a susceptibility effect of the b haplotype. in our study, there were no statistically significant differences between the rate of aa and bx genotypes of chronic hbv patients and patients with spontaneous remission and the control group. additionally, in a recent study, pan suggested the association of a combination of full - length form and 22 bp - deleted form of kir2ds4 (kir2ds4/1d) with hepatocellular carcinoma incidence in patients with chronic hbv. previous studies showed that there are important similarities between inhibitory and activating kir frequencies of patients with hepatitis c and hbv infections, despite these viruses being phylogenetically unrelated. khakoo reported that genes encoding the inhibitory nk cell receptor kir2dl3 and its ligand, hla - c1, influence resolution of hepatitis c virus infection in caucasians and african americans with expected low infectious doses of hcv but not in those with high - dose exposure. chronic hbv patients, patients with spontaneous remission of hbv infection, and healthy controls in our population demonstrate that kir2dl3 and kir3ds1 are important immuno - genetic markers in determining antiviral immunity. to explore the role of kirs in hbv infections, the interrelation between kir genes, genotypes, and chronic hbv infection should be investigated in many different populations. models based on both activating and inhibitory receptors and their ligand interactions could be generated for detailed genetic studies in wider groups. thus, in order to confirm the present general results obtained in this study, functional studies and investigations in different populations are still needed to better understand this mechanism. | backgroundkiller cell immunoglobulin - like receptors (kirs) are a family of inhibitory and activating receptors expressed by natural killer (nk) cells and regulate nk cell activity in the innate response against viral infections. the aim of this study was to determine the possibility of kir genes and genotypes as a candidate for susceptibility to or protection against chronic hepatitis b virus (hbv) infection or spontaneous remission of the infection in a turkish cohort.material/methodsthe present study was carried out on 37 patients with chronic hbv infection, 36 patients in spontaneous remission of hbv infection, and 85 healthy subjects. sequence - specific oligonucleotide probes analysis was used to investigate 16 kir genes. all data were statistically analyzed by the fisher exact test.resultsthe rate of inhibitory kir2dl3 (p=0.0) and 3ds1 (p=0.0) were higher in the healthy group than the group composed of chronic hbv patients and patients with spontaneous remission. there were no statistically significant differences between the rate of aa and bx genotypes of chronic hbv patients and patients with spontaneous remission and the control group (p>0.05).conclusionsour results suggest that kir2dl3 and kir3ds1 genes could be protector genes for hbv infection and they could be important immuno - genetic markers in determining antiviral immunity in the turkish population. |
obesity has become an increasingly important global health problem. currently, 13% of the world 's adult population aged 18 years and older are obese, with a body mass index (bmi) 30 kg / m. in 20082011, 23% of the male and 24% of the female adult population in germany had a bmi 30 kg / m. bariatric surgery is the most effective long - term treatment for the majority of morbidly obese patients with a bmi 40 kg / m or for those with a bmi 35 kg / m who are diagnosed with obesity - related medical comorbidities such as type 2 diabetes mellitus or arterial hypertension. in previous studies of weight loss outcomes after bariatric surgery, the amount of excess weight loss as a percentage (% ewl) was commonly used as a marker of weight loss success (ewl 50%) or weight loss failure (ewl 0.90) of each of these variables on a single factor explained 87% of the total variance in the data set. motivation to lose weight, the broader construct psychological burden was generated and used for further multivariate analyses to retain statistical power. for the combined dependent variable psychological burden, four variables were used : perceived stress (psq-20), depression (phq-9), anxiety (gad-7), and mental impairment (isr). for the combined dependent variable coping style, four variables of brief cope were used : avoidant coping, for the combined dependent variable motivation to lose weight, three variables were used : self - motivation, social environment, and treatment environment. for additional exploratory analyses, univariate anovas were performed with bonferroni - adjusted post hoc comparisons using tukey 's hsd test to control for type i error. chi - square tests were conducted for the nominal dependent variables, with post hoc comparisons using standardized residuals and a critical value of 1.96 indicating significant group differences. the magnitude of group differences was further analyzed by means of effect sizes ; for metrical data, we used cohen 's d (0.2 = small, 0.5 = moderate, and 0.8 = large), and for nominal data, we used cohen 's w (0.1 = small, 0.3 = moderate, and 0.5 = large). preliminary analyses included describing the variables, screening for missing values and outliers, and testing for the normality, linearity, homogeneity of variance / variance - covariance matrices, and multicollinearity of the dependent variables, with no serious violations noted. the mean postoperative % ewl was 53% (sd = 24%, range : 14115%). in relation to the observed % ewl distribution in our study, patients were classified into three % ewl groups of nearly equal size based on tertiles : low (n = 21, ewl range : 1439%), moderate (n = 22, ewl range : 4059%), and high (n = 21, ewl range : 60115%). postoperative % ewl differed significantly between the three % ewl groups (p 0.05) (table 1). weight and bmi characteristics for the low-%ewl, moderate-%ewl, and high-%ewl groups before and after bariatric surgery are presented in table 1. within all three % ewl groups, the patients ' mean weight, excess weight, and bmi decreased significantly after surgery (p 0.05). in the high-%ewl group, 38% (n = 8) of the patients attained a postoperative nonobese bmi of 0.05). a small but statistically significant group difference in education levels was found : on average, the high-%ewl group had 2.2 more years of education than the low-%ewl group (p = 0.010). there were no statistically significant differences in education levels between the low-%ewl and moderate-%ewl groups or between the moderate-%ewl and high-%ewl groups (p > 0.05). with regard to physical comorbidities, table 2 shows that all three % ewl groups had high rates of presurgically diagnosed metabolic syndrome symptoms ; approximately half of the patients in each group suffered from type 2 diabetes mellitus. no group differences in diabetes prevalence were found (p > 0.05). with regard to mental comorbidities, the groups with low and high % ewl presented with particularly high rates of presurgically diagnosed mental disorders (i.e., depression) ; however, the results showed no statistically significant group differences in the prevalence of mental disorders (p > 0.05) (table 2). all three % ewl groups presented with high rates of disordered eating behaviors such as hyperphagia. group differences in the prevalence of eating disorders such as binge eating disorder, night eating syndrome, or sweet eating syndrome could not be detected (p > 0.05) (table 2). altogether, a total of 39% (n = 25) of the patients reported past or current psychotherapeutic treatment. the results showed a statistically significant group difference in the use of psychotherapy : slightly more patients in the low-%ewl group underwent psychotherapeutic treatment before lsg surgery compared with those in the moderate-%ewl group (p = 0.013). for the high-%ewl group, no statistically significant difference in the use of psychotherapy could be identified (p > 0.05) (table 2). preoperative psychological characteristics for the groups with low, moderate, and high % ewl are presented in table 2. the results revealed no statistically significant difference between the three % ewl groups in the overall preoperative psychological burden in terms of perceived stress (psq-20), depression (phq-9), anxiety (gad-7), and mental impairment (isr) (f(8,118) = 0.9, p = 0.535 ; pillai 's trace = 0.1 ; d = 0.5). furthermore, the three % ewl groups showed no statistically significant difference in their overall preoperative motivation to lose weight in terms of self - motivation or motivation from the social environment or treatment environment (f(6,118) = 1.0, p = 0.428 ; pillai 's trace = 0.1 ; d = 0.4). in terms of the overall preoperative coping style (brief cope), the three % ewl groups showed no statistically significant difference (f(8,118) = 1.6, p = 0.145 ; pillai 's trace = 0.2 ; d = 0.7). to further investigate our main research question (2), when the results for the different coping styles (avoidant coping, seeking support, positive reframing, and active coping) were considered separately in bonferroni - adjusted comparisons, a marked difference could be identified : patients with high postoperative % ewl reported slightly but significantly higher scores for active coping behavior prior to surgery compared with patients with low % ewl (p = 0.019) and moderate % ewl (p = 0.022). the low-%ewl and moderate-%ewl groups did not differ in this regard (p > 0.05) (table 2 and figure 1). the positive relationship between preoperative active coping and postoperative % ewl was confirmed by a statistically significant correlation analysis (r = 0.36 ; p = 0.004). the results showed no statistically significant differences between patients who dropped out of the study (n = 28) and patients who were reassessed after lsg (n = 64) in preoperative variables such as age, sex, bmi, years of education, prevalence of metabolic syndrome symptoms, mental disorders including eating disorders, or psychotherapy use (p > 0.05). furthermore, the two groups showed no statistically significant differences in their overall preoperative psychological burden (f(4,87) = 1.9, p > 0.05 ; pillai 's trace = 0.08 ; d = 0.6), coping style (f(4,87) = 1.0, p > 0.05 ; pillai 's trace = 0.04 ; d = 0.4), or motivation to lose weight (f(3,87) = 2.1, p > 0.05 ; pillai 's trace = 0.07 ; d = 0.5) (data not shown). in the present study, we employed a retrospective approach to examine associations between preoperative factors and the amount of % ewl achieved on average 20 months after bariatric surgery in 64 patients who underwent lsg. patients were classified into groups with low, moderate, and high postoperative % ewl based on tertiles to identify homogeneous subgroups of lsg patients for group comparisons. our results showed that lsg patients with high % ewl had a lower weight and bmi prior to surgery compared with patients with moderate % ewl, but no significant weight and bmi differences compared with patients with low % ewl were found. this initially counterintuitive finding is in line with previous studies of gastric bypass surgery reporting that patients who were preoperatively less obese have a higher postoperative % ewl [9, 44, 45 ]. one possible explanation is that patients who were preoperatively more obese (i.e., bmi 50 kg / m) tend to stagnate earlier in their weight loss process and begin to regain weight as early as 12 months after surgery. although early weight stagnation and weight regain might play a role, our prepost study design masks the time course of weight change, and therefore explanations remain speculative at this point. longitudinal data are necessary to assess the course of weight after lsg in more detail. the preoperative psychological burden and motivation to lose weight were not associated with the amount of % ewl in patients following lsg intervention. however, more self - reported active coping behavior (assessed by the following items : i have been concentrating my efforts on doing something about the situation i am in ; i have been taking action to try to make the situation better ; i have been trying to come up with a strategy about what to do ; and i have been thinking hard about what steps to take) seemed to be beneficial for treatment success in terms of more favorable weight loss outcomes. in summary, a more active coping style might be predictive of higher postoperative weight loss outcomes. however, the results provided no clear evidence of a clinically important role of preoperative mental health and the motivation to lose weight in the weight - related treatment success of lsg. previous studies have identified psychological predictors of weight loss outcomes after bariatric surgery ; for example, some have observed less weight loss in patients with mood and anxiety disorders [24, 27 ]. however, across reviews of the prebariatric predictors of postbariatric weight loss [28, 46 ], relationships between psychological factors and weight - related surgery outcomes seem inconsistent and appear to vary by study design and sample. bariatric surgery patients must meet certain criteria to be eligible for surgery (e.g., they must meet a certain bmi requirement, be free of potential contraindications, and obtain approval from health care team members), which evidently results in a homogenized sample of medically and mentally healthier patients. therefore, the variability within our sample of patients who underwent lsg surgery might be reduced, which could in turn lower the magnitude of % ewl group differences and underestimate the impact of psychological factors on weight loss outcomes. on the other hand, static factors such as sociodemographic status assessed prior to bariatric intervention might have limited practical value for predicting weight loss because they do not capture patients ' flexibility in adapting to changing circumstances after the intervention. in fact, some studies suggest that postbariatric factors such as the (re)occurrence of depressive and anxiety disorders [27, 48 ] or the loss of control over eating have a much stronger impact on weight loss outcomes after bariatric surgery than prebariatric factors do while suggesting tailored interventions to optimize treatment success, our results demonstrate the difficulty of preoperatively identifying patients who are at risk for more unfavorable postoperative weight - related outcomes. however, our results might also indicate that more active coping behavior is a marker of higher postoperative weight loss. as discussed by ahnis., active coping behavior in obese patients seeking a bariatric intervention might include the preoperative search for information about surgical treatment options on the internet, in support groups, in informative meetings, or during medical visits and examinations. this behavior may in turn contribute to patients developing a more informed and educated perspective on the possibilities and limitations of lsg surgery and the necessary lifestyle modifications (e.g., following dietary advice and physical activity recommendations) to achieve higher and sustained weight loss after surgery. however, because bariatric surgery leads to a profound change in patients ' gastrointestinal and whole - body physiology, it is important to also consider potential physiological mechanisms. in fact, such considerations might be complex, and psychological and physiological factors might actually combine and interact in influencing outcomes. the strength of our study is that it was conducted in a naturalistic clinical setting. in addition, whereas the majority of previous research in this area focused on roux - en - y gastric bypass surgery, we had access to a homogeneous clinical sample of patients undergoing lsg. to the best of our knowledge, this was the first study that systematically assessed the relationship between postoperative % ewl on average 20 months after surgery and the preoperative psychological burden (as a broader construct comprising perceived stress, depression, anxiety, and mental impairment), coping style, and motivation to undergo surgery in a sample of lsg patients. the size of our sample was comparable to that of other small - scale studies in the field of bariatric surgery. moreover, the attrition rate in our study was rather small, and our attrition analyses showed no significant differences in preoperative variables between patients who provided data at follow - up compared with those who did not. however, from a statistical perspective, the sample size is still small, allowing for only a few statistical tests in addition to a large set of exploratory analyses. the patients ' postoperative weight was self - reported, which might undermine the validity of the % ewl classification scheme. however, self - reporting of weight is relatively common in obesity studies, and there is evidence that objectively measured and self - reported weights are not significantly different in bariatric surgery patients. finally, it can be argued that the generation of psychological burden as a broader construct comprising perceived stress, depression, however, all these variables proved to be strong determinants of patients ' psychological burden, with high intercorrelations and high loadings on a single factor, thus supporting the use of the combined variable to capture the construct of psychological burden. although an active coping style seemed to be of value in predicting more favorable postoperative weight loss outcomes, neither biomedical markers nor an extensive set of other psychological constructs assessed before surgery enabled a clinically relevant prediction of the weight - related treatment success of lsg. our study highlights the need for further research on the psychological correlates of postbariatric health outcomes. nevertheless, despite our finding of a considerably large degree of variation in postoperative weight loss in our sample of lsg patients, all three % ewl groups showed significant weight loss and decreases in body weight and bmi, including the low-%ewl group. therefore, the bariatric intervention proved to be highly beneficial for the vast majority of patients, thus promoting positive health outcomes. | background. the amount of excess weight loss (% ewl) among obese patients after bariatric surgery varies greatly. however, reliable predictors have not been established yet. the present study evaluated the preoperative psychological burden, coping style, and motivation to lose weight as factors determining postoperative treatment success. methods. the sample included 64 morbidly obese patients with a preoperative bmi of 51 8 kg / m2 who had undergone laparoscopic sleeve gastrectomy (lsg). well - established questionnaires were applied before surgery to assess the psychological burden in terms of perceived stress (psq-20), depression (phq-9), anxiety (gad-7), and mental impairment (isr) as well as coping style (brief cope) and motivation to lose weight. % ewl as an indicator for treatment success was assessed on average 20 months after surgery. results. based on the % ewl distribution, patients were classified into three % ewl groups : low (1439%), moderate (4059%), and high (60115%). lsg patients with high % ewl reported significantly more active coping behavior prior to surgery than patients with moderate and low % ewl. patients ' preoperative psychological burden and motivation to lose weight were not associated with % ewl. conclusion. an active coping style might be of predictive value for better weight loss outcomes in patients following lsg intervention. |
acute rejection (ar) is a major risk factor for chronic allograft nephropathy and renal allograft failure after kidney transplantation. the banff classification criteria divided ar into acute cellular rejection (acr) and acute humoral rejection. t cell mediated rejection, as it is associated with cytotoxic t cell infiltration. however, long - term allograft survival has not been completely improved by controlling factors that affect the t cell pathway [35 ]. in addition to t cells, other inflammatory cells, including cd20-positive b cells [68 ], plasma cells [911 ], macrophages [1215 ], eosinophils [1618 ], and nk cells, can also infiltrate grafts in acr and may affect the severity of rejection and the therapeutic response. reported the presence of cd20-positive b lymphocytes in the graft interstitium of pediatric recipients with acr for the first time, and they concluded that it was strongly associated with clinical glucocorticoid resistance and graft loss. classified acr biopsies into the cd20-positive group if they demonstrated strong and diffuse staining characteristics, while trace or rare cd20-positivity was recognized as the cd20-negative group. other studies also suggested a correlation between cd20 graft infiltration and steroid - resistant rejection [20, 21 ]. however, relevant studies have argued that cd20-positive b cells exhibited in biopsies have no effect on clinical outcome [22, 23 ]. clatworthy. conducted a clinical trial comparing rituximab (an anti - cd20 monoclonal antibody) with daclizumab (an anti - cd25 monoclonal antibody) as induction therapy in nonsensitive kidney transplant recipients, but this trial was suspended because of an excess incidence of acr in the rituximab group. the authors surmised that this anti - cd20 monoclonal antibody might have cleared immunoregulatory b cells, including b cells in the allograft tissue, which led to a marked increase in acr. disagreements that exist in published studies may be because of a relatively small sample size and lack of a unified standard for the definitions of what is cd20-positive and cd20-negative. the aim of this study was to determine the effects of cd20-positive b cell graft infiltration during acr on allograft outcome in a chinese population. this is a retrospective study of patients who underwent kidney transplantation between september 2001 and december 2014 at the kidney disease center of the first affiliated hospital of zhejiang university (hangzhou, china). this study was approved by the committee of ethics in biomedical research of zhejiang university. pathological records, clinical data, test results, and follow - up information of all patients were collected from the electronic medical record system and the kidney transplantation database of our center. altogether, 217 patients were identified with biopsy - proven acr (grade i or ii) according to the banff 2005 criteria and were negative for c4d staining. excluding one patient who was lost of follow - up after antirejection treatment, 216 patients were included in this analysis. all patients were followed up until june 30, 2015. according to the presence of cd20-positive b cell infiltration, 83 recipients were classified into the cd20-negative group, and 133 were classified into the cd20-positive group. most of the recipients received calcineurin inhibitor (cni) (cyclosporine or tacrolimus) in combination with mycophenolate mofetil (mmf) and steroids as maintenance immunosuppressive regimen, while some received rapamycin in place of cni. cyclosporine (csa) was initiated at 5 mg / kg / d and tacrolimus (fk506) at 0.100.15 g / l and 812 g / l, respectively, during the first month after transplantation ; 200250 g / l and 610 g / l, respectively, from the second to the third month ; 150200 g / l and 48 g / l, respectively, from the fourth to the sixth month ; and around 150 g / l and 36 g / l, respectively, after the sixth month. mmf was started at 1.52 g / d for half a month and maintained at 1 since then, starting from 80 mg / d, with a daily reduction of 10 mg, prednisone was maintained at 1015 mg / d. once acute rejection was proven by allograft biopsy, intravenous methylprednisolone was administrated at 610 mg / kg daily for 3 days as pulse therapy. if the serum creatinine (cr) level decreased more than 50% or went back to the baseline level within 1 - 2 weeks, the treatment was considered effective. if not, acr was further treated with okt3 at 510 mg / d or atg at 100200 mg / d for 57 days. response to therapy was determined by comparing the serum cr level measured two weeks after completion of the antirejection treatment to the baseline serum cr level measured before rejection. response was considered complete if a decrease in serum cr level was maximally 125% of baseline and partial if the cr was 125%175% of baseline, and it is no - response if cr was still more than 175% of the baseline or graft loss (back to dialysis or nephrectomy). kidney allograft pathology diagnosis was made by an experienced renal pathologist (w. h.) according to the banff 2005 criteria. vascular rejection refers to the existence of intimal arteritis in the acr sample, that is, grades iia, iib, iia + ia, iia + ib, iib + ia, and iib + ib, according to the banff 2005 criteria. immunohistochemical staining for cd20 and c4d was routinely performed on paraffin sections using the cd20 monoclonal antibody from zhongshan (cat number za0549, beijing, china) and the c4d polyclonal antibody from abcam (cat number ab36075, cambridge, uk)., cd20-positive was defined as strong and diffuse staining characteristics, while trace or rare cd20-positivity was assigned to cd20-negative. the cd20-positive specimens were further assessed independently by two authors (w. r. and w. h.) and defined as mild - positive if cd20-positive cells accounted for less than 25% of the inflammatory cells, moderate - positive if cd20-positive cells were 26%49% of the inflammatory cells, and severe - positive if cd20-positive cells were more than 50% of the inflammatory cells. continuous variables are expressed as mean standard deviation (sd) or median (range). normally distributed continuous variables were analyzed using student 's t - test or one - way anova, and nonnormally distributed continuous variables were analyzed using mann graft / patient survival was analyzed with kaplan - meier method and differences between survival curves were calculated by the log - rank test. factors associated with graft loss on the univariate analysis with p < 0.1 were included into a cox multivariate analysis. eighty - three patients were assigned to the cd20-negative group, and 133 patients were classified as cd20-positive. no significant differences in age, gender, cold / warm ischemia time, donor type, primary disease, induction regimen, and prerejection immunosuppressive drugs were observed between these two groups. acr was diagnosed earlier after kidney transplantation in the cd20-negative group compared with cd20-positive group (median time to acr, 29 days versus 142 days, p = 0.016). as presented in table 1 there was significantly more vascular rejection (iia, iib, iia + ia, iia + ib, iib + ia, and iib + ib) in the cd20-negative group (50/83 patients, 60.2%), compared with the cd20-positive group (55/133 patients, 41.4%) (p = 0.005). in general, cd20-negative patients presented with higher prerejection serum cr levels, compared with the cd20-positive group (180.1 128.4 versus 130.6 68.1 mol / l, p = 0.002). the same results were obtained with peak cr at rejection (352.7 242.3 versus 274.1 265.6 mol / l, p = 0.027). no significant differences were observed at any other time point during follow - up (table 3). corresponding to this, worse gfr was observed in the cd20-negative group before rejection (47.2 21.3 versus 60.4 21.6 ml / min, p < 0.001), and the same results were obtained at the time of rejection (25.0 15.0 versus 30.6 13.3 ml / min, p = 0.005). no significant differences between cd20-positive and cd20-negative groups were observed at any other time point during follow - up (table 4). patients in the cd20-positive and cd20-negative groups received similar maintenance immunosuppressive regimen after rejection (table 5). after acr, significantly more cd20-negative patients (49/83, 59.0%) received steroid plus antibody therapy (defined as steroid - resistant rejection) compared with the cd20-positive group (52/133, 39.1%) (p = 0.004). more patients in the cd20-negative group (27/83, 32.5%) experienced graft loss compared with the cd20-positive group (25/133, 18.8%), which reached a significant difference (p = 0.022). figure 2(a) displayed the graft survival over time analyzed by the kaplan - meier death - censored method for cd20-positive and cd20-negative groups. we further divided the cd20-positive group into cd20 mild - positive subgroup (n = 76), cd20 moderate - positive subgroup (n = 36), and cd20 severe - positive subgroup (n = 31) according to the percentage of cd20-positive b cells found in the inflammatory cell population. figure 3(a) showed that the cd20 severe - positive subgroup tended to have better graft survival compared to the other three groups, but this difference was not significant. univariate analysis showed that the cd20-positive infiltration, prerejection immunosuppressive regimen, antirejection therapy, and antirejection response were the factors influencing renal allograft loss. further multivariate cox regression analysis revealed that cd20 infiltration was a protective factor for graft loss. the adjusted risk ratio of graft loss for steroid plus antibody treatment was 2.316 compared with steroid alone. compared with the complete response, the adjusted risk ratio of graft loss was 2.538 for partial - response and 13.847 for no - response, as exhibited in table 6. the prerejection immunosuppressive regimen, which was significant in the univariate analysis, did not reach significance in the multivariate analysis. our study demonstrated that cd20-positive infiltration in the biopsy specimens from the allografts with acr was associated with less steroid - resistant rejection and better allograft survival. further exploration of the infiltration degree suggested that it tended to be positively related with graft survival, but without statistical significance. multivariate cox regression revealed that cd20-positive infiltration, antirejection therapy, and antirejection response were independent predictors of graft loss. b cells and plasma cells in pathological tissues have been considered as nonspecific effector cells in the past [26, 27 ]. in 2003, first demonstrated the presence of cd20-positive b cells in the graft interstitium of pediatric transplant recipients experiencing acr. their study suggested that cd20-positive infiltration was associated with steroid - resistant rejection and worse graft survival. since then, the role of cd20-positive b cells in acr has attracted more attention. in adult kidney transplantation, 22% of acute rejection (ia, ib) specimens had cd20-positive infiltration, and it was associated with worse outcome. a mouse model of acute cardiac allograft rejection demonstrated that recipients ' b cells participate in indirect alloantigen presentation and play an important role in the progression of acute vascular rejection. studies analyzing the cd20-positive b cells ' infiltration pattern in adult kidney transplantation reported higher serum cr levels in recipients with clusters of b cells. some studies have suggested that once recruited into injured grafts, b cells can act as antigen - presenting cells to promote t cell mediated rejection, which is resistant to conventional steroid therapy. different result was observed, suggesting that the early infiltration of b cells can be beneficial [23, 31 ]. performed immunostaining for cd20 on 54 biopsy - proven acr samples, and no correlation was found between the number of cd20 cells, in clusters or in a scattered pattern, and clinical outcome. increased peripheral blood b cells were detected in the steady recipients, instead of those experiencing rejection. cd20 transcription was found to be increased in tolerant kidney transplant recipients [3335 ]. kayler. suggested that b cells were not indicators of graft loss or steroid resistance in their analysis of 120 acr biopsies. one of the possible explanations for this is the lack of a unified standard on the definition of cd20-positive and cd20-negative. sarwal and her colleagues defined cd20-positive as more than 275 cd20-positive cells in a single high power field (hpf) and came to the conclusion that cd20-positive cells were strongly associated with severe graft rejection. hippen. used a qualitative method in their research and defined biopsies with strong and diffuse staining characteristics of cd20-positive cells as the cd20-positive group, while trace or rare cd20-positive cells were recognized as the cd20-negative group. their research indicated that cd20-positive infiltration was more likely to have steroid - resistant rejection and worse graft survival. in bagnasco 's research, cd20-positive patients (at least one cluster containing more than 100/hpf cd20-positive cells) and cd20-negative patients (the count was below 50/hpf) were compared. cd20-positive lymphoid clusters, which were defined as any dense cluster of lymphoid cells containing more than 15 cd20-positive b cells by kayler., did not predict steroid resistance or worse graft survival. the definition of cd20-positive and cd20-negative in our study is in line with hippen. 's research. however, our study 's findings that cd20-positive infiltration is associated with better clinical outcomes are not consistent with hippen. 's results. first, our study included a larger number of acr biopsies than any published studies so far. a total of 216 cases of biopsy - proven acr were included in our analysis ; 83 samples were assigned to the cd20-negative group, and 133 were classified as cd20-positive. 's study cohort contained 27 patients and only 6 biopsies were classified as cd20-positive. as mentioned in the discussion by the authors, the relative small sample sizes in their analysis may limit the generalization of their conclusions. 's research was conducted in biopsies with proven banff ia or ib rejection within the first year after transplantation. our study included patients with acr grade i and grade ii at any time point after kidney transplantation. the differences in the inclusion criteria of study population may contribute to the different results. thus, besides the lack of a uniformed definition of cd20-positive and cd20-negative, a relatively small sample size, different study populations (pediatrics versus adults ; different subgroups of acr), differences in the induction and maintenance immunosuppression therapy, different follow - up durations, and other factors can contribute to the inconsistency in the studies concerning the role of cd20-positive infiltration in acr. the prognostic study of cd20-positive cells in acr helps to select future treatment, in particular, whether or not to apply b - cell - depleting agents in steroid - resistant rejection. rituximab, an anti - cd20 monoclonal antibody, was first applied in the treatment of lymphoma. it has been proven effective in treatment of a number of hematological diseases and autoimmune diseases [3840 ]. in the aspect of transplantation, rituximab has been used for desensitization of panel reactive antibody, anti - hla antibody, and anti - abo antibody before transplantation as induction regimen and treatment of humoral rejection after transplantation [4147 ]. in 2002, a cardiac transplant patient with vascular rejection refractory to plasmapheresis was successfully treated with rituximab, which was the first documented application of an anti - cd20 monoclonal antibody in the aspect of rejection. later, other case reports confirmed that cd20 monoclonal antibody was effective in the treatment of vascular rejection in heart and pancreas transplantation [4951 ]. at present the cd20-positive b cells in graft are significantly reduced after treatment, but the studies of the reconstruction of b cells in grafts are rather rare. our results showed that cd20-positive infiltration in patients with acr appeared to have a protective effect on graft outcome. additionally, a clinical trial which planned to use rituximab in nonsensitive kidney transplant recipients was forced to stop because of increases in rejection. thus, the administration of anti - cd20 monoclonal antibody in patients with acr requires careful consideration. cd20-positive b cell infiltration in renal allograft biopsies with acr is associated with less steroid - resistant rejection and better graft survival. | background. it is controversial whether lymphocyte infiltration exhibited in biopsy specimens is associated with transplant outcomes. this study focused on the effect of cd20-positive b cell infiltration in biopsy specimens from allografts with acute cellular rejection (acr) in a chinese population. methods. altogether, 216 patients transplanted from sep. 2001 to dec. 2014 with biopsy - proved acr (banff i or banff ii) were included in the analysis. biopsies were immunostained for cd20 and c4d. baseline information, serum creatinine and gfr before and after treatment, steroid resistance, response to treatment, graft loss, and survival were analyzed. results. eighty - three patients were classified into cd20-negative group, and 133 patients were classified into cd20-positive group. significantly more cd20-negative patients (49/83, 59.0%) received steroid plus antibody therapy compared with the cd20-positive group (52/133, 39.1%) (p = 0.004). the response to treatment for acr did not differ between these two groups. the cd20-positive group had less graft loss (18.8% versus 32.5%, p = 0.022) and a better graft survival rate. further exploration of the infiltration degree suggested that it tended to be positively related to graft survival, but this did not reach statistical significance. conclusion. cd20-positive b cell infiltration in renal allograft biopsies with acr is associated with less steroid resistance and better graft survival. the presence of cd20-positive b cells is protective for renal allografts. |
in the last two decades, li - ion batteries (libs) have occupied the portable - electronics market as a primary power supplier with a higher gravimetric and volumetric capacity than other rechargeable - battery systems (e.g., ni cd, lead acid, redox - flow, and metal - ion batteries). however, current lib technologies can not satisfy the energy and power requirements of a wide range of applications, from portable electronic devices to all - electric vehicles and smart grids. in this regard, battery roadmaps from the department of energy (doe, usa) and the new energy and industrial technology development organization (nedo, japan) indicate that successful development of progressive libs will become a top priority for nations around the world. hence, there are significant research challenges regarding all kinds of battery components, including cathodes, anodes, current collectors, electrolytes, and separators. regarding anodes in particular, substituting graphite with high - capacity alternative materials has been highlighted as a crucial challenge in practice. although conventional graphite anodes exhibit excellent electrochemical performance, such as a long cycle life, low irreversible capacity loss, and low volumetric expansion (870 nm for amorphous si.12b, the behavior of nanosized si during cycling were demonstrated by in situ transmission electron microscopy (tem) and mathematical modeling.12a kim. investigated the effect of the size of the si on electrochemical reactions, reporting elastic volume change as the size approached 10 nm. in addition, a high specific surface area between the electrolytes and nanostructured electrodes stimulates the charge transfer across the electrode / electrolyte interface. furthermore, the rate of li alloying / dealloying reactions can be improved significantly with nanomaterials having small dimensions, owing to the reduced characteristic time constant (t) in the diffusion, which is given by t = ld (l : diffusion length, d : diffusion coefficient). these merits enable the nanosized si not only to help in accommodating severe volume changes with its improved mechanical properties but also to provide improved electrochemical properties. in light of the improved battery performance of the nanosized si particle, one - dimensional (1d) nanowires and nanotubes for example, si nanowires that were directly grown on stainless steel exhibited a high battery performance owing to the prior benefits of the nanosize effects and the 1d electronic path of the wire structure. si nanotubes, which retain suitable voids in the wire structure, can also efficiently accommodate volume changes and provide good electrochemical properties. thus, reducing the material size and applying it to some kind of structure comprise an essential preliminary approach for increasing the electrochemical properties and handling the large volume change during cycling. in past decades, thin - film electrodes have been studied to elucidate the fundamental properties of si owing to their simple model for both simulations and experiments, including their mechanical behavior during cycling and their phase evolutions. regarding the strategies for resolving the volume - change problem, thin - film engineering has played an important role in clarifying the stress evolution of si anodes during cycling.19e,19f based on the mechanical estimation of the behavior of the thin - film electrodes, their architecture has advanced with patterns that can accommodate the volume change of si. soni.19f successfully fabricated a si - patterned thin - film electrode and calculated the critical size (5.18.9 m) of the pattern for preventing cracks in the electrode (figure 1 a). sophisticated honeycomb patterns that enabled the elastic behavior of the si during cycling were reported by baggetto. (figure 1 b) ; an alumina - coated patterned amorphous si electrode that protected the side reactions and enhanced the fracture resistance of the si was designed by he. (figure 1 c). as representative models for a volume - change - accommodating electrode design, si - patterned thin films can effectively relieve the mechanical stress via suitable voids between the patterns upon volume expansion and exhibit superior electrode stability with material integrity upon cycling. therefore, si - patterned thin - film anodes, which provide a high specific capacity, superior rate capability, and cycling stability, remain a candidate for fundamental study and application in new battery systems such as microbatteries and flexible batteries. a) relationship between the critical crack spacing (lcr) in the si film and critical size of si patches (l) against interfacial delamination. plastic localization inside si patches induces interfacial delamination when l is larger than lcr which is calculated as 5.18.9 m with 100 nm of thickness. c) sem images of alumina coated patterns before and after 1st lithiation in top view. reprinted with permission from refs. ]. copyright 2011 elsevier b.v ; copyright, 2011 john wiley & sons, inc. ; copyright, 2011 john wiley & sons, inc. si architectures incorporating pores and voids are considered effective for alleviating the volume variation of the si electrode during the electrochemical cycling. recently, li. reported the mesoporous si sponge (figure 2 a)which is synthesized from an si wafer through electrochemical etching as an anti - pulverization structure, performing a theoretical estimation and an in situ tem analysis (figure 2 b). they calculated the structural changes of their material, reporting a correlation between the expansion rate and the pore radius after full lithiation, as well as the range of volume change upon lithiation. the calculation corroborated an in situ tem analysis, indicating that the volume change of the si particle was greatly reduced. this porous structure for anti - pulverization with a porosity of 80 %, surface area of 494.7 m g, pore size of 50 nm, and si wall thickness of 10 nm achieved>81 % capacity retention over 1000 cycles (figure 2 c). moreover, even with an increasing area - specific capacity (> 3 mah cm), the bulk electrode provided great cycling behavior. similarly, ge. reported porous doped si nanowires synthesized from p - doped si wafer using a mathematical model. in their model, a higher maximum stress is generated after lithiation as the ratio of the initial pore radius (r) to the pore - to - pore distance (l), that is, the porosity, decreases. using this model, they fabricated a porous nanowire with a pore diameter and wall thickness of 8 nm (figure 2 d), which exhibited extremely stable cycling behavior over 2000 cycles (figure 2 e). these two studies verified that managing the porosity can certainly improve the capacity retention by providing a marginal volume for the si expansion and maintaining the structural integrity of the si anodes. mesoporous silicon sponge (mss) (a c) and porous boron - doped silicon nanowires (d, e). b) in situ tem images of mss before lithiation (left) and after 160 min of lithiation (right). d) morphological investigation of porous boron - doped silicon nanowires with sem (upper left), tem analysis and pore - size distribution. e) cycle performance of the porous boron - doped silicon nanowire. reprinted with permission from refs. ]. porous si has also attracted considerable attention for industrial applications owing to the demonstration of scalable top - down processes such as wet etching in almost all studies covering porous si.25b, recently, ge. reported the large - scale fabrication of porous si from cheap metallurgical si through simple stain etching with hf and fe(no3)3 (figure 3 a). the resulting porous si had an exposed surface area of 70 m g ; a pore volume of 0.133 cm g with nanopores ; and a porosity of 223 %, which was estimated by 3d tomography. this porous si exhibited an enhanced cycling performance for 160 cycles compared with non - etched metallurgical si, retaining a capacity of > 1,400 mah g at 0.2 c. zhang. suggested another scalable synthesis method for porous si / c composites that employs the rochow reaction, which is the most economical way to produce organosilane monomers (figures 3 b, c). they utilized unreacted waste comprising si, metal compounds, and deposited c and synthesized porous si / c composites by acid washing, carbonization at 900 c, and wet etching. the resulting porous si / c composite was 260 m in size and contained micropores of 25 m in size with a coated c layer and an interfacial space between the si and c layer, which enables the average capacity - fading rate to be as low as 0.15 % per cycle for 100 cycles. although top - down method can be considered wasteful, the economic production of porous si is possible when cheap reactants are utilized, as in the aforementioned examples. scalable porous silicon (a) and porous silicon / carbon composite (b, c). c) sem images of bulk si powder (top) and the porous silicon / carbon composite (bottom). reprinted with permission from refs. ]. copyright 2014, american chemical society ; copyright 2014, john wiley & sons, inc. since the first report of the design of si with a shape - preserving c shell in 2010, this architecture has attracted attention as an effective model for volume - change - accommodating electrodes. hertzberg. developed an ingenious si deformation model with a suitable nanospace (figure 4 a) and then fabricated a thin si tube confined by a li - ion permeable c - shell layer (figure 4 b). in this design, the rigid c shell allows the si li alloy to expand inward rather than outward, preventing the entire electrode from undergoing si volume expansion. this distinctive behavior yields stable sei formation upon cycling because the continued growth of the sei layer is restricted owing to the prevention of the morphologic changes in the external surface area. thus, stable cycling performances for over 250 cycles demonstrated that this design effectively improved the electrode stability, exhibiting an average ce greater than 99.6 % after the first cycle (figure 4 c). similarly, cui 's group designed a series of analogous concepts : a double - walled si nanotube (figure 4 d) ; a yolk shell design (figure 5 a) ; a pomegranate - inspired design (figure 5 d) ; and, most recently, a micrometer - sized porous si particle with a nonfilling c coating (figure 5 e). wu. suggested a double - walled si nanotube comprising inner si and outer si oxide as a mechanical clamping layer. although the electrochemical test was performed with a small mass loading (0.020.1 mg cm), this architecture set the world record for the stable cycling of a si anode with 6000 cycles at 12 c (figure 4 e). to develop the industrially scalable fabrication of si anodes, a yolk shell design comprising a commercial si nanoparticle yolk and a 510 nm - thick c shell was developed by liu. (figure 5 b). the electric and ionic conducting c shell and empty space between the yolk and shell allowed the si to be lithiated and delithiated steadily for 1000 cycles (figure 5 c). shell structure, a pomegranate - inspired structure wherein the primary particles (yolk shell) formed the secondary particles (pomegranate) through bottom - up micro emulsion was developed, exhibiting an increase in the tap density and a high mass loading with a stable, long cycle life. on the other hand, a micrometer - sized porous si particle with a nonfilling c coating was designed for practical applications by reducing the cost and improving volumetric capacity with a high mass loading. the cross - sectional scanning - electron - microscopy (sem) analysis supported the effectiveness of the volume - change accommodation for the structure (figure 5 f). in conclusion, taking a panoramic view of the research on the shape - preserving shell design, these strategies clearly prevent side reactions due to electrolyte decomposition and mechanical fractures, thereby realizing the stable cycling of the si anode. silicon tubes with shape - preserving shell of carbon (a c) and siox (d, e). b) sem (left) and tem (right) images of the silicon tube with carbon shell. d) schematic of double - walled silicon nanotube showing stable sei layer during cycling. e) long - term cycle performance of double - walled silicon nanotube. reprinted with permission from refs.. shell structures (a c) and recent studies with shape - preserving carbon shells (d f). d) schematic of pomegranate - structured silicon describing snug void spaces for volume expansion and stable sei layer after cycling. f) investigation of thickness change of the electrode after 100th cycle with sem images. copyright 2012, american chemical society ; copyright 2014, macmillan publishers ltd. ; copyright 2015, american chemical society. graphene has received great attention for many years as an ideal matrix of composite materials for high - performance lib anodes owing to their excellent electronic and mechanical properties. in this regard, the impressive beneficial properties of graphene, such as a great electrical conductivity and high flexibility, can be utilized on si composites to provide an electrical network throughout the whole electrode and accommodate the volume changes of si during the electrochemical cycling. recently, remarkable behavior of a graphene - based si nanocomposite was reported by ko. they succeeded in the facile fabrication of an idealized composite structure by a modified hummers method and the thermal decomposition of silane gas (sih4). the composite exhibited island - shaped amorphous si nanoparticles (a - sinps) 870 nm for amorphous si.12b, the behavior of nanosized si during cycling were demonstrated by in situ transmission electron microscopy (tem) and mathematical modeling.12a kim. investigated the effect of the size of the si on electrochemical reactions, reporting elastic volume change as the size approached 10 nm. in addition, a high specific surface area between the electrolytes and nanostructured electrodes stimulates the charge transfer across the electrode / electrolyte interface. furthermore, the rate of li alloying / dealloying reactions can be improved significantly with nanomaterials having small dimensions, owing to the reduced characteristic time constant (t) in the diffusion, which is given by t = ld (l : diffusion length, d : diffusion coefficient). these merits enable the nanosized si not only to help in accommodating severe volume changes with its improved mechanical properties but also to provide improved electrochemical properties. in light of the improved battery performance of the nanosized si particle, one - dimensional (1d) nanowires and nanotubes for example, si nanowires that were directly grown on stainless steel exhibited a high battery performance owing to the prior benefits of the nanosize effects and the 1d electronic path of the wire structure. si nanotubes, which retain suitable voids in the wire structure, can also efficiently accommodate volume changes and provide good electrochemical properties. thus, reducing the material size and applying it to some kind of structure comprise an essential preliminary approach for increasing the electrochemical properties and handling the large volume change during cycling. in past decades, thin - film electrodes have been studied to elucidate the fundamental properties of si owing to their simple model for both simulations and experiments, including their mechanical behavior during cycling and their phase evolutions. regarding the strategies for resolving the volume - change problem, thin - film engineering has played an important role in clarifying the stress evolution of si anodes during cycling.19e,19f based on the mechanical estimation of the behavior of the thin - film electrodes, their architecture has advanced with patterns that can accommodate the volume change of si. soni.19f successfully fabricated a si - patterned thin - film electrode and calculated the critical size (5.18.9 m) of the pattern for preventing cracks in the electrode (figure 1 a). sophisticated honeycomb patterns that enabled the elastic behavior of the si during cycling were reported by baggetto. (figure 1 b) ; an alumina - coated patterned amorphous si electrode that protected the side reactions and enhanced the fracture resistance of the si was designed by he. (figure 1 c). as representative models for a volume - change - accommodating electrode design, si - patterned thin films can effectively relieve the mechanical stress via suitable voids between the patterns upon volume expansion and exhibit superior electrode stability with material integrity upon cycling. therefore, si - patterned thin - film anodes, which provide a high specific capacity, superior rate capability, and cycling stability, remain a candidate for fundamental study and application in new battery systems such as microbatteries and flexible batteries. a) relationship between the critical crack spacing (lcr) in the si film and critical size of si patches (l) against interfacial delamination. plastic localization inside si patches induces interfacial delamination when l is larger than lcr which is calculated as 5.18.9 m with 100 nm of thickness. c) sem images of alumina coated patterns before and after 1st lithiation in top view. reprinted with permission from refs. ]. copyright 2011 elsevier b.v ; copyright, 2011 john wiley & sons, inc. ; copyright, 2011 john wiley & sons, inc. si architectures incorporating pores and voids are considered effective for alleviating the volume variation of the si electrode during the electrochemical cycling. recently, li. reported the mesoporous si sponge (figure 2 a)which is synthesized from an si wafer through electrochemical etching as an anti - pulverization structure, performing a theoretical estimation and an in situ tem analysis (figure 2 b). they calculated the structural changes of their material, reporting a correlation between the expansion rate and the pore radius after full lithiation, as well as the range of volume change upon lithiation. the calculation corroborated an in situ tem analysis, indicating that the volume change of the si particle was greatly reduced. this porous structure for anti - pulverization with a porosity of 80 %, surface area of 494.7 m g, pore size of 50 nm, and si wall thickness of 10 nm moreover, even with an increasing area - specific capacity (> 3 mah cm), the bulk electrode provided great cycling behavior. similarly, ge. reported porous doped si nanowires synthesized from p - doped si wafer using a mathematical model. in their model, a higher maximum stress is generated after lithiation as the ratio of the initial pore radius (r) to the pore - to - pore distance (l), that is, the porosity, decreases. using this model, they fabricated a porous nanowire with a pore diameter and wall thickness of 8 nm (figure 2 d), which exhibited extremely stable cycling behavior over 2000 cycles (figure 2 e). these two studies verified that managing the porosity can certainly improve the capacity retention by providing a marginal volume for the si expansion and maintaining the structural integrity of the si anodes. mesoporous silicon sponge (mss) (a c) and porous boron - doped silicon nanowires (d, e). b) in situ tem images of mss before lithiation (left) and after 160 min of lithiation (right). d) morphological investigation of porous boron - doped silicon nanowires with sem (upper left), tem analysis and pore - size distribution. e) cycle performance of the porous boron - doped silicon nanowire. reprinted with permission from refs. ]. porous si has also attracted considerable attention for industrial applications owing to the demonstration of scalable top - down processes such as wet etching in almost all studies covering porous si.25b, recently, ge. reported the large - scale fabrication of porous si from cheap metallurgical si through simple stain etching with hf and fe(no3)3 (figure 3 a). the resulting porous si had an exposed surface area of 70 m g ; a pore volume of 0.133 cm g with nanopores ; and a porosity of 223 %, which was estimated by 3d tomography. this porous si exhibited an enhanced cycling performance for 160 cycles compared with non - etched metallurgical si, retaining a capacity of > 1,400 mah g at 0.2 c. zhang. suggested another scalable synthesis method for porous si / c composites that employs the rochow reaction, which is the most economical way to produce organosilane monomers (figures 3 b, c). they utilized unreacted waste comprising si, metal compounds, and deposited c and synthesized porous si / c composites by acid washing, carbonization at 900 c, and wet etching. the resulting porous si / c composite was 260 m in size and contained micropores of 25 m in size with a coated c layer and an interfacial space between the si and c layer, which enables the average capacity - fading rate to be as low as 0.15 % per cycle for 100 cycles. although top - down method can be considered wasteful, the economic production of porous si is possible when cheap reactants are utilized, as in the aforementioned examples. scalable porous silicon (a) and porous silicon / carbon composite (b, c). c) sem images of bulk si powder (top) and the porous silicon / carbon composite (bottom). reprinted with permission from refs. ]. copyright 2014, american chemical society ; copyright 2014, john wiley & sons, inc. since the first report of the design of si with a shape - preserving c shell in 2010, this architecture has attracted attention as an effective model for volume - change - accommodating electrodes. hertzberg. developed an ingenious si deformation model with a suitable nanospace (figure 4 a) and then fabricated a thin si tube confined by a li - ion permeable c - shell layer (figure 4 b). in this design, the rigid c shell allows the si li alloy to expand inward rather than outward, preventing the entire electrode from undergoing si volume expansion. this distinctive behavior yields stable sei formation upon cycling because the continued growth of the sei layer is restricted owing to the prevention of the morphologic changes in the external surface area. thus, stable cycling performances for over 250 cycles demonstrated that this design effectively improved the electrode stability, exhibiting an average ce greater than 99.6 % after the first cycle (figure 4 c). similarly, cui 's group designed a series of analogous concepts : a double - walled si nanotube (figure 4 d) ; a yolk shell design (figure 5 a) ; a pomegranate - inspired design (figure 5 d) ; and, most recently, a micrometer - sized porous si particle with a nonfilling c coating (figure 5 e). wu. suggested a double - walled si nanotube comprising inner si and outer si oxide as a mechanical clamping layer. although the electrochemical test was performed with a small mass loading (0.020.1 mg cm), this architecture set the world record for the stable cycling of a si anode with 6000 cycles at 12 c (figure 4 e). to develop the industrially scalable fabrication of si anodes, a yolk shell design comprising a commercial si nanoparticle yolk and a 510 nm - thick c shell was developed by liu. the electric and ionic conducting c shell and empty space between the yolk and shell allowed the si to be lithiated and delithiated steadily for 1000 cycles (figure 5 c). shell structure, a pomegranate - inspired structure wherein the primary particles (yolk shell) formed the secondary particles (pomegranate) through bottom - up micro emulsion was developed, exhibiting an increase in the tap density and a high mass loading with a stable, long cycle life. on the other hand, a micrometer - sized porous si particle with a nonfilling c coating was designed for practical applications by reducing the cost and improving volumetric capacity with a high mass loading. the cross - sectional scanning - electron - microscopy (sem) analysis supported the effectiveness of the volume - change accommodation for the structure (figure 5 f). in conclusion, taking a panoramic view of the research on the shape - preserving shell design, these strategies clearly prevent side reactions due to electrolyte decomposition and mechanical fractures, thereby realizing the stable cycling of the si anode. silicon tubes with shape - preserving shell of carbon (a c) and siox (d, e). b) sem (left) and tem (right) images of the silicon tube with carbon shell. d) schematic of double - walled silicon nanotube showing stable sei layer during cycling. e) long - term cycle performance of double - walled silicon nanotube. reprinted with permission from refs.. shell structures (a c) and recent studies with shape - preserving carbon shells (d f). d) schematic of pomegranate - structured silicon describing snug void spaces for volume expansion and stable sei layer after cycling. f) investigation of thickness change of the electrode after 100th cycle with sem images. reprinted with permission from refs. copyright 2012, american chemical society ; copyright 2014, macmillan publishers ltd. ; copyright 2015, american chemical society. graphene has received great attention for many years as an ideal matrix of composite materials for high - performance lib anodes owing to their excellent electronic and mechanical properties. in this regard, the impressive beneficial properties of graphene, such as a great electrical conductivity and high flexibility, can be utilized on si composites to provide an electrical network throughout the whole electrode and accommodate the volume changes of si during the electrochemical cycling. recently, remarkable behavior of a graphene - based si nanocomposite was reported by ko. they succeeded in the facile fabrication of an idealized composite structure by a modified hummers method and the thermal decomposition of silane gas (sih4). the composite exhibited island - shaped amorphous si nanoparticles (a - sinps) < 10 nm in size that were strongly anchored on the graphene backbone and very well distributed over the entire graphene surface (figures 6 c, d). the a - si characteristic and island morphology effectively relieved the induced strain and stress and prevented the interference between adjacent particles during the volume expansion. in addition, the highly flexible graphene yielded a synergetic effect with a critical size of a - sinps for elastic behavior, providing an unprecedented decrease in electrode thickness after cycling as a result of self - compacting. this indicates that the fabricated electrode with loosely interconnected composite sheets self - compacted until reaching the rational electrode thickness with the proper agglomeration during cycling without any cracks on its surface. hence, this sample exhibited outstanding performance in mitigating the detrimental effects of the volume expansion / contraction and improving electronic conductivity, charge transfer, and li - ion diffusion. as a result, a high specific reversible capacity, excellent power capability, and good cycling stability during 1000 cycles were achieved. furthermore, a full cell test demonstrated remarkable capacity retention at fast charge / discharge rates. hence, continuous investment and research for applying graphene to si anodes are required for the development of next - generation anode materials. a) schematic of si / graphene composite exhibiting self - compacting behavior during cycling. b) electrode thickness decrease of the composite after 100th cycle and top view sem images of the electrode before and after 1st cycle. c) low - magnification and high - magnification (inset) sem images of highly porous graphene sheets. d) high - resolution tem images of amorphous silicon / graphene composite in low and high magnification (inset). reprinted with permission from ref.. severe volume change during cycling, which has a deleterious effect on battery performance, is the most critical challenge to be resolved in si anodes. we discussed outstanding strategies for realizing a volume - change - accommodating electrode with a sophisticated architecture of si anodes. developing a porous nanosized si structure is an essential preliminary approach for alleviating the induced stress and stimulating the electrochemical properties. a patterned thin - film structure allows a high rate capability and cycle stability with elastic behavior during the li insertion / extraction process. besides, a porous structure can yield a marginal volume when si becomes lithiated and also provides large active sites, incorporating the increased specific surface area of numerous pores. however, the high specific area generally creates serious side reactions with electrolyte decomposition, yielding a low ce and an increase in the internal resistance due to by - products. to cope with the side reactions and the volume - change problem, a shape - preserving shell design was devised that not only maintains the integrity of the si via confined voids in its composites but also enables the stable formation of the sei layer. the graphene composite presents impressive potential for accommodating volume changes, together with excellent electrical and mechanical properties and flexibility, resulting in self - compacting behavior. these efforts regarding the volume - change problem have certainly yielded progress toward the practical application of si anodes. first, the development of novel surface - coating methods and stable electrolytes to reduce the side reactions is an impressive challenge, especially for nanostructured si. in addition, reducing the hf derived from fluoroethylene carbonate (fec), which is widely used in si anodes to stabilize the sei layer, is required because substantial capacity fading occurs as the hf attacks both the cathodes and si. second, the relatively low density of nano- and porous structures can decrease the volumetric energy density.15b therefore, the elaborate tailoring of the porosity in the electrode is necessary to prevent an undesirable decrease in the volumetric energy density. finally, in order to apply the si anode to commercial libs and achieve a high energy density, the change in the electrode thickness after tens of cycles should be examined in calendered si anodes having an electrode density greater than 1.6 g cc, as an industrial standard. | si has been considered as a promising alternative anode for next - generation li - ion batteries (libs) because of its high theoretical energy density, relatively low working potential, and abundance in nature. however, si anodes exhibit rapid capacity decay and an increase in the internal resistance, which are caused by the large volume changes upon li insertion and extraction. this unfortunately limits their practical applications. therefore, managing the total volume change remains a critical challenge for effectively alleviating the mechanical fractures and instability of solid - electrolyte - interphase products. in this regard, we review the recent progress in volume - change - accommodating si electrodes and investigate their ingenious structures with significant improvements in the battery performance, including size - controlled materials, patterned thin films, porous structures, shape - preserving shell designs, and graphene composites. these representative approaches potentially overcome the large morphologic changes in the volume of si anodes by securing the strain relaxation and structural integrity in the entire electrode. finally, we propose perspectives and future challenges to realize the practical application of si anodes in lib systems. |
the pregnancy - associated glycoproteins (pags) constitute a large group of proteins belonging to the aspartic proteinase superfamily expressing in the placenta of eutherian mammals. pags are acidic glycoprotein sharing more than 50% amino acid sequence identities with pepsin, cathepsin d and e. they are secreted from the outer epithelial cell layer of placenti of various ungulate species possessing a predominant role in the placentogenesis, placental modeling, and embryogenesis during pregnancy in domestic species. many pag genes have been cloned and identified in many domestic animals such as cattle, sheep, goat, pig, and wild ruminants ' species [24 ]. structural modeling studies in bovine and porcine reveal their bilobed structure and proteolytically inactiveness due to key mutation at the active sites (alanine replaced by glycine : gly34) residue whose presence would cause displacement of the catalytic water molecule from its normal position between the two catalytic aspartic residues (asp32 and asp215). studies on bovine pags show that they have retained the peptide - binding cleft of aspartic proteinases to bind pepstatin and this property is an important factor to characterize members of aspartic proteinase. moreover pags share their identity with other members of aspartic proteinase family, namely, rennin [5, 6 ]. recently buffalo pregnancy - associated glycoprotein-1 (pag-1) gene sequence was deduced and in silico analysis revealed buffalo pag-1 to share more than 80% homology with other members of aspartic proteinase family. moreover deduced buffalo pag-1 amino acid sequence also reveals key mutation at the active site which renders it proteolytically inactive. predicted structure of buffalo pregnancy - associated glycoprotein-1 revealed it to possesses aspartic acid residues near the active site. but structural modeling and its analysis of buffalo pag-1 protein is still lacking. considering the paucity of knowledge, the present work was carried out to design and analyze the structural model of pregnancy - associated glycoprotein-1 buffalo (bubalus bubalis). secondary protein structure prediction from amino acid sequence was performed with phrye and consurf server [8, 9 ] to predict the location of the conserved sites in buffalo pag-1 amino acid sequence. the comparative modeling program modeler 9.9 in conjunction with pymol was done to construct various models of buffalo pag-1. structural docking studies with aspartic proteinase inhibitor, namely, pepstatin a on buffalo pag-1 protein was carried out using patchdock server to confirm the affinity of protease inhibitors on buffalo pag-1 protein. buffalo pag-1 structural analysis was carried out with sequences sharing similarity (> 25% with respect to the amino acid residue - long sequence of pag-1) and having similar secondary structure matching with the predicted secondary structure of the target pag-1 sequence. they were obtained from threading pag-1 sequence onto known structure by using the phyre server. energy nature, structural conformity, chemical nature, ramachandran plots, and z scores of the pag-1 of the deduced model of buffalo pag-1 were analyzed using software packages such as prosa, procheck, and whatif. multiple alignments of similar structurally related proteins were aligned with their pdb identity using phyre software to confirm the chemical nature of buffalo pag-1. saps software was used to predict the potential sites for proteolysis of the pag-1 protein indirectly measuring the stability of the protein [1618 ]. in the present study buffalo pag-1 was subjected to structural analysis to study the protein model conformation and stability. buffalo pag-1 protein model was designed using software, namely, modeller 9.9 and reconstructed using pymol. various models of buffalo pag-1 were constructed, namely, line, ball and stick, mesh, and space filling model. it is evident from deduced models that buffalo pag-1 has retained bilobed structure with cleft for pepstatin a binding (figure 1). secondary structure prediction of buffalo pag-1 protein using phyre and consurf software revealed surface and buried regions of buffalo pag-1 protein with their respective conformation. the entire buffalo pag-1 molecule has distinct regions of helices and strands separated with coils. it was deduced that buffalo pag-1 predicted secondary structure revealed strands and coil in their active sites (8595 aa) and (270279 aa) when compared to helices in other regions. the helix conformation was deduced in signal sequence as well as in residues 2545, 191199, and 278290 (figure 2). moreover the neural network algorithm in consurf server revealed the conserved, buried, surface, and functional residues in buffalo pag-1 protein. the buffalo pag-1 protein showed very high degrees of conserved regions in amino and carboxy terminals near the active aspartic regions 8595 and 268274 residues confirming its belonging to aspartic proteinase family. moreover majority of the residues near the active sites were buried inside the protein model and the potential functional residues ' locations were predicted in pag-1 protein molecule (figure 3). the predicted protein structure was analyzed with phyre server to retrieve similar protein molecules having similar structural conformity. blast analysis retrieved 50 protein molecules from protein database out of which only 10 molecules which showed close similarity to buffalo pag-1 were considered for structural analysis. molecules having more than 40% identity and showing 100% confidence level were taken into consideration for comparison with buffalo pag-1 (table 1). ten different molecules retrieved from the protein database showed biochemical similarity to members of aspartic proteinase from phyre database. it is evident from the structural comparison that all these members of aspartic proteinase family retain the bilobed structure similar to buffalo pag-1 protein structure. buffalo pag-1 protein on docking with specific aspartic proteinase inhibitor, pepstatin a (a hexapeptide consisting of rare amino acids, namely, isovaline and statine : pdb : 1 pso) revealed binding near the active sites in the cleft region between the bilobed structure similar to docking sites reported in bovine and porcine pag model. it is also evident that buffalo pag-1 possesses binding sites for aspartic protease inhibitors (pepstatin a) (figure 4). analysis with prosa software revealed the energy status of buffalo pag-1 in comparison to its various amino acid residues (figure 5). moreover energy status analysis of the entire molecule revealed the presence of more low energy pockets in comparison to high energy pockets. the active sites in the buffalo pag-1 protein (8595) and (275279) also revealed low energy status revealing the stable structure of the molecule. the z score of the buffalo pag-1 protein was 7.01 on analyses in x - ray and nmr methods showing the good quality of deduced buffalo pag-1 protein model (figure 6). analysis of buffalo pag-1 protein using saps software revealed potential regions of cleavage by any proteolytic enzyme at residues 8100, 140160, 160180, and 260280 in the amino acid sequence but it is evident buffalo pag-1 is stable molecule as the potential sites of proteolysis do not cross the threshold scores (figure 7). analysis of ramachandran plots of buffalo pag-1 depicted that 89.4% of all residues were located in the favored regions and 96.6% of all residues were located in the allowed regions. there were 13 amino acid residues which were lying outside the favoured or allowed regions (figure 8). four glycine residues (33, 149, 243, and 325 aa) and 1 proline residue (310 aa) were outliers in the predicted buffalo pag-1 protein model. moreover the predicted centre of mass of buffalo pag-1 protein is shown in table 2. thus structural modeling and analysis of buffalo pag-1 protein was done and reported for the first time. in conclusion this study reports structural modeling and analysis of buffalo pregnancy - associated glycoprotein-1. moreover in silico analysis of buffalo - associated glycoprotein-1 revealed its bilobed structure with conserved active sites having the property of binding aspartic protease inhibitors thereby confirming its belonging to aspartic proteinase superfamily. | the present study was conducted to design and analyze the structural model of buffalo pregnancy - associated glycoprotein-1 (pag-1) using bioinformatics. structural modeling of the deduced buffalo pag-1 protein was done using phyre, consurf servers and its structure was subsequently constructed using modeller 9.9 and pymol softwares buffalo pag-1 structural conformity was analyzed using prosa, whatif, and 3d - pssm servers. designed buffalo pag-1 protein structure on blast analysis retrieved protein structures belonging to aspartic proteinase family. moreover in silico analysis revealed buffalo pag-1 protein retained bilobed structure with pepstatin - binding clefts near the active sites by docking studies with pepstatin a using patchdock server. structural studies revealed that the amino and carboxy terminal containing aspartic residues are highly conserved and buried within the protein structure. structural conformity studies showed that more than 90% of the residues lie inside favored and allowed regions. it was also deduced that buffalo pag-1 possesses low and high energy zones with a very low threshold for proteolysis ascertaining the stableness of the buffalo pag-1 protein structure. this study depicts the structural conformity and stability of buffalo pag-1 protein. |
anaesthesia for mediastinal masses presents a topic for debate as to the questionable advantages of general anaesthesia (g.a.). however, successful management with minimal complications is reported of late due to well - balanced g.a. in such surgeries. the mediastinum is the most common site of chest masses in children. of the many intrathoracic sites where chest masses are seen, the anterior mediastinum poses a greater risk in terms of life - threatening complications arising from compression of airway and vascular structures. we present two cases, one with an anterior mediastinal mass suspected to be a lymphangioma for excision by median sternotomy and another with a non - compressible mediastinal mass electively taken up for right lateral thoracotomy ; both procedures were performed under g.a. an 8-year - old boy weighing 16 kg scheduled for median sternotomy for excision of anterior mediastinal mass had intermittent fever for 3 months and dry cough for 2 weeks associated with breathlessness on exertion. chest x - ray, computer tomography (ct) scan, magnetic resonance imaging (mri) and echocardiogram were performed to assess the mass and its compression on vital structures. the child was pre - medicated and induced with 5 mg / kg of thiopentone i.v. anaesthesia was maintained with n2o : o2 (50:50) and sevoflurane 0.8 - 2.0%. five hundred millilitres of ringer 's lactate was administered over 2 h. heart rate, systolic blood pressure, diastolic blood pressure, mean arterial pressure, oxygen saturation, end - tidal carbon - di - oxide (etco2) and electrocardiography (ecg) with st segment analysis were recorded. the patient was electively ventilated in a paediatric intensive care unit (icu) for 3 h, reversed and extubated. a 16-year - old female weighing 37 kg, with dyspnoea on exertion that worsened in the supine position, had productive cough, intermittent fever and dysphagia for solid food for 1 month ; hence, she was referred to a pulmonologist for management of her condition. on treatment with antibiotics and bronchodilators, her haemoglobin improved from 7.3 gm% to 11.5 gm% after transfusion of 2 units of packed red blood cells (prbcs). her pulse rate was 110/min and her blood pressure was 110/60 mmhg. on examination, her trachea was central and the apical impulse was in the 5 left intercostal space in the mid - axillary line and there was reduced air entry in the right supraclavicular, infraclavicular, mammary and subscapular areas and dullness on percussion. the chest x - ray showed mediastinal widening to the right of the midline obscuring the right cardiac border [figure 1 ]. obscured right heart border fibreoptic bronchoscopy (fob) performed pre - operatively by a pulmonologist with the aid of oral local anaesthetic gargle and spray showed no extrinsic compression on the airway. ct scan of the thorax revealed a lobulated heterogeneous solid cystic mass on the right side of the superior mediastinum, extending from the inlet of the thorax to the level of the upper part of the right atrium. spirometry showed severe restrictive and obstructive lung disease with peak expiratory flow rate of 26%. inj ondansetron 0.1 mg / kg and inj glycopyrrolate 0.02 mg / kg were administered before induction. pre - oxygenation with 100% oxygen for 3 min was followed by induction with sevoflurane 8%. after confirmation of mask ventilation, the child was intubated with a 26fr left - sided double - lumen tube (dlt). the tube was then removed and the patient was ventilated using a face mask with 100% o2. three attempts of intubation with the 26fr left - sided dlt failed to achieve single lung ventilation. as the patient started desaturating, ventilation with 100% o2 and intubation with a 6.00 mm cuffed oral endotracheal tube was performed. the patient responded to inj adrenaline (1 mg / kg) i.v. and developed tachycardia (150 - 170 bpm). because of the non - availability of a reinforced tube, the 6.0 mm tube (already in situ) was removed as it had failed to establish air entry, and was reintroduced this time with a stylet. this attempt with a stylet was successful at negotiating the compressive obstruction and establishing ventilation, although insufficiently. while the immediate danger of desaturation was addressed, adequate ventilation was not achieved. to achieve adequate ventilation, the 6.0 mm tube was replaced with a 7.0 mm tube using a tube exchanger, after making sure that the existing tube tip was indeed at the mid - tracheal position with the aid of a flexible fob. while risks versus benefit of proceeding with the surgery (in view of pulmonary oedema having occurred, although transiently and the possible need for elective ventilation should the need arise) were being deliberated by the surgical and the anaesthesiology teams, the patient was placed in a left lateral position for better ventilation. intra - operatively, there was one episode of hypotension, which was managed with inj noradrenaline infusion. etco2 was high (60 - 76 mmhg.) until excision of the tumour. after excision of the tumour, the heart rate and etco2 improved (36 - 48 mmhg). the patient was ventilated in the icu for 24 h. inotropic support was tapered on the second day and patient was extubated on the third post - operative day. an 8-year - old boy weighing 16 kg scheduled for median sternotomy for excision of anterior mediastinal mass had intermittent fever for 3 months and dry cough for 2 weeks associated with breathlessness on exertion. chest x - ray, computer tomography (ct) scan, magnetic resonance imaging (mri) and echocardiogram were performed to assess the mass and its compression on vital structures. the child was pre - medicated and induced with 5 mg / kg of thiopentone i.v. anaesthesia was maintained with n2o : o2 (50:50) and sevoflurane 0.8 - 2.0%. five hundred millilitres of ringer 's lactate was administered over 2 h. heart rate, systolic blood pressure, diastolic blood pressure, mean arterial pressure, oxygen saturation, end - tidal carbon - di - oxide (etco2) and electrocardiography (ecg) with st segment analysis were recorded. the patient was electively ventilated in a paediatric intensive care unit (icu) for 3 h, reversed and extubated. a 16-year - old female weighing 37 kg, with dyspnoea on exertion that worsened in the supine position, had productive cough, intermittent fever and dysphagia for solid food for 1 month ; hence, she was referred to a pulmonologist for management of her condition. on treatment with antibiotics and bronchodilators, her haemoglobin improved from 7.3 gm% to 11.5 gm% after transfusion of 2 units of packed red blood cells (prbcs). her pulse rate was 110/min and her blood pressure was 110/60 mmhg. on examination, her trachea was central and the apical impulse was in the 5 left intercostal space in the mid - axillary line and there was reduced air entry in the right supraclavicular, infraclavicular, mammary and subscapular areas and dullness on percussion. the chest x - ray showed mediastinal widening to the right of the midline obscuring the right cardiac border [figure 1 ]. obscured right heart border fibreoptic bronchoscopy (fob) performed pre - operatively by a pulmonologist with the aid of oral local anaesthetic gargle and spray showed no extrinsic compression on the airway. ct scan of the thorax revealed a lobulated heterogeneous solid cystic mass on the right side of the superior mediastinum, extending from the inlet of the thorax to the level of the upper part of the right atrium. spirometry showed severe restrictive and obstructive lung disease with peak expiratory flow rate of 26%. inj ondansetron 0.1 mg / kg and inj glycopyrrolate 0.02 mg / kg were administered before induction. pre - oxygenation with 100% oxygen for 3 min was followed by induction with sevoflurane 8%. after confirmation of mask ventilation, the child was intubated with a 26fr left - sided double - lumen tube (dlt). the tube was then removed and the patient was ventilated using a face mask with 100% o2. three attempts of intubation with the 26fr left - sided dlt failed to achieve single lung ventilation. as the patient started desaturating, ventilation with 100% o2 and intubation with a 6.00 mm cuffed oral endotracheal tube was performed. the patient responded to inj adrenaline (1 mg / kg) i.v. and developed tachycardia (150 - 170 bpm). because of the non - availability of a reinforced tube, the 6.0 mm tube (already in situ) was removed as it had failed to establish air entry, and was reintroduced this time with a stylet. this attempt with a stylet was successful at negotiating the compressive obstruction and establishing ventilation, although insufficiently. while the immediate danger of desaturation was addressed, adequate ventilation was not achieved. to achieve adequate ventilation, the 6.0 mm tube was replaced with a 7.0 mm tube using a tube exchanger, after making sure that the existing tube tip was indeed at the mid - tracheal position with the aid of a flexible fob. after 10 min, the patient developed pulmonary oedema for which inj furosemide 40 mg i.v. was given and pulmonary oedema was seen to resolve. while risks versus benefit of proceeding with the surgery (in view of pulmonary oedema having occurred, although transiently and the possible need for elective ventilation should the need arise) were being deliberated by the surgical and the anaesthesiology teams, the patient was placed in a left lateral position for better ventilation. intra - operatively, there was one episode of hypotension, which was managed with inj noradrenaline infusion. etco2 was high (60 - 76 mmhg.) until excision of the tumour. after excision of the tumour, the heart rate and etco2 improved (36 - 48 mmhg). the patient was ventilated in the icu for 24 h. inotropic support was tapered on the second day and patient was extubated on the third post - operative day. mediastinal masses assume significance due to the anaesthetic complications arising secondary to compression on the surrounding vital structures. as opposed to an adult average of 16% germ cell tumours, paediatric patients present with 19% germ cell tumours. there is a significant higher incidence of neurogenic tumours and a lower incidence of thymomas and thyroid tumours in children than in adults. the incidence of serious life - threatening respiratory and cardiovascular events in the paediatric population is approximately 7 - 20% intra - operatively and post - operatively. while it is difficult to extrapolate the same in adults, caution is advised. general anaesthesia for median sternotomy is associated with hazards, many of which are well documented. these risks are due to reduced functional residual capacity (frc) because of an increased abdominal muscle tone, decreased inspiratory muscle tone, loss of transpleural pressure gradient secondary to paralysed diaphragm, increased compressibility of the airways because of relaxation of the tracheobronchial tree under anaesthesia and supine position contributing to an increase in mass size secondary to increased central blood volume. factors such as younger age, smaller size of mass and soft compressible nature (lymphangioma) evidently contributed to an absence of complications. in case 2, although pre - operative fob failed to reveal compression on airway, compression nonetheless manifested. this is probably explained by time lapse that ensued forth during repeated attempts at securing the airway, first with a dlt, then with a single lumen tube (slt) of 6 mm without and with the aid of a stylet and eventually with an slt of 7 mm. this was further compounded by relaxation of the airway under g.a., which made the airway vulnerable to the compressive effect of the mass. although increased compressibility of the airways secondary to muscle relaxants can be countered by intermittent positive - pressure ventilation, it is of little help in the face of a non - compressible mass. the fact that on the third attempt a cuffed tube with stylet was successfully negotiated beyond the point of compression serves to illustrate the undeniable value in adequate preparation for such cases. in fact, had a reinforced tube been available, it would have further complemented the useful role of the stylet in a conventional tube. however, if all else fails, use of a microlaryngeal tube or rigid bronchoscope can be used under extraneous circumstances. in addition, measures such as change of position to lateral or semi - prone, emergency thoracotomy and tumour debulking, femoro femoral cardiopulmonary bypass, use of helium oxygen mixture and direct laryngoscopy must be available to address contingencies. the need for exhaustive pre - operative evaluation, meticulous preparation, perioperative anticipation of complications and equipping oneself to meet these requirements is paramount. spontaneous ventilation should be preferred during induction to preclude the possibility of airway collapse under influence of relaxants, especially while dealing with non - compressible masses. the use of reinforced tubes and stylets serve to negotiate near - fatal airway obstructions intra - operatively. last but not the least, asymptomaticity in the pre - operative period in no way precludes the possibility of disastrous eventualities like airway compromise or cardiopulmonary arrest intra - operatively. | we report the management of two paediatric cases undergoing median sternotomy and right lateral thoracotomy for mediastinal mass. an 8-year - old boy presented with a history of intermittent fever and episodes of respiratory illness since 3 years and a 16-year - old girl presented with dyspnoea, cough, fever and dysphagia for solid foods. radiological investigation confirmed the diagnoses. absence of pressure symptoms pointed towards a compressible mass in the boy and indicated a non - compressible mass in the girl. we discuss the anaesthetic management of the younger patient with an uneventful course as opposed to the older patient where airway obstruction ensued soon after induction and led to near - cardiopulmonary arrest necessitating rescue measures. swift measures at securing airway while simultaneously resuscitating the patient served to successfully revert an otherwise fateful eventuality. |
use of radioactive pharmaceuticals for diagnostic nuclear medicine procedures is one of the main sources of radiation exposure resulting from ionizing radiation to populations. annual assessment of patients absorbed dose can give a quantitative estimate of per capita population absorbed dose. risk of exposure to ionizing radiations is expressed by factors such as shortening of life span and induced malignancies. the international commission on radiological protection (icrp) provides the effective doses, and hence the radiation risk to patients caused by various radiopharmaceuticals and nuclear medicine procedures. although, the annual number of nuclear medicine procedures and their collective dose are way below the corresponding values for medical x - ray examinations (2% and 6%, respectively), the mean dose per procedure is larger for nuclear medicine (4.6 msv) than for medical x - rays (1.2 msv). with respect to the rapid growth in number of nuclear medicine procedures performed in iran, and considering the fact that previous survey in tehran was performed a decade ago, in 2003, we performed this study to give an updated estimate on the statistics and trends of nuclear medicine procedures as part of a residency thesis. the data of the annual diagnostic nuclear medicine procedures were obtained for all four active nuclear medicine centers affiliated to shahid beheshti university of medical sciences, tehran, iran, during 2009 and 2010. the data comprised the type and frequency of examinations, type of radiopharmaceuticals used, range of administered activity for each examination, and age distribution of the patients. as the amount of dose used in different nuclear centers varied, the mean administered activity for each examination was used in the five age brackets of 16 years. the first column in table 1 shows the diagnostic nuclear medicine procedures and corresponding radiopharmaceuticals used. to calculate the effective dose and collective effective dose, the authors used the effective dose per unit administered activity given in icrp publication no. 53 (1988) and its addenda, icrp publication no. 80 (1999), and icrp publication no. the effective dose per examination (fourth column) was obtained by multiplying the mean administered activity (second column) by the corresponding effective dose per unit administered activities for each examination (third column). the annual number of each examination in the five age groups is listed in the fifth column of table 1. the collective effective dose for each examination is shown in the last column, which was calculated by multiplying the effective dose per examination by the corresponding number of examinations in each age bracket. the effective dose per procedure was obtained by summing the effective doses used for all radiopharmaceuticals, and the collective effective dose was obtained. mean administered activities, effective dose per unit administered activities, effective dose per examination, annual number of examinations, and collective effective doses for diagnostic nuclear medicine examinations in 2010 frequency and percentage of nuclear medicine examinations in 2009 - 2010 the annual activities of the nuclear medicine centers in 2010 is provided in table 1, which comprises the examination type, radiopharmaceutical used, mean administered activities (mbq), effective dose per unit administered activity (msv / mbq), and the effective dose per examination (msv) for each examination in the five age groups. some miscellaneous procedures, such as red blood cell scan, indirect radionuclide cystography, and dacryoscintigraphy using tc pertechnetate, are provided as the annual total number of examinations and corresponding collective effective doses are calculated and provided in the last row of table 1. figure 1 is showing the percentage of the total number of examinations and percentage collective effective dose. during these 2 years, results reveal a 6.14% and 3.63% increase in the annual number of examinations and collective effective dose, respectively [figure 1 and table 2 ]. the contribution of nuclear medicine procedures from total annual number of examinations and collective effective dose (average of 2009, 2010) percentage share of radionuclides from total number of procedures and collective effective dose (average of 2009, 2010) the most frequently performed procedures were bone (30.16%), cardiac (28.96%), renal (17.97%), and thyroid scintigraphies (7.93%), which contributed to 24.01%, 36.76%, 5.82%, and 2.08% of the average collective and effective dose during these 2 years. figure 2 shows the relative contribution of radionuclides to collective effective dose and total number of procedures as averaged over these 2 years. the most frequently used radiopharmaceutical was tc, which contributed to 98.20% of a total number of examinations and 89.89% of collective effective dose. although i accounted for only 0.34% of procedures, it contributed to 5.68% of the collective effective dose. comprehensive studies on diagnostic nuclear medicine procedures and their contribution to the population absorbed doses have been reported by many investigators worldwide. however, despite the rapid growth of these procedures in iran, there is a profound lack of statistics and the previous survey in tehran was conducted a decade ago. compared to the previous study by the same group in the same centers, striking differences are noted in trends of diagnostic nuclear medicine procedures. thyroid scintigraphies with i which accounted for 2.35% of total number of procedures and resulted in 16.59% of collective effective dose in 1999 and 2000 contributed to only 0.03% of the number of examinations and 0.07% of the effective dose in 2009 and 2010. this is due to substitution of i with tc for thyroid examinations, which has led to less radiation absorbed dose from i to the patients. on the other hand, there is tremendous growth in the number of cardiac (55.7-fold) and bone (3.60-fold) scans with increases from 0.52% and 8.4% to 28.97% and 30.25% during the same period. the huge increase in the number of cardiac examinations is mainly due to the introduction of single - photon emission computed tomography technique. the changes in bone scan frequency could be the result of an increase in the prevalence of malignancies and lack of other screening techniques such as positron emission tomography (pet) scanners in the country. the overall number of thyroid examinations has decreased from higher than 80% in 1989 to 7.91% in 2010. this could be the result of lower prevalence of goiter due to the implementation of iodine enrichment diet programs, lower referral of patients by specialists, and the introduction of fine needle aspiration and advanced ultrasonography techniques. the latter two reasons are also responsible for the 78-fold decrease in liver / spleen tc - sulfur colloid examinations from 7% in 1989 to 0.09 in 2010. together, bone, cardiac, and renal scans accounted for 70.04% of examinations and 66.59% of collective effective dose. based on the results of our study, striking changes are noted on the trends of diagnostic nuclear medicine procedures in iran. this field is still evolving in the country, and this trend will change further with the introduction of pet scanners. | purpose : use of radiopharmaceuticals for diagnostic nuclear medicine procedures is one of the main sources of radiation exposure. we performed this study with respect to the rapid growth in nuclear medicine in iran and lack of updated statistics.materials and methods : the data were obtained for all active nuclear medicine centers affiliated to shahid beheshti university of medical sciences during 2009 and 2010.results:the most frequently performed procedures were bone (30.16%), cardiac (28.96%), renal (17.97%), and thyroid (7.93%) scans. there was a significant decrease in the number of thyroid scintigraphies with 131i and 99mtc - sulfur colloid liver / spleen scans and tremendous increase in the frequencies of cardiac and bone scintigraphies compared to one decade ago.conclusion:compared to previous studies, there were striking changes in trends of diagnostic nuclear medicine procedures in tehran. this field is still evolving in the country, and this trend will further change with the introduction of positron emission tomography scanners in future. |
the study of k - string composition of long dna sequences including complete genomes is a natural extension of g + c content, i.e., k = 1, analysis. using k values greater than 1 takes into account short - range (up to k 1) correlations of nucleotides and enhances species - specific features in the sequence. visualization of the k - string distribution on a computer screen using a crude color code is essentially a kind of coarse - graining that helps to highlight some prominent feature of the dna sequence. for example, short palindromic strings of a certain type are avoided or under - represented in some bacterial genomes, leading to quite specific 2d histograms, while in mammalian genomic sequences the lower content of the dinucleotide cg as compared to gc dominates the picture 1., 2.. two - dimensional portraits of the human chromosome 22 and the genomes of three bacteria are given in figure 1. the similar patterns in the portraits of escherichia coli and shigella flexneri are caused by the under - representation of strings that contain ctag as substrings. the species - specific avoidance signature of complete bacterial genomes has eventually led to a new way of inferring phylogenetic relationship of prokaryotes without sequence alignment 3., 4.. studies of the 1d histograms of extant complete genomes in contrast to their random counterparts have revealed the existence of universal length in complete genomes that can be explained by a simple universal model for genome growth and evolution 5., 6.. in order to see that an observed feature does not occur in a random sequence, it is desirable to have randomization function built - in. a seemingly surprising effect is the appearance of fine structures in some randomized prokaryotic genomes with significant g + c bias. in figure 2, the 1d histograms for k = 4 to 9 are shown for mycobacterium tuberculosis whose g and c make 65.6% of the genome. at fixed k, a total of k + 1 peaks can be seen in the histogram. this phenomenon has been fully understood. in particular, each peak may be well approximated by a poisson distribution (7). the visualization tool used by us to obtain the aforementioned results in the cited papers has been improved over the years. from a unix command line tool for 2d histograms based on xlib and xtoolkit (the old code is available at request to the corresponding author), it has evolved into a linux software using the gtk+ package with a user - friendly graphic interface. in order to count the frequency of occurrence of k - strings, a total of 4 counters are needed. to visualize the frequency distribution, these counters are allocated in a 2 2 square matrix and a color code is used to show the range of counting. the allocation of counters is realized by taking the direct product of k copies of the 2 2 matrix (1)(gcat).we put g and c in the first row to make the effect of g+c content readily visible. what we obtain is a 2d histogram or a portrait of the dna sequence. a 1d histogram is constructed by putting the counts along the abscissa from a minimal (may be zero) to a maximal count and the number of string types within a narrow range (a bin) of counts along the ordinate. to provide a reference for comparison, the program can randomize the input sequence, keeping the number of each type of nucleotides unchanged. the program takes one or more dna sequences in either genbank or fasta format as input. the user may form a list of sequences and then work with them to conduct comparative studies. seedna displays 2d as well as 1d histograms of the designated sequence or its reverse - conjugate or both (by concatenating them) using the original input or its randomized counterpart. using k greater than 9 would extend the picture beyond the screen of most present - day computers. the cursor will cause the designated string and its count (2d) or the count range and the number of string types whose counts fall in that range (1d) to be displayed. the 2d histograms of closely related species show strong similarities in k - string composition. this is clearly seen in the two lower portraits of figure 1 and the portrait of figure 3c, as e. coli, s. flexneri and s. typhi all belong to the same family enterobacteriaceae. therefore, it makes sense to display the difference of counts for each string type. to put the comparison on equal footing, then the two counts c1 and c2 for the same string type are used to calculate (c1 c2)/(c1 + c2). the last ratio is displayed using seven colors for the ranges (0.01, 0.01), (0.01, 0.1), (0.1, 0.5), and (0.5, 1). the string and its counts c1 and c2 are shown interactively at the bottom of the graph. this comparison feature is experimental for the time being and the way of showing the difference of portraits will be improved as more applications are implemented. for example, the user may change the color code or determine how many times the randomization procedure would be applied to the sequence before it is treated. at the users choice a screen figure may be exported to a gif file under a separate name for later manipulation. besides our old unix code, a very limited version of the 2d histogram was implemented at the european bioinformatics institute (ebi ; http://industry.ebi.ac.uk/openbsa/bsa_viewers/) and the national institute for standard and technology (nist ; http://math.nist.gov/~fhunt/genpatterns/). these implementations did not provide built - in randomization, 1d histogram and comparison of 2d histograms. our full - fledged seedna program is written in c language using the gtk+ graphic package. a user - friendly interface makes the choice or combination of features a matter of clicking on buttons. the 2d histograms, if shown only in black / white, look similar to the chaos game representation (cgr) of dna sequence 8., 9.. the chaos program in the free emboss package (10) implements the cgr algorithm. the consistency of the limiting measure of cgr and seedna algorithms has been analyzed by tin (11). however, the seedna realizes the visualization of density in one pass, keeping the resolution k fixed. this can not be done in cgr without changing the algorithm and program. moreover, due to finite resolution of the computer screen the actual k is out of control and it varies along different directions in the cgr. therefore, seedna may replace chaos entirely with many new features added (1d histogram, randomization, comparison of 2d histograms, etc.). the source code of seedna is freely available under the gnu general public license at the authors website (www.itp.ac.cn/~hao/seedna.tar.gz ; http://tlife.fudan.edu.cn/seedna.tar.gz). installation and running information as well as references are included as separate files in the above release package. since the definition of direct product of matrices applies to rectangular matrices as well, the idea of using direct product of matrices to represent k - strings may also be extended to protein sequences. we may define a 4 5 matrix (12)x=(acdefghiklmnpqrstvwy),where the matrix elements are the one - letter abbreviation of the amino acids. however, a similar visualization scheme would only work for k 4 if one does not scroll the picture behind the screen. furthermore, as protein sequences are much shorter than nucleic acids, the highlight of visualization must come from those strings that are present instead of those missing. | an interactive tool to visualize the k - string composition of long dna sequences including bacterial complete genomes is described. it is especially useful for exploring short palindromic structures in the sequences. the seedna program runs on red hat linux with gtk+ support. it displays two - dimensional (2d) or one - dimensional (1d) histograms of the k - string distribution of a given sequence and/or its randomized counterpart. it is also capable of showing the difference of k - string distributions between two sequences. the c source code using the gtk+ package is freely available. |
mesenchymal cells are precursors for a varied group of connective tissue cells including endothelial cells, smooth muscle cells, pericytes, chondroblasts, adipocytes, osteoblasts, odontoblasts, and fibroblasts. the interrelationships between cell lineages and differentiation potential contribute to wide range of synthetic products, rates of product synthesis, reaction to regulatory molecules, cellular turnover rates and morphological features leads to fibroblast diversity. the tissue distribution and relative proportion of fibroblast subpopulations have a considerable impact on the regulation of connective tissue function in health and disease. they appear as plump spindle shaped or stellate shaped cells (active fibroblasts) with centrally placed oval or round nucleus [figure 1 ]. these cells and their extracellular matrix products i.e. fibers and amorphous ground substance play pivotal roles in maintaining the structural integrity of connective tissues in health, healing processes, and in pathological alterations. in addition to well - described structural and functional similarities (e.g. collagen and fibronectin synthesis, vimentin intermediate filaments [figure 2 ], -actin), fibroblasts exhibit considerable variation of cytoskeletal proteins (e.g. -smooth muscle actin expression), surface markers and size, that suggests the existence of discrete cellular subsets. fibroblast variants can be seen both within a localized site (e.g. gingiva) and also between sites from various locations. the central hypotheses proposed that fibroblasts are phenotypically stable but exhibit heterogeneous subpopulations, which regulate tissue form and function. fibroblasts exhibit change in morphology and appear as elongated cells with thin flat / wavy nuclei (inactive fibroblasts) in the areas of dense collagen fibre formation [figure 3 ]. fibroblasts can also undertake other functions (e.g., as immune accessory cells), which extend their utility as architects and caretakers of connective tissues. fibrosarcoma [figure 4 ], a malignant mesenchymal neoplasm of fibroblasts or fibrohistiocytic lesions derived from a peculiar type of fibroblastic mesenchymal cell that show histiocytic areas and many other neoplasms can develop from fibroblasts. the concept that wound fibroblasts originating from peripheral blood cells goes back almost 100 years. since then, numerous studies have reported the differentiation of peripheral mononuclear cells into fibroblast - like cells. in 1994, a distinct population of blood - borne fibroblast - like cells that rapidly enter sites of tissue injury was described and were termed fibrocytes. these cells comprise 0.1 - 0.5% of non - erythrocytic cells in peripheral blood and show an adherent, spindle - shaped morphology. fibrocytes express collagen (col) i, col iii, and fibronectin, as well as the leukocyte common ag (cd45ro), the pan - myeloid ag (cd13), and the hemopoietic stem cell ag (cd34). in addition, fibrocytes express mhc class ii and costimulatory molecules (cd80 and cd86). morphology, growth properties and cell surface markers of fibrocytes appear to be distinct from monocytes / macrophages, dendritic cells, and other antigen presenting cell types. based on their presence in wounds and their secretion of proinflammatory cytokines, chemokines, and extracellular matrix proteins, fibrocytes have been postulated to play a role in connective tissue formation in wound healing. myofibroblasts (mf) are modified fibroblasts with smooth muscle like features characterized by the presence of contractile apparatus. myofibroblasts disclose several typical histologic traits characterized by large, spindle shaped stellate cells with long cytoplasmic extensions, amphophillic cytoplasm and indented nucleus with conspicuous nucleoli. these are extremely heterogenous and multifunctional cell population exhibiting a different phenotype and first discovered by electron microscopy in experimental granulation tissue. mf plays a key role in extracellular matrix synthesis, reorganization and tissue contraction during both physiologic process and pathologic process like wound healing and tumorigenesis. ultrastructurally these cells disclose irregular, stellate cellular outlines with numerous long cytoplasmic connections connected by intermediate or adherens junctions and are connected to the extracellular matrix by cell - to - stroma attachment sites through fibronexus. they contain bundles of cytoplasmic filaments arranged parallel to the long axis of the cell, a well developed rough endoplasmic reticulum, golgi and indented nucleus with prominent nucleoli. myofibroblasts discloses five cytoskeletal immuno phenotypes : phenotype v, represented by cells expressing only vimentin ; phenotype va represented by cells expressing vimentin and alpha smooth muscle actin (-sma) ; phenotype vad represented by cells expressing vimentin, -sma and desmin ; phenotype vd represented by cells expressing vimentin and desmin ; phenotype vam represented by cells expressing vimentin, -sma and myosin. most of the mf expresses alpha smooth muscle actin (-sma), an actin isoform found in vascular smooth muscle cells and regulated by tgf- and is considered as main immunohistochemical marker of myofibroblastic differentiation. in the oral cavity these mf were reported in the human palatal mucosa and granulation tissue during wound healing. the process of wound healing is highly orchestrated sequence of events in which myofibroblasts appear to be key cells. prostaglandins derived from myofibroblast are key factors in promoting healing by restitution and reconstitution of the epithelium. another important event in wound healing is the contraction of the wound which is due to the myofibroblasts because of the presence of alpha smooth muscle actin filaments in the cytoplasm of these cells. the extra cellular matrix complex is a mixture of collagens, glycoproteins and proteoglycans that form a scaffold for tissue formation. type i, iii, iv and viii collagens, fibronectin, tenascin are secreted by the myofibroblasts and tissue remodelling following injury which is mediated mainly by the matrix metalloproteinases, which are also secreted by the myofibroblasts. myofibroblasts have been reported in many locally aggressive odontogenic lesions like odontogenic keratocyst [figure 5 ] and solid ameloblastomas. in oral submucous fibrosis there was significant increase of myofibroblasts when compared to that of the normal control and could be used as markers for evaluating the severity of oral submucous fibrosis. the abundant myofibroblasts at the invasion front of oral squamous cell carcinomas [figure 6 ] contribute in growth of the tumor cells by secreting angiogenic molecules, growth factors and invasion by secretion of matrix metalloproteinases and suppression of host immune response. sma positive myofibroblasts in odontogenic keratocyst, 10 sma positive myofibroblasts in squamous cell carcinoma, 20 giant cell fibroma (gf) is characterized by the presence of many large stellate mono or multinucleate giant cells in a fibrous tissue containing abundant collagen and the degree of fibrosis varies from area to area within the fibrous tissue [figure 7 ]. the cytoplasmic borders of these cells are usually distinct with some fading at the apex of angular extension. some of these cells, especially those located beneath the epithelium may contain small brown granules with the staining characteristics of melanin. the overlying epithelium is hyperplastic with thin elongated retepegs and the inflammatory infiltrate is usually minimal. common irritation hyperplasias like fibrous hyperplasia, fibroepithelial polyp, fibroma show similar histologic features but the presence of numerous stellate giant cells differentiates giant cell fibroma from other lesions. giant cell fibroblasts in subepithelial region, 20 giant cell fibroblasts, 40 ultra structurally, giant fibroblasts appear as stellate cells with a large hyperchromatic nucleus, while the cytoplasm is well demarcated and frequently the cells show dendritic - like processes ; multinucleated giant cells in giant cell fibroma are unusual fibroblasts. immunohistochemical studies on giant fibroblasts showed positivity only for vimentin and negative reactivity for cytokeratin, neurofilament, hhf, cd68, hla dr, tryptase, leukocyte common antigen, s100 protein. | fibroblasts are a major stromal cell type present in human connective tissue maintaining the structural integrity in health. depending on the situation, location and various conditions, fibroblasts exhibit considerable variation in morphology, size and shape that suggest the existence of discrete cellular subsets. the purpose of this short communication is to provide information regarding the heterogenecity of fibroblasts and its variability in physiological and pathological conditions. |
it makes sense to prioritise actions on the small number of behavioural factors which are the leading determinants of health.1 2 on the contrary, other more costly technocratic approaches seem to be playing the dominant role in current public health policies. emphasising medical devices over lifestyles can potentially compromise public health,3 especially when preventive technologies are applied without simultaneously addressing the behavioural or structural underlying determinants of risk. we have selected some important public health conditions where this distortion of priorities currently seems quite conspicuous (table 1). public health problems and their respective technological, behavioural or structural solutions a mark () indicates an appropriate evidence - based preventive intervention. learning process that enables to understand, care about and act, on core values such as respect, justice, civic virtue and citizenship, and responsibility for self and others, which are the hallmark of safe, healthy and informed communities that serve as the foundation of our society. table 1 includes major contributors to the global burden of disease. the headings for each row (left column) represent sound and effective alternatives. some of these interventions are able to confront several chronic conditions at the same time. in contrast, the alternatives placed at the bottom row are the inefficient and technological solutions that seem to have been currently prioritised in many settings.4 at least 80% of premature cardiovascular deaths could be prevented simply through diet, physical activity and smoking avoidance. however, despite an increase in the use of antihypertensive and lipid - lowering drugs, the overall control of classical risk factors in the last years in europe has been poor. smoking continued unabated, and overweight / obesity prevalence increased dramatically.5 cardiovascular prevention might be futile without addressing the actual underlying causes of myocardial infarction and stroke. the 2013 updated american guidelines for cardiovascular prevention include blood cholesterol levels in all risk prediction algorithms.6 the strongest recommendation in these guidelines is the treatment with cholesterol - lowering drugs, mainly with statins (hydroxymethylglutaryl coenzyme a reductase inhibitors) for wide sectors of the population including subjects with no previous history of cardiovascular disease (cvd, ie, for primary prevention). however, the massive use of statins for primary prevention in healthy individuals is controversial. it is well known that statins do effectively reduce cardiovascular events in selected subgroups of patients with previous cvd, but the causal mechanisms leading from blood lipids to major cardiovascular clinical events need to be more thoroughly reappraised : is blood cholesterol really the major cause of cvd ? ; is cholesterol reduction the essential and indispensable step in cvd prevention for all kind of patients ? have we replaced the multifactorial origins of cvd by a single risk factor ? it is well known that the best way to market a drug is the marketing of a disease (or one proxy of a disease). today, it is becoming more obvious that it is not ldl - cholesterol that is directly implicated in cvd but small, dense, type b particles generated after a high intake of sugar and processed carbohydrates.79 overnutrition is related to blood lipids, and to blood pressure, resistance to insulin, inflammatory mechanisms, oxidative stress, coagulation factors and many other pathways leading to cardiovascular clinical events. a stronger focus on nutrition instead of the global oversimplification to massive statin use would have been the most sensible approach. the continually widening indication for statin prescription to more and more millions of healthy people does not seem to be scientifically justified.10 11 the us guidelines as well as the newly updated uk guidelines,12 seem to assume that the unique solution to the cvd pandemic is the replacement of cvd by a proxy (blood cholesterol) and therefore justify a blanket - wide use of statins. this oversimplification has provoked ample criticisms.8 10 13 do we need to prescribe statins or polypills to more than 30% of the general adult population for cvd prevention when we already know that 80% of cvd events can be prevented with simple dietary and non - dietary lifestyle measures?1417 as the large prevencin con dieta mediterrnea (predimed) primary prevention nutritional trial showed, simple dietary interventions can prevent many different cardiovascular problems. indeed, only a modest increment in the adherence to the mediterranean diet supplemented with extra virgin olive oil (100% fat) or with nuts (> 50% fat) obtained a 30% relative reduction in major cardiovascular events (stroke, myocardial infarction, cardiovascular death)18 19 and also attained other cardiovascular benefits in primary prevention.20 21 improved adherence to a high - quality dietary pattern has the additional benefit of enjoying palatable foods and will allow many more people to live longer without any need of recommending low - fat diets or using pharmacological solutions which are not exempt from side effects.15 yet, even though light to moderate alcohol intake might reduce cardiovascular mortality,22 being physically active and eating a healthier diet can be more effective than drinking a low dose of alcohol, which may have other undesirable effects.2 23 type 2 diabetes (t2d) is likely to become the next major epidemic largely as a result of the current obesity pandemic. t2d will affect more than 10% of the adult population in many countries during the next two decades, with a projected increase of 55% by 2035.24 25 t2d is also increasing in the youth.26 however, t2d is largely preventable.27 up to 91% of t2d cases could be prevented by relatively modest lifestyle changes.28 therefore global growing rates of t2d represent a profound humiliation for public health. randomised controlled trials and longitudinal observational studies have confirmed that dietary changes combined with non - dietary lifestyle modifications can have a long - term effect on t2d prevention.29 30 the large diabetes prevention program trial (figure 1) in 2002 showed that a lifestyle intervention based on dietary changes and on physical activity performed better than the metformin - medicalised option : 58% (lifestyle) versus 31% (metformin) relative reduction in risk over 3.2 years of follow - up, and 34% versus 18%, respectively, at 10 years of follow - up.31 32 furthermore, metformin efficacy was only limited to subjects with a body mass index > 35 kg / m.31 the outstanding results of this landmark trial continue today to support the superiority of lifestyle interventions in comparison with pharmacological approaches to prevention. this is also true for realistic improvements on different components of the metabolic syndrome and on the atherogenic dyslipidaemia frequently observed in patients with diabetes or prediabetes. these nutritional improvements help to reduce t2d and cardiovascular risk in people with impaired glucose tolerance.33 34 moreover, recent evidence supports that participants in nutrition intervention studies appear to sustain the dietary changes over time.35 additionally, pharmacological approaches to prevention may have adverse effects. metformin has a good record for effectiveness and safety, but the potential adverse effects of other medications used against diabetes (eg, thiazolidinediones)3638 add reasons for caution. the alarming worldwide prevalence of undiagnosed t2d, with almost half of all cases still not detected25 is a good reason to use preventive population - wide dietary and lifestyles strategies. thus, lower - cost healthy lifestyles should be the priority for the global prevention of t2d.27 28 39 the mediterranean diet, with a millenary history of no harm, is beneficial for primary cardiovascular prevention,40 and to reduce t2d risk.41 indeed, the large predimed randomised trial has also recently shown that changes in the overall dietary pattern with a long - term (up to 7-year follow - up) adoption of the mediterranean diet can reduce the risk of t2d among persons at high cardiovascular risk.30 cumulative incidence of type 2 diabetes in the diabetes prevention program trial (n=3234). p<0.001 for all comparisons. among participants with bmi < 35 kg / m (n=2040), no significant differences were found between metformin and placebo. from (knowler copyright (2002) massachusetts medical society. reprinted with permission from massachusetts medical society). another essential strategy for t2d prevention is physical activity, because physical inactivity is responsible of around 27% of t2d cases. the promotion of physical activity has been included in many international clinical guidelines for the prevention of major chronic diseases.42 43 the new fact sheet of the who recommends that adults should do at least 150 min / wk of physical activity of moderate intensity.44 however, we are still far from reaching this recommendation and global levels of physical activity keep falling.45 46 public health policies need to implement effective promotion programmes to make physical activity accessible and attractive for whole populations. an active lifestyle can be promoted with correct and specific instructions to be included in the routines of the general population at large. personal, social and environmental contexts have to be considered to achieve this purpose.43 the current absence of large randomised trials to assess the benefits of physical activity using hard clinical end points is somewhat surprising. large randomised trials to assess the long - term effects of physical activity are badly needed. worldwide, around 35% of the adult population are overweight and 12% are obese.47 48 the prevalence of overweight and obese children and adolescents is also rapidly increasing,4951 with an expected 9.1% worldwide prevalence in 2020.5254 one temptation is to seek technological or pharmaceutical solutions which allow to eat calorie - dense foods ad libitum and still not become obese. but magic antiobesity drugs is instructive : some were rejected by the food and drug administration (fda), others were withdrawn from the market or are still awaiting decisions because of safety concerns.5557 although it is easier for doctors and patients to turn to a pill than to address behaviour, we likely do not need more antiobesity drugs trials but a change of paradigm.58 59 the problem is that our culture, which advertises how to eat more, resists the simple message eat less.3 an obesogenic environment is a strong determinant of the current obesity epidemic. to palatable foods and to overeating has proven to be a decisive factor to explain weight gain in an obesogenic environment.60 given the actual prevalence of obesity and its worrisome health consequences, the population would benefit more from being turned towards attractive and high - quality lighter meals, with an adequate proportion of the evidence - based recommended foods. the development of the omics sciences (genomics, transcriptomics, proteomics, metabolomics) has contributed to overshadowing the fact that it is not genetic predisposition but social, environmental and behavioural factors which cause most cancers.2 6163 the good news is that these environmental and behavioural factors are modifiable.64 twelve forms of cancer are the major global contributors to deaths by neoplasia (figure 2). the cancer which causes most deaths lung cancer is the one that could be most easily and cost - effectively prevented, just by altering behavioural (active smoking) and environmental (passive smoking) factors.6567 major cancers in the world. expensive screening of lung cancer with low - dose ct has been recently endorsed by the united states preventive services task force (uspstf) in high - risk subjects because of their tobacco smoking history.68 however, this approach, which has important harms associated with false positive results, overdiagnoses and radiation, can not prevent most lung cancer - related deaths, as it results in only a 16% reduction in lung cancer mortality.68 in comparison, a near 40% reduction in lung cancer deaths was already attributed to decreases in smoking in the past century69 and a 90% risk reduction for overall smoking - associated mortality has been recently estimated.70 the lure of a high tech screening device can overshadow the fact that billions of cigarettes are still smoked worldwide every day and that the number of smokers is increasing in many countries.69 71 nineteen types of cancer are attributable to tobacco smoking.63 is it not worthy to tackle, as the first priority, this common cause of a largely lifestyle - associated disease projected to keep increasing?69 tobacco retail prices remain too low in some countries and although tobacco has become less affordable in some countries it is now more affordable in many others (figure 3). sadly, the global burden of disease attributable to tobacco smoking (including secondhand smoke) has changed little.2 cigarette affordability growth rates, 19902006. screening costs were not considered in the uspstf and other guidelines67 68 and screening is not an alternative to smoking cessation but an additional intervention. therefore, governmental actions must focus first on tobacco - avoiding policies.7279 the priority in lung cancer prevention is not screening (secondary prevention) but complete avoidance of smoking (primary prevention) and even primordial prevention to completely eradicate the existence of smoking in our societies and prevent the initiation of smoking for all members of future generations.61 69 80 the above - mentioned non - communicable diseases (ncds) are largely preventable by addressing common lifestyle determinants (unhealthy diet, physical inactivity and tobacco use).81 82 a recent modelling study has analysed the potential impacts in ncd mortality of reducing six selected preventable risk factors (tobacco, alcohol, salt intake, obesity, raised blood pressure and raised blood glucose). it has concluded that achieving the reduction of these six risk factors will decrease the probability of premature deaths from 2010 to 2025 by 33% from cvds, 12% from lung cancer and 5% from diabetes.83 therefore, sociological and cultural issues need to be fully addressed and require educational and structural responses.8489 from an equity perspective, environments should make the healthier choice the easiest choice so that prevention becomes accessible, available and affordable to all sectors of the population.57 58 9094 on the other hand, energy - dense fast foods, sugar sweetened beverages, smoking and sedentary lifestyles should be made the harder options. these are not sweet truths for some food or beverage corporations or for the technocratic business,39 95 but they are indeed the priorities for public health. also, some approaches to the prevention of communicable diseases have apparently forgotten the need to give appropriate priority to lifestyle interventions and heavily relied on technocratic solutions. universal policies to vaccinate girls against human papillomavirus (hpv) were adopted very rapidly during 20062009. however, many issues on this publicly funded mass vaccination remain unsolved : its coverage and affordability for the most vulnerable and affected countries, its long - term effectiveness and the uncertain though potential replacement of the vaccine - targeted strains with other high - risk types.9698 strong conflicts of interest are another reason for concern as available trials were sponsored by the manufacturers. affordability and an adequate coverage with complete vaccine regimens are two essential components for hpv vaccination programmes success. the vaccination programmes have mostly been implemented and publicly funded in higher - income countries although most of them have very low rates of hpv - related diseases.99 the rapid introduction of this publicly funded vaccine in spain does not match the epidemiological needs of the country because there is no epidemic of cervical cancer in spain whatsoever. on the contrary, mortality and incidence of cervical cancer are very low and show a decreasing trend in spanish women (figure 4). the coverage and effectiveness are lower for girls at higher risk.100 in addition, very few developing countries have introduced hpv vaccine into their national programmes although the burden of hpv - related diseases is highest there. at the current cost, mass vaccination is unaffordable in low - income and middle - income countries. in africa, although several countries are implementing hpv vaccine demonstration projects, only rwanda initiated a countrywide vaccination, after receiving a donation of several million vaccine doses from the manufacturer.101 102 the global alliance for vaccines and immunisation has offered some of the world 's poorest countries the quadrivalent vaccine at $ 4.50/dose. but overall, vaccination programmes will still be prohibitively expensive and their widespread implementation will not probably be sustainable. moreover, vaccine efficiency heavily depends on an adequate coverage with the complete regimen103 and we do not yet know the long - term efficacy even when a high coverage is reached. today, hpv vaccine coverage is still quite low in many countries, including economically developed countries such as the usa, where coverage for adolescent girls with all three doses was 33.4% in 2012. is the vaccination supplanting the need to combat the major risk factors ? why has an expensive and only partially preventive measure been rapidly introduced while other well - known and sufficiently proven measures been downgraded ? the rates of cervical cancer in a country are highly dependent on the availability of and women compliance with screening programmes. long - term primary prevention strategies are needed, which include structural interventions and sexual education with correct and complete information to increasing awareness about the basic facts of hpv infection. these simple, affordable and sustainable measures are absolutely essential for cancer prevention, especially in developing countries. if preventive strategies focus preferentially on glamorous technological options, apart from the problems herein described, another important unexpected consequence is risk compensation. people may consider themselves healthy enough when they eat foods labelled as low - energy / low - fat, take the prescribed pills and vaccines or attend the recommended screening programmes no matter if they keep sedentary, adhere to low - quality food patterns, smoke or have many other dietary and non - dietary risk behaviours. for example, the new uspstf guidelines for lung cancer screening notice that people may keep on smoking thinking that screening programmes can reduce their smoking - related risks.68 believing in a new preventive technology may lead to a dangerous sense of immunity. the available evidence is not fully consistent, but risk compensation has also been associated with hpv vaccine acceptability and this affects vaccine coverage and consequently, effectiveness and efficiency.96 97 99 103 therefore, it is important that preventive messages address the specific target population groups in which these biomedical strategies are to be recommended so that no erroneous beliefs turn up. always, apart from the high - risk subjects, the general population needs to be correctly informed because population - wide strategies to promote healthy lifestyles are frequently the most cost - effective option.57 screening, diagnosis and treatment represent real breakthroughs and have accounted for tremendous advances in health status. in fact, the technological preventive interventions mentioned in this paper can surely have some role and should be applied when they are appropriately justified. however, the unprecedented and continuous increase in the use of pharmacological / technological approaches, confirms that these approaches might not be adequate to manage the complex pathogenesis and consequences of chronic diseases. in addition, the partially successful pharmacological / technological approaches are responsible for inevitable and unsustainable increases in health expenditures ; hence, alternative lifestyle and dietary strategies should be given a sufficiently high priority. a body of sound epidemiological evidence exists to support the effectiveness of diet and lifestyles in the prevention of ncd. the technologically driven mentality might lead us further away from, rather than closer to, simpler, sensible approaches to the main behaviour - related public health problems. a common denominator for all the examples reviewed is that our culture fosters behaviours mainly driven by pleasure - seeking which are known to be associated with a clustering of unhealthy lifestyles. some global commercial powers have fostered a pleasure - seeking cultural environment which rich and the poor sectors of society. in this context, cultural deprivation seems more important than monetary poverty and needs to be counterbalanced by the cultural empowerment of individuals. this empowerment of individuals is needed to make them resistant to an environmental pressure favouring unhealthy behaviours.88 however, the success of individually focused interventions might be substantially improved when wider structural factors (social, cultural, familiar, educational, political or ideological factors) that act as determinants of individual behaviours are also addressed.69 as geoffrey rose already stated, population - based approaches addressing these structural determinants of health should be prioritised.104 we need to incorporate interventions that modify the environment through all public and private policies, in line with the idea of health in all policies. they will facilitate healthy choices that depend strongly on circumstances beyond individual control. today people can not make choices about behaviours in the circumstances of their own choosing. on the contrary, the promotion, price, availability and marketing of products affect their perceived costs and benefits, and consequently their choices. decisions about lifestyles depend now on choices / interests of governments, producers and multinational companies and consequently, on the incentives of financial institutions. a few powerful institutions and decision - makers who set the agenda and decide what is fashionable and what is not, are making unhealthy choices the easiest choices, shaping the preferences of the population at large and encouraging them to make unhealthy choices. consequently, as a result of the conflict with the dominant economical interests, wealth is being placed before health and an overemphasis on expensive technologies has led to underfunded prevention strategies. public health intervention policies are often failing to overcome these powerful forces.105 we acknowledge that the needed cultural change is not easy. cultivating an environment where healthier options are encouraged requires entering in decision arenas and counteracting commercially driven forces investing millions in advertising and opinion - making. therefore, it does not always conform with the politically correct positions and it is far from cheap and simple to achieve. however, if sociocultural and normative changes are attained, they will lead to dramatic reversals of epidemics. we do not need to shape individuals minds to fit our increasingly unhealthy societies but we need to redesign the environment to fit our populations health. the implementation of all the strategies proposed here should be considered a priority for public health. what is already known on this subject?reducing some of the main preventable risk factors described here (tobacco, alcohol, salt intake, high blood pressure and blood glucose and diabetes) will lead to higher reductions in probability of death compared with current trends with no additional action (22% in men and 19% in women) and even more in case of early action (24% and 21%).83 what this study adds?the new guidelines for cardiovascular prevention can be misinterpreted and lead to an excessive use of statins ; statin use should be decided depending on individual circumstances.the growing trends in type 2 diabetes (t2d) prevalence represent a humiliation for public health because t2d is easily prevented with diet and lifestyle.the key message for obesity prevention is to eat less.screening for lung cancer is probably inefficient and not affordable and may distort the true priority : smoking avoidance.technoprevention with hpv vaccination can backfire without addressing the true underlying behavioural determinants of risk. reducing some of the main preventable risk factors described here (tobacco, alcohol, salt intake, high blood pressure and blood glucose and diabetes) will lead to higher reductions in probability of death compared with current trends with no additional action (22% in men and 19% in women) and even more in case of early action (24% and 21%).83 the new guidelines for cardiovascular prevention can be misinterpreted and lead to an excessive use of statins ; statin use should be decided depending on individual circumstances. the growing trends in type 2 diabetes (t2d) prevalence represent a humiliation for public health because t2d is easily prevented with diet and lifestyle. screening for lung cancer is probably inefficient and not affordable and may distort the true priority : smoking avoidance. technoprevention with hpv vaccination can backfire without addressing the true underlying behavioural determinants of risk. | a dangerous distortion of priorities seems to be currently apparent in the dominant approaches to major public health problems, including cardiovascular disease, diabetes, obesity, cancer and some infectious diseases. relevant examples suggest an apparently inappropriate tendency to prioritise technocratic, partial solutions rather than confronting their true behavioural and structural determinants. technically oriented preventive medicine often takes excessive precedence over simpler, more sensible approaches to modify lifestyles, the environment and the social structure. structural factors (social, cultural, financial, familiar, educational, political or ideological factors) that act as determinants of individual behaviours should be effectively addressed to confront the essential causes of the most prevalent and important health problems. some consumer - directed commercial forces seem to be increasingly driving many aspects of the current sociocultural environment, and may eventually compromise the main pursuits of public health. population - wide strategies are needed to create a healthy sociocultural environment and to empower individuals and make themselves resistant to these adverse environmental and structural pressures. otherwise most public health interventions will most likely end in failures. |
syphilis is a sexually transmitted disease caused by infection with the bacterium treponema pallidum whose diagnosis remains elusive. the introduction of penicillin approximately 60 years ago along with public health improvements led to a decline in syphilis infection rates.1 however, after the rise of acquired immunodeficiency syndrome, the incidence of reported cases of syphilis increased.2 moreover, in south korea, the number of reported cases of syphilis gradually increased from 134 to 1,548 between 2002 and 2008.3 syphilis is clinically subdivided into three stages : primary, secondary, and tertiary. secondary syphilis can spread to the stomach, kidney, liver, joints, and eyes. the first two cases of gastric syphilis (gs) were reported in 1834 by andral,4 and the first histopathologically confirmed case of gs was reported by graham at 1922 in a patient whose tissues had been surgically removed.4 subsequently, additional studies have described a high incidence of gs diagnoses based on clinical, serological, and radiological evidences.1 moreover, kidney involvement due to syphilis has been reported during secondary, latent, and tertiary syphilis.5 although a number of nephritic syndrome case reports associated with secondary syphilis have previously been published, it is considered a rare presentation.6 furthermore, some cases of syphilis - related nephropathy were reported in the 1940s and 1950s, but relatively little has been published in more recent times. in addition, the co - occurrence of gs and nephrotic syndrome in the same patient is extremely rare. here we report a particular case of gs presenting with concomitant membranous glomerulonephritis (mgn). as cases such as this represent a diagnostic challenge, this report provides information on the typical features of gs that might be helpful for raising awareness of this rare disease entity among clinicians, facilitating its earlier diagnosis and appropriate therapy. a 34-year - old unmarried man presented to our hospital on february 28, 2011 with nocturnal epigastric pain and mild febrile sensation lasting 3 weeks. physical examination on admission revealed a blood pressure of 110/70 mm hg, heart rate of 82 beats per minute, respiration rate of 14 breaths per minute, body temperature of 36.8, and 1 + pitting edema below the knee. he did not have any important personal, family, hospitalization, surgery, or other diseases history. multiple ulcers and erosions, extending from the cardia to the pylorus, were observed on upper endoscopy (fig. 1). the gastric mucosa was thickened and friable, and associated with the ulcer lesions. histologically, the biopsied tissue revealed gastric ulcer and diffuse active gastritis with dense plasma cell infiltration, as well as variable numbers of lymphocytes and neutrophils. although no endarteritis or endophlebitis were observed, owing to the superficial nature of biopsied tissue, silver staining was performed because of the suspicion of gs. numerous spirochetes were detected within the lamina propria and between epithelial cells, confirming the diagnosis of gs. in addition, some helicobacter organisms were also identified in the superficial mucus layer (fig. 2). laboratory investigations revealed normal hemoglobin, hematocrit, white blood cell count, and liver function. the speckled and skeleton patterns of antinuclear antibodies were detected at a titer of 1:80 and 1:320, respectively.. the venereal diseases research laboratory (vdrl) syphilis serology test was positive, with a titer of 1:256, and the fluorescent treponemal antibody absorption (fta - abs) and t. pallidum latex agglutination tests were also positive. urinalysis revealed 3 + protein without blood or red blood cells, and a 24-hour urine collection revealed 11.3 g of protein. laboratory data showed blood urea nitrogen, creatinine, and albumin values of 19 mg / dl, 1.2 mg / dl, and 1.8 g / dl, respectively. serum total cholesterol and triglycerides were elevated, with values of 301 mg / dl and 202 mg / dl, respectively. at this stage, we suspected nephrotic syndrome secondary to syphilis, and a diagnostic kidney biopsy was performed. the renal biopsy revealed slight thickening of glomerular capillary walls with segmental subepithelial ' pores ' on tangentially cut sections on silver staining, but the mesangium was not expanded. weak granular immunoglobulin g (igg) and c3 staining along the glomerular capillary walls was observed on immunofluorescence microscopy. electron microscopy (em) could not be performed because the em sample did not include the glomerulus (fig. correlation of clinical and serological findings with gastroscopy and renal biopsy results was consistent with gs and mgn secondary to syphilis. the patient was treated with 2.4 million units of penicillin g benzathine, leading to resolution of his clinical symptoms, including epigastric pain, skin rash, and generalized edema. the proteinuria also improved, with a reduction in the 24-hour urine protein values from 11.3 to 0.7 g after penicillin g treatment. although gs patients generally experience epigastric pain, anorexia, early satiety, nausea, vomiting, and weight loss,7,8 these symptoms rarely contribute to gs diagnosis.1 a systematic review published in 2010 showed that the majority of patients with gs had no clinical history (87%) or physical examination results (56%) compatible with syphilis. moreover, as no clear diagnostic criteria exist, establishing relevant associations between the medical, sexual history, and physical examination is important for diagnosis. moreover, as symptoms are nonspecific, a high degree of diagnostic suspicion is especially required. as gastric involvement is usually seen after secondary syphilis when the spirochetes spread via the circulation, after considering the timing of past intercourse in our patient history, we estimated that he had secondary stage syphilis. most patients show more than one lesion type, including multiple ulcerations (48%), nodular mucosa (26%), erosions (24%), large ulcers (24%), thickened folds (17%), narrowing and rigidity (17%), and mass lesions (2%).1 hypertrophy of the rugae at the antral and prepyloric regions is a common endoscopic finding. moreover, rugal hypertrophy and poor distensibility may lead to misdiagnosis of scirrhous carcinoma or lymphoma.9 a reddish purple stomach color is thought to be characteristic of gs by some authors.10 in our case, upper endoscopy revealed multiple irregular, shallow ulcers covered with whitish exudates and a central depression ranging from 0.5 to 2 cm in diameter in the antrum, body, and cardia, abruptly ending at the pyloric level. complications including gastric hemorrhage, perforation, and gastric outlet obstruction have also been reported, but are less common.11 spirochetes detection on silver staining is difficult in a background of elastic and reticulum fibers. nevertheless, a positive finding of mucosal spirochetes on silver staining is considered an important diagnostic tool for gs. in our case, histopathological analysis findings compatible with endovasculitis include arterial wall and submucosal layer thickening, perivascular cell infiltrate, diffuse lymphocytes, and plasmocytes infiltrate. although vasculitis, manifested by endarteritis or endophlebitis, is a typical finding in other sites, it is rarely observed in gastric samples, probably because endoscopic biopsies do not reach the submucosal layer. the nephrotic syndrome that occurs in patients with syphilis is the most common clinical sign that occurs in 0.3% of patients with syphilis,12 and results from the growth of syphilis bacteria in the kidney. the mechanism of renal injury associated with syphilis involves an immune complex - mediated glomerulonephropathy, with mgn being the most common. however, in korea, only one case of concurrent gs and nephrotic syndrome was reported by kwon.13 in 2004. in our case, the patient was diagnosed by using serology, gastroscopy, and renal biopsy, and his clinical symptoms and laboratory findings completely improved after penicillin treatment. even though gs and mgn caused by syphilis are rare, it is important to emphasize this particular case owing to its diagnostic difficulty. furthermore, as syphilis prevalence has seen a recent increase, it is likely that more patients will present to the clinic. thus, recognition of the clinical picture of syphilis and its gastric and renal complications is important. by providing information on the typical features of gs, this case report will help to raise awareness of this rare disease entity among clinicians, resulting in earlier diagnosis and appropriate therapy. | syphilis is a chronic systemic infectious disease caused by the bacterium treponema pallidum. gastric involvement and nephrotic syndrome are uncommon but well documented complications of syphilis, but the co - occurrence of these two complications in the same patient is extremely rare. thus, because of their nonspecific presentation, suspicion of gastric syphilis (gs) and nephrotic syndrome is essential for diagnosis. patients should be investigated thoroughly and a diagnosis made based on clinical, endoscopic, and histological findings, in order to initiate appropriate therapy. we report of a 34-year - old male patient with a history of epigastric pain and a diagnosis of gs and syphilis - associated membranous glomerulonephritis confirmed by gastroscopy and kidney biopsy, who was treated successfully with penicillin g benzathine. this case report provides information on the typical features of gs that should help raise awareness of this rare disease entity among clinicians, resulting in earlier diagnosis and administration of appropriate therapy. |
partial - thickness rotator cuff tears (ptrcts) have the potential to cause significant pain and disability in affected patients. after failed conservative management, operative intervention is typically indicated for patients with persistent symptoms. surgical treatment is generally limited to tear debridement with or without acromioplasty or tear repair with or without acromioplasty. most authors recommend repair of tears involving 50% or more of the tendon thickness. with the advent of magnetic resonance imaging (mri) and shoulder arthroscopy, more unfortunately, high - quality data on the management of ptrcts are relatively lacking in the literature when compared with those available on full - thickness tears. partial - thickness rotator cuff tears are classified into three subtypes : bursal side, articular side, and intratendinous tears. among them, intratendinous tears are an important clinical entity. intratendinous tears are characterized by the absence of fiber disruption on both the bursal and articular surface of the rotator cuff. a cadaveric study reported that this type of tear was the most frequent (55%) among all of the partial - thickness tears. because the intratendinous tear has no communication to the subacromial space and the glenohumeral joint, it is probably the most difficult condition to be diagnosed among the three types of the partial tear.. however, confirmation of such lesions during operation can be difficult. only a few literature described how to find the intratendinous tears during surgery. both bursal side and articular side rotator cuff tears have been extensively studied, but little has been written about intratendinous tears. although arthroscopy has led to an increase in treatment of ptrcts, there were only few case reports concerning about arthroscopic repair of intratendinous tears. in addition, no one reported the structural outcomes after arthroscopic repair of intratendinous tears. the purpose of this study was to evaluate the functional results and structural outcomes after arthroscopic repair of intratendinous ptrcts. our hypothesis was that arthroscopic repair of intratendinous ptrcts could achieve good clinical and structural results. this study received approval from the investigational review board. from february 2008 to april 2012, 36 consecutive patients (36 shoulders) with intratendinous tears underwent arthroscopic treatment. the inclusion criteria in this study were (1) symptoms lasting more than 3 months with proper conservative treatment and (2) no major associated pathology that would need to be addressed at the time of arthroscopic surgery, such as a frozen shoulder or bankart lesion. three patients with frozen shoulder were excluded from this study. therefore, 33 patients met the inclusion criteria and were retrospectively studied. all of the 33 patients (33 shoulders) were available for evaluation of clinical follow - up. the mean age at the time of surgery was 42.9 9.9 years (range, 2261 years). a total of 18 (54.5%) patients had repair of the dominant shoulder, with 15 left and 18 right shoulders involved. the active range of motion (rom) was 155 (range, 60180) in flexion, 156 (range, 45180) in abduction, 43 (range, 1555) in external rotation, and active internal rotation was l3 (range, t7gluteus). preoperatively, all of the patients received bilateral radiographs of anteroposterior and supraspinatus outlet views and a noncontrast mri examination. oblique sagittal, oblique coronal and transverse, t2-weighted fat - depressed, fast spin echo images were acquired for all shoulders. the diagnostic signs of intratendinous tears included a defect within the rotator cuff and fluid - intensity signals within the tendons, which did not connect to the surface of the tendon. depending on the serial oblique coronal images, we could estimate the distance between the center of the tear and the long head of the biceps tendon (bt) (slice thickness was 4 mm). this enabled us to identify the tear in the operation more easily. before operation, conservative therapy comprised rest, modification of activities, local application of heat or cold, nonsteroidal anti - inflammatory medication, subacromial steroid injection, gentle exercises for maintaining and increasing rom, and muscle - strengthening exercises. all of the arthroscopic procedures were performed with the patient under general anesthesia in the beach - chair position. diagnostic arthroscopy was performed, and intra - articular pathology was treated in the appropriate manner. the tear was then localized preliminarily under arthroscopic visualization. according to the distance between the long head of the bt and the tear, which was estimated on preoperative mri, we percutaneously penetrated the cuff with a spinal needle near tendon insertion to the humeral head. to determine this distance as accurately as possible (errors can be made as a result of the magnifying effect of the arthroscope), the width of the long head of the bt (approximately 6 mm) was taken as a guide. a no. 1 polydioxynone (pds) suture (ethicon, somerville, nj, usa) was introduced through the spinal needle, and the needle was then removed [figure 1 ]. arthroscopic view from a posterior glenohumeral portal of a right shoulder shows introduction of a polydioxynone marking suture through supraspinatus tendon. hh : humeral head ; bt : biceps tendon (note : all arthroscopic views are of right shoulders oriented in the beach - chair position). when looking through the posterolateral portal, marking suture could be found in the subacromial space. careful evaluation of the cuff insertion was then performed around the pds suture [figure 2 ]. the bursal surface was intact in all of the patients, but some areas of the tendon insertion appeared soft and lax as the tendon was palpated using a hooked probe [figure 3 ]. after inserting the probe into the center of the suspected lesion within the midsubstance of the tendon, a cavity within the tendon could be felt and the probe could easily touch the bone trough on the greater tuberosity [figure 4 ]. arthroscopic view from a posterolateral subacromial portal shows inspection of the intact bursal side tendon with hooked probe around the polydioxynone suture. arthroscopic view from a posterolateral subacromial portal shows that the bursal side tendon appeared soft and lax. after inserting the probe into the tendon, a cavity within the tendon could be felt, and the bone trough of the greater tuberosity could be palpated easily. arthroscopic view from a posterolateral subacromial portal. after confirming the intratendinous tear, the bursal side tendon was incised. all the degenerative tissues of the tendon were removed until normal articular side tendon fibers were identified as being inserted into the greater tuberosity [figure 5 ]. a cancellous bed was prepared at the site of the repair by removal of a thin layer of cortical bone with a power burr to promote healing of the reattached cuff. standard single - row repair was performed with one or two suture anchors according to tear length [figure 6 ]. arthroscopic view from a posterolateral subacromial portal shows the intratendinous tear with the intact articular side tendon. the arm was maintained in a sling at 15 of abduction and neutral rotation for 6 weeks. six weeks later, active rom exercises that progressively applied loads to the repair construct were allowed. strengthening exercises that focused on restoring power and endurance to the healed rotator cuff muscles began after 3 months and were continued until 46 months postoperatively. the university of california at los angeles (ucla) shoulder score and the constant score were used before the operation and at the final evaluation. tendon healing was classified into five types according to sugaya 's criteria as follows : type i, sufficient thickness compared with a normal cuff with homogenously low intensity on each image ; type ii, sufficient thickness compared with a partial high - intensity area ; type iii, insufficient thickness with less than half the thickness without discontinuity, suggesting a partial - thickness, delaminated tear ; type iv, presence of a minor discontinuity in only one or two slices on both oblique coronal and sagittal images, suggesting a small, full - thickness tear ; and type v, presence of a major discontinuity observed in more than two slices on both oblique coronal and sagittal images, suggesting a medium or large, full - thickness tear. preoperative and postoperative clinical scores were compared using the paired student 's t - test. postoperative clinical scores between patients with intact cuff and patients with retears were compared using an independent t - test. from february 2008 to april 2012, 36 consecutive patients (36 shoulders) with intratendinous tears underwent arthroscopic treatment. the inclusion criteria in this study were (1) symptoms lasting more than 3 months with proper conservative treatment and (2) no major associated pathology that would need to be addressed at the time of arthroscopic surgery, such as a frozen shoulder or bankart lesion. all of the 33 patients (33 shoulders) were available for evaluation of clinical follow - up. the mean age at the time of surgery was 42.9 9.9 years (range, 2261 years). a total of 18 (54.5%) patients had repair of the dominant shoulder, with 15 left and 18 right shoulders involved. the active range of motion (rom) was 155 (range, 60180) in flexion, 156 (range, 45180) in abduction, 43 (range, 1555) in external rotation, and active internal rotation was l3 (range, t7gluteus). preoperatively, all of the patients received bilateral radiographs of anteroposterior and supraspinatus outlet views and a noncontrast mri examination. oblique sagittal, oblique coronal and transverse, t2-weighted fat - depressed, fast spin echo images were acquired for all shoulders. the diagnostic signs of intratendinous tears included a defect within the rotator cuff and fluid - intensity signals within the tendons, which did not connect to the surface of the tendon. depending on the serial oblique coronal images, we could estimate the distance between the center of the tear and the long head of the biceps tendon (bt) (slice thickness was 4 mm). before operation, all of the patients received conservative treatment for at least 3 months. conservative therapy comprised rest, modification of activities, local application of heat or cold, nonsteroidal anti - inflammatory medication, subacromial steroid injection, gentle exercises for maintaining and increasing rom, and muscle - strengthening exercises. all of the arthroscopic procedures were performed with the patient under general anesthesia in the beach - chair position. diagnostic arthroscopy was performed, and intra - articular pathology was treated in the appropriate manner. the tear was then localized preliminarily under arthroscopic visualization. according to the distance between the long head of the bt and the tear, which was estimated on preoperative mri, we percutaneously penetrated the cuff with a spinal needle near tendon insertion to the humeral head. to determine this distance as accurately as possible (errors can be made as a result of the magnifying effect of the arthroscope), the width of the long head of the bt (approximately 6 mm) was taken as a guide. a no. 1 polydioxynone (pds) suture (ethicon, somerville, nj, usa) was introduced through the spinal needle, and the needle was then removed [figure 1 ]. arthroscopic view from a posterior glenohumeral portal of a right shoulder shows introduction of a polydioxynone marking suture through supraspinatus tendon. hh : humeral head ; bt : biceps tendon (note : all arthroscopic views are of right shoulders oriented in the beach - chair position). when looking through the posterolateral portal, marking suture could be found in the subacromial space. careful evaluation of the cuff insertion was then performed around the pds suture [figure 2 ]. the bursal surface was intact in all of the patients, but some areas of the tendon insertion appeared soft and lax as the tendon was palpated using a hooked probe [figure 3 ]. after inserting the probe into the center of the suspected lesion within the midsubstance of the tendon, a cavity within the tendon could be felt and the probe could easily touch the bone trough on the greater tuberosity [figure 4 ]. arthroscopic view from a posterolateral subacromial portal shows inspection of the intact bursal side tendon with hooked probe around the polydioxynone suture. arthroscopic view from a posterolateral subacromial portal shows that the bursal side tendon appeared soft and lax. after inserting the probe into the tendon, a cavity within the tendon could be felt, and the bone trough of the greater tuberosity could be palpated easily. arthroscopic view from a posterolateral subacromial portal. after confirming the intratendinous tear, the bursal side tendon was incised. all the degenerative tissues of the tendon were removed until normal articular side tendon fibers were identified as being inserted into the greater tuberosity [figure 5 ]. a cancellous bed was prepared at the site of the repair by removal of a thin layer of cortical bone with a power burr to promote healing of the reattached cuff. standard single - row repair was performed with one or two suture anchors according to tear length [figure 6 ]. arthroscopic view from a posterolateral subacromial portal shows the intratendinous tear with the intact articular side tendon. the arm was maintained in a sling at 15 of abduction and neutral rotation for 6 weeks. six weeks later, active rom exercises that progressively applied loads to the repair construct were allowed. strengthening exercises that focused on restoring power and endurance to the healed rotator cuff muscles began after 3 months and were continued until 46 months postoperatively. the university of california at los angeles (ucla) shoulder score and the constant score were used before the operation and at the final evaluation. tendon healing was classified into five types according to sugaya 's criteria as follows : type i, sufficient thickness compared with a normal cuff with homogenously low intensity on each image ; type ii, sufficient thickness compared with a partial high - intensity area ; type iii, insufficient thickness with less than half the thickness without discontinuity, suggesting a partial - thickness, delaminated tear ; type iv, presence of a minor discontinuity in only one or two slices on both oblique coronal and sagittal images, suggesting a small, full - thickness tear ; and type v, presence of a major discontinuity observed in more than two slices on both oblique coronal and sagittal images, suggesting a medium or large, full - thickness tear. preoperative and postoperative clinical scores were compared using the paired student 's t - test. postoperative clinical scores between patients with intact cuff and patients with retears were compared using an independent t - test. preoperative plain radiographs showed type ii acromion in 26 patients and type iii acromion in seven patients. on oblique, coronal t2-weighted fat - depressed images from 33 preoperative mris, 26 patients showed an area of high - signal intensity within the insertion of the supraspinatus tendon, supporting the diagnosis of intratendinous tears [figure 7 ]. two patients showed a tendon defect, three showed high signal on the bursal surface of the tendon, and two showed tendon degeneration. these were interpreted as two full - thickness tears, three bursal side partial tears, and two normal tendons preoperatively. the intratendinous tears, which were confirmed under the arthroscopy, were found within the supraspinatus tendon in all of the patients. the coracoacromial ligament surface was fibrillated or rough in all of the patients, indicating the presence of subacromial impingement. some intra - articular lesions were defined and treated, including two repairs and one debridement of superior labrum anterior and posterior lesion, one debridement of partial rupture of the long head of the bt, one debridement for partial tear of the subscapularis tendon, and three debridements of labrum lesions. seventeen patients had no pain, 13 patients felt light pain or discomfort occasionally while three patients felt pain during strenuous exercise. the active rom was 178 (range, 160180) in flexion, 176 (range, 150180) in abduction, 46 (range, 4050) in external rotation, and active internal rotation was t12 (range t7l3). both scoring systems reflected significant improvement in the status of the shoulder when the preoperative scores were compared with those at the time of the final follow - up [table 1 ]. the mean postoperative ucla score and constant score were significantly higher compared with that preoperatively (p < 0.001). no significant difference in either postoperative score was found between patients with an intact cuff and those with a cuff retear (ucla : p = 0.696, constant : p = 0.834) [table 2 ]. preoperative and postoperative clinical scores (n = 33) ucla : university of california at los angeles. comparison of functional outcomes between patients with an intact rotator cuff and those with a retear ucla : university of california at los angeles. a total of 27 (81.8%) patients received postoperative mri, which was performed at a mean of 15.2 months after surgery (645 months). there were four type i [14.8%, figure 8a ], 18 type ii [66.7%, figure 8b ], and five type iii retears [18.5%, figure 8c ]. in this study overall, there were 22 intact repaired cuff tendons (sugaya 's type i or ii) and five partial tears (sugaya 's type iii). (a) type i, sufficient thickness with homogenously low intensity (white arrow) ; (b) type ii, sufficient thickness with partial high intensity (white arrow) ; (c) type iii, insufficient thickness without discontinuity (white arrow). preoperative plain radiographs showed type ii acromion in 26 patients and type iii acromion in seven patients. on oblique, coronal t2-weighted fat - depressed images from 33 preoperative mris, 26 patients showed an area of high - signal intensity within the insertion of the supraspinatus tendon, supporting the diagnosis of intratendinous tears [figure 7 ]. two patients showed a tendon defect, three showed high signal on the bursal surface of the tendon, and two showed tendon degeneration. these were interpreted as two full - thickness tears, three bursal side partial tears, and two normal tendons preoperatively. the intratendinous tears, which were confirmed under the arthroscopy, were found within the supraspinatus tendon in all of the patients. the coracoacromial ligament surface was fibrillated or rough in all of the patients, indicating the presence of subacromial impingement. some intra - articular lesions were defined and treated, including two repairs and one debridement of superior labrum anterior and posterior lesion, one debridement of partial rupture of the long head of the bt, one debridement for partial tear of the subscapularis tendon, and three debridements of labrum lesions. seventeen patients had no pain, 13 patients felt light pain or discomfort occasionally while three patients felt pain during strenuous exercise. the active rom was 178 (range, 160180) in flexion, 176 (range, 150180) in abduction, 46 (range, 4050) in external rotation, and active internal rotation was t12 (range t7l3). both scoring systems reflected significant improvement in the status of the shoulder when the preoperative scores were compared with those at the time of the final follow - up [table 1 ]. the mean postoperative ucla score and constant score were significantly higher compared with that preoperatively (p < 0.001). no significant difference in either postoperative score was found between patients with an intact cuff and those with a cuff retear (ucla : p = 0.696, constant : p = 0.834) [table 2 ]. preoperative and postoperative clinical scores (n = 33) ucla : university of california at los angeles. comparison of functional outcomes between patients with an intact rotator cuff and those with a retear ucla : university of california at los angeles. a total of 27 (81.8%) patients received postoperative mri, which was performed at a mean of 15.2 months after surgery (645 months). there were four type i [14.8%, figure 8a ], 18 type ii [66.7%, figure 8b ], and five type iii retears [18.5%, figure 8c ]. in this study overall, there were 22 intact repaired cuff tendons (sugaya 's type i or ii) and five partial tears (sugaya 's type iii). (a) type i, sufficient thickness with homogenously low intensity (white arrow) ; (b) type ii, sufficient thickness with partial high intensity (white arrow) ; (c) type iii, insufficient thickness without discontinuity (white arrow). to the best of our knowledge, this is the largest study to examine the clinical and anatomical results of intratendinous ptrcts after arthroscopic repair. the combination of decompression and repair with preservation of as much of the intact articular tendon fiber as possible yields a satisfactory clinical outcome. postoperative mri also showed a high rate of healing of the repaired tendon among our patients. partial - thickness rotator cuff tear is more difficult to diagnose than a full - thickness tear. in particular, preoperative diagnosis of intratendinous tears may be the most challenging among the three subtypes of ptrcts. however, in recent years, advancement in mri, specifically sequence alteration and differential arm positioning, have greatly improved its accuracy in identifying intratendinous tears. one is a linear high signal within the tendon, which is parallel to the direction of tendon fibers. the other is a focal defect at the tendon insertion, which has no communication with either surface of the tendon. in the current study, 26 of 33 (78.8%) patients had been diagnosed with intratendinous tears by preoperative mri, showing that mri is an effective way of diagnosing intratendinous tears. although preoperative diagnosis has become more accurate, intraoperative localization of the tears remains problematic. this difficulty is due to the absence of overt tendon disruption on both the bursal and articular surfaces of the cuff. in uchiyama 's study, a definitive diagnosis was established by a longitudinal split of the supraspinatus tendon in the area of softening, fraying, edema, erosion, and redness. itoi and tabata reported three cases where intratendinous tear was suspected when the cuff was soft, fluffy, and bulged when the arm was elevated. bubble sign as facilitating the diagnosis of intratendinous tears. in our study, with the help of the marking suture, the inspected area could be minimized, and the tears could be found quickly. the intratendinous tear was excised in 15 patients, including the whole lesion and a small portion of the greater tuberosity. the tendon defect was then closed by side - to - side sutures and transosseous sutures. itoi and tabata reported three cases in which a full - thickness cuff involving the tear was resected and repaired. few studies have investigated the effectiveness of acromioplasty alone for the treatment of intratendinous tears. fukuda. showed in their histological study that partial - thickness tears have essentially no ability to heal themselves over time. intratendinous tears biopsied at the time of operative intervention show granulation tissue with rounded, avascular tissue margins without evidence of healing. biomechanical studies have shown that in the presence of a partial - thickness tear, the strain patterns within the remaining intact rotator cuff change, potentially predisposing the tissue to tear propagation. according to the results of these studies, tendon repair with acromioplasty may be more suitable. in the current study, intratendinous tears were converted to bursal side tears after the normal bursal side tendon was incised. some authors have proposed to complete a full thickness tear and repair it, whereas others believe that the normal articular sided tissue should be reserved because it can protect the repaired bursal side tendon and offer a good opportunity for healing of the repaired tendon. in addition, with preservation of an intact articular side tendon, some authors tend to perform a full - layer repair whereas others prefer to repair the outer layer only. in the present study, we preserved the healthy articular side tendon as much as possible and repaired the bursal flap back to the bone. good clinical and structural results showed that our technique was effective for intratendinous tears. to the best of our knowledge, few studies have examined structural outcomes after arthroscopic repair of intratendinous ptrct. in uchiyama low signal in tendon was found in 7 patients. with regard to our repair technique, koh. reported good structural integrity (88% healing rate) on mri after arthroscopic full - layer repair. kim. described satisfactory structural integrity (89%) after either conversion to a full - thickness tear repair or only repairing the detached layer. in this study, 22 (81.5%) repaired tendons were intact. the healing rate is consistent with these studies. whether the tendon integrity affect the clinical result is under debate. some authors believed that retearing had no effect on the clinical results, especially in small tears. our results are consistent with these reports. however, further studies are needed to clarify the reason of this interesting finding. first, this was a retrospective study with a relatively small number of patients and a relatively short time of follow - up. therefore, this study does not provide a clear understanding of the requirement for treatment of intratendinous rotator cuff tears. second, because we did not perform subacromial decompression alone to the intratendinous tears, we could not compare both results. third, postoperative mri scans were taken at 6 months to 4 years (i.e., the postoperative period varied). therefore, the structural integrity that we achieved might not match the clinical outcomes at the final follow - up. | background : partial - thickness rotator cuff tears (ptrcts) are being diagnosed more often because of high - resolution magnetic resonance imaging (mri). compared with articular and bursal side tears, there have been few studies about evaluating the clinical and structural outcomes after intratendinous tear repair.methods:from 2008 to 2012, 33 consecutive patients with intratendinous ptrcts underwent arthroscopic repair. all of them were retrospectively evaluated. the university of california at los angeles (ucla) and constant scores were evaluated before operation and at the final follow - up. postoperative cuff integrity was determined using mri according to sugaya 's classification.results:at the 2-year follow - up, the average ucla score increased from 16.7 1.9 to 32.5 3.5, and the constant score increased from 66.2 10.5 to 92.4 6.9 (p < 0.001). twenty seven patients received follow - up mri examinations at an average of 15.2 months after surgery. of these 27 patients, 22 (81.5%) had a healed tendon, and five patients had partial tears. there was no association between functional and anatomic results.conclusions:for intratendinous ptrct, clinical outcomes and tendon healing showed good results at a minimum 2-year after arthroscopic repair. |
throughout the 70 s of the 20th century, investigations on a new class of pharmacologically active substances actoprotectors (aids for improving human s physical and mental efficiency) were guided by professor vladimir vinogradov. these investigations resulted from the development of the first and the most commonly used actoprotector, bemitil (chemical structure 2-ethylbenzimidazole hydrobromide) (fig. 1). later, other actoprotectors were created, such as bromantane. for the last 20 yr, people synthesized and studied other compounds with actoprotecive properties belonging to different chemical classes : thiazoloindole derivatives, 3-hydroxypyridine derivatives, nicotinic acid derivatives, 1-oxa-4-aza-2-silacyclanes etc [3 - 5 ]. at the same time, experimental studies and analyses of pharmacological properties of certain herbs proved that some phytochemicals, while having a very low toxicity, are also aids that improve human s physical and mental efficiency. among such herbs, there are interesting plant adaptogens : panax ginseng and other species from genus panax, eleutherococcus senticosus, pfaffia paniculata, withania somnifera, schisandra chinensis, gynostemma pentaphyllum, rhodiola rosea, etc. actoprotectors are preparations that enhance the body stability against physical loads without increasing oxygen consumption or heat production, increasing the efficiency factor. actoprotectors fall under the metabolic drugs of non - consumptive class of action and possibly possessing antihypoxic characteristics at either higher or lower extent. the agents differ from antihypoxants since actoprotectors primarily stimulate protein synthesis and increase working capacity. moreover, the preparations exert an antihypoxic effect under hypoxic conditions, which may advance as a result of mitochondrion - decreased ability to oxidize substrates under higher physical loads. however, this is not the case in hypoxic conditions of other etiology. the principal difference of actoprotectors and psychostimulants (caffeine, sydnocarb, phenamine, methylphenidate, modafinil, adrafinil etc.) is that actoprotectors are agents of non - exhaustive actions. in actions of actoprotectors, there is no increase in oxygen consumption or heat production ; differing with nootropic agents actoprotectors increase not only mental, but physical work capacity as well. vinogradov presumed that actoprotectors did not have enough theoretical background to be labeled as a new class of pharmacological compounds. this separation appeared as a result of development of military medicine to improve physical strength. our opinion about this connection is that the actoprotectors are considered as synthetic (and possibly, natural origin) adaptogens with strong positive influence on physical work capacity. it means, for the convenience of pharmacological classification, some synthetic adaptogens that highly increase the physical performance can be determined as for example, benzimidazole derivatives dibazol (bendazol), levamisole and afobazol are all regarded in scientific literature as adaptogens. dibazol s adaptogenic action was initially realized in adaptation in difficult environment conditions through immune mechanisms [18 - 27 ]. levamisole s adaptogenic activity is also connected primarily with adaptive changes in the immune system [28 - 31 ]. afobazol has neuroprotective properties established in vitro on survival of ht-22 neurons in the model of oxidative stress and glutamate toxicity, and its adaptogenic action was determined through central nervous system adaptation [33 - 35 ]. since benzimidazole derivatives have adaptogenic properties, these compounds are similar to bemitil, but their influence on physical work capacity is either absent or minimal. we think that briefly, actoprotectors can be mentioned as synthetic or natural origin adaptogens with significant capacity to increase physical and mental performance. the classic reference actoprotector is bemitil ; in its chemical structure, bemitil is 2-ethylthiobenzimidazole hydrobromide (fig. currently, only two compounds, among all actoprotectors, are permitted for medical administration : bemitil (commercial name antihot, certified in ukraine as dietary supplement) and bromantane (commercial name ladasten, certified in russia as a drug) (fig. 1). adaptogenic herbs are more available all over the world. in many countries it becomes more convenient in the usage for people with active lifestyle or whose professional activity is related with heavy physical and/or mental loads (athletes, military service men, firefighters, crew members, computer operators, night shift doctors and nurses, etc.). therefore, adaptogenic herbs as potential actoprotectors have not just only theoretical importance for the understanding of mechanisms of their pharmacological action, but also practical applications in sport and occupational medicine. a primary analysis of actoprotector s effect under heavy physical loads observed its influence on carbohydrates and energy metabolism : slight decreases of glycogen and creatine phosphate content in the liver and muscles, and of glucose in the blood and lower accumulation of lactates in the tissues and blood, and lower increases in heat production and oxygen consumption. after the period of exertion ended, rehabilitation of the factors under study was accelerated, and indeed, some factors showed super compensation. 2 illustrates the influence of benzimidazole actoprotector on glycogen content in rat liver during recovery. interestingly, the 4 hour time - point showed a reversed pattern for all of the parameters. the authors assumed that at this point of the recovery period, the energy resources are expended on different biosynthetic processes, leaving the energy supply for muscular activity is severely limited. thus, in this situation, switching of intracellular metabolism to the anabolic reactions, rather than catabolic predominantly, occurs. this is why the work capacity settles at a relatively low level and can not be increased using pharmacological agents. noted the increase of the heart and not the liver glycogen content by the 4th hour of the recovery period, and drew conclusions about the importance of the liver glycogen content to the capacity for work. however, this phenomenon reflects a more complex mechanism that can not be explained on the aforementioned basis alone and requires further research. the significant decrease of total rna content in the 4th hour of the recovery period in liver under benzimidazole actoprotector administration is believed to be the evidence behind this reasoning (fig. it has been established that the therapeutic effect of actoprotectors (bemitil, as an example) is a function of its complex mechanism entailing cell genome activation, optimization of mitochondrial oxidation, oxidative stress reduction, and stimulation of cellular immune response. recently p. ginseng (known also as ginseng and korean ginseng) is one of the most well - known and studied adaptogens. it is grown in china, korea, japan, and russia while having a long - time (some thousands years) history of its administration in oriental medicine. nowadays, p. ginseng as a dietary and medicinal custom is not only in asia (especially korea and china), but is also used world - wide. ginseng is available in many forms : whole root, root powder (white ginseng), steamed root powder (red ginseng), heat processed root powder (sun ginseng), steamed and dried roots for 5 d and 9 times respectively (black ginseng), teas, tinctures, and standardized root extracts containing known and reproducible amounts of ginseng saponins in every batch [37 - 40 ]. in some countries, other species from genus panax (p. bipinnatifidus, p. japonicus, p. notoginseng, p. pseudoginseng, p. quinquefolius, p. stipuleanatus, p. trifolius, p. vietnamensis, p. wangianus, p. zingiberensis) are not as well - known as p. ginseng, but they are also used in oriental medicine. among the diverse constituents of ginseng, steroid - like phytochemicals with adaptogenic properties named ginsenosides have been found to be major components responsible for their biological and pharmacological actions. ginsenosides are a special group of triterpenoid saponins that can be classified into two main groups by the skeleton of their aglycones : panaxadiol group (rb1, rb2, rb3, rc, rd, rg3, rh2, and rs1) and panaxatriol group (re, rf, rg1, rg2, and rh1) (fig. more than 150 naturally occurring ginsenosides have been isolated from roots, leaves / stems, fruits, and/or flower buds of ginseng. ginsenosides have been the target to many researches as they are believed to be the main active components behind the claims of ginseng s efficacy. these steroid - like phytochemicals, which are known to counter the negative influence of stress, are beneficial for health property. the glycosides act on the adrenal glands, helping to prevent adrenal hypertrophy and excess corticosteroid production in response to stress. ginseng stimulates the formation of blood vessels and improves blood circulation in the brain, thereby improving memory and cognitive abilities. ginseng is also used as treatments of diabetes, migraines, infections, cancer, radiation and chemotherapy protection, sleep aid, and appetite stimulation [42 - 44 ]. the ginsenosides content in ginseng preparations can vary depending on the species, the age, portion of the plant, the preservation method, the season of harvest, and the extraction method [45 - 47 ]. for example, comparative study on the ginsenosides of 47 samples of ginseng products derived from different panax species was conducted using a reverse - phase hplc method. the results showed that the ginsenoside compositions in ginseng products of different origins were considerably variable. chikusetsu - ninjin derived from p. japonicus (japan) was found to have the highest content (192.80 - 296.18 mg / g) and a product from p. ginseng to be the lowest (5.78 - 15.63 mg / g). two main groups suggested by phytochemical data were clearly observed : group i mainly containing dammarane saponins consisted of p. ginseng, p. quinquefolius, p. notoginseng, p. vietnamensis and p. vietnamensis var. fuscidiscus and group ii containing a large amount of oleanolic acid saponins was composed of p. japonicus (japan), p. zingiberensis, p. japonicus (china), p. japonicus var. the ratios of the subtotal of dammarane saponins to that of oleanolic acid saponins were found to be > 1.9 and < 0.25 for groups i and ii, respectively. the product samples derived from the same botanical origin revealed similar constituent patterns, in other words, each panax taxon showed its own characteristic chromatographic profile, which appeared in the specific shape of an 11-direction radar graph constructed on the basis of the result of quantitative analysis. similarities of chemical constitution were seen among the closely phylogenetically - related taxa, including p. ginseng and p. quinquefolius, p. vietnamensis and p. vietnamensis var. fuscidiscus, p. japonicus (china) and its varieties, except for p. japonicus (japan) and p. zingiberensis. as mentioned above, except for ginsenosides, plants from genus panax contain other active compounds (carbohydrates including polysaccharides, vitamins, alkaloids, fat soluble components, organic acids, microelements and macroelements, etc.) which make important contributions in their pharmacological activity, but the quantity and composition of these compounds differ among the different species [49 - 53 ]. all together these facts explain why pharmacological properties of plants from genus panax are similar, but not the same ; moreover, pharmacological activity of different preparations from the same part (roots, leaves etc.) of the same species can be different depending on the season of harvest and the extraction method. finally, differences between different ginseng preparations can have an influence not just only in their potency, but also in kinds of their pharmacological activity. recently, the most widely standardized ginseng extracts, both commercially and for research purposes, are g115 and products of korea ginseng corporation (seoul, korea), concentrated aqueous extracts from p. ginseng root, which are standardized to contain a certain amount of ginsenosides. poor standardization can cause difficulties in evaluation of data received from the animal experiments and human studies related with pharmacological activity of adaptogens including ginseng. it means that sometimes data from different laboratories connected with pharmacological properties (including neurocognitive and actoprotective activity) of preparations from the same species can not be compared (or, at least, their comparison is very complicated). in conclusion, data on pharmacological activity of preparations received from different species from genus panax should be evaluated separately. analyses of scientific literature connected with influence of preparations from plants of genus panax on physical work capacity is more complicated when compared with that of their influence on cognitive functions. similar to the situation with memory and attention, most studies are connected with preparations from p. ginseng. results of many animal experiments attest that p. ginseng preparations can significantly increase physical work capacity. administration preparations with different qualities from this plant in different dosages increase exhaustion time for swimming in mice [55 - 58 ] and rats and exhaustion time for treadmill running in rats [60 - 62 ]. short - term (4 d), although not acute, treatment with complex of ginseng saponins (10 and 20 mg / kg / d) significantly prolongs the aerobic endurance of non - trained rats exercising at approximately 70% vo2max. wang. established that pec (the oral liquid which consists of p. quinquefolius, epimedium brevicornum, s. chinensis bail and cervus eplaphus) administration could prolong swimming duration of mice in water tank and increase the tolerant ability against oxygen - deficiency. however at the same time, results of some other experimental studies show no significant influence of ginseng on physical work capacity. martinez and staba established that saponin extracts from different kinds of p. ginseng (korean red, shiu - chi red, kirin red and sanchi ginseng) and p. quinquefolius (canadian, american white and american red ginseng) ergogenic stems from the greek roots ergon and genes, meaning work and any means of enhancing energy production or utilization may be described as an ergogenic aid. it defines ergogenic aids as substances, foods, or training methods that enhance energy production, in use or recovery, while providing athletes with a competitive advantage. regarding to herbs currently being used to enhance physical performance, bucci subscribed that they can have different reasons for use including their adaptogenic properties, testosterone - like (anabolic) effect, stimulating effect on central nervous system, effect on capacity to increase endogenous testosterone production (testosterone booster), and alpha - adrenergic agonist properties etc. a wide understanding of ergogenic aid makes this term a practical definition in the field of sport science and sport medicine but not pharmacology. according to modern pharmacological classification, p. ginseng and most other herbs from genus panax should be definite adaptogens due to their ability to increase physical work capacity in a healthy person, this being one of the important components of adaptogens action. however on the other hand, different adaptogens have different capacities to increase physical performance. that is why adaptogens with the strongest potency to increase physical work capacity are referred to actoprotecors. according to conventional wisdom, it is reasonable to refer agents from actoprotectors class to synthetic adaptogens and to regard their strong actoprotective effect as one of their components of adaptogenic action. it should be stressed that the focus of this study is on the ability to enhance physical work capacity and not on the adaptogens origins, synthetic or natural. according to this point of view, adaptogens of natural origin also can be referred to actoprotectors if they have potent influence on physical work capacity. some mechanisms of antifatigue action can be included into adaptogen action ; but other mechanisms can be different. as we see regarding to ginseng, its actoprotective properties are very discussible, but antifatigue properties have even more evidence supporting this along with proofs. from the results of experimental and human studies on the influence of ginseng preparations on physical performance and restoration after loads, there are many other controversies besides those mentioned about critical points of protocols and experimental techniques, including administration of different quality and composition ginseng supplements. detail analyses of experimental results demonstrated no influence by ginseng based on the swimming exhaustion time of rats and mice indicating critical points. for example, in one study some experimental groups included very few animals (3 - 4). in this study, results of the swimming test generally showed variable swimming time (205 - 592 min). it can not be excluded that such various individual results can possibly be connected with methodological defects because of the difficulties in managing swimming test (water of room temperature was preferred to avoid gas sorption on hair but could not use fresh tap water) along with insufficient quantity of animals in some experimental groups. in jung.s study, very high doses of ginseng extract were used (500 mg / kg / d) during a long time period (4 wk), although it is well - known that too high of dose of adaptogens can lead to inverse effects. results of human studies with plants from genus panax on physical performance (adapted with modifications from) #, data not listed or unavailable ; co, crossover ; db, double - blind ; dmae, dimethylaminoethanol ; f, female ; fsh, follicle stimulating hormone ; lh, luteinizing hormone ; m, male ; nc, not controlled ; panas, positive and negative affect schedule ; pc, placebo - controlled ; poms, profile of mood survey ; r, randomized ; rer, respiratory exchange ratio ; rpe, ratings of perceived exertion ; sb, single - blind ; ve, expiratory ventilation. results from numerous human studies, which are summarized in table 1, are also controversial. similar to animal experiments, (cited in) demonstrated that ginseng supplementation had no effect but had a very small sample size (5 athletes in experimental group and 6 in placebo group). ziemba. established that ginseng administration does improve psychomotor performance during exercise without affecting exercise capacity in their study with soccer players, but used non - specific method for this kind of sport test (incremental bicycle ergometer exercise test).. demonstrated substantial ergogenic effects but for ginseng combined with dimethylaminoethanol bitartrate, vitamins, minerals, and trace element. established that ginseng supplementation does not exert an ergogenic property on aerobic fitness enhancement in well - fit individuals with 60 young men (30 in experimental and 30 in control group), but used non - standardized 100% ginseng instead of any standardized ginseng preparation such as g115, products of korea ginseng corporation. or any other standardized extract. two separate studies forgo, 1981 and 1982 respectively (both cited in), showed significant change in aerobic capacity, lactate level, and heart rate under ginseng administration but failed to show either placebo or control conditions. forgo did, however, extend these studies with a double blind placebo - controlled investigation into the effects of 9 weeks administration of g115, g115 plus tocopherol, or placebo, on physiological and hormonal measures (luteinizing hormone, testosterone, and cortisol) in athletes. he reported the significant increase in oxygen uptake and significant decreases in both exercise blood lactates and heart rate, but no change in hormone levels for both of the active treatments in comparison to placebo. this was followed by a further double blind study investigating the duration of the effects of 9 weeks administration of g115 (100 mg twice daily) during exercise. results reported a significant increase in oxygen uptake and forced expiratory volume and significant decrease in heart rate and visual reaction times. some of these differences persisted at 3 weeks at the end of administration of g115 (forgo and schimert, cited in). liang. reported that 30 d administration of p. notoginseng improves endurance time of exhaustion, and lowers mean blood pressure and vo2 during endurance exercise in healthy untrained adults. other studies do not support the view on ginseng as supplementation increases physical work capacity.. reported that acute p. ginseng supplementation does not affect the endurance of running performance of the heat - adapted male recreational runners in the heat. morris. found that 1week administration of two different doses of ginseng does not show better effect on any of the physiological indices under investigation (oxygen, free fatty acids, lactate, and glucose) than placebo in a placebo - controlled, cross - over study. allen. reported, in a randomized double - blind, placebo - controlled study involving 28 healthy young adults, that the administration of 200 mg ginseng extract for 21 d did not significantly affect heart rate or perceived exertion at 150 and 200 w ergometric exercise and claimed that it did not affect vo2, exercise time, workload, plasma lactate, or hematocrit at peak levels of exercise. did not establish any increasing of physical work capacity after its course administration in a many - years series of ergogenic properties of g115. thus, engels and wirth failed to demonstrate any effect of 8-weeks administration of ginseng on o2 consumption, respiratory exchange ratio, minute ventilation, blood lactic acid levels, heart rate, or perceived effort in a randomized double blind placebo - controlled g115 trial involving 36 healthy men. engels. found no effect of 400 mg / d g115 for 8 wk on supramaximal exercise performance and postexercise heart rate in 19 healthy women. engels. failed to demonstrate improvement of physical performance and heart rate recovery of individuals undergoing repeated bouts of exhausting exercise of 8-weeks administration of ginseng (g115, 400 mg / d) in a double - blind, placebo - controlled, randomized study involving 38 active healthy women. morris. found that no influence of short (7 d) administration of p. quinquefolius water - ethanol extract (8 or 16 mg / kg / d) on cycle time to exhaustion and physiologic responses for loads in healthy people. direct increasing of physical work capacity after acute or course administration (actoprotective properties) should be separated from increasing of recovery speed after previous physical or other heavy loads for the convenience of administration of ergogenic aids in practice of sport preparedness as well as for pharmacological study of their mechanism of action. the property of increasing of recovery speed after previous physical or other heavy loads can be defined as drugs and dietary supplements with antifatigue properties are very important in some types of sports with demand for repeated performance after short intervals (academic rowing, kayak and canoe paddling, different styles of wrestling, etc.). positive influence of p. ginseng on parameters of recovery after exhaustive physical loads has been proved by numerous animal experiments since the 1970 s. the first article published in 1974 studied the effects of extracts obtained from p. ginseng root (50 - 200 mg / kg intraperitoneal, immediately following the exercise) on recovery from exhaustion (four hour oscillation movements) using six methods : exploratory movement (em), hole cross (hc), rotating rod (rr), sliding angle (sa), spring balance (sb) and rectal temperature (rt) tests. water extract significantly accelerated the recovery after em, increased motor activity index in em test, and elevated rectal temperature. however, water extract decreased the index in hc test and grip tone in sb test. lipophilic fraction significantly sped up the recovery from fatigue in em, rr, rt, and sb tests while delaying recovery in hc and sa tests. later, banerjee and izquierdo studied antistress and antifatigue properties of p. ginseng preparation on swiss albino mice which were exposed to various experimental models of stress in comparison with piracetam. both ginseng and piracetam were administered chronically in drinking water for 16 to 18 d as well as acutely 30 to 60 min prior to the experiments by injection. reactivity of the mice, loss of body weight, amount of feces, length of endurance, and incidence of mortality were graded and measured. both piracetam and ginseng treatment provided good protection against electroshock stress when compared to untreated mice. fighting scores, incidence of tonic convulsion, and mortality were significantly less in the treated groups. in the heat stress experiments, both piracetam and ginseng provided significant protection to the heat - exposed mice. in the fatigue stress of forced swim test, ginseng treatment was provided to be effective on adaptation to fatigue and ginseng also increased the endurance in both male and female mice. piracetam, on the other hand, only showed some antifatigue effects in the male mice. in the locomotor activity tests, ginseng did not depress motility, while piracetam did as described in the later part of the tests. from human studies on healthy people and clinical studies on patients who suffered from fatigue, the antifatigue property of p. ginseng preparations can be confirmed. (cited in) reported that administration of ginseng extract during 12-weeks improves postexercise recovery. later, postexercise recovery under ginseng administration was confirmed by ng and ng (cited in), mcnaughton. evaluated the effect of the traditional chinese medicine tongxinluo and ginseng which had a good effect on the excess fatigue rats using metabolomics approach. a metabolomics study was performed on the excess fatigue rats treated with traditional tongxinluo or ginseng based on ultra - fast liquid chromatography coupled with ion trap - time of flight mass spectrometry. the plasma metabolic profiling data of the control rats, excess fatigue rats, and excess fatigue rats treated with tongxinluo or ginseng were acquired. the orthogonal partial least squares analysis was applied for the multivariate statistics, leading to the discovery of important differential metabolites distinguishing the excess fatigue rats treated with tongxinluo or ginseng from the control rats and excess fatigue rats. the results showed that tryptophan, bile acid, and lysophosphatidylcholine metabolism were disturbed in the excess fatigue rats. the metabolic pattern including the related metabolic pathways of the rats, after being treated with tongxinluo or ginseng, was adjusted towards the normal state. clinical studies of p. ginseng administration in treatment of unexplained chronic fatigue of unknown etiology demonstrated as effective in 56% cases ; p. ginseng and p. quinquefolius preparations can be regarded also as perspective compounds to improve cancer - related fatigue. in the last 20 yr of scientific literature, has been widely discussed [67,97 - 101 ]. based on modern understanding of pharmacology terms and definitions, it seems logical to concretize this debate by dividing it into two questions : is p. ginseng an actoprotector and is p. ginseng an antifatigue supplementation ? such division has a principal character and needs separate explanation. analyses of data from properly controlled studies on p. ginseng preparations (table 1) allow us to make the preliminary conclusion that the controversies related to this study are connected with different doses, duration of courses being used in different studies, and physical condition of subjects who participated in these studies. enhancement of physical work capacity was only observed in studies when : 1) higher doses of ginseng supplementation (over 200 mg / kg / d of standardized extract) were used, 2) there were longer durations of study (not less than 8 wk), 3) had larger subjects number, indicating greater statistical power, and 4) subjects were in relatively poor physical condition. one of the explanations that ginseng supplementation has no positive influence on physical performance was made by ferrando.. in their experiments, the effects of the ginseng extract on various biochemical and hematological parameters in male wistar rats subjected to a treadmill exercise protocol were studied for 12 wk. the increase was the largest for the animals treated with the extract during the third month of the study. the exercise alone also led to the increase in these parameters, while the combination of both exercise and ginseng extract produced smaller increase. this study shows a clear physiological response due to the ginseng extract administration that reproduces many of the effects obtained after long - term exercise. authors made conclusion that the combination of exercise and treatments seems to support the theory that there is no clear synergic effect when compared with the performance of exercise. in other work, the same authors established that treatment with p. ginseng increases the capillary density and the mitochondrial content of the red gastrocnemius muscle of rats. the results suggest that prolonged treatment with p. ginseng increases the capillary density and the oxidative capacity of the muscles with greater aerobic potential in a manner similar to the performance of physical exercise. this explanation can be accepted as one possibility, but it generally can not be a foundation for the conclusion that any effects of physical training and ginseng supplementation may be obtained separately but not when combined. the facts mentioned above allow us to conclude that p. ginseng (and other plants from genus panax, possibly) can be regarded as a potential actoprotector and antifatigue preparation with further research of its influence on physical work capacity, endurance and restoration after exhaustive physical loads in comparing with reference actoprotector bemitil. possible biochemical mechanisms for increasing the endurance after ginseng administration are connected with its influence on 1) carbohydrate and fat metabolism [57,63,104 - 106 ], 2) immune and endocrine mechanisms, and 3) regulation of oxidative balance [106 - 111 ]. it seems possible, that in realization of the actoprotective and antifatigue properties of ginseng preparations, saponins are not the only components that have big importance. wang. established that ginseng polysaccharides have anti - fatigue activity, reflecting in the effects on the physiological markers for fatigue. it seems logical that such controversies are connected with different doses, duration of courses used in different studies, as well as with administration of different quality and composition of ginseng supplements. such a conclusion also allows ginseng to be regarded as potential actoprotector and allows for further research on its influence on physical work capacity, endurance and restoration after exhaustive physical loads in being compared to reference actoprotector, bemitil. numerous animal experiments and clinical studies about the influence of ginseng preparations (mainly preparations from p. ginseng) on cognitive functions show less controversial results compared to studies connected with exercise performance. several of them show memory improvement after ginseng administration. various memory - impairment models (aged animals, scopolamine - induced memory deficit, ethanol - induced memory deficit, electroconvulsive shock - induced memory disturbances, muscarinic - induced memory deficit, dopamine - induced memory deficit, brain ischemia, cerebral infarct, sham or medial prefrontal cortex lesions, reserpine - induced orofacial dyskinesia, beta - amyloid - induced amnesia model, etc.) have been used to evaluate the effects of ginseng and its active ingredients on a person s learning and memory. results of experimental studies on normal animals and on mentioned above animal models are summarized in table 2. results of animal experiments with separated ginsenosides and preparations of plants from genus panax on cognitive functions #, data not listed or unavailable ; i.p., intraperitoneal ; p.o., per os ; wsf, water - soluble fractions ; lsf, lipid - soluble fractions ; pd, protopanaxadiol ; pt, protopanaxatriol ; pnb, p. notoginseng burk ; bdnf, brain derivative neurotrophic factor ; pns, p. notoginseng saponins ; samp8, senescence accelerated mouse prone 8. in most studies, independent of experimental model used, course administration of p. ginseng preparations had as a final result with significant antiamnaestic effect. in addition, positive results for cognitive functions enhancement were received from preparations of p. quinquefolium, p. notoginseng and p. pseudoginseng. however, for example, saito. found that extracts of ginseng inhibits conditioned avoidance response and discrimination behavior on pole climbing and shuttle box tests. similarly, petkov and mosharrof found that high doses of g115 impaired, rather than improved, conditioned reflex activity, and takagi. and takagi. demonstrated decreasing exploratory activity and a specific blocking action of conditioned responses following the administration of a crude ginsenoside fraction. some experiments were provided with isolated components of ginseng preparations, first with ginsenosides rg1 and rb1. in passive avoidance test, rg1 improved learning and memory acquisition, consolidation, and retrieval, indicating that rg1 can improve all stages of memory. later, to study the effect of rg1 on one s learning and memory loss induced by -amyloid, passive avoidance and performance in the morris water maze were assayed after the final treatment. ginsenoside rg1 significantly decreased the latency and swimming distance, improved corresponding changes in search strategies in the morris water maze, and increased the step - through latency. in other studies, rg1 significantly improved memory deficits in aged rats, ovariectomized rats, and cerebral ischemia - reperfusion rats (qiu. these results showed that ginseng extract and ginsenosides rg1 and rb1 facilitated acquisition and retrieval of memory. moreover, ginsenosides rb1 and rg1 also antagonized memory loss and cognitive deficit under various pathological conditions, such as cerebral ischemia and dementia (qiu., cited in). at the same time, other ginsenosides like rg3(s), rg5/rk1, and rh2 and even nonsapongin fraction of red ginseng also have antiamnaestic properties and may have some importance on prevention of memory impairment or treatment of memory disorders. results of most human studies, connected with evaluation of influence of ginseng supplementation on cognitive functions, are summarized in table 3. some of these studies show positive effects of ginseng preparations even at acute [148 - 150 ] or short course administration. poor standardization of different preparations unfortunately does not allow for the comparing of results from different studies. in this connection, it is necessary to put attention on row of studies provided with g115 [152 - 160 ]. effects of acute administration of g115 on cognition in young healthy individuals were evaluated in randomized double blind placebo - controlled studies [152,156 - 158 ] where ginseng differentially improved scores on a secondary memory factor (a composite of four memory tasks). in the first study, secondary memory was found following 400 mg at four post - dose testing sessions while the lower and higher dosage reduced performance on the speed of attention factor. secondary memory. a later study assessed the effects of 200 and 400 mg ginseng during sustained cognitive demand - repeated cycles of serial threes, serial sevens, and the bakan rapid visual information processing (rvip) task. serial sevens performance was improved by the 200 mg dose. in a follow - up study, it appears that p. ginseng or its constituents are capable of producing tangible cognitive enhancing effects and that 200 to 400 mg appears to be the optimal dose range for young healthy adults when administered acutely prior to a cognitive test. course administration of ginseng preparations in most studies also showed positive effect on cognitive functions (table 3). results of human studies with plants from genus panax on neurocognitive function (adapted with modifications from) #, data not listed or unavailable ; co, crossover ; db, double - blind ; dmae, dimethylaminoethanol ; f, female ; fsh, follicle stimulating hormone ; grs, ginseng - rhizome saponin ; lh, luteinizing hormone ; m, male ; nc, not controlled ; panas, positive and negative affect schedule ; pc, placebo - controlled ; poms, profile of mood survey ; r, randomized ; rer, respiratory exchange ratio ; rpe, ratings of perceived exertion ; sb, single - blind ; ve, expiratory ventilation. detail analyses of mechanisms to determine underlying the positive impact on cognition under ginseng administration is out of the focus of this article. they are already described in numerous review articles published in recent literature [146,156,171 - 180 ]. it is necessary to subscribe that among these mechanisms is the capacity of ginsenosides to potentiate the cholinergic system in central nervous system. other important neurotransmitters for learning, memory, and cognitive functions involved in mechanism action of ginsenosides are glutamate and 5-ht. similar to studies connected with physical performance, it seems logical that such inconsistencies in the results of different studies are connected with different doses, duration of courses used in different studies, as well as with administration of different quality and composition ginseng supplements. despite that, most studies show positive influences of ginseng supplementation on intellectual work capacity in normal subjects and those of decreased cognitive functions. such conclusion also allows ginseng to be regarded as potential actoprotector and opens the way for further research of its influence on mental work capacity and cognitive functions in comparing with reference actoprotector, bemitil, and reference nootropic drug, piracetam. related to the capacity of many plant adaptogens to increase physical and mental performance, the question that arose about actoprotectors class including not just only synthesized but also natural origin compounds has importance for fundamental theory of pharmacological science and practical administration of many phytochemicals. the ginsenosides content in ginseng preparations can vary depending on the species, the age and part of the plant, the preservation method, the season of harvest, and the extraction method. in this connection, poor standardization can cause some difficulties in the evaluation of data received from animal experiments and human studies about the pharmacological activity of adaptogens including ginseng. despite these difficulties, large quantities of data received from animal experiments and human studies allow for making some preliminary conclusions about potential actoprotective properties of ginseng preparations : 1) results of some animal experiments and human studies attest that p. ginseng (administered as extract) can significantly increase physical and intellectual work capacity and the data allow ginseng to be referred as an actoprotector of natural origin ; 2) results related to the influence of ginseng on physical performance are more controversial than those connected with its influence on intellectual work capacity ; and 3) ginseng preparations can be regarded as potential actoprotectors and allow for further research of its influence on physical and mental work capacity, endurance, and restoration after exhaustive physical loads in comparing with reference actoprotectors (bemitil) and nootropic drugs (piracetam). pharmacological activity of preparations received from different species from genus panax should be evaluated separately, but extract preparation should be standardized. comparison of ginseng preparations with preparations of other adaptogenic herbs will allow the decision of the most effective herbal actoprotectors. composition based on additive effects of herbal actoprotectors and synthesized ones can become the more useful in clinical and preventive medicine. | actoprotectors are preparations that increase the mental performance and enhance body stability against physical loads without increasing oxygen consumption. actoprotectors are regarded as a subclass of adaptogens that hold a significant capacity to increase physical performance. the focus of this article is studying adaptogen herbs of genus panax (p. ginseng in particular) and their capabilities as actoprotectors. some animal experiments and human studies about actoprotective properties of genus panax attest that p. ginseng (administered as an extract) significantly increased the physical and intellectual work capacities, and the data provided suggests that ginseng is a natural source of actoprotectors. preparations of ginseng can be regarded as potential actoprotectors which give way to further research of its influence on physical and mental work capacity, endurance and restoration after exhaustive physical loads while compared with reference actoprotectors. |
bacterial infection in newborns, especially preterm, may rapidly evolve into generalized sepsis. this condition has a gradual and subtle onset, with nonspecific symptoms that may severely compromise the infant s clinical state if untreated and lead to life - threatening consequences. neonatal sepsis has a fairly low incidence at birth (110/1000 live births) but may affect up to 16% of infants in the neonatal intensive care unit (nicu) with birth weight of 5011500 clinical manifestations are nonspecific and laboratory parameters such as white blood cell (wbc) count or c - reactive protein (crp) are of limited value in identifying infected newborns. as a consequence, appropriate diagnosis and therapy could be delayed, worsening the prognosis of the patient [26 ]. in studies elsewhere, even the combination of total neutrophil count, immature - to - total neutrophil ratio (i / t), and platelet count failed to reach an appropriate sensitivity and specifity in this pathology. c - reactive protein has been thoroughly studied as a diagnostic tool in neonatal sepsis and also as an indicator of response to therapy [9, 10 ]. the underdeveloped immune system predisposes preterm newborns to infection, which is a major cause of neonatal morbidity and mortality. sepsis and endotoxin activate monocytes, macrophages, lymphocytes, fibroblasts, and endothelial cells that produce and secrete il-1, tnf-, -interferon, il-6, il-8, and other proinflammatory cytokines. il-6, stimulated by tnf-, il-1, and endotoxin of viral and bacterial infections, acts as a t - cell activation indicator, induces antibody secretion by human b - cells, causes differentiation of cytotoxic t - cells, and also has the ability to inhibit tnf- production. moreover, il-6 is the major stimulant in hepatic protein synthesis, that is, crp and fibrinogen during acute phase responses. previous studies have shown that determinations of il-6 in neonatal blood are of diagnostic value in sepsis. elevated serum il-1, il-6, il-8, and tnf- levels have been found in both the neonatal and adult sepsis. several studies have evaluated the role of cytokine determinations as early diagnostic markers in neonatal sepsis [1117 ]. the aim of this study is to determine serum il-1, il-6, il-8, and tnf- levels in neonatal sepsis at the time of diagnosis and after therapy and to show the meaningful on the follow up. this prospective study was performed on newborns who were hospitalized for neonatal sepsis at nicu. inclusion criteria were positive clinical signs of sepsis and/or history of factors associated with increased risk for infection and parental informed consent. exclusion criteria were congenital malformations, congenital infections associated with the torch complex, and refusal of parental consent. clinical signs of sepsis were defined as the presence of three or more of the following categories of clinical signs : apnea, tachypnea (> 60/min), nasalflaring, retraction, cyanosis, respiratory distress - bradycardia (180/min), hypotonia, seizures - poor skin colour, capillary refilling time longer than two seconds, irritability, and lethargy. historical factors associated with increased risk for infection included premature rupture of the membranes (in term infants > 18 hours), maternal fever during labour, intraamniotic infection, and chorioamnionitis. two or more abnormal values of the sepsis screen (as white blood cell count 10.000 mm, immature - to - total neutrophil ratio higher than 0.2 and crp positivity) were considered as supportive for diagnosis of infection. newborns were classified as culture - proven sepsis (positive blood culture), as culture - negative sepsis (negative blood culture, but clinical signs of sepsis with positive sepsis screen and/or a history of risk factors, and antibiotic treatment longer than 7 days), and as control groups (healthy, noninfectious newborns). blood samples were obtained at time of diagnosis and seventh day after antibiotic treatment, their serum extracted and il-1, il-6, il-8, and tnf- were determined. blood analysis was done in firat medical center immunology laboratory (elazig, turkey). crp was determined by the behring nephelometer 100 analyzer bn ii (ny, usa). mg / l and a serum value of > 8 mg / l was defined as abnormally elevated. the serum samples of the study and control groups were studied by elisa for il-1, il-6, il-8, and tnf- levels with human cytokine kits (biosource, calif, usa). detection limit for serum il-1 level was 1 pg / ml, measure range was 0250 pg / ml. detection limit for serum il-6 level was 2 pg / ml, measure range was 0500 pg / ml. detection limit for serum il-8 level was 5 pg / ml, measure range was 01000 pg / ml. detection limit for serum tnf- level was 1.7 pg / ml, measure range was 01000 pg / ml the collected blood samples were centrifuged at 2500 g for 10 minutes at 4c. the serum layer was separated and frozen at 80c for cytokine analysis, which was performed in less than 2 weeks. kruskal wallis and post hoc test scheffe procedures were used ; the difference in three groups and p<.05 was considered to be significant. wilcoxon test was used for the interpretation of the difference between at time of diagnosis and after therapy. in total, 50 newborns were included in the study : 12 culture - proven sepsis, 21 culture - negative sepsis, and 17 control. table 1 shows the characteristics of the study group. at time of diagnosis, serum il-1, il-6, il-8, and tnf- levels of culture - proven sepsis were significantly higher than those of the control groups (p<.05) ; but only serum il-8 levels of culture - proven sepsis was significantly higher than culture - negative sepsis (p<.05). at time of diagnosis, serum il-1, il-6, il-8, and tnf- levels of culture - proven sepsis and culture - negative sepsis were significantly higher than levels at seventh day after antibiotic treatment (p<.05). serum il-1, il-6, il-8, and tnf- levels were showed in table 2. bacterial infection continues to be the major cause of morbidity and mortality in the newborn. because the prognosis for sepsis largely depends on early identification and treatment, these newborns are subjected to extensive diagnostic evaluation and empirical systemic antibiotic treatment, pending laboratory results. the definitive diagnosis of sepsis is made by a positive blood culture, which requires a minimum of 4872 hours, yields a positive result in only 3070% of cases, and may not always be available in peripheral health centers. there is, however, a lack of consensus on the essential tests that would identify newborns with acute infection. conducted a systematic review to determine the value of diagnostic tests for bacterial infection in early life (from birth to 90 days old) and reported that the accuracy of tests varies enormously and the tests are of limited value in the diagnosis of infection. the possible sources of heterogeneity were population, age, whether the subjects were at term or preterm, methodological quality, different leukocyte indices, different cutoff values, and interpretation of test results by different laboratory observers. in the past few decades, it has been observed that several mediators of inflammation tend to become elevated during sepsis. the concentrations of some proinflammatory cytokines, especially tnf-, il-6, and il-8, in systemic circulation were reported to increase in severe infections and septic shock.. showed that serum il-6, il-8, and tnf- levels were all higher in septic than in nonseptic newborns. the study of il-1 and tnf-, cytokines that are synthesized at the beginning of the inflammatory cascade has rendered differing results. in our study, the serum tnf- and il-1 levels were significantly increased in newborns with sepsis. results of different published studies relation to these cytokines are contradictory. concerning il-1 results, similar to ours, they have been reported by some researchers while not by others [2528 ]. some studies found the diagnostic utility of this cytokine [25, 26 ] while others demonstrated similar or even lower levels in infected newborns compared to healthy newborns [29, 30 ]. discrepancies in results among different studies could be explained by the variations in laboratory methods in performing the analysis, the time of the sample collection, or the control population selected. interleukin-6 has been reported as an early indicator of neonatal sepsis because of its rapid increase after endotoxin challenge. previous studies have shown il-6 to be a useful marker of early infection in the newborn [3134 ].. showed that septic preterm newborns had significantly elevated il-6 levels at the onset of sepsis as compared to the recovery period and the controls. in our study, it was observed that il-6 levels of newborn with culture - proven sepsis and culture - negative sepsis were significantly higher than controls (p<.05). interleukin-8 is a cytokine that has a role in the release, activation, and chemotaxis of neutrophils. serum il-8 level has been reported to increase in neonatal sepsis and have a sensitivity of about 8090% and a specifity of about 76100% [35, 36 ]. in this study, it was detected that il-8 levels of newborns with culture - proven sepsis were significantly higher than culture - negative sepsis and controls (p<.05). another characteristic of the markers that are used in the diagnosis of neonatal sepsis is that it gives information about the prognosis of the disease and helps in coming to a decision as to whether to stop or continue antibiotic treatment. in this study, it is found that il-1, il-6, il-8, and tnf- levels were statistically decreased in newborns after seven - day therapy than in newborns at the time of diagnosis (p<.05). serum levels of il-1, il-6, il-8, and tnf- are mediators of inflammation and can be used at the diagnosis and at the evaluation of the therapeutic efficiency in neonatal sepsis. | aim. to determine serum il-1, il-6, il-8, and tnf- levels in neonatal sepsis at the time of diagnosis and after therapy, and to show the meaningful on the follow up. methods. this prospective study was performed on newborns who were hospitalized for neonatal sepsis and who were classified as culture - proven sepsis (n=12), as culture - negative sepsis (n=21), and as healthy newborns (n=17). results. at the time of diagnosis, serum il-1, il-6, il-8, and tnf- levels of culture - proven sepsis were significantly higher than those of the control groups (p<.05). at the time of diagnosis, il-1, il-6, il-8, and tnf- levels of culture - proven sepsis and culture - negative sepsis were significantly higher than levels at the seventh day after antibiotic treatment. conclusion. serum il-1, il-6, il-8, and tnf- are mediators of inflammation and can be used at the diagnosis and at the evaluation of the therapeutic efficiency in neonatal sepsis. |
the physical and mechanical properties of photo - cured composites are directly influenced by the level of conversion attained during polymerization. the degree of conversion (dc) is determined by the proportion of the remaining concentration of the aliphatic c = c double bonds in a cured sample relative to the total number of c = c bonds in the uncured material. typical composites used in dental restorative applications are composed of at least two dimethacrylate monomers. the cured composites based on monomers with high molecular weight, as the bis - gma or uedma, exhibit a considerable number of remaining double bonds3,13. the limited conversion found in many network polymers is due to restricted mobility of radical chain ends, pendant methacrylate and monomer imposed at high crosslink density5. in general, the photoactivated dental composites reach a dc ranging from 43 to 75%, basically depending on the composite composition, irradiation intensity and exposure time5,11. techniques such as fourier transform infrared (ftir) spectroscopy3,13,14, raman4,12, epr15 (electron paramagnetic resonance), nmr9 (nuclear magnetic resonance), dsc1 (differential scanning calorimetry) and dta6,8 (differential thermal analysis) have been used to determine the dc. among these the use of ftir spectroscopy requires certain precautions during sample preparation and method performance in order to obtain appropriate spectral data that will provide an accurate determination of the conversion degree. therefore, this paper presents the foundations and experimental details that can aid researchers interested in using this technique with ultimate outcomes. ftir spectroscopy is a widely used technique for investigating materials in the gaseous, liquid or solid phase. it is based on the interaction between electromagnetic radiation and natural vibrations of the chemical bonds among atoms that compose the matter. not all possible vibrations within a molecule will result in an absorption band in the infrared (ir) region. for a material to absorb radiation in the infrared region, two conditions should be fulfilled : (1) there must be coincidence (resonance) among the frequencies of the infrared radiation and molecular vibration ; (2) the natural vibration must cause change in the dipole moment during vibration. the vibration frequencies of a chemical bond depend on the stiffness of this bond (characterized by a proportionality constant termed the force constant) and the masses of the atoms at each end of the bond. there are two types of molecular vibrations : one that changes the bond length (stretching) and other that changes the bond angle (bending). the position of absorption bands in the spectra are presented as wavelength (), either as meters or sub - multiples of a meter. in the infrared region, the commonly used unit is the wavenumber (v), which is expressed in cm-, because it is directly proportional to energy (e) and frequency (v) of radiation, according to the equation : where h is the planck 's constant and c is the speed of light in vacuum. transmittance (t) is defined as the ratio between intensities of the transmitted (i) and incident (i o) beams. on the other hand, absorbance (a) is the logarithm (base 10) of the reciprocal of the transmittance : the transmitted radiant energy depends on the thickness (x) and absorption coefficient () of the sample, according to the equation : infrared is often divided into three spectral regions, i.e., the near (nir from 4,000 to approximately 14,000 cm-), mid (mir from 400 to 4,000 cm-) and far - infrared (fir from approximately 25 to 400 cm-). in the contemporary spectrometers, it is possible to work in these three spectral regions, thus it is necessary to change some of their optical components in order to shift to another spectral region. the main components of a contemporary spectrometer are : ir source, michelson interferometer and ir detector. the more stable source of radiation, emitting in the three ir regions is the ever - glo ceramic. by using the appropriate beamsplitter (interferometer component) and ir detector in combination with this source, it is possible to provide energy for the spectral range from 7,400 to 50 cm-. the michelson interferometer basically consists of two perpendicular plane mirrors (one fixed and the other movable) and a beamsplitter. the function of an interferometer is to split a beam of light into two beams and to introduce an optical path difference between them. as a consequence, the path difference creates the condition for that interference to take place when the beams recombine at the beamsplitter. the intensity variations of the beam emerging from the interferometer are monitored as a function of path difference by the detector. the fourier transform is the mathematic tool used to convert the interferogram into a spectrum, which is done by a computer. to obtain a spectrum, one must first record a background (bg) spectrum, which contains the absorptions of molecules present in the air. dividing the sample spectrum by the background spectrum removes all absorptions contained in the bg so that the absorption peaks in the final spectrum are due solely to the sample. when a sample absorbs some of the infrared radiation, the intensity of the transmitted and reflected radiation is reduced. regardless of the spectral region one is working on, the spectra can be obtained by transmission or reflection method. the transmission method is the oldest and most commonly used currently. in this arrangement, the detector measures the intensity of the infrared radiation passing through the sample (transmitted radiation). in the reflection method in current days, there are different reflectance methods, such as the attenuated total reflectance (atr), diffuse and specular reflectance. for each method there are different forms to prepare the sample to be analyzed by the transmission method. the choice for a method strongly depends on the nature of the sample to be analyzed. for example, for solid samples, mixing a small amount of sample with a dry potassium bromide (kbr) powder is usually necessary. independently of the cell to be used, the window material must be transparent for the incident infrared radiation. to determine dc in composites based on methacrylates, two spectral infrared regions can be used ; nir or mir. in the mir region, dc is determined by measuring the intensity (or area) decrease of the methacrylate (c = c) stretch absorption band at 1,638 cm- as the methacrylate monomer is converted to polymer. in the nir region, there are two aliphatic bands that can be used, one at 6,165 cm- (overtone = ch2) and the other at 4,743 cm- (combination of = ch2 bands). regardless of the spectral region to be used, determination of dc is facilitated when the material presents a stable absorption band, whose intensity is unaltered during polymerization process. generally, composites based on methacrylate monomers present aromatic bands at 1,583, 1,608, and 4,623 cm-, which can be used as internal standards14. the band at 4,623 cm- is usually not recommended because, depending on resin composition, it can to undergo slight variation in its intensity14, introducing error in the dc determination. therefore, it is important to always verify the stability of this band before using it. in the absence of an isolated stable band, a calibration curve for c = c concentration of monomer that composes the percentage of unreacted aliphatic c = c bonds remaining throughout the polymerization reaction is obtained by the equation : where abs can be the height or the area of absorption band. dc is determined by subtracting the residual percentage of aliphatic c = c from 100% (dc%=100-(%c = c)). the mir or nir spectral region should be used with caution to evaluate the quantity of remaining double bonds. in the mir, the region where the c = c aromatic and aliphatic absorptions are located lies embedded in the water region (figure 1b). thus, any difference in water vapor concentration between background and sample spectra may raise deformations in the final spectrum (figure 2). figure 2 distinctly illustrates the deformations caused in the spectrum, mainly in the band peak at 1,638 cm- (vertical arrow). to solve this problem, the spectrometer should be purged with inert gas (dry nitrogen is recommended). figures 3 and 4 show absorption spectra of tph composite (table 1) in the mir and nir region, respectively. here, the aliphatic and aromatic absorption bands are highlighted, before and after the polymerization, which are used to evaluate dc. it can be observed that the intensities of the bands used as internal standard do not change during the polymerization process. depending on the dental composite it is not always possible to localize a stable band to use as internal standard. for example, in the nir and mir spectra of the acron mc and classic composites (information in table 1) it was not possible to localize a stable and resolved band that could be used as internal standard. these resins are composed of two parts, with one of them in powder (polymer) form and the other one liquid (monomer). for these two composites and other methacrylate - based resins, one can use the method developed by loshaek and fox7 (1953), which was verified by rueggeberg10 (1994) and bartoloni,.2 (2000). this method is based on the assumption that the methacrylate group (h2c = c(ch3)c = o) can be used as a gravimetric form of concentration measurements. the ir absorption peak height for the aliphatic c = c group divided by the product of the path length and the weight percent methacrylate group monomer conversion degree is expressed as a change in weight percent of the methacrylate groups (wpmg) remaining after polymerization, when compared to the amount found prior to curing. rueggeberg10 (1994) worked with different methacrylate - based resins and obtained a mean k value equal to 0.64. the calibration curve is obtained by diluting the monomer of composite in spectrophotometric grade hexane in different concentrations. the curve establishes the relationship between ir absorption peak height and c = c concentration (moles c = c / ml). the number of moles of c = c per milliliter of each standard solution is determined by dividing the number of moles of methacrylate units present in the undiluted monomer volume by the volume of the solution (in ml). the number of moles of methacrylate units (= number of moles of c = c) is obtained by dividing the undiluted monomer mass by the molecular weight of a methacrylate unit (69,081). as an example, for acron mc composite four different dilutions were prepared and the nir infrared spectra were obtained using a transmission micro - liquid cell with kbr windows at a path length of 0.528 mm. the spectra (figure 5) were obtained from 64 scans at a resolution of 4 cm- on a ftir spectrometer (nexus 670 of nicolet). the spectral region used was from 6,050 to 6,300 cm-, where the = ch2overtone band at 6,165 cm- is localized. the mathematical relationship between absorbance and c = c concentration is obtained from the calibration curve, which enables determining the c = c molar concentration in the undiluted monomer. figure 6 shows, as an example, the calibration curve obtained for acron mc composite. with the curve, it is now possible to study the dc of composites, which is defined as follows : where wpmgcur and wpmguncur are weight percentage of methacrylate groups in cured and uncured composite, respectively. to determine wpmgunc, a spectrum of undiluted monomer should be obtained. however, in order to use the calibration curve it is necessary to perform the measurement using the liquid cell with the same path length as the one used to build the curve. the c = c concentration (moles c = c / ml) present in the undiluted monomer is determined from the mathematical relationship. therefore, wpmgunc is calculated by multiplying the c = c molar concentration by the molecular weight of a methacrylate unit (69,081) and dividing the result by the monomer density (g / ml). wpmgcur is determined from ir spectrum of cured resin film. for acron mc composite, 0.5 mm - thick samples are sufficient to obtain a good spectrum in the nir region. from the spectrum, dividing this value by the product between sample thickness and k (0.64), one can obtain wpmgcur. for composites having internal standard, the percentage of unreacted aliphatic c = c bonds remaining throughout the polymerization reaction is obtained by the equation : where abs can be the height or the area of absorption band. dc is determined by subtracting the residual percentage of aliphatic c = c from 100% (dc%=100-(%c = c)). the mir or nir spectral region should be used with caution to evaluate the quantity of remaining double bonds. in the mir, the region where the c = c aromatic and aliphatic absorptions are located lies embedded in the water region (figure 1b). thus, any difference in water vapor concentration between background and sample spectra may raise deformations in the final spectrum (figure 2). figure 2 distinctly illustrates the deformations caused in the spectrum, mainly in the band peak at 1,638 cm- (vertical arrow). to solve this problem, the spectrometer should be purged with inert gas (dry nitrogen is recommended). figures 3 and 4 show absorption spectra of tph composite (table 1) in the mir and nir region, respectively. here, the aliphatic and aromatic absorption bands are highlighted, before and after the polymerization, which are used to evaluate dc. it can be observed that the intensities of the bands used as internal standard do not change during the polymerization process. depending on the dental composite it is not always possible to localize a stable band to use as internal standard. for example, in the nir and mir spectra of the acron mc and classic composites (information in table 1) it was not possible to localize a stable and resolved band that could be used as internal standard. in such cases, it is necessary to build a calibration curve. these resins are composed of two parts, with one of them in powder (polymer) form and the other one liquid (monomer). for these two composites and other methacrylate - based resins, one can use the method developed by loshaek and fox7 (1953), which was verified by rueggeberg10 (1994) and bartoloni,.2 (2000). this method is based on the assumption that the methacrylate group (h2c = c(ch3)c = o) can be used as a gravimetric form of concentration measurements. the ir absorption peak height for the aliphatic c = c group divided by the product of the path length and the weight percent methacrylate group can be considered as an optical constant (k). monomer conversion degree is expressed as a change in weight percent of the methacrylate groups (wpmg) remaining after polymerization, when compared to the amount found prior to curing. rueggeberg10 (1994) worked with different methacrylate - based resins and obtained a mean k value equal to 0.64. the calibration curve is obtained by diluting the monomer of composite in spectrophotometric grade hexane in different concentrations. the curve establishes the relationship between ir absorption peak height and c = c concentration (moles c = c / ml). the number of moles of c = c per milliliter of each standard solution is determined by dividing the number of moles of methacrylate units present in the undiluted monomer volume by the volume of the solution (in ml). the number of moles of methacrylate units (= number of moles of c = c) is obtained by dividing the undiluted monomer mass by the molecular weight of a methacrylate unit (69,081). as an example, for acron mc composite four different dilutions were prepared and the nir infrared spectra were obtained using a transmission micro - liquid cell with kbr windows at a path length of 0.528 mm. the spectra (figure 5) were obtained from 64 scans at a resolution of 4 cm- on a ftir spectrometer (nexus 670 of nicolet). the spectral region used was from 6,050 to 6,300 cm-, where the = ch2overtone band at 6,165 cm- is localized. the mathematical relationship between absorbance and c = c concentration is obtained from the calibration curve, which enables determining the c = c molar concentration in the undiluted monomer. figure 6 shows, as an example, the calibration curve obtained for acron mc composite. with the curve, it is now possible to study the dc of composites, which is defined as follows : where wpmgcur and wpmguncur are weight percentage of methacrylate groups in cured and uncured composite, respectively. to determine wpmgunc, a spectrum of undiluted monomer should be obtained. however, in order to use the calibration curve it is necessary to perform the measurement using the liquid cell with the same path length as the one used to build the curve. the c = c concentration (moles c = c / ml) present in the undiluted monomer is determined from the mathematical relationship. therefore, wpmgunc is calculated by multiplying the c = c molar concentration by the molecular weight of a methacrylate unit (69,081) and dividing the result by the monomer density (g / ml). wpmgcur is determined from ir spectrum of cured resin film. for acron mc composite, 0.5 mm - thick samples are sufficient to obtain a good spectrum in the nir region. from the spectrum, dividing this value by the product between sample thickness and k (0.64), one can obtain wpmgcur. although ir spectroscopy is a widely utilized technique, scrutiny is mandatory when choosing the best methodology to obtain the spectra that will enable a reliable quantitative analysis. the study of conversion degree in dental composites by ftir technique provides a better understanding of these materials, which is expected to optimize the polymerization process. | infrared spectroscopy is one of the most widely used techniques for measurement of conversion degree in dental composites. however, to obtain good quality spectra and quantitative analysis from spectral data, appropriate expertise and knowledge of the technique are mandatory. this paper presents important details to use infrared spectroscopy for determination of the conversion degree. |
nonsteroidal, plant - derived compounds that disrupt or mimic the normal action of estradiol are referred to as phytoestrogens. those that disrupt or mimic the action of testosterone or dihydrotestosterone are referred to as phytoandrogens. these chemicals influence endocrine activity in animals and have been shown to play a role in the prevention of certain hormone - dependent cancers, such as breast and prostate cancers. the american cancer society estimated that 218,890 men in usa would be diagnosed with prostate cancer during 2007. furthermore, they estimated that prostate cancer would kill 33,370 men in usa in 2007, making prostate cancer the fourth leading cause of cancer deaths in american men after lung cancer. at the same time, african americans have the highest incidence of prostate cancer and the highest mortality rate due to prostate cancer of any population studied. in asian men from china, japan, and thailand, the low incidence of prostate disease in eastern populations is attributed to dietary phytochemicals such as isoflavones, flavones, and lignans. epidemiological studies suggest that the reduced risk of prostate disease in asian populations is associated with consumption of foods rich in soy and vegetable products [57 ]. there is growing interest in using natural, dietary plant estrogens (phytoestrogens), particularly those found in soy products, as a potential chemopreventive regimen for prostate cancer. several clinical trials and biochemical studies have been conducted to ascertain whether diets containing high levels of phytoestrogens may provide a chemopreventive benefit for prostate cancer patients [3, 8 ]. studies analyzing urinary excretion and prostatic fluid for the presence of phytoestrogens demonstrated that phytoestrogen values were higher in populations exhibiting a lower prostate cancer incidence [9, 10 ]. a phytoestrogen - formulated diet reduces the number of spontaneous prostate - seminal vesicle tumors in rats predisposed to prostate tumors [11, 12 ]. in humans, prostate cancer patients who consumed high levels of phytoestrogens had lower levels of prostate - specific antigen, a common marker for prostate cancer [6, 13 ]. in addition, organ culture studies showed that the phytoestrogen genistein decreased growth of prostate cancer tissue and benign prostatic hypertrophy [1416 ]. taken together, these studies suggest that some constituent of phytoestrogen - containing diets possesses antiandrogenic and antitumorogenic activities, which could provide some beneficial effects in prostate cancer patients. biologically active, nonsteroidal, androgenic, and estrogenic agents are found primarily in soy products, legumes, and whole grains. kola acuminate, also known as obi or bizzy nut to the ettu people of jamaica, is a cure - all herbal medicine. it reportedly affects many biological processes, many of which are directly, or indirectly, modulated by hormones. available ethnobotanical information suggests that k. acuminate may contain bioactive chemicals that possess estrogenic and androgenic properties [18, 19 ]. anecdotal reports suggest that bizzy nut may be useful for a number of medical purposes, such as removal of poisons from the body, birth control, control of diabetes, weight loss, and relief of menstrual cramps [20, 21 ]. given the hormonal dependency of some of these biological activities, it is possible that nonsteroidal androgen present in bizzy nut extracts be responsible for the medicinal value attributed to it. recently, we identified several hormonally active extracts of bizzy nut that were capable of inhibiting the growth of different cancer cell lines. in our laboratory, we are interested in natural products such as bizzy nut, which contain phytoestrogens, phytoandrogens, or compounds that are antiandrogenic in nature. this article describes the putative androgenic effects of a bizzy nut extract on pathways mediated by an androgen receptor (ar) in lncap cells. herein, we describe the ability of a bizzy nut extract to induce apoptosis in an ar - positive cell line and to modulate ar - dependent gene expression. lncap and du145 cells were obtained from atcc (rockville, md, usa). cells were maintained in rpmi 1640 (lncap) or kaighn 's modification of ham 's f-12 (f12-k) medium supplemented with 10% fbs, 0.2 mm glutamine, 100 u / ml penicillin, and 100 mg / ml streptomycin. cells were kept in 5% co2 in a water - jacketed incubator, and were passaged using a trypsin / edta solution (sigma - aldrich, inc., st. lncap or du145 cells (1 10) were grown in poly - d - lysine - coated, 6-well, or 20 cm plates in cellgro serum - free medium (mediatech, inc., herndon, va, usa) for 24 hours, then induced with varying amounts of biz-2 (ether extract) or dihydrotestosterone (dht). for time - course studies of induction, cells were induced for 6, 12, and 24 hours with the appropriate compound after which the medium was collected and concentrated using a centrivap concentrator (labconco, kansas city, mo, usa). the corresponding attached cells were extracted using ripa buffer (pierce biotechnology, rockford, ill, usa), and stored at 80c until used. the ether extract of bizzy nut (biz-2) was prepared as previously described. for experiments involving cell growth and gene induction, lncap cells were grown for five days in rpmi 1640 medium containing 5% fbs that was stripped three times with dextran - coated charcoal. cells were plated in 96-well plates (1 10 cells / well) and allowed to attach overnight. the biz-2 extract in 0.1% dmso was added in a series of concentrations (01000 ppm) to a 96-well plate. as a control and a reference, 10 m genistein (ge) or 10 m dht was added to separate wells of each plate., the final concentration of vehicle solvent did not exceed 0.01% v / v in the medium. after 24-hour exposure to the test compounds, the effect on cell viability and gene expression was determined. cytotoxicity was determined by the celltiter 96 aqueous one solution cell proliferation assay (promega corporation, madison, wis, usa) according to the manufacturer 's instructions. after incubation with 3-(4,5-dimethyl-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2h - tetrazolium, inner salt (mts), absorbance at 490 nm was measured using an elx800uv universal microplate reader (bio - tek, inc., the cell viability was calculated as [(a490(control) a490(treatment))/a490(control) ] 100. for tryphan blue staining, cells were plated in 12-well plates (10 000 cells / well) and induced with 100 ppm biz-2 for 6, 12, or 18 hours. after induction, cells were harvested and stained with tryphan blue, and the number of cells was determined using a hemocytometer. total rna was obtained from cells treated with 01000 ppm biz-2 extract, 10 nm dht, or 100 nm ge in the presence or absence of 50-fold flutamide for 24 hours by lysing with 1 ml of tri reagent (invitrogen, carlsbad, calif. the rna pellet was resuspended in water, treated with rnase - free dnase i, reprecipitated, and quantified by reading the absorbance at 260 and 280 nm on an nd-1000 spectrophotometer (nanodrop tech., wilmington, del, usa). for cdna synthesis, 5 ug of dnase - i - treated total rna were reverse - transcribed in a 100 ul reaction mixture using the abi high capacity cdna archive kit according to the manufacturer 's instruction (applied biosystems, foster city, calif, usa). the reaction contained 1x rt buffer, 100 um of each deoxynucleoside triphosphate (dntp), 1x random primer, 5 u of rnase inhibitor, and 250 u of reverse transcriptase ii. the reaction was carried out at 25c for 10 minutes then at 37c for 2 hours. control reactions were those in which the rt enzyme or the target rna was omitted from the reaction. taqman pcr was performed on the cdna samples using an abi prism 7500 sequence detection system (applied biosystems). for each gene tested (see table 1), the pcr was carried out in a multiplex mode with every 25 ul reaction containing 2 ul of cdna reaction, 1x taqman universal pcr master mix, 250 nm of a gene - specific primer, 250 nm of an endogenous control primer, 250 nm of fam - labeled fluorogenic taqman probe, a vic - labeled 18s rrna fluorogenic control taqman probe, and 2.5 u of taqman enzyme. the pcr amplification was conducted using a taqman universal pcr master mix (applied biosystems) at universal thermal cycling conditions : 50c for 2 minutes, 95c for 10 minutes, 40 cycles at 95c for 15 seconds, and 60c for 1 minute. an increase in fluorescence was obtained at the annealing and extension step at 60c. the relative level of expression of each gene in the samples was determined using the relative 2 expression method as described in detail in the abi prism sequence detection system user bulletin 2. after the linear range of amplification (threshold cycle, ct) was determined for the genes of interest, it was normalized against an endogenous 18s rrna control and then against the untreated control sample, which served as the calibrator. the value of the relative level of expression for the gene of interest represents two independent inductions performed in triplicate. the binding affinity of biz-2 to the androgen receptor was evaluated on whole - cell, lncap extract or on 10 nm of the baculovirus - expressed ligand binding domain of the ar (panvara, madison, wis, usa) [24, 25 ]. samples (100 ul) containing 250 ug of total protein in 1x binding buffer (10 mm hepes, ph 7.9, 10% glycerol, 0.02% ficoll 400, 100 mm nacl, 0.1 mm edta, 2.5 mm for each of mgcl2, cacl2, and dtt, and 1 g / ml for each of leupeptin, pepstatin, antipain, aprotinin, soybean trypsin inhibitor, and chymostatin) were incubated with 2 nm [h]-r1881 in the presence or absence of a 10-fold serial dilution of 10 000 ppm biz-2, for 18 hours at 4c. the ic50 (the concentration of competitor that results in 50% of maximal binding) and ki (the competitor binding constant assuming 1 nm kd for radiolabeled ligand) were determined by fitting the data to the cheng - prusoff equation using the prism iii software program (graphpad, san diego, calif, usa). for microscopy, 5 10 cells (lncap or du145) were grown on microscope slides and induced with 0, 100, and 500 ppm of biz-2 for 24 hours. on each slide, cells were stained for 5 minutes with 5 l of a 0.1 ug / ul solution of acridine orange and ethidium bromide. two fluorescence parameters, green emission from acridine orange (525 nm) and red emission from ethidium bromide (620 nm), were examined under a fluorescence light microscope (nikon optiphot, melville, ny, usa) for the nuclear changes that are typically associated with apoptosis. an index of apoptosis was calculated as the ratio of the number of cells per microscopic field with early and late apoptosis characteristics in treated samples relative to the total number of cells per microscopic field. caspase 3/7 activity was determined using an apo - one homogeneous caspase-3/7 assay kit (promega corporation) according to the manufacturer 's instructions. briefly, cells were grown in test medium to a density of 1 10 cells / ml. the cells were then treated with biz-2, antigen, or a combination of the two, as indicated, for 12 or 24 hours. following induction, cells were harvested by incubation in 5 ml of harvesting solution at 37c for 510 minutes. the pellets were resuspended in 100 ul of hypotonic cell lysis buffer (25 mm hepes, ph 7.5, 5 mm mgcl2, 5 mm edta, 5 mm dtt, and 2 mm pmsf). the samples were subjected to two rounds of freezing and thawing in liquid n2, then centrifuged at 14000 g for 15 minutes. caspase 3/7-like activity was determined based on proteolytic cleavage of rhodamine 110, bis-(n - cbz - l - aspartyl - l - glutamyl - l - valyl - l - aspartic acid amide, z - devd - r110). the free rhodamine 110 was quantified on a spectramax gemini fluorescence spectrophotometer with excitation at 499 nm and emission at 521 nm using the softmax pro program in static mode. the caspase 3/7-like activity in each sample was determined from the maximum fluorescence after 3 hours. immunoblot of the lncap protein fraction was performed as previously described [28, 29 ]. briefly, lncap cells grown under the indicated condition were lysed at 4c in ripa buffer supplemented with 1x sigma protease inhibitor cocktail (sigma - aldrich, inc.). a bca protein assay kit (pierce biotechnology) was used to determine protein concentration. an aliquot of the total protein sample (30 ug) was size - fractionated using a 10% or a 420% precast (sds - page) gel (pierce biotechnology), then the fractionated proteins were transferred to a polyvinylidene difluoride (pvdf) membrane (immobilien, millipore, bedford, mass, usa). the membrane was blocked with 5% nonfat dry milk in tbst buffer (10 mm tris - hcl, ph 8, 150 mm nacl, and 0.1% tween-20) for 1 hour at room temperature, and immunostained with the following antibodies : 0.5 ug / ml anti - bcl2 and 0.5 ug / ml anti - bax (santa cruz biotechnology inc., santa cruz, calif, usa), 1.5 ug / ml anti - ar and 0.5 ug / ml anti - gdph (cell signaling, danvers, mass, usa). the blots were washed three times with tbst buffer, and immunoreactive proteins were detected using a 1:20,000 dilution of antirabbit igg horseradish peroxidase (amersham, arlington heights, ill, usa) at room temperature for 1 hour. the bands were visualized using an enhanced chemiluminescence detection system (pierce biotechnology) according to the instructions of the manufacturer. the immunoblot signal was captured using an alphainnotech fluorochem hd 9900 (alphainnotech, san leandro, calif, usa) equipped with a cdd camera. the images were analyzed with the alphaeasefc software (alphainnotech), and curves and graphs were fitted with graphpad prism 3.0 software (graphpad). the total amount of prostate - specific antigen (psa) secreted by lncap cells was quantified under different experimental conditions using a two - site sandwich, colorimetric base elisa kit according to the manufacturer 's instructions (cbi psa elisa kit, calbiotech, inc. briefly, 1 10 cells were treated with biz-2, phytoestrogen, or dht as indicated. the conditioned medium was removed and centrifuged at 12000 rpm for 5 minutes to remove any detached cells. an aliquot of the medium (1 or 10 ul) was added to each well of a 96-well plate, precoated with anti - psa antibody. the horseradish peroxidase - labeled psa enzyme conjugate was added for 30 minutes followed by the addition of the colorimetric terminating message buffer substrate, and the color change was read at an absorbance of 570 nm using an elx800uv universal microplate reader (bio - tek, inc.). to quantify the relationship between absorbance and the concentration of psa, a standard curve (050 ng / ml) was prepared from psa solutions of known concentration. the results were expressed as nanograms of psa per ml of conditioned medium, and were adjusted to nanograms per mg of secreted protein. briefly, cells were plated at a density of 1 10 cells / well in 96-well plates, and incubated overnight. biz-2 in 0.1% dimethyl sulfoxide was added at a series of concentrations (01000 ppm) to eight wells each of a 96-well plate, and incubated for 24 hours. after adding 0.5 uci / well of [methyl - h]thymidine the medium was removed and cells were harvested onto a whatman 934-ah glass microfiber filter (fisher scientific, pittsburgh, pa, usa) using a 96-well filtration manifold. to lyse the cells, filters were washed with 0.2 mm naoh. the filter paper was cut into 96 distinct pieces, placed in scintillation vials containing 3 ml of liquid scintillation fluid (mp biomedicals, solon, ohio, usa), and counted in a tricarb 2200ca scintillation counter (packard, medien, conn, usa). a 10 g sample of finely ground bizzy root was sequentially extracted in a soxhlet apparatus using 500 ml of 100% hexane, ether, acetone, methane, or water, solvents with increasing polarity. the extraction mixture was allowed to reflux for 24 hours at temperatures corresponding to the boiling point of the respective solvent and the extraction monitored by tlc chromatography. following extraction, particulate matter was removed by filtering the samples through a 0.45 m glass - fritted filter, and the extract was evaporated to dryness using a combination of simple distillation and rotary evaporation. the residue of each extract was resuspended in dmso to a concentration of 10000 ppm. aliquots (100 ppm) of each extract were run on thin - layer chromatography plates (silica gel hl, analtech, newark, de, usa ; ca. 10 cm wide 20 cm high) using a solvent of 40% v / v ether-60% v / v hexane. the analytes were visualized under ultraviolet light, and the image was captured digitally using a fluorchem hd alpha innotech system. all numerical data were expressed as mean sem. in each assay, three or four measurements were made. means for the treatment groups were compared using analysis of variance and duncan 's multiple range test (p <.05). to analyze the absorbance density from western blot data, a two - tailed t - test (p <.05) was used to compare the mean (n = 3) for each treatment group with the mean for the untreated control group. the graphpad prism 3.0 software program (graphpad) was used for the statistical analyses. the androgenic potential of natural compounds is manifested in a variety of biological responses including induction of cell growth, secretion of cellular protein, and receptor - dependent gene expression. furthermore, modulation of psa level is used as a biomarker in assessing prostate development and function. as an initial step in identifying and characterizing medicinally relevant, putative, selective androgen receptor modulators (sarms) present in bizzy nut, we performed solid - liquid extraction using solvents of increasing polarity. we screened each extract for bioactivity using several in vitro assays that were designed to reveal if any of the extracts contained androgenic or estrogenic activity. we determined whether an ether extract of bizzy nut (biz-2) was capable of modulating prostate function by exerting its effect on psa secretion by lncap cells. lncap cells were grown in a serum - free medium for 24 hours, and then induced with 100 ppm of biz-2 for 6, 12, or 24 hours. a psa elisa was then used to determine the concentration of psa in the medium. psa secretion by lncap cells in the presence of biz-2 displayed a biphasic response (figure 1(a)). relative to control, biz-2 induced an initial 26.59 13.3% increase in psa after the first 6 hours of exposure. the level of psa decreased by 32.6 1.3% during the second six - hour period, and increased by 25.93 3.3% 12 hours later (figure 1(a)). in contrast, dht produced a time - dependent increase (9.6 6.7% and 130 6% after 12 and 24 hours, resp.) in psa production under the same experimental conditions (figure 1(a) ; data not shown). to understand the relationship between biz-2 modulation of psa secretion and the androgen - dependent pathway, we determined whether the psa secretion was mediated by a biz-2/androgen receptor interaction. to answer this question, psa secretion was measured in the presence of the antiandrogen flutamide (flu) (figure 1(b)). as a positive control, we measured psa secretion in the presence of flutamide with or without the natural androgen, dht. consistent with previous studies [31, 32 ], flutamide blocked the ar - dependent stimulation of psa (1.014 0.08 ng / ul for dht versus 0.549 0.07 ng / ul for dht / flu) by lncap cells. treatment of lncap cells with 10 ppm biz-2 plus 1 nm of flutamide prevented the biz-2 inhibition of psa secretion (figure 1(b)). at 10 ppm biz-2, psa levels decreased by 24.80 3.4% of control, that is, from 0.654 0.01 addition of flutamide at 1 nm restored the psa level to that of control (0.673 0.077 ng / ul biz-2/flu versus 0.654 0.03 ng / ul control). in our system, there was a significant increase (16 2.8%, n = 8, p <.01) in psa secretion in the presence of flu, suggesting that there may have been residual androgen present in the medium. alternatively, flutamide may have induced an androgenic effect on psa under serum - free conditions (figure 1(b)). nevertheless, flu was able to prevent the biz-2-induced decrease in psa secretion, which was an observation that was complimentary to what we observed with dht / flu treatment. these results strongly suggested that the biz-2 inhibition of psa secretion was dependent on the ar pathway. modulation of psa secretion in the presence of biz-2 may have resulted from changes in psa mrna production, and could have been independent of the secretion processes that were present in lncap cells. to test this hypothesis, we measured psa mrna levels in cells exposed to biz-2 using taqman real - time rt - pcr. multiplex real - time pcr was performed using a primer / probe set specific for psa and 18s rrna (pe applied biosystems, foster city, calif, usa). the expression levels of psa were obtained from dnase - i - treated total rna, and were normalized to those of the 18s rrna gene, which served as the calibrator for our experiments. the logarithm of the fluorescence intensity of each probe versus the number of cycles and the level of expression of mrna of psa in lncap cells was evaluated (figure 2). in the present study, the mrna expression of psa was determined using the 2 method, and is expressed relative to the control sample which is set to 1. we observed a time - dependent increase in levels of psa mrna between 6 and 24 hours of exposure in the presence of 10 ppm biz-2 (figure 2(b)). analysis of the data in figure 2(b) also indicated that, after treatment with biz-2 or the positive control (dht), levels of psa mrna expression showed a statistically significant increase. exposure of lncap cells to 10 ppm biz-2 resulted in a 0.87 0.17-fold increase in psa mrna, which was increased by 12-fold (0.87 0.17 to 10.56 2.25) in the second 12-hour period. we determined the potency of biz-2 in stimulating psa mrna by exposing lncap cells to different amounts of biz-2 for 24 hours. the response of psa mrna production to biz-2 concentration was bell - shaped (figure 2(c)). at concentrations below 10 ppm, biz-2 elicited a dose - dependent increase in psa mrna expression, whereas at high concentrations (100 ppm and greater) expression of psa was inhibited. biz-2 at low concentrations produced a similar increase in psa mrna at 12 and 24 hours as the endogenous androgen dht (figure 2(b) ; data not shown). to substantiate the observation that biz-2 modulated psa activity in an ar - dependent manner, we measured biz-2-induced psa mrna in the presence of the ar antagonist flutamide. the biz-2-induced expression of psa mrna was inhibited by 55% (3.46 0.25-fold biz-2 to 1.55 0.14-fold biz-2/flu) in the presence of 1 nm flutamide (figure 3) suggesting that biz-2 mediated an increase in psa mrna level through an interaction with the ar present in lncap cells. on the other hand, resveratrol, a phytoestrogen with bioactivity in lncap cells, induced a 1.5-fold increase in psa mrna levels, which was independent of the ar (figure 3). next we ascertained whether the stimulatory effects of biz-2 on psa expression were a result of rna stability by measuring the mrna levels of psa in the presence and absence of actinomycin - d, a known transcription inhibitor. pretreatment of lncap cells with 5 ug / ul of actinomycin - d for 4 hours resulted in a 26% inhibition of psa expression relative to biz-2. at the same time, blocking of protein synthesis using cycloheximide resulted in an increase in the biz-2-induced expression of psa (figure 3). because actinomycin - d alone could not have induced psa mrna synthesis, our data suggested that biz-2 regulated psa expression directly at the level of transcription. to further characterize the effects of biz-2 on the ar - dependent pathway, we examined the androgenic effects of biz-2 on the transcription activity of three androgen - regulated genes (psa, part-1, and nkx3 - 1) [3335 ] and three steroid receptor genes (er-, er, and ar) [36, 37 ] using real - time, quantitative, two - step rt - pcr (table 1). biz-2 produced a robust induction in the three androgen - regulated genes tested (table 1). we ascertained the specificity and the strength of induction of androgen - specific genes by biz-2 by determining the relative gene expression at 10 ppm biz-2 or 10 nm dht. we observed that biz-2 was as effective as dht in inducing the expression of the well - known prostate - specific gene (psa). biz-2 at 10 ppm produced 10.55 2.2-, 3.9 0.74-, and 5.95 1.4-fold inductions of psa, nkx3 - 1, and tsc22 mrna levels, respectively. relative to dht, biz-2 was six times more effective in stimulating tsc22 expression (table 1). biz-2 showed a marginal increase in expression levels of steroid receptor genes (er : 1.4 0.3 ; er : 1.2 0.4 ; ar : 2.8 0.2) suggesting differential regulation of androgen - regulated genes by biz-2 in lncap cells (table 1). biz-2 was able to stimulate each prostate - specific, ar - dependent gene 2-fold to 8-fold relative to control. taken together, we surmised that biz-2 had a major influence on ar - dependent gene activation in lncap cells. to corroborate our gene expression data and to provide further evidence that the effects of biz-2 are ar - mediated, we measured the ability of biz-2 to bind to the ar. we examined the ability of biz-2 to compete with [h]r1881 for binding to ar using purified, recombinant - expressed ar, lncap cells, which contained high levels of the mutated form of ar, or cells transfected with the wild - type pcmv - ar expression plasmid. a pcmv - ar expression plasmid was transfected into either lncap or du145 cells, and the ability of the transfected cells to bind to biz-2 specifically was measured using a competition receptor binding assay [28, 39 ]. the du145 cells were chosen as a null environment because they are ar - negative. the concentration of biz-2 that reduced the specific binding of [h]r1881 by 50% (ic50) was determined by incubating protein obtained from transfected and nontransfected cells with 2 nm [h]r1881 in the absence and presence of increasing concentration of biz-2. biz-2 was able to displace [h]r1881 bound to the mutant androgen receptor in lncap cells, purified recombinant receptor, or the wild - type receptor protein (figure 4(a)). biz-2 displayed high - affinity binding to both the mutant and the wild - type ar, suggesting that the t877a mutation of the lncap ar was not responsible for the biz-2/ar biology. the ar binding affinity (ic50 and ki) of biz-2 was determined from the competition assay, because the assay was performed under conditions where the [h]r1881 and the competing biz-2 were not depleted. the ic50 and apparent ki for biz-2 binding to ar were obtained by fitting the radioligand competitive data to the cheng - prusoff equation. the ic50 was determined from nonlinear regression of the data fitted to a one - site competition binding, where the kd for [h]r1881 binding to ar was assumed to be 1 nm (figure 4(b)). the calculated ki and ic50 for biz-2 binding to the wild - type or lncap ar were 26.45 (ci 17.85 to 39.20) and 52.91 1.69 ppm (p < comparison of the ki of biz-2 to that of r1881 binding to the ar suggested that biz-2 was only 13x less potent in binding to the ar. biz-2 at high concentrations reduced psa secretion by lncap cells, but increased psa mrna levels. at these high concentrations, components of biz-2 to test this hypothesis, we determined whether biz-2 exerted any cytotoxic effects using mtt viability and a [h]-thymidine proliferation assay. the cytotoxicity of biz-2 was determined in both the ar - positive lncap and ar - negative du145 cells. biz-2 at less than 20 ppm was capable of inducing cell death (proliferation inhibition) in more than 50% of lncap cells (figure 5). in addition, biz-2 was more effective in inducing death in du145 cells at the concentrations tested (figure 5(a)). next we determined the potency of biz-2 in inhibiting survival of lncap and du-145 cells. the gi50 of biz-2 was determined by plotting the thymidine data as a dose - response curve with a variable slope. maximal inhibition of lncap cell growth by biz-2 was achieved at 50 ppm with a gi50 of 14.69 1.16 ppm (figure 5(a)). biz-2 was five times more potent in the androgen - independent cell line, du145, than in the lncap cells. both mtt and tryphan blue staining demonstrated a significant decrease in cell viability after 6 hours at 100 ppm biz-2 (figure 5(b)). biz-2 induced 31.44% and 35.63% decreases in lncap cell viability and cell number, respectively (figure 5(b)). to corroborate the [h]-thymidine incorporation assay, we evaluated the effect of biz-2 on lncap cell proliferation using mtt exclusion as an index of cell cytotoxicity. within 24 hours of exposure to biz-2, this decrease was similar to that observed with the thymidine incorporation assay (figure 5(a)). the lethal dose concentration (ld50) and the growth inhibitory concentration (gi50) of biz-2 on lncap cells were 14.69 1.16 ppm and 15.24 0.24 ppm in the mtt and [h ] thymidine incorporation assays, respectively. taken together, these results suggested that in lncap cells, high concentration of biz-2 elicits a cytotoxic effect that is time - dependent and may reduce cell proliferation and increase the frequency of cell death. our current data suggest that in ar - positive lncap cells, biz-2 is cytotoxic, which presumably leads to inhibition of cell proliferation. we investigated whether the observed cytotoxicity was a result of a chemically induced cellular cytotoxicity or cell - induced apoptosis. that is, we hypothesized that a necrotic reaction, but not programmed cell death, was responsible for the cytotoxity of biz-2. therefore, we examined whether the initial cellular cytotoxicity of biz-2 was related to the extent of apoptosis. lncap cells (5 10) were grown, induced with increasing concentration (0.1100 ppm) of biz-2, and prepared for microscopic examination as described in section 2. slides were examined under a fluorescent light microscope for the nuclear changes that are typical of apoptosis. microscopic examination of apoptotic cells revealed that there was a dose - dependent increase in apoptosis of both lncap and du145 cells following 24-hour exposure to biz-2. examination of cells treated with biz-2 by phase - contrast microscopy showed a dramatic decrease in cell number and cellular shrinkage (figures 6(a) and 6(b)). fluorescence staining with acrydine orange and ethidium bromide revealed signs of nuclear condensation, nuclei fragmentation, and membrane budding, which are all hallmark features of apoptosis (figures 6(a) and 6(b), bottom panels). light microscope analysis of cells indicated that at 1 and 100 ppm biz-2, 24%65% of cell death occurred in lncap cells, whereas only 5%15% cell death was observed in du145 cells after a 24-hour exposure. the apoptotic index was determined for both lncap and du145 by quantifying the relationship between dose of biz-2 and apoptosis (figure 6(c)). we calculate the apoptotic index by averaging the number of apoptotic cells per field (7060 cells) then dividing by the total number of cells per field (120140 cells). in the case of lncap cells, we observed a greater degree of apoptosis in the ar - positive lncap cells as compared to the ar - negative cell, du145. a concentration of biz-2 of 10 ppm induce 2025 3% apoptosis in lncap as compared to 1012 4% in du145 cells. as the concentration of biz-2 was increased to 10 and 100 ppm, the frequency of apoptotic cells increased in both cell lines (figure 6(c)). to gain an understanding of the relationship between biz-2-induced cytotoxicity and apoptosis the temporal dynamics of bcl2 and bax during biz-2-induced cytotoxicity in lncap cells was assessed using western blot analysis and qrt - pcr. bcl2 protein was detectable in lncap cells grown in serum - free medium for 48 hours. induction with 0.1 ppm of biz-2 resulted in a 4-fold increase in bcl2 protein and mrna (figure 7(a) and table 1). following the initial stimulation by biz-2, the decrease in bc12 protein expression was dose - dependent. the decrease in bcl2 levels with the increase in biz-2 probably was not due to metabolism of this compound, because there was a time - dependent increase in bcl2 at 10 ppm biz-2 (data not shown). similarly, when we analyzed the dose - dependent expression of the proapoptotic protein bax in the presence of biz-2, there was a slight increase (0.51.3-fold) in bax protein and a dramatic increase (9.97-fold as compared to control) in its mrna expression within the first 1224 hours of exposure (figure 7(a) and table 1). the decrease in both bax and bcl2 proteins after 24-hour exposure to 100 ppm biz-2 appeared to be related to the time - dependent decrease in both proteins (figure 7(a) ; data not shown). because the bax and bcl2 protein levels were important in the release of a key factor early in the apoptotic cascade, we determined the bax / bcl2 ratio in the presence of biz-2. bax / bcl2 levels decreased with increasing concentration of biz-2. at a high concentration, we validated the morphological analysis and protein assessment of biz-2-induced apoptosis by ascertaining if the protein activity of the downstream apoptotic protein caspase 3/7 had been modulated in the presence of biz-2. the level of active caspase-3 was measured by proteolytic cleavage of rhodamine 110, from the bis-(n - cbz - l - aspartyl - l - glutamyl - l - valyl - l - aspartic acid amide) (z - devd - r110) substrate. there was a dose - dependent increase in biz-2-induced cytotoxicity in lncap cells (0.110 ppm) as evidenced by the 2.5-fold increase in caspase 3/7 activity relative to the untreated control (figure 7(c)). in the analysis of time - dependent caspase 3/7 activity in the presence of 100 ppm biz-2, caspase 3/7 activity decreased significantly relative to the untreated control within the first 6 hours of induction, which suggested that a high concentration of biz-2 inhibited apoptosis in lncap cells (figure 7(c) ; data not shown). we used the protein synthesis inhibitor cycloheximide (chx) and the ar antagonist flutamide (flu) to investigate (a) whether biz-2-induced apoptosis required protein synthesis and (b) if biz-2-induced apoptotic processes use an ar signaling pathway (figure 8). treatment of lncap with 1 ug / ml of chx for 12 hours after induction with 100 ppm biz-2 resulted in an inhibition of biz-2-induced caspase 3/7 activity and bax, and bcl2 protein expression (figure 8(b) ; data not shown). at low concentration, chx completely abolished the biz-2-stimulated caspase levels, which suggested that the effect of biz-2 on caspase required protein synthesis. the analysis of caspase 3/7 activity and bax expression in the presence and absence of actinomycin - d implied that biz-2 did not elicit a direct transcription effect on bax or caspase levels because pretreatment with actinomycin - d had no effect on their expression (figure 8(b) ; data not shown). to corroborate the chx data and to generate further evidence that biz-2-modulated apoptosis in lncap cells involved transcriptional regulation through an androgen - dependent pathway, we measured the expression of bax and bcl2 and caspase 3/7 activity in the presence of the ar antagonist flutamide. bcl2 protein levels and caspase activity decreased in the presence of 1 nm flu, which suggested that the antiandrogen protected prostate cells from apoptotic assaults (figure 8). at 10 ppm biz-2, there was an 80% decrease in caspase 3/7 activity in the presence of flu (figure 8(b)). flu produced up to a 2-fold decrease in bcl2 protein but had a notable 2-fold increase on bax protein levels (figure 8(a)). as with the caspase 3/7 activity, cotreatment of biz-2 with flu completely blocked biz-2-induced increases in bcl2 and bax proteins. to substantiate the flu data, we measured bcl2-protein levels in the presence of resveratrol, which induces apoptosis in lncap cells. resveratrol - induced inhibition of bcl2 and bax expression was completely blocked by flu (figure 8(a)). thus, the cytotoxic effect of biz-2 on lncap cells was decreased by more than 90% in the presence of chx or the antiandrogen flu, and was unaffected by actinomycin - d, which suggested that the mode of action of biz-2 involved ar pathways and protein synthesis. given the high incidence of prostate cancer, there is an urgent need for treatment paradigms that improve prostate health. nonsteroidal compounds are an interesting target for prostate cancer treatment because they do not produce the undesirable effects associated with traditional steroidal regimes [12, 39, 41, 42 ]. the search for nonsteroidal androgen usually starts by identifying a natural compound that shows the potential of antiandrogen properties. one group of compounds that has received a tremendous amount of attention is the naturally occurring phytoestrogens found in fruits, vegetables, and teas. these compounds have also been shown to possess antiandrogenic activity due to their ability to inhibit and delay prostate cancer [11, 43 ]. growth and normal development of the prostate gland are under the control of androgen acting through interaction with the ar. the need for new androgenic therapies to improve prostate function has centered on agents that alter the ar action. recently, we reported that the common jamaican herbal medicine, bizzy, contains a putative nonsteroidal compound with bioactivity in both breast and prostate cancer cells. in this study, we applied the androgen - dependent lncap prostate tumor cell model along with the androgen - independent du145 prostate tumor cell model to ascertain the androgenic effect of this medicinal extract. screening of several bizzy extracts for bioactivity using several in vitro assays was designed to evaluate whether any of the extracts contained androgenic or antiandrogenic activity. the study shows that an ether extract of bizzy (biz-2) is the most potent inhibitor of lncap cell growth because it has a high affinity for the ar. at high concentrations, we tested the hypothesis that bizzy nut extract can modulate prostate activity by using prostate secretion as an index of prostate function. we observed that the rate of psa secreted by lncap cells in the presence of biz-2 was sharply decreased. biz-2 modulation of psa production was ar - dependent, which implied that biz-2 's biological effect may serve as an index of putative phytoandrogen in prostate cancer cells. the key to a successfully chemopreventive agent against prostate and other types of cancer will rely on these agents ' ability to induce cell death in tumor cells in a tissue - dependent and even a receptor - dependent manner. the search for natural compounds capable of functioning as potential chemopreventive agents for prostate cancer has met with mixed results [19, 4345 ]. natural chemopreventive agents as well as anticancer agents function by modulating one or several major steps in the carcinogenesis pathway. naturally occurring agents that could induce apoptosis in prostate cells in an ar - dependent manner would signal a new generation of prostate - specific, chemopreventative agents. our biz-2 extract appears to possess some of the fundamental activities required for this type of chemopreventive agent. we demonstrated that in lncap cells, biz-2 inhibits at least one family member of the natural inhibitors of apoptosis (bcl2), which suggests that biz-2 may force cells into the apoptotic pathway. the ratio of these proteins determines whether a cell will commit to the apoptosis pathway. the data provided by this study point to biz-2 as a putative chemopreventive agent in prostate cells. biz-2 showed a time - dependent and dose - dependent increase in the proapoptotic gene at both the protein and mrna levels. the increase in proapoptotic protein was coupled to morphological signs of apoptosis and to an increase in enzyme associated with late apoptotic events. furthermore, the ability of the antiandrogen flutamide to prevent biz-2 induction of both caspase activity and bcl2 expression supports the role of the ar pathway in this process. it is interesting to note that in the absence of ar, bizz-2 may possess antiproliferative activity. in the ar - negative cell, du145, we observed a greater degree of inhibition of cell proliferation as compared to ar - positive lncap cells.. taken together, these observations suggest that biz-2 may elicit antiproliferative activity that does not require a functional androgen receptor pathway. in deciphering the role of biz-2 in prostate function, it is important to examine the transcriptional effects of this extract on both estrogen - responsive and androgen - responsive genes. androgen, including phytoandrogen, acts via binding of different types of ligands to the ar coalescent in gene expression. antagonists, which inhibit the transcriptional activity of the ar, are currently being used as potential treatment agents in the fight against prostate cancer. the involvement of biz-2 in ar biology was examined using two parameters : (1) receptor binding and (2) ar - dependent gene activation. in classical competition experiments, components of our biz-2 extract the potency of the putative androgenic compound in biz-2 is only thirteen times lower than the potency of the synthetic androgen r1881. examination of the transcriptional response of several androgen - regulated genes reveals a 5-fold induction in mrna expression following a 24-hour exposure to biz-2. levels of expression of nkx3 - 1 or psa, both prostate - specific genes, were elevated 5-fold and 10-fold, respectively, by biz-2. we observed that biz-2 regulated both androgen - dependent and androgen - independent genes such as bcl2 and bax, but was ineffective in regulating the steroid receptor mrna levels. this study clearly demonstrated that effects of biz-2 on transcriptional activation of ar - dependent genes suggested that biz-2 may be androgenic at the levels of transcription. several hypotheses aimed at explaining the diverse action of these compounds have been proposed. one prevailing hypothesis for the cancer preventative effect of phytoandrogen or phytoestrogen in prostate cancer is the activation of an apoptotic cascade by components of the natural extract. in this study, we provide evidence that biz-2 extract has the ability to eradicate prostate cancer cells by inducing apoptosis in an apparent ar - dependent manner. validation of these in vitro findings with an in vivo model system is warranted. our findings highlight the need for a closer examination of bizzy nut as a potential source of natural chemicals that may modulate prostate growth and function. | the low incidence of prostate cancer in asians has been attributed to chemopreventative properties of certain chemicals found in their diet. this study characterized the androgenic and chemopreventative properties of the jamaican bush tea bizzy, using androgen receptor positive and negative cell lines. exposure of prostate cells to biz-2 resulted in a growth inhibition (gi50) of 15 ppm in lncap cells and 3.6 ppm in du145 cells. biz-2 elicited a 2-fold increase in the mrna of the anti - apoptotic gene bcl2, with a 10-fold increase in that of the proapoptotic gene bax. we observed a 2.4- to 7.5-fold change in apoptotic cells in both cell lines. biz-2 at 10 ppm elicited a time- and dose - dependent stimulation of both the protein and mrna levels of several androgen - regulated genes. biz-2 caused a 36% decrease in psa secretion and a significant increase in psa mrna. the relative binding affinity (ic50) of biz-2 for ar was 2- to 5-fold lower than that of the synthetic androgen r1881. biz-2 was found to be a specific ligand for the ar in that the natural ligand, dht, and the anti - androgen, flutamide, displaced biz-2 bound to ar and inhibited biz-2-induced transcription and psa secretion. this study provided evidence that biz-2 extract possesses the ability to modulate prostate cancer cell biology in an ar - dependent manner. |
congenital heart disease encompasses a variety of lesions that may include communication / s between the left and the right side of the heart. such communications may cause volume overload in the short and medium term, possibly resulting in heart failure, or irreversible complications in the long term such as eisenmenger 's syndrome. previously, such defects (typically atrial (asd) and ventricular septal defects (vsd) and patent ductus arteriosus (pda)) were closed surgically. over the last decade, a vast variety of devices have been developed to close such defects through the transcatheter route. we report one patient who had self - limiting haemolysis after implantation of an amplatzer perimembranous vsd device. our patient was born via normal vaginal delivery at 38 weeks gestation after an uneventful preganacy. at the routine 6 week visit, she was noted to be failing to thrive and a 3/6 systolic murmur was noted. diuretics were commenced and she throve. at 4 years of age, she was admitted to the paediatric surgical ward with fever, abdominal pain and vomiting. surgical exploration of the abdomen under antibiotic cover was normal, as was an echocardiogram at this time. fever persisted and a repeat echocardiogram showed tricuspid valve endocarditis with a large vegetation that eventually eroded part of the valve resulting in significant regurgitation. the endocarditis was treated with antibiotics and transcatheter closure of the vsd was done successfully using a 14 mm amplatzer perimembranous vsd device at 5 years of age. one week after discharge, she was readmitted due to jaundice and dark coloured urine. haemoglobin was 9.5g / dl, liver function tests were deranged (bilirubin 80umol / l ; direct bilirubin 12umol / l ; gamma gt 80 u / l ; alt 58 u / l ; alkaline phosphatase 707 u / l, with urobilinogen in the urine. viral studies, inclujding cmv, ebv, hepatitis a and b, were all negative. she was discharged home as after two weeks as her jaundice cleared and her liver function tests improved. haemolysis has been documented after amplatzer device closure of pda,1 asd,2 and vsd.3 the one reported case after vsd closure resulted in transient renal failure.3 hemolysis has also been associated with the use of amplatzer devices to close paravalvar mitral valve leaks after mitral valve replacement.4 conservative treatment is usually sufficient but reintervention of some form may occasionally be necessary, such as intradevice coil deployment in order to completely eliminate any degree of residual left to right shunting.5 | over the last few years, a vast variety of devices have been developed to close various septal defects through the transcatheter route. haemolysis has been documented after amplatzer device closure of patent ductus arteriousus, atrial septal defect, and ventricular septal defect. we report one patient with self - limiting haemolysis after implantation of an amplatzer perimembranous vsd device. |
nosocomial infections, also called healthcare - associated infections are those infections acquired by a patients as a result of treatment in a hospital, clinic or healthcare service centre. these infections generally appear 48 hours or more after hospital admission or within 30 days after discharge. they occur because of instrumentation, increased use of antimicrobial agents, breaks in aseptic techniques and lack of hand hygiene. at any time, microorganisms often implicated in these infections include escherichia coli, pseudomonas aeruginosa, klebsiella species, staphylococcus aureus and mycobacterium tuberculosis. according to the american national nosocomial infections surveillance, more than 40% of nosocomial infections occurred in parts of asia, latin america, and sub - saharan africa. it usually ferments lactose on macconkey agar to produce pink colonies with surrounding areas of precipitated bile salts. e. coli strain will produce indole from tryptophan ; it does not produce hydrogen sulfide, urease, and can not use citrate as sole carbon source. in some hospitals, e. coli strains were found to be the highest and most frequent among the pathogenic microorganisms isolated from ten teaching hospitals in china. pathogenic strains of e. coli are responsible for three types of infections in humans ; urinary tracts infections, neonatal meningitis, and intestinal diseases. in many west african countries, nosocomial infections are abound but not much study has been done to determine the proportion of infections acquired by patients or health workers from hospital and or healthcare - providing facilities. hospitals serve a reservoir of various types of microorganisms ; some may be multiple resistant to antibiotics and the selective pressure of antimicrobial use in hospitals, therefore makes the environment a repository for these resistant strains. newman and his colleagues reported on the occurrence of nosocomial infections in korle - bu teaching hospital in accra, ghana. these studies are therefore necessary and need to be conducted in many other parts of the country in order to generate national data on these pathogenic organisms, more especially on their antibiotic resistant patterns in ghana. this study sought to determine the antibiotic resistance patterns of e. coli isolates from the premises of three hospitals in kumasi, ghana. the samples were collected from kumasi south, tafo and suntreso hospitals in kumasi, ghana. a total of 600 swabs samples of floors, benches, beds, door handles, and waste water from drainages were collected between january and june, 2010. the swabs were put into sterile test tubes, closed tightly, and labeled appropriately. all the materials including culture media, reference antibiotics, and reagents were purchased from oxoid, basingstoke, united kingdom unless otherwise stated. the various samples collected were separately inoculated into 10 ml of nutrient broths and incubated at 37c for 24 hours. using a sterile platinum loop, each culture was separately streaked onto the surface of macconkey agar plates, labeled and incubated at 37c for 48 hours, and observed for signs of growth and colony appearance. colonies that appeared pink on the macconkey agar plates were removed with sterile inoculating wire and separately streaked onto the surface of eosin methylene blue agar plates. isolated black - colored colonies with metallic sheen were again fished out into nutrient broths and incubated at 37c for 24 hours. the various subcultures were streaked onto nutrient agar slants, incubated at 37c for 48 hours, and then kept in the refrigerator at 20c for further identification and antibiotic sensitivity studies. the e. coli isolates were screened through the various microscopic examination and biochemical reactions to confirm their identities. these included indole, oxidase, and arginine dehydrolase production, citrate utilization, nitrite reduction, fermentation of carbohydrates (such as xylose, maltose, arabinose, glycerol, and starch), methyl red - voges proskauer test, and reaction triple sugar iron agar [11, 12 ]. all the tests were performed on reference - typed culture of e. coli (atcc 25922). kirby - bauer disc diffusion method as recommended by the clinical and laboratory standards institute was used to determine the in vitro susceptibility of the identified e. coli isolates to gentamicin (gm) 10 g, ciprofloxacin (cip) 5 g, ceftriaxone (cro) 30 g, ampicillin (amp) 10 g, and cotrimoxazole (sxt) (trimethoprim - sulphamethoxazole) 25 g. a standardized suspension of the isolated e. coli was prepared by inoculating a colony into 10 ml peptone water and incubated at 37c for 24 hours. a sterile swab was dipped into the standardized inoculum and used to inoculate evenly the surface of already prepared mueller - hinton agar (oxoid basingstoke, uk). the agar was left for 15 minutes for the surface moisture to dry. a multichannel disc dispenser (oxoid, basingstoke, uk) the method was replicated three times and the mean zones of inhibition compared with figures (table 1) provided by the clinical and laboratories standards institute. a total of 150 (lactose fermenter) isolates recovered on macconkey agar (oxoid, basingstoke, uk) were suspected to be e. coli. e. coli isolates were identified from the various locations (benches, floor, door handles and drainages, male, female, and pediatrics wards) in the three hospitals (figure 1). a total of 97 isolates from the three hospitals were confirmed as e. coli. jarvis and martone reported that e. coli as the most common nosocomial pathogen in some hospitals in the united states. also, e. coli has been reported to be among the most frequent isolates in hospitals in ethiopia. among the three hospitals from which the samples or swabs were taken, e. coli isolates were widely distributed in various locations throughout the three hospitals for which samples were analyzed (table 2). about 90% of the e. coli isolates exhibited resistance to ampicillin while 6.2 and 3.1%, respectively, showed intermediate and sensitive. for cotrimoxazole (trimethoprim - sulphamethoxazole), 78.4% of the isolates were resistant while 9.3 and 12.3% intermediate and sensitive responses. between 26.8 to 46.4% of the e. coli isolates also showed resistance to gentamicin, ciprofloxacin, and ceftriaxone, while 14.4 to 47.4% gave intermediate responses. ceftriaxone, ciprofloxacin, and gentamicin sensitive isolates were also in the range of 23.7 to 39.2% (figure 2). the majority of the gentamicin sensitive e. coli isolates (28.9%) was isolated from the male wards followed by floor samples (21.1%) as shown in table 3. none of the drainage samples were resistant to gentamicin, while 20% each from the floor and female wards proved resistant., 46 e. coli isolates exhibited intermediate response to ceftriaxone, 30% were from the male wards, 21.4% from floor and 2.2% from drainage samples. most of the e. coli resistant isolates (26.9%) were from the benches and 19.2% from male wards while no resistant strains were recovered from door handles (table 3). ciprofloxacin - resistant e. coli isolates were recovered from floor samples (29%) followed by the samples from pediatric wards (19.4%). e. coli isolates which exhibited intermediate response to ciprofloxacin (30%) were in the samples / swabs from the male ward and none from door handles. majority of the e. coli sensitive isolates were from female wards (30.4%) followed by male and pediatric wards samples (17.4%). the distributions of ampicillin resistant e. coli isolates were 22.7, 20.5, and 19.3% for male wards, floors, and benches, respectively (table 3). many of the isolates obtained were found to be resistant to more than two different classes of the reference antibiotics (table 4). majority of the e. coli isolates (53.6%) were isolated from the hospital beddings while about 21% were from floor samples (table 2). most of the e. coli isolates (90 to 78%) were resistant to ampicillin and cotrimoxazole, respectively (figure 1). the high occurrence of e. coli isolates in these samples could be attributed to poor hygienic conditions in these hospitals and the overcrowding in these hospitals due to inadequate number of health care facilities in the region. a total of 46.4, 32.0, and 26.8% of the e. coli isolates exhibited resistance to gentamicin, ciprofloxacin, and ceftriaxone, respectively, and these were similar to what was reported by yismaw and his colleagues. yismaw. also reported a similar resistance pattern of e. coli to gentamicin (47%), ciprofloxacin (33%), and ceftriaxone (26%). and these high levels of antibiotic resistance have been attributed to widespread abuse of these antibiotics. out of 97 e. coli isolates, 78 isolates or 80.4% exhibited multiple drug resistance to at least three different classes of the reference antibiotics used. these high numbers of resistant e. coli isolates in the hospitals are potential reservoirs of resistant genes which can easily be transferred to other pathogens. hence, there is a need to observe proper hygiene, use of effective disinfectants, and monitor the administration and prescription of antibiotics in hospitals. most of the e. coli isolates (80.4%) exhibited multiple drug resistance and measures such as observation of proper personal hygiene by health staff and patients, use of effective disinfectants in reducing the possible pathogenic organisms in these hospitals, and so forth. these findings have therefore showed the need for the hospital management to be concerned about the potential of hospitalized patients becoming infected with some nosocomial infections, especially resistant strains of e. coli. | nosocomial infections are infections acquired by a patient as a result of treatment in a hospital or healthcare service providing center and symptoms occurs within a short period of hospitalization. the study was to determine the antibiotic resistance patterns of escherichia coli isolated from kumasi - south, tafo and suntreso hospitals, kumasi, ghana. total of 600 swabs samples from the hospitals were collected between january and june, 2010. the isolates were identified using morphological and biochemical means. a total of 97 e. coli isolates were obtained from the hospitals. beds in hospital wards had the highest number of e. coli strains (53.6%), followed by floors (20.6%) while drainages had the least isolates (3.1%). majority of the e. coli isolates (90.7%) exhibited resistance to ampicillin while 6.2 and 3.1% showed intermediate and sensitive respectively. co - trimoxazole, 78.4% of the isolates were resistant while 9.3 and 12.4% exhibited intermediate and sensitive responses respectively. e. coli isolates (28.6 to 46.4%) were resistant to gentamicin, ciprofloxacin and ceftriaxone while 14.4 to 47.4% gave intermediate responses. most isolates (80.4%) exhibited multi - drug resistance. there is a need to observe proper personal hygiene, use of effective disinfectants and proper disposal of contaminated / pathogenic materials in these hospitals to control nosocomial infections. |
autistic spectrum disorder (asd) is seen in all races, cultures, and societies. asds are also known as pervasive developmental disorders (pdds). in diagnostic and statistical manual - text revised (dsm - iv - tr), pdds included autism, asperger s, pdd - not otherwise specified (pdd - nos), disintegrative disorder, and rett 's disorder. but in the new classification of diagnostic and statistical manual of mental disorders, fifth edition (dsm-5), autism, pdd - nos, asperger s, and disintegrative disorder are all named as autism spectrum disorders (asds). they might also have developmental delays and intellectual disabilities, in addition to difficulties in processing social and emotional information and expressing their emotion. in sum, the disorder results in developmental and functional deficits. parenting a child with autistic disorder is expected to cause an enduring stress and is a demanding responsibility for the parents. several studies have reported higher level of stress among mothers of children with autism. in comparison to parents of normal children, parents of autistic children show an inclination to report higher family stress, and they experience severe physical and psychological problems. the enduring stress eventually shows in the form of various psychological problems such as depression, anxiety, lack of satisfaction in life, and sleep disorders. these problems not only lead to parents having an anxious and sad life, but also decrease the effect of early educational and therapeutic interventions for autistic children. these parents need to be evaluated for psychological problems, and they need to have a strong social support network. perceived social support network can increase the feeling of satisfaction and competence as a parent. in iran, as an eastern society, mothers are mainly responsible for raising children at home. mothers are more concerned than fathers about the psychological and behavioral problems of autistic children, and they get the most referrals to s pecialists. although mothers historically have been the primary caregivers of children in iran, the importance of the role of fathers belonging to younger generation in iran and the necessity of their involvement in the process of assessment and treatment of children with asd are clinically obvious. in spite of the increased recognition of the fact that both mothers and fathers have significant challenges in bringing up a child with asd, even in the western countries, most of the studies about parental stress among parents of children with asd have been conducted in the western societies. since the stress experienced by fathers and mothers of children with asd can affect their ability to effectively raise and respond to the needs of these children, recognizing the differences in parental stress among the mothers and fathers of children with asd and their related factors could help the mental health professionals to plan and implement effective interventions for reducing these stresses and help these parents. in fact, obtaining more information about the thoughts, feelings, and experiences of such parents would play a special role in designing more effective and specific interventions for both mothers and fathers of children with asd. in addition, research shows that one of the most significant sources of parental stress among parents of children with asd is lack of adequate support from professionals. since there exists no systematic patient referral system in iran, going to a healthcare center and choosing a doctor is related to the level of awareness in families. therefore, many patients do not receive appropriate assessment and treatment, and this can lead to much more frustration after a long period of time. also, past theories about the psychogenic cause of asd, such as refrigerator mothers, have caused a climate of distrust and suspicion in the relationship between parents and mental health professionals such as nurses who work in this field. findings of another study suggest that parents of these children perceived the professionals as being controlling and judgmental. therefore, knowing the nature and profile of parental stress among the mothers and fathers of children with asd may help the professionals such as mental health nurses to have more effective communication with these parents and be more supportive. considering these issues, this research aims to evaluate the parental stress among the fathers and mothers of children with asd and find the relationship between the severity of the disorder in children and the level of parental stress. this research aimed at better understanding and increase in scientific and practical information regarding asd was carried out for the first time in iran. forty - two parents of children aged between 2 and 12 diagnosed with asd based on the new approach of dsm-5 were selec ted. based on dsm - iv - tr criteria, the sample consisted of two groups ; the first group included 21 couples with autistic children and the second group consisted of 21 couples whose children were diagnosed with pdd - nos. diagnoses were made by a child and adolescent psychiatrist and was confirmed by another one. participants were selected by convenient sampling method from two educational - therapeutic centers, namely (private center) and tabasom (public center), in mashhad over a period of 12 months from the summer of 2011 to the summer of 2012. parents who agreed to take part in the research signed the informed consents before participating in the study. the protocol of research was approved by the ethical committee of mashhad university of medical sciences. the severity of pdd in children was determined based on childhood autism rating scale (cars) and the stress of parents was measured using parenting stress index (psi). based on the final score, patients are classified as follows : 1530 shows no autism, 3037 represents mild to moderate autistic disorder, and 3760 represents severe autistic disorder. the psi is a 120-item self - report (filled up by parents) questionnaire. parents rate their agreement or disagreement on a 4-point scale to the questions which investigate parents feelings about their children (e.g. i worry or multiple - choice questions assess total stress and three other important domains : child domain : represents stress attributed to the childparental domain : represents stress attributed to parentslife stress index : represents stressful dimensions in the life of parents. child domain : represents stress attributed to the child parental domain : represents stress attributed to parents life stress index : represents stressful dimensions in the life of parents. the scores of child domain for children, parental domain, life stress index, and total stress were registered separately. for the child domain, parental domain, and total stress scores, the percentile values were calculated based on the table of percentiles standardized according to children 's age (presented by abidin), and the resulting percentile values were used in statistical calculations, instead of index scores. the current version, the wechsler intelligence scale - fourth edition (wisc - iv), was designed in 2003. the wisc - iv is divided into 15 subtests, 10 of which formed part of the previous wisc - iii. the five new subtests include three core tests (picture concepts, letter - number sequencing, and matrix reasoning) and two supplemental tests (cancellation and word reasoning). the wisc - iv generates a full scale iq (fsiq) which represents overall cognitive ability ; the four other composite scores are verbal comprehension index (vci), perceptual reasoning index (pri), processing speed index (psi), and working memory index (wmi). there was a significant correlation between wisc - iv, raven 's progressive matrices, and wisc - ii. descriptive statistics were presented as tables, graphs, and indexes. for qualitative variables, pearson 's chi - square test was performed and the results of two groups were compared. correlation test was conducted between variables, subscale scores of the psi, scores of cars, and the age of children. if a correlation existed, appropriate correlational relationships, with the assistance of linear regression, were calculated and presented. variables with normal distribution and non - normal distribution were determined. for normally distributed quantitative variables in both groups, t - test was performed, and for non - normally distributed quantitative variables in the two groups, square test was performed. based on dsm-5 criteria for data analysis about the correlation between parenting stress and severity of disorder, we considered all participants as subjects with asd. this research aimed at better understanding and increase in scientific and practical information regarding asd was carried out for the first time in iran. forty - two parents of children aged between 2 and 12 diagnosed with asd based on the new approach of dsm-5 were selec ted. based on dsm - iv - tr criteria, the sample consisted of two groups ; the first group included 21 couples with autistic children and the second group consisted of 21 couples whose children were diagnosed with pdd - nos. diagnoses were made by a child and adolescent psychiatrist and was confirmed by another one. participants were selected by convenient sampling method from two educational - therapeutic centers, namely (private center) and tabasom (public center), in mashhad over a period of 12 months from the summer of 2011 to the summer of 2012. parents who agreed to take part in the research signed the informed consents before participating in the study. the protocol of research was approved by the ethical committee of mashhad university of medical sciences. the severity of pdd in children was determined based on childhood autism rating scale (cars) and the stress of parents was measured using parenting stress index (psi). this scale is used to determine the severity of asd. based on the final score, patients are classified as follows : 1530 shows no autism, 3037 represents mild to moderate autistic disorder, and 3760 represents severe autistic disorder. this scale is used to determine the severity of asd. based on the final score, patients are classified as follows : 1530 shows no autism, 3037 represents mild to moderate autistic disorder, and 3760 represents severe autistic disorder. the psi is a 120-item self - report (filled up by parents) questionnaire. parents rate their agreement or disagreement on a 4-point scale to the questions which investigate parents feelings about their children (e.g. i worry or multiple - choice questions assess total stress and three other important domains : child domain : represents stress attributed to the childparental domain : represents stress attributed to parentslife stress index : represents stressful dimensions in the life of parents. child domain : represents stress attributed to the child parental domain : represents stress attributed to parents life stress index : represents stressful dimensions in the life of parents. the scores of child domain for children, parental domain, life stress index, and total stress were registered separately. for the child domain, parental domain, and total stress scores, the percentile values were calculated based on the table of percentiles standardized according to children 's age (presented by abidin), and the resulting percentile values were used in statistical calculations, instead of index scores. the current version, the wechsler intelligence scale - fourth edition (wisc - iv), was designed in 2003. the wisc - iv is divided into 15 subtests, 10 of which formed part of the previous wisc - iii. the five new subtests include three core tests (picture concepts, letter - number sequencing, and matrix reasoning) and two supplemental tests (cancellation and word reasoning). the wisc - iv generates a full scale iq (fsiq) which represents overall cognitive ability ; the four other composite scores are verbal comprehension index (vci), perceptual reasoning index (pri), processing speed index (psi), and working memory index (wmi). there was a significant correlation between wisc - iv, raven 's progressive matrices, and wisc - ii. descriptive statistics were presented as tables, graphs, and indexes. for qualitative variables, pearson 's chi - square test was performed and the results of two groups were compared. correlation test was conducted between variables, subscale scores of the psi, scores of cars, and the age of children. if a correlation existed, appropriate correlational relationships, with the assistance of linear regression, were calculated and presented. variables with normal distribution and non - normal distribution were determined. for normally distributed quantitative variables in both groups, t - test was performed, and for non - normally distributed quantitative variables in the two groups, square test was performed. based on dsm-5 criteria for data analysis about the correlation between parenting stress and severity of disorder forty - two couples with asd children aged between 2 and 12 were enrolled in the study. variables including age, sex, intellectual level, and history of seizure for children, as well as age, level of education, and the number of children for parents were compared between the two groups of participants, and they showed no significant difference. age and education level of parents are shown in tables 1 and 2, respectively. intellectual level and history of seizure in all children comparison of parents age comparison of parents education iq and history of seizure in all participants correlation between the psi subscales and those of the cars in all participants was evaluated and positive correlation coefficients were obtained between the psi - parent domain and cars score (r = 0.339, p = 0.028) and also between the total stress index and cars rating (r = 0.333, p = 0.031, pearson 's rank test) [table 4 ] for fathers. it is thus suggested that fathers of children with more severe developmental disorders experience more stress. correlations between the psi quantitative variables and the cars score of all participants in order to compare parental stress between fathers and mothers, mann the results showed significant differences between fathers and mothers in the three psi subscales including psi - child domain score (87.4 14.6 vs. 95.0 7.2, respectively, p < 0.005), psi - parent domain score (73.7 20.2 vs. 87.0 20.1, respectively, p < 0.005), and the total stress index (83.1 17.8 vs. 93.1 22.4, respectively, p < 0.005). as a result, mothers had significantly more stress than fathers [table 5 ]. parenting stress has been investigated in some studies in the western countries, but has not been studied in iran. also, many studies have focused only on mothers of children with asd and have not examined the parenting stress among the fathers of these children. in the present study, parenting stress among the mothers and fathers of children with asd and its association with the severity of asd positive correlation coefficients were obtained between the psi - parent domain score and cars rating score and also between the total stress index and cars rating score for fathers. it is thus suggested that fathers of children with more severe developmental disorders experience more stress. mothers showed significantly higher scores in the three psi subscales including psi - child domain score, psi - parent domain score, and total stress index than fathers. in general, parenting stress indexes in fathers were lower than those in mothers. it was not surprising, as usually in iranian culture, mothers are more involved than fathers in bringing up their children. this finding was also reported by hastings. taken together, it seems that the severity of asd is correlated with the parenting stress indexes of fathers, since this relation did not reach a significant level for mothers. so, mothers had more parenting stress than fathers and their stress did not have a significant correlation with the severity of symptoms. it might be because of more emotional reaction of mothers to the diagnosis of asd in their children. however, the parenting stress of fathers is significantly correlated to the severity of disorder in children. a transactional model proposed by hastings in 2002 could explain this correlation. according to this model, the severity of child 's problems leads to more parenting stress, which in turn interferes with appropriate parenting strategies and results in more child behavior problems. these results are consistent with several other studies. for example, in a study by tobing., the total score of psi was significantly different between the two groups of parents of autistic children and those of pdd - nos children, although in that study, only mothers problems were investigated. in another study, they showed a significant correlation between the severity of disruptive behaviors of children and parental stress or negative mood. concurrently, benson. showed positive correlations between disruptive behaviors of children and parental depression. similar results were also obtained in other studies. on the other hand, a few studies like those of phetrasuwan. it should be noted that all the studies mentioned above evaluated the correlation between the severity of children 's behaviors and the parenting stress in general indexes. in this study, however, we evaluated all psi indexes and subscales. furthermore, this was a cross - sectional study, and thus, we did not evaluate the longitudinal process of parenting stress among parents of children with asd. future studies are needed to propose a more complete model for related factors of parental stress among parents of asd children. to conclude, the findings of this study revealed that mothers of children with asd had higher levels of parental stress than fathers. the amount of stress in fathers was correlated to the severity of disorder in the child. so, fathers whose children had more severe disorder reported higher levels of parenting stress. these findings, consistent with several previous studies, show that parents with asd children have many emotional needs which should be considered in planning the effective treatment strategies for these children and their families. knowing the nature of parental stress in parents with asd children may help the mental health professionals such as nurses- who work with these children and their families- to provide more support for these parents. for example, considering the higher level of stress in fathers of children with more severe disorders, inclusion and assessment of these fathers in mental health programs seems necessary, although it seems that all mothers with different degrees of severity of disorders in their children need more support and intervention to reduce their stress level. | background : most of the studies about parenting stress among parents of children with autistic spectrum disorder (asd) have been conducted in western societies. the objective of this research, conducted in iran, is to evaluate the parenting stress among fathers and mothers of children with asd and find the correlation between severity of the disorder in children and the level of parental stress.materials and methods : participants included 42 couples having children aged between 2 and 12 diagnosed with asd based on diagnostic and statistical manual of mental disorders, fifth edition (dsm-5) criteria. the diagnosis was made by two child and adolescent psychiatrists. demographic information of the participants was collected using a questionnaire. the severity of pervasive developmental disorder in children was determined based on childhood autism rating scale (cars) ; stress of parents was measured using parenting stress index (psi). collected information was analyzed by the spss (version 16) software.results:evaluation of subscales in participants data showed a positive correlation coefficient between the psi - parent domain and childhood autism rating scale - parent form cars - p rating (r = 0.339, p = 0 0.028) and also between the total stress index and cars - p rating (r = 0.333, p = 0.031) for fathers. it is thus suggested that fathers of children with more severe developmental disorders experience more stress. the results showed significant differences between fathers and mothers in the three psi subscales including psi - child domain score (p < 0.005), psi - parent domain score (p < 0.005), and the total stress index (p < 0.005). mothers had significantly more stress than fathers.conclusions:these findings show that parents with asd children have many emotional needs which should be considered in planning the effective treatment strategies for their children. |
according to a recent survey conducted by harvard school of public health and alzheimer 's europe consortium on alzheimer 's disease (ad), dementia of the alzheimer 's type is a major cause of health concern in adults. a similar trend is predicted in most countries in sub - saharan africa (ssa) where the proportion of elderly people is expected to rise over the coming years. worldwide, the prevalence of dementia among those aged 60 years and above ranges from five to seven percent and studies conducted in developed countries have consistently shown that ad is the most common type of dementia followed by vascular dementia (vad). however, there are scarce and conflicting reports on the prevalence of dementia and its subtypes in ssa [3, 5, 6 ], which may have far - reaching implications on public health policies on dementia in the region. while some studies suggest a lower prevalence of dementia in some parts of ssa [3, 710 ], other studies report prevalence rates comparable to those reported from western countries [6, 11, 12 ]. a variety of reasons may account for the varying reported prevalence rates of dementia in ssa. this is a vast territory with a population of 1.1 billion people [13, 14 ], and the number of people aged 60 years and above is projected to rise to over 67 million by 2030. the region consists of several ethnic groups, with different cultures, languages, diets, and traditions, which may impact the prevalence of diseases in unique ways. additionally, the relatively high prevalence of communicable diseases such as hiv - aids, low life expectancy at birth, the rising prevalence of cardiovascular risk factors such as hypertension and diabetes, and low - literacy level in ssa are important factors that are also reported to influence the epidemiology of chronic diseases like dementia [16, 17 ]. further, genes play a role in the development of dementia and may impact its epidemiology in the genetically diverse african population. the factors mentioned above, combined with the limited amount of region - wide, standardized epidemiological studies in ssa, call for a review of studies on dementia in the region. the objective of this paper is to identify the prevalence, incidence, and risk factors of dementia in ssa in order to gain a clearer view of this major public health concern. we conducted a search of medline (from january 1st, 1992 to december 31, 2013) for epidemiologic studies using the keywords dementia or alzheimer 's and africa, with no restriction to language (figure 1). subsequently, each author reviewed the abstracts of all articles that were identified through the search. studies were selected for further review and analysis if they satisfied the following inclusion criteria : studies that related epidemiologic data (i.e., prevalence, incidence, or risk factors) on dementia in ssa (i.e., 49 sovereign nations, 2 overseas departments of france, and 1 overseas british territory located fully or partially south of the sahara desert) (figure 2) ; studies that were population or hospital based ; studies that included persons aged 60 years and above ; studies that used validated screening and diagnostic tools for dementia and dementia subtypes ; studies describing histological findings from brain autopsies of elderly subjects. references of selected articles were also reviewed in order to identify additional relevant articles that met our selection criteria. when there was a disagreement between the authors as to whether an article should be selected for review, a discussion took place and both authors reached a consensus. studies were excluded on the basis of the following exclusion criteria : studies not conducted in ssa;studies that were reviews, case reports, or case series;studies that did not relate epidemiologic data;studies that did not discuss dementia or its subtypes in individuals aged 60 years and above. studies not conducted in ssa ; studies that were reviews, case reports, or case series ; studies that did not relate epidemiologic data ; studies that did not discuss dementia or its subtypes in individuals aged 60 years and above. a summary of the studies that were selected is provided in tables 1 and 2. the abstracts of all the articles were reviewed and 35, that met the inclusion criteria, were selected for further review (figure 1). six additional articles were identified from the references of the selected articles, making a total of 41 articles that were finally reviewed. the 41 articles included one study (2.44%) each from burkina faso, cameroon, ghana, and the republic of congo, two studies (4.88%) each from benin republic, kenya, senegal, and south africa, three studies (7.32%) from central african republic and tanzania, and 23 studies (56.10%) from nigeria. twenty - seven (65.85%) studies were population - based ; thirteen (31.71%) were hospital - based studies. most of the population - based studies had study participants ranging from 184 persons in a kenyan study (84 controls versus 100 demented persons) to 4,706 persons in the indianapolis - ibadan epidemiological study of dementia (2,494 nigeria - yoruba versus 2,212 african americans in indianapolis), while the range for hospital - based studies was 23 to 240,294 participants (tables 1 and 2). overall, the reported age - adjusted prevalence of dementia for the population - based studies we reviewed varied widely ranging from 2.29% (ad = 1.41%) in nigeria - yoruba, aged 65 years and above, who lived in the idikan community in ibadan city, to 21.60% (ad prevalence not reported) in the rural hai district of tanzania (study participants aged 70 years and above). the reported prevalence of dementia for hospital - based studies ranged from 0.05% at a neuropsychiatric practice in southwestern nigeria (survey period 19982007), to 8.87% at a geriatric center in dakar, senegal. further, dementia accounted for 6.90% of patients with acute confusional state in a hospital in tanzania, while 74.00% of 305 patients who presented to a memory clinic in south africa were diagnosed with dementia. the incidence of dementia in ssa was only reported in two population - based studies both conducted in nigeria - yorubas. the age - standardized annual incidence rate of dementia reported by one of the studies was 1.35% (ad = 1.15%), while the other study reported a dementia incidence of 2.19% in a survey of 1225 yoruba subjects, aged 65 years and above. major risk factors for dementia that were identified by most of the population - based studies included increasing age, female gender, cardiovascular disease, and low - literacy level [6, 10, 35 ]. in most studies, ad was the most reported dementia subtype [810, 22, 36, 52 ]. while there were reports of a high frequency of the apoe - 4 allele in africans, most studies found no significant association between the apoe - 4 allele and dementia in ssa [8, 9 ]. the first community - based study we found on the prevalence of dementia in ssa was conducted in ibadan, nigeria, in 1992. the authors found impaired cognition in 4.4% of the 932 study participants (293 were aged 65 years and above), and none met the dsm - iii - r diagnostic criteria for dementia, suggesting that dementia was a rare disease in nigeria. a year later, the authors conducted a similar but hospital - based study in which they found that 37 out of a total of 57,440 hospitalized patients had dementia. of the 37 patients, 18 (48.70%) had vascular dementia and one (2.70%) patient was identified as having probable primary neurodegenerative disease. additionally, a study of 198 postmortem brains conducted at a university hospital in ibadan revealed a paucity of histological markers of ad (cortical neuronal loss, amyloid beta plaques, neurofibrillary tangles, and amyloid angiopathy). in 1995, prevalence data on dementia from a collaborative project between researchers in indianapolis, united states, and ibadan, nigeria, the indianapolis ibadan dementia research project (iidp), was reported. the authors found the prevalence of dementia in an ibadan community to be 2.29% (ad = 1.41%). the study enrolled 2494 yorubas and 2212 african american indianapolis residents, aged 65 years and above. it is worth noting that the dementia screening instruments used for the ibadan - indianapolis study was customized to reflect the literacy level and culture of the study participants. in another well - powered, cross - sectional survey of persons who lived in the rural djidja community of benin, the reported prevalence of dementia was also low at 2.60% in those aged 65 years and above. two years later, a similar prevalence study conducted in the urban city of cotonou in benin, reported a nonsignificantly higher but comparable prevalence of 3.70%. a lower prevalence of 2.85% was also reported at a neurology clinic in yaound, the capital of cameroon, where the authors reviewed the medical records of 912 patients who visited the clinic from may 2005 to december 2011. the cameroon finding is similar to a study conducted in eastern nigeria where dementia accounted for 3.00% of all neurological admissions into the medical ward of a university hospital between 2003 and 2007. in northern nigeria, the prevalence of dementia in a cross - sectional survey of 322 hausa - fulanis, aged 65 years and above, was 2.79% with ad accounting for 66.67% of cases. although this was a survey of nursing - home residents in cosmopolitan lagos, the authors found that 11 (37.93%) of the 29 residents had dementia, a prevalence that is close to those reported in similar institutions in western countries. further, turkson and asamoah reported that dementia was the second most common diagnosis made at a psychiatric out - patient clinic in accra, ghana, between 1989 and 1993 in 35 patients, aged 60 years and above. additionally, a cross - sectional survey conducted in central nigeria reported a slightly higher prevalence of dementia (6.40%) than was reported in studies conducted in ibadan, nigeria. two hospital - based surveys in senegal equally reported higher prevalence rates of dementia of 6.60% (in participants aged 55 years and above) and 8.87% (participants aged 65 years and above) [49, 51 ]. similarly, a population - based study conducted in the central african republic capital city of bangui reported a dementia prevalence of 8.10%, a rate that is similar to data from western countries. in 2012/13, a two - phase cross - sectional survey of six villages was conducted in the rural hai district of tanzania (subjects aged 70 years and above) using two different diagnostic tools for dementia, the dsm - iv and the 10/66 dementia research group diagnostic criteria for dementia for low and middle income countries [6, 40 ]. surprisingly, a higher dementia prevalence of 21.60% was found using the 10/66 diagnostic criteria compared to a prevalence rate of 6.40% when diagnosis was based on the dsm - iv criteria [6, 40 ]. only two of the studies we reviewed reported incidence data on dementia, and both were population - based longitudinal studies conducted in ibadan, nigeria [24, 35 ]. after a five - year followup, the first study reported the age - adjusted incidence of dementia in persons aged 65 years and above as 1.35% (ad = 1.15%), while the estimated incidence of dementia in a similar cohort of elderly participants in a 2011 study was 2.19% after a 3-year followup. a fairly broad range of genetic and environmental risk factors for dementia was reported by many of the studies we reviewed. studies conducted in nigeria, kenya, tanzania, and benin all reported a high frequency of the apoe - 4 allele (genetic risk factor for ad) in africa [8, 9, 20, 25, 26, 39 ]. despite the high frequency of the apoe - 4 allele found in africans, there was a general lack of association between the allele and dementia in the region [21, 25, 39 ]. interestingly, guerchet., in their benin study, reported a significantly lower frequency of the apoe - 2 allele in study participants with dementia. interaction between genetic and environmental risk factors in the development of ad was highlighted in some studies. for instance, hall. found that in yoruba subjects who had high levels of cholesterol and ldl in conjunction with the apoe - 4 allele had a decreased risk of ad compared to subjects without the allele. the effect of gene - gene interaction on dementia was reported by a study that aimed to compare the age- and gender - specific distribution of the apoe and alpha-1-antichymotrypsin (act) genes and the effect of this interaction on ad. in this study, kamboh. suggested that the higher prevalence of ad in both caucasian and black women may be due to the modifying effects that act has on the apoe gene. specifically, the study found a higher frequency of the acta and apoe 4 alleles in nigerian blacks. the authors hypothesized that the interaction between these two alleles may account for the higher prevalence of dementia observed in women. environmental factors reported to be associated with dementia in ssa include the following : increasing age, female sex, positive history of hypertension, hypercholesterolemia, diabetes mellitus, peripheral arterial disease, stroke, low level of education, diet, depressive symptoms, and low body mass index [8, 9, 27, 29, 32, 33, 35, 37, 38, 47, 54 ]. in an iidp study, a comparison of smoking history and mean body mass index (bmi) showed that these factors were significantly higher in african - americans than in the yoruba suggesting that environmental factors play a significant role in the development of alzheimer 's dementia. an additional two studies found hypertension and low bmi to be associated with an increased risk of dementia in elderly yoruba [30, 31 ]. similarly, increasing age, female gender, hypertension, low weight, living alone, and low education level were reported to be significantly associated with dementia in a survey of elderly study participants living in bangui, central african republic and brazzaville, congo.. found that self - reported hypertension was a protective factor for alzheimer 's dementia in yorubas. increased homocysteine levels were also reported to be associated with a similar but nonsignificant increase in dementia risk for both yoruba and african americans although there was a significant difference in folate levels between the two sites. further, two senegal studies linked age, illiteracy, and low social network to the development of dementia [49, 51 ]. the senegal findings are consistent with those of a cross - sectional study conducted in south africa the south africa study found that participants with dementia and mild cognitive impairment were of advanced age and had less than 12 years of formal education in addition to having a higher prevalence of vascular events such as hypertension and stroke. however, this study found no significant association between the sex of participants and dementia. more recently personality change was reported to be an indicator for future dementia in elderly african americans and nigeria - yoruba. this review highlights the fact that the reported prevalence of dementia in ssa varies widely. because age is the strongest risk factor for dementia [57, 58 ], the low prevalence of dementia reported in ssa may be associated with the low life expectancy in the region. additionally, the paucity of epidemiologic data on dementia makes it difficult to get an overall picture of the burden of the disease in this region. employing this approach might contribute to the reported low prevalence of dementia because, in several african cultures, people with dementia and other mental health problems are often stigmatized. furthermore, only few studies provided age - adjusted rates for dementia despite differences in the age - structure of countries in ssa. therefore, inferences based on a comparison of crude prevalence data on dementia across studies may be misleading. for hospital - based studies, low utilization of healthcare facilities by the elderly might have contributed to the reported low prevalence rates of dementia. this may also pose a special challenge for researchers working on dementia who adopt standardized dementia screening tools that were originally developed for western societies. most of the studies included in our review used standardized screening tools for dementia in accordance with internationally recognized guidelines. however, some researchers customized these screening tools to the culture, language, and literacy level of study participants, as was the case with the iidp and the test of senegal, a dementia - screening tool, among other studies [6, 8, 34, 35 ]. this approach is novel and could be considered in developing a harmonized screening tool for dementia in ssa in the future. the finding that there was a lack of association between the apoe - 4 allele and dementia appears to be unique to the african population as the presence of this allele has been associated with a higher prevalence of ad in caucasians and african americans [25, 39 ]. in fact, hall. found a higher risk for ad in subject participants with high cholesterol and ldl levels who lack the apoe - 4 allele. additionally, the finding that the absence of the apoe - 2 allele in study participants in benin is significantly associated with dementia, and cognitive impairment is unique and calls attention to the role that genes play in the prevalence of dementia in specific ssa populations. further, urban versus rural living was found to be associated with dementia. while two studies conducted in benin found a nonsignificantly lower prevalence of dementia in the rural djidja community (2.60%) compared to the urban city of cotonou, benin, (3.70%) [9, 10 ], gureje. found rural living to be associated with an increasing incidence of dementia in southwestern nigeria. for instance, guerchet. attributed the higher prevalence of dementia in two urban cities of central africa to hypertension, among other risk factors. the lower prevalence of cardiovascular diseases and diabetes in yoruba compared to african americans living in indianapolis was also suggested to play a role in the low prevalence of dementia in yorubas. the yoruba diet which is low in calories, fat, and salt but high in fiber and ascorbic acid was also identified as being protective against ad. overall, the studies reviewed suggest that genetic and environmental factors also affect the epidemiology of dementia in ssa. however, further research into the association between these factors and dementia should be encouraged. this review provides an overview of the scope of epidemiologic studies conducted on dementia in ssa. to that effect, both community and hospital - based studies conducted over the last twenty - two years were included in our analysis. in addition to presenting prevalence data, we also reviewed available data on the incidence and risk factors (including genetic and environmental factors) of dementia in ssa. for instance, our initial search was limited to the medline database and might have excluded some relevant work. finally, because most of the studies we found were conducted in single communities in various countries across ssa, the results lack external validity. this review of published work on the epidemiology of dementia in older persons in ssa suggests that research in this area is limited. most of the population - based studies were in single communities and may not be representative of the country in which they were conducted. overall, earlier studies reported a lower prevalence of dementia, while recent studies have put these findings into question suggesting that dementia prevalence rates in ssa may in fact be similar to western countries. based on these observations, more epidemiologic studies that are representative of the ssa population should be encouraged. for instance, comparison of genetic polymorphisms between different communities in the region may unravel subtle factors that contribute to the epidemiology of dementia. the use of a harmonized screening tool for dementia that accounts for differences in literacy levels and sociocultural characteristics is also suggested. in other regions of the world, dementia has been established as a disease of high economic and public health significance. as the population of the elderly is predicted to rise globally, the burden of dementia in ssa is likely to increase. therefore, stakeholders in public health in the region are advised to map out strategies to tackle this important public health issue. | objectives. to review epidemiologic studies on the prevalence, incidence, and risk factors of dementia in sub - saharan africa (ssa). methods. a medline search (from january 1992 to december 31, 2013) of epidemiologic studies, with no language restriction, was conducted using the keywords dementia or alzheimer 's and africa. we selected for review population and hospital - based studies that reported the prevalence, incidence, or risk factors of dementia in ssa in people aged 60 years and above. references of selected articles were reviewed to identify additional relevant articles that met our selection criteria. results. of a total of 522 articles, 41 were selected and reviewed. the reported prevalence of dementia in ssa varied widely (range : 2.29%21.60%) ; alzheimer 's disease was the most prevalent type of dementia. only two studies conducted in nigeria reported incidence data. major risk factors identified include older age, female gender, cardiovascular disease, and illiteracy. conclusion. data on the epidemiology of dementia in ssa is limited. while earlier studies reported a lower prevalence of dementia in older persons, recent studies have put these findings into question suggesting that dementia prevalence rates in ssa in fact parallel data from western countries. |
almost 170 million people are infected with hepatitis c virus (hcv) globally, which accounts for 2 to 2.2 percent of world population. the virus prevalence is various in different countries and has been reported between 0.1% and 12%. the main routes of this virus transmission are through blood, sexual contacts and sharing syringe practiced in shooting galleries (1). in iran the drug abusers are the main source of infection (2) ; they transmit the infection through practicing unsafe sex, sharing syringes and using shared shaving razors. the second important group in danger of gaining the infection are those who received blood before the start of blood screening program in 1995 (3). these include thalassaemia and hemophilliac patients ; the prevalence rate of infection in them is 11.8% and 53.3% respectively (3). hcv prevalence in general population in iran is estimated to be between 0.12% and 0.89% (4). many people around the world are infected by hepatitis b virus (hbv). the world health organization (who) has estimated that almost two billion people have been infected with this virus globally and almost 350 million chronically infected people live worldwide (5). prevalence of this virus in southeast asia, china and some parts of africa is high and reaches 8%, while in developed countries this rate is lower than 2% (5, 6). according to the latest reports, the rate of hbv prevalence in iran has declined to less than two percent (7, 8). hcv and hbv are two major causes of liver cirrhosis and hepatocellular carcinoma (hcc) (1, 6) and the rate of hbv - hcv co - infection is different among hbv chronic patients, ranging from 4.54% to 0.7%, which complicates the process of management and treatment of infected people (9, 10). human t - cell lymphotropic virus-1 (htlv-1) was first discovered by poiesz in the lymphocytes of a patient with cutaneous t - cell lymphoma. this virus, after a long period of incubation time, causes a particular type of lymphoma called adult t - cell lymphoma (atl) (11, 12). this virus also causes a neurological disorder called tropical spasmatic parapheresis (tsp) (12). htlv-1 is highly prevalent in southwest of japan, caribbean basin and some parts of africa (13). in iran this virus is prevalent in northeast of iran (khorasan province). in a study, the rate of htlv prevalence in volunteer blood donors of this province reported 0.77% (14). in another study among thalassemia patients and healthy control subjects, the researchers found that the rate of htlv-1 infection among patients was 1.6% in comparison to 0.5% in healthy control subjects (15). the aim of this study was to assess the hbv, hcv, htlv-1 seroprevalence among individuals attending the endoscopy ward and also evaluating the association between some demographic criteria with the status of antibody against these viruses. this descriptive cross sectional study was performed between 2009 and 2011on two hundred and nineteen individuals attending the endoscopy ward of taleghani hospital, tehran, iran. blood samples of enrolled individuals were taken and a questionnaire containing demographic information was filled for each participant. the study was approved by the institutional medical ethics committees of research center for gastroenterology and liver disease of shaheed beheshti university of medical sciences. sera were separated from blood and were kept in -20 degree celsius freezer until the serologic tests were undertaken. the antibodies against htlv-1 and hcv were assessed through enzyme linked immunosorbent assay method (dia.pro italy). for detection of hepatitis b virus infection status, at first sera were tested for antibody against hepatitis b core antigen (anti - hbc ab) using elisa technique (dia.pro) and if the result were positive, then we would test the sera for hepatitis b surface antigen (hbs ag) (dia.pro). test results and information gained from questionnaires were entered into spss program (spss inc, chicago, usa) and all of statistical analysis was performed by it. student s t - test was utilized to compare means of some continuous variable of two independent sample groups. continuous variables are represented as mean standard deviation and other parameters as frequency and percentage. a p - value of 0.05 or less was considered statistically significant and all reported p- values were two sided. 92 of them (42%) were male and 127 (58%) were female. the mean age of the population was 39.87 16.47 years ; their age range was between 13 and 84 years old. the mean age of male participants was 37.51 16.33 and the mean age of female participants was 42.97 16.98. there was no statistically significant relationship between gender and mean age (p = 0.076). two subjects (0.9%) had hbs antigen, a sign of active infection, while 24 of anti - hbc positive individuals (92.31%) had cleared the infection (table 1). the frequency of antibody against hbv, hcv and htlv-1 among participants hbc ab : antibody against hepatitis b core antigen, hbs ag : hepatitis b surface antigen, hcv ab : antibody against hepatitis c virus, htlv-1 ab : antibody against human t - cell lymphotropic virus-1 mean age of those subjects who had antibodies against hbc antigen was 48.88 17.46, whereas the mean age of those negative for antibody was 38.7116.02 ; the difference in these two groups was statistically significant (p = 0.003). fourteen individuals from 26 people with anti - hbc antibody were female and twelve were male. there was no significant relationship between gender and anti - hbc antibody status (p= 0.65). the two subjects who had hbs ag were a male 51 years old and a female 61 years old. because of the low frequency of positive subjects for htlv-1 antibody and lack of positive individuals for hcv antibody, we were not able to perform any statistical analysis for these patients. however, the mean age of positive subjects for htlv-1 was 61.50 15.18 years and the negative individuals were 39.48 16.26 years. viral hepatitis is one of major concerns of public health in countries like iran (16). htlv-1 infection plays an important role in etiology of many cancers including atl and gastric cancer (13, 17). in our study we did not find any individual with anti - hcv antibody which was similar to the results achieved by moradi and colleagues (18). mohebbi and colleagues in another study found out that the rate of hcv infection was only 0.2% among pregnant women in western iran (10). it is an indicator that the rate of hcv infection in our country is low. apparently our findings is in contradiction with the results of sarkari and colleagues (19), but in that study studied subjects were from a high risk population. results of this study showed that a considerable number of participants have had exposure to hbv infection (11.87%), but have cleared the infection. there was a significant relationship between mean age of participants and anti - hbc ab status, an indicator of a high prevalence of hbv infection in the past. farzadegan and colleagues reported the rate of hepatitis b antigen among iranians between 2.5 and 7.2 percent (20). according to different reports three percent of iranians. additionally we have to keep in mind that with increasing the age of a subject, one s chance of contracting the virus rises accordingly. in alavian and colleagues review article, gender was mentioned as a risk factor for acquiring hbv infection (8). however, we did not find any association between gender and anti - hbc seropositivity. only 0.9% of our studied population had hbs antigen (an indicator of active infection). this low rate can be an indicator of declining trend of hbv infection in iranian general population. this observation can be accounted for by mass mandatory vaccination in children and voluntary vaccination in adults and the improved condition of sanitation in iran and increase of public knowledge about routes of hbv transmission in recent years. however in high risk individuals the rate of hbv infection in these people is still high (22, 23) current study shows that htlv-1 prevalence rate is 1.82%. abbaszadegan and colleagues reported the htlv-1 seroprevalence rate in 2003 in khorasan province 0.77% (14). tarhini and colleagues reported that in the years 2004, 2005 and 2006 the rate of htlv-1 prevalence has declined to 0.5%, 0.44% and 0.42%, respectively (24). our study shows that the rate of infection in our studied population is higher in comparison to the previous studies. however our study is in accordance with the results of study performed by arjmand and colleagues on iranian organ donors that reported the rate of htlv-1 prevalence 1.87% (25). results of this study are in accordance with the results achieved by heidari and colleague in which they studied the prevalence of blood - borne infections in cardiology ward of a hospital in mashahd ; the rate of hcv, hbv and htlv-1 infections were 0.3, 2.37 and 2.59 percent, respectively (26). in a study in west africa the researchers found out that the rate of anti - hbc ab, hbs antigen, hcv and htlv-1 in two separate regions were 69.6/76.4, 14.3/17.3, 2.2/1.5 and 1.4/0.5 percent respectively (27). in another study among immigrants to spain, the researchers found out that the rate of hbv, hcv and htlv-1 prevalence was 4.1, 2.9 and 0.8 percent respectively (28). the relatively high htlv-1 seroprevalence in compared to previous studies is alarming. in the light of achieved results we suggest that in addition to northeastern section of the country, the screening for htlv-1 become mandatory for other parts of iran. this practice is being implemented in japan, a country with a high rate of htlv-1 seropositivity (29). | aimthis study was designed to evaluate the frequency of antibody against these viruses in individuals attending the endoscopy ward of taleghani hospital tehran, iran.backgroundblood-borne viruses such as hepatitis b and hepatitis c virus and htlv-1 virus are among the world s public health problems. hepatitis viruses cause liver problems and htlv-1 infection can lead to adult t - cell lymphoma (atl).patients and methodsblood samples of 219 individuals attending the endoscopy ward of taleghani hospital between years 2009 - 2011 were collected. a questionnaire containing demographic data was completed for each subject. blood samples were tested for antibody against htlv-1, hcv and hbc by elisa (dia.pro italy). in case of positive results for anti - hbc, samples were also tested for hbs ag antigen.resultsninety two subjects were male and 127 were female. mean age of the population was 39.87 16.47. none of the subjects had anti - hcv antibody, while 4 of them had anti - htlv-1 antibody and 26 anti - hbc antibody ; which only two of these individuals had hbs antibody.conclusionthe results of this study show that frequency of anti - hcv and anti - htlv-1 antibodies are very low, while the frequency of anti - hbc was higher in the population. since htlv-1 is the causative agent of a type of blood cancer, it seems that screening of donated bloods in this region should be considered. |
ultrasound has been widely used for rapid assessment of critical illness and is regarded as a visual stethoscope. there are few reports on the diagnosis of intracranial lesions by ultrasound in icu patients. here we present a multiple trauma patient who had undergone craniectomy and in whom recurrent intraventricular hemorrhage was rapidly detected by ultrasound. a 29-year - old man was transferred from a local hospital 9 hours after a 5-meter fall. his glascow coma score (gcs) was 4 and both pupils were unequal in size. the diagnosis was severe cerebral contusion and subdural hemotoma in the left temporal and parietal lobe, bilateral lung contusion and left clavicle fracture. he received an urgent decompressive craniectomy and evacuation of hematoma, and was then admitted to the emergency icu. in the following days, his condition improved and his gcs reached 8, although this suddenly decreased to 6 on day 12. bedside ultrasound was performed instantly and showed acute intraventricular hemorrhage (ivh), which was confirmed by subsequent computed tomography (ct) (figure 1). bedside ultrasound and a head ct scan were arranged immediately, both showing recurrence of ivh (figure 1). the family refused further treatment and he then became brain dead (figure 1). computed tomography and ultrasound images of the head in a multiple trauma patient with craniectomy and recurrent intraventricular hemorrhage. (a, b) head computed tomography (ct) before craniectomy showing severe cerebral contusion and the deformed left lateral ventricle. (c, d) head ct on the fi rst day post - craniectomy showing the absence of the skull and the normal left lateral ventricle. (e) ultrasound image corresponding to the ct scan shown in (d) ; (f) the normal doppler pattern of the left middle cerebral artery (lmca). (g - i) head ct and ultrasound images after the fi rst intraventricular hemorrhage (ivh) : (g, h) hematocele in both lateral ventricles ; (i) slightly abnormal doppler pattern of the lmca. (j - l) head ct and ultrasound images after the second ivh : (j, k) both enlarged lateral ventricles with hematocele compared with (g) ; (l) reverse blood fl ow during the diastolic period of lmca. the absence of the skull may facilitate the ultrasound to detect the brain, and intracranial morphological abnormal signs such as dislocation of the midline, intracerebral hematomas, size of lateral ventricular and hydrocephalus may be clearly displayed on the screen. this rapid and non - invasive method can complement the results of ct and may help to reduce delays in surgical management. caricato and colleagues found that ultrasound in patients with decompressive craniectomy was as effective as ct to evaluate intracerebral disorders. in this multiple trauma patient, ivh happened twice after the craniectomy and was immediately identified by ultrasound. meanwhile, ultrasound may detect the characteristics of cerebral blood flow, which helps to assess intracranial pressure and cerebral perfusion pressure. ct : computed tomography ; gcs : glascow coma score ; ivh : intraventricular hemorrhage. | ultrasound may be a useful tool to evaluate intracranial abnormalities in critically ill patients undergoing decompressive craniectomy. we present a multiple trauma patient who had undergone craniectomy and in whom recurrent intraventricular hemorrhage and patterns of cerebral blood flow were rapidly detected by ultrasound. |
the holt oram syndrome is characterized by congenital cardiovascular malformations and skeletal abnormalities of the upper limbs, hence, the terms heart - hand syndrome and heart upper - limb syndrome. arm deformity covers a wide range of anomalies extending from minor abnormalities, through to serious, even handicapping, malformations. the most common cardiac manifestation is atrial septal defect (asd) ; however, other structural abnormalities and also rhythm disorders have been described. we herein present our experience in 4 consecutive patients over a 10 year period with the holt oram syndrome (table 1). a 15-year - old boy with tetralogy of fallot presented followed by a history of two previous aorto - pulmonary shunts and a stroke. physical examination revealed prominent kyphosis, and absent index, ring and little fingers of the right hand (fig. 1). electrocardiography (ecg) showed sinus rhythm (sr), biatrial enlargement, right axis, right ventricular hypertrophy (rvh) and t wave abnormalities. echocardiography revealed a large ventricular septal defect (vsd), pulmonary atresia and hypoplastic pulmonary arteries. the patient underwent a successful construction of a new central shunt, made an uneventful recovery and was discharged home in good condition. an asymptomatic 4-year - old girl presented with an asd. on examination she was found to have short both upper limbs and ring fingers. she was also diagnosed with mental retardation, psychomotor disorders and epilepsy in the context of trisomy 13. ecg showed sinus atrial tachycardia, incomplete right bundle branch block (rbbb) and rvh. the patient underwent surgical closure of the defect and was discharged from hospital in excellent clinical condition. a 1-year - old boy presented with tetralogy of fallot. on examination, kyphosis, scoliosis, hypoplastic clavicles, pectus excavatum, syndactyly of the left thumb and index finger and forward displacement of the right thumb were noted (fig. 2). the ecg showed sr, ventricular premature complexes and abnormal right axis deviation. echocardiography revealed a large vsd, aortic overriding, right ventricular outflow tract obstruction, rvh and also a secundum asd. the patient underwent standard surgical correction, made a good overall recovery and was discharged home in good clinical condition. a 2-year - old girl presented with a canal type vsd, concomitant mitral cleft and a history of a pulmonary artery banding at the age of 1 month. physical examination revealed syndactyly of the left thumb and index finger and forward displacement of the right thumb (fig. echocardiography revealed a large perimembranous vsd and a mitral cleft without a primum septal defect (figs. 4 and 5). a 15-year - old boy with tetralogy of fallot presented followed by a history of two previous aorto - pulmonary shunts and a stroke. physical examination revealed prominent kyphosis, and absent index, ring and little fingers of the right hand (fig. 1). electrocardiography (ecg) showed sinus rhythm (sr), biatrial enlargement, right axis, right ventricular hypertrophy (rvh) and t wave abnormalities. echocardiography revealed a large ventricular septal defect (vsd), pulmonary atresia and hypoplastic pulmonary arteries. the patient underwent a successful construction of a new central shunt, made an uneventful recovery and was discharged home in good condition. an asymptomatic 4-year - old girl presented with an asd. on examination she was found to have short both upper limbs and ring fingers. she was also diagnosed with mental retardation, psychomotor disorders and epilepsy in the context of trisomy 13. ecg showed sinus atrial tachycardia, incomplete right bundle branch block (rbbb) and rvh. the patient underwent surgical closure of the defect and was discharged from hospital in excellent clinical condition. kyphosis, scoliosis, hypoplastic clavicles, pectus excavatum, syndactyly of the left thumb and index finger and forward displacement of the right thumb were noted (fig. 2). the ecg showed sr, ventricular premature complexes and abnormal right axis deviation. echocardiography revealed a large vsd, aortic overriding, right ventricular outflow tract obstruction, rvh and also a secundum asd. the patient underwent standard surgical correction, made a good overall recovery and was discharged home in good clinical condition. a 2-year - old girl presented with a canal type vsd, concomitant mitral cleft and a history of a pulmonary artery banding at the age of 1 month. physical examination revealed syndactyly of the left thumb and index finger and forward displacement of the right thumb (fig. echocardiography revealed a large perimembranous vsd and a mitral cleft without a primum septal defect (figs. 4 and 5). the holt oram syndrome is an autosomal dominant condition first described in 1960 by mary holt and samuel oram and was named after them a year later by victor mckusick, when describing a similar case. multiple transcription factors regulate specific programs of gene expression in heart development. of these, tbx5, member of a family characterized by a highly conserved dna binding motif (t - box) participates in the specification of left / right ventricles and ventricular septum position during cardiogenesis. oram syndrome is caused by the mutation of a gene residing on the long arm of the chromosome 12q24. it is argued, however, that heart - limb syndromes are expressed by mutation in different genes suggesting a genetically heterogeneous disease with just one locus mapping on this chromosome. tbx5, nonetheless, directly or indirectly, alters the transcription of different genes in heart and limb. inward directed thumb as in the original description by holt and oram was found in 3 of our patients. however, a large number of different skeletal abnormalities have been reported. in particular, distally displaced, triphalangeal thumbs, hypoplastic thenar eminences, hypoplastic, absent or extra fingers, anomalies of the carpus, radial aplasia, phocomelia, hypoplasia of the clavicles and shoulders and pectus excavatum have been described. upper extremity deformity is in the preaxial radial ray distribution, usually bilateral, yet may be asymmetrical in severity, the left side usually being the worst. persistent ductus arteriosus, anomalous coronary arteries, mitral valve prolapse, persistent left superior vena cava, tetralogy of fallot, double outlet right ventricle and total anomalous pulmonary venous return have been described in patients with the holt also sinus node dysfunction, bradycardia, atrial fibrillation, atrioventricular block, rbbb, wolf - parkinson - white syndrome and even sudden cardiac death have been reported. hypoplastic and ectopic peripheral vessels are common, posing as a serious challenge in getting vascular access in these patients. a variety of morphological and anatomic criteria in conjunction of genetic analyses have led to the recognition of multiple heart - limb syndromes, with holt the association of a canal type vsd and mitral valve cleft with the holt oram syndrome (case # 4) has not been reported before to our knowledge. obviously, longevity of individuals with holt oram syndrome depends upon the identification and treatment of their cardiac maladies. in our case series, nevertheless, morbidity was minimal. since the majority of the clinical information available is provided mostly by isolated reports, further epidemiological and genetic analyses are required to determine the incidence and categorize the different types of heart limb syndromes. written informed consent was obtained from the patients for publication of these case reports and accompanying images. a copy of the written consent for each one separately is available for review by the editor - in - chief of this journal on request. vassiliki fotiadou md, theophili kousi md, christos apostolidis md, and prodromos azariadis md collected the data. cleo laskari md helped for data analysis and interpretation ; andrew c. chatzis md involved in study concept and design, data analysis and interpretation, writing and editing the paper and is the guarantor of the work.key learning pointsthe holt oram syndrome exhibits a variety of congenital cardiac anomalies and not only atrioventricular septal defects.although the syndrome affects predominately the upper limbs, it is also associated with other skeletal malformations.the trait may not be expressed in other family members. the holt oram syndrome exhibits a variety of congenital cardiac anomalies and not only atrioventricular septal defects.although the syndrome affects predominately the upper limbs, it is also associated with other skeletal malformations.the trait may not be expressed in other family members. oram syndrome exhibits a variety of congenital cardiac anomalies and not only atrioventricular septal defects. although the syndrome affects predominately the upper limbs, it is also associated with other skeletal malformations. | introductionthe holt oram syndrome is a rare congenital disorder involving the skeletal and cardiovascular systems. it is characterized by upper limb deformities and cardiac malformations, atrial septal defects in particular.presentation of casefour consecutive patients 115 years old with the holt oram syndrome presented over a 10 year span for surgical treatment of their cardiac maladies. the spectrum of the heart defects and skeletal deformities encountered in these patients are described and discussed.discussionthe holt oram syndrome is an autosomal dominant condition ; however absence of the morphological features of the trait in close family members is not rare. although patients are known to predominately present with atrial septal defects, other cardiovascular anomalies, including rhythm abnormalities, are not uncommon. skeletal disorders vary as well.conclusioncardiovascular disorders, skeletal malformations and familial expression of the holt oram syndrome, vary widely. |
hba1c is a retrospective analyte of the carbohydrate metabolism reflecting the mean blood glucose levels during the last 6 to 8 weeks. clinical studies revealed a close relation between late diabetic complications and the concentration of glycated proteins in blood. therefore hba1c determination is widely used to assess the metabolic status and to monitor the medical treatment of diabetic patients. the diabetes control and complications trial (dcct) and the united kingdom prospective diabetes study (ukpds) used hba1c as one of the main indicators for the quality of diabetes management,. hba1c is meanwhile recommended for screening of diabetes, since hba1c concentrations in blood are not affected by acute metabolic alterations in the patients. standardization of hba1c determinations affords the establishing and implementation of a reference measurement procedure with the highest accuracy possible. at the end of the 80s a certified reference material of hba1c was not available and an high performance liquid chromatography (hplc) peak of hba1c analysis developed by goldstein and co - workers became the reference for the calibration of hba1c measurement. the hplc procedure was accepted as a common voluntary consensus standard for the hba1c determination in the dcct- and ukpds - studies. moreover, the procedure was applied as standard protocol for analytical devices for hba1c measurements. the national glycohemoglobin standardization program (ngsp) became the basis for the calibration of hba1c measurements in the usa. according to this calibration hba1c values are reported in % of blood haemoglobin concentration. further investigations showed that the separation of hba1c from other proteins by hplc was incomplete and the specificity was not appropriate for international standardization. at the end of the 90s, the international federation of clinical chemistry (ifcc) had established a working group to develop an international reference measurement procedure for hba1c traceable to a standard of higher metrological order. the principle of the ifcc reference measurement procedure was the proteolytic treatment of the blood sample with endoproteinase glu - c cleaving glycated or non - glycated hexapeptides from the n - terminal -chains of the haemoglobin. the ratio of the glycated and non - glycated n - terminal hexapeptides of the haemoglobin -chain expressed in percent was defined as the ifcc unit. the decision created considerable confusion, since from now on there were two different calibrations with the same unit on the market. the results between the laboratories of the working group were regularly monitored by intercomparison surveys. the quality of measurements, expressed in terms of inaccuracy and imprecision, was improved during the measurement campaigns. from the collected data of the ifcc working group a master equation was developed to convert values from ifcc units into ngsp units and vice versa. since 2007, laboratories in europe, australia, and japan calibrated their analytical systems for hba1c according to the ifcc reference measurement procedure and started to report their results in mmol / mol to avoid confusions ; us laboratories remained with ngsp calibration and express hba1c values in ngsp %. the effort of the ifcc working group resulted in a remarkable improvement with respect to the ngsp consensus calibration. however, the key problem of the ifcc reference measurement procedure revealed to be the quality of hba1c and hba0 calibrator preparations and their traceability to the si standard. during the inter - comparison studies a more robust lc - ms reference measurement procedure improving the reproducibility of measurement was established,. in a recent study the traceability of hba1c, measurement results to si units has been achieved by isotope - dilution mass spectrometry, using glycated and non - glycated -n - terminal hexapeptides of defined purity and stated uncertainty of measurement as calibrators and deuterated -n - terminal hexapeptides as internal standards. the traceability is accomplished by hydrolysis of the unlabelled hexapeptide standards and the determination of the amino acid concentration by lc - id - ms calibrated with certified amino acid standards (figure 1 (fig. 1)). in a recent article little. claim the development of hba1c standardization from chaos to order during the last 15 years with the ngsp and ifcc standardization efforts and discuss problems arising from the implementation of the ifcc reference system. unbroken chain of comparison using a reference measurement procedure of highest metrological order and, if possible, a reference material of highest metrological level which is traceable to si units. with this iso standard the traceability of measurement the new reference measurement procedure is appropriate to set target values in external quality assessment schemes. in figure 2 (fig. 2) the dispersion of routine values around the different target values is demonstrated in a recent external quality assessment scheme (eqas) for hba1c. the three possible target values (consensus value, ifcc reference measurement procedure value, and idms value) are given in this scheme. the new calibration using the lc - id - ms procedure leads to slightly higher hba1c levels than the recent calibration according to the ifcc reference measurement procedure. in summary, a new standardization of hba1c measurement has been established at the highest level of accuracy, with stated uncertainty of measurement and with traceability to si units following the ifcc reference measurement protocol using lc - id - ms as procedure of highest metrological order. | glycated haemoglobin (hba1c) measurements are used in clinical studies and for the management of diabetic patients. various efforts were made to standardize the hba1c measurements with consensus standards and standards based on a reference measurement procedure with external calibration. according to iso 17511 a standard should meet highest accuracy possible, have a defined uncertainty of measurement and the calibration should be traceable to si units. for hba1c this has been realized using a lc - id - ms procedure based on the existing reference measurement procedure. |
the mammary gland is currently the only readily available animal bioreactor, but optimized expression vector construction is required for transgenic expression of recombinant proteins, and expression vectors still have strides to make [1, 2 ]. one strategy for optimized expression vectors includes using elements like insulators and matrix - attached regions, but the expression level of proteins is often modest. construction of the targeting vector is one of the most important techniques for mammary gland bioreactors, but the currently available techniques are laborious, time consuming, and inefficient. constructs with milk protein gene loci could be an ideal strategy for high level expression of foreign genes [2, 4, 5 ], but it is often difficult to manipulate the large size of the vector into donor cells for nuclear transfer [3, 6 ]. in our previous studies, a hybrid milk protein promoter (goat -casein, bovine s1-casein, and goat -lactoglobulin (blg)) with cytomegalovirus (cmv) enhancer was constructed and the expression level of recombinant human lactoferrin in the milk of transgenic mice was up to 8.2 mg / ml, which was more effective than using a single milk protein promoter (740 ng / ml). therefore, construction of a hybrid milk protein promoter with enhancer is an attractive way to improve the expression level of recombinant proteins. although the use of a hybrid promoter / enhancer is a valuable strategy in a transgenic mouse model, it is still unknown whether it is also effective for other animals, such as goats. genetic modification has resulted in animals that have tremendous utility for both agriculture and medicine. practical applications of transgenic livestock include improved milk production and nutrient composition, increased growth rate, improved feed usage, improved carcass composition, increased disease resistance, enhanced reproductive performance, and increased reproductive capacity [9, 10 ]. goat milk besides other milks is a significant food and nutrient source for people in many countries, with up to 55% of all milks produced in one country. to improve the nutritional value of goat milk and supply human -la for pharmaceutical research, expression of human -la in goat milk by transgenic technology appears to be promising. alpha - lactalbumin (-la) is a 14 kda ca - binding milk protein synthesized in the secretory cells of lactating mammary glands. its main function is to interact with b1,4-galactosyltrans - ferase-1 (b4gal - t1) to form lactose synthase complex, which is responsible for the production of lactose. expression of -la in the milk increased milk production via increased lactose synthesis, which led to increased neonatal growth [12, 13 ]. -la accounts for 28% of the total protein in human milk but only 3% of the total protein in goat milk. furthermore, -la contains a relatively high proportion of essential amino acids and thus has physiological and nutritional significance for humans. therefore, adding value (hla) to goat whey proteins by application of scnt may confer functional benefits on the health and growth of kids, creating a potential economic benefit. furthermore, hla is a nutritional protein in human milk, so it is beneficial to adjust the components of goat milk to resemble that of human milk to better satisfy the nutritional requirements of infants and adults. recently, the production of transgenic cows that produced human -la in their milk was reported to improve the nutritional value of the milk, but the same application in transgenic goats has not been reported. in the present study, we describe the use of the hla gene as a model for transgenic expression. a vector with goat blg promoter combined with cmv enhancer was constructed and transfected into goat fetal fibroblast cell lines (gffcs) for nuclear donors and the expression level of rhla in the milk of the transgenic cloned goats was tested. these data will provide the basis for the use of a hybrid promoter / enhancer strategy for producing transgenic goats. unless otherwise stated, all media and components were purchased from sigma - aldrich corp. (st. louis, mo, usa). the genomic dna (gdna) sequence encoding hla (genbank accession no. x05153.1), which contained exon 1 - 4, intron 1 - 3, and poly a sequence (2.36 kb), was prepared by polymerase chain reaction (pcr) using human blood dna as the template with primer sets (sense : gctcgagatgaggtt ctttgtc cctc ; antisense : gctcgagtgacttcaaagtgggacc). to facilitate the subcloning into pbcc, the xho i (takara) site was added to the 5 and 3-terminal end. the pcr reactions consisted of 94c for 3 min in the first instance, 94c for 40 sec, and 68c for 4 min for 30 cycles, with a final extension of 72c for 5 min. the resulting hla sequence digested by xho i was subcloned into the xho i site of pbcc named pblac (figure 1). the fragment for transfection was excised from pblac by sal i - not i (takara) digestion, run on 0.8% tris - acetate - ethylenediaminetetraacetic acid gel and purified using dna purification kit (qiagen co, ltd., uk) according to the manufacturer 's instructions. cmgecs were isolated from a hormone - induced lactating goat as previously described [17, 18 ]. for electroporation, 5 10 cmgecs were collected at 80% confluence, mixed with 20 g dna, transferred into a 0.2 cm cuvette (eppendorf, san diego, ca, usa), and subjected to one pulse of 0.2 kv and 100 s delivered by a gene pulser (eppendorf). cells were plated out in culture medium containing dulbecco 's modified eagle 's medium (dmem)/f-12 (gibco, carlsbad, ca, usa), 10% fetal calf serum (fcs ; gibco), 10 g / ml insulin, 5 g / ml transferrin, 5 g / ml hydrocortisone, 200 u / ml penicillin - g, and 200 g / ml streptomycin sulfate for 48 h and selected with g418 (400 g / ml). after 20 days of selection, a number of single colonies were isolated and expanded. the expression vector for hla was transfected into gffcs by electroporation as previously described by an.. briefly, the day before transfection, confluent fetal fibroblasts (at passage 1 to 2) were trypsinized, counted, and plated into six - well culture dishes to reach 80% confluency on the day of transfection. for electroporation, 1 10 gffcs were collected at 80% confluence, mixed with 6 g dna, transferred into a 2 mm cuvette (eppendorf), and subjected to one pulse of 0.4 kv, 100 s delivered by multiporator (eppendorf). cells were plated out in culture medium containing dmem / f-12, 10% fetal bovine serum (fbs), 200 u / ml penicillin - g, and 200 g / ml streptomycin sulfate for 48 h and selected with g418 (800 g / ml). after 14 days of selection, a number of transgenic single colonies were isolated, expanded, or frozen in liquid nitrogen. oocytes were recovered surgically at 2628 h after injection of lhrh by flushing the oviduct with ham f-12 medium (gibco) plus 0.5% fbs. briefly, mature oocytes with a first polar body were cultured in m16 containing 5 g / ml cytochalasin b for 30 min. after staining with 2 g / ml bisbenzimide (hoechst 33342) for 2 min, oocytes were held with a holding micropipette and the zona pellucida was partially dissected with a fine glass needle to make a slit near the first polar body. the first polar body and adjacent cytoplasm, presumably containing the metaphase - ii chromosomes, were extruded by squeezing with the same needle. trypsinized single cells (transgenic or nontransgenic (nt)) with a smooth surface were selected and transferred into the perivitelline space of enucleated oocytes. these couplets were placed in a 0.3 m mannitol solution containing 0.1 mm mgso4, 0.05 mm cacl2, 0.5 mm hepes, and 3 mg / ml bovine serum albumin (bsa) for 5 min and transferred to a chamber consisting of two electrodes overlaid with fusion solution, where they were fused by two direct current pulses (1.7 kv / cm for 40 s) delivered by an electrocell fusion manipulator (kefa ; institute of developmental biology, beijing, china). after incubation for 5 h in m16 medium, the fused couplets were incubated in m16 containing 5 m ionomycin for 5 min, cultured for 5 h in m16 containing 7.5 g / ml cytochalasin b and 2 m n-6 dimethylaminopurine prepared in m16 medium, and surgically transferred into synchronized recipients on day 0 of their estrus cycle. to detect pblac in transgenic donor cells and cloned goats, genomic dna was extracted and pcr amplification was performed. the pcr product of 875 bp was amplified with cla1 (5-tgttcccatagt aacgccaat-3) and cla2 (5-agcgaaactccacttcaaa-3) primers. the pcr product of 435 bp was amplified with neo1 (5-cactgaagcgggaagggactg-3) and neo2 (5- gcaatatcacgggtagccacg-3) primers. the pcr reaction was 95c for 5 min in the first instance, 94c for 45 sec, 61c for 45 sec, and 72c for 30 sec for 30 cycles, with a final extension of 72c for 10 min. the pcr products were then run in a 1% agarose gel, stained with ethidium bromide, and visualized under ultraviolet light. the quantitative real - time pcr was performed using the line - gene k fqd-48a pcr system with sybr premix kit (promega, wi, usa). reactions were done in a total volume of 20 l comprising 1 l sense and antisense primer (2 m), 10 l sybr premix, 7 l dh2o, and 1 l sample of genomic dna. all primers used for quantitative pcr are listed in table 2 ; pcr was performed at 95c for 2 min, followed by 40 cycles of 95c for 5 s and 60c for 30 s ; a melting curve was done at the end of the amplification for the specificity. quantification was performed with the standard curve method using five standard dilutions, in triplicate, of two goats (bc186 and bc228) gdna ranging from 16.50 to 0.33 ng (5000 to 100 haploid genome copies) per reaction. the copy number of hla gene in each goat was estimated ; actin sequence was used as endogenous gene. for detection of rhla secreted by cmgecs, 2 10 cells were plated into a six - well cell culture. confluent cells were cultured to induce expression of rhla in dmem / f12 containing 10% fcs, 10 g / ml insulin, 5 g / ml transferrin, 5 g / ml hydrocortisone, 5 g / ml prolactin, 200 u / ml penicillin - g, and 200 g / ml streptomycin sulfate for 48 h. after induction, the medium (200 l) was collected and stored at 70c for later use. milk was collected from lactating transgenic female goats (bc186 and bc228 ; 4 months of age) 18 days after hormone induction. milk was collected by gentle massage of the mammary gland, collected in a capillary tube, and stored at 70c until analysis. milk samples from cmgecs and transgenic goats were boiled in protein denaturing solution (1 : 1) for 10 min and run on a 12% sodium dodecyl sulfate polyacrylamide gel electrophoresis (sds - page) gel. the proteins (40 g) were electrophoretically transferred to polyvinylidene fluoride membranes. after transfer, the membranes were incubated overnight in phosphate - buffered saline with 0.1% tween-20 (tpbs) supplied with 4% bsa, followed by a 2 h incubation with 1 : 1000 (v / v) dilution of rabbit anti - hla (santa cruz biotechnology, inc. the membranes were washed with tpbs and incubated with secondary goat anti - rabbit igg - hrp (1 : 1000 dilution ; santa cruz biotechnology, inc., ca, usa) for 2 h. after washing a 96-well microtiter plate was coated with 50 l of rabbit anti - human la, at a 1 : 1000 dilution with 50 mm sodium bicarbonate buffer, ph 9.6 at 4c overnight. the plate was then equilibrated at room temperature (25c) for 1 h, the coating solution removed, and the wells washed with pbs. samples (50 l) at appropriate dilution and standards were prepared in tpbs, added to the wells, and incubated at 37c for 2 h. the samples were then aspirated out and the wells washed with pbs. secondary goat anti - rabbit igg - hrp at a 1 : 1000 ratio was added and incubated at 37c for 1.5 h ; then the wells were washed three times with pbs - t. fifty microliters of substrate (0.5 mg / ml diaminobenzidine, 1 mg / ml imidazole, and 1 l / ml 30% h2o2 added just before use) was then added in a dark room at 37c. the developed color was read at 490 nm on an elisa reader (rt-6000, rayto life and analytical sciences co., ltd. the expression plasmid containing the hla gdna was fused to the cmv sequence and flanked by the untranslated regions and flanking sequences of goat blg gene, which contained 4.2 kb of 5 and 1.2 kb of 3 caprine blg flanking no - coding sequence fused to 2.36 kb of hla gdna with a sv40 pa (figure 1). the resistant transgenic colonies were expanded and induced to expression of protein verified by western blot. the results showed that high - expression level (0.94 g / ml) of rhla was found in eight of 45 colonies in the culture medium. a single protein band of approximately 14 kda was shown on western blot analysis, with a very similar migration pattern compared with the commercial human milk - derived la (figure 2). to evaluate whether the transgene could affect cloning efficiency, gffcs were transfected with the pblac vector and 42 g418 resistance clones were obtained, 24 of which were confirmed to harbor the transgene by pcr. three lines (number 1 (n17iih27), number 2 (n17iih15), and number 3 (n17iih3)) were used for nuclear donor cells. development of the embryos reconstructed with hla transgenic and nt donor cells is summarized in table 1. a total of 334 one - cell stage embryos reconstructed with hla transgenic donor cells were surgically transferred to the oviducts of 25 surrogate mothers. five pregnant goats were carried to term and naturally delivered six kids (1.8%), three of which died within 2 days of birth. in the nt group, 132 cell couplets were produced using normal fetal fibroblast cells and the fusion rate of cell couplets was 80.3%. ninety - nine pronuclear - stage embryos were transferred into the oviducts of 12 recipient goats. five of these (41.7%) were confirmed pregnant on day 30, and two delivered a total of two cloned kids (2%). there was no significant difference in the rate of fusion (72.3% versus 80.3%), pregnancy (48% versus 41.7%), or nuclear transfer efficiency (1.8% versus 2%) between nontransfected and transfected cell lines (p > 0.05). among the three transgenic cell lines used, the cloning efficiency of number 1 was lower than that of numbers 2 and 3 (0.9% versus 1.9% and 2.4% (p 0.05). the pregnancy rate of surrogate mothers on day 35 for the transgenic group was slightly higher than for the nt group (48% versus 41.7%), but the fusion rate (72.3% versus 80.3%) and clone efficiency (1.8% versus 2%) were slightly lower. the clone efficiency was similar to the results reported using transgenic or nt donor cells and oocytes matured in vivo [3, 19, 33, 34 ]. in our previous studies, when the cmgecs were used for nuclear donor cells, the clone efficiency was 2%, similar to the result obtained with fetal fibroblast cells. these results may indicate that cmgecs have the same cloning efficiency as fetal fibroblast cells and may be another cell source for transgenic modification. in conclusion, transgenic goats that contained the hla gene were produced by scnt and a vector with a hybrid promoter and enhancer was able to drive the hla gene to express in vitro and in vivo. in addition, transfection of donor cells had no effect on the ability of nuclear transfer embryo development. | to improve nutrient content of goat milk, we describe the construction of a vector (pblac) containing a hybrid goat -lactoglobulin (blg) promoter / cytomegalovirus (cmv) enhancer. we also describe the generation of transgenic goats expressing rhla by somatic cell nuclear transfer (scnt). of 334 one - cell stage embryos derived from three transgenic cell lines and 99 embryos derived from non - transgenic (nt) cells surgically transferred to the oviducts of 37 recipients, two recipients delivered two kids (2%) from the non - transfected line and five recipients delivered six kids (1.8%) from transgenic cell lines, three of which died within 2 days. compared to the nt donor cells, transfection of donor cells does not negatively affect the development of nuclear transfer embryos into viable transgenic offspring. however, the clone efficiency in cell line number 1 was lower than that in numbers 2 and 3, and in the nt lines (0.9% versus 1.9% 2.4% and 2% ; p < 0.05). two transgenic cloned goats expressed rhla in the milk at 0.10.9 mg / ml. the mammary gland - specific expression vector pblac with hybrid blg / cmv can drive the hla gene to express in vitro and in vivo. these data establish the basis for use of a hybrid promoter / enhancer strategy to produce rhla transgenic goats. |
albuminuria (i.e., urinary albumin, or ua) is defined as an abnormally high amount of albumin in the urine and is a strong sign of early renal damage [14 ]. in type 2 diabetes and nondiabetic subjects, albuminuria is also associated with early- and long - term cardiovascular mortality [5, 6 ]. elevated ua reflects a general state of widespread endothelial dysfunction and vascular damage [710 ]. inflammation and endothelial dysfunction may be key mechanisms in the development of albuminuria [1113 ]. however, evidence of an association between markers of inflammation and albuminuria is limited and controversial. in diabetic subjects with albuminuria, no differences in c - reactive protein levels (a marker of inflammation) were observed compared with healthy controls. yet in another study, serum levels of sialic acid, another marker of inflammation, correlated with increasing albumin excretion. absolute neutrophil count (anc) is also a sensitive marker of inflammation, and the test for it is simple and inexpensive. recently, clinical studies have shown a link between neutrophils and the development of diabetic retinopathy [1618 ]. although albuminuria is an accepted sign of early renal injury, it is not known whether the anc is related. we hypothesized an association between anc and ua levels. like the world 's human population in general, china 's is aging and we chose to study the elderly. here, the ua creatinine ratio (uacr) was used as a measure of albumin excretion. since overnight uacr correlates well with ua excretion, this study specifically investigated an association between systemic anc and uacr in an elderly chinese population. this community - based, cross - sectional study focused on the clinical risk factors of albuminuria. we performed the study with outpatients of our hospital in shanghai, from march to august of 2010. all community - dwelling participants aged 60 years, including those residing in private residences and personal care homes, were recruited to a platform of chronic disease (pcd) prevention program for a routine medical checkup. participants who could not come to the prevention center were interviewed in their place of residence by trained personnel. all questionnaires and procedures were approved by the institutional review board in our hospital for research with human subjects. the identification of diabetes was based on the diagnostic criteria recommended by the american diabetes association in 1997. potential subjects included those with a history of past diabetes or who had newly received a diagnosis by oral glucose tolerance test. in total, 3053 subjects aged between 60 and 91 years (median age : 70 y) were considered for the study. the following subjects were excluded : 28 subjects presenting with painful urination, fever, cough, or skin damage ; 5 subjects who were incontinent and not capable of caring for themselves ; and 12 subjects with white blood cell (wbc) counts 10 10/l or serum creatinine (scr) 141 further 738 subjects had missing ua data, because they did not collect morning urine samples. therefore the subjects underwent a glucose tolerance test with a 75 g oral glucose overload. the blood samples were collected by edta tube before and at 2 h after the tolerance test. glucose, cholesterol, triglycerides, scr, and alanine aminotransferase (alt) levels were measured using a dimension vista analyzer (siemens ag). wbc, anc, and anc / wbc ratio values were measured using an automated 5-category hematology analyzer (japanese sysmex xs1000i). participants were asked to collect a random morning spot urine sample in a clean, lidded container. all urine samples were assessed centrally in a single reference laboratory at fifth hospital, shanghai, china. samples were centrifuged at 1500 g for 10 min and then stored at 80c prior to analysis. test results were considered positive for albuminuria (ua) at an albumin - to - creatinine ratio (acr) > 0 mg / g ; otherwise the results were accepted as negative (ua ; acr = 0 mg / g). microalbuminuria, or a moderate increase in ua, was identified as an acr from 30 to 299 mg / g. blood pressure was measured twice at about 8:00 a.m., with the subject seated and with an interval of 5 min between measurements. blood pressure measurements were taken on the right arm, which was relaxed and supported by a table, at an angle of 45 from the trunk (sphygmomanometer, yutu, shanghai, china). hypertension was defined as systolic blood pressure (sbp) 140 mmhg or diastolic blood pressure (dbp) 90 mmhg. the following measurements were recorded for all subjects : height, weight, waist circumference (horizontal position of the anterior superior iliac crest and twelfth rib edge midpoint), and hip measurement (measuring horizontally from the front of the pubic symphysis to the most convex point behind the gluteus maximus) by experienced nurses in the pcd program. body mass index (bmi) was calculated as weight / height (kg / m). mann - whitney u tests and chi - squared tests were used for analysis of continuous variables and categorical variables, respectively. the anc levels of the following subgroups of patients were calculated and compared by analysis of variance : nondiabetic ; diabetic without albuminuria ; diabetic with low - level albuminuria (0 < ua < 30 mg / g) ; diabetic with microalbuminuria (ua 30299 mg / g) ; and diabetic with macroalbuminuria (ua 300 mg / g). all subjects were categorized into 5 groups according to the quintile of anc levels (i v). multivariate logistic regression analysis was used to investigate an independent association between anc and ua. areas under the roc (auc) curve 0.5 were considered statistically significant (spss software version 17.0 ; spss, chicago, il, usa). the data analysis included 2265 participants aged between 60 and 91 years (median : 70 y) with a male - to - female ratio of 56.8 to 43.1 (table 1). compared with the 1011 participants who were free of diabetes, the 1254 participants with diabetes were older, with a higher prevalence of hypertension and increased sbp, anc, wbc, anc / wbc, and fasting blood glucose (fbg). the 641 participants testing positive for uacr (ua) were older, with higher bmi and waist - to - hip ratio, sbp, dbp, scr, anc, wbc, and anc / wbc compared with the 1624 persons testing negative for uacr (ua). as described in subjects and methods, all subjects were classified as follows : nondiabetic ; diabetic without albuminuria ; diabetic with low - level albuminuria ; diabetic with microalbuminuria ; or diabetic with macroalbuminuria (figure 1). anc levels and anc / wbc increased with the severity of ua (p < 0.0001). patients with macroalbuminuria had significantly higher anc and anc / wbc counts than did the patients in the other 4 groups (p < 0.001) regarding the results of the multivariate logistic regression analyses, after adjustments for age, bmi, gender, sbp, dbp, and scr, the odds ratios (ors) indicated that anc levels significantly correlated with risk of macroalbuminuria (p < 0.0001). compared with quintile i of anc, quintile v of anc had the highest or value (2.311, 95% confidence interval [ci ] : 1.6083.321 ; table 2). roc curves were plotted to evaluate the diagnostic value of age, bmi, waist - to - hip ratio, gender, sbp, dbp, alt, scr, total cholesterol, triglycerides, fbg, 2-hour glucose, and anc for macroalbuminuria. anc was the strongest predictive factor for macroalbuminuria (auc = 0.6001) followed closely by fbg (auc = 0.5876) and sbp (auc = 0.5767 ; table 3). to investigate interactions among anc, fbg, sbp, and scr, fbg sbp (model 2 ; variables are multiplied) and anc fbg sbp scr (model 3) indicated 1.67% and 3.12% increase, respectively, in the predictive value for macroalbuminuria, compared with model 1 (anc fbg), but these increases were not statistically significant (p = 0.5188 and 0.5338). thus anc and fbg were the most meaningful diagnostic indices for macroalbuminuria. we found that ancs significantly increased in diabetes with macroalbuminuria, and anc was the strongest factor predicting macroalbuminuria. these results indicate that neutrophil - mediated inflammation may be involved in the exacerbation of albuminuria. to the best of our knowledge, this is the first report describing an association between ua and anc levels in a population - based study. it is perplexing that the systemic neutrophil count, a very simple and inexpensive laboratory parameter, has not been reported previously in association with ua, although data from a study of 30 793 people conducted in korea showed an association between anc and diabetic retinopathy, after adjusting for the effects of blood pressure, blood glucose, and scr. in our present study, patients with albuminuria or those with diabetes had higher anc levels. to study further the association between diabetes, ua, and anc, subjects were stratified into a nondiabetic group and 4 groups with diabetes at different levels of severity of albuminuria. we found that patients with diabetes with macroalbuminuria had a notably higher mean anc than did the other 4 groups. in addition, anc was an independent indicator of macroalbuminuria, but it was not an independent indicator of ua. thus, anc might have an important role in accelerating the progression of albuminuria but not the formation of urinary protein. although establishing a causal mechanism for the association between anc and albuminuria was beyond the scope of this study, the underlying link may concern vascular damage. in clinical and laboratory studies, elevated neutrophil counts were found associated with increased levels of tumor necrosis factor- (tnf-), cytokine - induced neutrophil chemotactic factor 2 alpha / beta (cinc-2/), interleukin- (il-) 1, il-6, and c - reactive protein, as well as excessive production of superoxide and reactive oxygen species [2023 ]. based on the results of the present study and past investigations, we hypothesize that the systemic neutrophil count reflects the local number of neutrophils in renal vessels [24, 25 ]. under the influence of proinflammatory cytokines, neutrophils in renal vessels are activated and their adhesion is intensified. these responses cause abnormal leukocyte - endothelial interactions and ultimately vascular damage. in the present study, compared with the other 4 quintile anc groups, the highest level of the anc group had the highest or for the risk of macroalbuminuria and not quintiles ii or iii. this shows that the higher the anc level, the more likely the presence of macroalbuminuria, reflecting an overtly inflammatory status in patients with macroalbuminuria [24, 27 ]. the exact mechanism is not clear, but whether changes in the function or shape of neutrophils are involved warrants further research. first, the study design was cross - sectional and therefore we were not able to confirm a causal link between anc and macroalbuminuria. second, the inclusion of participants attending a routine health checkup in one community represents a potential source of selection bias, which should be considered when interpreting the results. third, information regarding other traditional risk factors for albuminuria, such as heavy exercise, could not be obtained and analyzed in this study. despite these limitations, our study involved many clinical and laboratory parameters in a large number of subjects and showed a new clinical risk factor for albuminuria in individuals, 60 years of age and older. the potential effect of neutrophil - mediated inflammation in the progression of macroalbuminuria warrants further research. | background. this study investigated an association between systemic absolute neutrophil count (anc) and albuminuria in elderly chinese people. methods. a cross - sectional study was conducted on 2265 participants attending a routine medical examination in minhang district as part of a platform of chronic disease program. their drug history, waist circumference, height, blood pressure, fasting blood glucose, anc, and urine albumin levels were recorded. this study conformed to the requirements of the strobe statement. results. of the 2265 subjects, 1254 (55.4%) were diabetic and 641 (28.3%) had albuminuria. the mean anc of patients with diabetes comorbid with macroalbuminuria was significantly higher than that of both the nondiabetic patients and patients with diabetes with lower levels of albuminuria ; the latter 2 groups had statistically similar anc. anc significantly and positively correlated with levels of urine albumin. based on multivariate analysis, with each 109/l increase in anc, the increase in rates of macroalbuminuria was significant but not in rates of albuminuria positivity. based on areas under the receiver operating characteristic curve, anc was the strongest factor predicting macroalbuminuria. conclusions. elevated anc was associated with macroalbuminuria in diabetes, indicating that neutrophil - mediated inflammation may be involved in the exacerbation of albuminuria. |
nocturnal enuresis (ne) is defined as nighttime bedwetting after developmental age when bladder control should have been established. anatomical and functional integrity of noradrenaline, dopamine and serotonin systems is required for continence. iatrogenic ne is an adverse event commonly reported in patients taking several central nervous system agents, in particular antipsychotics, (risperidone and clozapine), ssri and some antiepileptics (sodium valproate). despite enuresis being reported as a very rare adverse event in summary of product characteristics of some antihistamines, no single case report is available to date in literature. we herein report a case of a child presenting with ne after treatment with the antihistamine drug cetirizine. a 6-year - old female child presented with recurrent episodes of rhinitis, bronchitis and bronchospasm since the age of 2 years. her family history was positive for allergic diatheses. the rest of her past medical history was unremarkable with normal developmental milestones having been reached. she never experienced episodes of ne after bladder control was achieved at the age of 3 years. during an episode of persistent dry coughing, which was unresponsive to oral betamethasone 1 mg / day, she was prescribed add - on oral cetirizine 5 mg / day in the evening for a week. on day two months later, she was again treated with oral cetirizine at the same dosage for another episode of cough and bronchospasm. a total score of 9 (probable) was obtained on the naranjo causality scale. in particular, a subtle regulation between noradrenaline, serotonin and dopamine pathways is required for appropriate bladder control. functional imbalance of these neurotransmitters within basal ganglion structures appears to be central in the pathophysiology of enuresis and urinary incontinence. the substantial role of dopaminergic circuits is supported by the frequent neurogenic detrusor overactivity and voiding dysfunction in patients with parkinson 's disease or other extrapyramidal dysfunctions, due to nigrostriatal dopamine depletion. noradrenergic and serotoninergic systems exert their effects on continence directly, but also by facilitating or inhibiting dopaminergic pathways, respectively. overall, pharmacological agents depleting or blocking norepinephrine or dopamine cause incontinence or enuresis, while drugs increasing these pathways induce urinary retention [table 1 ]. experimental studies proved that the histaminergic system directly influences the serotonin transmission in the central nervous system, by the presynaptic inhibition of 5-hydroxytryptamine release. therefore, antihistamine treatment, acting on 5-hydroxytryptamine regulation, could involve a central serotonin disinhibition, leading to an imbalance of the serotonin / dopamine ratio. drugs reported to be associated with enuresis in particular, cetirizine in this patient could have enhanced serotonin pathways originating from raphe nucleus, which exert an inhibitory effect on dopamine release from the mesocortical tract. thus, this disrupted serotonin modulation can lead to a relative dopaminergic depletion, which eventually causes enuresis. | nocturnal enuresis is a common disorder in childhood, but its pathophysiological mechanisms have not been fully elucidated. iatrogenic nocturnal enuresis has been described following treatment with several psychotropic medications. herein, we describe a 6-year - old child who experienced nocturnal enuresis during treatment with the antihistamine cetirizine. drug rechallenge was positive. several neurotransmitters are implicated in the pathogenesis of nocturnal enuresis, including noradrenaline, serotonin and dopamine. antihistamine treatment may provoke functional imbalance of these pathways resulting in incontinence. |
a total of fifty male wistar rats (taconic), 12 weeks old, with a weight of approximately 360 g at arrival, were placed in makrolon iii cages in an open system, with five animals in each cage. they were kept under standard laboratory conditions with 12 h dark12 h light cycles and temperature 22 1c, relative humidity 55 5 % and twenty air changes per h. the rats had free access to food and tap water. the experiment was conducted according to the guidelines for care and use of experimental animals, and the protocol was approved by the norwegian state board of biological experiments with living animals. dss (mw 44000 ; tdb consultancy ab) at 50 g / l was administered in drinking water as previously described for 7 d to induce colitis. the rats were acclimatised for 7 d and then separated into five groups of ten rats. the following diets were given : (1) control, (2) dss + control, (3) dss + fo (5 %), (4) dss + fp (35 %) and (5) dss + fo + fp. all groups had free access to food on days 129, and dss was administered during the last week of the experiment in groups 25. all rats were killed the day after dss treatment was discontinued on day 30. at that time the animals were anaesthetised by inhalation of isoflurane (2 % ; isoba vet, intervet / schering - plough animal health) in an anaesthesia chamber. the control diet consisted of a standard casein diet with 20 % (w / w) protein (sigma - aldrich), and 7 % fat, composed of 5 % lard (a generous gift from ten kate vetten bv) and 2 % soyabean oil (dyets inc.). lard was replaced by 5 % fo in group 3 (epax 4020 tg, epax as), and casein partly by 35 % fp hydrolysate (marine bioproducts as) in group 4, and both in group 5. the fp were produced from salmon by - products (spine) by enzymatic hydrolysis using controlled autolysis with commercial proteases. the resulting hydrolysate was further fractionated using different forms of filtration including ultrafiltration. the sizes of the peptides were 90 % peptides, but had a lower glutamine content of 85 % (w / w). glutamine, a substrate for enterocyte metabolism, could act protectively by preserving intestinal integrity and barrier function, as shown in previous experimental colitis models. the n-3 content in fp was only 30 %, similar to the controls in our study (27 %), and can probably not explain the beneficial changes after the fp diet. specific structural features have been linked to potentially bioactive peptides ; the molecular weight should be < 10 kda, most preferably < 1 kda, and the size of peptides between two and twenty amino acids. epithelial injury is fundamental in this model, and during the acute colitis phase innate immune responses are activated. the pro - inflammatory cytokine levels in the dss model were at their lowest after the fp diet at both the protein and mrna levels, suggesting an anti - inflammatory effect from bioactive fp, influencing innate immunity. pgd2 reduces granulocyte infiltration in experimental colitis, and its synthesis is up - regulated in uc patients in remission. the tendency for pgd2 to increase after fp diets in our study may point to a protective effect. contrary to expectations, fo did not improve signs of colitis. as compared to dss, hcs was unaltered and dai increased. this is in contrast to previous trials with dietary n-3 pufa administration in experimental colitis, which has generally shown beneficial effects. the fatty acid analysis of the diets confirmed large relative amounts of epa and dha in the two fo diets, with an n-3:n-6 ratio in the feed of 29 and 31. the relatively anti - inflammatory eicosanoid pge3 was increased, which is expected after dietary intake of epa. in our study however, vitamin e or other anti - oxidants were not added to the diets containing fo. this could result in increased lipid peroxidation and oxidative stress in the colonic mucosa, which could counteract an anti - inflammatory effect. however, the levels of oxidation markers in our study were not increased, but rather tended to decrease, after the fo diet. when combining fo and fp diets we observed that the pge3 levels increased as compared to the fo diet. the reason for this is unclear, as adding the fp diet did not provide high amounts of epa. fp, when combined with the fo diet, could possibly influence the enzymatic activity of cox2, thus leading to elevated pge3 synthesis. we observed that the mrna levels of ptgs2/cox2 as well as ptges were elevated in the combined fo + fp group v. fo, but not reaching significance. nos2 expression was elevated after dss v. controls, and was significantly increased after the fo + fp diet v. dss alone. no is a result of inducible no synthase expression, and seems to have a dual role thus, the higher nos2 levels after the fo + fp diet may be a protective response, supported by the pge3 and pgd2 increase, or it may be detrimental, as suggested by a tendency for elevated hcs and cytokine levels. this study has its limitations : antioxidant added to the fo diets might have influenced the results. an increased number of rats in each group would have increased the statistical power of the analyses. we induced a severe colitis, leading to death in two animals, by administering 5 % dss for 1 week, which could limit the detection of modest beneficial effects. the diets used might affect the healing time of the colitis after stopping dss. the effects observed may be due to prophylactic as well as therapeutic potential of the diets, as the study design can not differentiate between these aspects. the dss model clearly has limitations as a substitute for the human disease, as a chemically induced injury model instead of an endogenously triggered inflammation. in conclusion, dietary hydrolysed salmon peptides may offer protection against dss colitis as compared with a fo diet, but do not improve inflammatory variables significantly when compared with dss alone. a combined diet may affect eicosanoid metabolism by increasing pge3 levels, although not attenuating other signs of colon inflammation. hydrolysed salmon peptides should be further investigated as a dietary intervention against inflammation in animal models, as well as in patients with ibd. | fish oil (fo) has been shown to have anti - inflammatory properties in animal models of inflammatory bowel disease, but how fish peptides (fp) influence intestinal inflammation has been less studied. male wistar rats, divided into five groups, were included in a 4-week dietary intervention study. of the groups, four were exposed in the fourth week to 5 % dextran sulfate sodium (dss) to induce colitis, while one group was unexposed. the diets were : (1) control, (2) control + dss, (3) fo (5 %) + dss, (4) fp (35 %) + dss, (5) fo + fp + dss. following dss intake, weight and disease activity index (dai) were assessed, and histological combined score (hcs), selected colonic pg, cytokines, oxidative damage markers and mrna levels were measured. fp reduced hcs, tended to lower dai (p = 007) and reduced keratinocyte chemoattractant / growth - regulated oncogene levels, as compared with the fo diet. fp also reduced mrna levels of il-6 and cxcl1, although not significantly. fo intake increased the dai as compared with dss alone. pge3 levels increased after the fo diet, and even more following fo + fp intake. the fp diet seems to have a protective effect in dss - induced colitis as compared with fo. a number of beneficial, but non - significant, changes also occurred after fp v. dss. a combined fo + fp diet may influence pg synthesis, as pge3 levels were higher after the combined diet than after fo alone. |
the presence of postoperative seromadesis is common, corresponding to the presence of serum in the subcutaneous tissue post a surgical event. we present a case of a 63-year - old woman having undergone femoral prosthesis surgery and total hip replacement with a subfacial seroma without findings of infection, refractory to standard treatment of compression bandages, massage and cleaning surgery in two oportunities. a literature review was undertaken to obtain the therapeutic alternatives where erythromycin seromadesis is chosen with excellent response. erythromycin sclerotherapy should be considered as an effective and safe option in the treatment of seroma in general surgery and traumatology. we believe that this is the first study of use of erythromycin as sclerotherapy in a traumatology case. a seroma is the collection of fat, liquid, serum and lymph in one area of the body following a traumatic or surgical event. usually, it is formed in a wound in the immediate postoperative period, usually in the first week, although it may be delayed. generally it is benign, but often annoying to the patient and has a moderate risk of infection. the presence of a seroma may be asymptomatic, or may have swelling, pain and exude from the wound. the diagnosis can be by inspection and palpation of the wound, with computed tomography and the ultrasound beign useful for identifying fluid collection. seroma s have been seen in orthopaedic surgery as well, where they are likely to have serious repercussions. this is true especially in prosthetic surgery, with greater chances of infection of prosthetic components and failure of the joint replacement associated with high costs, lengthy hospitalizations, and at times need for a subsequent surgery. treatment options can be categorized as preventive or curative, xonsisting of intraoperative application of sclerosing chemicals as hypertonicsaline and talc in humans and gram positive anaerobe like corynebacterium parvum in rat models, tissue adhesives (fibrin or platelet concentrates), use of negative pressure drainage, repeated percutaneous aspiration and surgical drainage with complete removal of seroma and its capsule. the use of erythromycin as a sclerosing agent was described in animal studies, that was first assessed as a pleural sclerosant, proving effective and with fewer sideeffects than talc, tetracycline and diazepam. this is used safely in humans in the management of breast surgeries, non neoplastic ovaran cysts and pleurodesis. there are no reports of its use in orthopedics, and we believe that this is the first study of this kind. a female patient of 63-year - old presented to our orthopaedic department with prosthetic loosening of the isoelastic stem (fig. 1), also femur and acetabulum with massive osteolytic defect performed by modular aloprosthesis of proximal femur and acetabulum of tantalum, and metal on polyethylene pair of friction (fig. patient had good clinical evolution with the drain removed at the first postoperative day with output of 100 cc. five days later, patient was re - admitted to the emergency room for increased volume in relation to wound without infectious signs. 3). cemented total hip arthroplasty left hip, with extensive osteolysis in bone cement interface.. soft tissue ultrasonography, in hypodermic one hypoechoic collection of 10.5 4.0 4.6 cm. to avoid superinfection of a large extent surgery, it was decided to make an early cleaning surgery, in order to drain and take tissue samples and fluid culture. a collection is located under muscle planes adjacent to the aloprotesis, with communication between up fascia lata muscleplane. after the cleaning surgery and drainage, equally the seroma is maintained for 5 days with daily output of 200 cc of serous fluid. it was decided to perform a new scouring, with obliteration of third space, massage and compression bandages. negative cultures were obtained. given the persistence of seroma, a literature review was undertaken to obtain therapeutic alternatives. finally, surgical cleanliness was performed with resection of pseudocapsule seroma with curettage, making crops and application of 2 g. erythromycin diluted in 200 cc.of 0.9% saline solution. customary closing was performed flat leaving a aspiration drainage n 9 undert he fascia, which was measured daily. the next day, the drainage measured serohematic liquid 100cc, and 60cc was measured on the 2nd day. on the 3rd day, 10 cc of liquid was measured, and the drainage was removed on the 4th day. subsequently, the patient was discharged in good condition without signs of infection, tension, edema or collection in the thigh wound. it has been assessed that there are certain factors that could favor the formation of seroma, such as a high bodymass index, use of electrocautery to dissect, early withdrawal of drain (within 24 hours), obliteration of dead space and use of drains under vacuum. in our case, it is highlighted that the drainage was removed on the first postoperative day, which could have favored the formation of seroma. although, maintaining a drainage for more number of days also increases the risk ofinfection. it is important to consider the differential diagnosis of surgical wound infection, hence blood inflammatory parameters were evaluated, and fluid cultures of the wound were taken. if an infection is confirmed, systemic antibiotic treatment should be given. in addition, open the wound, drain the liquid and perform irrigation and debridement folllowed by wound closure. in the search for bibliographical studies, with terms mesh in pubmed for seroma and erythromycin a single study was located, ali - khan. 2009, which refers to the use of erythromycin as sclerotherapy in the management of seroma in series of patients of plastic surgery, showing effectiveness and no serious complications. the search for terms mesh in pubmed for seroma and sclerotherapy, located two investigations, throckmorton. in 2008 with povidoneiodine or ethyl alcohol in postmastectomy and moritz. in 2013 with polidocanol in varicose vein surgery. the current evidence allows the use of this therapy in this patient, although there is no evidence in trauma surgery. it is necessary to conduct more studies to evaluate the effectiveness and reproducibility of this therapy. it is known that erythromycin as sclerosing product tends to be very effective with fewer adverse effects than other compounds used for the same condition. it has evaluated with satisfactory results in pleurodesis, non - neoplastic adnexalcyst, and plastic surgery. erythromycin use as sclerosing product in orthopedic surgery must be evaluated as a effective and safe therapeutic alternative. | introduction : the presence of postoperative seromadesis is common, corresponding to the presence of serum in the subcutaneous tissue post a surgical event. erythromycin has been reported as sclerosing, although not in orthopedic surgery. we report a case of erythromycin seromadesis in orthopedic surgery.case presentation : we present a case of a 63-year - old woman having undergone femoral prosthesis surgery and total hip replacement with a subfacial seroma without findings of infection, refractory to standard treatment of compression bandages, massage and cleaning surgery in two oportunities. a literature review was undertaken to obtain the therapeutic alternatives where erythromycin seromadesis is chosen with excellent response.conclusion:erythromycin sclerotherapy should be considered as an effective and safe option in the treatment of seroma in general surgery and traumatology. more studies are necessary to get a better evidence. we believe that this is the first study of use of erythromycin as sclerotherapy in a traumatology case. |
allostasis is the process by which living organisms maintain biological homeostasis during a diverse array of challenges, including those of an environmental or physiological nature.1, 2 it is thought that cumulative effects of stress (repetitive or continuous), referred to as allostatic load, affect several physiological systems including the hypothalamic pituitary adrenal axis ; the autonomic nervous system ; and the cardiovascular, metabolic, and immune systems.1, 2 because 7.7 million us persons suffer from posttraumatic stress disorder (ptsd) in a given year3 and the expected lifetime prevalence of ptsd is 8% in the general population,4 better understanding of the impact of ptsd on cardiovascular health has become critical. in a large internationally representative epidemiologic research study,5 the effects of psychosocial factors on myocardial infarction were even larger than wellestablished medical risk factors such as diabetes, hypertension, and obesity. multiple prospective cohort studies have estimated the association of ptsd with incident cardiovascular events and/or cardiovascular death with hazard ratios ranging from 1.46 to 3.28 compared with those of patients without ptsd (reviewed by edmondson and cohen6). despite the disproportionate association of ptsd and cardiovascular disease (cvd), a possible explanation is that patients with ptsd have higher rates of traditional cvd risk factors, including hypertension, dyslipidemia, diabetes, obesity, and tobacco use,7 but neither these risk factors nor depression fully account for the increased rate of cvd in the ptsd population.6 nitric oxide is known to be a key mediator of endothelial function,8 and a recent study reports that biomarkers of nitric oxide synthetic capacity are significantly impaired in veterans with ptsd compared with those without ptsd.9 acute stress has been shown to increase circulating markers of endothelial dysfunction and to impair vasoreactivity, as assessed by endotheliumdependent flowmediated vasodilation (fmd).10, 11, 12 we hypothesized that chronic stress, as experienced by veterans with ptsd, leads to less vasoreactivity (ie, worse endothelial function) than that of an agematched control veteran population without ptsd. between june 2011 and august 2015, 214 patients were recruited from the san francisco veterans affairs medical center (vamc) for evaluation of their vascular function and for the presence of ptsd (crosssectional design), including 136 veterans who were referred to the surgery clinic and 78 veterans who were receiving care in the medical clinic. the investigatorinitiated protocol was approved by the university of california, san francisco (ucsf), committee on human research, and all patients gave informed consent. the research team administered the ptsd checklist (pcl), a selfreport measure composed of 17 fivepoint likert scales that provide a total score for ptsd (range 1785 points), according to the diagnostic and statistical manual of mental disorders (fourth edition).13 only patients with completed pcl testing were included. a score of 40 was used to define the presence of ptsd, as suggested by the vamc national center for ptsd.14 in a sample of male veterans in ptsd treatment, the correlation of the pcl with the clinicianadministered ptsd scale is reported to be 0.79.15 to assess comorbid psychiatric diagnosis, the patient health questionnaire was also used to evaluate depressive symptoms (score of 10). this selfreport instrument measures the frequency of depressive symptoms corresponding to the 9symptom criteria in the diagnostic and statistical manual of mental disorders (fourth edition).16 endothelial function was measured using brachial artery endotheliumdependent fmd in the vascular integrated physiology and experimental therapeutics (viperx) laboratory at ucsf, according to current guidelines and standards previously described by our group.17, 18, 19, 20, 21, 22 under fasting conditions, including abstention from nicotine and caffeine, participants acclimated in the laboratory for 10 minutes in a supine position in a temperaturecontrolled, lowlit room. a 5cm tourniquet blood pressure cuff was placed on the upper arm distal to the insertion of the deltoid. although there is no consensus on the location of the cuff (upper arm versus lower arm), our laboratory has adopted the upper arm technique, which is supported by current guidelines.23 the patient 's blood pressure was recorded in the contralateral arm. the brachial artery was surveyed by bmode ultrasound (philips hd11 ; philips) using a broadband linear array transducer with a range of 3 to 12 mhz (philips l123 ; philips) to identify a segment suitable for imaging. criteria for a suitable segment include a straight arterial segment with adequate visualization of a double line sign on the near and farwall intima media lines and an accompanying registration structure such as a crossing vein. the baseline diameter of the vessel was recorded using ekggated imagecapture software (brachial imager ; medical imaging applications llc), and baseline doppler spectral waveform was recorded using an insonation angle of 60. mean diameter and velocity at baseline were calculated from measurements collected for 60 seconds. the blood pressure cuff was then inflated to 250 or 50 mm hg above the participant 's systolic blood pressure, whichever first induced cessation of brachial artery blood flow by sonography, for a period of 5 minutes. blood flow cessation was confirmed by sonographic monitoring of the brachial artery during cuff inflation. following cuff deflation, hyperemiastimulated brachial artery luminal diameter and doppler spectral waveforms vasorelaxation determined by this method has been shown to be mediated predominantly by nitric oxide with little influence from other endotheliumderived relaxing factors. postacquisition image analysis and calculation of hemodynamic parameters was performed using continuous edgedetection software (brachial analyzer ; medical imaging applications llc). the velocity time integral was calculated by the peak velocity method of integrating the spectral waveform over the first 4 cardiac cycles after cuff release. blood flow was calculated as the product of blood vessel crosssectional area and velocity time integral modeling the artery as a circle. mean shear stress was calculated by the hagenpoiseuille equation, in which tw is shear stress in dynes / cm and mean volumetric flow is q. the viscosity of blood () is assumed to be 0.0035 poise, and lumen radius (r) is in centimeters:(1)tw=4qr3 corresponding hyperemia parameters were calculated over a predetermined time window of 55 to 65 seconds after cuff release. fmd% was calculated as ([60second hyperemia diameter?mean baseline diameter / mean baseline diameter]100). image quality was evaluated by a second person and graded on a 6point scale that included registration structure (landmark), horizontally directed artery, correct longitudinal alignment, clearly visualized near and farwall intima media thickness, and at least 5 mm of clearly visualized artery. the interobserver variability in our laboratory is 0.050.16%, and the intraobserver variability is 00.15%. demographic and anthropometric data were collected at the time of fmd testing to better characterize research participants and included age, race, sex, hip and waist circumference, and body mass index. we collected from the participants a history of cvd, such as coronary artery disease, cerebrovascular disease, and previous lower extremity vascular disease, as well as risk factors including hypertension, diabetes mellitus types 1 and 2, hyperlipidemia, and history of current or past tobacco use. blood samples were collected in a fasting state for measurement of albumin, total cholesterol, triglycerides, lowdensity lipoprotein, highdensity lipoprotein, highsensitivity creactive protein, and hemoglobin a1c by the vamc clinical laboratory per standard methodology (beckman coulter analyzer). estimated glomerular filtration rate was calculated using the abbreviated modification of diet in renal disease formula based on age, sex, race, and serum creatinine level.24 characteristics of patients with and without ptsd were compared, and statistically significant associations were identified with t tests for continuous variables and with chisquare tests for categorical variables. we used maximum likelihood regression models to estimate mean (95% ci) values of fmd by levels of patient characteristics, singly (univariate) and together (multivariable), and to test the significance of these associations using likelihood ratio tests. multivariable adjustment was made for demographic characteristics and traditional cardiovascular risk factors with p<0.05 in univariate models ; however, depression status was omitted from the multivariable model of fmd because it is very strongly associated with ptsd status, and our goal was to study association of fmd with ptsd. in addition to analyzing associations with ptsd status, if pcl scores 40 defined the presence of ptsd, we used linear regression models to estimate associations of patient characteristics and mean brachial artery fmd with pcl quartiles and to test for statistically significant associations using 1 and 3df likelihood ratio statistics, respectively. an illustrative plot of predicted fmd by pcl quartile, against a background of observed fmd values by logarithm base10 pcl scores, was created using sas transreg (sas institute). statistical analyses were performed using stata / se 12 (statacorp) and sas version 9.4. between june 2011 and august 2015, 214 patients were recruited from the san francisco veterans affairs medical center (vamc) for evaluation of their vascular function and for the presence of ptsd (crosssectional design), including 136 veterans who were referred to the surgery clinic and 78 veterans who were receiving care in the medical clinic. the investigatorinitiated protocol was approved by the university of california, san francisco (ucsf), committee on human research, and all patients gave informed consent. the research team administered the ptsd checklist (pcl), a selfreport measure composed of 17 fivepoint likert scales that provide a total score for ptsd (range 1785 points), according to the diagnostic and statistical manual of mental disorders (fourth edition).13 only patients with completed pcl testing were included. a score of 40 was used to define the presence of ptsd, as suggested by the vamc national center for ptsd.14 in a sample of male veterans in ptsd treatment, the correlation of the pcl with the clinicianadministered ptsd scale is reported to be 0.79.15 to assess comorbid psychiatric diagnosis, the patient health questionnaire was also used to evaluate depressive symptoms (score of 10). this selfreport instrument measures the frequency of depressive symptoms corresponding to the 9symptom criteria in the diagnostic and statistical manual of mental disorders (fourth edition).16 endothelial function was measured using brachial artery endotheliumdependent fmd in the vascular integrated physiology and experimental therapeutics (viperx) laboratory at ucsf, according to current guidelines and standards previously described by our group.17, 18, 19, 20, 21, 22 under fasting conditions, including abstention from nicotine and caffeine, participants acclimated in the laboratory for 10 minutes in a supine position in a temperaturecontrolled, lowlit room. a 5cm tourniquet blood pressure cuff was placed on the upper arm distal to the insertion of the deltoid. although there is no consensus on the location of the cuff (upper arm versus lower arm), our laboratory has adopted the upper arm technique, which is supported by current guidelines.23 the patient 's blood pressure was recorded in the contralateral arm. the brachial artery was surveyed by bmode ultrasound (philips hd11 ; philips) using a broadband linear array transducer with a range of 3 to 12 mhz (philips l123 ; philips) to identify a segment suitable for imaging. criteria for a suitable segment include a straight arterial segment with adequate visualization of a double line sign on the near and farwall intima media lines and an accompanying registration structure such as a crossing vein. the baseline diameter of the vessel was recorded using ekggated imagecapture software (brachial imager ; medical imaging applications llc), and baseline doppler spectral waveform was recorded using an insonation angle of 60. mean diameter and velocity at baseline were calculated from measurements collected for 60 seconds. the blood pressure cuff was then inflated to 250 or 50 mm hg above the participant 's systolic blood pressure, whichever first induced cessation of brachial artery blood flow by sonography, for a period of 5 minutes. blood flow cessation was confirmed by sonographic monitoring of the brachial artery during cuff inflation. following cuff deflation, hyperemiastimulated brachial artery luminal diameter and doppler spectral waveforms vasorelaxation determined by this method has been shown to be mediated predominantly by nitric oxide with little influence from other endotheliumderived relaxing factors. postacquisition image analysis and calculation of hemodynamic parameters was performed using continuous edgedetection software (brachial analyzer ; medical imaging applications llc). the velocity time integral was calculated by the peak velocity method of integrating the spectral waveform over the first 4 cardiac cycles after cuff release. blood flow was calculated as the product of blood vessel crosssectional area and velocity time integral modeling the artery as a circle. mean shear stress was calculated by the hagenpoiseuille equation, in which tw is shear stress in dynes / cm and mean volumetric flow is q. the viscosity of blood () is assumed to be 0.0035 poise, and lumen radius (r) is in centimeters:(1)tw=4qr3 corresponding hyperemia parameters were calculated over a predetermined time window of 55 to 65 seconds after cuff release. fmd% was calculated as ([60second hyperemia diameter?mean baseline diameter / mean baseline diameter]100). image quality was evaluated by a second person and graded on a 6point scale that included registration structure (landmark), horizontally directed artery, correct longitudinal alignment, clearly visualized near and farwall intima media thickness, and at least 5 mm of clearly visualized artery. the interobserver variability in our laboratory is 0.050.16%, and the intraobserver variability is 00.15%. demographic and anthropometric data were collected at the time of fmd testing to better characterize research participants and included age, race, sex, hip and waist circumference, and body mass index. we collected from the participants a history of cvd, such as coronary artery disease, cerebrovascular disease, and previous lower extremity vascular disease, as well as risk factors including hypertension, diabetes mellitus types 1 and 2, hyperlipidemia, and history of current or past tobacco use. blood samples were collected in a fasting state for measurement of albumin, total cholesterol, triglycerides, lowdensity lipoprotein, highdensity lipoprotein, highsensitivity creactive protein, and hemoglobin a1c by the vamc clinical laboratory per standard methodology (beckman coulter analyzer). estimated glomerular filtration rate was calculated using the abbreviated modification of diet in renal disease formula based on age, sex, race, and serum creatinine level.24 characteristics of patients with and without ptsd were compared, and statistically significant associations were identified with t tests for continuous variables and with chisquare tests for categorical variables. we used maximum likelihood regression models to estimate mean (95% ci) values of fmd by levels of patient characteristics, singly (univariate) and together (multivariable), and to test the significance of these associations using likelihood ratio tests. multivariable adjustment was made for demographic characteristics and traditional cardiovascular risk factors with p<0.05 in univariate models ; however, depression status was omitted from the multivariable model of fmd because it is very strongly associated with ptsd status, and our goal was to study association of fmd with ptsd. in addition to analyzing associations with ptsd status, if pcl scores 40 defined the presence of ptsd, we used linear regression models to estimate associations of patient characteristics and mean brachial artery fmd with pcl quartiles and to test for statistically significant associations using 1 and 3df likelihood ratio statistics, respectively. an illustrative plot of predicted fmd by pcl quartile, against a background of observed fmd values by logarithm base10 pcl scores, was created using sas transreg (sas institute). statistical analyses were performed using stata / se 12 (statacorp) and sas version 9.4. among the 214 participants in this study, the range of pcl scores was 17 to 85, and 64 (31%) were found to have ptsd, as defined by a score 40 (table 1). patients with ptsd were more likely to be male (99% versus 91%, p=0.04) and to have depression (56% versus 8%, p<0.0001) but were less likely to be on an angiotensinconverting enzyme inhibitor (17% versus 36%, p=0.007) or blocker treatment (25% versus 41%, p=0.03). there was no difference in the proportion of patients who were active smokers between the 2 groups (ptsd 27% versus nonptsd 25%, p=0.81). quartiles of pcl scores showed that the majority of the sample was at lower risk levels (1720, 2130, 3146, 4785). when patient characteristics were examined by pcl quartile (table s1), the trends were similar to those observed by ptsd status. characteristics of patients with and without ptsda acei indicates angiotensinconverting enzyme inhibitor ; crp, creactive protein ; egfr, estimated glomerular filtration rate ; hdl, highdensity lipoprotein ; hga1c, hemoglobin a1c ; ldl, lowdensity lipoprotein ; phq9, patient health questionnaire ; ptsd, posttraumatic stress disorder. continuous characteristics are summarized by meansd and categorical characteristics as percentage of ptsd level having the characteristic. among 209 participants with nonmissing outcomes, patients with ptsd had worse endothelial function, as measured by significantly lower brachial artery fmd (5.83.4% versus 7.53.7% ; p=0.003) (table 2). brachial artery flowmediated vasodilation in patients without and with ptsd fmd indicates flowmediated vasodilation ; ptsd, posttraumatic stress disorder ; rh, reactive hyperemia. student t test. to avoid inflating the type 1 error rate (falsepositive claims), statistical tests examined 1 measure each of variation at start and at end of vasodilation challenge. we used a regression model to examine linearity of fmd as a function of logarithm base10 pcl scores, stratified by pcl quartile (figure). this model estimated that fmd declines nonlinearly with logarithm base10 pcl scores, with mean differences between quartiles of 1.8%, 1.0%, and 0.45%, respectively (3df likelihood ratio test p=0.060) (figure and table s2). mean (with 95% ci and prediction limits) brachial artery fmd per sample quartile of pcl score suggests that greater worsening of endothelial function occurs at earlier stages of ptsd. fmd indicates flowmediated vasodilation ; pcl, ptsd checklist ; ptsd, posttraumatic stress disorder. univariate analysis demonstrated that lower fmd also was significantly associated with a diagnosis of ptsd (p=0.003), increasing age (p=0.008), decreasing estimated glomerular filtration rate (p=0.003), hypertension (p=0.002), aspirin use (p=0.03), and blocker treatment (p=0.01). in multivariate analysis (table 3), ptsd remained independently associated with fmd (p=0.0005). in an adjusted model, this corresponded to an fmd of 4.9% (95% ci 3.76.0%) in patients with ptsd compared with 7.3% (95% ci 6.78.0%) in those without ptsd. univariate and multivariate associations with endothelial function measured by brachial artery flowmediated vasodilation acei indicates angiotensinconverting enzyme inhibitor ; asa, acetylsalicylic acid ; egfr, estimated glomerular filtration rate ; fmd, flowmediated dilation ; ptsd, posttraumatic stress disorder. a regression model coefficient estimates the mean (95% ci) change in fmd per unit change in a patient characteristic ; for example, the univariate analysis estimated a mean change of 1.7 as ptsd status changed from 0 to 1 (table 3), which is consistent with the fmd means of 7.5 and 5.8 for ptsd absence and presence, respectively, reported in table 2. fmd was also significantly associated with the presence of depressive symptoms, which are frequently comorbid with ptsd (coefficient 1.3 ; 95% ci 2.5 to 0.12 ; p=0.03). after additional adjustment for depression in the full model presented in table 3, the relationship between fmd and ptsd remained significant (coefficient 1.8 ; 95% ci 3.4 to 0.2 ; p=0.03). in a cohort of outpatients treated at the san francisco vamc, ptsd was associated with worse endothelial function, as measured by fmd., these data represent the largest cohort in which endothelial function with fmd was measured in patients with ptsd. these data provide evidence of a clear association between ptsd and vascular function among veterans and illustrate the need to empirically determine the optimal multidisciplinary strategies to treat patients with comorbid ptsd and cvd risk. patients with ptsd have higher rates of traditional biological and behavioral cvd risk factors, including hypertension, dyslipidemia, diabetes, obesity, and tobacco use.7 nevertheless, in our work and that of others, the association of ptsd and cvd has not been fully explained by these risk factors or by depression, suggesting that the pathway is not merely related to poor health behaviors or traditional cvd risk factors.6, 25, 26, 27 rather, a direct relationship between ptsd and vascular function appears to be involved. in fact, our study demonstrated an association between ptsd and endothelial dysfunction measured by brachial artery fmd after adjustment for age, hypertension, and renal function. our work expands on prior examinations of ptsd and vascular function.10, 11, 12, 28 to date, only 1 study in the literature focused on ptsd and vascular function measured with fmd. this study, conducted in a cohort of 100 police officers, found that higher levels of ptsd symptoms were associated with a nearly 2fold decrease in fmd after adjustment for demographics and health behaviors.29 consequently, our current data represent the largest study reporting the association between ptsd and endothelial dysfunction using brachial artery fmd. our study demonstrated a 2.4% adjusted difference in fmd between patients with and without ptsd. in fact, in recent metaanalysis, it has been estimated that a 1% decrease in fmd is predictive of a 10% absolute increase in future cardiovascular events and mortality.30, 31 it is currently unknown whether treatment of ptsd would improve vascular function or future cardiovascular risk. based on current data, damage to the endothelial lining of blood vessels appears to be worsened by mental or psychological stress. this supports the notion that repeated provocation of endothelial stress reactivity, as may occur with persistent ptsd, may have an atherogenic effect on the endothelium over time. mechanisms may include impairments of nitric oxide pathways via stressarousal mediators,9, 32 an increase in inflammation10, 33 (although not present in this study), and a perturbation in major stress systems such as the hypothalamic pituitary adrenal axis and the autonomic nervous system.2 patients with ptsd have lower peripheral cortisol levels,34, 35 which could contribute to a proinflammatory milieu and an inflammatory activation of endothelial cells.36, 37, 38 it is also possible that psychological stress leads to endothelial dysfunction through an increase in oxidative stress39 or through the release of potent vasoconstrictors including endothelin40 and angiotensin ii.41 although this work represents the largest study to date on the association between ptsd and endothelial function, this study was observational and used a crosssectional design. it is also important to note that depression has been associated with worse fmd.42 in our study, a percentage of the patients met criteria for both ptsd and depression (based on scores on the patient health questionnaire). depressive symptoms in some cases can reflect the overlap of the diagnostic criteria with ptsd (anhedonia, cognitive decrements, sleep disturbance, guilt). furthermore, some argue that unless major depressive disorder was established prior to ptsd, the cooccurrence may represents a traumarelated phenomenon that is distinct from major depressive disorder.43 in the current study, the timing of occurrence of diagnosis was not established. furthermore, in the majority of patients, use of antidepressants or antianxiety drugs was not recorded. although participants were recruited through both the surgery and medical clinics, all vascular testing was conducted by the same laboratory (viperx), and ptsd was measured in the same fashion. last, it should be noted that the baseline diameter was different between the groups and possibly could contribute to the difference seen in fmd. this is however less likely since the fmd equation adjusts for baseline diameter as demonstrated in the methods section. although this work represents the largest study to date on the association between ptsd and endothelial function, this study was observational and used a crosssectional design. it is also important to note that depression has been associated with worse fmd.42 in our study, a percentage of the patients met criteria for both ptsd and depression (based on scores on the patient health questionnaire). depressive symptoms in some cases can reflect the overlap of the diagnostic criteria with ptsd (anhedonia, cognitive decrements, sleep disturbance, guilt). furthermore, some argue that unless major depressive disorder was established prior to ptsd, the cooccurrence may represents a traumarelated phenomenon that is distinct from major depressive disorder.43 in the current study, the timing of occurrence of diagnosis was not established. furthermore, in the majority of patients, use of antidepressants or antianxiety drugs was not recorded. although participants were recruited through both the surgery and medical clinics, all vascular testing was conducted by the same laboratory (viperx), and ptsd was measured in the same fashion. last, it should be noted that the baseline diameter was different between the groups and possibly could contribute to the difference seen in fmd. this is however less likely since the fmd equation adjusts for baseline diameter as demonstrated in the methods section. in summary, our results support the hypothesis that patients with ptsd have worse endothelial function, as demonstrated by lower brachial artery fmd. prospective studies are needed to establish whether ptsd contributes to the increased risk of cardiovascular events via endothelial dysfunction. furthermore, future research is needed to understand whether treatment of ptsd could improve measures of endothelial function and decrease the risk of cvd or cvd events. this work was supported by startup funds from the university of california san francisco and the northern california institute for research and education (dr grenon), by award number kl2rr024130 from the national center for research resources, award number 1k23hl12244601 from the national institute of health / nhlbi, and a society for vascular surgery seed grant and career development award (dr grenon). this project was also supported by k23 hl 09476501 from the national heart lung and blood institute (dr cohen), the department of defense, the american heart association, the brain and behavior research foundation, the northern california institute for research and education, the university of california, san francisco, and the irene perstein foundation. the content is solely the responsibility of the authors and does not necessarily represent the official views of the national center for research resources or the national institutes of health. the funding organizations were not involved in the design and conduct of the study ; collection, management, analysis, and interpretation of the data ; or preparation, review, or approval of the manuscript. table s1. characteristics of patients by quartiles of the ptsd checklist table s2. brachial artery flowmediated vasodilation by sample quartiles of the ptsd checklist score click here for additional data file. | backgroundcurrent research in behavioral cardiology reveals a significant association between posttraumatic stress disorder (ptsd) and increased risk for cardiovascular disease and mortality ; however, the underlying mechanisms remain poorly understood. we hypothesized that patients with ptsd would exhibit endothelial dysfunction, a potential mechanism involved in the development and progression of cardiovascular disease.methods and resultsa total of 214 outpatients treated at the san francisco veterans affairs medical center underwent tests of endothelial function and evaluation for ptsd. flowmediated vasodilation of the brachial artery was performed to assess endothelial function, and current ptsd status was defined by the ptsd checklist, based on the diagnostic and statistical manual of mental disorders (fourth edition), with a score 40. multivariable linear regression models were used to estimate the association between ptsd status and endothelial function. patients with ptsd (n=67) were more likely to be male (99% versus 91%, p=0.04) and to have depression (58% versus 8%, p<0.0001) and were less likely to be on an angiotensinconverting enzyme inhibitor (17% versus 36%, p=0.007) or blocker treatment (25% versus 41%, p=0.03). univariate analysis demonstrated that patients with ptsd had significantly lower flowmediated vasodilation (5.83.4% versus 7.53.7% ; p=0.003) ; furthermore, lower flowmediated vasodilation was associated with increasing age (p=0.008), decreasing estimated glomerular filtration rate (p=0.003), hypertension (p=0.002), aspirin (p=0.03), and blocker treatments (p=0.01). in multivariable analysis, ptsd remained independently associated with lower flowmediated vasodilation (p=0.0005).conclusionsafter adjusting for demographic, comorbidity, and treatment characteristics, ptsd remained associated with worse endothelial function in an outpatient population. whether poor endothelial function contributes to the higher risk of cardiovascular disease in patients with ptsd deserves further study. |
ileostomy formation is occasionally required in patients with complicated inflammatory bowel disease requiring colonic resection. this procedure can lead to a number of recognised complications including stomal obstruction, stomal prolapse, skin erythema and ileal inflammation. a less commonly described complication is high output ileostomy which occurs when there is a disproportionate fluid and electrolyte loss through the stoma. in the first few days after ileostomy formation, there is frequently an increased stool effluent through the stoma, but this rapidly decreases because of ileostomy adaptation. the normal output through an ileostomy following a total colectomy is between 400 and 600 g of stools daily. in a high output ileostomy, stool output is more than 1,000 g daily, which can result in severe dehydration and electrolyte imbalance. while impaired ileostomy adaptation has been used to describe the pathogenesis of high output ileostomies, there is now an increasing body of evidence suggesting that enteral infection with clostridium difficile might contribute to the cause [3, 4 ]. while it is difficult to estimate the incidence of this complication, it is certainly an important issue which has a significant effect on patients quality of life and significant morbidity and mortality. therefore adequate management of high output ileostomies is important. in this article we present a patient with a high output ileostomy and describe the physiological changes that are believed to occur and the recommended management issues of this important complication. a 42-year - old female lawyer with a 4-year history of ulcerative proctitis presented to our hospital with a 2-week history of worsening shortness of breath at rest, which was worse on exertion. she had failed medical therapy (which consisted of mesalazine 3.2 g daily since diagnosis, mesalazine enemas, azathioprine at a dose of 2.5 mg / kg for the previous 4 years and infliximab at a dose of 5 mg / kg every 6 weeks for the previous 3 years), and 2 months before her current presentation she had undergone a panproctocolectomy with ileal pouch formation and ileoanal anastomosis. she had also required regular steroids in view of clinically active disease (raised partial mayo score for ulcerative colitis), blood tests as manifested by anaemia and raised inflammatory markers and endoscopically active disease. multiple stool samples for culture, ova, cysts, parasites, c. difficile toxins and colonoscopic biopsies had ruled out co - existent superinfection. the patient had persistently refused to undergo colectomy until recently. the patient had no other symptoms besides shortness of breath. on initial assessment she was tachycardic with a heart rate of 130 beats per minute and tachypnoeic with a respiratory rate of 30 breaths per minute and an spo2 of 93%. in view of her symptoms, recent surgery and the above findings an echocardiogram was performed, which revealed a hypocontractile right ventricle. meanwhile her initial blood investigations revealed a hypochloraemic metabolic acidosis on a background of dehydration as indicated in table 1. on more detailed questioning, she had lost 6 kg since her surgery and had an effluent through the stoma of more than 2 litres per day. other possible causes of high output stomas such as intraabdominal sepsis, bowel obstruction and infective enteritis were ruled out through the appropriate tests. she was managed with 1 litre 0.9% saline 12-hourly and oral fluids with diarolyte sachets (0.47 g sodium chloride per sachet) and an isotonic energy drink (0.11 g sodium chloride per 240 ml of fluid). the patient was not keen on having codeine or lomotil to slow down the output through the stoma. thus, she was prescribed omeprazole 40 mg twice daily orally which resulted in a decrease in the effluent through the stoma. on starting this treatment her condition improved rapidly and she was discharged from hospital 6 days later, by which time her blood tests had all normalized. after 3 months the dose of omeprazole was gradually reduced and then stopped and the patient underwent closure of her stoma. ileostomy adaptation refers to the physiological process that occurs in the small intestine whereby faecal output through a stoma decreases in volume and becomes less fluid. this tends to occur within one to two weeks after ileostomy formation, but may take up to two years. ileostomy adaptation requires cell hyperplasia and increased mucosal surface area with an increase in bowel circumference, an increase in length and bowel wall thickness, and an increase in villus height and crypt depth. proctocolectomy and the establishment of an ileostomy leads to increased fluid and electrolyte losses even when adaptation is complete, and such patients are susceptible to salt and electrolyte depletion [2, 5 ]. a possible complication of this disproportionate increased output of water and electrolytes is a high output ileostomy. serum gastrin is raised in patients who have undergone bowel resection [7, 8 ]. hypergastrinaemia has been shown to cause diarrhoea, possibly due to hyperacidity in the stomach. in fact, patients with gastrinomas tend to present with diarrhoea as their initial complaint in up to 90% of cases. in the management of high output ileostomies with marked electrolyte and water depletion, replacing fluids by administering 24 litres / day of intravenous normal saline is of paramount importance. keeping the patient starved initially is also important since the net output is driven by the oral intake. treatment for high output from a stoma begins with the patient restricting the total amount of both oral hypotonic and hypertonic fluids to less than 500 ml per day. the addition of a glucose - saline replacement solution (90 mmol / l sodium or more) is required to make up the total fluid intake. loperamide and codeine phosphate reduce intestinal motility and thus decrease water and sodium output from an ileostomy by approximately 2030%. loperamide is preferred over codeine phosphate as it is not sedative or addictive and does not cause fat malabsorption. if tablets or capsules are seen unchanged in stool or stomal output, they can be crushed, opened, mixed with water, or put on food. drugs that reduce gastric acid secretion (for example, the h2 antagonists or proton pump inhibitors or the somatostatin analogue octreotide) are also commonly used. ranitidine (300 mg orally twice daily) and omeprazole (40 mg orally daily or intravenously twice daily) reduce stomal output, particularly in those with a net secretory output and generally in those with an output exceeding 2 litres every day. omeprazole is readily absorbed in the duodenum and upper small bowel but if less than 50 cm of jejunum remains, it may need to be given intravenously. these drugs, which inhibit gastric acid secretion, are as effective as octreotide (50 mg subcutaneously twice daily) in reducing the volume of stomal output, but they do not change the absorption of electrolytes and do not reduce stomal output enough to reduce the severity of intestinal failure. the greatest reductions in intestinal output are in those with a net secretory output, and the volume of parenteral supplements needed may be reduced. the reduction in sodium output parallels that of intestinal output while magnesium balance is unchanged. total energy and nitrogen absorption are not significantly changed while fat absorption may be unchanged or reduced. long - acting octreotide or somatostatin preparations have not been assessed in large studies but may prove to be effective in the future. mineralocorticoids or high - dose hydrocortisone may reduce stomal output in patients with a retained ileum. some authors recommend that the management algorithm of a high output ileostomy should include exclusion of small bowel c. difficile, particularly in inflammatory bowel disease patients with a history of previous infection. if clostridium toxins are found, treatment with oral metronidazole or vancomycin may result in quick resolution of symptoms. we present a case of high output stoma following bowel resection which was managed by adequate rehydration and proton pump inhibitors. this case highlights the importance of closely following and advising this group of patients with such stomas in order to prevent and identify as early as possible such complications. | high output ileostomies are important complications of stoma formation following bowel surgery. adequate management of such stomas might prevent severe morbidity and mortality when this potentially fatal complication develops. in this case report, we describe a female patient with a recent ileostomy formation following panproctocolectomy for ulcerative colitis who presented with progressively increasing shortness of breath. the patient was found to have a hypochloraemic metabolic acidosis on arterial blood gases. she rapidly improved with adequate sodium and fluid replacement and with the use of a course of proton pump inhibitors. this case highlights the importance of recognising high output ileostomies early and important management issues in their regard. |
although it provides favorable results in terms of strength, form and function, it usually shows unaesthetic appearance from metal underneath, especially at the cervical part of the restoration or from the opaque porcelain layer.1 in addition, metal substructure obstructs the light transmission to underlying natural tooth, and its oxide discoloration affects the appearance of the prosthesis. for some patients, alloys, used in pfm restorations, may induce allergic reaction to the patients.1 therefore, the high - gold - content alloys are sometimes used to solve the unaesthetic problem in fixed dental prosthesis with low allergic reaction to the patients, but this type of alloys is relatively expensive.2,3 when first high - alumina content porcelain was developed for fabrication of all - ceramic crown,4 it presented superior aesthetics similar to natural dentition, however it is relatively weak with limited clinical use and prone to fracture under function. before the application of zirconia in fabrication fixed dental prosthesis (fdp), it was found that the primary cause of failures of all - ceramic fdp was the fracture of the connector5,6,7,8,9 which differed from that reported for metal - ceramic fdp.10,11 since then, zirconia - based ceramic has been developed and introduced as restorative materials for fabrication of fdp especially in posterior region because of its excellent mechanical properties. this ceramic has the highest fracture toughness and strength compared with other substructure ceramics.12 in combination with cad / cam technique, this high strength ceramic can be conveniently fabricated from partially sintered or fully sintered blocks by avoiding conventional steps such as waxing, investing, and casting. however, machining from fully dense block requires robust milling equipment, and it is questionable for the accuracy of milling the thin section of brittle material.13 for partially sintered zirconia, it can be easily machined using cam system and subsequently sintered to retrieve fully dense framework. however, large sintering shrinkage approximately of 25% needs to be compensated by calculation of software design.13,14 since the introduction of zirconia as fdp, the fracture of zirconia framework has been rarely reported.15,16 apart from the excellent mechanical properties of the framework, the long - term clinical success of zirconia - based restoration can be influenced by marginal and internal fit of the prostheses.17,18,19,20 the poor marginal fit leads to plaque accumulation and secondary caries, induces periodontal disease, and creates microleakage.15,21,22,23,24,25,26 it was reported that the highest rate of marginal discoloration was found in zirconia fdp.16 this may be resulted from the marginal inaccuracy of those zirconia frameworks. a variety of acceptable marginal openings were recommended. hung.27 and weaver.28 suggested that an acceptable marginal opening were 50 to 75 m and 70 10 m respectively. nevertheless, there is an agreement that marginal discrepancy between 100 - 150 m is clinically acceptable.20,29,30,31,32 however, there have been still very few data available on the measurement of the fit in zirconia substructure compared between the different types of fixed dental restorations. therefore, the objective of this study was to compare the marginal and internal gaps of zirconia substructure of single crown and those of three - unit fixed dental prostheses. commercially available y - tzp zirconia block (lava zirconia block, 3 m espe, st. paul, mn, usa) and cad / cam system (lava scan st design, lava cnc 500 milling machine and lava furnace 200, 3 m espe, st. maxillary teeth (columbia dentoform corp, long island city, ny, usa) were embedded in model stone type iii (comet 3, ultima, ayutthaya, thailand) simulating a second premolar and a second molar in a position of abutments for zirconia all - ceramic single crowns (premolar and molar) and three - unit fixed dental prostheses (tooth 25 - 27). a putty type silicone impression (express, 3 m espe, st. paul, mn, usa) was made as a silicone index to control volumetric reduction of abutment teeth in this study. after that, ivorine maxillary teeth were prepared as complete - coverage zirconia all - ceramic single crowns and a three - unit bridge restorations. after preparation was completed, the ivorine abutment teeth in model stone type iii (kerr lab, orange, ca, usa) platform were duplicated using silicone duplicate material (wirosil, bego, bremen, germany) and casted for a standardized co - cr model (fig. impressions of standardized co - cr model were taken using customized perforated plastic tray and polyether impression material (impregum 3 m espe, st. paul, mn, usa). then all impressions were poured with die stone type iv (velmix, kerr lab, orange, ca, usa) for working models. after models were fully set, all models were labeled and divided into 2 groups (n=10/group) : single crowns (premolar and molar) and 3-unit bridge before transferring to the milling center. the same standard setting was employed to all scanning models with cement spacer : 15 m at the margin and finish line ; additional cement space of 50 m (65 m total) at 2 mm above the margin of restoration ; and additional 65 m (85 m total) at the occlusal area. when substructure fabrication process was finished, all the definitive substructures were returned to their respective groups and examined by the investigators for any defect. the internal replica technique was employed by loading low - viscosity silicone impression material (express xt, 3 m espe, st. paul, mn, usa) on the inner surface of the substructure and seating substructure on co - cr model using 50 n load. subsequently, heavy body silicone impression material (express xt, 3 m espe, st. paul, mn, usa) was used to stabilize the thin layer of light body impression material for easy handling and to determine the gaps of zirconia substructure (fig. all the replicas of abutment teeth, which adhered to custom plastic tray, were sectioned with razor blade (dorco co., ltd., seoul, korea) in the mid - plane at buccal - lingual surface and mesial - distal surface. each part of the replica was examined under optical light microscope (nikon eclipse e400 pol, sendai, japan) at a magnification of 50, and photograph was taken for gap measurement using dslr camera (canon eos 450d, sendai, japan). finally, the gaps were measured in 5 positions (9 points / section) (fig. 3 and fig. 4) : marginal opening (mo), chamfer area (ca), axial wall (aw), cusp tip (ct), occlusal adaptation (oa) using image pro plus program v.7.0 (media cybernatics, rockville, md, usa). all marginal and internal gap data were collected and analyzed using independent t - test statistic at a significance level of 0.05 (spss version 11, armonk, ny, usa) to determine if statistical differences exist between both types of substructures in terms of marginal and internal gaps at the different measurement positions. there were significant differences of marginal and internal gaps between single crown and three - unit bridge at all locations. the mean sd of marginal gap in premolar was 43.6 0.4 m and 46.5 0.5 m for single crown and 3-unit bridge substructure respectively. for molar substructure the mean sd of marginal gap was 48.5 0.4 m and 52.6 0.4 m for single crown and 3-unit bridge respectively (fig. the largest gaps were found at the occlusal area, which were ; 150.5 0.5 m and 154.5 0.4 m for single and 3-unit bridge premolar substructures respectively ; and 146.5 0.4 m and 211.5 0.4 m for single crown and 3-unit bridge molar substructure respectively (fig. all - ceramic restorations have become increasingly popular because of their esthetics, biocompatibility and improved strength. previously, all - ceramic restorations require some steps in fabrication process that could lead to an inaccuracy of the restorations. cad / cam technology was introduced to derive precision and enhance the predictability of restorations, however, scanning process, software design, milling system, and material processing may compromise the accuracy of this method.33 the success of zirconia all - ceramic restoration depends on several factors, and one of the most important factors that makes zirconia all - ceramic restoration achieve acceptable longevity is the fit of the restorations which can be determined by marginal and internal gaps in the restorations. misfit can affect retention, fracture strength34 and thus reduce longevity of restorations from the adverse effects of poor fit such as ; damage to the adjacent tissue ; or increased dissolution of the cementing medium.35 for marginal and internal gaps of zirconia restorations, it was found that the fit of zirconia restoration is influenced by heterogeneity in terms of experimental methodology, milling system, manufacturers, sintering states of the zirconia, sample size and span length.36 in this study, the marginal gap values all zirconia substructures were less than 60 m, which was less than that of the clinically acceptable value. for the internal gap, this study showed the axial and occlusal gaps were in the range of 31 - 90 m and 108 - 215 m respectively. the axial gap values were slightly less than that of previous studies.36 in this study, internal relief for cement space was 15 microns, with 50 microns additional horizontal gap at 2 mm above the collar position, and 65 m additional occlusal gap. when compared with the manufacturer 's parameters, the gap in chamfer area of premolar and molar substructure were in the range of 36 - 62 m and 51 - 82 m respectively, which were slightly greater than setting parameter of the system. the most used approaches to determine the adaptation of the restorations are embedded and replica techniques. the embedded method may be considered as the most accurate method for measuring the marginal and internal fit, however, the disadvantage is the destruction of the material from the cutting. in this study, the replica technique that is the non - destructive method was used to determine the gap under zirconia substructure. by using the low - viscosity impression material to represent the marginal and internal gap width this method was used to investigate the accuracy of single crown and fixed dental prostheses in clinical studies.24,37,38 in this study, 50-n load was employed to insert zirconia substructure onto the standard abutment to ensure the complete seating of the substructure. this applied load was employed according to our pilot study, which we found that there was no difference of marginal gap between the zirconia substructures with low - viscosity impression material and those without the material. from this study, the gap values in three - unit substructures were higher than those of single crowns. the study also showed that even though the manufacturer 's recommended parameters were set for cad / cam zirconia system, the gaps were not as precise as the setting parameter by the system especially at the occlusal area. this may be because of the more complex shape of the occlusal surface of the molar and the larger dimension of bridge framework than those of single crown substructure. in addition, the calculation of the cad / cam software may not as precise as it should be. therefore, it has to be considered that a tendency for the greater gaps than the expected value could be found. in addition, as in the tooth preparation step, clinicians should always remind themselves to prepare enough space for the restorations. because the gaps increment in the restorations can be greater than the set - up value of the system when the fdps have larger span length, it should be considered that the span length, the type of the restorations or other factors may have a significant effect on the marginal and internal gaps of zirconia restorations. there should be further studies to investigate other factors to clarify how those effects could be avoided in routine cad / cam fabrication for zirconia restorations. according to the experimental results, all the marginal gaps were less than 120 microns, which is clinically acceptable for the system used in this study. however, the measured gaps tended to be greater than those of the parameter set by cad system especially at the occlusal area. in addition, the fit of zirconia substructure was also affected by the dimension of the restorations in which the gaps of bridge substructure was larger than those of single - unit substructure. | purposeto compare marginal and internal gaps of zirconia substructure of single crowns with those of three - unit fixed dental prostheses.materials and methodsstandardized co - cr alloy simulated second premolar and second molar abutments were fabricated and subsequently duplicated into type - iii dental stone for working casts. after that, all zirconia substructures were made using lava system. marginal and internal gaps were measured in 2 planes (mesial - distal plane and buccal - palatal plane) at 5 locations : marginal opening (mo), chamfer area (ca), axial wall (aw), cusp tip (ct) and mid - occlusal (oa) using replica technique.resultsthere were significant differences between gaps at all locations. the mean sd of marginal gap in premolar was 43.6 0.4 m and 46.5 0.5 m for single crown and 3-unit bridge substructure respectively. for molar substructure the mean sd of marginal gap was 48.5 0.4 m and 52.6 0.4 m for single crown and 3-unit bridge respectively. the largest gaps were found at the occlusal area, which was 150.5 0.5 m and 154.5 0.4 m for single and 3-unit bridge premolar substructures respectively and 146.5 0.4 m and 211.5 0.4 m for single and 3-unit bridge molar substructure respectively.conclusionindependent-samples t - test showed significant differences of gap in zirconia substructure between single crowns and three - unit bridge (p<.001). therefore, the span length has the effect on the fit of zirconia substructure that is fabricated using cad / cam technique especially at the occlusal area. |
with these words in 1937, there began a worldwide appeal to establish a chiropractic hospital at the palmer school of chiropractic (psc):does not the reader agree with me that the next great step forward ought to be the establishment at the psc of a wonderful chiropractic hospital, to which patients of all classes, from every nation, could come, and in which they would be nursed back to health under competent chiropractic services ? does not the reader agree with me that the next great step forward ought to be the establishment at the psc of a wonderful chiropractic hospital, to which patients of all classes, from every nation, could come, and in which they would be nursed back to health under competent chiropractic services ? the importance of complete chiropractic care, including hospitalization, was understood from the very beginning of the chiropractic profession by its founder, dr daniel david palmer. there were in - patient facilities at the psc from its inception in the late 1890s to the mid-1920s. interestingly, the principal force behind this movement was not dr bartlett joshua palmer, the charismatic son of dd palmer and president of the psc, but dr william ivens of winnipeg, manitoba, canada. the purpose of this article is to relate information about the life of dr ivens and describe the effort led by him to fulfill his dream of a chiropractic hospital equipped and established as the voluntary goodwill contribution of chiropractors and patients the world over to the psc the fountain head of chiropractic. " william bill ivens (fig 1) was born in barford, warwickshire, england, in 1878. after graduating from the university of manitoba, he became a methodist minister at the mcdougal church in winnipeg. rev ivens was a well - known social activist and broke with the church over his pacifism during world war i. he was ultimately expelled from the methodist church for his political views and went on to found the labour church. his sermons centered on politics, philosophy, and religion. in 1918, rev ivens became editor of the western daily news, a labor newspaper. he was arrested and found guilty of seditious conspiracy in 1920 for activities related to his staunch support of the local labor movement during the winnipeg general strike of 1919. ironically, and apparently legally, while serving a 1-year prison sentence, william ivens ran for and was elected to the manitoba legislature as a member of the dominion labour party., william ivens also completed further studies and became a 1926 graduate of the manitoba school of chiropractic. as dr william ivens, he conducted a successful chiropractic practice out of his home in winnipeg until the mid-1950s. dr ivens lost his seat in the manitoba legislature in the 1936 elections and never held public office again. he tried to remain active in politics, but his influence waned as a younger generation came into power. it is not certain when dr ivens became acquainted with dr bj palmer ; but by the mid-1930s, the two carried on an extensive correspondence and even friendship that lasted over the next quarter century (fig 2). it was during this time that he came upon the idea of establishing a hospital at the psc. the notion of creating a chiropractic hospital at the psc appears to have originated with dr ivens around 1932, but bj rejected this suggestion at that time., he had formulated a detailed plan to make what he called the fountain head chiropractic hospital. this was to be constructed in conjunction with the bj palmer clinic, the already existing outpatient facility at the psc. agreed to the suggestion provided he personally be allowed to stand aside, an interested, but inactive, onlooker. since the proposed hospital would be set up as part of the institution which he personally owns, he has now agreed to set aside the whole second floor of his huge clinic building just as soon as the proposal sufficiently matures. agreed to the suggestion provided he personally be allowed to stand aside, an interested, but inactive, onlooker. since the proposed hospital would be set up as part of the institution which he personally owns, he has now agreed to set aside the whole second floor of his huge clinic building just as soon as the proposal sufficiently matures. throughout the ensuing campaign to create the hospital, bj palmer, who understood the political climate of the time, continued to support the idea, but behind the scenes. in a letter to dr ivens dated july 1, 1940, he wrote:i am as vitally interested in the necessity for the hospital as i ever was. but, it does seem to be a case of be damned if you do, and be damned if you don't. if i was outright for it then i was after more money. if i did n't say anything and let you folks take the initiative and go ahead, with my silent acquiescence, then b. j. does not really want the hospital, and so on. what to do i am as vitally interested in the necessity for the hospital as i ever was. but, it does seem to be a case of be damned if you do, and be damned if you don't. if i was outright for it then i was after more money. if i did n't say anything and let you folks take the initiative and go ahead, with my silent acquiescence, then b. j. does not really want the hospital, and so on. what to do therefore, it appears that dr ivens became the leader of the movement to build the hospital with dr palmer 's blessings and full support. after architectural consultation, it was thought that the space set aside for the hospital could be made into 35 to 40 wards with from 1 to many beds each. when completed the hospital will be composed of four distinct types of wards and service, as follows:1.wards for general chiropractic hospitalization.2.obstetrical wards where chiropractic service will prevail.3.traumatic wards, where patients accidentally injured will no longer be deprived of chiropractic service.4.service in a separate institution where mental cases can get the finest type of chiropractic health service. wards for general chiropractic hospitalization. traumatic wards, where patients accidentally injured will no longer be deprived of chiropractic service. service in a separate institution where mental cases can get the finest type of chiropractic health service. there were blueprints that were eventually rendered in 1941, but these appear to have been lost. the average cost for each ward was approximately $ 1000, and it was thought that another $ 20 000 would be needed to provide equipment. therefore, a sum of $ 50 000 would be needed to initiate this project ; and this became the goal of an aggressive, worldwide fund - raising project led by dr ivens. dr ivens made his dream known to the world in an article entitled a wonderful half century, which appeared in the december 1937 issue of the chiropractor. the chiropractor was a monthly publication of the psc that, according to its title page, was a national magazine devoted to the promotion and perpetuation of straight chiropractic. this magazine became the primary method that ivens used to communicate information about the hospital campaign to the profession, at least that portion of the profession that seemed to be aligned with the palmer style of chiropractic. from december 1937 through september 1942, dr ivens wrote almost monthly articles in the chiropractor. throughout this nearly 5-year period, only 5 issues of the chiropractor did not have an article written by dr ivens. in most of these articles, he promoted the campaign to raise funds for the hospital and reported the status of the campaign. thought was that chiropractors everywhere spontaneously and voluntarily unite their forces to create and equip the hospital. he saw this project as a profession - wide undertaking. in an article in the march 1938 issue of the chiropractor entitled chiropractic hospital at the psc a practical proposal a dream that must come true, dr ivens appealed to chiropractors and patients the world over that (n)ow is the time for us all to make a gesture that will fittingly honor our profession. not only did he think that there would be worldwide support for the psc hospital, but that from it would be created a world - wide chiropractic hospital consciousness. in this vein, in 1939, he received a letter from a dr peter boike, who at the time was apparently rendering chiropractic services to mahatma gandhi in india, which stated:now in regards to the hospital plan i am most heartily in favor of the plan. if b.j. and the chiropractic profession had real idealism and had the science at heart as much as they claim, instead of fighting and back - biting each other in all the many years they could have established something that the whole world would have been proud of. now in regards to the hospital plan i am most heartily in favor of the plan. the chiropractic profession had real idealism and had the science at heart as much as they claim, instead of fighting and back - biting each other in all the many years they could have established something that the whole world would have been proud of. on the other hand, dr ivens was a practical person and a shrewd businessman. at the psc lyceum in august 1938, he unveiled the fountain head chiropractic hospital organization (fig 3). this organization had a world chiropractic committee that was composed of local committees in each state, canadian province, and 11 foreign countries, one of which was alaska, that were to work out their own methods of raising the necessary contributions. it also created the fountain head chiropractic hospital fund advisory board that would be in charge of the funds and would work in close cooperation with the psc. dr ivens was the chairman of the advisory board ; however, it is interesting to note that dr palmer was not an official part of the organization at all. the advisory board 's headquarters offices were in davenport, ia (location of the psc). placed with two reliable chartered banks, and auditors appointed to assure that all monies were accurately accounted for, and the headquarters office can expend no funds until so instructed by the executive officers, and their joint signatures appended to checks issued. besides direct appeals, several other fund - raising techniques were used. these included letter writing campaigns, at least one appeal over woc, the radio station in davenport, ia, owned by bj palmer, and explanatory literature available to chiropractors to put in their offices in order to generate donations from patients. a novel notion was the use of money (dime) banks in the shape of the clinic building at the psc (fig 4). it should be noted that the banks were modeled on a building with 3 stories, but the bj palmer clinic building actually had only 2 stories. this seems to be a reflection of the unbridled optimism that dr ivens had for the project. it may well be that shortly another floor will have to be added to find accommodation for the many patients who may throng from all parts of the world. it was suggested that donations of $ 1000 be raised by individuals, states, companies, and organizations to sponsor a hospital ward. a children 's ward was suggested in a letter from dr ivens to dr palmer. dr mabel palmer, bj 's wife, was well known in the chiropractic profession and especially at the psc where she taught anatomy, wrote an anatomical textbook, and was a popular figure on campus. this ward was oversold, as a letter - writing campaign raised $ 2000 from 200 lady chiropractors and chiropractic wives in just 2 months. the first progress report of how the campaign was going was in a may 1939 article in the chiropractor, which stated that the chiropractic hospital fund had $ 10 296.16 cash on hand plus $ 13 934.57 in pledges, for a total of $ 24 229.73. this represented 48% of the goal of $ 50 000. in march 1940, cash on hand ($ 26 991.73) and pledges ($ 16 002.00) had reached $ 42 993.73. by august that same year, ivens reported a total of $ 45 122.72 (cash, $ 31 456.01 ; pledges, $ 13 666.71). in september 1940, it was triumphantly announced in the chiropractor article entitled chiropractic hospital fund goes over the top that the campaign had a total of $ 50 349.00. there were $ 15 589.87 in pledges that were still outstanding. throughout 1941 and most of 1942, dr ivens ' articles in the chiropractor had a different feel. the exception was the november 1941 article where the bakkum chiropractic hospital in waukon, ia, was touted as a prime example of chiropractic hospitalization. it was also noted that the hospital campaign had $ 46 552.92 on hand. the only other report on the hospital campaign during this period came in april 1942. ivens ' article noted that the hospital campaign lacked only $ 1239.96 from reaching its stated goal of $ 50 000. dr ivens and drs roy and jessie bakkum, who owned the bakkum chiropractic hospital, were good friends. dr roy was the chairman of the iowa committee in the fountain head organization. in 1939, drs bakkum visited dr ivens in winnipeg, along with other interested parties from canada, to meet about the hospital. this meeting happened to occur when the king and queen of england were in winnipeg ; and because drs ivens still had some political connections, he and jessie attended a speech given by the king. the drs bakkum brought back a clock with 2 accompanying statues from dr ivens that was presented to dr palmer for placement in the hospital. the clock and statues are still on display on the mantle in the bj palmer mansion in davenport, ia (fig 5). also from 1940 to 1942, milton ivens, md, who was the son of william ivens, worked as the resident medical physician and lived at the bakkum chiropractic hospital. in september 1942, dr ivens wrote what was to be his last article in the chiropractor for nearly a decade. entitled war makes chiropractic hospital imperative, it represented the official announcement that the hospital campaign was ceasing. the final balance sheet showed $ 51 061.67 cash on hand and $ 10 510.54 in outstanding pledges, for a grand total of $ 61 572.21. a roll call of states was included that gave the totals of funds from each state. not too surprisingly, iowa had the biggest total with pledges of $ 12 681.35, of which $ 12 091.55 had been received as cash. therefore, the hospital campaign did reach its stated goal of raising $ 50 000 ; but unfortunately, the fountain head chiropractic hospital was never realized. even though $ 50 000 was the goal for the initial fund - raising campaign, this amount was seen as only a beginning. hospitals are expensive propositions, and the people involved with this campaign knew this. in a 1940 letter from dr mabel palmer to dr ivens, she wrote:in building any kind of structure, it always runs beyond the first amount that is laid down, and in building a hospital and having it in keeping with b.j. 's clinic, will run in excess of $ 50,000. i am facing this hospital in cold figures, and i know that after the $ 50,000 is raised it will take more to complete it ; and i know that neither b.j. nor i will plunge ourselves into such indebtedness as we have in the past much as i see that the hospital is needed badly. there is not anything i would like to see in these few years that we have ahead of us, to complete the picture here at the fountain head, more than to have a beautiful hospital. in building any kind of structure, it always runs beyond the first amount that is laid down, and in building a hospital and having it in keeping with b.j. 's clinic, will run in excess of $ 50,000. i am facing this hospital in cold figures, and i know that after the $ 50,000 is raised it will take more to complete it ; and i know that neither b.j. nor i will plunge ourselves into such indebtedness as we have in the past much as i see that the hospital is needed badly. there is not anything i would like to see in these few years that we have ahead of us, to complete the picture here at the fountain head, more than to have a beautiful hospital. the timing of the notion of creating a hospital at the psc was not optimal given the larger world picture. with the fund - raising campaign starting during the depths of the great depression, donations were relatively difficult to elicit from people who were trying to make financial ends meet. furthermore, the goal of raising the $ 50 000 was realized during the early portion of america 's involvement in world war ii. with the uncertainty of the times, it is not surprising that there was no rush to start construction. with the official end of the hospital campaign in september 1942, dr ivens appears to have started playing a smaller role in the life of the psc. it is known that he worked at collecting pledges for the hospital as late as 1948. even so, his hope for a hospital at the psc was still alive. in 1948, he wrote to dr palmer:the future holds great possibility and will make heavy demands along chiropractic hospitalization lines. the future holds great possibility and will make heavy demands along chiropractic hospitalization lines. after dr mabel palmer died in 1949, dr bj palmer wrote a general letter of appreciation to his colleagues and friends. what could be more appropriate than the mabel palmer memorial hospital, a fund now existing for that purpose ? six suggestions have been received re a memorial to mabel. what could be more appropriate than the mabel palmer memorial hospital, a fund now existing for that purpose ? the funds raised for the hospital were placed in government bonds and held in davenport until 1951. at this point, an opportunity arose for the money to be used toward fulfilling at least part of dr ivens ' original dream. the clear view sanitarium, a chiropractic mental hospital, had been founded in davenport in 1926. when its owners retired in 1951, they wished to insure the continuation of the sanitarium as a chiropractic institution, converted this desire into reality by offering the institution to the fountain head hospital committee. the board accepted the offer, and (o)n october 13th, the purchasing committee of the fountain head hospital fund deeded clear view sanitarium to the palmer school of chiropractic. this represented a de facto end for the fountain head hospital becoming a reality, since the clear view sanitarium continued to function under its original name until it was closed in 1961. this mental health facility was the only part of the original plan that was actually achieved. by this time, dr ivens was no longer chairman of nor even sat on the fountain head chiropractic hospital fund advisory board. it is not clear why this change occurred. at the time of the purchase of clear view dr murphy had been an important part of the hospital project from the very beginning. she was the secretary of the fountain head chiropractic hospital fund advisory board when it was created in 1938 and had also been involved in the woc radio campaign. it appears that dr murphy had become the chair of the board shortly before the purchase of clear view and that dr ivens was glad at this turn of events. in a letter to drs roy and jessie bakkum dated september 5, 1951, dr ivens stated that he had received a letter from dr murphy the day before in which she informed him that there had been an election of officers for the committee and that she that is most fitting is n't it ? even though dr ivens was not on the board, dr palmer still valued dr ivens ' opinion and asked for it relative to the purchase of clear view. [dr palmer ] phoned me three times and wired me twice, so my advice was sought thereon. in this same letter, dr ivens seemed pleased that the money for his vision was used as it was, although he still had hoped that this was only a beginning:yes, we are all glad that at long last the money we so laboriously raised a decade ago has now been invested in clearview sanatorium [sic ]. the property is good ; the location ideal ; and my hope is that presently the institution can be expanded into a general hospital as well as a mental one. yes, we are all glad that at long last the money we so laboriously raised a decade ago has now been invested in the property is good ; the location ideal ; and my hope is that presently the institution can be expanded into a general hospital as well as a mental one. dr palmer had also not given up on the idea of a true hospital at the psc. with the coming acquisition of the clear view sanitarium in 1951,dr. palmer, president of the palmer school, who announced the anticipated change at the annual lyceum in august, indicated that clear view would stand as the first unit in a hospital plan to include other buildings and facilities as soon as funds and available material permitted. palmer, president of the palmer school, who announced the anticipated change at the annual lyceum in august, indicated that clear view would stand as the first unit in a hospital plan to include other buildings and facilities as soon as funds and available material permitted. after the fountain head hospital fund had been spent to acquire clear view, dr ivens appears to have faded further out of the picture. at the time of the purchase of clear view, he sent an airmail letter to dr palmer asking whether or not he and ralph evans (editor of the chiropractor) wanted him to write an article for that publication on how the hospital funds were used for that purpose. apparently, he was not taken up on the offer because he had only 2 more articles that appeared in the chiropractor, both in 1952 and both concerning social issues : the cold war and world food supplies. although he was not an active part of events at the psc any more, dr ivens still did not want to be forgotten. in a letter to drs roy and jessie bakkum sent when they were preparing to go to the psc lyceum in 1954, dr ivens wrote:if you see tena murphy please say a hearty she holds a warm place in my esteem. also, if you chat with b.j. tell him that often he is in my thoughts, and that i am happy that the hospital is now part of the psc set up. tell him that often he is in my thoughts, and that i am happy that the hospital is now part of the psc set up. because of failing health, dr ivens spent his last years with his son, milton ivens, in california. he died in chula vista, ca, in 1958, just before his 80th birthday. dr william ivens had a dream that chiropractic hospitals would be a worldwide phenomenon and that the flagship institution would be the fountain head chiropractic hospital at the psc in davenport, ia. during some of the most challenging years of the 20th century, he worked tirelessly to try to make this dream come true. even after the campaign to raise funds for the hospital did not fulfill this dream in the way he envisioned he held on, until the end of his days, to the belief that the world needs chiropractic care in a hospital setting. because of the political climate during dr ivens ' era, the only way for chiropractic in - patient care to become a reality was for the chiropractic profession to build its own facilities more recently, through the diligent work of other leaders in the chiropractic profession, a few doctors of chiropractic have gained the necessary privileges to offer their services in conventional in - patient facilities, eg veterans ' administration hospitals. it may well be that dr ivens ' notion of chiropractic care being available to hospitalized patients may still become a reality, although not in the way he envisioned, as separate facilities, but rather by doctors of chiropractic being added to the health care teams managing patients in mainstream hospitals. | objectivethe purpose of this article is to relate information about the life of dr william ivens and describe the worldwide effort led by him to establish a chiropractic hospital at the palmer school of chiropractic.discussiondr william ivens, a colorful politician and chiropractor from winnipeg, canada, was the driving force behind the idea of establishing a chiropractic hospital at the palmer school of chiropractic in davenport, ia, during the late 1930s. with the blessings of dr bj palmer, president of the palmer school of chiropractic, dr ivens led an aggressive, worldwide campaign to raise the funds necessary to establish what was to be called the fountain head chiropractic hospital. during the tumultuous years of 1937 - 1942, this campaign successfully raised the target sum of $ 50 000, thought necessary to create the hospital, but the idea never became a reality. these funds were eventually used to purchase the clear view sanitarium, a chiropractic psychiatric facility, in davenport, ia, in 1952.conclusiondr william ivens stands as a prime example of a relatively small, but dedicated, number of chiropractors during the mid-20th century who not only believed in, but toiled for, the idea of chiropractic care being given in an in - patient setting. |
a spinal subdural hematoma (sdh) is a rare clinical entity that accounts for only 4.1% of all spinal hematomas. it can be caused by major or minor trauma and iatrogenic injuries, such as those resulting from spinal punctures performed for diagnostic or anesthetic purposes5). simultaneous intracranial and spinal sdhs are rare and may be a distinct subgroup, and only 12 cases have been reported in english literature1 - 3,6,7,9 - 14). among them, only two cases of spontaneous concomitant cranial and spinal sdhs were reported in a patient receiving anticoagulant therapy who did not have a history of antecedent head or back injuries or lumbar spinal puncture3). here, we report on a case of patient with a spontaneous nontraumatic spinal sdh that occurred with a simultaneous intracranial subacute sdh. the pathophysiological mechanisms of this uncommon entity are discussed, and the relevant literature is reviewed. a 67-year - old female who complained of back pain and both leg radiating pain was referred to our emergency room. she also complained of a severe bitemporal headache at the same time. during the previous 3 years she was treated with combined low dose aspirin and 75 mg clopidogrel bisulfate (plavix) per day. examination of blood tests had shown a platelet count of 14210/l, a prothrombin time of 10.4 sec (range 9.4 - 12.5), an international normalize ratio of 1.2 (range 0.9 - 1.27) and partial thrombolplastin time of 40.2 sec (range 28.0 - 44.0). they were all within normal ranges. upon physical examination, she was alert and fully oriented in spite of the severe headache. the neurological examination revealed slight motor weakness (grade iv) and numbness in the lower extremities. an immediate magnetic resonance imaging of the brain and spine revealed a subacute sdh in the left fronto - temporo - parietal area that was 8 mm at its thickest point and a well - circumscribed intradural lesion, which was isodense with the dural sac, that measured 8 mm at its maximum diameter and compressed the cauda equina at l4-s1. the intradural lesion showed high signal intensities on t1 weighted images and low signal intensities on t2 weighted images. no contrast enhancement was seen on fat - suppressed t1-weighted images (fig. 1, 2). based on these magnetic resonance (mr) findings, the patient was diagnosed with concomitant cranial and spinal sdhs. the hematoma was evacuated under local anesthesia through one burr hole using a 5-l catheter 7 days after admission. the spinal sdh was treated conservatively. to distinguish this case from other conditions for differential diagnosis, the cerebrospinal fluid (csf) analysis revealed 190000 red blood cells / mm and 267 white blood cells / mm. a brain computed tomographic scan and lumbar spine mr images taken 14 days after admission revealed that the spinal sdh had completely resolved (fig. 3). the patient was in good health and free of neurological deficits during the 12-month follow - up period. unlike the cranial counterpart, the spinal subdural space lacks the bridging veins that act as an origin for a sdh. the lower incidence of sdh in the spine has been attributed to the protection of the spinal subdural space by the vertebrae and broad paravertebral muscles and to the rare passage of blood vessels, such as bridging veins, through the subdural space3,14). moreover, a concomitant intracranial and spinal sdh is extremely rare, and, to the best of the authors ' knowledge, a total of 13 cases of the concomitant occurrence of intracranial and spinal sdhs have been reported so far in the english literature (table 1). among them, most cases were attributed to head injury or changes of csf hydrodynamics, and there has been only two reports, including our report, associated with anticoagulation in the absence of trauma3,4). when using antiplatelet agents, the adp receptor antagonists prevent adp - induced fibrinogen binding to platelets, a necessary step in the platelet aggregation process. they would not influence the coagulation profiles of our patient, so the patient 's coagulation status remained normal. the exact etiology of the simultaneous occurrence of intracranial and spinal sdhs has not been clearly elucidated. initial hemorrhage in the subarachonoid space is thought to be the primary lesion that eventually dissects into the subdural space, and the subarachnoid hemorrhage is washed out by cerebrospinal flow3). however, the causal relationship between cranial and spinal bleeding is not clearly documented by this theory. hung.2) hypothesized that a rise of intracranial pressure may also increase shearing force between spinal subdural and subarachnoid spaces so that the inner dura may tear and bleed. either high or low intracranial pressure has been proposed as a predisposing factor for this migration. raised intracranial pressure due to brain swelling the anatomic continuity between the intracranial and spinal subdural spaces can be observed using an electron microscope8). a spinal sdh and rebleeding might have occurred in the cranial lesion before the onset because mr imaging of the brain suggested that the hematoma was in the subacute phase on admission. oral antiplatelet therapy and brain atrophy with aging may have facilitated the rebleeding and migration of the hematoma. the limitation of this study is that even though we discard the possibility of a minor trauma and thoroughly educate the patient, there is not enough to rule out the possibility of chronic subdural hematoma due to an accidental minor injury to the head. although rare, concomitant intracranial subacute sdh and spinal sdh should be included in the differential diagnosis of nerve root compression in a patient receiving anticoagulant therapy. | simultaneous intracranial and spinal subdural hematomas are extremely rare. in most cases, they are attributed to major or minor trauma and iatrogenic causes, such as those resulting from spinal puncture. to the best of the authors ' knowledge, there has been only two reports of spontaneous concomitant intracranial and spinal subdural hematomas in a patient receiving anticoagulant therapy who had an absence of evident trauma history. we report on a case of spontaneous concomitant intracranial and spinal subdural hematomas that occurred in association with anticoagulant therapy and present a review of the relevant literature. |
the most common causes of hypercalcemia are malignancies, particularly solid tumors, in hospitalized patients1 and primary hyperparathyroidism in non - hospitalized patients.2 the most common cause of primary hyperparathyroidism is a solitary parathyroid adenoma.2 neck ultrasound and dual - phase tc-99 m sestamibi (mibi) scan are generally used as first - line tools in the diagnosis of primary hyperparathyroidism.35 neck ultrasound is the least invasive and most inexpensive method to accurately localize hyperfunctioning parathyroid, but its efficacy is related to the operator experience and may be reduced in the presence of concomitant nodular goiter.3 mibi is a lipophilic monovalent cation showing increased uptake in epithelial cells rich in mitochondria such as hyperfunctioning parathyroid cells. mibi scan shows high sensitivity (71%93%) and specificity (90%) in localizing hyperfunctioning parathyroid.35 reported sensitivity and specificity of mibi plus spect for solitary adenomas vary from 92% to 97% and from 96% to 99%, respectively.37 mibi retention is not parathyroid - specific and is also observed in hypermetabolic thyroid nodules ; blood vessels esophagus, longus colli muscle, and enlarged lymph nodes may represent other rare sources of false - positive results.3,8,9 hypercalcemia occurs in 2%63% of patients with sarcoidosis ; hypercalciuria is about three times more common (30%50% of cases).1,10 hypercalcemia in sarcoidosis is due to the uncontrolled synthesis of 1,25-dihydroxyvitamin d3 by macrophages. 1,25-dihydroxyvitamin d3 leads to an increased absorption of calcium in the intestine and to an increased resorption of calcium in the bone.1,10,11 primary hyperparathyroidism can coexist with sarcoidosis.11,12 less well - recognized is the ability of sarcoidosis itself to masquerade as a parathyroid adenoma.13 we report a case of cervical lymph node sarcoidosis misdiagnosed as parathyroid adenoma. accumulation of mibi in hilar lymph nodes and in pulmonary interstitial fibrosis in sarcoidosis has been reported previously;1416 other cases of sarcoidosis have been misinterpreted as primary hyperparathyroidism before the mibi was introduced into clinical practice.12,13 a case of active sarcoid mimicking a mediastinal parathyroid adenoma on mibi scan was previously described by klieger.17 to our knowledge this is the first reported case of neck lymph node misdiagnosed as parathyroid adenoma on mibi scan and second case described in literature considering other localizations.17 she had a history of hypothyroidism caused by hashimoto s thyroiditis and treated with l - thyroxine. serum investigation revealed increased calcium of 10.5 mg / dl (normal range (nr) : 8.610.2) and a parathyroid hormone (pth) of 162 pg / ml (normal range 1265). serum phosphorus was 3.5 mg / dl (nr : 2.74.5), urinary calcium was 152 mg/24 h (nr : 50250), and urinary phosphorus was 1298 mg/24 h (nr : 8003000). vitamin d 25-oh was 21 ng / ml (nr : 20100). serum creatinine was 1.25 mg / dl (nr : 0.61.1), the estimated glomerular filtration rate (egfr) was 90 ml / min/1.73 m (nr : 90120), creatinine clearance (ccr) was 85 (85130 ml / min). calcium clearance / creatinine clearance ratio was 0.02 and diagnosis of familial hypocalciuric hypercalcemia (fhh) was excluded. primary hyperparathyroidism was suspected and a neck ultrasonography was performed, revealing a paratracheal hypoechoic mass of 15 mm of maximum diameter with peripheral vascularization located near the lower pole of the right lobe of the thyroid (compatible with lower right parathyroid). mibi scan and spect / ct identified a mibi - positive area corresponding to the paratracheal nodule detected by ultrasonography (us), suggesting a lower right parathyroid adenoma (fig. being concordant us and mibi scan, a right inferior parathyroid adenoma was suspected and the patient underwent surgical exploration. the indication for parathyroidectomy was based on the suspicion of parathyroid adenoma while the indication for thyroidectomy, after informed consent of the patient, was based on the thyroid volume, the volume and the characteristics of the thyroid nodules, and the fact that the thyroid and the nodules volume were in constant growth. measurement of intraoperative pth was made : basal pth was 152 pg / ml, pth 10 minutes after excision was 211 pg / ml, while pth 20 minutes after excision was 152 pg / ml. the bilateral exploration of the neck was negative for the presence of other pathological parathyroid glands. pathologic examination confirmed the preoperative diagnosis of hashimoto s thyroiditis associated with hyperplastic nodular goiter, but did not confirm the diagnosis of parathyroid adenoma, the mass being a granulomatous lymph node consistent with active sarcoidosis (fig. no other sarcoidosis lesions or related findings were found, the neck lymph node being the only visible lesion. the patient has begun therapy for sarcoidosis with corticosteroids and is currently well 5 years after surgery. we report a case of cervical lymph node sarcoidosis misdiagnosed as parathyroid adenoma on neck ultrasonography and mibi scan. difficulty in us and mibi scan interpretation with high rate of false - positive images (15%20%) has been described in the presence of hypermetabolic thyroid nodules ; blood vessels, esophagus, longus colli muscle, and enlarged lymph nodes may represent other rare sources of false - positive results.3,8,9 hypercalcemia can occur in sarcoidosis, its prevalence being approximately 20%;11 the relation between sarcoidosis and hypercalcemia was first noted in 1939.10,18 risk factors for development of hypercalcemia in patients with sarcoidosis include renal insufficiency, increased dietary vitamin d, dehydration, increased uptake of oral calcium and/or decreased calcium excretion, and increased sunlight exposure.10,18 our patient had mild renal insufficiency. in our case, postoperative exams and follow - up allowed to exclude the presence of a primary hyperparathyroidism, sarcoidosis thus being the only cause of hypercalcemia. the presence of a mild renal insufficiency may have been the cause of the increase in pth. as with other lipophilic cations, the precise uptake mechanism in sarcoidosis is unknown.15 lymph nodes with sarcoid involvement are found in 23% to 37% of patients with sarcoidosis.13 accumulation of mibi in hilar lymph node and in pulmonary interstitial fibrosis in sarcoidosis has been reported previously.1416 it is a rare to observe other lymph nodes outside the chest showing increased uptake.14 before the introduction of mibi scanning into clinical practice, cases of sarcoidosis misinterpreted as primary hyperparathyroidism have been described.12,13 to our knowledge, the only case of active sarcoid mimicking a parathyroid adenoma on mibi scan was previously described by klieger,17 but in that case the disease was localized in the mediastinum. our case was particularly interesting because it s the second case described in the literature of lymph node sarcoidosis mimicking a parathyroid adenoma on mibi scan ; the first case in involved a lymph node localized to the neck. preoperative imaging studies (us, mibi, scan and spect / ct) were concordant and preoperative diagnosis of parathyroid adenoma was made. intraoperative measurement of pth gave discordant results for which it was carried out a bilateral exploration of the neck : no pathological parathyroid was found. fortunately, the suspicion of parathyroid adenoma was not the only indication for surgery, being present a large multinodular goiter associated with a thyroiditis. only histological examination revealed the correct diagnosis of sarcoidosis which was subsequently treated. in conclusion, sarcoidosis should be taken into account as a cause of unexplained hypercalcemia and the differential diagnosis of hypercalcemia, even in presence of mibi uptake, must include sarcoidosis localized in an isolated cervical lymph node. | we report a case of cervical lymph node sarcoidosis misdiagnosed as parathyroid adenoma. this is the second case described in the literature in which lymph node sarcoidosis was misdiagnosed as parathyroid adenoma on tc-99 m sestamibi (mibi) scan, the first case localized in the neck. a 64-year - old woman presented with a hypercalcemia. neck ultrasonography revealed a paratracheal hypoechoic mass of 15 mm with peripheral vascularization. mibi scan and spect / ct identified a mibi - positive area corresponding to the nodule detected by ultrasonography suggestive for a lower right parathyroid adenoma. a mass interpreted as the lower parathyroid was excised associated to a total thyroidectomy. pathologic examination revealed a granulomatous lymph node consistent with active sarcoidosis. sarcoidosis should be suspected as a cause of unexplained hypercalcemia and the differential diagnosis of hypercalcemia, even in presence of mibi uptake, must include sarcoidosis localized in an isolated cervical lymph node. |
to report the case of a patient with unilateral idiopathic macular telangiectasia (imt) associated with type 3 neovascularization. we describe a case of an 85-year - old woman who presented at our department with a gradual vision loss in her left eye (le). fundus examination showed 2 small hemorrhages located nasally to the le fovea, as well as lipid exudates. spectral - domain optical coherence tomography (sd - oct) showed several microaneurysms within the inner retinal layers. no signs of imt or type 3 neovascularization were detected in the right eye. based on these findings the le was treated with intravitreal anti - vascular endothelial growth factor (anti - vegf) injections. twenty - four months later, sd - oct revealed regression of the exudative signs, and le bcva improved to 20/100. we describe the case of an unusual association between older - onset imt and type 3 neovascularization, and subsequent regression by anti - vegf injections. we propose a new imt subtype called type 1c for this association. further research must be done in order to establish the pathophysiologic mechanism and likelihood of this association. in 1982, gass and oyakawa described idiopathic macular telangiectasia (imt) as a condition involving capillary ectasia and dilation in the juxtafoveal region. clinical presentation comprises decreased visual acuity, sometimes accompanied by metamorphopsia, as well as a central scotoma, as the disease slowly progresses. according to the classification by gass and blodi, there are 3 types of imt (table 1). type 1 (imt-1) : unilateral macular telangiectasia with visible aneurysms, which occurs predominantly in males ; in this case, the cause of visual loss is mostly macular edema [visible and exudative imt (imt-1a) ; visible, exudative and focal imt (imt-1b) ]. type 2 (imt-2) : bilateral macular telangiectasia that occurs in men and women, with characteristic features on multimodal imaging ; subretinal or intraretinal neovascularization is frequently seen in this type [occult and nonexudative imt (imt-2a) ; juvenile, occult and familial imt (imt-2b) ]. type 3 (imt-3) : very rare, associated with vascular occlusions, occurring in the larger setting of a medical or neurological disease [occlusive imt (imt-3a) ; occlusive imt associated with central nervous system vasculopathy (imt-3b) ]. moreover, in 2006, yannuzzi. merged the imt-1 subtypes into one group of aneurysmal telangiectasia, characterized by clearly visible aneurysms, and defined imt-2a as a group of perifoveal telangiectasia, leaving out imt-2b and imt-3 because of their rarity. in addition, they described the possible association of imt-2 with retino - retinal anastomosis and choroidal neovascularization. the therapeutic options for imt-1 consist of laser photocoagulation, which is the main treatment, as well as intravitreal injections (ivts) of steroids or anti - vascular endothelial growth factor (anti - vegf) agents. the case we report combines the characteristics of imt-1a with the intraretinal vascular complex typical of a type 3 neovascularization. an 85-year - old woman presented at our clinic complaining of gradual vision loss in her left eye (le). her best - corrected visual acuity (bcva) was 20/80 in the right eye (re) and 20/200 in the le. fundus examination of the re was unremarkable, while for the le, it revealed 2 small hemorrhages located nasally to the fovea accompanied by lipid exudates inferiorly and superiorly (fig. early - phase fluorescein angiography (fa ; spectralis, sd - oct+hra, heidelberg engineering, germany) was unremarkable in the re, while it demonstrated dilated capillaries within the le fovea, along with vascular tortuosity in the superior and nasal macula (fig. early fa of the le also showed a zone of focal hyperfluorescence with a superotemporal right - angle dilated feeding vessel, deepening into the foveal avascular zone, evocative of a type 3 intraretinal neovascularization (fig. spectral - domain optical coherence tomography (sd - oct ; spectralis) of the re showed an epiretinal membrane along with a discrete vitreomacular traction. sd - oct of the le revealed small, round, well - demarcated foveal lesions with hyperreflective edges in the inner retinal layers, corresponding to microaneurysms along with cystoid spaces. a hyperreflective lesion located in the outer retinal layers, temporal to the macula and adherent to the retinal pigment epithelium [6, 7 ], indicating the presence of type 3 intraretinal neovascularization, was also noted (fig. indocyanine green angiography (icga ; spectralis) revealed a late hyperfluorescence and confirmed the presence of a type 3 neovascularization in the le (fig. 2c). based on these findings, the patient was diagnosed with atypical imt-1 (the average age at presentation of patients in this group is 37 years) and coincident type 3 neovascularization. the patient was treated with a series of 3 monthly ivts of ranibizumab (0.5 mg/0.05 ml) in the le followed by a prn regimen. at 6 months, after 3 ranibizumab ivts, bcva improved to 20/160 in the le. fa and icga showed absence of late - phase leakage from the lesion, and sd - oct revealed regression of the exudative signs (fig. sd - oct revealed recurrence of exudative signs at 8 months, and thus, the patient received repeated ranibizumab ivts on a monthly basis up to month 14 (6 ivts). at month 16, due to recurrence of exudative signs, the patient received repeated ranibizumab ivts on a monthly basis up to month 22 (6 ivts). at 24 months, after a total of 15 ivts, bcva improved to 20/100 in the le, and fa, icga and sd - oct showed regression of both cystoid macular edema and serous retinal detachment. we described the case of a patient diagnosed with atypical imt-1a associated with type 3 neovascularization. according to the classification by gass and blodi, the presence of a unilateral telangiectatic lesion accompanied by microaneurysms would suggest the diagnosis of imt-1a. nevertheless, the association of macular telangiectasia with a type 3 intraretinal neovascularization is a typical complication of imt-2 and is known to be a sign of exudative age - related macular degeneration [8, 9 ]. to our knowledge, the shared characteristics between imt-1 and imt-2 have only been described once in a similar case in 2011, by mezad - koursh.. given the unusual association observed, our cases, along with the case described by mezad - koursh., are evocative of a new subtype of imt that we propose to call imt-1c, characterized by unilateral macular telangiectasia with visible aneurysms and macular edema, possibly complicated by type 3 neovascularization. the description of more cases of imt-1c is desirable in order to define this subtype of imt. the authors have no proprietary interest in the materials used in this study and received no financial or material support for the research and the work. | purposeto report the case of a patient with unilateral idiopathic macular telangiectasia (imt) associated with type 3 neovascularization.methodsobservational case report.resultswe describe a case of an 85-year - old woman who presented at our department with a gradual vision loss in her left eye (le). her best - corrected visual acuity (bcva) was 20/200 in the le. fundus examination showed 2 small hemorrhages located nasally to the le fovea, as well as lipid exudates. fluorescein angiography revealed early hyperfluorescence corresponding to the dilated capillaries. spectral - domain optical coherence tomography (sd - oct) showed several microaneurysms within the inner retinal layers. late indocyanine green angiography revealed a focal hyperfluorescence corresponding to a type 3 neovascularization. no signs of imt or type 3 neovascularization were detected in the right eye. based on these findings, the patient was diagnosed with type 1 imt and coincident type 3 neovascularization. the le was treated with intravitreal anti - vascular endothelial growth factor (anti - vegf) injections. twenty - four months later, sd - oct revealed regression of the exudative signs, and le bcva improved to 20/100.conclusionwe describe the case of an unusual association between older - onset imt and type 3 neovascularization, and subsequent regression by anti - vegf injections. we propose a new imt subtype called type 1c for this association. further research must be done in order to establish the pathophysiologic mechanism and likelihood of this association. |
we have studied the effect of several environmental chemicals on the transient expression of a chloramphenicol acetyltransferase (cat) reporter gene linked to the promoter sequences in the long terminal repeat (ltr) of the human immunodeficiency virus type 1 (hiv-1). aflatoxin b1, 2,3,7,8-tetrachlorodibenzo - p - dioxin (tcdd ; dioxin) and benzo[a]pyrene cause a significant increases in cat expression in mouse hepatoma hepa-1 cells. the induction of cat after tcdd treatment is abolished by administration of n - acetyl - l - cysteine or 2-mercaptoethanol and does not take place in a mutant cell line that lacks cyp1a1 enzymatic activity. linker - scanning mutational analysis of transcription factor binding sites in the promoter revealed that both the nf kappa b and an adjacent aromatic hydrocarbon response element (ahre) are required for tcdd - dependent cat expression. in addition, mutation of the nfat / ap-1 binding sites in the negative regulatory region of the promoter increases the magnitude of the tcdd effect. we conclude that induction of a functional cyp1a1 monooxygenase by tcdd stimulates a pathway that generates thiol - sensitive reactive oxygen intermediates which, in turn, are responsible for the tcdd - dependent activation of genes linked to the ltr. these data might provide an explanation for findings that tcdd increases infectious hiv-1 titers in experimental systems and for epidemiologic reports suggesting that exposure to aromatic hydrocarbons, such as found in cigarette smoke, is associated with an acceleration in aids progression.imagesp366-afigure 2.figure 3.figure 4.figure 5. |
|
schwannoma also called as neurilemmoma is a benign neoplasm of the schwann cells surrounding the nerves.. however, intraosseous schwannoma are extremely rare in jaw bones and represent less than 1% of benign primary tumors of the jaws. a 42-year - old man hailing from dakshina kannada district in karnataka, india, reported to us with a slowly growing swelling on the left side of lower jaw since the previous 4 years. three years ago teeth in the same region became loose and were extracted at a primary health center. the patient had visited the same health center a number of times because of the swelling. medications were prescribed each time but there was no decrease in the size of the swelling. a diffuse swelling was observed on the left lower third of the face extending to the left submandibular region with normal overlying skin. intraoral examination revealed bicortical expansion of the edentulous ridge in the same region with reduced buccal sulcus depth. residual cyst, fibro - osseous lesion, ameloblastoma, dentigerous cyst, and odontogenic keratocyst were listed as the possible differential diagnoses. a mandibular lateral occlusal radiograph was made, which showed buccolingual expansion in the same region and orthopantomogram revealed the presence of large radiolucent area (5 7 cm) on the left side of the mandible involving the body and ramus [figure 1 ]. a sclerotic rim extending 1 cm below the lower border of the mandible was observed. anteriorly the lesion extended to the distal aspect of premolar and posteriorly to the ramus. a biopsy was performed from the intraoral site, middle of the mandibular residual alveolar ridge and evaluated histopathologically. it revealed the presence of spindle - shaped cells with elongated nuclei arranged in typical circular (antoni a) and linear pattern (antoni b) along with small cyst - like spaces and eosinophilic verocay bodies [figure 2 ]. based on these histopathologies, it was diagnosed as schwannoma. since the lesion was massive and only a thin margin of the base was intact, which could lead to pathological fracture, the entire left segment of the mandible was resected barring the condyle. the left side was then reconstructed with bone plate and stabilized with interdental wiring for 3 weeks before being discharged from the hospital. the patient was followed - up for 6 months during which the patient had of localized numbness on the left side of the lower lip. the patient was also advised prosthetic rehabilitation but failed to keep up with further appointments. (left side) mandibular lateral occlusal radiograph revealing buccolingual expansion of the body of mandible on the left side. (right side) orthopantomogram showing large radiolucent area in the left body and ramus region of mandible photomicrograph (hematoxylin and eosin stain ; original magnification 100) showing cells with elongated spindle - shaped nuclei (antoni a type) and also homogenous acellular areas (verocay bodies) a recent review of literature revealed that only 44 cases of intrabony schwannomas have been reported. three possible mechanisms of bone involvement by schwannoma have been explained : (1) a tumor may arise within the bone ; (2) a tumor may arise within the nutrient canal and produce canal enlargement ; or (3) a peripheral tumor causing bone enlargement. in our case a combination of the first 2 mechanisms could be the cause of bone involvement. in most of the reported cases the same nerve was involved in our case on the left side of the mandible. radiographically schwannomas present as well - defined unilocular radiolucency with sclerotic borders but sometimes features, such as cortical expansion, root resorption, spotty calcification, and peripheral scalloping can be evident. microscopically spindle - shaped cells in antoni a and antoni b arrangement interspersed with hyalinized verocay bodies are characteristic features. surgical treatment was carried out in our patient, which is the most widely used method to prevent recurrence. intraosseous schwannoma although extremely rare, knowledge of the clinical radiological and histopathological features is extremely important for prompt diagnosis and appropriate management. | schwannoma, a benign nerve sheath tumor is relatively rare in occurrence and even rarer in sites, such as jaw bones. there are only 45 reported cases of intraosseous schwannoma of the jaws reported in the literature. we report a rare case of mandibular schwannoma in a 50-year - old indian male. the clinical features resembled that of a residual cyst, fibro - osseous lesion or an odontogenic tumor / cyst. radiological differential diagnoses of ameloblastoma or odontogenic keratocyst was made based on the findings of the orthopantomogram. the lesion was examined histopathologically and a final diagnosis of schwannoma arising from the inferior alveolar nerve was made. the aim of this report is to add information to the existing sparse literature on intraosseous schwannomas of the jaw. |
gynecomastia occurs due to increase level of estradiol, decreased androgen level or imbalance between estrogen and androgen. familial gynecomastia occurs because of increased peripheral aromatization in families and due to inversion in chromosome 15q21.2 - 3 resulting in increased estrogen production in fatty tissue. gynecomastia requires urgent and extensive evaluation if it is recent onset, rapidly growing, tender and occurs in lean subjects. it is rare for gynecomastia predisposing to carcinoma except in klinfelter syndrome (kfs). surgery is indicated for cosmetic reasons like increase in size, tenderness and in suspected malignancy. two brothers, 18-years - old and 14-years - old, born out of non - consangious marriage, were brought by their father in endocrine out - patient department (opd) with complaints of swelling in both breast since 6 years and 2 years, respectively. on investigation, the breast swellings were gradually increasing in size and painless with no discharge from the nipple. no history of chronic use of drugs, local applications of ointments or substance abuse was reported. no history of palpitation, weight loss, headache, diminution of vision, viral infections, trauma or similar complaints in any other family member. patients father attained puberty at the age of 22 years and mother 's age of menarche was 12 years. pulse = 84/min, blood pressure (bp) = 122/82, 114/80 mm of hg supine and standing, respectively height = 154 cm, weight = 52 kg, body mass index (bmi) = 21.94 kg / m, arm span = 153 cm, upper segment = 78 cm, lower segment = 76 cm. both the breasts were firm, 2.5 cm 1.9 cm in size (tanner stage iii), not attached to underlying tissue, non - tender. pulse = 88/min, bp = 116/78, 110/76 mm of hg in supine and standing position, respectively, height = 160 cm, weight = 59 kg, bmi = 23.04 kg / m, arm span = 165 cm, upper segment = 77 cm, lower segment = 83 cm patient had eunochoid physique, wide hip, narrow shoulders, no facial hair. axillary hairs were sparse, pubic hair had feminine distribution (tanner stage ii). genitals appeared prepubertal, testis volume 2/2 (prader orchidometer) = 5 cm, stretched penile length of 4 cm, thin scrotal skin. both the breasts were 4.1 cm 3.8 cm (tanner stage v), firm, non - tender, not attached to underlying tissue. hb = 13.4 gm%, tc = 8900 cells / cu mm, blood glucose fasting = 92 mg% and post - prandial glucose 134 mg%, total bilirubin = 0.6 mg%, sgpt and sgot within normal limits, serum creatinine = 0.9 mg%. serum fsh = 5.42 miu / ml, serum lh = 1.82 miu / ml, serum prolactin = 6.75 ng / ml, serum testosterone = 500.8 ng / dl, tsh 2.01 = miu / ml, ft4 = 7.4 mgm / dl, ft3 = 129.18 ng / dl, serum cortisol (8 am) = 14.5 mgm / dl. ultrasonography of the chest showed fat deposition in subcutaneous plane, glandular tissue (right > left). ultrasonography of the scrotum = right testis 3.5 2.1 1.3 cm, left testis 3.4 2.1 1.8 cm, left epididimal cyst. in view of normal clinical, biochemical, hormonal, and radiological investigations hb = 11.6 gm%, tc = 7100 cells / cmm, blood sugar fasting = 92 mg% and post - prandial = 112 mg%, total bilirubin = 0.6 mg%, sgpt and sgot within normal limits, serum creatinine = 1 mg%. serum fsh = 42.04 miu / ml, serum lh = 47.2 miu / ml serum prolactin = 4.9 ng / ml, serum testosterone = 191.77 ng / dl, tsh = 1.41 miu / ml, ft4 = 9.9 mgm / dl, ft3 = 168.5 ng / dl, serum cortisol (8 am) = 16.1 mgm / dl. ultrasonography of the chest showed fat deposition in subcutaneous plane, glandular tissue (right > left). ultrasonography of the abdomen = normal, ultasonography of the scrotum = right testis 1.1 1.1 0.8 cm, left testis 1 0.8 0.5 cm suggestive of atrophic hypoplastic testis. his karyotype revealed 47xxy. in view of cinical, biochemical, hormonal, radiological investigations and karyotype, pulse = 84/min, blood pressure (bp) = 122/82, 114/80 mm of hg supine and standing, respectively height = 154 cm, weight = 52 kg, body mass index (bmi) = 21.94 kg / m, arm span = 153 cm, upper segment = 78 cm, lower segment = 76 cm. both the breasts were firm, 2.5 cm 1.9 cm in size (tanner stage iii), not attached to underlying tissue, non - tender. pulse = 88/min, bp = 116/78, 110/76 mm of hg in supine and standing position, respectively, height = 160 cm, weight = 59 kg, bmi = 23.04 kg / m, arm span = 165 cm, upper segment = 77 cm, lower segment = 83 cm patient had eunochoid physique, wide hip, narrow shoulders, no facial hair. axillary hairs were sparse, pubic hair had feminine distribution (tanner stage ii). genitals appeared prepubertal, testis volume 2/2 (prader orchidometer) = 5 cm, stretched penile length of 4 cm, thin scrotal skin. both the breasts were 4.1 cm 3.8 cm (tanner stage v), firm, non - tender, not attached to underlying tissue. hb = 13.4 gm%, tc = 8900 cells / cu mm, blood glucose fasting = 92 mg% and post - prandial glucose 134 mg%, total bilirubin = 0.6 mg%, sgpt and sgot within normal limits, serum creatinine = 0.9 mg%. = 135 meq / l, serum potassium = 4.1 meq / l. serum fsh = 5.42 miu / ml, serum lh = 1.82 miu / ml, serum prolactin = 6.75 ng / ml, serum testosterone = 500.8 ng / dl, tsh 2.01 = miu / ml, ft4 = 7.4 mgm / dl, ft3 = 129.18 ng / dl, serum cortisol (8 am) = 14.5 mgm / dl. ultrasonography of the chest showed fat deposition in subcutaneous plane, glandular tissue (right > left). ultrasonography of the scrotum = right testis 3.5 2.1 1.3 cm, left testis 3.4 2.1 1.8 cm, left epididimal cyst. in view of normal clinical, biochemical, hormonal, and radiological investigations hb = 11.6 gm%, tc = 7100 cells / cmm, blood sugar fasting = 92 mg% and post - prandial = 112 mg%, total bilirubin = 0.6 mg%, sgpt and sgot within normal limits, serum creatinine = 1 mg%. serum fsh = 42.04 miu / ml, serum lh = 47.2 miu / ml serum prolactin = 4.9 ng / ml, serum testosterone = 191.77 ng / dl, tsh = 1.41 miu / ml, ft4 = 9.9 mgm / dl, ft3 = 168.5 ng / dl, serum cortisol (8 am) = 16.1 mgm / dl. ultrasonography of the chest showed fat deposition in subcutaneous plane, glandular tissue (right > left). ultrasonography of the abdomen = normal, ultasonography of the scrotum = right testis 1.1 1.1 0.8 cm, left testis 1 0.8 0.5 cm suggestive of atrophic hypoplastic testis. his karyotype revealed 47xxy. in view of cinical, biochemical, hormonal, radiological investigations and karyotype, familial gynecomastia is rare, with description of three brothers in a single family and was due to increased extraglandular aromatase activity. in pubertal boys it is generally subaerolar nodule and may regress in half to approximately one and half year in majority of cases. kfs described by harry f. klinefelter is the most common chromosomal abnormality associated with primary testicular failure and infertility. gynecomastia is present in about > 40% of kfs patients. in physiological or familial gynecomastia but in kfs, estradiol levels are high already in the prepubertal age, irrespective of development of gynecomastia. testosterone treatment, testicular volume, bone density, as well as the social status of the patients are inversely related to gynecomastia. whereas, height and gynecomstia are positively correlated. bilateral gynecomastia in kfs is seen in 42% patients in pubertal age, with small testes and neurodevelopmental disorders. whereas gynecomastia is the presenting symptom in 10% and sign in 33% of adults kfs. from an endocrinological standpoint, patient 's complaints may vary, according to gonadal dysfunction, from signs of sex hormone deficiency in young adults to infertility in a male without other signs of hypogonadism. before puberty, the condition is usually under recognized due to the fact that childhood is a period characterized by normally low testosterone levels and no sperm. histologically, there is hyperplasia of interductal tissue, unlike ductal hyperplasia seen in other high estrogen states. there is a high risk of carcinoma breast, about 60-fold higher than normal men. this high risk is due to the hyperestrognic state secondary to increase aromatization of testosterone to estradiol and over expression of oncogene on x chromosome that has escaped inactivation. no treatment is required except reassurance of the patient which was given to the younger brother. the younger brother was advised dietary modification, weight loss in addition to increased physical activity, however, he later underwent for bilateral surgical resection. elder brother in view of his clinical and biochemical profile was started on testosterone injection after discussion with patient and family members. for the family it was devastating to learn that over the years they were told gynecomastia was normal in the elder sib and would go away with age. however, after confirmation of diagnosis and extensive discussion and counseling of the family members they were relieved and proceeded with further treatment of their children. our case was unusual as both brothers in one family developed gynecomastia in their adolescence, but had different etiologies and both required different management strategies. management in such cases requires assurance, reassurance, therapeutic trial of drugs, family counseling, or surgical approach depending on an individual case. | gynecomastia is a common occurrence in pubertal age group, and is physiological in up to 65 percent of cases. when occurs in the family it should be investigated in order not to miss on a treatable etiology. two brothers within the same family, presenting with bilateral gynecomastia of different causes and requiring different treatment are presented. |
ultrasensitivity, or threshold behaviour, where small changes in a stimulus near some threshold value produce a large change in a response, but large changes in the stimulus far from the threshold produce small changes in the response (i.e., a sigmoidal stimulus response curve), is an important property of many biological systems koshland, 1982 ; ferrell, 1996. ultrasensitivity can function to dampen irrelevant fluctuations in the signal, a decisive response when needed. prokaryotic transcription factors (tfs) often have ultrasensitive activating or repressing effects by virtue of cooperative binding of the tf to multiple dna sites. although eukaryotic transcription is a highly synergistic process, involving the cooperative action of many different dna - associated proteins (carey, 1998 ; naar, 2001 ; figure 1a), this synergy does not in itself provide a mechanism for ultrasensitive responses to changes in concentration or activity of a single tf. such ultrasensitivity can be produced, as in bacteria, by direct cooperative binding of the tf due to favourable contacts between the tf protomers bound at different sites (burz, 1998 ; figure 1a, tf1). tf protomers bound at different sites may be able to simultaneously make favourable contacts with some common target such as proteins of the transcriptional apparatus (carey, 1998 ; figure 1a, tf2). alternatively, in collaborative competition, binding of the tf to one site competes with a nucleosome that can block binding of the tf to other sites (miller and widom, 2003 ; figure 1a, tf3). however, it is not clear how common these cooperative binding mechanisms are in eukaryotes. here, we propose a mechanism for generating high ultrasensitivity that does not require cooperative tf binding, but rather involves nucleosome modifications. many eukaryotic tfs act, at least in part, by recruiting histone - modifying enzymes to the promoter region figure 1b. these enzymes include histone acetyltransferases and deacetylases (hats and hdacs ; struhl, 1998 ; naar, 2001 ; eberharter and becker, 2002), methyltransferases (hmts ; demers, 2007) and demethylases (hdms ; swigut and wysocka, 2007). this recruitment can result in changes to the modification state of nearby nucleosomes (vignali, 2000). in turn, the histone modifications carried by the nucleosomes located in the vicinity of the promoter affect transcription, although in ways that are not yet well understood. histone modifications change the dna - binding properties of the nucleosomes, affecting competition with other dna - binding proteins (anderson, 2001), and also can affect the binding of other proteins, including those of the transcription apparatus, to the nucleosomes themselves (naar, 2001 ; taverna, 2007 ; vermeulen, 2007). again, recruitment of a particular histone - modifying enzyme should not in itself provide an ultrasensitive transcriptional response, because changes in the localized activity of the enzyme should be linear with respect to changes in the dna site occupancy of the tf that recruits it. however, it has been proposed that nucleosome modifications can sustain positive feedback loops, where nucleosomes carrying a particular modification recruit enzymes capable of maintaining the same modification state among neighbouring nucleosomes (grunstein, 1998 ; turner, 1998 ; schreiber and bernstein, 2002). we show that such feedback loops can convert linear changes in dna occupation by a tf into a highly ultrasensitive transcriptional response. we previously introduced a simplified numerical model of positive feedback in nucleosome modification for investigation of epigenetic cell memory (dodd, 2007). the model considers a patch of n nucleosomes carrying mutually exclusive modifications, for example, methylation or acetylation of a specific lysine residue (such as lysine 9 of histone h3), giving three types of nucleosome with regard to this modification : methylated (m), unmodified (u) or acetylated (a). nucleosome interconversions can occur by a positive feedback process, where acetylated nucleosomes recruit specific hdms and hats, while methylated nucleosomes recruit hdacs and hmts that can act on any other nucleosome in the patch (figure 2). as well as these local positive feedback reactions, non - feedback or noisy ' interconversions can occur independently of the local nucleosomes, for example, through the action of non - recruited enzymes or enzymes bound to nucleosomes outside the patch. the relative strengths of the feedback and noise processes is parameterized by (figure 2), with the feedback - to - noise ratio, f defined as f=(1). we found that with increasing n and f, the patch of nucleosomes becomes increasingly bistable, existing in either a highly acetylated or a highly methylated state with rare transitions between the states. bistability also required the positive feedback reactions leading to one modification to be of similar efficiency to those leading to the opposing modification (dodd, 2007). here, we make two changes to this model to investigate gene activation or repression by a tf that recruits a histone - modifying enzyme. first, we allow the relative strengths of the positive feedback reactions in one direction (e.g. towards a) to be of a different strength to the reactions in the other direction (e.g. towards m). the balance of these reactions is expressed by the parameter (figure 2). if deviates significantly from 0.5, indicating an imbalance, then the patch of nucleosomes is only stable in one modification state (dodd, 2007). we imagine that for any particular mutually exclusive modification (e.g. the m and a in figure 2), the concentrations of modifying enzymes, their affinities for the recruiting nucleosomes and their enzymatic activities will often differ so that one modification will be favoured, possibly in a location - dependent manner, so that a particular patch of nucleosomes will tend to exist by default in a particular modification state. second, we add a tf that binds to the dna within the nucleosome patch and recruits a histone - modifying enzyme, bringing the enzyme into proximity with the nucleosomes in the patch and facilitating their modification (figure 1b). we do not consider any other action of the tf (e.g. direct interaction with the transcription complex). the strength of the tf - stimulated reaction is given by, which sets an additional rate for the u to a transition ; a larger makes it proportionally more likely to change a u to an a anywhere in the system (figure 2). we imagine that increases in result from increases in the activity or concentration of the tf that, in turn, increase occupation of its dna - binding site or its ability to recruit the modifying enzyme. in figure 3, we show the results of iterating the reaction steps of figure 2 when, by default, the patch contains a low proportion of a - type nucleosomes due to an imbalance in the feedback reactions due to =2/3 (i.e., m - favouring reactions are twice as likely as a - favouring reactions). as the strength of the tf - stimulated hat reaction is increased (increased from 0 to 1), the average steady - state fraction of acetylated nucleosomes, a, increases to the point where a nucleosomes dominate the patch. depending on the parameters, the model is able to give a range of ultrasensitive responses of a to increases in (figure 3, upper panels), as quantified by the hill coefficient h, with h>1 indicating ultrasensitivity (koshland, 1982 ; ferrell, 1996). if promoter activity is taken to be proportional to a and is taken to be proportional to tf activity, such that the only source of non - linearity in the system is the nucleosome modification reactions, then it is clear that this mechanism alone can generate an ultrasensitive response of promoter activity to tf activity. when there is a high fraction of one nucleosome type, increases in the minority modification due to are strongly resisted by the dominating activity of the majority type. however, as the threshold (ma) is approached, the resistance decreases, because the opposing feedback reactions are more balanced, allowing changes in a to occur easily. the strength of the positive feedback increases with f and n and thus these parameters control the ultrasensitivity (figure 3, top panels). in principle, this could allow the ultrasensitivity of the response of a promoter to a tf to be tuned by adjusting the strength of the positive - feedback modifications relative to noise (f) or by alterations to the size of the nucleosome patch (n). although figure 3 shows activation by recruitment of a modifying enzyme that adds a modification (figure 2), recruitment of an enzyme that removes the opposing modification produces a similar response. of course, the system is not limited to activation by a tf. if the modification favoured by the tf has an inhibitory effect on the promoter, then an ultrasensitive repressive response can be produced. rossi (2000) found hill coefficients (h) of 1.63.2 for doxycycline regulation of promoters activated by tet repressor vp16 fusions, while ajo - franklin (2007) found h values of 2.73.6 for promoter control by vp16-derived activation domains fused to zifh or lexa dna - binding domains. because multiple adjacent activator dna - binding sites were used, it is possible (but was not tested) that the ultrasensitivities were caused by cooperative dna binding. however, the responses may also be explained by our model, as the vp16 activation domain has been shown to interact with hats, and when fused to the gal4 dna - binding domain can target hat activity to nucleosomes around the gal4-binding site (vignali, 2000). in these experiments, the two models could be tested by measuring ultrasensitivity with the same number of activator binding sites but placed at separate locations, which should disrupt cooperative binding, but not our mechanism. the model can also explain the results of carey (1990), in which an ultrasensitive promoter response was seen with respect to increasing copies (in tandem) of a binding site for a gal4vp16 activator. because all the binding sites were saturated with tf, carey and co - workers ruled out cooperative binding and proposed that the ultrasensitivity was due to 510 tf molecules simultaneously contacting the transcription machinery. we find it sterically implausible that the transcription machinery has so many sites simultaneously available to adjacently bound vp16 moities, while the results are easily explained by vp16 at each saturated binding site recruiting additional hat activity, adding to. conditions in the model that give high ultrasensitivity also produce bistability. the lower panels of figure 3 show the probability distributions of the fraction of a nucleosomes at various. in the high ultrasensitivity case (left panel), there are some values for which the promoter can exist with high probability in either a high- or a low - a state. such bistability can not arise from cooperative tf binding, even at high ultrasensitivities, as without positive feedback there can be only one promoter activity for each tf activity. bistability by our mechanism may help explain observations of bimodal gene expression, where in a population of cells, a promoter can be fully on in some cells and fully off in the others, despite the cells being in the same environment (fiering, 2000 ; rossi, 2000). stable bimodal expression can result from the combination of high ultrasensitivity and differences in tf levels between cells, as long as these differences span the off on transition region and are reasonably persistent. in contrast, bimodal expression in our model can occur even when promoters are exposed to identical conditions, also explaining bimodal promoter activity within different nuclei in the one cell (newlands, 1998) or even in the same nucleus (riviere, 1998). we note also that the proposed mechanism provides a straightforward means by which the activities of many tfs can be integrated at the promoter. if each tf recruits a histone - modifying enzyme that affects the balance between a particular pair of modifications (i.e., stimulates one of the four modification reactions ; figure 2), then the activities of these tfs combine to produce a single output. an analysis of the way in which these signals combine is beyond the scope of this report ; however, our preliminary investigations indicate that the integration is not simply additive and depends on which combination of reactions is stimulated. finally, the evolution of a system consisting of indirectly acting tf factors should be less constrained than for systems requiring direct contact with the transcription complex. evolution of the promoter to respond to a new tf would simply require the formation of a binding site in the dna within the nucleosome patch. in contrast, evolution of a new regulation by a tf that acts by recruiting or stabilizing rnap binding is likely to be limited by the stereochemical constraints of linking a dna - binding site and an available contact site on the transcriptional apparatus. thus, positive - feedback loops in nucleosome modification can, in theory, provide not only a mechanism for long - term epigenetic memory (dodd, 2007), but also a powerful system for controlling the way in which a promoter responds to and integrates multiple signals. our modelling highlights the importance of further experimental work to substantiate and characterize such feedback loops. we previously introduced a simplified numerical model of positive feedback in nucleosome modification for investigation of epigenetic cell memory (dodd, 2007). the model considers a patch of n nucleosomes carrying mutually exclusive modifications, for example, methylation or acetylation of a specific lysine residue (such as lysine 9 of histone h3), giving three types of nucleosome with regard to this modification : methylated (m), unmodified (u) or acetylated (a). nucleosome interconversions can occur by a positive feedback process, where acetylated nucleosomes recruit specific hdms and hats, while methylated nucleosomes recruit hdacs and hmts that can act on any other nucleosome in the patch (figure 2). as well as these local positive feedback reactions, non - feedback or noisy ' interconversions can occur independently of the local nucleosomes, for example, through the action of non - recruited enzymes or enzymes bound to nucleosomes outside the patch. the relative strengths of the feedback and noise processes is parameterized by (figure 2), with the feedback - to - noise ratio, f defined as f=(1). we found that with increasing n and f, the patch of nucleosomes becomes increasingly bistable, existing in either a highly acetylated or a highly methylated state with rare transitions between the states. bistability also required the positive feedback reactions leading to one modification to be of similar efficiency to those leading to the opposing modification (dodd, 2007). here, we make two changes to this model to investigate gene activation or repression by a tf that recruits a histone - modifying enzyme. first, we allow the relative strengths of the positive feedback reactions in one direction (e.g. towards a) to be of a different strength to the reactions in the other direction (e.g. towards m). the balance of these reactions is expressed by the parameter (figure 2). if deviates significantly from 0.5, indicating an imbalance, then the patch of nucleosomes is only stable in one modification state (dodd, 2007). we imagine that for any particular mutually exclusive modification (e.g. the m and a in figure 2), the concentrations of modifying enzymes, their affinities for the recruiting nucleosomes and their enzymatic activities will often differ so that one modification will be favoured, possibly in a location - dependent manner, so that a particular patch of nucleosomes will tend to exist by default in a particular modification state. second, we add a tf that binds to the dna within the nucleosome patch and recruits a histone - modifying enzyme, bringing the enzyme into proximity with the nucleosomes in the patch and facilitating their modification (figure 1b). we do not consider any other action of the tf (e.g. direct interaction with the transcription complex). the strength of the tf - stimulated reaction is given by, which sets an additional rate for the u to a transition ; a larger makes it proportionally more likely to change a u to an a anywhere in the system (figure 2). we imagine that increases in result from increases in the activity or concentration of the tf that, in turn, increase occupation of its dna - binding site or its ability to recruit the modifying enzyme. in figure 3, we show the results of iterating the reaction steps of figure 2 when, by default, the patch contains a low proportion of a - type nucleosomes due to an imbalance in the feedback reactions due to =2/3 (i.e., m - favouring reactions are twice as likely as a - favouring reactions). as the strength of the tf - stimulated hat reaction is increased (increased from 0 to 1), the average steady - state fraction of acetylated nucleosomes, a, increases to the point where a nucleosomes dominate the patch. depending on the parameters, the model is able to give a range of ultrasensitive responses of a to increases in (figure 3, upper panels), as quantified by the hill coefficient h, with h>1 indicating ultrasensitivity (koshland, 1982 ; ferrell, 1996). if promoter activity is taken to be proportional to a and is taken to be proportional to tf activity, such that the only source of non - linearity in the system is the nucleosome modification reactions, then it is clear that this mechanism alone can generate an ultrasensitive response of promoter activity to tf activity. when there is a high fraction of one nucleosome type, increases in the minority modification due to are strongly resisted by the dominating activity of the majority type. however, as the threshold (ma) is approached, the resistance decreases, because the opposing feedback reactions are more balanced, allowing changes in a to occur easily. the strength of the positive feedback increases with f and n and thus these parameters control the ultrasensitivity (figure 3, top panels). in principle, this could allow the ultrasensitivity of the response of a promoter to a tf to be tuned by adjusting the strength of the positive - feedback modifications relative to noise (f) or by alterations to the size of the nucleosome patch (n). although figure 3 shows activation by recruitment of a modifying enzyme that adds a modification (figure 2), recruitment of an enzyme that removes the opposing modification produces a similar response. if the modification favoured by the tf has an inhibitory effect on the promoter, then an ultrasensitive repressive response can be produced. rossi (2000) found hill coefficients (h) of 1.63.2 for doxycycline regulation of promoters activated by tet repressor vp16 fusions, while ajo - franklin (2007) found h values of 2.73.6 for promoter control by vp16-derived activation domains fused to zifh or lexa dna - binding domains. because multiple adjacent activator dna - binding sites were used, it is possible (but was not tested) that the ultrasensitivities were caused by cooperative dna binding. however, the responses may also be explained by our model, as the vp16 activation domain has been shown to interact with hats, and when fused to the gal4 dna - binding domain can target hat activity to nucleosomes around the gal4-binding site (vignali, 2000). in these experiments, the two models could be tested by measuring ultrasensitivity with the same number of activator binding sites but placed at separate locations, which should disrupt cooperative binding, but not our mechanism. the model can also explain the results of carey (1990), in which an ultrasensitive promoter response was seen with respect to increasing copies (in tandem) of a binding site for a gal4vp16 activator. because all the binding sites were saturated with tf, carey and co - workers ruled out cooperative binding and proposed that the ultrasensitivity was due to 510 tf molecules simultaneously contacting the transcription machinery. we find it sterically implausible that the transcription machinery has so many sites simultaneously available to adjacently bound vp16 moities, while the results are easily explained by vp16 at each saturated binding site recruiting additional hat activity, adding to. conditions in the model that give high ultrasensitivity also produce bistability. the lower panels of figure 3 show the probability distributions of the fraction of a nucleosomes at various. in the high ultrasensitivity case (left panel), there are some values for which the promoter can exist with high probability in either a high- or a low - a state. such bistability can not arise from cooperative tf binding, even at high ultrasensitivities, as without positive feedback there can be only one promoter activity for each tf activity. bistability by our mechanism may help explain observations of bimodal gene expression, where in a population of cells, a promoter can be fully on in some cells and fully off in the others, despite the cells being in the same environment (fiering, 2000 ; rossi, 2000). stable bimodal expression can result from the combination of high ultrasensitivity and differences in tf levels between cells, as long as these differences span the off on transition region and are reasonably persistent. in contrast, bimodal expression in our model can occur even when promoters are exposed to identical conditions, also explaining bimodal promoter activity within different nuclei in the one cell (newlands, 1998) or even in the same nucleus (riviere, 1998). we note also that the proposed mechanism provides a straightforward means by which the activities of many tfs can be integrated at the promoter. if each tf recruits a histone - modifying enzyme that affects the balance between a particular pair of modifications (i.e., stimulates one of the four modification reactions ; figure 2), then the activities of these tfs combine to produce a single output. an analysis of the way in which these signals combine is beyond the scope of this report ; however, our preliminary investigations indicate that the integration is not simply additive and depends on which combination of reactions is stimulated. finally, the evolution of a system consisting of indirectly acting tf factors should be less constrained than for systems requiring direct contact with the transcription complex. evolution of the promoter to respond to a new tf would simply require the formation of a binding site in the dna within the nucleosome patch. in contrast, evolution of a new regulation by a tf that acts by recruiting or stabilizing rnap binding is likely to be limited by the stereochemical constraints of linking a dna - binding site and an available contact site on the transcriptional apparatus. thus, positive - feedback loops in nucleosome modification can, in theory, provide not only a mechanism for long - term epigenetic memory (dodd, 2007), but also a powerful system for controlling the way in which a promoter responds to and integrates multiple signals. our modelling highlights the importance of further experimental work to substantiate and characterize such feedback loops. the model outlined in figure 2 is simulated as an ongoing sequence of events (time steps) that take place in a system consisting of n nucleosomes (sites). each site can be in one of the three states : m, u or a. there are no intermediates between these states ; we disregard nucleosome heteromodification (possible as any nucleosome has two copies of any specific histone residue). furthermore, we only allow transitions between a and u, and u and m, that is, no direct transitions between a and m. furthermore, in the standard model, we disregard any positional effects, implying that the state of the system is completely characterized by the fraction of m sites (m) and the fraction of a sites (a). given m and a the fraction of u sites is u = nam. the dynamics of the system is determined by two intrinsic parameters, f=(1)>0 and plus one external parameter that quantifies the strength of the tf. first, we consider the tf - independent move, extending the previous model (dodd, 2007) to take into account asymmetry between the strength of the recruited enzymes facilitating more ms and the one facilitating more as. this asymmetry is large when the parameter is close to 0 or 1. at each time step, then : one selects a random number r from a uniform distribution over the interval. if r<, one attempts a move that simulates the feedback from the system. this is done by selecting another random nucleosome n2 from anywhere in the system and letting this attempt to mediate a change in n1 : if n2 is in the m state, one with probability changes n1 one step towards m. this means that an n1 in the a state makes a transition to the u state, whereas an n1 in the u state makes a transition to the m state. if n1 was already in the m state, no change is made.if n2 is in the a state, one with probability 1 changes n1 one step towards a. this means that an n1 in the m state makes a transition to the u state, whereas an n1 in the u state makes a transition to the a state. if n1 was already in the a state, no change is made.if n2 is in the u state, no change is made.if r, one makes a noise move, where the change in n1 is independent of the rest of the system. when n1 is in the m or a state, it is changed to u with probability 1/2. when n1 is in the u state, it is changed to m with probability 1/2, or else it is changed to the a state. at each time step, then : one selects a random number r from a uniform distribution over the interval. if r<, one attempts a move that simulates the feedback from the system this is done by selecting another random nucleosome n2 from anywhere in the system and letting this attempt to mediate a change in n1 : if n2 is in the m state, one with probability changes n1 one step towards m. this means that an n1 in the a state makes a transition to the u state, whereas an n1 in the u state makes a transition to the m state. if n1 was already in the m state, no change is made.if n2 is in the a state, one with probability 1 changes n1 one step towards a. this means that an n1 in the m state makes a transition to the u state, whereas an n1 in the u state makes a transition to the a state. if n1 was already in the a state, no change is made.if n2 is in the u state, no change is made. if n2 is in the m state, one with probability changes n1 one step towards m. this means that an n1 in the a state makes a transition to the u state, whereas an n1 in the u state makes a transition to the m state. if n1 was already in the m state, no change is made. if n2 is in the a state, one with probability 1 changes n1 one step towards a. this means that an n1 in the m state makes a transition to the u state, whereas an n1 in the u state makes a transition to the a state. if r, one makes a noise move, where the change in n1 is independent of the rest of the system. when n1 is in the m or a state, it is changed to u with probability 1/2. when n1 is in the u state, it is changed to m with probability 1/2, or else it is changed to the a state. the above description of a single time - step involves some steps that take place with probability <1 and 1<1. to simulate an event taking place with probability, we select a random number x from a uniform distribution between 0 and 1, and do the change if and only if x<. to simulate the action of a tf that recruits a hat, we at each time - step supplement the above action and : select a random number x. if x<, we randomly select one of the n nucleosomes in the system. if this nucleosome is in the u state, it is changed to the a state. select a random number x. if x<, we randomly select one of the n nucleosomes in the system. if this nucleosome is in the u state, it is changed to the a state. a small simulates a situation where the tf is not bound to its operator very often, and therefore, only rarely influences the system. a large corresponds to the case where the tf often recruits a hat that makes an attempted acetylation somewhere in the system. the model is sufficiently iterated over many time - steps to allow the system to explore all its possible states. | eukaryotic transcription involves the synergistic interaction of many different proteins. however, the question remains how eukaryotic promoters achieve ultrasensitive or threshold responses to changes in the concentration or activity of a single transcription factor (tf). we show theoretically that by recruiting a histone - modifying enzyme, a tf binding non - cooperatively to a single site can change the balance between opposing positive feedback loops in histone modification to produce a large change in gene expression in response to a small change in concentration of the tf. this mechanism can also generate bistable promoter responses, allowing a gene to be on in some cells and off in others, despite the cells being in identical conditions. in addition, the system provides a simple means by which the activities of many tfs could be integrated at a promoter. |
a 77-year - old woman suffered wallenberg syndrome after a stroke in the territory of the left vertebrobasilar artery. three years later, she came to our hospital complaining of chronic lancinating left eye (os) pain of two years ' duration. she was being treated in the pain unit for left hemifacial pain, and she had no history of herpes zoster ophthalmicus. the patient 's best - corrected visual acuity (bcva) in the right eye (od) was 1 and in the os was 0.3. in the os, she was found to have corneal anaesthesia in all four quadrants by examination with cotton swabs ; a thin meniscus ; a tear break - up time of 1 second ; and a severe confluent superficial punctate keratitis at the interpalpebral fissure, oxford grade iv. schirmer 's test without anaesthesia produced results of 5 mm in the od and 1 mm in the os (fig. the treatments prescribed were artificial tears containing 0.1% hyaluronic acid (ha genteal ; novartis pharmaceuticals corporation, east hanover, nj, usa) every 8 hours, with nightly carbomer lubricating eye drops 0.2% (lipolac ophthalmic gel ; farma - lepori, berlin, germany), and autologous serum eye drops (csa) at 20% four times a day. a neurophysiological study of the trigeminal nerve showed chronic partial injury to a moderate degree. the distribution of neurophysiological findings demonstrated nerve involvement in the spinal trigeminal tract at the bulbar level, without evidence of facial nerve injury or peripheral polyneuropathy. with treatment, the patient improved her visual acuity up to 0.5 in os, although a superficial punctate keratitis of oxford grade ii remained. a 72-year - old woman presented with a history of left ischaemic wallenberg syndrome one year prior, and suffered from od amblyopia. ophthalmologic examination showed a bcva in the od of 0.15 and in the os of 0.3. in the os, a central corneal ulcer was surrounded by superficial punctate keratitis, grade iii on the oxford scale ; associated with corneal anaesthesia in all four quadrants ; and lagophthalmos. schirmer 's test without anaesthesia was 20 mm for the od and 6 mm for the os. the proposed treatments were lubricating eye drops four times a day (systane ; alcon, fort worth, tx, usa), dexpanthenol gel twice a day (recugel ; bausch & lomb, berlin, germany), gentamicin ointment at night (oculos epithelializing ; thea, clermont - ferrand cedex 2, france) and autologous serum eye drops at 20% four times a day. four months later, the patient showed a bcva of 0.7 in the os and superficial punctate keratitis in the interpalpebral fissure, oxford grade ii. a neurophysiological study showed a partial lesion of the sensory component in the left trigeminal nerve, with preservation of the motor component. blink reflexes showed increased late responses to stimulation of the first left branch of the trigeminal nerve (fig. a 58-year - old woman was referred because of a persistent epithelial defect following corneal transplantation in the os. she had presented with two corneal abscesses in the os within the past 7 years, and a penetrating keratoplasty with an amniotic membrane graft had been performed 4 months earlier because of corneal leukoma. after the surgery, the patient maintained treatment with topical 0.3% tobramycin and 0.1% dexamethasone every 6 hours (tobradex, alcon). she had reported a cerebral ischaemic event in the left cerebral territory eight years earlier that led to a residual right hemihypoesthesia. the bcva was 0.7 in the od and count fingers (cf) in the os. in the os, the corneal button had an epithelial defect 3.5 mm in diameter with central stromal thinning, and in the anterior chamber there was a hypopyon level of 1.5 mm (fig. schirmer 's test without anaesthesia was 12 mm in the od and 2 mm in the os. corneal cultures were taken for bacteria, fungi, and herpes family polymerase chain reaction, varicella zoster virus, herpes simplex virus i and ii, cytomegalovirus, epstein - barr virus, virus herpes 6, which were all negative. the prescribed treatment was moxifloxacin (vigamox eye drops, alcon) every 3 hours ; 0.3% tobramycin eye drops ; dexamethasone 0.1% reduced to every 12 hours (tobradex, alcon) ; 1 tablet of 500 mg valacyclovir every 24 hours (valtrex ; glaxo smithkline, research triangle park, nc, usa) ; prednisone 15 mg daily (10 mg prednisolone tablets alonga ; sanofi - aventis, quebec, canada) ; 3% trehalose eye drops four times a day (thealoz, thea) ; and one tablet of doxycycline daily (100 mg vibracina ; invicta farma, madrid, spain). autologous serum eye drop treatment was not possible because of a positive hepatitis c virus serology. the evolution was satisfactory, and at the last visit two months later, os examination showed a bcva of 0.3 despite the leukoma and the irregular epithelium at the corneal button (fig. 4). the neurophysiological study showed a left trigeminal nerve lesion at the bulbar level. no changes were observed in the facial and right trigeminal nerves. oral valacyclovir treatment (valtrex, glaxo smithkline) a 77-year - old woman suffered wallenberg syndrome after a stroke in the territory of the left vertebrobasilar artery. three years later, she came to our hospital complaining of chronic lancinating left eye (os) pain of two years ' duration. she was being treated in the pain unit for left hemifacial pain, and she had no history of herpes zoster ophthalmicus. the patient 's best - corrected visual acuity (bcva) in the right eye (od) was 1 and in the os was 0.3. in the os, she was found to have corneal anaesthesia in all four quadrants by examination with cotton swabs ; a thin meniscus ; a tear break - up time of 1 second ; and a severe confluent superficial punctate keratitis at the interpalpebral fissure, oxford grade iv. schirmer 's test without anaesthesia produced results of 5 mm in the od and 1 mm in the os (fig. the treatments prescribed were artificial tears containing 0.1% hyaluronic acid (ha genteal ; novartis pharmaceuticals corporation, east hanover, nj, usa) every 8 hours, with nightly carbomer lubricating eye drops 0.2% (lipolac ophthalmic gel ; farma - lepori, berlin, germany), and autologous serum eye drops (csa) at 20% four times a day. a neurophysiological study of the trigeminal nerve showed chronic partial injury to a moderate degree. the distribution of neurophysiological findings demonstrated nerve involvement in the spinal trigeminal tract at the bulbar level, without evidence of facial nerve injury or peripheral polyneuropathy. with treatment, the patient improved her visual acuity up to 0.5 in os, although a superficial punctate keratitis of oxford grade ii remained. a 72-year - old woman presented with a history of left ischaemic wallenberg syndrome one year prior, and suffered from od amblyopia. ophthalmologic examination showed a bcva in the od of 0.15 and in the os of 0.3. in the os, a central corneal ulcer was surrounded by superficial punctate keratitis, grade iii on the oxford scale ; associated with corneal anaesthesia in all four quadrants ; and lagophthalmos. schirmer 's test without anaesthesia was 20 mm for the od and 6 mm for the os. the proposed treatments were lubricating eye drops four times a day (systane ; alcon, fort worth, tx, usa), dexpanthenol gel twice a day (recugel ; bausch & lomb, berlin, germany), gentamicin ointment at night (oculos epithelializing ; thea, clermont - ferrand cedex 2, france) and autologous serum eye drops at 20% four times a day. four months later, the patient showed a bcva of 0.7 in the os and superficial punctate keratitis in the interpalpebral fissure, oxford grade ii. a neurophysiological study showed a partial lesion of the sensory component in the left trigeminal nerve, with preservation of the motor component. blink reflexes showed increased late responses to stimulation of the first left branch of the trigeminal nerve (fig. a 58-year - old woman was referred because of a persistent epithelial defect following corneal transplantation in the os. she had presented with two corneal abscesses in the os within the past 7 years, and a penetrating keratoplasty with an amniotic membrane graft had been performed 4 months earlier because of corneal leukoma. after the surgery, the patient maintained treatment with topical 0.3% tobramycin and 0.1% dexamethasone every 6 hours (tobradex, alcon). she had reported a cerebral ischaemic event in the left cerebral territory eight years earlier that led to a residual right hemihypoesthesia. the bcva was 0.7 in the od and count fingers (cf) in the os. in the os, the corneal button had an epithelial defect 3.5 mm in diameter with central stromal thinning, and in the anterior chamber there was a hypopyon level of 1.5 mm (fig. schirmer 's test without anaesthesia was 12 mm in the od and 2 mm in the os. corneal cultures were taken for bacteria, fungi, and herpes family polymerase chain reaction, varicella zoster virus, herpes simplex virus i and ii, cytomegalovirus, epstein - barr virus, virus herpes 6, which were all negative. the prescribed treatment was moxifloxacin (vigamox eye drops, alcon) every 3 hours ; 0.3% tobramycin eye drops ; dexamethasone 0.1% reduced to every 12 hours (tobradex, alcon) ; 1 tablet of 500 mg valacyclovir every 24 hours (valtrex ; glaxo smithkline, research triangle park, nc, usa) ; prednisone 15 mg daily (10 mg prednisolone tablets alonga ; sanofi - aventis, quebec, canada) ; 3% trehalose eye drops four times a day (thealoz, thea) ; and one tablet of doxycycline daily (100 mg vibracina ; invicta farma, madrid, spain). autologous serum eye drop treatment was not possible because of a positive hepatitis c virus serology. the evolution was satisfactory, and at the last visit two months later, os examination showed a bcva of 0.3 despite the leukoma and the irregular epithelium at the corneal button (fig. no changes were observed in the facial and right trigeminal nerves. oral valacyclovir treatment (valtrex, glaxo smithkline) corneal injury secondary to wallenberg syndrome is a rare cause of unilateral keratitis, as the only reported case was presented in the following article : " persistent visual loss from neurotrophic corneal ulceration after dorsolateral medullary infarction (wallenberg syndrome) ". the case described a 48-year - old patient suffering from a corneal abscess ipsilateral to a previous spinal cord infarction. as is typical for this reason, he developed an infiltrated corneal ulcer with stromal involvement and hypopyon that was unobserved by the patient until a late stage of the disorder, leaving a residual visual acuity of cf. the diagnosis of trigeminal damage at the ophthalmic branch level can be easily achieved by scanning for corneal sensitivity by inducing the blink reflex using a swab to the cornea. the neurophysiological findings help us to locate the precise anatomical level of the trigeminal pathway. these tests are not regularly required for unilateral keratitis, but will help to confirm the suspected aetiology if the patient had a previous stroke, demonstrating that prior vascular involvement is related to the location of the trigeminal damage detected by neurophysiology. radiological nuclear magnetic resonance findings in wallenberg syndrome show a characteristic hypointense sequence on t1 and a hyperintense signal on t2 at the brainstem lesion. the neurophysiological study of this pathology.by electroneurography of the trigeminal nerve.reveals the location of sensory trigeminal nerve fibre involvement at the level of the spinal tract nucleus in the posterolateral region of the bulb, secondary to vascular obstruction in this brain stem region. in some cases, involvement of adjacent facial nerve fibres is also observed. the blink reflex is used to evaluate the integrity of the cranial nerves, including the trigeminal and facial nerves, and the intensity and level of damage. the electrical signals read by the electrode placed at this level enabled us to interpret the results. we confirmed by neurophysiological study that the cause of unilateral keratitis in all cases was located at the central level. our three case studies were exposed to a differential diagnosis that included unilateral keratitis (mainly herpetic in origin). we were able to avoid unnecessary treatments and performed careful patient monitoring while improving the patients ' visual acuity and quality of life. normally, patients who suffer neurotrophic keratitis do not report pain. however, as we found in our first case, patients can report eye pain, which may be related to ipsilateral facial pain. trigeminal neuralgia caused by a stroke is not frequent, and it is also unusual to find facial pain in a patient with wallenberg syndrome. facial pain in wallenberg syndrome seems to be correlated with ischaemic lesions produced at the trigeminal tract, with the trigeminal spinal nucleus subsequently developing trigeminal neuralgia. as two of our cases show, loss of corneal sensitivity due to trigeminal nerve involvement results in the appearance of epithelial erosions. initially, the erosions may be unobserved by patients with systemic complications (i.e., strokes), but to prevent the progression and development of corneal ulcers with secondary infection and abscess formation, early detection is important, especially as the resolution process may be time - consuming and costly. as a result, patients with wallenberg syndrome should undergo comprehensive ophthalmologic examinations, including slit - lamp examination, corneal esthesiometer, and schirmer 's test, to rule out trigeminal nerve injury and to grade severity of anterior segment damage. in these patients, the signs of neurotrophic keratitis may present years after an ischemic event (e.g., case 3) and have various manifestations, such as corneal erosions, persistent epithelial defects / ulcerations, and even hypopyon, which can mimic infectious keratitis. therapeutic measures in cases of punctate keratitis include the daily periodic application of artificial tears, night creams, and autologous serum. ocular occlusion and nasal strips arranged perpendicular to the lid margin promote healing of erosions. additional procedures such as punctal plugs, amniotic membrane implantation, and surgical tarsorrhaphy may become necessary if the disease worsens. neurology specialists should contemplate this pathology in order to refer these patients to the ophthalmology department. wallenberg syndrome should be included in ophthalmology procedure manuals regarding the differential diagnosis of unilateral keratitis in order to ensure proper medical management. ophthalmologists also should take careful patient histories and should consider neurological causes of neurotrophic keratitis. finally, radiological and neurophysiological studies are relevant techniques to establish the location and cause of unilateral corneal injuries in patients with previous central neurological damage. | we studied three patients who developed left unilateral punctate keratitis after suffering left - sided wallenberg syndrome. a complex evolution occurred in two of them. in all cases, neurophysiological studies showed damage in the trigeminal sensory component at the bulbar level. corneal involvement secondary to wallenberg syndrome is a rare cause of unilateral superficial punctate keratitis. the loss of corneal sensitivity caused by trigeminal neuropathy leads to epithelial erosions that are frequently unobserved by the patient, resulting in a high risk of corneal - ulcer development with the possibility of superinfection. neurophysiological studies can help to locate the anatomical level of damage at the ophthalmic branch of the trigeminal nerve, confirming the suspected etiology of stroke, and demonstrating that prior vascular involvement coincides with the location of trigeminal nerve damage. in some of these patients, oculofacial pain is a distinctive feature. |
microorganisms play a key role in pulpitis, infection - mediated necrosis and their extension to the periapical tissue. the necrotic pulp presents a polymicrobial flora characterized by a wide variety of combinations of bacteria, averaging 4 - 7 species per canal, predominantly anerobic, with approximately equal proportions of gram - negative and gram - positive bacteria. the ultimate goals of endodontic treatment are complete removal of bacteria, their byproducts, and pulpal remnants from infected root canals. endodontic medicaments have been thought to be an essential step in killing the bacteria in root canals. calcium hydroxide is the most widely used medication because of its well - documented antibacterial activity which can be use in various combinations. among these combinations metapex (meta biomed co. ltd, cheongju, korea), a silicone oil - based calcium hydroxide paste containing 38% iodoform is very commonly used. metronidazole has a wide spectrum of bactericidal action against oral obligate anaerobes, even against isolates from infected necrotic pulps, in fact, more than 99% of the bacteria found in carious lesions and infected root dentine. biopure mtad (dentsply tulsa dental, tulsa, ok) is a mixture of a tetracycline isomer, an acetic acid, and tween 80 detergent (mtad) was designed to be used as a final root canal rinse before obturation. it represents an innovative approach in simultaneous removal of endodontic smear layers and disinfection of root canals. biopure mtad has been shown to be a clinically effective and biocompatible endodontic irrigant with potential antibacterial substantivity. aztreonam, a monobactem, has been successfully used in medical field since long time as an antibacterial due to its high affinity against gram - negative bacteria. this study was undertaken to evaluate the antimicrobial efficacy of metapex, metronidazole, biopure mtad and azetronam on bacteroides fragilis (gram - negative strict anerobe) and propionibacterium acne (gram - positive strict anerobe). the micro - organism employed in this study were two obligate anerobic bacteria i.e., b. fragilis (atcc 25285) and p. acnes (atcc 6921). these strains were allowed to reactivate in media which contains brain heart infusion broth (bhi) (difco co, becton dickinson, sparks, md) supplemented with hemin (5 mg / l) and menadione (0.5 mg / l). biopure mtad (dentsply tulsa dental, tulsa, ok) prepared after mixing biopure mtad powder with the diluents as manufactures instruction. metapex (meta biomed co. ltd, cheongju, korea) solution prepared by dissolving metapex in ethanol (99.9%), by heating until it completely dissolved (0.22 mg / dl conc). other antibiotic discs used were of aztreonam and metronidazole from bd diagnostic. after revival of the organisms in about 48 hours, inoculum for each bacterial strain was prepared by picking up four to five colonies with the help of a circular, previously sterilized loop and dissolving them into respective test tube containing 5 ml of 0.85% saline solution - to produce a turbidity of 0.5 on mcfarland scale (1.5 108 cfu / ml). these organisms were streak on wilkins - chalgren agar plate (difco, becton - dickinson and co.) in a form that lawn growth can be observed. antibiotic discs and control discs were then aseptically transferred to the agar plate previously inoculated with bacteria. plates were than incubated for 48 hours at 37c in an anerobic jar with mixture of gas (n2, h2, and co2 used). the values were statistically evaluated with one - way anova and the intergroup comparison was performed with the bonferroni multiple comparison test. biopure mtad (dentsply tulsa dental, tulsa, ok) prepared after mixing biopure mtad powder with the diluents as manufactures instruction. metapex (meta biomed co. ltd, cheongju, korea) solution prepared by dissolving metapex in ethanol (99.9%), by heating until it completely dissolved (0.22 mg / dl conc). after revival of the organisms in about 48 hours, inoculum for each bacterial strain was prepared by picking up four to five colonies with the help of a circular, previously sterilized loop and dissolving them into respective test tube containing 5 ml of 0.85% saline solution - to produce a turbidity of 0.5 on mcfarland scale (1.5 108 cfu / ml). these organisms were streak on wilkins - chalgren agar plate (difco, becton - dickinson and co.) in a form that lawn growth can be observed. antibiotic discs and control discs were then aseptically transferred to the agar plate previously inoculated with bacteria. plates were than incubated for 48 hours at 37c in an anerobic jar with mixture of gas (n2, h2, and co2 used). were statistically evaluated with one - way anova and the intergroup comparison was performed with the bonferroni multiple comparison test. tables 1 and 2 show the diameters (means and standard deviations) of the zones of microbial growth inhibition (in mm) for the tested materials against b. fragilis [figure 1 ] and p. acne, respectively. comparision of the antimicrobial effect of endodontic medicaments against bacteroides fragilis comparision of the antimicrobial effect of endodontic medicaments against propiobacterium acne zone of inhibition against b. fragilis by aztreonam, metronidazole and metapex metronidazole show the largest zone of inhibition size against both b. fragilis and p. acne. according to bonferroni test significant differences in zone of inhibition size against b. fragilis were found between biopure mtad and metronidazole (t = 4.83, p 0.05) and biopure mtad and aztreonam (t = 2.23, p > 0.05). according to bonferroni test significant differences in zone of inhibition size against p. acne were found between biopure mtad and aztreonam (t = 58.44, p < 0.001), biopure mtad and metronidazole (t = 7.31, p < 0.001). the selection of the test endopathogens for this study was arbitrary and not a random sampling from necrotic teeth. nevertheless, an attempt was made to select representative bacteria that have been commonly isolated from necrotic canals. agar disc - diffusion test method is a well - established technique for antibacterial study. advantage of this method is that chemical properties of the medicaments are not changed and the antimicrobial resistance can be detected by challenging bacterial isolates with antimicrobial discs. moreover, this is an easy and less technique - sensitive method. in the present study, antimicrobial efficacy of medicaments were tested against b. fragilis because it is a gram - negative anerobic bacilli, commonly isolated bacteria in endodontic infections. in previous studies, p. acnes has been identified among the microfiora of endodontic infections which is the cause of its selection in the present study. metapex in this study, showed antimicrobial effect against both b. fragilis and p. acnes which is an agreement with previous studies. the antimicrobial effects of metapex may be due to the combination with iodoform and the viscous and oily vehicle, which may prolong the action of the medicament. accordingly, gomes., showed that oily vehicles increase the antimicrobial effects of calcium hydroxide which might be the reason of effect on p. acne. calcium hydroxide usually increases ph and allowed an unfavorable microenvironment to the growth of b. fragilis strains. metronidazole has shown effect against both b. fragilis and p. acne, which is in accordance with previous studies. this action requires intracellular reduction of the nitro group of these prodrug to produce reactive radical species. biopure mtad in this study has shown significant zone of inhibition against both b. fragilis and p. acne which might be due to presence of doxycycline (broad - spectrum antibiotic), as shabahang. previous literatures have proved the effect of doxycyline on b. fragilis and p. acne, by inhibiting the protein synthesis. aztreonam is a novel monocyclic 1-lactam antibiotic which is highly active against aerobic gram - negative bacteria in vitro and in vivo. it is relatively inactive against gram - positive organisms, such as staphylococcus aureus but it is little effective against b. fragilis which is in accordance with the present study. aztreonam has shown significant effect on b. fragilis but it has low efficacy than metronidazole but higher efficacy than other endodontic medicaments. metronidazole showed maximum antimicrobial efficacy against b. fragilis followed by azetronam, metapex, biopure mtad in descending order. antimicrobial efficacy against p. acnes was again shown maximum by metronidazole followed by biopure mtad and metapex. | aim : the purpose of this study was to evaluate the comparative antibacterial efficacy of biopure mtad, metapex, metronidazole, and aztreonam against two obligate anerobic bacteria.materials and methods : antimicrobial efficacy of selected medicaments against two obligate anaerobic bacteria bacteroides fragilis and propionibacterium acnes was done by agar disc - diffusion method. pre - sterilized whatman paper discs, 6 mm in diameter and soaked with the test solution, were prepared and placed onto the previously seeded agar petri plates. each plate was incubated in anaerobic jar for anerobic environment at 37c for 48 hours. a zone of inhibition was recorded for each plate and the results were analysed statistically. saline and ethanol used as control group in this study.results:biopure mtad, metapex and metronidazole were effective against all the selected microorganisms. aztreonam was effective against bacteroides fragilis. saline and ethanol used as control were ineffective.conclusions:metronidazole showed the superior antibacterial property amongst the tested medicaments. |
eighteen eyes from 18 healthy new zealand white albino male rabbits obtained from the laboratory animal resource center, kafkas university (kars, turkey) ; aged 10 to 12 months and weighting between 3 and 3.5 kg were used in the study. the study was carried out in accordance with the animal ethical guidelines for investigations in laboratory animals and was approved by the medical experimental research ethics committee of kafkas university (ka - hadyek/2012 - 002). the rabbits were kept under standard conditions (201c, 12-h light/12-h dark cycles) and received humane care as outlined in the guide for the care and use of laboratory animals.14 the animals were randomly divided into 3 groups : a control group (cg), an -lipoic acid group (alag), and a mitomycin - c group (mmcg). after tenon s capsule dissection ; the mmcg received an antimetabolism drug administered with small (24 mm) lint impregnated with 0.25 mg / ml mitomycin (mitomycin - c, kyowa hakko kogyo, japan), alag and cg received ala and saline solution on the sclera and the tenon s capsule for 3 minutes, respectively. the sponges were then removed and the surgical field was irrigated with copious amounts of balanced salt solution. the alag received 1% ala (thioctacid 600 t ; meda, hamburg, germany) and cg received saline eye drops 5 times / d for 28 days. twenty - eight days after trabeculectomy, the animals were killed, the trabecular region was removed, and the histopathologic and immunohistocemical analyses were performed by scoring the tissue changes and then comparing them among the 3 groups. samples were analyzed on the 28th day, because miller and colleagues showed that in rabbits, 94% of blebs were closed on the 17th day, whereas in a study by zhong and colleagues, their control group blebs were closed on day 12.82.2, and mmc group blebs were closed on day 19.02.0. in similar studies, tina and colleagues reported that blebs were closed on the 16th day in the control group and on the 51.3rd day in the mmc group. corderio and colleagues showed that in their control group, all blebs were closed by the 14th day. tissues were taken from the rabbits on 28th day to account for the bleb closure time mentioned in the literature.1518 food was withheld from the animals for 12 hours before the operation. general anesthesia was performed intramuscularly with a combination of xylazine hcl (rampun, 2%, bayer ; 5 mg / kg body weight) and ketamine hcl (ketalar, 50 mg / ml, pfizer ; 50 mg / kg body weight). before the surgical procedure, proparacaine hcl 0.5% (alcaine, alcon) was also applied as a topical anesthetic eye drop to produce a more analgesic effect. at the 28th postoperative day the rabbits were euthanized using an intracardiac injection of 1 ml pentobarbital sodium (nembutal, abbott, turkey). trabeculectomies were performed based on a standard study protocol : a 6 mm limbus - based conjunctival incision was produced 5 mm from the limbus. the underlying tenon s capsule was opened and dissection was continued to the limbal area. each rabbit underwent a limbus - based trabeculectomy. a half thickness trapezoidal scleral flap (32 mm) was created, starting 2 mm behind the limbus and continuing until the blade was just visible in the anterior corneal stroma. a piece of tissue containing the inner sclera, trabeculum, and peripheral cornea measuring approximately 31 mm was excised. the anterior chamber was filled and formed with ophthalmic viscosurgical device (1.8% na hyaluronate, protectalon ; vsy, turkey). the scleral flap was closed with 10 - 0 nylon sutures (ethicon ; johnson & johnson ; new jersey, nj). at the end of surgery, the conjunctiva all glaucoma filtration surgeries were performed by a single surgeon with experience in using the rabbit model (me). topical antibiotic drops [tobramycin (tobrased ; bilim ila, istanbul, turkey) ] and antibiotic ointment (tobrased ; bilim ila) was applied to all eyes for 14 days postoperatively. we did not prefer to use steroid and/or nonsteroid anti - inflammatory agents in order to assess the primary effectiveness of ala. intraocular pressure was not collected as an endpoint as our specific metric of interest involved bleb function and histologic differences between groups. macroscopic assessment was performed by penlight to evaluate the presence of infection. to evaluate the filtrating bleb patency, we injected 0.1 ml 0.1% trepan blue dye into the anterior chamber and observed its passage into the subconjunctival space. injections were applied without allowing excessive deepening of the anterior chamber and sudden increase in intraocular pressure. in studies performed with in vitro human tenon s capsular fibroblasts, it has been shown that trepan blue dye does not affect the antimetabolic effect of mmc. it has also been reported that during cataract surgery, trepan blue dye can be useful to evaluate filtering bleb patency and baerveldt tube function by observing trepan blue passage into the subconjunctival space after injection of the dye into the anterior chamber.1922 a large amount of tissue including the trabeculectomy site was removed using a lancet. the architecture of the superior fornix and conjunctival tissues around the drainage site was preserved. the tissues were fixed in 10% buffered formal saline for 24 hours, stored in 70% alcohol, and fixed in paraffin wax. sequential 5-m sections of the operative wound site were prepared, and histologic staining was performed to demonstrate cellularity and extracellular matrix (ecm) deposition including : hematoxylin and eosin (for total cellularity), masson trichrome frozen sections of 4- to 5-m thickness (for collagen organization) -smooth muscle actin (-sma) immunohistochemistry (monoclonal mouse anti - human smooth muscle actin antibody, clone 1a4 ; dako, high wycombe, uk) (for myofibroblast phenotype identification). the stained samples were observed under a leica dm6000b photomicroscope and the parameters were graded randomly by 2 masked observers. for evaluating cellularity, the polymorphonuclear leukocyte, plasmocyte, lymphocyte, and lymphoid aggregate and vascular structures were calculated in 1 magnification area (40 : magnifications). for evaluating toxicity, analysis of the conjunctiva and the ciliary body were made and the findings were evaluated by scoring according to the grading systems published by polak and aptel,24 with slight modifications. the scale used for conjunctival changes was : 0=no histologic change : no inflammation ; 1=minimal histologic change / conjunctiva epithelium preserved, thickening of conjunctiva ; 2=mild histologic change / conjunctiva epithelium preserved, thickening of conjunctiva, and mild inflammatory cell infiltration ; 3=moderate histologic change / score 2 with loss of collagen fibril organization ; and 4=severe histologic change : loss of conjunctival epithelium, total disorganization, and necrosis of the underlying scleral stroma. the scale used for ciliary body changes was : 0=no histologic change ; 1=minimal histologic change / ciliary epithelium height normal, demonstrating minimal fibroblast proliferation, congestion, and edema, no fibrin ; 2=mild histologic change / ciliary epithelium height decreased, demonstrating moderate fibroblast proliferation with fibrin, moderate congestion and edema ; 3=moderate histologic change / score 2 with inflammatory cell infiltration ; 4=severe histologic change / desquamation of ciliary epithelium, total disorganization, and necrosis of ciliary body. to evaluate the collagen organization we used a modified scoring system (which was based on that described by janin - manificat). the scale used for collagen organization was : 0=no collagen disorganization / parallel mature collagen fibers ; 1=weak collagen disorganization / long, discrete collagen fibers ; 2=moderate collagen disorganization / shortened, focal perpendicular sequence of collagen fibers ; and 3=strong collagen disorganization / collagen fibers shortened and pointing in all directions. for evaluating immunohistochemistry, the percentage of stained cells and the grade of staining were employed as criteria and a semiquantitative method was used : 0=no staining ; 1=weak staining ; 2=moderate staining ; and 3=strong staining. for sections, an immunohistochemistry score was calculated using (h - score = ipc ; i, the grade of staining ; and pc, the percentage of stained cells).26 all data were expressed as mean gradesd (meansd). calculations were performed using the statistical package for the social sciences (spss) version 18.0 system for personal computers (spss inc., chicago, il). general anesthesia was performed intramuscularly with a combination of xylazine hcl (rampun, 2%, bayer ; 5 mg / kg body weight) and ketamine hcl (ketalar, 50 mg / ml, pfizer ; 50 mg / kg body weight). before the surgical procedure, proparacaine hcl 0.5% (alcaine, alcon) was also applied as a topical anesthetic eye drop to produce a more analgesic effect. at the 28th postoperative day the rabbits were euthanized using an intracardiac injection of 1 ml pentobarbital sodium (nembutal, abbott, turkey). trabeculectomies were performed based on a standard study protocol : a 6 mm limbus - based conjunctival incision was produced 5 mm from the limbus. the underlying tenon s capsule was opened and dissection was continued to the limbal area. each rabbit underwent a limbus - based trabeculectomy. a half thickness trapezoidal scleral flap (32 mm) was created, starting 2 mm behind the limbus and continuing until the blade was just visible in the anterior corneal stroma. a piece of tissue containing the inner sclera, trabeculum, and peripheral cornea measuring approximately 31 mm was excised. the anterior chamber was filled and formed with ophthalmic viscosurgical device (1.8% na hyaluronate, protectalon ; vsy, turkey). the scleral flap was closed with 10 - 0 nylon sutures (ethicon ; johnson & johnson ; new jersey, nj). at the end of surgery, the conjunctiva was closed with 8/0 vicryl sutures (ethicon, johnson & johnson). all glaucoma filtration surgeries were performed by a single surgeon with experience in using the rabbit model (me). topical antibiotic drops [tobramycin (tobrased ; bilim ila, istanbul, turkey) ] and antibiotic ointment (tobrased ; bilim ila) was applied to all eyes for 14 days postoperatively. we did not prefer to use steroid and/or nonsteroid anti - inflammatory agents in order to assess the primary effectiveness of ala. intraocular pressure was not collected as an endpoint as our specific metric of interest involved bleb function and histologic differences between groups. macroscopic assessment was performed by penlight to evaluate the presence of infection. to evaluate the filtrating bleb patency, we injected 0.1 ml 0.1% trepan blue dye into the anterior chamber and observed its passage into the subconjunctival space. injections were applied without allowing excessive deepening of the anterior chamber and sudden increase in intraocular pressure. in studies performed with in vitro human tenon s capsular fibroblasts, it has been shown that trepan blue dye does not affect the antimetabolic effect of mmc. it has also been reported that during cataract surgery, trepan blue dye can be useful to evaluate filtering bleb patency and baerveldt tube function by observing trepan blue passage into the subconjunctival space after injection of the dye into the anterior chamber.1922 the architecture of the superior fornix and conjunctival tissues around the drainage site was preserved. the tissues were fixed in 10% buffered formal saline for 24 hours, stored in 70% alcohol, and fixed in paraffin wax. sequential 5-m sections of the operative wound site were prepared, and histologic staining was performed to demonstrate cellularity and extracellular matrix (ecm) deposition including : hematoxylin and eosin (for total cellularity), masson trichrome frozen sections of 4- to 5-m thickness (for collagen organization) -smooth muscle actin (-sma) immunohistochemistry (monoclonal mouse anti - human smooth muscle actin antibody, clone 1a4 ; dako, high wycombe, uk) (for myofibroblast phenotype identification). the stained samples were observed under a leica dm6000b photomicroscope and the parameters were graded randomly by 2 masked observers. for evaluating cellularity, the polymorphonuclear leukocyte, plasmocyte, lymphocyte, and lymphoid aggregate and vascular structures were calculated in 1 magnification area (40 : magnifications). for evaluating toxicity, analysis of the conjunctiva and the ciliary body were made and the findings were evaluated by scoring according to the grading systems published by polak and aptel,24 with slight modifications. the scale used for conjunctival changes was : 0=no histologic change : no inflammation ; 1=minimal histologic change / conjunctiva epithelium preserved, thickening of conjunctiva ; 2=mild histologic change / conjunctiva epithelium preserved, thickening of conjunctiva, and mild inflammatory cell infiltration ; 3=moderate histologic change / score 2 with loss of collagen fibril organization ; and 4=severe histologic change : loss of conjunctival epithelium, total disorganization, and necrosis of the underlying scleral stroma. the scale used for ciliary body changes was : 0=no histologic change ; 1=minimal histologic change / ciliary epithelium height normal, demonstrating minimal fibroblast proliferation, congestion, and edema, no fibrin ; 2=mild histologic change / ciliary epithelium height decreased, demonstrating moderate fibroblast proliferation with fibrin, moderate congestion and edema ; 3=moderate histologic change / score 2 with inflammatory cell infiltration ; 4=severe histologic change / desquamation of ciliary epithelium, total disorganization, and necrosis of ciliary body. to evaluate the collagen organization we used a modified scoring system (which was based on that described by janin - manificat). the scale used for collagen organization was : 0=no collagen disorganization / parallel mature collagen fibers ; 1=weak collagen disorganization / long, discrete collagen fibers ; 2=moderate collagen disorganization / shortened, focal perpendicular sequence of collagen fibers ; and 3=strong collagen disorganization / collagen fibers shortened and pointing in all directions. for evaluating immunohistochemistry, the percentage of stained cells and the grade of staining were employed as criteria and a semiquantitative method was used : 0=no staining ; 1=weak staining ; 2=moderate staining ; and 3=strong staining. for sections, an immunohistochemistry score was calculated using (h - score = ipc ; i, the grade of staining ; and pc, the percentage of stained cells).26 calculations were performed using the statistical package for the social sciences (spss) version 18.0 system for personal computers (spss inc., chicago, il). of the 18 rabbits observed for the duration of the 28-day experimental period, all completed the experimental protocol. no intraocular infection or cataract was observed. the tolerability of ala drops was found very well and no side effect (conjunctival redness, chemosis, or discharge) was detected. when the filtrating bleb patency was evaluated using 0.1% trepan blue dye, it was observed that all 6 blebs (100%) of control group had failed, whereas only 2 (33%) from the alag and none from the mmcg had failed on the 28th postsurgical day (fig. 1). there was a statistically significant difference between cg and mmcg (p=0.002), whereas the difference between cg and alag did not reach statistical significance (p>0.05). a and b, failed blebs from the control group, (c and d) -lipoic acid (ala) group and (e and f) mitomycin - c (mmc) group filtrating bleb patency and trepan blue dye passage into the subconjunctival space can be seen. histologic analysis of the specimens was performed at the center of the sclerotomy site, as indicated by the location of the iridectomy. inflammatory cell infiltration was obviously lower in the ala and control groups compared with the mmcg (fig., there was a statistically significant difference between the mmc and ala groups and between the mmc and control groups (p0.05). there were no statistically significant differences among all groups when plasmocyte and lymphoid aggregate scores were evaluated. with respect to polymorphonuclear leukocyte scores, there was a statistically significant difference between the ala and mmc groups and the ala and control group scores (p0.05). with respect to vascular structure scores, there was statistically significant difference between the control and ala groups, and the control and mmc groups (p0.05) (table 1). tissues shown in (a) are from the control group, (b) is the ala group, and (c) is the mmc group. control group tissues show moderate inflammatory cells and closed sclerotomy. in the ala group few inflammatory cells and fistula tract and in the mmc group severe inflammatory cells and fistula tract can be seen. ala indicates -lipoic acid ; c, cornea ; cb, ciliary body ; cj : conjunctiva ; mmc, mitomycin - c ; ss : sclerostomy site. histopathologic findings of study groups in the control group, mild histologic changes due to surgical trauma were observed in the conjunctiva and in the ciliary body. the conjunctival epithelium was preserved with mild inflammatory reaction, cell infiltration, and minimal thickening. there was minimal fibroblast proliferation, congestion, and edema in the ciliary body. in the ala group the height of the conjunctival epithelium was normal, with minimal fibroblast proliferation, congestion, and edema. in the ciliary body, the height of the epithelium was normal, with minimal fibroblast proliferation, congestion, and edema. in the mmc group, the histologic changes observed in the conjunctiva were a decrease in the collagen density of the conjunctival epithelium, the loss of organization in the collagen fibrils, the slowing of mature collagen formation, epithelial cell loss, and increased inflammatory cell infiltration. the histologic changes observed in the ciliary body were a decrease in the height of pigmented and nonpigmented epithelium, the change of the cuboidal epithelium into a columnar epithelium, the accumulation of fibrin, and the disorganization of collagen fibers, with congestion and edema. when conjunctival and ciliary body toxicity scores were evaluated, there was statistically significant difference among all the groups (ala 0.05). a and b, failed blebs from the control group, (c and d) -lipoic acid (ala) group and (e and f) mitomycin - c (mmc) group filtrating bleb patency and trepan blue dye passage into the subconjunctival space can be seen. histologic analysis of the specimens was performed at the center of the sclerotomy site, as indicated by the location of the iridectomy. inflammatory cell infiltration was obviously lower in the ala and control groups compared with the mmcg (fig., there was a statistically significant difference between the mmc and ala groups and between the mmc and control groups (p0.05). there were no statistically significant differences among all groups when plasmocyte and lymphoid aggregate scores were evaluated. with respect to polymorphonuclear leukocyte scores, there was a statistically significant difference between the ala and mmc groups and the ala and control group scores (p0.05). with respect to vascular structure scores, there was statistically significant difference between the control and ala groups, and the control and mmc groups (p0.05) (table 1). tissues shown in (a) are from the control group, (b) is the ala group, and (c) is the mmc group. control group tissues show moderate inflammatory cells and closed sclerotomy. in the ala group few inflammatory cells and fistula tract and in the mmc group severe inflammatory cells and fistula tract can be seen. ala indicates -lipoic acid ; c, cornea ; cb, ciliary body ; cj : conjunctiva ; mmc, mitomycin - c ; ss : sclerostomy site. histopathologic findings of study groups in the control group, mild histologic changes due to surgical trauma were observed in the conjunctiva and in the ciliary body. the conjunctival epithelium was preserved with mild inflammatory reaction, cell infiltration, and minimal thickening. there was minimal fibroblast proliferation, congestion, and edema in the ciliary body. in the ala group the height of the conjunctival epithelium was normal, with minimal fibroblast proliferation, congestion, and edema. in the ciliary body, the height of the epithelium was normal, with minimal fibroblast proliferation, congestion, and edema. in the mmc group, the histologic changes observed in the conjunctiva were a decrease in the collagen density of the conjunctival epithelium, the loss of organization in the collagen fibrils, the slowing of mature collagen formation, epithelial cell loss, and increased inflammatory cell infiltration. the histologic changes observed in the ciliary body were a decrease in the height of pigmented and nonpigmented epithelium, the change of the cuboidal epithelium into a columnar epithelium, the accumulation of fibrin, and the disorganization of collagen fibers, with congestion and edema. when conjunctival and ciliary body toxicity scores were evaluated, there was statistically significant difference among all the groups (ala < control < mmc) (table 1). masson trichrome staining showed a shortened, focal perpendicular sequence of collagen fibers in the cg, organized collagen fibers in the alag, and collagen fibers that were much looser and pointed in all directions, hypocellular connective tissue, and rare blue collagen deposition in the mmc group (fig. 3). when masson trichrome collagen organization scores were evaluated, there were statistically significant differences among all the groups (ala < mmc < control) (table 1). tissues stained with masson trichrome on day 28. tissues shown in (a and b) are from the control group, (c and d) from the ala group, and (e and f) from the mmc group. in the control group : moderate collagen disorganization / shortened, focal perpendicular sequence of collagen fibers. in the ala group : weak collagen disorganization / long, discrete collagen fibers, and in the mmc group : strong collagen disorganization / shortened and pointing in all directions ; collagen fibers can be seen. ala indicates -lipoic acid ; c, cornea ; cb, ciliary body ; cj : conjunctiva ; mmc, mitomycin - c ; ss : sclerostomy site : moderate disorganization of collagen fibers. : weak disorganization of collagen fibers. : strong disorganization of collagen fibers. when -sma staining scores (h - scores) were evaluated, there were statistically significant differences among all groups (mmc < ala < control). ala significantly reduced the population of cells expressing -sma, indicating less fibroblast differentiation into the myofibroblast phenotype (p<0.05) when compared with the cg (fig. 4) (table 1). immunohistochemical staining of filtration blebs on day 28. tissues shown in (a and b) are from the control group, (c and d) is the ala group and (e and f) is the mmc group. there was a reduction in the number of -sma - expressing cells in ala(c - d) and mmc (e and f) groups compared with the control (a and b) group. ala indicates -lipoic acid ; mmc, mitomycin - c ; sma, smooth muscle actin. its long - term efficiency is entirely dependent on the permanency of the surgically created fistula. it is unanimously agreed that fistula obstruction arises from an abnormal subconjunctival tissue regeneration process.4,27 many procedures have been developed to inhibit unwanted fibrotic activity in the trabeculectomy area, using different pharmacological agents with variable success. among these, the most commonly used has been mmc perioperatively applied. however, its use has been reported to be associated with a high complication rate.16 in this study we investigated inhibitory effect of topically applied ala on inflammation and proliferation ; and we observed that it can be used as an agent to reduce scar tissue formation in trabeculectomy surgery and can provide filtering bleb patency, which increases the success of the surgery. to the best of our knowledge, this is the first experimental study in which topical ala has been used in rabbit eyes undergoing trabeculectomy to prevent scar tissue formation at the trabeculectomy area, and in which trepan blue dye has been used to evaluate filtering bleb patency. angiogenesis is a key element of the proliferative phase of healing, supplying oxygen and nutrients to support the rapid growth of the cells and mediating repair.28 fibroblasts play the most important role in scar formation. when activated, they transform into myofibroblasts (activated collagen secreting -sma fibroblast).29 chronic inflammation and repair can trigger excessive accumulation of ecm components, which leads to the formation of fibrotic scarring. during this period, profibrotic cytokines and growth factors, such as transforming growth factor (tgf-), il-13 and platelet - derived growth factor play a critical role.30 some chemokines / cytokines and their functions on tissue healing are shown in table 2. the effect of ala on chemokines / cytokines which are important in tissue - healing process mmc is an antibiotic agent with antiproliferative properties and is classified as a cell cycle nonspecific alkylating agent. thus, it inhibits both dna replication and protein synthesis.39 mmc causes dna damage directly by generating oh - free radicals after a bioreductive process, causes apoptotic cell death by alkylating guanine in the dna structure, and activates caspase-3, caspase-8, and caspase-9, which causes apoptosis and necrosis.40 the inhibition of dna synthesis results in long - term inhibition of tenon s fibroblast proliferation.41 despite the favorable effect of this agent on the long - term outcome of trabeculectomy, it is has been demonstrated that its perioperative use is associated with various complications such as toxicity to corneal endothelial cells, hypotony, blebitis, and endophthalmitis.16 in this study, we observed that in the mmc group there was high inflammatory cell infiltration, the collagen fibers were disorganized with a decrease in density, the ciliary body was congested, and the sma - expressing cells were reduced. when the filtrating bleb patency was evaluated on 28th day by using 0.1% trepan blue dye, it was observed that none of the blebs had failed. the effects of ala on chemokines / cytokines are shown in table 2. in the literature, in various studies it is shown that ala reduces the development of oral submucous fibrosis, postoperative peritoneal adhesions, fibrosis, and epidural fibrosis.42 rats have been found to be protected by ala against carbon tetrachloride (ccl4)-induced liver fibrosis ; possibly through its antioxidant activity, its capacity to induce matrix metalloproteinase-13, and through its inhibitory effect on the tgf-.43 trivedi showed that in the aqueous humor, glaucoma patients levels of tgf-2 (a strong profibrotic agent) are higher than those of nonglaucoma patients. in addition, cvenkel determined that in unsuccessful trabeculectomy surgery there are increased il-6 and tnf- levels in the aqueous humor. previously, it has been shown that topical ala, which is used as a drop, penetrates to the cornea and the anterior chamber of the eye and its concentration in the aqueous humor increases.46 studies have shown that ala decreases tgf-2, il-6 ve, and il-11, and also decreases il-1 and tnf-.38 according to above - mentioned literature, ala penetrates to the anterior chamber and can decrease the levels of profibrotic agents tgf-2, il-6, and tnf- in the aqueous humor and the filtering bleb area, which supports the direct effects on the surgical area of topically applied ala. in our study, less inflammatory cells infiltration and lower collagen fiber density were observed ; the collagen fibers were better organized and the number of -sma - expressing cells was lower than for the control group. when the filtrating bleb patency was evaluated using 0.1% trepan blue dye, it was observed that 2 (33%) blebs had failed in the alag on 28th day. this result did not reach statistically significance when compared with the control group, but in our opinion, and as whitley and petrie defined, a result can be of clinical significance but not statistical significance because of a small number of subjects. all the above - mentioned studies and our findings indicate that ala may be able to prevent and/or reduce fibrosis in the human body, by inhibiting the pathways of inflammation, revascularization, and the accumulation of ecm. in the literature it has been reported that topically instilled trehalose onto eyes after simple conjunctival incision or trabeculectomy,49 intraoperative subconjunctival implantation of a sustained - release dexamethasone implant,50 at a concentration of 0.2 mg / ml, or postoperative subconjunctival injections of ilomastat17 and postoperative use of 0.5% pirfenidone eye drops16 prolongs bleb survival and may also act as a potential adjuvant treatment when mmc alone is inadequate. the weaknesses of our study are as follows : we determined the doses of ala as 51/d independently, due to the lack of reference to the use of ala as drops in the literature. we used hematoxylin and eosin staining for the identification of inflammatory and endothelial cells in our study but instead we could have used specific immune staining. only the bleb function was evaluated in our study ; a more detailed evaluation could be done by adding the bleb area / calculated volume and bleb vascularity ; to the study. in conclusion, this study shows that peroperatively and postoperatively topically applied ala may regulate scar tissue formation at the site of trabeculectomy by blocking collagen synthesis, delays tissue regeneration and provides a more functional and permanent fistula in rabbit eyes. clinical studies are needed to investigate the safety of the topical application of ala in human eyes, and its long - term efficacy in reducing scar tissue formation in the postoperative period of trabeculectomy. | purpose : to evaluate the efficacy of -lipoic acid (ala) in reducing scarring after trabeculectomy.materials and methods : eighteen adult new zealand white rabbits underwent trabeculectomy. during trabeculectomy, thin sponges were placed between the sclera and tenon s capsule for 3 minutes, saline solution, mitomycin - c (mmc) and ala was applied to the control group (cg) (n=6 eyes), mmc group (mmcg) (n=6 eyes), and ala group (alag) (n=6 eyes), respectively. after surgery, topical saline and ala was applied for 28 days to the control and alags, respectively. filtrating bleb patency was evaluated by using 0.1% trepan blue. hematoxylin and eosin and masson trichrome staining for toxicity, total cellularity, and collagen organization ; -smooth muscle actin immunohistochemistry staining performed for myofibroblast phenotype identification.results:clinical evaluation showed that all 6 blebs (100%) of the cg had failed, whereas there were only 2 failures (33%) in the alag and no failures in the mmcg on day 28. histologic evaluation showed significantly lower inflammatory cell infiltration in the alags and cgs than the mmcg. toxicity change was more significant in the mmcg than the control and alags. collagen was better organized in the alag than control and mmcgs. in immunohistochemistry evaluation, ala significantly reduced the population of cells expressing -smooth muscle action.conclusions:la prevents and/or reduces fibrosis by inhibition of inflammation pathways, revascularization, and accumulation of extracellular matrix. it can be used as an agent for delaying tissue regeneration and for providing a more functional - permanent fistula. |
the majority of suicides (85%) in the world occur in low and middle - income countries. non - fatal suicide attempts occur mostly in young persons and are up to 10 - 40 times more frequent than suicides. persons with a history of previous suicide attempt are at a high risk of dying by suicide with up to 2% dying within one year and up to 7% within 10 years. over 100,000 people die by suicide in india every year. in the last two decades two large epidemiological verbal autopsy studies in rural tamil nadu revealed that the actual suicide rate is six to nine times the official rate. if these figures are extrapolated it is estimated that half a million suicides occur every year and at least 5 million attempt suicide each year in india. there are many studies on attempted suicide in india that discuss the various sociodemographic, clinical, psychosocial factors in attempted suicide[1420 ] but studies on interventions are sparse. most research about intervention for attempted suicides is conducted in developed countries and little is known about the burden of attempted suicide and effectiveness of intervention for suicide attempters in developing countries. the suicide - prevention multisite intervention study on suicidal behaviors (supre - miss), launched by the world health organization (who) in 2000, aimed at increasing the knowledge about suicidal behaviors and the effectiveness of brief interventions for suicide attempters in culturally diverse places around the world and chennai was the centre in india. the brief intervention and contact (bic) employed in the supre - miss trial is an adaptation of brief interventions used for alcohol problems. brief interventions were found to be effective in reducing alcohol - related problems and facilitating treatment referral of problem drinkers and in reducing suicide in high - risk patients. regular contact has been found to reduce suicidal behavior in those who have attempted suicide. compared to the usual psychological and medical interventions employed for suicide attempters, the advantage of this type of intervention is that it requires little space, equipment or highly trained personnel. given the resource limitations of low and middle - income countries, interventions that involve highly trained staff are not feasible while bic interventions are easily implementable. consequently, the supre - miss study aimed at assessing the potential benefits of bic as an add - on to the usual care for suicide attempters. the current paper discusses the effectiveness of bic in reducing suicides and attempted suicide in chennai, india. persons who attempted suicide were initially seen in the emergency department and all were routinely admitted to the intensive medical care unit of the hospital. all those over the age of 12 years who attempted suicide, identified from january 2002 to january 2004, were invited to participate in the study. the interviews were conducted face - to - face and took place in the intensive medical care unit. two experienced psychiatrists conducted the interview after the interviewee was medically stable, at the most three days after admission. those who were over the age of 12 years and were medically unable to give consent or interview or refused were excluded. the 680 enrolled participants were randomly assigned to the bic (n=320) or treatment as usual (tau) (n=360) group. the allocation sequence was based on random number table and maintained in a separate location to ensure that the clinician responsible for the assignment of the subject could not bias the assignment throughout the duration of study. the bic procedure included a standard one - hour individual information session as close to the time of discharge as possible combined with periodic follow - up contacts after discharge. the individual session provided information about the psychological and social distress that often underlies suicidal behavior, risk and protective factors for suicidal behaviors, basic community - specific epidemiology of suicide, repetition of suicidal behaviors, alternatives for constructive instead of self - destructive coping strategies, and contacts / referral options. follow - up contacts involved visits at 1 week, 2, 4, 7, 11 weeks and 4, 6, 12 and 18 months after discharge. during each visit the subjects in the bic group were asked how they felt and whether they perceived the need for any support. if they reported needing support they would be referred to an appropriate service agency. if a person denied the need for support, but was considered to be at current suicide risk, referral to a local treatment service was suggested. these visits were conducted by two psychologists with a one - day special training and documented using a short one - page form. the goal was to check - in with the patients and to determine their current status. if the individual had died, the cause of death as reported by relatives or other informants was recorded ; if the individual was alive, information on subsequent suicide attempts (if any) was recorded. typically, treatment was limited to acute management of the somatic squeal of the suicide attempt and did not include psychiatric or psychological assessment or treatment, or any psychological or social consultation. if there were no physical complications, patients were usually discharged after somatic treatment was completed, typically within 24 h. rarely, patients were discharged with a referral to outpatient mental health services. subjects in the tau group were contacted at six months and eighteen months after discharge to assess the suicidal behaviour using the same questionnaire used for the bic group. flow chart of recruitment the questionnaire, based on the european parasuicide study interview schedule (epsis) of the who / euro multicentre study on suicidal behavior was used. it covered detailed sociodemographic information, the history of suicidal behavior and family data, physical health, contact with health services, mental health, questions related to social support, substance use, hopelessness, traumatic events, legal problems, antisocial behavior, beck suicide intent scale, beck depression inventory, spielberger trait anger scale, who wellbeing index, who psychiatric disability assessment schedule and eysenk impulsiveness scale. all the instruments were translated, backtranslated and field - tested in the regional language and the interviewers were trained in the administration of the instruments. the bic procedure included a standard one - hour individual information session as close to the time of discharge as possible combined with periodic follow - up contacts after discharge. the individual session provided information about the psychological and social distress that often underlies suicidal behavior, risk and protective factors for suicidal behaviors, basic community - specific epidemiology of suicide, repetition of suicidal behaviors, alternatives for constructive instead of self - destructive coping strategies, and contacts / referral options. follow - up contacts involved visits at 1 week, 2, 4, 7, 11 weeks and 4, 6, 12 and 18 months after discharge. during each visit the subjects in the bic group were asked how they felt and whether they perceived the need for any support. if they reported needing support they would be referred to an appropriate service agency. if a person denied the need for support, but was considered to be at current suicide risk, referral to a local treatment service was suggested. these visits were conducted by two psychologists with a one - day special training and documented using a short one - page form. the goal was to check - in with the patients and to determine their current status. if the individual had died, the cause of death as reported by relatives or other informants was recorded ; if the individual was alive, information on subsequent suicide attempts (if any) was recorded. typically, treatment was limited to acute management of the somatic squeal of the suicide attempt and did not include psychiatric or psychological assessment or treatment, or any psychological or social consultation. if there were no physical complications, patients were usually discharged after somatic treatment was completed, typically within 24 h. rarely, patients were discharged with a referral to outpatient mental health services. subjects in the tau group were contacted at six months and eighteen months after discharge to assess the suicidal behaviour using the same questionnaire used for the bic group. the questionnaire, based on the european parasuicide study interview schedule (epsis) of the who / euro multicentre study on suicidal behavior was used. it covered detailed sociodemographic information, the history of suicidal behavior and family data, physical health, contact with health services, mental health, questions related to social support, substance use, hopelessness, traumatic events, legal problems, antisocial behavior, beck suicide intent scale, beck depression inventory, spielberger trait anger scale, who wellbeing index, who psychiatric disability assessment schedule and eysenk impulsiveness scale. all the instruments were translated, backtranslated and field - tested in the regional language and the interviewers were trained in the administration of the instruments. appropriate statistical measures and tests were carried out using the spss version 13. detailed description of the method and instruments can be ascertained in a prior publication. the study tried to include all suicide attempters consequently seen at the emergency care department. various factors like rapid departure of the patients, delayed notification of research staff, inadequate recording, constraints in hospitalization, etc. made it difficult to include all eligible patients. other reasons were refusals, clinical condition not allowing an interview, leaving against medical advice etc. hence out of the eligible 1691 persona those who did not participate in the study were similar in age and sex to those who participated. there were no significant differences between the bic and tau groups in sociodemographic factors like age, sex, marital status, educational status, employment status and religion as shown in table 1. sociodemographic variables the groups were also comparable in the duration of stay in the hospital, history of previous suicide attempt, number of previous attempts and family history of suicide and suicide attempt [table 2 ]. also, there was no difference in the method used. table 3 reveals that there were no differences in the psychological and clinical variables, thus suggesting that the bic and tau groups are comparable. completed and attempted suicide was found to be significantly lower in the bic group after intervention at 18 months follow - up compared to the tau group [table 4 ]. in the intervention group, the one completed suicide occurred in the first week itself. while in the tau group, five occurred before six months and four before 18 months. one attempted suicide occurred in week 1, three at six months, one at 12 months and three at 18 months during followup in the bic group while in the tau group there were three attempts in six months and 14 at 18 months follow - up. for the first time a randomized controlled study evaluating the effectiveness of bic in suicide attempters with suicide and attempted suicide as the primary outcome measure has been carried out in india. the findings demonstrate that a brief intervention session combined with a systematic long - term contact after discharge can have a positive effect on preventing subsequent suicide and suicide attempts. bic might have acted in a variety of ways to reduce suicidality by acting as a social support network ; by increasing awareness about the problems that led to the suicidal act and hence helping in formulating an alternate coping mechanism, by enhancing a feeling of connectedness and a feeling of being cared for. carter., have also shown in a randomized trial that intervention using postcards reduced repetition of hospital - treated deliberate self - harm poisoning. fleischmann., (2008) have shown that mortality was reduced in the bic group compared to the tau group in all the five sites of the supre - miss study. the problem of accurate collection of data in india is compounded by the fact that attempted suicide continues to be a punishable offence unlike in the majority of the countries in the world. the follow - up of subjects proved to be a major challenge due to the complex setting and high mobility. so ideally although the tau group should have been seen only after 18 months, they were seen at six months and 18 months to reduce the number of lost to follow - up patients. another limitation was that the ascertainment of suicidal behavior during follow - up was from the subject and family members with no corroborating official records. maselk and patel have suggested that combination strategies that reduce domestic violence, provide poverty relief and strengthen the health system in identification and treatment of mental disorders will contribute to the reduction of suicidal behavior, particularly in women. taking into consideration the human and economic resource limitations in india, interventions like bic are readily implementable in the healthcare sector. bic can be a cost - effective strategy to reduce subsequent suicidal behavior after a suicide attempt. this paper is based on the data and experience obtained during the participation of the authors in the who multisite intervention study on suicidal behaviours (supre - miss), a projected funded by the world health organization and the participating field research centres. | aim : to determine whether brief intervention and contact (bic) is effective in reducing subsequent suicidal behavior among suicide attempters.materials and methods : suicide attempters (n=680) admitted in a general hospital in chennai were randomly allocated to treatment as usual and bic whose components include brief intervention at the time of discharge and contact for 18 months.results:completed suicide was significantly lower in the bic group, or 35.4 (ci 18.4 78.2) as also attempted suicide, or 17.3 (ci 10.8 - 29.7).conclusions : this low - cost intervention which can be readily implemented may be an important suicide prevention strategy in healthcare settings in india. |
inteins self - splice from precursor polypeptides to reconstitute functional proteins. here we describe inteins as redox - responsive switches in bacteria. regulation was achieved by engineering a disulfide bond between the intein s catalytic cysteine and the flanking polypeptide. this interaction was validated by an x - ray structure, which includes a transient splice junction. a natural analogue of the designed system was identified in pyrococcus abysii, suggesting an unprecedented form of adaptive, post - translational regulation. |
|
supernumerary teeth may be defined as any teeth or tooth substance in excess of the usual configuration of 20 deciduous, and 32 permanent teeth. supernumerary teeth may occur singly, multiply, unilaterally or bilaterally, and in one or both jaws. rajab and hamdan reported in their study that males were more affected than were females, the sex ratio being 2.2:1. hongstrum and anderson and brook also reported a 2:1 ratio of sex distribution, whereas luten found a sex distribution of 1.3:1. the occurrence of multiple supernumerary teeth without any associated systemic conditions or syndromes ; however, is a rare phenomenon. single supernumeraries occur in 76 - 86% of cases, double supernumeraries in 12 - 23% of cases, and multiple supernumeraries in less than 1% of cases tooth fusion is the result of the union of two distinct dental entities that occurs at any stage of dental organ development. this process involves epithelial and mesenchymal germ layers resulting in irregular tooth morphology rajendran, 2006. the teeth may be fused with dentine or cementum, the latter case being called as concrescence. concrescence of teeth is actually a form of fusion which occurs after root formation has been completed. in this condition, teeth are united by cementum only and is thought to arise as a result of traumatic injury or crowding of teeth with resorption of the interdental bone so that the two roots / supernumerary teeth are in approximate contact and become fused by the deposition of cementum between them. the concrescence leads to a loss of gingival architecture leading to the development of funnels which may cause plaque accumulation thus, resulting in periodontal tissue destruction. most fusions between a molar and a supernumerary tooth require surgical removal due to the abnormal morphology and excessive mesiodistal width that causes problems with crowding, alignment and occlusal function. this article highlights the presence of a concrescence between mandibular second molar and a supernumerary tooth, with its clinical and radiographic findings and a multidisciplinary approach required for its management. a male patient aged about 30 years reported to department of periodontics, sri siddhartha dental college, and tumkur with a chief complaint of swelling in the lower right back teeth region and discharge. clinical examination revealed the presence of an irregular morphology of the permanent mandibular second molars. the morphology suggested the presence of a concrescence of a supernumerary cusp with mesio - buccal cusp of right mandibular second molar # 47 [figures 1 and 2 ]. paramolar occlusal view showing extra cusp in relation to # 47 paramolar occlusal view [close -up ] showing extra cusp in relation to # 47 in addition, increased mesio - distal crown width and distinct developmental occluso - gingival grooves on the labial and lingual surfaces were noticed. the gingiva around # 47 appeared to be reddish in color, with the loss of stippling and inflamed. a deep pocket was seen in relation to the buccal aspect of # 47 [figure 3 ]. probing pocket depth as measured with a university of north carolina - pcp 15 probe radiographic examination showed the union of a supernumerary tooth with the second permanent molar, suggesting bilateral fusion and the presence of an extensive periradicular lesion associated only with # 47 [figure 4 ]. pre - operative radiograph showing periapical radiolucency in relation to # 47 the case was diagnosed to be of a cemental fusion of a supernumerary paramolar with mesio - buccal cusp of permanent molar, which resulted in loss of gingival architecture thus, creating funnels for accumulation of plaque. the tooth was vital so treatment was solely aimed at elimination of the local plaque retentive factor and regenerating the lost periodontium by bone graft. the patient was re - evaluated at 3 and 6 months so as to check for the periapical radiolucency. after the radiolucency had subsided, resection of the tooth was carried out under local anesthesia. a full thickness flap was reflected, and the extra cusp was eliminated using a bur and hand piece [figure 5 ]. a full thickness mucoperiosteal flap reflected this excision led to a large defect on the buccal aspect of # 47, which was subsequently filled with bone graft [figure 6 ]. the flap was sutured using the black braided silk suture and a non - eugenol periodontal pack (coe pack) was given. post - operatively the patient did not complain of any discomfort with the tooth and the healing was satisfactory. the patient at 6 month recall showed significant reductions in probing pocket depth [figure 7 ]. a permanent restoration was planned and a stainless crown was fabricated and cemented on # 47 [figure 8 ]. post resection with bone graft post - operative probing depth at 3 month recall permanent restoration fabricated and cemented the terminology dental fusion and concrescence are used to define two different morphological dental anomalies, characterized by the formation of a clinically wide tooth. despite the considerable number of cases reported in the literature, case history and clinical and radiographic examinations can provide the information required for the diagnosis of such abnormalities. after a judicious evaluation of all information, we can report that this case represents concrescence of right second mandibular molars with supernumerary teeth. concrescence may defy radiographic detection as well ; they may be misdiagnosed as simple radiographic overlap or superimposition of teeth. in addition, a normal amount of cementum involved in the concrescence may also contribute to an inaccurate diagnosis. a diagnostic consideration ; however, not a rule is that supernumerary teeth are often slightly aberrant and present a cone shaped clinical appearance. thus, fusion between a supernumerary tooth and a normal tooth will generally show the difference in the two halves of the crown. this case of concrescence between supernumerary paramolar and the permanent molar is very rare and to our knowledge there are only few cases reported in the periodontal literature where concrescence is one of the local etiologic factors for localized periodontal destruction. in cases of fusion, the factors to be considered in detail before planning the treatment is the presence of normal complement of teeth, level of separation of fusion of tooth, depth and extent of caries, level of co - operation / motivation of the patient and in children, age of the patient. if normal complements of teeth are present and fusion does not extend apically, sectioning can be attempted. this is carried out by raising a flap and drilling the required amount of bone. while sectioning, cutting should be carried out, naturally at the expense of the tooth to be removed. subsequent recontouring of the retained root may also be carried out at the same time to forestall periodontal complication. bone removal should be minimal so as not to compromise the attachment apparatus of the retained root. the iatrogenic defect due to section can be treated orthodontically by moving the tooth into the defect. if typically a tooth is missing the option of recontouring the tooth with composites or by crowns will be needed for esthetics. in cases of third molars then best treatment is extraction. the present case was of cemental fusion of a supernumerary paramolar with the mesiobuccal cusp of permanent molar. a multidisciplinary approach was needed to eliminate the tooth anomaly along with successful restoration of the tooth function. it is extremely imperative for us as clinicians that we do all we can to save the teeth which are vitally placed in the dental arch. different cases require a variety of knowledge about alternative operative techniques and abilities. a multidisciplinary approach with different practitioners working together | concrescence is a developmental anomaly of dental hard tissues. it is a condition showing union of adjacent teeth by cementum. the concrescence leads to a loss of gingival architecture leading to the development of funnels, which may cause plaque accumulation thus, resulting in periodontal tissue destruction. there is a slight predilection for the mandible especially in the premolar area followed by the molar and anterior regions. awareness of these developmental disturbances with proper diagnosis and treatment is very essential because it can compromise the periodontal attachment and can lead to the tooth loss. this article highlights the presence of a concrescence between mandibular second molar and the supernumerary fused teeth with their clinical and radiographic findings, along with its management. |
cardiovascular diseases (cvds) account for nearly a third of all deaths worldwide. the key intervention in cvds is to identify risk factors early and initiate therapy to control them. hence, diagnosis of hypertension and appropriate treatment to optimize bp are important public health goals worldwide. all groups of professional drivers especially those carrying passengers are at excess risk of htn, myocardial infarction, and hemorrhagic stroke [26 ]. traffic congestion, exposure to vehicle exhausts, constant whole body vibration, poor condition of roads, poor town planning and traffic regulation, over speeding due to competition between buses, and carelessness of pedestrians contribute to their misery. besides, most of the drivers are in the habit of eating main meals from hotels and consuming snacks (often oily and fried) and fast food items between trips. no study has been published regarding the prevalence of htn or special risk factors among professional bus drivers in india. in this context, we aimed to estimate the prevalence of htn and to identify its risk factors among male occupational bus drivers of kozhikode, a city in kerala, south india. this cross - sectional study was carried out in the corporation bus stand, kozhikode, one of the busiest bus stands in kerala. the approximate prevalence of htn among males in kerala as determined in previous studies is 35% [79 ]. but we decided to study all male bus drivers enlisted in the corporation bus stand giving consent to participate in the study. those who reported violent physical exercise, smoking, tobacco chewing, or drinking tea or coffee within thirty minutes prior to bp measurement were excluded. information about their medical history, lifestyle, and occupation was obtained by personal interview using a pretested semistructured questionnaire. bp was measured manually using a mercury column sphygmomanometer and stethoscope by the auscultatory method. two readings were taken one before and one after the interview, and the two were at least 15 minutes apart. patients with bp in prehypertensive and hypertensive range were asked to report one week later and another set of readings was obtained for confirmation. we measured the subjects ' height and weight, from which the body mass index (bmi) was calculated. the weight was measured (closest to 1 kg) using a beam type weighing scale. height was measured (nearest to 1 cm) with the subject in an erect position against a vertical surface. hypertensives were referred for medical care and prehypertensives were advised lifestyle modification and bp monitoring. htn was defined as systolic bp of 140 mm hg and/or diastolic bp of 90 mm hg or current pharmacological treatment for htn. pre - htn was defined as systolic bp 120139 mm hg and/or diastolic bp 8089 mm hg. isolated systolic htn was defined as systolic bp 140 mm hg in presence of a normal diastolic bp. aware of htn status if he reported a diagnosis of htn made by a medical practitioner. treatment for htn was defined as regular use of a prescription medication for htn. control of htn with treatment was defined as sbp and dbp less than 140 mm hg and 90 mm hg, respectively, in a subject on regular antihypertensive therapy. never smoked was assigned to subjects who never smoked cigarettes or beedis and current smokers to those who smoked at any time during past one year. quit smokers were those who had quit smoking at least one year before the study. the smoking habit was quantified in pack - years (number of packets of cigarettes smoked per day multiplied by the duration of smoking in years assuming that each packet contains 20 cigarettes). based on alcohol use (35 years, being married, supporting more than 4 family members, taking main meals from restaurants on most working days, eating egg on most days, bmi 23 kg / m, and longer duration of employment as bus driver were strongly associated with htn on bivariate analysis. binary logistic regression was done with these risk factors and current smoking and being diabetic as independent variables (due to strong epidemiological association with htn in previous studies) as independent variables and htn as dependant variable. age > 35 years (p = 0.015), bmi 23 kg / m (p = 0.007), supporting more than four family members (p = 0.011), and taking main meals from restaurants on most working days (p = 0.017) were independently associated with htn. out of 74 hypertensive individuals, 12.16% (9/74) (95% ci = 4.7219.6) were aware of their hypertensive status, while only 4.05% (3/74) (95% ci = 0.008.54) were treated and only 1.35% (1/74) (95% ci = 0.003.98) had bp adequately controlled. no significant association was found between awareness about htn and educational qualification (chi - square-0.033, p = 1.000). through our study we aimed to report the prevalence and special risk factors of htn among occupational bus drivers, a particularly vulnerable group. the only other study on transit vehicle operators in india deals with htn among autorickshaw drivers of nagpur among whom the reported prevalence was 35.14%. only two studies have been published from south asia on htn in drivers. in one study, 23% of bus drivers were found to be hypertensive compared to 15.85% of the normal population. another study conducted by saleekul. in bangkok observed the prevalence of diastolic htn to be 17.5% against 7.7% of controls. but professional drivers especially those carrying passengers were found to be at an increased risk of stroke, attributed to htn and stress. the overall prevalence of htn in the study group is much higher than the reported pooled prevalence of about 1620% in india [1719 ]. in the general population also, the prevalence of htn is higher in kerala compared to the rest of india. this has been attributed in previous studies to an advanced state of epidemiological transition existing in kerala [79 ]. reported a htn prevalence of about 30% among males aged 3059 years in kumarakom, a relatively rural area in kerala. another study conducted in chemmaruthy, varkala, a rural area, gives htn prevalence of 31.2% among males 2059 years old. a third study reports a prevalence of 56.3% among urban males aged 4060 years which is comparable to our finding of 54.5% in the same age group. this shows that prevalence of htn among bus drivers is higher than the rural population in kerala but similar to that observed in urban population of comparable age. the near urban prevalence of htn in them could be due to the drivers acquiring life style risk factors seen in urban population. this may be due to the habits associated with the job. among subjects with age up to 35 years, 21 (26.3%) were hypertensive, which is also high. the genetic predisposition among indians for acquiring cardiovascular risk factors early in life, coupled with the unhealthy lifestyle, could be the cause of high htn prevalence in the young [20, 21 ]. jnc7 suggests that poor sbp control is one factor responsible for the unacceptably low rates of overall bp control. the proportion of prehypertensives in a middle aged urban population of thiruvananthapuram was about 36%. the study from kumarakom reported pre - htn rate of 48.3%, while only 15.3% had normal bp. in our study, only 16.8% of the study population had normal bp. the same has been proven in a recent study conducted among residents of rural kerala. the responsibility of supporting more than four family members was found to be associated with htn. supporting a larger family the possibility of drivers working overtime to meet their financial needs was considered, but average work hours among the two groups were same. probably, having to support a large family caused a degree of mental stress and anxiety which contributed to the risk of htn. the association of htn with dietary sodium intake and fat content and protective role of fruits and vegetables is known. most of the bus drivers leave their home early in the morning to start work. there may be practical difficulties in preparing tiffin early in the morning. in spite of a person carrying tiffin, he may not get adequate time, space, or other facilities to enjoy his homely meal, during a short stoppage in a long trip. to circumvent this problem, most drivers are forced to take meals from restaurants, whose food often contains excess salt, oil (the same oil may be used repeatedly for deep frying which is harmful), spices, and other additives to make it more palatable. there was significant association between prevalence of htn and being overweight (bmi 25 kg / m). it is seen that morbidity and mortality due to cvds in indians are higher in people with lower bmi when compared to western population. so, some have advocated a cutoff point of 23 kg / m for normal bmi among indian population. in the current study, when the cutoff point for high bmi was made 23 kg / m, the significance levels increased. some of the studies have reported duration of employment as a risk factor [6, 12 ]. many studies have attributed the higher prevalence of htn among bus drivers to job stress especially while working in heavy traffic (a work barrier which causes risky behavior or needs extra effort), factors in the occupational environment, erratic work hours, sedentary lifestyle, and a sense of underpayment [2, 46, 15 ]. there are also studies that say that there is no association between stress and htn, while some others report inverse association between self - reported stress and htn [19, 23 ]. in our study, we explored this aspect with self - reported traits like getting irritated often, frequently involving in heated exchanges, rash driving, previous involvement in accidents, and subjective feeling of adequate sleep and exercise. explanations that have been given for this inconsistent association between stress and htn include adverse situations making a person angry which facilitates development of htn and htn altering perception of the degree of stress.. however, we could not find any association between the two in the present study. in addition, our study population was relatively young, about 70% being below 40 years. around middle age, many bus drivers tend to leave the vocation. in the young, type 2 diabetes is asymptomatic and often goes undiagnosed unless blood sugar is estimated. our study relied entirely on subjects ' self - reporting of diabetes if previously detected. 61.54% of diabetics were having htn in our study, a figure comparable to the kumarakom study. we observed that diabetics have higher mean values of systolic and diastolic bps. we analyzed the relation between htn and (a) smoking status (current smokers versus nonsmokers and quit smokers) as well as (b) degree of exposure estimated as pack - years of smoking. it may be possible to clarify the relation by studying a larger sample of the population. consumption of fish on most days was found to be protective against development of htn in one study, likely explanation being the higher content of polyunsaturated-3-fatty acids in fish. this could be because, majority of the population under study are habitual fish eaters. (96%), so that the protective effect could not reveal itself for lack of contrast. the levels of awareness, treatment, and adequate control of bp are poor in india compared to the west. in the study from rural kerala, 20.6% of men were aware of their hypertensive status, 16.4% were treated, and 4.6% had their bp controlled. these figures were 33.7%, 22.8%, and 8%, respectively, among urban males of kerala. awareness about htn (12.1%) among bus drivers is lower than the above values. the proportion of hypertensives receiving treatment and having their bp reduced to target levels is very low. this low level of awareness, treatment, and optimal control of bp is unacceptable considering the high literacy level of kerala. poor awareness about htn may reflect (a) lack of frequent contact with the health system, (b) deficits in routine clinical examination on patients, or (c) a lower degree of overall awareness about cvds, risk factors, and prevention. one of our limitations was not measuring the abdominal circumference which correlates better with htn than bmi. employing a questionnaire which will objectively assess the driving habits and compare the stress levels with other occupations will provide more insight into the factors contributing to htn. similar studies should be conducted on a larger scale at multiple centers and involving more refined techniques and expertise to yield better results. to conclude, the prevalence of htn among male bus drivers of kerala is very high. a close - to - urban unhealthy lifestyle acquired as part of their job lies at the heart of the problem. they are at risk of developing coronary artery disease, stroke, and chronic kidney disease in future. this will cause significant mortality and morbidity, reduce economic and social participation, and burden their family as well as the nation 's health system. all occupational drivers should be screened for lifestyle diseases at entry into the vocation and then periodically. those at risk should be rehabilitated to protect their own health and to ensure the safety of passengers. the study underscores the pressing demand for targeted educational interventions, regular health checkups, and appropriate lifestyle modifications among bus drivers. | background. hypertension is a leading cause of morbidity and mortality worldwide. we aimed to evaluate the prevalence of hypertension in a population of male bus drivers in north kerala, india. methods. the study population included male bus drivers of corporation bus stand kozhikode, kerala. blood pressure, height, and weight of subjects were measured, and relevance was obtained using a structured questionnaire. results. age varied from 21 to 60 years (mean 36.5 8.4). among 179 bus drivers studied, 16.8% (30/179) had normal bp, 41.9% (75/179) had prehypertension, and 41.3% (74/179) had hypertension. isolated systolic htn was seen in 6.70% (12/179) individuals. out of 74 hypertensives, 9 (12.1%) were aware of their hypertension, while 3 (4.0%) were medicated and only 1 (1.3%) had bp adequately controlled. age > 35 years (p = 0.015), bmi 23 kg / m2 (p = 0.007), supporting more than four family members (p = 0.011), and taking main meals from restaurants on most working days (p = 0.017) were independently associated with htn in binary logistic regression. conclusion. prevalence of hypertension was high among bus drivers. age > 35 years, elevated bmi, supporting a large family, and dietary habits associated with the job showed significant association with hypertension. primary and secondary prevention strategies need to be emphasized in this occupational group. |
malrotation of the midgut is an abnormality in embryological development of gastrointestinal tract. by the fourth intrauterine week the gastrointestinal tract is in the form of an endoderm lined tube divided into fore, mid- and hindgut. mid- and hindgut defined by their blood supply the superior and inferior mesenteric arteries respectively. by the fifth week of life the midgut begins a process of rapid enlargement, physiological herniation and rotation. with rapid expansion of liver and kidneys, expansion of the midgut intestinal loop can not be contained within the abdominal cavity ; this results in temporary physiological midgut herniation through the umbilical cord with superior mesenteric artery forming the axis. this process forms c of the duodenum and places it behind the superior mesenteric vessels. hernial reduction occurs by week 10 with the jejunum reducing first and lying to the left and subsequent distal portions lying progressively to the right. the ceacum descends from position in the right upper quadrant forming the descending colon with its mesentery gradually disappearing. a 17-year - old male was seen in the emergency department with 10-year history of abdominal colic which is relieved by vomiting, along with dehydration. there was no history of jaundice, fever, steatorrhea, or bleeding per rectum. the patient had been treated with proton pump inhibitors, prokinetic agents by general practitioners, without any relief. his ultrasound examination and standing x - ray of abdomen physical examination was normal except minimal abdominal tenderness in epigastric, right hypochondriac region along with mild dehydration. his liver function tests, renal function tests, amylase, hemogram, and urinalysis were normal. duodenum appeared connected to small intestine seen on right side giving a whirlpool appearance due to rotation of gut around the superior mesenteric artery. superior mesenteric vein was seen on left of superior mesenteric artery [figures 1a and b ]. stomach and duodenum appear connected to small intestine seen on the right side giving a whirlpool appearance due to rotation of gut around the superior mesenteric artery. superior mesenteric vein is seen on the left of superior mesenteric artery surgical referral was made ; he was treated with four - port laparoscopic ladd 's procedure. the peritoneum to the right of the ascending colon and caecum was incised and the anteriorly situated bands were stripped to free the duodenum. he was discharged within 2 days eating a normal diet and made a good postoperative recovery. at 3 months he was gaining weight and had no further vomiting. midgut mal and nonrotation refers to failure in counter clockwise rotation of the midgut which results in misplacement of the duodeno jejunal junction to the right of the midline ; in addition the small bowel mesentery has narrow vertical posterior attachment which is prone to volvulus. other anatomical abnormalities include peritoneal (ladd 's) bands running from the right colon to the lateral abdominal wall and an extensively mobile ceacum that fails to descend. acute presentation is with volvulus of midgut or ileoceacum occurring most frequently in neonate with likelihood decreasing with age. in most of the reported cases of this presentation, patients present with bilious vomiting in the first month of life because of duodenal obstruction or a volvulus. pathophysiology of these chronic symptoms may relate to the compressive effects of peritoneal bands running from ceacum and ascending colon to the right lateral wall. the short mesentery allows the small bowel to twist around the narrowed sma pedicle to create a distinctive whirlpool appearance. surgical management of intestinal malrotation was first described by ladd in 1936 and remains mainstay of management today. it involves reduction of vovulus if present, division of abnormal peritoneal bands (duodeno colic, dodenojejunal - ileocolic), and placement of the small bowel to the right of the abdomen and ceacum to the left. increasingly laparoscopic ladd 's procedures are being performed and have been shown to be effective where there is no acute volvulus.[79 ] this minimally invasive approach allows for earlier oral intake and discharge from hospital. | abnormalities in midgut rotation occur during the physiological herniation of midgut between the 5th and 10th week of gestation. the most significant abnormality is narrow small bowel mesentery which is prone to volvulus. this occurs most frequently in the neonatal period, less commonly midgut malrotation presents in adulthood with either acute volvulus or chronic abdominal symptoms. it is the latter group that represents a diagnostic challenge. we report a case of a 17-year - old male patient who presented with 10-year history of nonspecific gastro - intestinal symptoms. after extensive investigation the patient was diagnosed with midgut malrotation following computed tomography of abdomen. the patient was treated with a laparoscopic ladd 's procedure and at 3 months he was gaining weight and had stopped vomiting. a laparoscopic ladd 's procedure is an acceptable alternative to the open technique in treating symptomatic malrotation in adults. midgut malrotation is a rare congenital anomaly which may present as chronic abdominal pain. abdominal ct is helpful for diagnosis. |
in japan, there was no choice of medication for the treatment of alzheimer s disease (ad), other than donepezil, for more than a decade, as rivastigmine, galantamine, and memantine were not approved by the japanese ministry of health, labour and welfare until 2011. the recent availability of the three medications is leading to a new stage in the medical treatment of ad in japan. donepezil and galantamine block only acetylcholinesterase, while rivastigmine is a dual inhibitor of acetylcholinesterase and butyrylcholinesterase. on the other hand, galantamine is a potent allosteric potentiating ligand of nicotinic receptors.1 memantine blocks the n - methyl - d - aspartate receptor2 and thereby protects nerve cells from excess stimulation by glutamate. since these drugs have different pharmacological profiles, one should select the appropriate drug carefully, according to the ad progression and symptoms of the patients. however, there are few instances of using the newly approved drugs for the treatment of ad in japan. here, we report on two patients with ad who showed deterioration in the behavioral and psychological symptoms of dementia (bpsd) associated with switching to donepezil from rivastigmine after a clinical phase iii trial. a 76-year - old woman without family history of ad presented with a 5-year history of cognitive decline and a decrease in her activities of daily living. she needed the help of her family for daily activities such as excretion, bathing, and changing her clothes. on the mini - mental state examination (mmse), a cranial mri revealed moderate atrophy of the cerebral cortices, an enlargement of the inferior horn of the right lateral ventricle, and a slight ischemic change in the deep white matter. brain bloodflow scintigraphy showed a right dominant decline in the parietotemporal lobes and a decline in the posterior cingulate gyrus. there was no use of drugs or physical or neurological factors to explain her cognitive disturbance. based on these findings the patient participated in the clinical study of rivastigmine a 24-week, multicenter, randomized, double - blind, placebo - controlled, parallel - group, dose - finding study evaluating the efficacy, safety, and tolerability of the once - daily rivastigmine patch formulation in patients with probable ad (mmse score of 1020)3 and an accompanying, open - label, 52-week, extension study. one week after the extension study with a rivastigmine patch (18 mg / day), she started treatment with donepezil at a dose of 3 mg / day. she suffered from insomnia 3 days later and did not follow family advice, eg, walking around outside regardless of bad weather and ending up being protected by the police. in spite of it being a very hot day, she went out and lost her way, and was subsequently put under protective custody at a police station. consequent to these occurrences, she was admitted to national hospital organization, kikuchi hospital. her scores on the neuropsychiatric inventory (npi) before taking donepezil and at admission were 17 and 38 points, respectively (figure 1a). her agitation, irritability, and loitering tendencies improved after her discontinuation of donepezil and subsequent to her being prescribed 5 g / day yokukansan (tj-54 ; tsumura co, tokyo, japan) within a week. yokukansan (in japan) is a traditional asian herbal medicine that has been approved for insomnia and anxiety disorders by the japanese ministry of health, labour and welfare ; prescriptions for it are covered under the national health insurance plan. a 56-year - old woman who had no family history of ad showed a 5-year history of cognitive decline. her cranial mri images showed moderate atrophy of the parietal lobes, mild enlargement of the lateral ventricle, and no ischemic changes. upon clinical examination, there was apathy, but no neurological abnormalities were found. we found no drug - related or physical or neurological factors to have caused her cognitive disturbance. from these findings two weeks after the extension study with a rivastigmine patch (18 mg / day), she was prescribed donepezil (3 mg / day) according to the wishes of her husband. she began to go out early in the morning 4 days after starting donepezil ; she loitered all day and became agitated and aggressive toward family members 6 days later. her npi scores before taking donepezil and when undergoing npi were 20 and 40 points, respectively (figure 1b). her loitering, agitation, and aggression decreased after her discontinuation of donepezil and subsequent to her being prescribed tandospirone (30 mg/ day) and yokukansan (7.5 g / day) within a week. it is a member of the azapirone and piperazine chemical classes and is closely related to other agents such as buspirone and gepirone. a 76-year - old woman without family history of ad presented with a 5-year history of cognitive decline and a decrease in her activities of daily living. she needed the help of her family for daily activities such as excretion, bathing, and changing her clothes. on the mini - mental state examination (mmse), a cranial mri revealed moderate atrophy of the cerebral cortices, an enlargement of the inferior horn of the right lateral ventricle, and a slight ischemic change in the deep white matter. brain bloodflow scintigraphy showed a right dominant decline in the parietotemporal lobes and a decline in the posterior cingulate gyrus. there was no use of drugs or physical or neurological factors to explain her cognitive disturbance. based on these findings the patient participated in the clinical study of rivastigmine a 24-week, multicenter, randomized, double - blind, placebo - controlled, parallel - group, dose - finding study evaluating the efficacy, safety, and tolerability of the once - daily rivastigmine patch formulation in patients with probable ad (mmse score of 1020)3 and an accompanying, open - label, 52-week, extension study. one week after the extension study with a rivastigmine patch (18 mg / day), she started treatment with donepezil at a dose of 3 mg / day. she suffered from insomnia 3 days later and did not follow family advice, eg, walking around outside regardless of bad weather and ending up being protected by the police. in spite of it being a very hot day, she went out and lost her way, and was subsequently put under protective custody at a police station. consequent to these occurrences, she was admitted to national hospital organization, kikuchi hospital. her scores on the neuropsychiatric inventory (npi) before taking donepezil and at admission were 17 and 38 points, respectively (figure 1a). her agitation, irritability, and loitering tendencies improved after her discontinuation of donepezil and subsequent to her being prescribed 5 g / day yokukansan (tj-54 ; tsumura co, tokyo, japan) within a week. yokukansan (in japan) is a traditional asian herbal medicine that has been approved for insomnia and anxiety disorders by the japanese ministry of health, labour and welfare ; prescriptions for it are covered under the national health insurance plan. a 56-year - old woman who had no family history of ad showed a 5-year history of cognitive decline. her cranial mri images showed moderate atrophy of the parietal lobes, mild enlargement of the lateral ventricle, and no ischemic changes. upon clinical examination, there was apathy, but no neurological abnormalities were found. we found no drug - related or physical or neurological factors to have caused her cognitive disturbance. from these findings two weeks after the extension study with a rivastigmine patch (18 mg / day), she was prescribed donepezil (3 mg / day) according to the wishes of her husband. she began to go out early in the morning 4 days after starting donepezil ; she loitered all day and became agitated and aggressive toward family members 6 days later. her npi scores before taking donepezil and when undergoing npi were 20 and 40 points, respectively (figure 1b). her loitering, agitation, and aggression decreased after her discontinuation of donepezil and subsequent to her being prescribed tandospirone (30 mg/ day) and yokukansan (7.5 g / day) within a week. it is a member of the azapirone and piperazine chemical classes and is closely related to other agents such as buspirone and gepirone. our patients suffered from deterioration of bpsd associated with a switching from rivastigmine to donepezil. comparing the pharmacological profiles of donepezil and rivastigmine, it is known that donepezil is a specific acetylcholinesterase inhibitor, while rivastigmine is a dual cholinesterase inhibitor (chei) that is capable of inhibiting butyrylcholinesterase, another enzyme involved in acetylcholine degradation.4 the different efficacies of these cheis are also reported in clinical settings;57 however, it is not evident that these differences are due to the different pharmacological profiles mentioned above. it is also conceivable that the pharmacological differences among the cheis result in different profiles of adverse events, including neuropsychiatric symptoms. the occurrence and presentations of bpsd varied between our patients, and the manifestation of bpsd may be affected by patient profiles, including personality and environmental factors such as caregiving. in ad patients, sensitivity to psychoactive drugs may also vary, and some patients can be prone to drug - induced psychiatric events.8 it is reported that some ad patients show hostility or agitation accompanying their donepezil treatment,911 suggesting the possible exacerbation of neuropsychiatric symptoms by donepezil treatment. we occasionally experience dementia patients whose bpsd has been worsened by donepezil.12,13 it can be hypothesized that, in some patients, neuropsychiatric symptoms may be induced and enhanced by donepezil but that they are not, or are less evidently so, by rivastigmine. with this hypothesis, we should carefully evaluate the bpsd of patients after switching cheis, because the switch may cause bpsd to deteriorate, as it did in our patients. it also should be mentioned that we should be cautious when switching the medication in the reverse direction, ie, from donepezil to rivastigmine, as the switch may potentially cause other adverse effects in some patients. besides the two drugs different pharmacological profiles, their difference in formulation might be related to the deteriorated bpsd in the observed cases. rivastigmine is applied as a patch formulation, while donepezil is an oral - delivery formulation. with the patch, the pharmacologically active ingredient is continuously absorbed through the skin barrier composed of the epidermis and dermis, resulting in an unfluctuating blood concentration of the compound throughout the treatment.14 the pharmacokinetic profile of donepezil is known to be preferable, not least due to its long plasma half - life (t1/2) resulting in a considerably high trough level with oral applications at 24-hour intervals. however, like other oral medications, peak plasma concentration (cmax) after oral administration is unavoidable. in this regard, the deterioration in behavioral and psychological symptoms observed in the two clinical cases have been caused by their different pharmacokinetic profiles. the high peak - blood concentration of chei or the temporal fluctuation of the blood concentration may have caused such adverse symptoms. it may also be possible that both pharmacological and pharmacokinetic differences were involved in the cases we observed. nevertheless, the cases should be considered, in the context of pharmacology and pharmacokinetics, to have been exceptional ones that showed patients with profiles prone to negative effects from donepezil treatment. a randomized, double - blind clinical trial comparing the efficacy and safety of rivastigmine and donepezil5 showed no significant difference in overall efficacy as determined by the severe impairment battery.15 a slight but significant difference was observed in the alzheimer s disease cooperative study - activities of daily living inventory,16 the assessment battery on activities of daily living, suggesting pharmacological difference between the two medications.5 in the study, gastrointestinally adverse events were more frequent in the patients treated with rivastigmine, because it was given in capsule instead of patch formulation. as different responses to different medications may have occurred only in some patients, it is not possible to detect such responses in large clinical trials involving hundreds of patients. the discovery of biomarkers to discriminate patients with symptoms exacerbated by participation, together with careful and intensive observation of patients, will be needed to generalize our observations in this report. we have reported on two ad patients who showed deterioration of bpsd induced by switching from rivastigmine to donepezil. our observations might give general practitioners information useful for noticing possible unfavorable reactions caused by changing medications from the same therapeutic class. further collection and verification of cases is required to find patient populations with the optimum medications and/or risk factors, in order to determine the most appropriate medications to administer, according to the symptoms, disease stages, or putative subtypes of the disease. | rivastigmine, galantamine, and memantine, in addition to donepezil, which has been on the market over 10 years, have been available for the treatment of alzheimer s disease (ad) since 2011 in japan, leading a new stage in the medical treatment of ad. we studied two ad patients showing sudden deterioration of behavioral and psychological symptoms of dementia (bpsd) associated with switching from rivastigmine to donepezil after the clinical trial of rivastigmine. in the patients, rivastigmine seemed to be more beneficial than donepezil for the control of bpsd. although it was not obvious whether their different responses to the two cholinesterase inhibitors were due to the different pharmacological profiles, ie, the presence of inhibition of butyrylcholinesterase in rivastigmine, a particular cholinesterase inhibitor might be more effective in particular ad cases. further investigations are needed to confirm the difference, and to identify the measures for selecting the most appropriate medication for each ad patient. |
although rheumatic heart disease is increasingly rare in developed countries, it remains the most common cardiac disorder in much of the world. percutaneous mitral valvuloplasty has been shown to be a new therapy for patients with mitral stenosis and has achieved excellent results in the majority of patients with severe mitral stenosis. this report describes our first clinical application with this procedure in a pregnant woman with severe rheumatic mitral stenosis. she had been free of cardiac symptoms until one month prior to admission (25 weeks gestation). she began to be treated with digoxin and diuretic therapy. on two days before admission the blood pressure was 100/60 mmhg and the pulse rate was 120/min ; respirations were 28/min. cardiac examination revealed a prominent right ventricular heaving. the first heart sound was increased and the second sound was narrowly split with an accentuated pulmonic component. there were no abnormal findings on gynecological examination except enlarged uterus due to 26 weeks gestation. after intensive treatment with diuretics she could remain in the supine position. to protect the fetus from radiation, she was wrapped in a lead shield from the diaphragm to the symphysis pubis. fetal monitoring, including fetal heart rate, was done during the procedure. using the percutaneous femoral approach, a 7 fr. after prevalvuloplasty measurements (table 1), transseptal catheterization was accomplished from the right femoral vein using a modified brockenbrough needle and an 8 fr. systemic anticoagulation was achieved with 5000 units of heparin given after successful transseptal catheterization. left heart pressures and transvalvular gradients wedge ballon catheter was advanced through the mitral and aortic valves to the descending aorta, followed by insertion of a 0.035 inch, 260 cm long teflon - coated exchange guide wire through the flow directed catheter. the sheath and balloon catheter were then removed, leaving only the guide wire in place., a second guide wire was introduced to the descending aorta through the double lumen catheter which was inserted through the first guide wire. were advanced across the septum through the left atrium and positioned across the mitral annulus. two balloon inflations with a mixture of saline solution and iodinated contrast medium were then performed until the indentation in the balloon due to the mitral stenosis disappeared. immediately after catheter valvotomy, all hemodynamic measurements, including determinations of transvalvular gradient and cardiac output, were repeated (table 1). figure 1 shows the simultaneous left atrial and left ventricular pressure before and after balloon dilatation. there was a decrease in mean diastolic gradient across the mitral valve to 8 mmhg and an increase in cardiac output to 6.6 liters / min. right heart oximetry demonstrated no evidence of a left to right shunt across the atrial septum. to minimize radiation exposure to the fetus, left ventricular however, definite evidence of mitral regurgitation was not detected by physical examination and by doppler examination of the mitral valve. the procedure was completed in 2 hours (fluoroscope time ; 35 min.) and the patient tolerated it well with minimal discomfort. there was no evidence of fetal distress and the amount of radiation was 0.13 rem during the procedure. she delivered a 3.51 kg, healthy, full - term boy without any evidence of fetal abnormalities. follow - up examination of this boy for 17 months has shown normal growth and development. after intensive treatment with diuretics she could remain in the supine position. to protect the fetus from radiation, she was wrapped in a lead shield from the diaphragm to the symphysis pubis. fetal monitoring, including fetal heart rate, was done during the procedure. using the percutaneous femoral approach, a 7 fr. after prevalvuloplasty measurements (table 1), transseptal catheterization was accomplished from the right femoral vein using a modified brockenbrough needle and an 8 fr. systemic anticoagulation was achieved with 5000 units of heparin given after successful transseptal catheterization. left heart pressures and transvalvular gradients wedge ballon catheter was advanced through the mitral and aortic valves to the descending aorta, followed by insertion of a 0.035 inch, 260 cm long teflon - coated exchange guide wire through the flow directed catheter. the sheath and balloon catheter were then removed, leaving only the guide wire in place., a second guide wire was introduced to the descending aorta through the double lumen catheter which was inserted through the first guide wire. were advanced across the septum through the left atrium and positioned across the mitral annulus. two balloon inflations with a mixture of saline solution and iodinated contrast medium were then performed until the indentation in the balloon due to the mitral stenosis disappeared. immediately after catheter valvotomy, all hemodynamic measurements, including determinations of transvalvular gradient and cardiac output, were repeated (table 1). figure 1 shows the simultaneous left atrial and left ventricular pressure before and after balloon dilatation. there was a decrease in mean diastolic gradient across the mitral valve to 8 mmhg and an increase in cardiac output to 6.6 liters / min. right heart oximetry demonstrated no evidence of a left to right shunt across the atrial septum. to minimize radiation exposure to the fetus, left ventricular however, definite evidence of mitral regurgitation was not detected by physical examination and by doppler examination of the mitral valve. the procedure was completed in 2 hours (fluoroscope time ; 35 min.) and the patient tolerated it well with minimal discomfort. there was no evidence of fetal distress and the amount of radiation was 0.13 rem during the procedure. she delivered a 3.51 kg, healthy, full - term boy without any evidence of fetal abnormalities. follow - up examination of this boy for 17 months has shown normal growth and development. our findings demonstrate that percutaneous mitral valvuloplasty is an effective and safe procedure for treating pregnant patients with mitral stenosis. the patient had immediate symptomatic relief and the hemodynamic data showed significant relief of pulmonary hypertension and a significant increase in mitral valve area. these favorable results suggest that prercutaneous mitral valvuloplasty could be the treatment of choice for selected pregnant patients with mitral stenosis refractory to medical treatment. | a 28-year - old woman with severe mitral stenosis underwent percutaneous mitral valvuloplasty at 26 weeks gestation. balloon dilation using a double 18 - 18 mm balloon resulted in improvement in mean mitral pressure gradient (32 to 8 mmhg) and in calculated mitral valve area (0.9 to 2.4 cm2) without complications and any evidence of fetal distress during procedures with an estimated radiation exposure to the fetus of 0.13 rem. this procedure resulted in the disappearance of symptoms of congestive heart failure and allowed for normal full term spontaneous delivery of a 3.51 kg boy without any complication. |
warfarin is the most widely used anticoagulant agent for the prevention of stroke or systemic thromboembolism in patients with atrial fibrillation. however, warfarin has a narrow therapeutic range of international normalized ratio (inr) and is known to have multiple interactions with drugs, food, and herb. there is some difficulty in deciding a starting dosage of warfarin, because of the large interindividual variation in the dose needed to reach adequate level of inr. the warfarin dose can be affected by several factors including dietary, demographic factors, drugs and, several pathophysiological conditions (1). genetic factors also play a relevant role in the individual variability of the warfarin dose. in particular, several single nucleotide polymorphisms of the cytochrome p450 (cyp), subfamily iic, polypeptide 9 (cyp2c9) and vitamin k epoxide reductase (vkorc1) genes can significantly influence the warfarin dose requirement (2). several coagulation and fibrinolytic parameters appear to be affected by thyroid hormone excess (3). we report a patient with atrial fibrillation in whom the concomitant presence of rare genetic abnormality and thyrotoxicosis caused a marked increase in the inr level at the beginning of warfarin therapy. a 73-yr - old korean male with permanent atrial fibrillation visited outpatient clinic for the management of atrial fibrillation on feb. 21, 2012. he had a history of hypertension and colon cancer with liver metastasis. at the age of 68, he had undergone extended right hemicolectomy with liver tumorectomy due to colon cancer with liver metastasis and received adjuvant chemotherapy for two years. his current medication included diltiazem (90 mg / day) and aspirin (100 mg / day), spironolactone (25 mg / day), hydrochlorothiazide (12.5 mg / day). considering his risk for stroke and systemic thromboembolism (cha2ds2-vasc score 2), oral anticoagulation was recommended for him. when he revisited the outpatient clinic after six days, his inr was significantly increased to 15 (fig. he was admitted for correction of high inr and bleeding tendency on march 12, 2012. his liver function test at the time of admission was normal and he had no short bowel syndrome which would affect drug absorption. he denied any drug, alcohol, or herbal intake, which may affect inr level. we also performed a pharmacogenetic test on him to identify genetic susceptibility to warfarin effect. genomic dna was extracted from peripheral blood leukocytes using dna extract all lysis reagents (applied biosystems, ca, usa). genotyping for polymorphisms of cyp2c9 (rs1057910, cyp2c93) and vkorc1 (rs9934438, 1173c > t) variants was performed using taqman drug metabolism genotyping assays and 7500 fast real - time pcr system (applied biosystems, ca, usa). later, he was found to be an intermediate metabolizer with genotype of cyp2c91/3 and had vkorc1 + 1173tt genotype indicating high warfarin sensitivity (fig. then on hospital day (hd) 3, aspirin 100 mg a day was started to replace warfarin. we measured his plasma warfarin and 7-hydroxy - warfarin concentrations by high - performance liquid chromatography tandem mass spectrometry on hd 0 as a baseline and hd 3. on hd 0, total plasma warfarin, 7-hydroxy - warfarin concentration (7-oh - warfarin), and the ratio of warfarin/7-oh - warfarin were 0.793 g / ml (therapeutic range 0.5 to 3.0 g / ml), 0.046 g / ml, and 7.2, respectively. on hd 3, total plasma warfarin and 7-oh - warfarin levels were decreased to 0.178 g / ml and 0.01 g / ml, respectively, and the ratio of warfarin/7-oh - warfarin was increased to 18 (fig. 1). on thorough history taking, he complained of hand tremor with proximal muscle weakness. he also experienced unexplained body weight loss before admission. from this information, we suspected hyperthyroidism and thyroid function test was performed on hd 3 to confirm the diagnosis. total t3, total t4, tsh, and free t4 were 437.84 ng / dl (normal range 60 to 181 ng / dl), 17.6 g / dl (normal range 3.2 to 12.6 g / dl), 0.01 iu / ml (normal range 0.64 to 6.27 iu / ml), and 6.86 ng / dl (normal range 0.89 to 1.8 ng / dl), respectively. the results were consistent with hyperthyroidism, so carbimazole (20 mg twice daily) and betaxolol (20 mg twice daily) were started., warfarin was discontinued due to the risk of bleeding and instead aspirin was maintained for atrial fibrillation. we have observed a rare case with genotype of cyp2c91/3 and concomitant hyperthyroidism in which the usual initiation of warfarin therapy caused a dangerous and unexpected elevation of the inr value and led to bleeding complication. cyp2c9 is a liver enzyme required for the oxidative metabolism of a large number of clinically important drugs, including warfarin. three alleles, cyp2c91, 2, and 3 are present in most ethnic populations. both cyp2c92 and 3, and only in carriers of at least 1 copy of cyp2c93 confer significantly higher risk for warfarin over - anticoagulation and hemorrhagic complications compared to wild type allele (4). the frequency of cyp2c9 and vkorc1 1173 c / t polymorphism is largely dependent on ethnicity. in a korean population study, the allele frequencies of cyp2c93 and cyp2c91 are reported to be 6% and 93.4%, respectively. but cyp2c92 allele has not been detected. the frequencies of cyp2c91/3 and 1/1 genotypes are 12% and 86.9%, respectively (5). vkorc1 + 1173tt genotype associated with high warfarin sensitivity predominates in asian population than in non - asian population (6). it has been reported that overt hyperthyroidism exerts a procoagulant effect and increases the risk of thromboembolic events (5). in contrast, thyrotoxicosis has been associated with an increased sensitivity to warfarin, irrespective of the nature of the underlying thyroid disease (6). several studies reported warfarin - induced hypoprothrombinemia in hyperthyroidism with an increased risk of bleeding (7, 8, 9, 10). in thyrotoxic patients, warfarin produced a greater fall in factors (ii and vii) and a greater increase in prothrombin time than in the euthyroid state (11). furthermore in thyrotoxicosis, the degradation rate of coagulation factors is increased, resulting in their higher plasma clearance and shorter plasma half - life (6). we are presenting a very rare case about a patient with an uncommon genetic susceptibility to warfarin effect and co - existing hyperthyroidism at the beginning of warfarin treatment. from this case, we learned the clinical usefulness of pharmacogenetic and thyroid function tests in patients with atrial fibrillation, in whom warfarin is considered to prevent stroke or systemic thromboembolism. | a 73-yr - old korean man with permanent atrial fibrillation visited outpatient clinic with severely increased international normalized ratio (inr) values after taking a usual starting dosage of warfarin to prevent thromboembolism. we found out later from his blood tests that he had hyperthyroidism at the time of treatment initiation. his genetic analysis showed cyp2c9 1/3 and vkorc1 + 1173tt genotypes. we suspect that both hyperthyroidism and genetic variant would have contributed to his extremely increased inr at the beginning of warfarin therapy. from this case, we learned that pharmacogenetic and thyroid function test might be useful when deciding the starting dosage of warfarin in patients with atrial fibrillation.graphical abstract |
cells and culture conditions the following cells were used : bhk21 (c-13) fibroblasts (baby hamster kidney clone 13, american type culture collection), bhk21-tta / anti - clathrin heavy chain (chc) cell line (30), cav-1-ko and cav-1-wt mouse endothelioma cell lines (31), c2c12 mouse myoblasts (32), and 3t3 mouse fibroblasts (invitrogen). the cells were cultured in dulbecco 's modified eagle 's medium (high glucose, with sodium pyruvate and l - glutamine) (paa, pasching, austria) supplemented with 10 or 20% (the latter for c2c12 cells only) fetal calf serum (paa, pasching, austria), 2 mm l - glutamine (invitrogen), 50 g / ml gentamicin (paa, pasching, austria). for the cav-1-ko and cav-1 wild type (wt) endothelioma cell lines, the growth media was additionally supplemented with 1% nonessential amino acids (sigma), 1% sodium pyruvate (invitrogen), and 2 mm 2-mercaptoethanol diluted in phosphate - buffered saline (invitrogen). for the bhk21-tta / anti - chc cell line, the following additives were added : 10% tetracycline - negative fetal calf serum (paa, pasching, austria), 0.2 mg / ml geneticin (g418, invitrogen), 0.5 g / ml puromycin (sigma), 2 g / ml tetracycline (sigma). for the induction of chc antisense rna expression, peptides, proteins, and fluorophores peptides 5,6-carboxytetramethylrhodamine (tamra)-tat (grkkrrqrrr) and tamra - ptd4 (yaraarqara) (29) were synthesized as d - isomers and coupled directly to tamra at the n terminus (peptide specialty laboratories gmbh, heidelberg, germany). peptides and labels were diluted in rpmi 1640 medium without phenol red (paa, pasching, austria) and applied at 10 m final concentration to the cells. at lower concentrations, as we have shown previously (8), only the endocytic mode of uptake was detected (supplemental fig. s1). to monitor chc expression and function, transferrin (tf) conjugated to alexa fluor 633 (invitrogen) was added as a marker for clathrin - dependent endocytosis. nonreactive forms of the fluorophores fitc (fluorescein isothiocyanate) and tamra were generated by incubation with tris buffer (indicated by an asterisk) and used as a small molecule to monitor the generation of pores during the transduction event. to control for the complete inhibition of endocytosis at 4 c, the globular protein tat - biotin - streptavidin (tat - bt - sav) labeled with the fluorophore cyanine dye was used as an additional marker for fluid - phase uptake (supplemental fig. live cell uptake experiments for all experiments either 8-well -slides or 35-mm -dishes (ibidi, martinsried, germany) were used. the cells were seeded onto the observation chambers and incubated overnight at 37 c with 5% co2. the peptides tamra - tat and tamra - ptd4 (10 m), the fluorophores fitc and tamra (10 m), and tf (10 g / ml) were diluted in rpmi 1640 medium (paa, pasching, austria) without phenol red and used at the indicated concentrations. special care was taken to ensure that the volume of the peptide solution above the cells was comparable in the two different observation chambers and that the exchange against the appropriate peptide (label, marker) dilutions was performed very gently. immediately after addition of the peptide (label, marker) to the cells, time lapses over 60 min (with time intervals of one image per min) were recorded. for the uptake experiments at 4 c a custom - built cooling chamber was used. the height of this cooling chamber occupying the cooling flow and the radius of the loophole at the bottom were optimized to guarantee a constant temperature exchange between the 35-mm -dish observation chamber and the cool water flux. the temperature was regulated by a thermostat, and the exact temperature of 4 c inside the medium above the cells was verified by measurements with a thermometer before and after the 1-h time lapses. microscopy, image acquisition, and analysis confocal optical sections were acquired with a zeiss confocal laser scanning microscope, lsm510 meta, mounted on an axiovert 200 m inverted microscope equipped with a live cell microscope incubation cage (okolab, ottaviano, italy) using a 63 plan - apochromat na1.4 oil immersion, phase - contrast objective. the microscope incubation cage maintained a humidified atmosphere of 5% co2 and 37 c, which was used throughout except for the low temperature experiments. for all settings the main beam splitter was hft uv/488/543/633, and the specific parameters for the single fluorophores were as follows : fitc excited at 488 nm, detected with a 500530-nm bandpass filter ; tamra - tat and tamra - fluorophore excited at 543 nm, detected with a 565615-nm bandpass filter, transferrin - alexa fluor 633 excited with 633 nm, detected with a 650-nm long pass filter. phase contrast images were recorded with excitation at 488 nm and detection in the transmission channel. the laser power for observation was 1% (488 nm, 25 milliwatts), 7% (543 nm, 1 milliwatt), and 25% (633 nm, 5 milliwatts). settings were adjusted in a way that image pixels were not over- or underexposed with the range indicator function in the zeiss laser scanning microscopy software version 3.2. to ensure that weak intracellular fluorescence signals of the peptides were not missed, a set of overexposed images was additionally collected. for the quantification of transduction, 100150 cells per transduction experiment were evaluated to obtain the percentage of transduced cells (indicated by nucleolar appearance of the labeled peptide), and the kinetics of tat transduction was further characterized by the earliest time point when transduction could be detected within a field of view (initiation time of transduction). western blotting for western blot analysis of the cav-1-ko and wt cells, half a million cells were counted, resuspended in 100 l of phosphate - buffered saline, and boiled in laemmli sample buffer for 10 min, and cell lysates were analyzed by sds - page followed by blotting onto polyvinylidene difluoride membranes. signals were detected with the following primary antibodies : rabbit anti - cav-1 polyclonal antibody (lifespan biosciences, inc., seattle, wa) and mouse anti - cav-2 and anti - cav-3 monoclonal antibodies (1:2000 dilution, bd transduction laboratories). anti - rabbit igg - hrp (sigma) and anti - mouse igg - hrp (enhanced chemiluminescence, amersham biosciences) were used as secondary antibodies. immunoreactive signals were visualized using enhanced chemiluminescence plus detection solution (amersham biosciences) and recorded using a luminescence imager (luminescent image analyzer las-1000, fuji photo film, tokyo, japan). because of their particularly high transduction ability, which solely depends on a minimal number of arginines, rrps play a special role among cpps (18, 3335). to clarify the role of endocytosis in the uptake mode of cpps with low molecular weight (lmw) cargos into living cells, we investigated the occurrence and extent of transduction of tat and ptd4 as cpps with high and low transduction frequency, respectively (8). the intracellular distribution of peptides in living cells was analyzed by laser scanning confocal microscopy. to unravel the relevance of endocytic routes for the uptake and intracellular distribution of peptides, endocytic pathways were specifically inhibited by genetic approaches or were blocked in ensemble by incubation of cells at low temperature. role of clathrin - mediated endocytosis in cpp uptake clathrin - dependent endocytosis represents a major endocytic pathway. for example, transferrin is taken up exclusively by this route, and several enveloped viruses (36), such as equine arteritis virus (37), exploit this route (38). as an early step of this route, upon binding of an extracellular ligand to specific cell - surface receptors, clathrin together with other adapter proteins builds an endocytic coat at the plasma membrane (fig. 2a). the coated membrane buds and pinches off to form a cargo - filled vesicle (fig. clathrin - dependent endocytic uptake of tat has been repeatedly reported as a possible mechanism for cpp entry (23, 39, 40). to clarify the contribution of clathrin - dependent endocytosis in the uptake mode of arginine - rich cpps, we used the bhk21-tta / anti - chc (30) cell line. this cell line expresses antisense chc rna under the control of a tetracycline - responsive element (fig. more specifically, the transcription activator (tta) is composed of the dna binding domain of tetracycline repressor protein and a c - terminal activation domain of vp16 (herpes simplex virus protein) that functions as a strong transcription activator (41). the presence of tetracycline prevents binding of the transactivator tta to the operator sequence and thus transcription of antisense rna. in the absence of tetracycline the transactivator tta binds to its operator sequence and activates the transcription of antisense rna. as a consequence, the synthesis and functionality of chc protein is significantly reduced, thereby suppressing clathrin - dependent endocytosis (30). the absence of tetracycline for 2 days was reported to inhibit 90% of transferrin internalization, and the expression of the chc protein was reduced to 10% over 6 days in the absence of tetracycline (30). therefore, to explore to what extent transduction of tat depends on clathrin - dependent endocytosis, uptake of tamra - tagged tat and ptd4 was investigated in the presence (+ tet) and absence (tet) of tetracycline over 6 days. to simultaneously control the level of clathrin - dependent endocytosis, internalization of alexa fluor 633-labeled transferrin was monitored (fig. the control cells (+ tet cells) are shown on the left panel of fig. 2c and supplemental fig. s3. tat was homogeneously distributed throughout the cytoplasm and accumulated in the nucleolus (fig. 2c, arrowheads) and therefore displayed the uptake mode of transduction. in addition, the labeled peptide was also present in cytoplasmic vesicles. ptd4 applied at the same concentration and monitored at identical confocal microscope settings did not show any transduction - associated cytoplasmic localization comparable with tat. however, we observed the presence of ptd4-containing vesicles (fig. 2c, left side, lower panel). fluorescent transferrin was internalized at high rates and enriched in the trans - golgi network (42). s3a, right panel) was verified by the suppression of uptake of transferrin. tat displayed the same intracellular distribution regarding the vesicular uptake as well as transduction, indicated by similar intensities inside the nucleolar compartment compared with the control (+ tet) cells (fig. 2c and supplemental fig. similar to the control cells, no diffuse intracellular occurrence was observed for ptd4, but in contrast to + tet cells the vesicular internalization of ptd4 was almost completely abolished. the clathrin coat is required for membrane invagination, and for the scission of clathrin - coated vesicles dynamin is needed. b, schematic representation of the tet - off system, allowing a conditional knockdown of chc in the bhk21-tta / anti - chc cell line. the binding of the transcriptional activator tta to an operator sequence in the absence of tetracycline (tet) results in activation of transcription of chc - antisense rna and thereby repression of the chc mrna translation. c, confocal optical sections of living cells during incubation with the fluorescent cpps tat (upper panel) or ptd4 (bottom panel) in the presence of the transferrin (tf) as a marker for clathrin - dependent endocytosis. each panel displays high magnification images of the phase contrast (pc) and the fluorescently labeled compound to show the details of their intracellular distribution and low magnification images to highlight the frequency of cpp transduction and tf internalization (see also supplemental fig. transduction experiments were performed in the presence (left panel) and absence (right panel) of tetracycline. although uptake of tf is nearly abolished after tetracycline removal over a period of 6 days, the tat cpp is still capable of reaching all intracellular compartments (diffuse, nonvesicular fluorescence, and accumulation inside nucleoli), indicating that this mode of uptake is not influenced by clathrin - dependent endocytosis. vesicular uptake of the cpp tat was still detected under tet conditions albeit at reduced levels. scale bar, 10 m for high and 20 m for low magnification images. the clathrin coat is required for membrane invagination, and for the scission of clathrin - coated vesicles dynamin is needed. b, schematic representation of the tet - off system, allowing a conditional knockdown of chc in the bhk21-tta / anti - chc cell line. the binding of the transcriptional activator tta to an operator sequence in the absence of tetracycline (tet) results in activation of transcription of chc - antisense rna and thereby repression of the chc mrna translation. c, confocal optical sections of living cells during incubation with the fluorescent cpps tat (upper panel) or ptd4 (bottom panel) in the presence of the transferrin (tf) as a marker for clathrin - dependent endocytosis. each panel displays high magnification images of the phase contrast (pc) and the fluorescently labeled compound to show the details of their intracellular distribution and low magnification images to highlight the frequency of cpp transduction and tf internalization (see also supplemental fig. transduction experiments were performed in the presence (left panel) and absence (right panel) of tetracycline. although uptake of tf is nearly abolished after tetracycline removal over a period of 6 days, the tat cpp is still capable of reaching all intracellular compartments (diffuse, nonvesicular fluorescence, and accumulation inside nucleoli), indicating that this mode of uptake is not influenced by clathrin - dependent endocytosis. vesicular uptake of the cpp tat was still detected under tet conditions albeit at reduced levels. scale bar, 10 m for high and 20 m for low magnification images. we confirmed that tat transduction was observed in most cells by acquiring low magnification images (fig. 2c and supplemental fig. s3). to control for any potential side effects of tetracycline, the parental bhk21 cells (43, 44) were incubated with the cpps and transferrin in the presence and absence of tetracycline. however, no difference of peptide transduction and vesicle formation was observed (data not shown). therefore, we conclude that clathrin - dependent endocytosis is not required for transduction of the rrp tat fused to an lmw cargo. role of caveolin - mediated endocytosis in cpp uptake besides the classical clathrin - mediated endocytic pathway, caveolae - mediated endocytosis is one of the main endocytic entry routes into living cells (22, 45). for example, it is exploited by bacterial toxins and by simian virus 40 (36). caveolae are flask - shaped, small (5070 nm diameter) invaginations in the plasma membrane (fig. 3a) that constitute membrane domains enriched in cholesterol and sphingolipids, called lipid rafts (46). caveolae are characterized by the presence of the integral membrane protein caveolin-1 and are involved in the intracellular transport of lipid raft - associated molecules (47). this pathway has been repeatedly reported as an uptake route for cpps into the cells (24, 25). former studies used fluorescently labeled -subunit of cholera toxin as a marker to monitor caveolar uptake. however, the pathway chosen by cholera toxin subunit depends on the cell type (48) and hence may not be a faithful indicator for a single internalization pathway. to specifically inhibit only the caveolin - dependent route and to prevent the potential side effects caused by chemical inhibitors of endocytosis, we made use of an endothelial heart cell line generated from a knock - out (ko) mouse deficient for caveolin (cav-1) and the respective wild type (wt) cell line. as reported previously (31), in the absence of caveolin-1, caveolin-2 protein is degraded. in contrast to wt cells, no cav-1 and cav-2 were detected in the ko cells, and in addition, antibodies directed against muscle cell - specific cav-3 gave a much weaker signal in the extract of ko cells compared with those from wild type cells. to elucidate if caveolae - dependent endocytosis plays a role in the uptake mode of tat with the lmw tamra, we applied tat (fig. 3c, middle panel) to the medium of wild type cells and cav-1-ko cells. to control whether the tagged fluorophore supports peptide internalization, the uptake of tamra alone at the same concentration as the peptides was studied (fig. confocal optical sections are displayed at high and low magnification. because of the large size of these cells, it was not possible to show a higher number of cells per field and at the same time keep imaging parameters constant throughout all experiments. tat also became internalized by an endocytic route, as indicated by the punctated intracellular fluorescence. in contrast to tat, the ptd4 peptide entered the cells only by the endocytic mode and could not be detected freely inside the cyto- and nucleoplasm and the nucleolus (fig. tamra was excluded from the cytoplasm and intracellular compartments providing strong evidence that peptide uptake is not aided by the fluorophore. based on these results, we conclude that caveolae - mediated endocytosis is not involved in the uptake mode of transduction of tat conjugated to an lmw cargo. a, schematic diagram illustrating structural features of flask - shaped caveolae, which are lined by caveolin. caveolae - mediated endocytosis is driven by a coat made of the integral membrane proteins caveolin-1, -2, or -3. b, western blot analysis of the integral membrane proteins caveolin (cav) -1, -2, and -3 in wt and caveolin 1 ko endothelioma cells. c, confocal optical sections of living cells during incubation with the fluorescent cpps tat (upper panel) or ptd4 (mid panel) and the fluorophore tamra (bottom panel). each panel displays images of the phase contrast (pc) and the peptide or fluorophore fluorescence at high magnification to display their intracellular distribution and at low magnification to highlight the frequency of cpp transduction in wt and cav-1-ko cells (see also supplemental fig. whereas the amphipathic control peptide ptd4 and the fluorophore tamra were not transduced, the cpp tat was homogeneously distributed in the cytoplasm, and it reached the nucleus where it accumulated inside the nucleolar compartment (marked by arrowheads). scale bar, 10 m for high and 20 m for low magnification images. a, schematic diagram illustrating structural features of flask - shaped caveolae, which are lined by caveolin. caveolae - mediated endocytosis is driven by a coat made of the integral membrane proteins caveolin-1, -2, or -3. b, western blot analysis of the integral membrane proteins caveolin (cav) -1, -2, and -3 in wt and caveolin 1 ko endothelioma cells. c, confocal optical sections of living cells during incubation with the fluorescent cpps tat (upper panel) or ptd4 (mid panel) and the fluorophore tamra (bottom panel). each panel displays images of the phase contrast (pc) and the peptide or fluorophore fluorescence at high magnification to display their intracellular distribution and at low magnification to highlight the frequency of cpp transduction in wt and cav-1-ko cells (see also supplemental fig. whereas the amphipathic control peptide ptd4 and the fluorophore tamra were not transduced, the cpp tat was homogeneously distributed in the cytoplasm, and it reached the nucleus where it accumulated inside the nucleolar compartment (marked by arrowheads). both cpps displayed vesicular uptake in wt and cav-1-ko cells. scale bar, 10 m for high and 20 m for low magnification images.. a, schematic overview of the different pathways of endocytic internalization that are suppressed at 4 c : clathrin- and caveolin - dependent endocytosis, clathrin- and caveolin - independent endocytosis, and macropinocytosis. c, confocal optical sections of living cells during incubation with the fluorescent cpps tat (upper panel) or ptd4 (lower panel) in the presence of the fluorophore fitc as a small molecule marker to control for membrane pores or damage. each panel displays high magnification images of the phase contrast (pc) and the fluorescently labeled peptide or fluorophore to show their uptake and intracellular distribution and low magnification images to highlight the frequency of transduction at 37 and 4 c (see also supplemental fig. the transduction experiments were performed in bhk21 cells kept at 37 and 4 c. although no intracellular vesicles were found at 4 c, the transduction of tat (nonvesicular, diffuse fluorescence with accumulation inside nucleoli) remained unchanged both at 37 and 4 c. in contrast, the amphipathic control peptide ptd4 and fluorophore fitc were not transduced at 37 c nor at 4 c. scale bars are 10 m for high and 20 m for low magnification images.. a, schematic overview of the different pathways of endocytic internalization that are suppressed at 4 c : clathrin- and caveolin - dependent endocytosis, clathrin- and caveolin - independent endocytosis, and macropinocytosis. c, confocal optical sections of living cells during incubation with the fluorescent cpps tat (upper panel) or ptd4 (lower panel) in the presence of the fluorophore fitc as a small molecule marker to control for membrane pores or damage. each panel displays high magnification images of the phase contrast (pc) and the fluorescently labeled peptide or fluorophore to show their uptake and intracellular distribution and low magnification images to highlight the frequency of transduction at 37 and 4 c (see also supplemental fig. the transduction experiments were performed in bhk21 cells kept at 37 and 4 c. although no intracellular vesicles were found at 4 c, the transduction of tat (nonvesicular, diffuse fluorescence with accumulation inside nucleoli) remained unchanged both at 37 and 4 c. in contrast, the amphipathic control peptide ptd4 and fluorophore fitc were not transduced at 37 c nor at 4 c. scale bars are 10 m for high and 20 m for low magnification images. uptake of cpps upon shutting off endocytic pathways because neither clathrin- nor caveolin - dependent endocytosis inhibits cpp uptake and in both cases we could still find tat - containing vesicles concomitantly with freely available cytoplasmic tat peptide, we tried next to inhibit all endocytic pathways simultaneously. for this purpose, we followed the internalization of tat and ptd4 at low temperature, 4 c. 4a depicts all potential endocytic uptake routes in cells that are expected to be inhibited under such conditions. previous reports addressing the uptake of arginine - rich cpps with lmw cargos into living cells are inconsistent. although some reports insisted on the inability of cpps to penetrate cells at low temperature and hence endocytosis would be required for internalization (49), according to other reports, cpp uptake is not inhibited at 4 c (14, 19, 20). 4b displays the experimental setup for assessing the transduction ability of tat and ptd4 in c2c12 mouse myoblasts (data not shown) and in bhk21 hamster fibroblasts in the presence (37 c) and absence (4 c) of endocytosis by time - lapse confocal microscopy. to make sure that potential membrane lesions generated by low temperature conditions would not corrupt the transduction assay, the fluorophore fitc was applied simultaneously with the tamra - labeled peptides to the cells. in case of severe membrane damage or pore formation induced by the peptides, the 389-da - sized fitc molecule should also be detectable intracellularly. s5 reveal that even at 4 c tat entered living cells and distributed over the cytoplasm and nucleus, where it accumulated inside nucleoli. at the same time the fluorophore fitc did not gain access to intracellular compartments indicating that the plasma membrane was not compromised. the complete obstruction of endocytosis was further confirmed by the absence of fluorescently labeled vesicles at 4 c. vesicles were not observed for the cpp tat nor for ptd4. furthermore, uptake of the globular tat fusion protein tat - bt - sav that is restricted to endocytosis (8) was also blocked on the level of the plasma membrane at 4 c (supplemental fig. these results prove unambiguously that arginine - rich cpps like tat are capable of reaching intracellular compartments of living cells by a mechanism that is independent of endocytosis. however, the data also clearly show that a minimal number of arginines is crucial to permit transduction. assembly of confocal optical sections of living cells with time intervals of 15 min derived from the 60-min time lapses (see supplemental movies s1s10) displaying the kinetics of tat uptake in the different cell lines. all cell lines showed an unchanged transduction behavior in the control cells and the cells that were inhibited for a distinct or all pinocytic events. but the average entry time point of the tat peptide is cell type - specific. the last column summarizes the transduction frequencies of tat after 60 min of incubation in cells, where distinct or all endocytic pathways were suppressed. transduction frequency was scored by counting the percentage of cells showing the intracellular freely available peptide (see fig. 1, b and c). assembly of confocal optical sections of living cells with time intervals of 15 min derived from the 60-min time lapses (see supplemental movies s1s10) displaying the kinetics of tat uptake in the different cell lines. all cell lines showed an unchanged transduction behavior in the control cells and the cells that were inhibited for a distinct or all pinocytic events. but the average entry time point of the tat peptide is cell type - specific. the last column summarizes the transduction frequencies of tat after 60 min of incubation in cells, where distinct or all endocytic pathways were suppressed. transduction frequency was scored by counting the percentage of cells showing the intracellular freely available peptide (see fig. 1, b and c). scale bar, 10 m. frequency and initiation time of tat transduction to quantify our results on the transduction ability in the absence of a distinct pathway or all pathways of endocytosis, we evaluated the percentages of transduced cells after 60 min of incubation with the cpp tat and the initiation time of transduction (fig. 5 and supplemental movies s1s10). the control cells (+ tet, day 0) showed a transduction frequency of 83%. while over the first 3 days after induction of the conditional knockdown of chc (tet) the transduction percentages were reduced to 68%, they recovered back to 84% transduction frequencies by day 6, although the internalization of fluorescently labeled transferrin was reduced by 90%. the frequency of transduced cells was identical in cav-1-deficient and isogenic wt cells (54%), although in these cells it was lower than in the bhk21-tta / anti - chc cells. finally, the inhibition of all potential pinocytic pathways at 4 c determined in bhk21 fibroblasts revealed that the transduction of the tat peptide is diminished about 12% in comparison with transduction occurring in cells kept at 37 c, but still 63% of the cells displayed nucleolar accumulation of tat. in bhk21-tta / anti - chc cells, the transduction mode of uptake initiated between 15 and 30 min of peptide addition after chc knockdown as well as in control cells. the kinetics of peptide uptake in cav-1-ko and wild type cells displayed an uptake initiation at 45 min after application of tat. the fastest uptake of tat occurred in bhk21 fibroblasts within 1 min of addition to the medium and independent of temperature. a summary of the uptake kinetics of tat peptide in all conditions tested is presented in fig. the frequency and initiation time of tat transduction was unchanged within a given cell type independent of endocytosis. however, both parameters were cell type - specific, suggesting that the membrane composition influences the velocity of transduction. despite the controversy and uncertainty regarding the uptake mechanism, the property of cpps to deliver nonpermeable molecules into living cells makes them attractive vectors to be used in biological sciences as well as in medicine and biotechnology. former studies used chemical inhibitors of endocytosis to assign the uptake of cpps to a particular endocytic pathway. however, the potential side effects and lack of specificity of such inhibitors make these studies difficult to interpret. either the chemical compounds affect more than one specific pathway, like methyl--cyclodextrin that affects both lipid raft (26) and caveolin - coated vesicle formation (50) hence also caveolin - dependent endocytosis, or they have other side effects that may impact the import of rrps, e.g. chlorpromazine was shown to interface with a number of ca - dependent signaling pathways (51) and to bind to dopamine receptors (19, 52). thus, we have used genetically modified systems or physical methods to clarify the role of endocytosis in the translocation of rrps. the different phenotypes shown in fig. 1 permit at least two explanations for the occurrence of free rrps inside the cytoplasm and nucleoplasm. either rrps become endocytosed and a portion of the peptide stored in vesicles gets released into the cytoplasm or a second nonendocytic entry route that allows rrps to directly cross the plasma membrane has to be considered. earlier reports associated uptake of rrps with and without attached cargos to distinct endocytic pathways (16, 2328, 39, 40, 49). however, our results unambiguously demonstrate that the transduction of tat into living cells is not dependent on any endocytic or pinocytic events. we could exclude the pathway of clathrin - mediated endocytosis by a carefully controlled knockdown experiment. also caveolin - mediated endocytosis was not involved in tat translocation, because caveolin knock - out cells showed an identical transduction frequency to the wild type cells. most importantly, tat was not excluded from cells that were gently transferred to 4 c, a state where all potential endocytic pathways are inhibited. it is noteworthy to mention that the amount of tat transduced into a cell varies between cells within a single experiment, but its intracellular distribution does not. this phenomenon was observed in every cell type and was independent of which endocytic route was down - regulated. (fig. 2, 3, 4, 5 and supplemental fig. s3s5). comparing the transduction frequencies of the specific cell types, a variation from 68 to 84% for the bhk21-tta / anti - chc cell line, over 6375% in bhk21 cells, and to 54% in the mouse endothelioma cells can be found, suggesting that the particular membrane composition of different cell types impacted on transduction (fig. this was further corroborated by the observation that the average initiation time of transduction was cell type - specific, but it did not change upon the inhibition of endocytosis within a given cell type. all experiments were conducted in addition to ptd4 as a representative cpp (29) with a reduced number of arginines compared with tat. at the same concentration, this peptide did not gain access to the intracellular compartments in a freely diffusing form and was internalized exclusively by endocytosis. this could be explained by the fact that a minimal number of six arginines is required to permit transduction (18). instead although not capable of performing transduction, the cpp ptd4 was endocytosed more efficiently than non - cpp compounds added to the medium, e.g. the fluorophore tamra alone (fig. recent mechanistic studies with artificial membrane systems described the formation of pores as a consequence of the interaction with intermediate concentrations of the rrp tat (53). however, the fluorophore fitc, concomitantly applied to the cells together with the tat peptide, remained outside of the cells, whereas tat transduced selectively into the cells (fig. our data indicate that tat cpp internalization is independent of endocytosis and occurs without disruption of the cell membrane. these properties and its high intracellular bioavailability make tat cpp a very effective tool to deliver small compounds into living cells. | arginine - rich peptides are a subclass of cell - penetrating peptides that are taken up by living cells and can be detected freely diffusing inside the cytoplasm and nucleoplasm. this phenomenon has been attributed to either an endocytic mode of uptake and a subsequent release from vesicles or to direct membrane penetration (transduction). to distinguish between both possibilities, we have blocked endocytic pathways suggested to be involved in uptake of cell - penetrating peptides. we have then monitored by confocal microscopy the uptake and distribution of the cell - penetrating transactivator of transcription (tat) peptide into living mammalian cells over time. to prevent side effects of chemical inhibitors, we used genetically engineered cells as well as different temperature. we found that a knockdown of clathrin - mediated endocytosis and a knock - out of caveolin - mediated endocytosis did not affect the ability of tat to enter cells. in addition, the tat peptide showed the same intracellular distribution throughout the cytoplasm and nucleus as in control cells. even incubation of cells at 4 c did not abrogate tat uptake nor change its intracellular distribution. we therefore conclude that this distribution results from tat peptide that directly penetrated (transduced) the plasma membrane. the formation of nonselective pores is unlikely, because simultaneously added fluorophores were not taken up together with the tat peptide. in summary, although the frequency and kinetics of tat transduction varied between cell types, it was independent of endocytosis. |
we present a case of status epilepticus due to cerebral amyloid angiopathy - related inflammation, successfully treated with immunomodulation. a 52-year - old man with a history of hypertension and alcohol abuse, presented in january of 2015 with new - onset seizures. the patient 's family first noted new - onset irritability, paranoia, and confusion that were thought to be atypical for him. two days later, the patient noted a 45-minute episode of elementary visual hallucinations consisting of bright colors and stars in his right visual field with an associated expressive aphasia. he reported that he could understand questions and formulate responses in his head but not actually speak. he was brought to an outside hospital where he had a witnessed seizure during which he had deviation of his head to the left, evolving to a generalized tonic - convulsion seizure lasting 40 seconds, with associated tongue biting and postictal confusion but no incontinence. his exam was notable only for a right inferior quadrant visual field defect, which was homonymous but more profound in the right eye. a lumbar puncture was performed, and cerebrospinal fluid was acellular with normal protein and glucose, with no oligoclonal bands, and with negative cytology and flow cytometry. routine electroencephalograms (eegs) showed spike wave discharges with several electrographic seizures in the left occipital region. magnetic resonance imaging (mri) revealed left occipital white matter and cortical t2 hyperintensity with mild focal mass effect, without enhancement but with petechial hemorrhages on gradient echo (gre) imaging and with a second smaller focus of t2 hyperintensity in the left anterior insula (fig. he was loaded with levetiracetam and was discharged from the hospital. upon initial formulation, the patient 's history, exam, and studies were thought to be most consistent with a multifocal glioma, less likely an infectious or inflammatory process, and even less likely an old stroke. his levetiracetam dose was increased because of a recurrent episode of visual symptoms and aphasia, and he was scheduled for a biopsy of the left occipital lesion. however, a repeat mri performed in march 2015 in preparation for the biopsy showed significant improvement of the left occipital and left anterior insular lesions (fig. these shifting lesions were thought to be more consistent with a demyelinating process such as acute disseminated encephalomyelitis (adem). the brain biopsy was aborted, and the patient was instead admitted for an expedited inflammatory workup. a repeat lumbar puncture was again unrevealing (including negative oligoclonal bands, cytology, flow cytometry, and igh gene rearrangement). a computed tomography (ct) scan of the chest, abdomen, and pelvis revealed multiple 1- to 2-cm hepatic lesions with peripheral nodular enhancements, which were then confirmed as hepatic hemangiomas on abdominal mri. magnetic resonance imaging of the cervical and thoracic spine showed only mild degenerative disc disease, and ct angiogram of the head and neck was unremarkable. the patient was again discharged home, but follow - up mri in june 2015 showed worsening of the left occipital t2 hyperintensity (fig. 2c) and new left frontal t2 hyperintensities, as well as new enhancement of the lesion in the right anterior temporal lobe (not shown). the biopsy showed reactive changes and thickened blood vessels with beta - amyloid deposition in vessel walls (fig. he was then brought to the emergency department for a sudden clinical deterioration with global aphasia and confusion. he was unable to name objects, repeat phrases, or follow commands ; made frequent paraphasic errors ; and was noted to have decreased blink to threat on the right. an eeg was obtained, revealing continuous lateralized periodic discharges with overlying fast activity over the left posterior quadrant (fig. 4b), consisting of 9-hz rhythmic sharp waves, without clinical return to baseline between seizures. he was therefore determined to be in nonconvulsive status epilepticus (ncse) and was admitted. over the course of approximately 24 h, he was started on lacosamide, phenytoin, and valproic acid in addition to levetiracetam, and ncse was aborted. g 's clinical status improved only slightly with the arrest of seizures, and he continued to demonstrate significant global aphasia and confusion. positron emission tomography (pet) scan of the brain and whole body revealed increased fluorodeoxyglucose (fdg) uptake in the left occipital and left temporal regions, consistent with the known lesions on mri. these areas of increased fdg uptake were thought to be most likely due to an inflammatory process and less likely due to recent seizure activity. at this point, the diagnosis of cerebral amyloid angiopathy - related inflammation was advanced, and he was started on a 5-day course of methylprednisolone, 1000 mg daily as a diagnostic and therapeutic maneuver. clinically, his speech difficulties and confusion resolved almost entirely, and he was able to name, repeat, and follow commands normally. he was able to discontinue phenytoin and valproic acid without recurrence of seizures (either clinically or on eeg). following pulse - dose steroids, he was discharged on a slow taper of oral prednisone. repeat imaging in september of 2015 showed marked improvement of all t2 hyperintense lesions and complete resolution of all enhancement (fig. cerebral amyloid angiopathy (caa) consists of -amyloid deposition in small and medium arteries of the brain and leptomeninges. it is found in 2357% of the asymptomatic elderly population and at increased rates in those with dementia and intracerebral hemorrhage. cerebral amyloid angiopathy can more rarely cause an inflammatory reaction, known as caa - related inflammation (caa - i). this has historically been described as primary angiitis of the central nervous system associated with caa, cerebral amyloid angiitis, and cerebral amyloid inflammatory vasculopathy,,. cerebral amyloid angiopathy - related inflammation presents with subacute cognitive decline, headaches, and seizures rather than the chronic dementia or hemorrhagic strokes classically associated with cerebral amyloid angiopathy. the mean age at onset is approximately 68 years, significantly younger than for hemorrhagic caa. magnetic resonance imaging findings in caa - i include shifting multifocal white matter t2 hyperintensities abnormalities colocalized with petechial hemorrhages on swi. cerebrospinal fluid is typically bland, though protein may be elevated, and more rarely, pleiocytosis has been observed. the apoe 4/4 genotype is present at increased rates 71% of patients in one case series. histopathologic findings include amyloid deposition within vessel walls and perivascular, transmural, or intramural inflammation, including perivascular multinucleated giant cells. several published cases and case series describe treatment with immunosuppressive therapy, including corticosteroids with or without additional immunosuppressive therapy such as methotrexate, mycophenolate mofetil, or most commonly cyclophosphamide. thirty - eight of 53 published cases showed improvement with immunosuppressive treatment, as did mr. our patient 's case was notable for a typically subacute fluctuating clinical course and multifocal fluctuating radiographic findings, classically bland csf, and a biopsy demonstrating amyloid deposition within artery walls. inflammatory infiltrate was not seen on biopsy, and this was attributed to the biopsied lesion being an older, burned out cerebral amyloid angiopathy - related inflammation is an unusual but highly treatable cause of new - onset seizures in the middle - aged and elderly population and should be considered in the differential diagnosis of new - onset seizures after the age of 40, associated with fluctuating multifocal t2 hyperintensities and petechial hemorrhages on mri. | this report discusses a case of nonconvulsive status epilepticus, caused by cerebral amyloid angiopathy - related inflammation. brain biopsy demonstrated cerebral amyloid angiopathy, with clinical and radiographic features indicative of a fluctuating inflammatory process. immunomodulatory treatment with pulse steroids resulted in rapid and dramatic clinical and radiographic improvement. cerebral amyloid angiopathy - related inflammation should be considered in the differential diagnosis of new - onset seizures after the age of 40, when associated with fluctuating multifocal t2 hyperintensities and petechial hemorrhages on gradient echo (gre) or susceptibility - weighted (swi) mri sequences. |
the medical records of all subjects evaluated by a glaucoma specialist (krs) from march 2008 to may 2015 in the glaucoma clinic of the asan medical center were retrospectively examined. initial testing included a comprehensive ophthalmologic examination, including a review of the medical history, measurement of best - corrected visual acuity, slit - lamp biomicroscopy, multiple intraocular pressure measurements by goldmann applanation tonometry, gonioscopy, a dilated funduscopic examination, stereoscopic optic disc / rnfl photography, a vf test, measurement of central corneal thickness (dgh-550 instrument ; dgh technology, exton, pa, usa), and spectral domain optical coherence tomography (sd - oct). inclusion criteria at the initial assessment included a best - corrected visual acuity of 20 / 40 or better, a spherical refractive error between -6.0 and + 4.0 diopters, a cylinder correction within + 3 diopters, and the presence of a normal anterior chamber and an open - angle on slit - lamp and gonioscopic examinations. subjects with glaucomatous optic disc changes, such as diffuse or focal neural rim thinning, disc hemorrhage, or rnfl defects, as confirmed by two glaucoma specialists (krs and jyl), were included. subjects with any other ophthalmic or neurologic condition that could result in a vf defect and subjects with a history of diabetes mellitus or severe myopic fundus precluding adequate examinations were excluded. if both eyes of the same patient were found to be eligible, one eye was randomly selected for the analysis. all subjects with glaucoma were subjected to follow - ups at 6-month intervals, involving stereoscopic optic disc photography, rnfl photography, vf testing, and sd - oct scanning. all tests were performed at the same visit or within 2 weeks of one another. to be included, all participants received medical therapy during the follow - up period. if the subject underwent intraocular surgery or laser therapy during the follow - up period, only data obtained before these operations were included. vf tests were performed using a humphrey field analyzer (swedish interactive threshold algorithm 24 - 2 ; carl zeiss meditec, dublin, ca, usa). only reliable vf test results (false - positive errors < 15%, false - negative errors < 15%, and fixation loss < 20%) were included in the analysis. patients were expected to return approximately 1 month after the baseline examination to assess their responses to medication and to undergo a third vf test. data from the first vf test were excluded to obviate any learning effect, and the results of the second and third vf tests, performed within 1 month of each other, were considered baseline examinations. subjects who underwent at least five reliable vf tests, excluding the first, at separate visits were included. participants were divided into two subgroups, those with preperimetric and those with perimetric glaucoma. perimetric glaucomatous eyes had glaucomatous vf defects, defined as glaucoma hemifield test results outside the normal limits or a pattern of standard deviation exceeding 95% of normal limits. in addition, these eyes had to have a cluster of three points with probabilities < 5% on the pattern deviation map in at least one hemifield, including at least one point with a probability < 1% or a cluster of two points with a probability < 1%. the study protocol was approved by the institutional review board of asan medical center, and the study design followed the principles of the declaration of helsinki. sd - oct images were obtained using a cirrus hd - oct system (carl zeiss meditec), which was calibrated regularly by a technician employed by the manufacturer. all accepted images exhibited a centered optic disc or macula ; were well - focused, with even and adequate illumination ; exhibited no eye motion within the measurement circle ; and had signal strength 7. for inclusion in the progression analysis, at least five acceptable oct images had to be obtained on separate visits, with all images meeting the requirements for image quality. average circumpapillary rnfl (crnfl) thickness was determined in the optic disc cube mode, and the average and sectoral gc - ipl thicknesses were measured in the macular cube mode. gc - ipl parameters included the average, minimum, and six sector (superotemporal, superior, superonasal, inferonasal, inferior, and inferotemporal) gc - ipl thicknesses. the overall progression of the vf was determined using commercial software (humphrey field analyzer guided progression analysis, carl zeiss meditec) and was defined as a significant deterioration from the baseline pattern, with a deviation at three or more of the same test points evaluated on three consecutive examinations or as a significantly negative slope (p < 0.05) on a linear regression analysis using vf index data (overall progression criterion). if vf progression was present within the central 10 (i.e., a significantly deteriorated point on three consecutive examinations within the central 10), the case was considered central vf progression. progression of the rnfl in the central area was determined by evaluation of the entire series of red - free rnfl photographs displayed on a liquid crystal display monitor. two glaucoma experts (krs and jel) independently assessed all photographs to estimate glaucoma progression. the two graders were not aware of the other 's progression assessments and were masked to all clinical, oct, and vf information. each grader viewed all photographs of each eye before making an assessment and then classified each glaucomatous eye as either stable or progressing. in this study, progression of rnfl defects inside the macular 6.0-mm - diameter circle on red - free rnfl photographs, corresponding to the area in the gc - ipl map, was considered central rnfl photographic progression (fig. if the opinions of the two graders differed, consensus was reached after discussion, and if consensus was not reached, that eye was excluded from the subsequent analyses. of the 219 preperimetric eyes initially evaluated, 180 were found to be stable in the vf and rnfl photographic assessments during the follow - up period. among 180 eyes, 110 eyes were randomly chosen for an assessment of long - term variability of sd - oct measurement. the intraclass correlation coefficient, coefficients of variation, and intersession test - retest variabilities were calculated for average crnfl thickness and for average, minimum, and the six sector gc - ipl thicknesses on serial cirrus sd - oct scans obtained at 6-month intervals. in this present study, the intersession test - retest variability was defined as 1.96- and 1.28-fold greater than the inter - visit standard deviations for the 95% and 80% confidence intervals, respectively. if any change from baseline exceeded the test - retest variability in a negative direction in two consecutive follow - up sd - oct tests, that eye was regarded as showing progression. the sensitivity and specificity of cirrus sd - oct for detecting progression using two vf criteria (overall and central) were determined for (1) average crnfl thickness, (2) average gc - ipl thickness, (3) minimum gc - ipl thickness, (4) 1 sector in gc - ipl thickness, and (5) thickness of each of the six gc - ipl sectors during the follow - up period. the sensitivity and specificity for detecting central vf progression of gc - ipl thickness and rnfl photographic progression in the central area were compared using mcnemar 's test. all statistical analyses were performed using commercial software ibm spss ver 22.0 (ibm corp., the medical records of all subjects evaluated by a glaucoma specialist (krs) from march 2008 to may 2015 in the glaucoma clinic of the asan medical center were retrospectively examined. initial testing included a comprehensive ophthalmologic examination, including a review of the medical history, measurement of best - corrected visual acuity, slit - lamp biomicroscopy, multiple intraocular pressure measurements by goldmann applanation tonometry, gonioscopy, a dilated funduscopic examination, stereoscopic optic disc / rnfl photography, a vf test, measurement of central corneal thickness (dgh-550 instrument ; dgh technology, exton, pa, usa), and spectral domain optical coherence tomography (sd - oct). inclusion criteria at the initial assessment included a best - corrected visual acuity of 20 / 40 or better, a spherical refractive error between -6.0 and + 4.0 diopters, a cylinder correction within + 3 diopters, and the presence of a normal anterior chamber and an open - angle on slit - lamp and gonioscopic examinations. subjects with glaucomatous optic disc changes, such as diffuse or focal neural rim thinning, disc hemorrhage, or rnfl defects, as confirmed by two glaucoma specialists (krs and jyl), were included. subjects with any other ophthalmic or neurologic condition that could result in a vf defect and subjects with a history of diabetes mellitus or severe myopic fundus precluding adequate examinations were excluded. if both eyes of the same patient were found to be eligible, one eye was randomly selected for the analysis. all subjects with glaucoma were subjected to follow - ups at 6-month intervals, involving stereoscopic optic disc photography, rnfl photography, vf testing, and sd - oct scanning. all tests were performed at the same visit or within 2 weeks of one another. to be included, all participants received medical therapy during the follow - up period. if the subject underwent intraocular surgery or laser therapy during the follow - up period, only data obtained before these operations were included. vf tests were performed using a humphrey field analyzer (swedish interactive threshold algorithm 24 - 2 ; carl zeiss meditec, dublin, ca, usa). only reliable vf test results (false - positive errors < 15%, false - negative errors < 15%, and fixation loss < 20%) were included in the analysis. patients were expected to return approximately 1 month after the baseline examination to assess their responses to medication and to undergo a third vf test. data from the first vf test were excluded to obviate any learning effect, and the results of the second and third vf tests, performed within 1 month of each other, were considered baseline examinations. subjects who underwent at least five reliable vf tests, excluding the first, at separate visits were included. participants were divided into two subgroups, those with preperimetric and those with perimetric glaucoma. perimetric glaucomatous eyes had glaucomatous vf defects, defined as glaucoma hemifield test results outside the normal limits or a pattern of standard deviation exceeding 95% of normal limits. in addition, these eyes had to have a cluster of three points with probabilities < 5% on the pattern deviation map in at least one hemifield, including at least one point with a probability < 1% or a cluster of two points with a probability < 1%. the study protocol was approved by the institutional review board of asan medical center, and the study design followed the principles of the declaration of helsinki. sd - oct images were obtained using a cirrus hd - oct system (carl zeiss meditec), which was calibrated regularly by a technician employed by the manufacturer. all accepted images exhibited a centered optic disc or macula ; were well - focused, with even and adequate illumination ; exhibited no eye motion within the measurement circle ; and had signal strength 7. for inclusion in the progression analysis, at least five acceptable oct images had to be obtained on separate visits, with all images meeting the requirements for image quality. average circumpapillary rnfl (crnfl) thickness was determined in the optic disc cube mode, and the average and sectoral gc - ipl thicknesses were measured in the macular cube mode. gc - ipl parameters included the average, minimum, and six sector (superotemporal, superior, superonasal, inferonasal, inferior, and inferotemporal) gc - ipl thicknesses. the overall progression of the vf was determined using commercial software (humphrey field analyzer guided progression analysis, carl zeiss meditec) and was defined as a significant deterioration from the baseline pattern, with a deviation at three or more of the same test points evaluated on three consecutive examinations or as a significantly negative slope (p < 0.05) on a linear regression analysis using vf index data (overall progression criterion). if vf progression was present within the central 10 (i.e., a significantly deteriorated point on three consecutive examinations within the central 10), the case was considered central vf progression. progression of the rnfl in the central area was determined by evaluation of the entire series of red - free rnfl photographs displayed on a liquid crystal display monitor. two glaucoma experts (krs and jel) independently assessed all photographs to estimate glaucoma progression. the two graders were not aware of the other 's progression assessments and were masked to all clinical, oct, and vf information. each grader viewed all photographs of each eye before making an assessment and then classified each glaucomatous eye as either stable or progressing. in this study, progression of rnfl defects inside the macular 6.0-mm - diameter circle on red - free rnfl photographs, corresponding to the area in the gc - ipl map, was considered central rnfl photographic progression (fig. if the opinions of the two graders differed, consensus was reached after discussion, and if consensus was not reached, that eye was excluded from the subsequent analyses. of the 219 preperimetric eyes initially evaluated, 180 were found to be stable in the vf and rnfl photographic assessments during the follow - up period. among 180 eyes, 110 eyes were randomly chosen for an assessment of long - term variability of sd - oct measurement. the intraclass correlation coefficient, coefficients of variation, and intersession test - retest variabilities were calculated for average crnfl thickness and for average, minimum, and the six sector gc - ipl thicknesses on serial cirrus sd - oct scans obtained at 6-month intervals. in this present study, the intersession test - retest variability was defined as 1.96- and 1.28-fold greater than the inter - visit standard deviations for the 95% and 80% confidence intervals, respectively. if any change from baseline exceeded the test - retest variability in a negative direction in two consecutive follow - up sd - oct tests, that eye was regarded as showing progression. the sensitivity and specificity of cirrus sd - oct for detecting progression using two vf criteria (overall and central) were determined for (1) average crnfl thickness, (2) average gc - ipl thickness, (3) minimum gc - ipl thickness, (4) 1 sector in gc - ipl thickness, and (5) thickness of each of the six gc - ipl sectors during the follow - up period. the sensitivity and specificity for detecting central vf progression of gc - ipl thickness and rnfl photographic progression in the central area were compared using mcnemar 's test. all statistical analyses were performed using commercial software ibm spss ver 22.0 (ibm corp., a total of 35 of 419 eyes (8.4%) that met the other inclusion criteria were excluded due to a disagreement between the two graders regarding the rnfl progression assessment. therefore, a total of 384 eyes from 384 patients with glaucomatous optic disc changes, including 219 preperimetric and 165 perimetric glaucomatous eyes, were included in our final study cohort. the mean follow - up period (standard deviation) was 4.30 0.95 years, and the mean numbers of analyzed optic disc / rnfl photographs, sd - oct images, and vfs were 7.82 1.51, 7.74 1.52, and 7.60 1.43 per eye, respectively. of the 219 preperimetric eyes, 180 did not progress, according to either rnfl or vf assessment. of these 180 eyes, 110 were used to assess the variability of sd - oct measurement, as described earlier. the remaining 109 preperimetric eyes and 165 perimetric glaucomatous eyes were included in the main analysis. the mean age and follow - up period did not differ between these two groups (table 1). of the 109 preperimetric eyes included in the main analysis, seven showed progression by the overall vf criterion and three by the central vf criterion. of the 165 perimetric eyes, 38 showed overall vf progression and 25 showed central vf progression. the intraclass correlation coefficients, which ranged from 0.984 to 0.998, were excellent for average crnfl thickness and all gc - ipl measurements. the test - retest variabilities, defined at the 95% confidence level, were 4.08 mm for average crnfl thickness and 1.76 mm for average gc - ipl thickness (table 2). at the 95% confidence level, the sensitivity of gc - ipl thickness to detect overall vf progression ranged from 26.5% (for the superior gc - ipl sector) to 76.5% (for 1 sector gc - ipl) (table 3). at the 95% confidence level, the sensitivity of gc - ipl thickness to detect progression ranged from 28.6% (for the superior gc - ipl sector) to 82.1% (for 1 sector gc - ipl), and specificities ranged from 58.5% (for 1 sector gc - ipl) to 87.0% (for the superonasal gc - ipl) when using the central vf criterion (table 4). at the 80% confidence level, the sensitivities of the average and minimum gc - ipl parameters to detect central vf progression did not differ significantly from the central rnfl photographic assessment (60.7% vs. 53.6% and 64.3% vs. 53.6%, respectively). however, the sensitivity of gc - ipl (1 sector) was significantly higher than that of central rnfl photographic progression (89.3% vs. 53.6%, p = 0.013), whereas the specificity was significantly lower (43.9% vs. 76.4%, p < 0.001) (table 5). the intraclass correlation coefficients, which ranged from 0.984 to 0.998, were excellent for average crnfl thickness and all gc - ipl measurements. the test - retest variabilities, defined at the 95% confidence level, were 4.08 mm for average crnfl thickness and 1.76 mm for average gc - ipl thickness (table 2). at the 95% confidence level, the sensitivity of gc - ipl thickness to detect overall vf progression ranged from 26.5% (for the superior gc - ipl sector) to 76.5% (for 1 sector gc - ipl) (table 3). at the 95% confidence level, the sensitivity of gc - ipl thickness to detect progression ranged from 28.6% (for the superior gc - ipl sector) to 82.1% (for 1 sector gc - ipl), and specificities ranged from 58.5% (for 1 sector gc - ipl) to 87.0% (for the superonasal gc - ipl) when using the central vf criterion (table 4). at the 80% confidence level, the sensitivities of the average and minimum gc - ipl parameters to detect central vf progression did not differ significantly from the central rnfl photographic assessment (60.7% vs. 53.6% and 64.3% vs. 53.6%, respectively). however, the sensitivity of gc - ipl (1 sector) was significantly higher than that of central rnfl photographic progression (89.3% vs. 53.6%, p = 0.013), whereas the specificity was significantly lower (43.9% vs. 76.4%, p < 0.001) (table 5). although the oct measure of rnfl thickness showed good capability in diagnosing glaucoma, it was not as effective in its ability to detect disease progression. previous publications have reported poor to moderate agreement of oct measurements of rnfl thickness with optic disc / rnfl photographic or vf assessment, methods that are considered reference standards for detecting glaucomatous progression. one possible reason why oct measures of rnfl thickness showed poor ability to detect progression may be that the measurements have lower reproducibility in actual clinical practice than measurements obtained during well - designed evaluations. the first was to determine whether longitudinal variability in real clinical practice is within an acceptable range, and the second was to determine the practical cut - off values for defining changes in gc - ipl thickness. in previous studies, gc - ipl measurements by sd - oct showed good reproducibility in both healthy and glaucomatous eyes. the previously determined long - term reproducibility of gc - ipl measurements was similar to that of our results. in our current study, the intraclass correlation coefficient of the average gc - ipl thickness was 0.991 and the coefficient of variation was 1.13% in stable preperimetric glaucomatous patients, with these patients showing excellent long - term test - retest reproducibility. with an event - based analysis using the calculated variability as a cut - off, we found that gc - ipl parameters had moderate levels of sensitivity and specificity in detecting overall glaucomatous vf progression. however, sectoral gc - ipl parameters, defined as the 95% confidence level, were less sensitive in detecting progression than was average gc - ipl thickness. this may have been due to the greater test - retest variability of sectoral gc - ipl than of average or minimum gc - ipl thickness. the rnfl is thickest in the superotemporal and inferotemporal areas and, thus, is well visualized in these regions, allowing the detection of changes in these regions using rnfl photography. however, the rnfl in the macular area is thinner than crnfl and not well identified in some eyes. therefore, we hypothesized that sd - oct is more sensitive than rfnl photographic assessment in detecting changes in gc - ipl thickness and thereby detecting central vf progression. when central vf progression is considered a reference standard, the average change in gc - ipl thickness change was similar to rnfl photographic assessment, but the one - sector change in gc - ipl thickness showed better performance. thus, measuring the change in gc - ipl thickness may be an adjunctive strategy, especially when the rnfl is poorly visualized. however, the specificity for this parameter was lower than that for crnfl. therefore, gc - ipl parameters demonstrated comparable sensitivity and specificity to rnfl photographic assessment in detecting vf progression that has developed in the central retina. to our knowledge, our present study is the first to investigate the ability of gc - ipl measurements to detect overall and central vf progression using an event analysis. however, our study had several limitations. first, the follow - up period was relatively short. second, the limits of test - retest variability derived from stable preperimetric patients may not be identical to those from other patients. in conclusion, gc - ipl parameters with cirrus sd - oct show excellent long - term reproducibility. using an event - based analysis incorporating our own reproducibility data, the diagnostic sensitivities of gc - ipl measurements are similar to those of rnfl photographic assessment in the prediction of glaucomatous central vf progression. | purposeto investigate the use of ganglion cell inner plexiform layer (gc - ipl) thickness, as measured by spectral domain optical coherence tomography, to detect central visual field (vf) progression.methodsthis study included 384 eyes from 384 patients (219 preperimetric and 165 perimetric glaucomatous eyes ; average follow - up, 4.3 years). photographic assessment of retinal nerve fiber layer (rnfl) and serial vf analysis were performed to detect glaucoma progression in the central (within 10) area. study inclusion required at least five serial spectral domain optical coherence tomography exams at different visits. the long - term test - retest variability of average gc - ipl thicknesses was calculated in 110 stable preperimetric glaucomatous eyes. the sensitivity and specificity of gc - ipl measurements for the detection of central vf progression were calculated in an event - based analysis using the calculated variability as a cut - off and were compared with those of central rnfl photographic assessment.resultsthe intersession test - retest variability, defined as the 95% confidence interval, was 1.76 m for average gc - ipl thickness. the sensitivity and specificity of the average gc - ipl thickness for detecting central vf progression were 60.7% and 78.9%, respectively. among six sectors, the inferonasal gc - ipl sector showed the highest sensitivity (53.6%). the sensitivity of the 1 sector gc - ipl to detect central vf progression was significantly higher than that of central rnfl photographic progression (p = 0.013). other gc - ipl parameters showed comparable sensitivity and specificity to detect central vf progression compared with rnfl photographic progression.conclusionsserial gc - ipl measurements show comparable performance in the detection of central glaucomatous vf progression to rnfl photographic assessment. |
attention - deficit and hyperactivity - disorder (adhd) affects 58% of the worldwide childhood population, it has high comorbidity and it shares symptoms with other behavioral and emotional disorders (boyle., 2011 ; larson., 2011). adhd prevalence rates vary significantly between and within countries, and depend on the ascertainment method and criteria utilized. of particular concern is the marked variability in diagnostic rates of adhd in developed countries (getahun., 2013). this may reflect increased awareness of teachers and parents to symptoms of adhd in communities with a focus on education and adequate health care. however, even within communities there is marked variability in rates of adhd due to the subjective nature of primarily descriptive (symptom - based) diagnostic procedures (asherson., 2012 ; polanczyk., 2014 ; see also recent reports by the us center for disease control and prevention). such diagnostic heterogeneity and its poor reliability have hampered efforts to determine the pathophysiology of adhd (morgan., 2013). attempts have been made to find neuroimaging - based biomarkers of adhd using structural magnetic resonance imaging (johnston. 2013), resting - state functional mri (hoekzema., 2014 ; tomasi and volkow, 2014), fmri data acquired during a single cognitive task (hale., 2015 ; hart., 2014a ; hart., 2014b), or combinations of some of these techniques (anderson., 2014 ; these studies provide mixed insights regarding the possible underlying neurocognitive deficit of adhd, and they report moderate classification accuracies (rarely exceeding 80%), insufficient for clinical diagnosis. adhd is characterized by behavioral symptoms and multiple cognitive deficits associated with context dependent abnormal patterns of neural activity distributed across multiple brain regions. consequently, adhd is unlikely to be characterized by localized structural brain abnormalities robust enough to be detected using available structural imaging techniques. it is also unlikely that significant functional brain abnormalities characterizing adhd would be evident regardless of the mental state of the test subject, during the scan (castellanos and proal, 2012 ; hammer., 2015). key characteristics of adhd include poor working memory, greater reliance on external feedback, and abnormal reward processing. these are associated with altered patterns of activity in distinct brain networks : (i) attention and working memory, comprising the dorsolateral prefrontal cortex, parietal cortex and temporal cortices (burgess., 2010 ; ehlis., 2008 ; vance., 2007) ; (ii) executive functions and cognitive control (including feedback processing and response selection), comprising the dorsal, medial and ventral frontal cortices (booth., 2005 ; clark., 2007 ; sonuga - barke and fairchild, 2012) ; and (iii) reward - processing, comprising the orbitofrontal cortex, anterior cingulate cortex and basal ganglia (del campo., 2013 ; plichta. notably, there are substantial individual differences in reactions to reward and feedback manipulation in adhd (demurie., 2011 ;, 2015 ; hammer., 2015 ; plichta and scheres, 2014 ; van der schaaf., accordingly, we hypothesized that using fmri data from an ensemble of visuospatial working memory (vswm) tasks that differ in the motivational context (determined by the availability of reward and feedback) would increase the odds that abnormal patterns of brain activity would be reliably detected in a larger proportion of adhd cases. we expected this to enable more accurate detection of adhd cases than the accuracies obtained by using fmri data acquired from any single vswm task, or the accuracy based on the participant 's respective behavioral performance. given the central role of vswm in adhd, we compared fmri data from four distinct vswm tasks in boys with adhd and typically developed (td) boys. tasks differed in the availability of trial - by - trial feedback (feedback versus no - feedback) and the participant 's expectation for significant monetary reward (large versus small). all tasks required tracking the spatial location of letters while ignoring the letters ' identity, and executing timely responses. the manipulation of feedback and reward provided different motivational contexts, each requiring somewhat distinct executive skills found to be impaired in children with adhd. we used a multimodal analysis based on relatively few brain regions of interest, discovered using an independent univariate analysis (hammer., 2015 ; morris., 2012 ; mulligan., 2011 ; thoma and henson, 2011). using a sparse principal component analysis, we further reduced the number of variables that were provided as input to the classifier. this substantially limited the odds of discovering an overfitted adhd classification model, and simplified the interpretation of the discovered model. we used a logistic regression (lr) classifier, which directly models the class conditional probabilities for each case (i.e., calculating the predicted probability that a given child has adhd) by attempting to find a model allowing a decisive classification of as many cases as possible. this attribute is important in clinical settings where we aim to find a model that allows classification with confidence (nouretdinov., 2011). twenty boys with a diagnosis of adhd combined - type (mean age in years = 10.42 sd = 0.80) and 20 typically developed (td) boys (10.96 0.91) participated in the experiment. participants gave their informed consent (and parental consent) in accordance with the policies of the institutional review board (irb) at northwestern university. at the time of the fmri scanning session, adhd youth were weaned off stimulant medication for at least 24 h (12 participants used prescribed stimulants on a regular basis during the time they participated in this study). adhd diagnoses were based on exceeding the clinical cut offs on the adhd rating scale (dupaul., 1998) and the semi - structured diagnostic interview, the kiddie schedule for affective disorders and schizophrenia for school aged children : present and lifetime (k - sads - pl) version (kaufman., 1997). mean total adhd score was higher in the adhd group than in the td group (supplemental table 1). participants were excluded if they had been diagnosed with a neurological disorder or were treated medically for a comorbid psychiatric disorder. all participants were right - handed native english speakers with normal or corrected to normal vision. mean full - scale iq scores were within normal range in both groups, however the average iq in the adhd group was lower than the average iq in the td group (supplemental table 1), which is not uncommon in adhd studies (e.g., hart., 2014a). each task was 48 trials long. before and after each 2-back task the participant performed a fixation task where he was asked to press a key whenever the fixation - cross changed its color (which happened in 4/12 of the trials). e - prime 2.0 (psychology software tools, inc.) was used for stimuli presentation and for recording participants ' responses (for more details about the experimental design, see hammer., 2015). the two independent factors in the study were reward size (large - reward versus small - reward) and presence of trial - by - trial feedback (no - feedback versus feedback). in an earlier practice session, and at the beginning of the scanning session, each participant was instructed that the reward for each correct decision in the large - reward task was 10 times larger than in the small - reward task. in the trial - by - trial feedback task, each key - press was followed by either a green square (indicating a correct decision) or a red square (indicating an incorrect decision) presented in the center of the screen. in the no - feedback task, the participant was informed about his overall performance only after concluding the task (fig. 1). imaging data were acquired on a 3.0 tesla siemens tim trio scanner using a 12-channel head coil. a susceptibility weighted single - shot epi (echo planar imaging) method with bold (blood oxygenation level - dependent) was used for functional image acquisition with the following scan parameters : tr = 2000 ms, te = 20 ms, flip angle = 80, matrix size = 128 120, field of view = 220 206.3 mm, slice thickness = 3 mm (0.48 mm gap), and number of slices = 32 (an effective functional voxel size of 2 2 4 mm). a total of 145 images (trs) a high resolution, t1 weighted 3d image was also acquired with the following parameters : tr = 2300 ms, te = 3.36 ms, flip angle = 9 matrix size = 256 256, field of view = 256 mm, slice thickness = 1 mm, and number of slices = 160. the acquisition of the anatomical scan took approximately 9 min. prior to the scanning session children this enabled confirming that the participant is capable of keeping his head still for the duration of the scanning session. to minimize head movements in the scanner, gaps between the participant 's head and the head - coil data analysis was performed using mathworks matlab, spm8 (statistical parametric mapping, wellcome trust centre for neuroimaging, london, uk), and ibm spss. preprocessing involved : (i) slice timing ; (ii) realignment of all functional images to the 24th image. (iii) co - registration of the functional and anatomical images ; (iv) normalization of the t1 image to the mni305 template image, which is most commonly used also for analyzing fmri data of pediatric populations (e.g., burgund. (v) 4 4 8 mm full width half maximum (fwhm) gaussian kernel smoothing. (vi) we confirmed that movement was kept below 4 mm (in any of the x, y, or z dimensions) within a scan using the artrepair software. images (up to 9 per scan) were realigned in artrepair, using interpolated values from the two adjacent non - outlier images. for subsequent general linear model (glm) analyses, the excluded noisy images were deweighted. as reported in supplemental table 2, the two groups did not differ in patterns of head movements, and the replacement of outlier images primarily enabled reducing the signal to noise ratio in the fmri data of both groups. in order to further reduce within scan variability in neural activity, only trials in which the participant responded correctly (hit and correct rejection) were modeled, with onset time - locked to the beginning of each trial (calhoun. (vii) a high pass filter with a cut - off of 256 s was applied. structural and functional brain images were inspected and found not to have significant image artifacts. we confirmed that for each participant maximal head displacement (the distance between the two most distant fmri images within a scan) in all translational axes was no larger than the size of a voxel (i.e., 4 mm). there were no significant between - groups differences in any head translation or rotation axes, all p > 0.25 (supplemental table 2). we also confirmed that it is unlikely that head movements underlie the adhd classification results we got based on the brain activity data (supplemental fig. 1). feature detection was based on a univariate glm analysis, intended to identify functional brain regions of interest (frois) that showed significant activation or deactivation in all four vswm tasks, contrasted with all the fixation tasks, using the brain activity data of the adhd boys and td boys combined (total of 40 participants ; see chu., 2012 ; friston, 2012 for discussions regarding optimal sample size). we found eight frois showing significant activation (vswm > fixation) and eight frois showing significant deactivation (fixation > vswm). we used a voxel threshold of p 0.6 ; absolute weights > 0.1). loading rotation was based on the varimax rotation method (lu and zhang, 2012 ; ma, 2013 ; qi and luo, 2015 ; sjstrand., 2006). the use of this threshold resulted with 39 features (out of 64) affecting the first 10 pcs (pcs with eigenvalues > 2), where each feature affected a single pc (fig. the first 10 pcs explained approximately 70% of the variability evident in the original 64 features. each of the remaining pcs explained less than 3% of the variability in the data. interestingly, we found each one of the first 10 pcs to reflect brain activity from several rois from the same vswm task, but not brain activity in a specific roi in several tasks. the exception was pc-2, which was based on the left and right middle frontal gyri in the two vswm tasks without feedback. this supports our hypothesis that functional brain - imaging data from several distinct tasks is likely to add information useful for classification. for the learning of the adhd classification model the lr directly models the class conditional probabilities for each case, attempting to decisively classify as many cases as possible. a standard, 2013 ; ponce - alvarez., 2012) was used for finding which of the 10 pcs significantly contributed to classification accuracy. in each cross validation iteration the lr classifier was trained based on the fmri data of 39 participants, and then the goodness of fit of the learned model was evaluated based on the correlation between the clinician diagnosis of the left - out participant (adhd or td) and the lr classifier predicted adhd probability for this participant. the predictive power from all iterations was averaged to determine which of the 10 pcs are with statistically significant predictive power, and for estimating the predictive power of the final model. the reporting of a classification model based only on significant pcs has two advantages : (i) such a model is less likely to be overfitted or biased due to being based on too many predictors (pcs), and thus it provides a more conservative estimate of the classification accuracies that can be achieved with the data at hand and (ii) it further reduces the number of brain regions by which the two groups of interest (i.e., adhd vs. tds) differ, enabling a more parsimonious characterization of the differences in neurocognitive mechanisms between the two groups (see supplemental fig. 5 for an illustration of the data processing pipeline). running the lr with the leave - one - out cross validation showed a statistically significant contribution for adhd classification accuracies for only four pcs (pc-2, p 0.67) assigned to most adhd boys (75%), and low values (pp 0.67) in the 15 permutations were 24.5%, versus 77.5% of the adhd model, p = 0.000 (exact test), t(14) = 13.59, p 0.67) based on the fmri data from the small - reward with feedback vswm task was 60%, which is significantly lower (17.5%) than the four - task classification accuracy, p 0.67) assigned to only 50% of the adhd boys, and low values (pp < 0.33) assigned to only 65% of the td boys (fig. this accuracy level is significantly lower (20%) than the decisive classification accuracy based on the four significant pcs (based on four tasks), p < 0.04 (one - tailed fisher exact test). performance levels in the four tasks were highly correlated, where a boy that exhibited low performance in one task likely exhibited low performance in the other tasks. moreover, we found high correlations between the behavioral performances in the four vswm tasks and pc-2 (fig. that is, the brain activity represented by pc-2 (right and left mfg, tasks without feedback) explains much of the observed variability in the behavioral data. on the other hand, the behavioral performances had low correlations with pc-3, pc-4 and pc-8, hence the additional diagnostic information provided by these pcs to the classification model. feeding the lr classifier with both the behavioral and fmri data (10 pcs) resulted in exactly the same model as when feeding it with only the fmri data. we show that using a logistic regression (lr) classifier, which received as input brain imaging data that was acquired while children perform four distinct vswm tasks, enabled an adhd classification accuracy of 92.5% (fig. 3). classification accuracies that were based on the fmri data from all four tasks were significantly higher than those obtained using the fmri data from any single task. we found that the brain regions in which boys with adhd exhibited altered pattern of brain activity differed from one task to the other. the corresponding behavioral data from the four vswm tasks enabled an classification accuracy level of 75% (fig. 5), which is significantly lower than those obtained using the fmri data from the four tasks. participants who were misclassified based on the data from one vswm task were not necessarily misclassified when using the data from other vswm tasks (fig. when the lr classifier was fed with the pcs calculated based on the four vswm tasks together, we observed a substantial improvement in the classification accuracy (fig. this is consistent with the underlying theorem of ensemble - based classification (rokach, 2010 ; klppel., 2012). as expected based on this theorem, classifying participants by using several measurements for each participant (e.g., fmri data from few distinct vswm tasks), where each measurement enables a better than chance classification accuracy, and where there is a substantial degree of independency between the measurements (e.g., distinct cognitive tasks), enabled higher classification accuracies compared to accuracies achieved by using the data from each single measurement. our findings are with important theoretical contribution, providing additional support to the idea that the manifestation of neurocognitive abnormalities in adhd is context dependent (dovis. specifically, in the absence of trial - by - trial feedback, altered activity patterns characterizing adhd were most evident in the bilateral middle frontal gyri (mfg), specifically the right - mfg (see pc-2 weight in fig. 3 ; see feature weights in fig. the mfg is believed to play an executive role in the visuospatial working memory network, and a primary role in volitional (top - down) allocation of attention (burgess. we found that in vswm tasks without feedback, boys with adhd exhibited lower levels of activity in the mfg as compared with td boys. this may indicate poor vswm and poor capacity in allocating attention to target stimuli in children with adhd, manifested when feedback is absent (see cortese. the fmri data from the small - reward with feedback vswm task also had a considerable contribution to adhd classification (pc-8 and pc-3 ; fig. 3 ; fig. here, boys with adhd exhibited altered brain activity in a network (pc-8) that primarily included the bilateral orbitofrontal cortex (bi - ofc) and the left fusiform gyrus (left - ffg). the ofc has been reported to play two primary roles that have potential relevance to the current task : together with the inferior frontal gyrus, the anterior insula, the superior temporal cortex and the temporoparietal junction, the ofc is part of the ventral attention network, acting as a bottom - up saliency detection system determining subjective and context - dependent susceptibility to unexpected salient stimuli (corbetta., 2008 ; the ofc was also found to be involved in the processing of reward - related information (schoenbaum and roesch, 2005 ; pauli., 2012). it is suggested that the ofc is involved in monitoring which recent actions were rewarded, and predicting which future actions are most likely to be rewarded (kahnt., 2010). the left - ffg was found to be involved in letter identification and reading (mccandliss., 2003 ; dehaene and cohen, 2011 ; mcnorgan., 2013 here we found greater deactivation in these two brain regions in td boys, as compared to boys with adhd, primarily in the small - reward with feedback vswm task. this may indicate that boys with adhd fail in suppressing task irrelevant information (letter identity in a task that requires monitoring the spatial location of letters, and visual feedback indicating insignificant reward). the features with significant loadings on pc-3 (small - reward with feedback) were the two frois in the right medial / superior prefrontal gyrus (right - mefg- and right - mefg+, fig. 2b), the left - mfg, the right superior temporal gyrus (right - stg), the right anterior insula (right - antins), and the right supramarginal gyrus. these brain regions are involved in feedback processing (ferdinand and opitz, 2014), bottom - up attention and in sensory integration (prado. the loadings on pc-3 (and pc-8), indicate that in the small - reward with feedback condition children with adhd are likely to exhibit altered suppression of irrelevant visual features (ffg), altered visuospatial processing (precuneus), altered sensory integration (stg and supramarginal), altered bottom - up attention control (ofc), altered feedback processing and top - down attention control (mefg and mfg), and altered synchronization between bottom - up and top - down attention control (antins). the fmri data from the large - reward with feedback vswm task had the smallest contribution to adhd classification (57.5% accuracy, with only a trend toward a significant model fit ; fig. altered activity in adhd in this vswm task was evident in pc-4 (fig. 3), which included the right inferior parietal lobe (right - ipl), the right - antins, the right - mefg (the activated right - mefg froi ; see fig. 2) and the right precuneus. these frois partially overlap (right - antins and right - mefg) with those included in pc-3 (small - reward with feedback). this implies that the right - antins and right - mefg are associated with altered feedback processing in adhd (regardless of reward expectation). this is consistent with earlier findings showing that the right - antins and the right - mefg (together with the anterior cingulate) mediate between the central executive network and brain regions involved in risk / gain prediction, where response selection is required (menon and udin, 2010 ; preuschoff., 2008 ; early studies showed that children with adhd exhibit poor cognitive control associated with lower levels of neural activity in the anterior insula, as compared with tds (cubillo. we show that using fmri data from four distinct vswm tasks enabled substantially better classification accuracies than the use of fmri data from a single vswm task. nevertheless, the current investigation was limited to the manipulation of feedback and reward in vswm tasks, where many characteristics of the four tasks were identical. it is possible that an even better adhd classification can be achieved by using other, perhaps more demanding cognitive tasks that require other cognitive skills impaired in adhd (e.g., tasks with specifically greater response inhibition demands ; booth., 2005 ; rubia., 2005 moreover, the duration of each vswm task we used here was 48 trials long (~100 s). it is possible that these tasks can be shortened (e.g., reduced to 32, or even fewer trials) without compromising classification accuracies. as part of the development of a practical diagnosis tool, future investigations should aim to identify an optimized ensemble of cognitive tasks that would yield the highest classification accuracies in the shortest scanning time possible. future investigation may also involve looking for an ensemble of tasks that enable differentiation between children with adhd from other clinical populations, with shared symptoms. the use of multi - task - based fmri data may also enable earlier diagnosis of adhd, prior to the onset of clear behavioral symptoms, which in turn may enable earlier intervention. in order to be of practical clinical use, task - based fmri diagnosis requires the scanned participants to accurately perform a cognitive task while keeping still throughout a relatively long scan. thus, a multi - task - based fmri diagnosis session may not be practical for very young children or individuals with severe cognitive deficits. however, mild adhd and moderate adhd are much more common and represents more of a diagnostic dilemma for clinicians. in contrast, severe or very early onset adhd would likely have a more distinct etiology. future developments should ideally involve an integrative use of multi - task - based fmri, resting - state fmri and structural imaging. this would likely enable an effective diagnosis of most clinical cases, and the detection of the onset of some clinical condition in early childhood. ideally, future imaging - based diagnostic tools may enable finer differentiation of adhd subgroups, assisting clinicians in customizing intervention. it is likely that similarly high (or even higher) classification accuracies can be achieved by using other machine - learning based classification methods. future studies should specifically explore machine - learning methods based on whole brain data, from multiple tasks, which automatically detect brain regions in which the targeted clinical population exhibits abnormal patterns of brain activity (e.g., ryali. we show that fmri data acquired while participants perform a few distinct cognitive tasks enables substantial improvement in the detection of adhd cases, as compared with the use of fmri data from a single task (or corresponding behavioral data). showing that fmri data enables better classification accuracies than the corresponding behavioral data suggests that even adhd cases that exhibited normal - like vswm performance were likely to be characterized by substantially altered pattern of brain activation. this provides a proof - of - concept that scanning subjects while they perform an ensemble of distinct cognitive tasks is likely to payoff, enabling greater accuracies and higher confidence diagnosis of clinical cases. we suggest that this approach can be used for diagnosing other clinical populations, and possibly also for dissociating between distinct clinical populations who share behavioral symptoms. this would require using cognitive tasks that target the neurocognitive deficits characterizing the clinical condition of interest, or a battery of tasks that may enable dissociating between distinct neurocognitive abnormalities. | finding neurobiological markers for neurodevelopmental disorders, such as attention deficit and hyperactivity disorder (adhd), is a major objective of clinicians and neuroscientists. we examined if functional magnetic resonance imaging (fmri) data from a few distinct visuospatial working memory (vswm) tasks enables accurately detecting cases with adhd. we tested 20 boys with adhd combined type and 20 typically developed (td) boys in four vswm tasks that differed in feedback availability (feedback, no - feedback) and reward size (large, small). we used a multimodal analysis based on brain activity in 16 regions of interest, significantly activated or deactivated in the four vswm tasks (based on the entire participants ' sample). dimensionality of the data was reduced into 10 principal components that were used as the input variables to a logistic regression classifier. fmri data from the four vswm tasks enabled a classification accuracy of 92.5%, with high predicted adhd probability values for most clinical cases, and low predicted adhd probabilities for most tds. this accuracy level was higher than those achieved by using the fmri data of any single task, or the respective behavioral data. this indicates that task - based fmri data acquired while participants perform a few distinct vswm tasks enables improved detection of clinical cases. |
clear cell carcinoma (ccc) is a low grade malignant neoplasm representing approximately 1% of all salivary gland tumors. the differential diagnosis of clear cell salivary neoplasms encompasses a broad range of possibilities, including primary salivary clear cell tumors, such as ccc, epithelial - myoepithelial carcinoma (emec), and clear cell myoepithelial carcinoma (ccmec), as well as clear cell variants of other salivary tumors, including acinic cell carcinoma, oncocytoma and mucoepidermoid carcinoma. metastatic tumors such as renal cell carcinoma or balloon cell melanoma are also a consideration.[24 ] a female 88-year - old, presented with a gradual painless mass of 2 months duration in the right parotid region. there was no history of tumor elsewhere and her medical history was non - contributory. on palpation, a painful non - tender mass of about 3 cm was found. the analysis showed hypercellularity with large cells having enlarged nucleus and also multinuclear cells with a prominent and large nucleolus. computed tomography (ct) scan showed a 2.8 1.7 cm solid poorly defined mass in the superficial lobe of the right parotid gland that hinted in the deep lobe [figure 1a ]. moreover, the mass was intensely and homogeneously enhanced with contrast and the structural appearance was that of a solid lesion of parenchymatose consistency with colliquative necrosis in the central areas. the cervical ct also revealed the presence of one metastatic cervical node with deep soft tissue and skin extension. (a) cervical ct showing a 2.8 1.7 cm solid poorly defined mass in the superficial lobe of the parotid right gland, (b) full body ct (abdominal section) ruling out a renal tumor on the suspicion of a ccc, a full body ct was performed to rule out a renal tumor or metastasis, but it failed to show pathological results [figure 1b ]. a diagnosis of primary ccc was thus made. modified functional neck dissection and radical parotidectomy with resection of the facial nerve the neck dissection included sternocleidomastoid muscle, spinal nerve and internal jugular vein, because they all were affected by the mass. (a) preoperative photograph of the tumor, (b) intra - operative photograph showing the area after modified funcional neck dissection and radical parotidectomy histology disclosed a non - encapsulated well defined tumor, though it had some infiltrating areas [figure 3a and b ]. the mass was totally composed of cells with round central nucleus and abundant clear cytoplasm [figure 3c ]. areas without clear cells were not observed. additionally, one of the 34 isolated neck nodes was positive. gross photopraph showing a well - circumscribed, grey - white tumor in the parotid parenchyma, (b) surgical specimen - cut surface (c) photomicrograph showing sheets of clear cells separated by hyalinized stroma (h and e, 400), (d) tumor cells negative for glycogen and mucin (pas, 400), (e) carcinoembryonic antigen stain (200), (f) cd10 inmunoreactivity (400) tumor cells were negative for glycogen and mucin [figure 3d ]. immunohistochemical stains revealed that the tumor cells were positive for high - molecular - weight cytokeratins, carcinoembryonic antigen (cea) [figure 3e ] and epithelial membrane antigen (ema) and were negative for low - molecular - weight cytokeratins (cam 5.2 and ae3), vimentin, s-100 protein, ck (cytokeratin) 7 and ck20. a posterior immunohistochemical study revealed that the tumor cells were positive for cd 10 (cluster of differentiation) [figure 3f ], which suggested the possibility of metastasis of renal clear cell adenocarcinoma. the patient underwent postoperative radiotherapy and she was free from local or distant disease during 4 years of follow - up. unfortunately, in 2011, an abdominal ct disclosed metastatic disease in the right lung, however no additional treatment was performed due to old age and poor health. this tumor has a female preponderance and a median age in the sixth and seventh decades of life. this low - grade malignant tumor of putative duct cell origin is composed exclusively of a monomorphic population of undifferentiated cells that have optically clear cytoplasm but lack features that would allocate them in any of the specific categories. malignant neoplasms account for 15 - 35% of all parotid gland tumors ; 21 - 42% of those correspond to metastatic processes. most metastatic tumors of the salivary glands proceed from lesions of the head and neck and consist of melanomas in 45% of cases and squamous cell carcinomas of the skin in 37%. only a small percentage arises from distant sites such as the lung, breast, kidney, gastrointestinal tract, and prostate. tumors composed exclusively of or predominantly of clear cells are infrequent in the parotid gland, representing only 1 - 2% of all salivary gland tumors, originating also in other areas, including normal or aberrant gland tissue. clear cells in these lesions most often result from artifacts of fixation, but in some instances, they may be a reflection of peculiar functional states of the tumor cells. a scarcity of organelles, glycogen storage, and accumulation of mucins, lipids, tonofilaments, and immature zymogen granules also may account for this appearance. primary salivary clear cell neoplasms can be divided into those that diagnostically require evidence of myoepithelial differentiation (i.e., ccmec and emec) and those that do not (i.e., ccc). most of these tumors have been reported as sporadic cases with the exception of a few well - documented series of either emec or ccc, and to our knowledge, myoepithelial differentiation has not been documented in ccc till date. ccc is a classic and distinct entity that represents the latter differentiation pathway. by definition, ccc contains a significant proportion of clear cells, but it does not fit into any other recognized neoplastic entities. although non - lipid and non - mucin, but glycogen rich clear cell tumors in salivary glands have long been recognized, they were only recently included in the third who (world health organisation) classification as a distinct low - grade carcinoma. the who classification of salivary gland tumors does not define a specific category for clear cell tumors and only indicates that the presence of clear cells is a feature common to the various neoplastic formations originating in that site. the natural course is an indolent, painless mass that occurs predominantly in the minor salivary glands. the biological behavior is not very aggressive and development, which is very slow, is usually asymptomatic and indeed, the tumor often reaches considerable dimensions before being diagnosed. when clear cells predominate, a definitive diagnosis may be problematic because many of these tumors will share common histologic features. indeed the histopathologic finding of a malignant clear cell tumor in a parotidectomy surgical specimen involves the necessity of differential diagnosis between clear cell primary parotid tumors and metastases. carcinomas from the kidney, liver, large bowel, prostate and thyroid are known to have the potential for clear cell differentiation and all of them are able to metastasize to the maxillofacial area with renal cell carcinoma doing so most frequently. classically, the differential diagnoses of clear cell tumors in the parotid area includes mainly clear cell variants of primary tumors such as clear cell myoepithelial carcinoma, clear cell emec, clear cell acinic cell carcinoma, clear cell adenocarcinoma of salivary glands and hyalinizing ccc. also clear cell mucoepidermoid carcinoma, clear cell oncocytoma and clear cell odontogenic tumors need to be ruled out [figure 4 ]. immunohistochemical evaluation is essential in distinguishing these tumors, but its sensibility and specificity is occasionally not enough to confirm the diagnosis. some authors consider that definite differentiation between ccc and metastatic renal clear cell adenocarcinoma in the salivary gland is often impossible by pathologic studies alone and requires clinical evaluation to rule out a primary renal tumor. ihc : immunohistocheimstry, em : electron microscopy, lm : light microscopy ccc of salivary glands usually expresses epithelial markers (cytokeratins, ema, and cea) but lacks expression of myoepithelial markers (s-100 protein, actin, vimentin, and glial fibrillary acid protein). immunohistochemical staining in renal clear cell adenocarcinoma shows complete negativity for high - molecular - weight cytokeratin and weak and moderate patchy staining for low - molecular - weight cytokeratin (cam 5.2) in more than 80% of the cases. it also stains strongly for ema and vimentin and it is negative for actin, s-100, glial fibrillary acid protein, and cea. recently, cd10 immunoreactivity was observed in 90% to 94% of the cases of renal ccc, which permits more specificity in the histopathologic diagnosis. cd10 is a cell membrane associated neutral endopeptidase, also known as enkephalinase, calla, and ec3.3.24.11, that plays a physiological role in degrading biologically active peptides, including those implicated in autocrine growth stimulation of certain cancers. clear cell myoepithelial carcinoma shows sheets of clear cells sometimes admixed with spindle shaped and other myoepithelial cells. these cells are positive for cytokeratins, s-100 and actin (alpha smooth muscle actin). the tumor cells are also positive for glycogen. clear - cell variants of acinic cell carcinoma are usually never pure and cells with periodic acid schiff positive and diastase resistant cytoplasmic zymogen granules are also present. sebaceous neoplasms are positive for fat stains and clear cell mucoepidermoid carcinomas show positivity for mucin. metastatic renal cell carcinomas are positive for both fat and glycogen and immunohistochemically positive for vimentin and cd10. because of the lack of awareness, ccc is often misdiagnosed as poorly differentiated carcinoma, squamous cell carcinoma, acinic cell carcinoma, mucoepidermoid carcinoma and emec. wide excision is the treatment of choice for most ccc, although neck dissection and radiotherapy have been performed in some cases. the decision to include node dissection or radiotherapy is generally based on the presence of positive margins, high - grade histology, invasion (vascular / neural) or positive neck nodes. while these prognostic factors also apply to ccc, an additional factor correlated with nodal metastasis is the presence of mitotic activity. patients may develop multiple recurrences up to two decades after resection and tends to occur at intraoral sites (65%). it is generally considered that definite differentiation between clear cell primary tumors of parotid gland and metastatic clear cell renal adenocarcinoma in the same location is quite difficult. the importance of the correct diagnosis lies in the possibility of localizing the primary tumor and treating it adequately. although cccs in the parotid region are rare, when the histopathologic study demonstrates a clear cell epithelial tumor in this area, primary ccc should come to mind as one of the main possibilities, besides metastatic renal clear cell adenocarcinoma and a thorough clinical and radiological examination will help us to arrive at the right diagnosis. | clear cell carcinoma (ccc) is a rare low - grade carcinoma that represents only 1% to 2% of all salivary glands tumors. the finding of a clear cell tumor in a parotid gland involves the necessity of differential diagnosis between primary clear cell parotid tumors and metastases, mainly from kidney. the biological behavior is not very aggressive and development, which is very slow, is usually asymptomatic and indeed, the tumor often reaches considerable dimensions before being diagnosed. the treatment of choice is the surgical excision. there are rare cases of local recurrence and distant metastases. the aim of this article is to report a primary ccc in the parotid gland that microscopically closely resembled a metastatic ccc of renal origin, making microscopic differentiation difficult. |
in rhegmatogenous retinal detachment, the neurosensory retina becomes separated from the underlying retinal pigment epithelium (rpe), resulting in many biochemical and structural changes [14 ]. morphological studies provide evidence that the most obvious detachment - induced damage within the neurosensory retina is shortening of the outer segments and gradual death of the photoreceptor cells [57 ]. this triggers a complex process of photoreceptors recovery that can lead to partial or even complete restoration of vision. the animal studies have demonstrated that healing is achieved by at least partial reconstruction of the outer segments of rods and cones. the process is characterized by wide individual variation and depends strongly on the duration of detachment. although complete restoration of the retinal structure has not been achieved, a modified version of the photoreceptor - rpe complex was established with significant variations in outer segment length and orientation. studies based on animal models have also demonstrated that remodeling of the outer segments varies in intensity depending on the retinal area that is being remodeled. the restoration of photoreceptor outer segments has been recently confirmed in vivo in humans using spectral domain optical coherence tomography (sdoct). the hyperreflective band corresponding to the junction of photoreceptor inner and outer segments (is / os) was observed in 5% of eyes at one month and in 50% of eyes 6 months after surgery. postoperative visual acuity correlated with a restored is / os line. however, the detailed dynamics of this process in relation to the particular macular areas is still unclear. the purpose of this study is to analyze topographically photoreceptor outer segments recovery process in patients after pars plana vitrectomy for retinal detachment using sdoct. the medical records of the patients who underwent pars plana vitrectomy for rhegmatogenous macula - off retinal detachment at the department of ophthalmology, nicolaus copernicus university, between january and june 2010 were reviewed. the inclusion criteria were as follows : successfully treated retinal detachment involved macula and two to four fundus quadrants, minimal number of four control visits during at least one year of follow - up. exclusion criteria were as follows : high myopia, preexisting macular pathologies (e.g., macular hole or epiretinal membrane), and proliferative vitreoretinopathy stage c involving more than two hours. the eyes with the presence of any residual subretinal fluid in postoperative sdoct exam were also excluded from the study. all patients underwent a pars plana vitrectomy with gas tamponade (sf6, c2f6, or c3f8). in each case the study protocol was approved by an ethics committee of nicolaus copernicus university. during follow - up visits patients underwent complete ophthalmic examination, including best - corrected visual acuity (bcva) and fundus biomicroscopy. the first control visit was performed between the second and fourth weeks after surgery shortly after gas absorption. the third visit was between 24 and 48 weeks and the fourth one between 48 and 72 weeks after surgery. sdoct of the macula was performed during each visit (soct copernicus, optopol, poland, or rs-3000 nidek, japan). fifty - two to 64 horizontal scans of 6.0 mm length were performed, each consisting of 1024 lines. the reflectivity of the is / os line in central cross section running through foveolar center was evaluated independently by two oct experts (jjk, bls) according to the following subjective grading scale : grade 0 : lack of the is / os line, grade 1 : the reflectivity of the is / os line similar to the reflectivity of external limiting membrane (elm), grade 2 : the reflectivity of the is / os line higher than the reflectivity of elm but lower then that of rpe (intermediate reflectivity), grade 3 : the reflectivity of the is / os line similar to that of rpe. the central one was foveola recognized as a flat retinal surface of 300 m in diameter in the center of foveal depression. the region located between the border of the foveola and the margin of foveal slope from nasal side was called nasal fovea and the corresponding region from temporal side was temporal fovea. both of them have diameter of 600 m. parts of the retina located outside fovea was named nasal and temporal parafovea (figure 1). additionally, in eyes examined by the rs-3000 the en face reflectivity maps at the level of the is / os were created in automatic fashion using commercially available software. this facilitated evaluating the reflectivity of this layer throughout the entire examined area. to evaluate statistical relationship between the grade of the is / os reflectivity and the retinal topography, the follow - up time, and the type of the used intraocular gas the chi - square test was used. correlation between bcva and the is / os reflectivity was evaluated using spearman 's coefficient. statistical analysis demonstrated good agreement between observers in evaluating the degree of the is / os reflectivity. the differences of the average grade in subjective scale were not statistically significant in any follow - up period. in all eyes the gradual process of at least partial restoration of normal is / os reflectivity was observed. the average is / os reflectivity grade within five topographical regions in the central sdoct cross section in relation to the elapsed time since surgery is displayed in table 2. at the first follow - up visit (between the second and fourth week after surgery) the average reflectivity of the is / os line calculated in all 5 regions together was 1,05. the is / os line had very similar reflectivity along the entire scan in all eyes except 9 in which the increase in reflectivity to grade 2 or 3 was observed in peripheral part of central cross section. at the second follow - up visit (between the fourth and twelfth week after surgery) grade 0 appeared only in 3,33% of evaluated regions. the most significant increase in reflectivity was observed in temporal and nasal parafovea with average values of 2,17 and 2,22, respectively. sdoct exam performed during the third follow - up visit (between 24 and 48 weeks after surgery) showed further improvement in is / os appearance with the average reflectivity grade reaching value of 2,19. when compared to the second follow - up visit, the third region, except peripheral parts of the scan, of average is / os reflectivity higher than grade 2 appeared. it was foveola with the average reflectivity of 2,33. at the last follow - up visit (between 48 and 72 weeks after surgery) in all 5 regions of the central cross section the is / os reflectivity exceeded grade 2 reaching the highest average values in nasal and temporal parafovea and foveola. statistical analysis confirmed that the grade of the is / os reflectivity during all follow - up visits except the first one was significantly related to the topographical regions of the central cross section. the process of restoration of the is / os reflectivity started in peripheral part of the central scan and was followed by the improvement of the is / os visibility in centrally located foveola with persistent areas of reduced reflectivity in nasal and temporal fovea. in majority of eyes the process of the is / os line restoration was symmetrical but in 30% of them the increase in the reflectivity was initially observed either in temporal or in nasal side of the scan. the opposite part of is / os band located between foveola and parafovea got normal reflectivity in the later follow - up or remained unchanged. three eyes during final visit had highly reflective is / os layer in parafovea, foveola, and temporal part of the fovea with area of reduced reflectivity in nasal fovea. in one eye the normal is / os reflectivity returned in nasal part of the scan (figure 2). the above described changes are also visible on en face reflectivity maps (figure 3). they show that the areas of normal is / os reflectivity initially appear in peripheral macula. another small area of normal reflectivity is usually located in the center of the fovea. the maps made six months later reveal that the size of areas with increased reflectivity enlarged. as a result, peripheral and central areas of increased reflectivity approach each other, leaving only a small part of the macula with reduced reflectivity. low grade of reflectivity at the first follow - up visit was related to an average bcva of 0.19. eyes with partial recovery of is / os reflectivity at the second and third control visit had average bcva of 0,37 and 0,49, respectively. the correlation between bcva and the grade of the is / os reflectivity was statistically significant (p < 0.0001 ; spearman cc = 0,63). statistical analysis revealed that the type of intraocular gas used during the surgery had no influence on the level of the is / os reflectivity. after a vitrectomy for macula - off rhegmatogenous retinal detachment that ends up with retinal reattachment the gradual change in reflectivity of the is / os line can be observed. this process typically starts independently in the peripheral and central macula and can last more than a year, often leading to a complete restoration of nearly normal is / os appearance. because of a significant difference in the refractive index present within photoreceptor cells, the is / os line is clearly visible on sdoct in healthy eyes. it is noteworthy that recent data suggest better correlation of this hyperreflective line with photoreceptor ellipsoid zone rather than the junction between the inner and outer segments. its unchanged appearance is often used in research as a marker of normal photoreceptor morphology. the abnormal is / os reflectivity was observed in patients after surgical treatment of macular holes, epiretinal membranes, and diabetic macular edema [1113 ]. published reports have also demonstrated photoreceptor defects in patients after surgically treated retinal detachment [1416 ]. the defects were present in 76% to 83.3% of eyes within 3 to 7 months postoperatively, regardless of the performed procedure. in cases in which the mean time since the surgery was 23.1 months, photoreceptor defects were present in 53.3% of eyes. some authors point out that the is / os reflectivity can change over time, which may suggest some potential for tissue regeneration. similar changes have been described in the course of the natural healing process of such macular diseases as multiple evanescent white dot syndrome as well as in patients with surgically treated full - thickness and lamellar macular holes [1921 ]. shimoda. reported a reduction of the proportion of eyes with is / os abnormalities from 55% to 17% between the first and sixth postoperative months among patients in whom vitrectomy was performed because of retinal detachment, which may suggest gradual restoration of the outer photoreceptor segments. the regeneration process of the retina has been described based on an animal model, which was used to analyze the microscopic changes that occur after retinal reattachment. the results revealed that the length of the outer photoreceptor segments gradually increases depending on the duration of retinal detachment and time since reattachment. the strongest regeneration was observed in eyes with the shortest detachment time and the longest interval between the reattachment and the morphological examination. the authors also noted large discrepancies in the degree of regeneration among specific retinal regions. moreover, the study demonstrated that the cone and rod regeneration processes differ. in cone regeneration, the topographic variability of changes in reflectivity patterns observed in our study may be associated with the differences between the cone and rod regenerative processes. the processes leading to increased reflectivity of the is / os start within the peripheral macula, where rods predominate, and gradually shift toward the center. at the same time, hyperreflective areas begin to appear within the central fovea, where only cones are present. the observed regeneration processes are very individualized and do not always lead to complete is / os restoration. they can stop at any stage, resulting in abnormal reflectivity of the is / os junction and decreased visual acuity. our study shows that sdoct can visualize gradually increasing is / os reflectivity in patients with retinal detachment that has been successfully treated with vitrectomy. this process is not random and follows different patterns within the central and peripheral macula which may be attributed to the variable regenerative potential of cones and rods. | purpose. to evaluate the spatial distribution of photoreceptor inner and outer segment junction (is / os) reflectivity changes after successful vitrectomy for macula - off retinal detachment (ppv - moff) using spectral domain optical coherence tomography (sdoct). methods. twenty eyes after successful ppv - moff were included in the study. during a mean follow - up period of 15.3 months, sdoct was performed four times. to evaluate the is / os reflectivity a four - grade scale was used. results. at the first follow - up visit the is / os had very similar reflectivity in entire length of the central scan with total average value of 1,05. at the second visit the most significant increase of the reflectivity was observed in temporal and nasal parafovea with average values of 2,17 and 2,22, respectively. the third region of increased reflectivity of an average value of 2,33 appeared during the third follow - up visit and was located in the foveola. at the last follow - up visit in entire central cross section the is / os reflectivity exceeded grade 2 reaching the highest average values in nasal and temporal parafovea and foveola. conclusions. a gradual increase of the is / os reflectivity was observed in eyes after ppv - moff. the process is not random and starts independently in the peripheral and central part of the macula which may be attributed to the variable regenerative potential of cones and rods. |
for almost a century, drug discovery was driven by the quest for magic bullets, which act by targeting one critical step in a disease process and elicit a cure with few other consequences. however, this concept is far from biological reality, and even the most successful rationally designed drugs (such as gleevec) show a quite promiscuous binding behavior, which has opened novel therapeutic possibilities. today, the emerging picture is that drugs rarely bind specifically to a single target, and this challenges the concept of a magic bullet. indeed, recent analyses of drug and drug - target networks show a rich pattern of interactions among drugs and their targets, where drugs acting on a single target seem to be the exception. drug - repositioning strategies seek to exploit the notion of polypharmacology, together with the high connectivity among apparently unrelated cellular processes, to identify new therapeutic uses for already approved drugs. the main advantage of this approach is that, since it starts from approved compounds with well - characterized pharmacology and safety profiles, it should drastically reduce the risk of attrition in clinical phases. there are several successful examples of drug repositioning (for example, thalidomide to treat leprosy or finasteride for the prevention of baldness), although they were all found by serendipity and are not the result of well - thought strategies. more recently, and following the observation that most novel entities are found by phenotypic profiling techniques, systematic initiatives to find new indications for old drugs have flourished. these approaches rely mostly on genome - wide transcriptional expression data from cultured human cells treated with small molecules, and pattern - matching algorithms to discover functional connections between drugs, genes and diseases through concerted gene - expression changes. however, unfortunately, pre - clinical outcomes often do not correlate with therapeutic efficacy ; only approximately 30% of the compounds that work well in cell assays work in animal models and, of these, only 5% work in humans. being aware of the efficacy gap between pre - clinical and clinical outcomes, bork and collaborators presented, in 2008, a strategy to link precise molecular data with phenotypic observations. in their seminal work, they established and catalogued the relationship between drugs and side - effects observed in clinical phases, and exploited this information to identify shared target proteins between chemically dissimilar drugs. sharan and colleagues built on these molecule - phenotype relationships to develop drug - drug and disease - disease similarity measures that they used to train a machine learning algorithm for inferring novel indications to drugs under development, with potential applications in future personalized medicine. in a recent article published in plos one, yang and agarwal present a computational method that systematically explores novel potential applications of already marketed drugs in distinct therapeutic areas (for example, suggesting an antidiabetic effect for an anticonvulsant drug). the rationale behind their approach is that drugs sharing a significant number of side - effects should also have, to some extent, a common mechanism of action. in a way, the side - effect becomes a type of phenotypic biomarker for each particular disease. the authors then compiled a list of all known drug - disease and drug - side - effect relationships to build disease - specific side - effect profiles and explored the possibility of using these links as hints to suggest novel indications for drugs sharing the same profiles, but prescribed within different therapeutic areas. approximately 4% of the 84,680 disease - side - effect associations investigated (that is, 145 diseases and 584 side - effects) were found to be informative, and some handpicked examples indicate a common mechanism of action for the drugs with similar side - effect profiles. the approach has also been used to predict safety indications and suggest mechanisms of action for compounds in clinical development phases. in this case, because the precise safety indications are far less clear, the method had to predict side - effect profiles for each novel compound with a structure - activity relationship approach, including an extra level of uncertainty. as expected, the applicability and accuracy observed in this case are lower than those achieved for marketed drugs with more precise side - effect information. fifty years ago, drug discovery was mostly driven by the phenotypical response to the assayed molecules observed in animal models. however, in the early 1980s, owing to the success of molecular biology, the criteria for evaluating the potential of a novel compound shifted from a strict physiological observation to a molecular one, where the best lead chemicals were those that bound strongly to the target protein and had a good specificity profile. retrospectively, in most cases this selection strategy was an enormous mistake, because it attempts to predict the behavior of a complex system, with many and varied emerging properties at each level (that is, molecular, cellular and systemic) from its constituent components in isolation. as a shortcut to bridge molecular and clinical observations, many cell - based and functional assays in animal models have been developed, but unfortunately making inferences from one complexity level to another is often inaccurate, as shown by the attrition rates in drug discovery pipelines. analogously, repositioning strategies that rely on chemical structures of drugs (that is, molecular level), or their protein targets and cellular responses (that is, pre - clinical level) are also bound to suffer from the same problems (figure 1). the drug repositioning strategy presented by yang and argawal is almost exclusively based on clinical observations, without relying on data collected in different complexity levels, and thus should be able to overcome some of these limitations. bridging the levels of biological complexity. the left half of the scheme represents the association between drugs and their therapeutic effects measured with different assays. captured biological side - effects are on the outer level and constitute a signal of similar complexity to the therapeutic effect. pre - clinical experiments such as disease - gene associations or gene - expression profiles provide biomolecular rationale for a disease, but the underlying mechanism of action (moa) upon treatment can only be proposed as a complement. finally, a structure - activity relationship (sar) does not embrace biological understanding because the therapeutic outcome is ciphered within the molecular structure alone. all this information is used in the right half to guide drug repositioning, where candidates are screened correspondingly. arrows crossing biological complexity levels imply functional inferences not necessarily supported by the assay design. although the idea of using drug - specific side - effect profiles to suggest novel indications, as shown by yang and agarwal, presents an attractive alternative to skip the uncertainties of traveling between molecular and clinical observations, there are several aspects that new implementations will have to address. the most important one is, undoubtedly, the need to consider the expected different frequencies of therapeutic and adverse effects in the population. whereas therapeutic effects are supposedly the result of interfering with molecules or processes central to the pathological process and common to most individuals, this could be related to the doses or the modes of administration of the drugs considered, in which case the issue could be easily addressed, although higher doses or a distinct formulation might also elicit novel undesired effects. however, some side - effects are possibly caused non - specifically by the chemical compound itself, or its degradation by - products, independently of any mechanism of action or the targets it binds, hampering the main hypothesis behind the study. future improvements of the method should focus on those side - effects directly related to target proteins shared between the therapeutic indication and the side - effect, and will profit from the availability of information about doses, biodisponibility, and so on, to investigate further whether the mechanism of action is indeed the same, and would certainly improve the accuracy of the predictions. given the crisis in the pharmaceutical industry arising from the lack of new molecules, drug repositioning seems a valid option to get the most out of the safe compounds that are already approved, and novel strategies to search rationally for new indications for old drugs are already flourishing. however, all current approaches rely on a very limited set of data available for a few hundreds of compounds on the market, and would greatly benefit from the vast amount of clinical data accumulated by the pharmaceutical industry in pre - clinical and clinical phases. we understand their fear that releasing these data could reveal unexpected side - effects for approved or experimental products, but it could also provide interesting opportunities to rescue abandoned compounds that showed low efficacy in clinical trials. this work was partially supported by the spanish ministerio de ciencia e innovacin (bio2010 - 22073) and the european commission under fp7 grant agreement 223101 (antipathogn). | side - effects are the unintended consequence of therapeutic treatments, but they can also be seen as valuable read - outs of drug effects in humans ; these effects are difficult to infer or predict from pre - clinical models. indeed, some studies suggest that drugs with similar side - effect profiles may also share therapeutic properties through related mechanisms of action. a recent publication exploits this concept to systematically investigate new indications for already marketed drugs, and presents a strategy to get the most out of the tiny portion of chemicals that have proved to be effective and safe. |
microbial adhesion takes place on all natural and man - made surfaces (1) and poses considerable threats in food processing, drinking water systems, and human health to mention a few. these threats are not always associated with adhering organisms, but often with their detachment causing contamination elsewhere. in human health for instance, contact lens - related microbial keratitis is caused by bacterial adhesion to and detachment from the contact lens case to the contact lens onto the cornea (2). in food processing, pasteurized milk can become bacterially recontaminated by detachment of thermoresistant streptococci from heat exchanger plates in the downward, cooling section of pasteurizers (3). bacterial detachment occurs through a viscoelastic failure model (4), and oral biofilm left behind after toothbrushing has been found to possess expanded bond lengths between adhering bacteria due to viscoelastic deformation (5). although more prominently demonstrated for bacterial detachment, viscoelastic deformation may also play a role in bacterial adhesion to substratum surfaces, since it increases the contact area between a bacterium and the surface. recently, it has been suggested (6) that deformation of bacterial cell surfaces during adhesion may result in so - called stress deactivation of the adhering organisms, making them more susceptible to antimicrobial agents which may provide new clues to prevent antibiotic resistance. deformation of the bacterial cell surface and an associated change in contact area in response to an applied external force are hard to model and require knowledge of the viscoelasticity of the bacterial cell surface. in colloid science, several deformation models (e.g., the hertz, johnson - kendall - roberts, and derjaguin - muller - toropov models) have been developed to describe the deformation of an elastic sphere under an applied external loading force (710). all models have in common that they require a priori knowledge of the reduced young s modulus e of the particle (i.e., a bacterium), and substratum in order to calculate deformation and possible changes in contact area during loading (11, 12). note that there is a subtle difference between the reduced young s modulus e and young s modulus e, according to the following equation : where is poisson s ratio of the material under consideration (for most materials, is between 0 and 0.5). poisson s ratio accounts for the fact that a material compressed or stretched in one direction usually tends to expand or become compressed, respectively, in the other two, perpendicular directions. poisson s ratio is the ratio of the fractional expansion divided by the fractional compression or vice versa (13). use of atomic force microscopy (afm) allows control of the applied external force and measurement of the induced deformation. such data in combination with any of the deformation models mentioned above can be applied to determine the reduced young s modulus of both hard and elastic materials (1416). application of these models assumes that the particles examined are homogeneous with respect to their composition and viscoelastic properties, but this is not the case for bacteria. bacteria can either be rod shaped or spherically shaped and are by no means structurally homogeneous. gram - positive bacteria consist of a cytoplasmic, intracellular fluid contained within a hard core, enveloped by a lipid bilayer or membrane covered by a thick and relatively rigid, cross - linked peptidoglycan layer (fig. gram - negative strains possess a double membrane with a thin layer of peptidoglycan between the two membranes. the outermost bacterial cell surface may consist of proteinaceous surface appendages of different diameters and lengths of up to hundreds of nanometers or by a layer of extracellular polymeric substances (eps), produced by the organisms (17). as a consequence of the structural and compositional heterogeneity of bacterial cell surfaces, there is no homogeneous stress distribution upon external loading, and the softer outer layer may deform to concentrate the stress toward the more rigid, hard core. therefore, the contact volume and its reduced young s modulus are beyond experimental reach for bacterial cell surfaces using afm and existing deformation models. (a) three - dimensional (3d) schematics of a gram - positive bacterium, consisting of intracellular cytoplasmic fluid contained within a hard core, composed of a lipid bilayer or membrane covered by a thick and rigid, cross - linked peptidoglycan layer. the softer, outermost cell surface may consist of a combination of proteinaceous surface appendages combined with eps (extracellular polymeric substances). (b) bacterium upon initial contact with a substratum surface in the absence of an external deformation force. the contact volume is represented by a cylinder with an initial area s0 and initial height h0. (c) deformation of the bacterial contact cylinder upon application of an external force fld to an area s and height h. in this paper, we present a new, simple model to derive the reduced young s modulus of the contact volume between an adhering bacterium and a substratum surface. our model is based solely on the assumption that contact is established through a cylinder with constant volume during deformation upon application of an external loading force. importantly, the model does not a priori require any assumptions on the properties and dimensions of the contact cylinder and is applicable to different bacterial strains and species, regardless of whether they are gram positive or gram negative, whether they are rod shaped or coccal, and other details of their surface structure and composition. the model requires measurement of force - distance curves using afm between a bacterial probe and a substratum surface and is applied here on six strains that allow pairwise comparisons to identify the effects of the following : (i) the absence or presence of fibrillar surface appendages (two isogenic streptococcus salivarius strains) (18, 19), (ii) slime production (two staphylococcus epidermidis strains) (20), and (iii) the degree of cross - linking in the peptidoglycan envelope (two isogenic staphylococcus aureus strains) (21). a summary of the relevant cell surface features of the different strains is given in table 1. note that we confined our experiments to this selection of gram - positive cocci, because they have pairwise unique properties that contribute to the interpretation and validation of the results based on our knowledge of their cell wall properties. also, reproducible preparation of bacterial probes for rod - shaped organisms is more difficult than for coccal organisms. structural features of the different pairs of bacterial strains included in this study structural features of the different pairs of bacterial strains included in this study together with dimensions and reduced young s moduli of the contact cylinder between adhering bacteria and a glass substratum. the reduced young s moduli were obtained from the proposed elastic deformation model of the contact cylinder and from hertz modeling of the compression data, pertaining to the soft, outermost cell surface and for an unknown part to the bacterial hard core (fig. 1). the values for h0 and e are means standard deviations for deformation measurements taken over 24 different spots on the glass substratum, comprising eight different bacteria. a bacterial probe attached to a tipless afm cantilever is compressed against a glass surface under the external loading force of the afm, yielding deformation of an assumed contact cylinder from an initial area s0 and height h0 (fig. assuming that the volume of the contact cylinder remains constant during adhesion and associated deformation, its initial and final dimensions can be related to the deformation equation = h0 h according to (2)s = s0h0h0 while by equating the volume of the spherical cap contacting the substratum with the volume of a cylinder of equal height, s0 can be estimated as (3)s0=rh0 in which r is the bacterial cell radius, taken as 500 nm for all strains employed in this study (12, 18, 22). as long as the bacterium is in contact with the substratum surface, can be calculated from the displacement of the sample stage as measured with the piezo - transducer of the afm, z, and the cantilever deflection d equating the elastic force fcant exerted by the cantilever with the force arising due to deformation of the contact volume according to hooke s law yields (5)fcant = kd = esh0 where k is the spring constant of the cantilever and e is the reduced young s modulus of the contact cylinder. by combining equations 2, 3, and 5, fcant can be expressed as subsequently, fitting of the experimental data for fcant and the deformation yields the reduced modulus e and the initial dimension h0. in fig. 2, the force sensed by the afm cantilever, fcant, upon deforming an adhering bacterium is presented as a function of the deformation. since the strains included in this study are pairwise selected with respect to differences in cell surface features (see table 1), the graphs have been arranged so that strains showing the largest deformation within a pair are presented on the right. deformation force exerted by the cantilever fcant as a function of the bacterial deformation applied to two strains of s. epidermidis (atcc 35983 and atcc 35984), s. salivarius (hb-7 and hb - c12), and s. aureus (nctc 8325 - 4 and its isogenic pbp4 strain). data could be well fitted to equation 6, yielding values of e and h0 for the contact cylinders. the data are summarized in table 1, together with values for the initial contact areas s0 calculated from equation 3. note that the quality of the fit to equation 6 is generally good, except for s. aureus nctc 8325 - 4, probably as a result of its relatively small deformation upon external loading. the reduced young s moduli calculated by our proposed deformation model vary by a factor of 7 among this collection of strains, and within the pairs of staphylococci and streptococci, it is lower in bacteria that produce eps, possess fibrils, and lack cross - linking in the peptidoglycan layer. an important feature of the model is that the dimensions of the contact cylinder at zero external loading force are obtained as well. within each pair, a decrease in reduced young s modulus is accompanied by a larger height and contact area of the initial contact cylinder. the reduced young s moduli of soft materials can also be obtained using the hertz model (8, 23), assuming the adhesion force arising from the contact can be neglected. when applying the hertz model to bacteria, a bacterium is simply considered a uniform, elastic sphere and approach force - distance curves are fitted to fitting of the experimental data for fcant and the deformation using the indentation module of nanoscope analysis software (bruker) then directly yields the reduced young s modulus e. analysis according to the hertz mode yields reduced young s moduli of the adhering bacteria only as a whole, and accordingly, as shown in table 1, these values are about 3 orders of magnitude larger than obtained from our proposed deformation model. the measured adhesion forces for the strains involved in this study were generally less than 2 nn (data not shown), which justifies the use of the hertz model. a bacterial probe attached to a tipless afm cantilever is compressed against a glass surface under the external loading force of the afm, yielding deformation of an assumed contact cylinder from an initial area s0 and height h0 (fig. assuming that the volume of the contact cylinder remains constant during adhesion and associated deformation, its initial and final dimensions can be related to the deformation equation = h0 h according to (2)s = s0h0h0 while by equating the volume of the spherical cap contacting the substratum with the volume of a cylinder of equal height, s0 can be estimated as (3)s0=rh0 in which r is the bacterial cell radius, taken as 500 nm for all strains employed in this study (12, 18, 22). as long as the bacterium is in contact with the substratum surface, can be calculated from the displacement of the sample stage as measured with the piezo - transducer of the afm, z, and the cantilever deflection d equating the elastic force fcant exerted by the cantilever with the force arising due to deformation of the contact volume according to hooke s law yields (5)fcant = kd = esh0 where k is the spring constant of the cantilever and e is the reduced young s modulus of the contact cylinder. by combining equations 2, 3, and 5, fcant can be expressed as subsequently, fitting of the experimental data for fcant and the deformation yields the reduced modulus e and the initial dimension h0. in fig. 2, the force sensed by the afm cantilever, fcant, upon deforming an adhering bacterium is presented as a function of the deformation. since the strains included in this study are pairwise selected with respect to differences in cell surface features (see table 1), the graphs have been arranged so that strains showing the largest deformation within a pair are presented on the right. deformation force exerted by the cantilever fcant as a function of the bacterial deformation applied to two strains of s. epidermidis (atcc 35983 and atcc 35984), s. salivarius (hb-7 and hb - c12), and s. aureus (nctc 8325 - 4 and its isogenic pbp4 strain). data could be well fitted to equation 6, yielding values of e and h0 for the contact cylinders. the data are summarized in table 1, together with values for the initial contact areas s0 calculated from equation 3. note that the quality of the fit to equation 6 is generally good, except for s. aureus nctc 8325 - 4, probably as a result of its relatively small deformation upon external loading. the reduced young s moduli calculated by our proposed deformation model vary by a factor of 7 among this collection of strains, and within the pairs of staphylococci and streptococci, it is lower in bacteria that produce eps, possess fibrils, and lack cross - linking in the peptidoglycan layer. an important feature of the model is that the dimensions of the contact cylinder at zero external loading force are obtained as well. within each pair, a decrease in reduced young s modulus is accompanied by a larger height and contact area of the initial contact cylinder. the reduced young s moduli of soft materials can also be obtained using the hertz model (8, 23), assuming the adhesion force arising from the contact can be neglected. when applying the hertz model to bacteria, a bacterium is simply considered a uniform, elastic sphere and approach force - distance curves are fitted to fitting of the experimental data for fcant and the deformation using the indentation module of nanoscope analysis software (bruker) then directly yields the reduced young s modulus e. analysis according to the hertz mode yields reduced young s moduli of the adhering bacteria only as a whole, and accordingly, as shown in table 1, these values are about 3 orders of magnitude larger than obtained from our proposed deformation model. the measured adhesion forces for the strains involved in this study were generally less than 2 nn (data not shown), which justifies the use of the hertz model. we propose a simple model to evaluate the elastic deformation of a bacterial cell surface upon external loading using afm. the model is based on the assumption that the contact between an adhering bacterium and a substratum surface can be represented as a cylinder having a constant volume during deformation, while the rigid, hard core of a bacterium (fig. 1) does not a priori participate in the deformation unless severely softened, as for instance when cross - linking of the peptidoglycan in the cytoplasmic envelope is absent. the model allows for derivation of the reduced young s modulus of the contact volume from the relationship between the external loading force fcant and the deformation. like the hertz model, our model accounts only for elastic deformation, although it has been argued that bacteria should be regarded as being viscoelastic (12). retardation time constants of bacteria based on standard solid models (24) are reported to be around 1 to 2 s, which is at least 10 times longer than the time scale in which we apply our external loading force. thus, considering the relatively high frequencies applied, a viscous contribution toward the bacterial cell surface deformation can be neglected using the current protocol. it could be argued (fig. 1) that during application of an external loading force, not only is the contact volume between the rigid, hard core of a bacterium and the substratum surface deformed, but the volume between the bacterium and the afm cantilever is also deformed. however, the adhesion force of a negatively charged bacterium to a positively charged cantilever (due to the adsorbed -poly - l - lysine layer) is much stronger than to a negatively charged glass surface (2527), while furthermore, the bond between the cantilever and bacterium has had ample time to mature. from this, we conclude that the contact volume between the bacterium and cantilever can be considered undeformable. nevertheless, the equations presented can be easily adjusted to include deformation of the contact volume between a bacterium and a cantilever. when for instance, both contact volumes would contribute equally to the deformation measured, should be replaced by /2, which would yield 2-fold - smaller values for h0 and s0, while reduced young s moduli would double. in order to judge whether the results obtained using our new model are realistic, we selected pairs of bacterial strains with distinctly different cell surface features and cell wall characteristics within each pair. within the pair of s. epidermidis strains, s. epidermidis atcc 35983 produces the least eps (20), explaining why the height of its contact cylinder is found to be smaller and its reduced young s modulus is higher than that for s. epidermidis atcc 35984. similarly, the differences in height and elasticity modulus between the isogenic s. salivarius strains can be ascribed to the difference in fibrillation of these strains. s. salivarius hb-7 possesses fibrils with a uniform length of 91 nm (18), and the contact cylinder, with a calculated height of 44 nm, is fully located within the fibrillar layer. however, at the surface of s. salivarius hb - c12, there are no fibrils (19), and the contact cylinder with a height of 28 nm extends well into the peptidoglycan layer of the bacterial cell wall, giving rise to a higher reduced young s modulus than for hb-7. the isogenic s. aureus strains differ with respect to the degree of cross - linking of their peptidoglycan layer. the peptidoglycan in the wall of s. aureus nctc 8325 - 4 is highly cross - linked, whereas that of the isogenic mutant (pbp4 mutant) is deficient in cross - linking (21). accordingly, the bacterial cell wall of s. aureus nctc 8325 - 4 is more rigid than the cell wall of the pbp4 mutant, as indicated by the higher reduced young s modulus. furthermore, the different values of the height of the contact cylinder reflect the difference in softness of the bacterial cell walls between the two strains and how far it extends toward the peptidoglycan layer (if not encompassing it). the fact that the method self - defines the dimensions of the contact cylinder is an important feature, as it makes the method applicable to highly complex bacterial cell walls, including those of gram - negative strains that possess a double lipid membrane. application of the established hertz model to our experimental data also yields pairwise differences in reduced young s moduli, demonstrating differences in cell surface features and cell wall characteristics within each pair of strains, similar to our new, elastic deformation model (table 1). however, the reduced moduli derived from the hertz model are orders of magnitude larger than those obtained from our proposed elastic deformation model. thwaites and mendelson (28) reported 10 mpa for the young s modulus of the peptidoglycan thread in bacillus subtilis cell walls, which is in the same order of magnitude as obtained for the present collection of strains using the hertz model. the high reduced young s moduli arrived in the hertz model likely pertain mostly to the bacterial hard core. on the other hand, the heights of the contact cylinder derived are limited to several tens of nanometers and therefore clearly refer to the features of the outermost cell surface (with the evident exception of the staphylococcal strain that is deficient in peptidoglycan cross - linking). accordingly, reduced young s moduli of bacterial contact volumes involved in adhesion derived by our model fall within the range of data published for the young s moduli of biopolymer gels (29, 30) and polyelectrolyte multilayers (31), generally ranging from 1 to 100 kpa. thus, we believe that our elastic deformation model yields advantages over the use of other models like the hertz model, as it accounts for the heterogeneous composition and viscoelastic properties of bacteria, which is especially important to identify the elastic properties of the bond between an adhering bacterium and a substratum surface. in conclusion, a simple model is proposed to determine reduced young s modulus of the bond between adhering bacteria and substratum surfaces. the model is based on the measurement of the elastic deformation of an assumed cylindrical contact of constant volume and defines its own initial cylinder height. the resulting reduced young s moduli and the dimensions of the contact cylinders could be interpreted on the basis of the cell surface features and cell wall characteristics, i.e., surfaces that are more rigid (because of either lower fibrillation, lower eps production, or higher degree of cross - linking of the peptidoglycan layer) have shorter contact cylinders and higher reduced young s moduli. unlike the values found using the hertz model, young s moduli derived for the contact volumes in our elastic deformation model correspond with young s moduli from the literature for biopolymer gels and polyelectrolyte multilayers. application of the established hertz model to our experimental data yields higher reduced young s moduli of all strains investigated, likely because the hertz model pertains to a major extent to the more rigid peptidoglycan layer surrounding the bacterial cytoplasm and, unlike our elastic deformation model, does not distinguish between the soft outer bacterial cell surface and the hard core of bacterial cells. although our model is applicable to different bacterial strains and species, regardless of whether they are gram positive or gram negative, rod shaped or coccal, and the details of their surface structure and composition, it is more difficult to apply to rod - shaped organisms, because the orientation of a rod - shaped organism with respect to the afm cantilever needs to be established and controlled. moreover, for rod - shaped organisms, other assumptions may have to be made with respect to the geometry of the contact volume, which does not necessarily need to be cylindrical as was assumed for coccal organisms. however, as long as the assumption of constant volume for the contact volume during deformation is made, our proposed method can be applied without further modification or difficulty. (i) s. epidermidis atcc 35983 and atcc 35984 are known as a poor and strong eps producer, respectively (20). (ii) isogenic s. salivarius hb-7 and hb - c12 are two related strains that differ in their possession of fibrillar surface appendages (18, 19). (iii) s. aureus nctc 8325 - 4 and its isogenic pbp4 mutant differ in the degree of cross - linking of their peptidoglycan layer (21). staphylococci were precultured from blood agar plates in 10 ml tryptone soya broth (oxoid, basingstoke, england), while streptococci were precultured from blood agar plates in 10 ml todd - hewitt broth (oxoid). after 24 h, 0.5 ml of a preculture was transferred into 10 ml fresh medium, and the main culture was grown for 16 h at 37c. bacteria were harvested by centrifugation at 5,000 g for 5 min, washed twice with 10 mm potassium phosphate buffer (ph 7.0) and finally suspended in the same buffer. when bacterial aggregates or chains were observed microscopically, the suspension was sonicated for 10 s at 30 w (vibra cell model 375 ; sonics and materials inc., danbury, ct) intermittently three times while the suspension was cooled in a water / ice bath. bacterial probes were prepared by immobilizing a bacterium to an np - o10 tipless cantilever (bruker, camarillo, ca). cantilevers were first calibrated by the thermal tuning method, and spring constants were always within the range given by the manufacturer (0.03 to 0.12 n / m). next, a cantilever was mounted to the end of a micromanipulator and using a microscope to observe, the tip of the cantilever was dipped into a droplet of a 0.01% -poly - l - lysine solution with a molecular weight (mw) ranging from 70,000 to 150,000 (sigma - aldrich, st. after 2 min of air drying, the tip of the cantilever was carefully dipped into a bacterial suspension droplet for 1 min to allow bacterial attachment through electrostatic attraction and dried in air for 2 min. all force spectroscopy measurements were performed in 10 mm potassium phosphate buffer (ph 7.0) at room temperature on a bioscope catalyst afm (bruker). in the method proposed, the bacterial probe was moved toward a glass microscope slide cleaned to a zero degree water contact angle (gerhard menzel gmbh, braunschweig, germany) at a constant velocity of 1 m / s. during deformation, the force fcant that was exerted by the cantilever was recorded as well as the displacement z of the sample stage as measured with the piezo - transducer of the afm until a maximum loading force of 3 nn. in order to verify that a bacterial probe enabled a single contact with the surface, a scanned image in afm contact mode with a loading force of 1 to 2 nn was made at the onset of each experiment and examined for double contour lines. double contour lines indicate that the afm image is not prepared from the contact of a single bacterium with the surface but that multiple bacteria on the probe are in simultaneous contact with the substratum. any probe exhibiting double contour lines were discarded. at this point, however, it must be noted that double contour line images seldom or never occurred, since it represents the unlikely situation that bacteria on the cantilever are equidistant to the substratum surface within the small range of the interaction forces, which is unlikely because the cantilever is contacting the substratum at an angle of less than 15. before the actual deformation measurements were taken, five force - distance curves of a bacterial probe toward a clean glass surface were measured at a loading force of 3 nn, and the maximal adhesion forces upon retraction were recorded. after each deformation measurement on a new spot on the glass slide and after increase of the external loading force on a bacterium up to 3 nn, the bacterial probe was retracted from the glass substratum, and the maximal adhesion force was measured again. whenever the maximal adhesion force recorded differed more than 1 nn from the initial value, the bacterial probe was regarded as damaged and replaced by a new one. (i) s. epidermidis atcc 35983 and atcc 35984 are known as a poor and strong eps producer, respectively (20). (ii) isogenic s. salivarius hb-7 and hb - c12 are two related strains that differ in their possession of fibrillar surface appendages (18, 19). (iii) s. aureus nctc 8325 - 4 and its isogenic pbp4 mutant differ in the degree of cross - linking of their peptidoglycan layer (21). staphylococci were precultured from blood agar plates in 10 ml tryptone soya broth (oxoid, basingstoke, england), while streptococci were precultured from blood agar plates in 10 ml todd - hewitt broth (oxoid). after 24 h, 0.5 ml of a preculture was transferred into 10 ml fresh medium, and the main culture was grown for 16 h at 37c. bacteria were harvested by centrifugation at 5,000 g for 5 min, washed twice with 10 mm potassium phosphate buffer (ph 7.0) and finally suspended in the same buffer. when bacterial aggregates or chains were observed microscopically, the suspension was sonicated for 10 s at 30 w (vibra cell model 375 ; sonics and materials inc., danbury, ct) intermittently three times while the suspension was cooled in a water / ice bath. bacterial probes were prepared by immobilizing a bacterium to an np - o10 tipless cantilever (bruker, camarillo, ca). cantilevers were first calibrated by the thermal tuning method, and spring constants were always within the range given by the manufacturer (0.03 to 0.12 n / m). next, a cantilever was mounted to the end of a micromanipulator and using a microscope to observe, the tip of the cantilever was dipped into a droplet of a 0.01% -poly - l - lysine solution with a molecular weight (mw) ranging from 70,000 to 150,000 (sigma - aldrich, st. after 2 min of air drying, the tip of the cantilever was carefully dipped into a bacterial suspension droplet for 1 min to allow bacterial attachment through electrostatic attraction and dried in air for 2 min. all force spectroscopy measurements were performed in 10 mm potassium phosphate buffer (ph 7.0) at room temperature on a bioscope catalyst afm (bruker). in the method proposed, the bacterial probe was moved toward a glass microscope slide cleaned to a zero degree water contact angle (gerhard menzel gmbh, braunschweig, germany) at a constant velocity of 1 m / s. during deformation, the force fcant that was exerted by the cantilever was recorded as well as the displacement z of the sample stage as measured with the piezo - transducer of the afm until a maximum loading force of 3 nn. in order to verify that a bacterial probe enabled a single contact with the surface, a scanned image in afm contact mode with a loading force of 1 to 2 nn was made at the onset of each experiment and examined for double contour lines. double contour lines indicate that the afm image is not prepared from the contact of a single bacterium with the surface but that multiple bacteria on the probe are in simultaneous contact with the substratum. any probe exhibiting double contour lines were discarded. at this point, however, it must be noted that double contour line images seldom or never occurred, since it represents the unlikely situation that bacteria on the cantilever are equidistant to the substratum surface within the small range of the interaction forces, which is unlikely because the cantilever is contacting the substratum at an angle of less than 15. before the actual deformation measurements were taken, five force - distance curves of a bacterial probe toward a clean glass surface were measured at a loading force of 3 nn, and the maximal adhesion forces upon retraction were recorded. after each deformation measurement on a new spot on the glass slide and after increase of the external loading force on a bacterium up to 3 nn, the bacterial probe was retracted from the glass substratum, and the maximal adhesion force was measured again. whenever the maximal adhesion force recorded differed more than 1 nn from the initial value, the bacterial probe was regarded as damaged and replaced by a new one. | abstractviscoelastic deformation of the contact volume between adhering bacteria and substratum surfaces plays a role in their adhesion and detachment. currently, there are no deformation models that account for the heterogeneous structure and composition of bacteria, consisting of a relatively soft outer layer and a more rigid, hard core enveloped by a cross - linked peptidoglycan layer. the aim of this paper is to present a new, simple model to derive the reduced young s modulus of the contact volume between adhering bacteria and substratum surfaces based on the relationship between deformation and applied external loading force, measured using atomic force microscopy. the model assumes that contact is established through a cylinder with constant volume and does not require assumptions on the properties and dimensions of the contact cylinder. the reduced young s moduli obtained (8 to 47 kpa) and dimensions of the contact cylinders could be interpreted on the basis of the cell surface features and cell wall characteristics, i.e., surfaces that are more rigid (because of either less fibrillation, less extracellular polymeric substance production, or a higher degree of cross - linking of the peptidoglycan layer) had shorter contact cylinders and higher reduced young s moduli. application of an existing hertz model to our experimental data yielded reduced young s moduli that were up to 100 times higher for all strains investigated, likely because the hertz model pertains to a major extent to the more rigid peptidoglycan layer and not only to the soft outer bacterial cell surface, involved in the bond between a bacterium and a substratum surface. |
loop prediction is generally one of the most challenging tasks in protein structure determination and modeling (117). the preferred conformation of loops often remains unclear even when the rest of the protein is resolved at high resolution. this is due to the high flexibility of loops that is often related to their function (18). medically highly relevant interactions, such as the coupling of receptors to g proteins are mediated by membrane protein loops (19). therefore, the knowledge of the conformation or the conformational space of a loop is essentially important to understand the mechanisms to activate or deactivate membrane receptors and transporters, or more broadly to model protein protein or protein ligand interactions. for loop modeling, two different methods, ab initio (1,3,5,8,1517) and comparative modeling (6,9,14) are applied. ab initio methods calculate possible loop conformations with the help of various energy functions and minimizations. these methods do not depend on large template libraries, but are generally time consuming, and are therefore less appropriate for interactive searches. comparative modeling approaches allow quick searches, but the quality of prediction largely depends on the availability of a suitable template loop structure. thus, the potential of comparative modeling methods grows, as the diversity of available templates enlarges (14). it is estimated that, at the moment, the conformation of any loop up to the length of 14 residues is already represented very well by protein fragments in the rcsb protein data bank (pdb) (12,20). therefore, the performance of knowledge - based methods to find the native loop conformation particularly depends on the size of the loop databank and on the scoring function. we have developed a scoring function for knowledge - based loop predictions that performs very well compared with other methods (14). based on this scoring function, we now setup superlooper, a web application that provides a very simple, quick, user - friendly and reliable way to fill in a missing loop. no extra software has to be installed and no databank has to be downloaded to get the program started. for user guidance, the candidate loops can be visualized by a jmol (http://www.jmol.org/) plug - in. moreover, the web server provides information on sequence identities or proline and glycine exchanges between the template and the target, as well as close distances between a selected loop and the remainder of the protein. finally, the membrane planes are automatically detected and visualized using the (21). thus, the specificities of membrane protein loops arising from the positioning at the membrane water interface can be respected, too (22). to allow the searches to be performed in real time, we have improved the scoring procedure that is the most time consuming process of our method (14). the search for the appropriate loop is now performed in a three - step process, described below. this hierarchical principle causes that the most cpu intensive calculations are performed on relatively small datasets. up to 100 000 candidates with the required loop length are preselected from the two databases lip (loops in proteins, 500 000 000 protein segments) and limp (loops in membrane proteins, 180 000 loops). the stem atoms (two main chain atoms preceding and following the loop, respectively) of candidate loops must fit the stem atoms of the target structure with a maximum deviation of 0.75 for each atom pair.the best 500 candidates are chosen by a specific goodness value that allows a quick estimation of the steric fit of loop candidates to a target protein, described in detail in our previous analysis (14).finally, the loop candidates are ranked by a score that includes the sequence similarity between loop candidate and target sequence, as well as the root mean square deviation (rmsd) of the stem atoms. to assure that the 50 top listed loops cover a maximum of the plausible conformational space, candidates with identical sequences and similar backbone conformations (rmsd < 1.0) are further excluded from the list. for the benchmarks described in the following, only the top - ranked loop was considered in each case. up to 100 000 candidates with the required loop length are preselected from the two databases lip (loops in proteins, 500 000 000 protein segments) and limp (loops in membrane proteins, 180 000 loops). the stem atoms (two main chain atoms preceding and following the loop, respectively) of candidate loops must fit the stem atoms of the target structure with a maximum deviation of 0.75 for each atom pair. goodness value that allows a quick estimation of the steric fit of loop candidates to a target protein, described in detail in our previous analysis (14). finally, the loop candidates are ranked by a score that includes the sequence similarity between loop candidate and target sequence, as well as the root mean square deviation (rmsd) of the stem atoms. to assure that the 50 top listed loops cover a maximum of the plausible conformational space, candidates with identical sequences and similar backbone conformations (rmsd < 1.0) are further excluded from the list. for the benchmarks described in the following, using the test dataset of the sali lab (15), we have shown previously that the accuracy of the method underlying superlooper performs better than other methods in particular for longer loops (14). the performance of superlooper was now benchmarked applying a new test dataset that was recently published to benchmark four commercially available programs for loop sampling prime (schrdinger, llc), modeler (accelrys software, inc.), icm (molsoft, llc) and sybyl (tripos, inc.) the outcome of that study is that prime, an ab initio method performs best especially with increasing loop lengths. to compare our results with this study, protein structures with the same pdb entry as in the test datasets different versions of the same protein or slightly mutated variants. this criterion is assessed by a sliding window technique as described previously (14). as a result, top - ranked loops show a global rmsd (main chain atoms) to the original loops of < 1.3 for loops up to six residues or < 3.0 for loops shorter than 10 residues. best results are obtained, when loops with nearly identical sequences or close homologs are available. this, however, is presently not always the case for longer loops. to compare the performance of superlooper with that of the above mentioned tools, the analysis was repeated for loops with 11- and 12-residues length using a sequence identity limit of 90%. as a result, the average performance of superlooper at loop lengths 11 and 12 (rmsd = 2.6 and 4.0, respectively) is comparable with that of prime (rmsd = 3.7 and 3.5, respectively). at loop length 11 homologous templates with sequence identities ranging from 32% to 82% are detected by superlooper for 9 of 14 tested loops. the average global rmsd of the modeled to the native loops is 0.7. for the remaining five template loops (with no homologous template available) the rmsd is 5.9. at loop length 12 homologous templates with sequence identities ranging from 58% to 95% the average global rmsd of the modeled to the native loops is 0.6. for the remaining six template loops, the rmsd = 6.3. thus, superlooper clearly outperforms prime at these critical loop lengths if a homologous template is available. if no homologue is found, the ab initio method prime performs usually better. in conclusion, the performance of knowledge based methods such as superlooper clearly depends on the size and actuality of the data base in use. more detailed data on actual benchmarks of superlooper are available from http://bioinformatics.charite.de / superlooper/. better results can always be obtained when not only the top ranked loop is considered. thus, the user is encouraged to visually inspect the loops to determine, which is most reasonable. superlooper was, therefore, implemented with a user - friendly interface to visualize and select the proper loop structure from a list of proposed conformations. superlooper is implemented as an easy to use web application combining an interactive query of the loop database with a 3d visualization of the results. at the query site, the stem amino acids of the uploaded pdb file have to be provided together with the destined amino acid sequence. the result site provides all information necessary for the user to select the appropriate loop from a list of candidates ranked from the limp and lip data bases (figure 1). loop candidates can be selected from both data bases provided. due to the extensive size, the quality of loop predictions taken from the lip data base generally ranges above that of predictions with the limp data base. nevertheless, considering the specific amino acid composition of transmembrane helix caps and loops (22) candidates taken from the limp data base should always be checked first, when a membrane loop is to be modeled. figure 1.alternative conformations (red) for loop 2 of the human 2-adrenergic receptor (2rh1.pdb) can be selected from the list calculated by superlooper considering the predicted membrane planes (yellow). alternative conformations (red) for loop 2 of the human 2-adrenergic receptor (2rh1.pdb) can be selected from the list calculated by superlooper considering the predicted membrane planes (yellow). if no appropriate loop is found, the search may be expanded easily in n- or c - terminal direction up to a final loop length of 35 amino acids. to generally avoid unfavorable loop conformations and steric hindrance, the positions of proline and glycine exchanges in the selected loop are highlighted as well as distances < 2.4 to the rest of the protein. the percentage sequence identity of a template loop is always noted to inform the user about the probability that the native loop conformation is actually matched. a membrane protein loop should be selected with respect to its relative orientation to the lipid bilayer indicated by the protein viewer. the expansions of the lipid bilayer are predicted applying the (21,23). membrane planes are calculated on a remote server (tmdet) connected via web service (21). the web site uses jmol (http://jmol.sf.net) for visualization, and therefore needs a java jre, freely available from http://java.net. the web application uses the pdb - file format as the default input and output format, and is designed to be used with internet explorer 7 and firefox 2.03.0. the web application is also compatible with ie 6, but tends to be unstable on some computers regarding some combinations of jre and ie 6. using the test dataset of the sali lab (15), we have shown previously that the accuracy of the method underlying superlooper performs better than other methods in particular for longer loops (14). the performance of superlooper was now benchmarked applying a new test dataset that was recently published to benchmark four commercially available programs for loop sampling prime (schrdinger, llc), modeler (accelrys software, inc.), icm (molsoft, llc) and sybyl (tripos, inc.) the outcome of that study is that prime, an ab initio method performs best especially with increasing loop lengths. to compare our results with this study, protein structures with the same pdb entry as in the test datasets different versions of the same protein or slightly mutated variants. this criterion is assessed by a sliding window technique as described previously (14). as a result, top - ranked loops show a global rmsd (main chain atoms) to the original loops of < 1.3 for loops up to six residues or < 3.0 for loops shorter than 10 residues. best results are obtained, when loops with nearly identical sequences or close homologs are available. this, however, is presently not always the case for longer loops. to compare the performance of superlooper with that of the above mentioned tools, the analysis was repeated for loops with 11- and 12-residues length using a sequence identity limit of 90%. as a result, the average performance of superlooper at loop lengths 11 and 12 (rmsd = 2.6 and 4.0, respectively) is comparable with that of prime (rmsd = 3.7 and 3.5, respectively). at loop length 11 homologous templates with sequence identities ranging from 32% to 82% are detected by superlooper for 9 of 14 tested loops. the average global rmsd of the modeled to the native loops is 0.7. for the remaining five template loops (with no homologous template available) the rmsd is 5.9. at loop length 12 homologous templates with sequence identities ranging from 58% to 95% the average global rmsd of the modeled to the native loops is 0.6. for the remaining six template loops, the rmsd = 6.3. thus, superlooper clearly outperforms prime at these critical loop lengths if a homologous template is available. if no homologue is found, the ab initio method prime performs usually better. in conclusion, the performance of knowledge based methods such as superlooper clearly depends on the size and actuality of the data base in use. more detailed data on actual benchmarks of superlooper are available from http://bioinformatics.charite.de / superlooper/. better results can always be obtained when not only the top ranked loop is considered. thus, the user is encouraged to visually inspect the loops to determine, which is most reasonable. superlooper was, therefore, implemented with a user - friendly interface to visualize and select the proper loop structure from a list of proposed conformations. superlooper is implemented as an easy to use web application combining an interactive query of the loop database with a 3d visualization of the results. at the query site, the stem amino acids of the uploaded pdb file have to be provided together with the destined amino acid sequence. the result site provides all information necessary for the user to select the appropriate loop from a list of candidates ranked from the limp and lip data bases (figure 1). loop candidates can be selected from both data bases provided. due to the extensive size, the quality of loop predictions taken from the lip data base generally ranges above that of predictions with the limp data base. nevertheless, considering the specific amino acid composition of transmembrane helix caps and loops (22) candidates taken from the limp data base should always be checked first, when a membrane loop is to be modeled. figure 1.alternative conformations (red) for loop 2 of the human 2-adrenergic receptor (2rh1.pdb) can be selected from the list calculated by superlooper considering the predicted membrane planes (yellow). alternative conformations (red) for loop 2 of the human 2-adrenergic receptor (2rh1.pdb) can be selected from the list calculated by superlooper considering the predicted membrane planes (yellow). if no appropriate loop is found, the search may be expanded easily in n- or c - terminal direction up to a final loop length of 35 amino acids. to generally avoid unfavorable loop conformations and steric hindrance, the positions of proline and glycine exchanges in the selected loop are highlighted as well as distances < 2.4 to the rest of the protein. the percentage sequence identity of a template loop is always noted to inform the user about the probability that the native loop conformation is actually matched. a membrane protein loop should be selected with respect to its relative orientation to the lipid bilayer indicated by the protein viewer. the expansions of the lipid bilayer are predicted applying the (21,23). membrane planes are calculated on a remote server (tmdet) connected via web service (21). the web site uses jmol (http://jmol.sf.net) for visualization, and therefore needs a java jre, freely available from http://java.net. the web application uses the pdb - file format as the default input and output format, and is designed to be used with internet explorer 7 and firefox 2.03.0. the web application is also compatible with ie 6, but tends to be unstable on some computers regarding some combinations of jre and ie 6. european union (profit) ; deutsche forschungsgemeinschaft (sfb449, sfb740, dfg grk1360). funding for open access charge : sfb449. | superlooper provides the first online interface for the automatic, quick and interactive search and placement of loops in proteins (lip). a database containing half a billion segments of water - soluble proteins with lengths up to 35 residues can be screened for candidate loops. a specified database containing 180 000 membrane loops in proteins (limp) can be searched, alternatively. loop candidates are scored based on sequence criteria and the root mean square deviation (rmsd) of the stem atoms. searching lip, the average global rmsd of the respective top - ranked loops to the original loops is benchmarked to be < 2, for loops up to six residues or <3 for loops shorter than 10 residues. other suitable conformations may be selected and directly visualized on the web server from a top-50 list. for user guidance, the sequence homology between the template and the original sequence, proline or glycine exchanges or close contacts between a loop candidate and the remainder of the protein are denoted. for membrane proteins, the expansions of the lipid bilayer are automatically modeled using the. this allows the user to select the optimal membrane protein loop concerning its relative orientation to the lipid bilayer. the server is online since october 2007 and can be freely accessed at url : http://bioinformatics.charite.de/superlooper/ |
osteopetrosis (op) has also called with its historical names as a albers - schnberg disease, which was firstly described by a german radiologist [1, 2 ]. the main cause of the disease is osteoclastic activity defect, which results hypersclerotic fragile bone [3, 4 ]. autosomal recessive op (aro) has a two subtype, which are infantile malignant op and intermediate type. infantile malignant aro has diagnosed within the first year of the life that has fatal clinical progression due to the bone marrow deficiency and infection. important neurological symptoms are cranial verve palsies due to the obliteration of cranial nerve foramina such as vision loss, deafness, and facial paralysis. the most common neurological finding is visual loss due to the optic nerve compression within the optic channel. in contrast to the aro, autosomal dominant op (ado) is described as adult benign type due to the normal life expectancy [2, 3, 7 ]. ado diagnosis is given easily by recurrent bone fracture history, osteomyelitis, radiologic and laboratory findings, and genetic examination. the typical signs are bone within the bone on the end bones, sclerotic appearances on the long bone and multiple previous fracture lines. other radiological findings are hypoplastic maxillary sinus, teeth deformity and multiple carious. the genetic mutation in the chloride channel 7 (clcn7) gene has been shown. clcn7 gene mutations are heterogeneous, but the result is osteoclastic activity failure [4, 6 ]. she was evaluated with magnetic resonance imaging (mri), which showed chiari i malformation with a 7 mm descent of cerebellar tonsils (fig. 1 a and b). computed tomography demonstrated diffuse calvarial thickening and loss of the medullary space (fig. 2). her past medical history was consistent with left eye surgery due to amblyopia when she was a child and she was blind in her left eye. radioactive i treatment had been given due to the graves disease and hyperthyroidism ; therefore, she was hypothyroidic and was using levothyroxine daily. her physical examination revealed prominent occipital area and midfacial hypoplasia. increased cortical thickness in her long bones c). there were no abnormal findings on neurological examination except of left eye amorozis. large enough posterior fossa craniectomy with c1 laminectomy was performed with ssep and mep monitoring. she developed superficial wound infection, which was treated with simple washout and antibiotics. figure 1:(a) sagittal t2-weighted image showing cerebellar tonsillar herniation and diffuse thickening of the occipital bone. (b) axial t1-weighted image showing compression on the upper cervical spinal cord (green arrow) and cerebellar tonsillar herniation (red arrow). figure 2:axial ct image (bone window) showing diffuse calvarial thickening and loss of the medullary space. figure 3:patients ' picture showing midfacial hypoplasia on the face (a), x - ray graphy of the right femur (b) and x - ray of left femur (c) showing diffuse cortical thickening. (a) sagittal t2-weighted image showing cerebellar tonsillar herniation and diffuse thickening of the occipital bone. (b) axial t1-weighted image showing compression on the upper cervical spinal cord (green arrow) and cerebellar tonsillar herniation (red arrow). axial ct image (bone window) showing diffuse calvarial thickening and loss of the medullary space. patients ' picture showing midfacial hypoplasia on the face (a), x - ray graphy of the right femur (b) and x - ray of left femur (c) showing diffuse cortical thickening. op is a rare and hereditary skeletal disease, which resulting from destructive or absence of osteoclastic activity. over this case is the second ado case associated with chiari type i, which presented with hindbrain headache and numbness on the upper extremity without other cranial nerve compression sign. mri revealed brain stem compression, tonsillar herniation, occipital bone thickening and shallow posterior fossa. the first diagnosis was chiari type i, but detailed history, endocrinologic and radiologic work - up yielded as an ado, which was a final diagnosis. reported that untreated aro patients died by the age of 4 years because of the pancytopenia and recurrent infection, which had a 75% rate. there are two type describe, which have different clinical, biochemical and histological manifestation. type i has osteosclerosis on the cranial vault, while type ii has end - plate thickening of vertebral body (rugger jersey spine) and end bones in the pelvis. both the types are strictly family related and seen in late childhood [3, 10 ]. the fracture frequency is increased in type ii and normal type i [1, 2, 4, 8, 10 ]. de oliveira. reported that there is no need to perform genetic study to confirm the disease. tohidi and bagherpour suggest that ado is rare condition, which can be asymptomatic. therefore, accurate diagnosis can be achieved with the proper clinical, endocrinologic and radiologic investigation. calcium, phosphorus and alkaline phosphatase levels are usually within the normal limits in the benign op [7, 10 ]. dlouhy and menezes proposed in their report that even if their report is the first case ado with chiari, further study is needed. in their report, the cause of the chiari malformation in the op explained as unclear. moreover, the absence of the osteoclastic activity leads to underdeveloped occipital bone, and this results in a smaller posterior fossa. in conclusion, however, patients can present with only chiari symptoms without other cranial nerves compression symptoms ; therefore, ado can be overlooked for differential diagnosis. symptomatic chiari malformation needs surgical intervention, but it should be kept in mind that the patients with chiari malformation should investigate differential diagnosis for ado. whole skeletal survey must be done, whether there are sclerotic chances, thickening skull base, bone within the bone appearance, rugger jersey spine, erlenmeyer flask deformity on the long bone and fracture line on the bone. | osteopetrosis (op) is hereditary x - linked, autosomal recessive (aro), or autosomal dominant (ado) skeletal disease. aro has two subtypes, which are infantile malignant and intermediate type. aro and x - linked op have poor clinical outcome. ado is called adult benign type because of the normal life expectancy, which has type i and type ii. here, the authors present an ado patient with chiari type i. concomitant ado with chiari type i malformation is an extremely rare condition. literature research yielded only one case report to date. |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.