article
stringlengths 0
682k
| abstract
stringlengths 146
3.69k
|
|---|---|
tissue samples were taken from 27 patients with suspected cl who had consulted the health centers from march 2005 to march 2006. local reference laboratories evaluated all stained slides by light microscopy and positively identified leishmania amastigotes. patients had no history of travel and were assumed to been infected in morocco ; all received free intralesional injections of meglumine antimoniate (glucantime ; sanofi - aventis, bridgewater, nj, usa) until total recovery, according to the protocol in the mmh leishmaniasis control manual. samples were collected in areas of morocco known for high cl incidence : north (sidi kacem), center (beni mellal and boulemane), southeast (errachidia), and southwest (taroudant and ouarzazate) (figure 1). dna extraction and pcr analysis by amplification of the ribosomal internal transcribed spacer 1 (its1), using stained slides, was performed as described by schonian. we used 0.6-nm primers and pcr - ready supreme mix (syntezza bioscience, jerusalem, israel) in 25 l of total reaction. leishmania dna (10 ng / reaction) from reference strains l. tropica (mhom / az/1974/saf - k27), l. major (mhom / tm/1973/5askh), and l. infantum (mhom / tn/1980/ipt1) were used as positive controls. after amplification, the pcr product was digested with 1.5 l bsuri endonuclease (mbi fermentas, burlington, ontario, canada), and all digested products were analyzed by agarose gel electrophoresis (12). all patients had classic symptoms of cl, from small erythematous papules to nodules and ulcerative lesions. papular lesions, nodular lesions, or both were present in 30% of the cl patients ; ulcerative lesions, in 52%. neither the papular / nodular nor the ulcerative forms correlated with a particular leishmania species. the erythematous clinical form was present in 18% of total case - patients and in 63% of case - patients from the sidi kacem region. undigested its1 amplicons from the 27 slides produced a band of 300350 bp (data not shown), which confirmed the presence of leishmania dna. band patterns from the digested samples were compared with digested standards for each reference strain and identified the parasite species (figure 2) as follows : l. major, 3 samples each from ouarzazate and errachidia ; l. tropica, 2 samples from taroudant, 4 from beni mellal, and 7 from boulemane ; l. infantum, 8 samples from sidi kacem. comparison between endonuclease bsuri digestion patterns of internal transcribed spacer 1pcr products from clinical samples and reference leishmania strains. clinical samples, lanes 16 : lane 1, boulmane ; lane 2, ouarzazate ; lanes 36, sidi kacem. reference strains, lanes 79 : lane 7, l. tropica (mhom / su/1974/saf - k27) ; lane 8, l. major (mhom / tm/1973/5askh) ; lane 9, l. infantum (mhom / tn/1980/ipt1). cl caused by l. major or l. tropica and vl caused by l. infantum have been reported in morocco (59). pcr on archived tissue samples enabled us to investigate the epidemiology of cl in disease - endemic regions of morocco and identify those species responsible for this disease in several new foci (table). our results, together with those of previous studies (59 ; unpub. data from mmh, 2001), indicate that cl caused by l. tropica is found throughout the center of the country in a band stretching from the atlantic ocean along the length of the atlas mountains almost to the mediterranean sea. cl caused by l. major is present in the desert region south of the atlas mountains in a strip bordering the sahara desert (figure 1). we report on a focus of cl in morocco caused by l. infantum, 8 samples from sidi kacem. in morocco, the only previous human cl case caused by l. infantum was reported in 1996, within an active focus of vl (13). the northern coastal regions of morocco are endemic for human and canine vl. as in other vl - endemic regions surrounding the mediterranean sea, this disease is caused by l. infantum (3). although it is unusual for this parasite to cause cl, our finding is similar to a recent report from tunisia, where l. infantum was shown to cause sporadic cl in regions endemic for vl. it appeared to have emerged in a new region of the country and was suggested to be more prevalent than originally indicated (14). cl and vl overlap in many provinces of central morocco ; anthroponotic foci of l. tropica cl are found in fes and taza (79) (figure 1), not far from existing vl foci including sidi kacem. furthermore, several cases of canine vl caused by l. tropica have been reported in regions where canine vl is caused by l. infantum. the nodular form of cl was caused by all 3 species ; ulcerative lesions were seen only with cl caused by l. tropica and l. major. of the 8 patients in sidi kacem with l. infantum infection, 5 showed the atypical erythematous papular form. the overlapping distribution of parasite species, causing diseases with similar clinical pictures, demonstrates the need for additional epidemiologic and ecologic studies of cl in conjunction with species identification. this is especially important as traditional methods of determining infection from patient history and microscopic examination prove increasingly unreliable. pcr can be performed rapidly on fresh or archived samples and does not require culturing of large amounts of parasites. in addition, pcr costs have come down considerably, and costs can be further reduced by sending samples by regular mail to a central facility. recent studies document the emergence of new leishmania foci and the coexistence of multiple leishmania species in the same geographic locale, including much of northern africa (14). we recommend that treatment protocols, particularly in areas of coexistence, be predicated on diagnosis of not only the clinical form cl versus vl but additionally the disease - causing species. in morocco, local physicians and healthcare administrators often do not realize that different species of leishmania require differential treatments, which can result in a failure to diagnose more serious disease. however, recurrent failure of local treatments (paromomycin and intralesional sodium stibogluconate) against l. tropica was evident (11). because l. tropica, and now l. infantum, cause both vl and cl, a physician treating a cutaneous lesion may overlook visceral disease, and a host of costlier health problems may ensue. a simple, sensitive pcr test could easily reduce such risk. further surveillance of cases and suspected cases from these foci should confirm the results of this limited study. recent implementation of pcr - based diagnosis in an outbreak in northern algeria increased the positive diagnosis of cl by 69% over cases diagnosed by using microscopy alone (15). furthermore, anthroponotic cl caused by l. tropica is limited to parts of southern europe, asia, and africa ; diagnosis and treatment of the disease at its earliest stage is of paramount importance for reduction of the human reservoir. failure to promptly diagnose and treat all cases will result in continued dissemination of the parasite. | during the past 20 years, cutaneous leishmaniasis has emerged as a major public health threat in morocco. we describe distribution of leishmania major and l. tropica in morocco and a new focus of cutaneous leishmaniasis due to l. infantum. we recommend using molecular techniques to diagnose suspected leishmaniasis cases. |
with the rapid increase in the applications of coronary angiography, a growing number of coronary artery ectasia (cae) cases have been detected. cae is an independent predictor of mortality, and aneurysmal patients with nonobstructive diseases have mortality rates similar to those of patients with 3-vessel diseases. the largest cohort study of cae to date found that aneurysmal patients had a 5-year mortality rate of 26% mortality in 1983. two decades later, the 5-year mortality rate of patients with coronary aneurysms remained as high as 29% despite the progressive advances and improvements in medical therapy for coronary artery diseases, and there was no statistically significant difference between the survival rate of aneurysmal patients with and without obstructive coronary artery disease (o - cad). several inflammatory biomarkers have been found to be associated with cae. in particular, the high - sensitivity c - reactive protein (hs - crp) the hs - crp was found to be significantly higher in patients with cae than in those with o - cad or with normal coronary angiography. inflammation contributes to the initiation and progression of atherosclerosis, but its role in the progression of cae remains unclear. the prognostic value of hs - crp in cardiovascular diseases has been well evaluated, such as in stable coronary artery disease and acute coronary syndrome. in addition, the hs - crp could improve risk prediction accuracy for adverse cardiovascular events (cvs). however, the prognostic value of hs - crp in established cae has not been assessed so far. since death and myocardial infarction are the prominent features of cae, the present investigation was designed to evaluate whether the baseline hs - crp could predict the composite cvs (cardiac death and nonfetal myocardial infarction) associated with cae. if so, it might be used to guide the risk stratification and clinical decisions of cae patients. the study population consisted of consecutively enrolled cae patients who had been admitted to our hospital and had undergone a coronary angiography during january 2009 and july 2013. the indication for coronary angiography was either the presence of typical angina or positive or equivocal results of noninvasive screening tests for myocardial ischemia. cae was defined as a localized or diffused luminal dilation exceeding 1.5-fold of the normal adjacent arterial segment. the cae patients were included consecutively, regardless of whether they had an o - cad or not. those who presented the following characteristics were excluded from the study : acute coronary syndrome, acute or chronic infection, renal failure, hepatic dysfunction, malignant disease, hematological disorder, pregnancy, severe valvular disease, cardiomyopathy, congenital heart disease, and drugs or alcohol abuse. the patients medical history and physician - administered physical examination information were obtained from the hospital 's medical records. all patients provided their informed consent, and the study was approved by local ethics committee. the baseline hs - crp values and other blood biomarkers were also collected from our medical records system, and all these biomarkers were measured from the samples collected in the morning after an overnight fast. the hs - crp was determined with an aus5400 (olympus, japan) molecular analyzer at our clinical laboratory department. the follow - up was performed through telephone interviews and consultation of the hospital 's medical records in july 2014. the researchers who conducted the follow - up were blind to the baseline status of the cae patients. the observational outcome was the composite of two cvs : cardiac death and nonfatal myocardial infarction. cardiac deaths were defined as death diagnosed by medical practitioners as definitely cardiogenic or unexplained sudden death. where a patient had reached more than one end point, only the first event was taken into count. all the data were analyzed with sas software, version 9.3 (sas institute, cary, nc, usa), and a two - tailed p 3 mg / l vs. 3 mg / l) was illustrated with a kaplan - meier curve, and the values were compared with a log - rank test. the adjusted kaplan meier curve and hazard ratios (hrs) were also obtained. subsequently, we examined the net reclassification improvement (nri) and of the risk categories (> 3 mg / l, 3 mg / l) for the prediction of the 3-year event - free survival and the integrated discrimination improvement (idi) by adapting recent approaches to convert the numbers into suitable survival data. the nri measures the correctness of reclassification of patients based on their predicted probabilities of events using the new model with the option of imposing meaningful risk categories (> 3 mg / l). the idi measures the new model 's improvement in average sensitivity without sacrificing average specificity. the multivariate logistic regression model was used for this analysis. a combination of the classical cardiovascular risk factors (age, sex, body mass index (bmi), low - density lipoprotein (ldl)/high - density lipoprotein ratio, smoking, diabetes, hypertension, and number of diseased vessels) was included in the basic model to derive the basic categories. mg / l) was added into the new model based on the basic model. the study population consisted of consecutively enrolled cae patients who had been admitted to our hospital and had undergone a coronary angiography during january 2009 and july 2013. the indication for coronary angiography was either the presence of typical angina or positive or equivocal results of noninvasive screening tests for myocardial ischemia. cae was defined as a localized or diffused luminal dilation exceeding 1.5-fold of the normal adjacent arterial segment. the cae patients were included consecutively, regardless of whether they had an o - cad or not. those who presented the following characteristics were excluded from the study : acute coronary syndrome, acute or chronic infection, renal failure, hepatic dysfunction, malignant disease, hematological disorder, pregnancy, severe valvular disease, cardiomyopathy, congenital heart disease, and drugs or alcohol abuse. the patients medical history and physician - administered physical examination information were obtained from the hospital 's medical records. all patients provided their informed consent, and the study was approved by local ethics committee. the baseline hs - crp values and other blood biomarkers were also collected from our medical records system, and all these biomarkers were measured from the samples collected in the morning after an overnight fast. the hs - crp was determined with an aus5400 (olympus, japan) molecular analyzer at our clinical laboratory department. the follow - up was performed through telephone interviews and consultation of the hospital 's medical records in july 2014. the researchers who conducted the follow - up were blind to the baseline status of the cae patients. the observational outcome was the composite of two cvs : cardiac death and nonfatal myocardial infarction. cardiac deaths were defined as death diagnosed by medical practitioners as definitely cardiogenic or unexplained sudden death. where a patient had reached more than one end point, only the first event was taken into count. all the data were analyzed with sas software, version 9.3 (sas institute, cary, nc, usa), and a two - tailed p 3 mg / / l) was illustrated with a kaplan - meier curve, and the values were compared with a log - rank test. the adjusted kaplan meier curve and hazard ratios (hrs) were also obtained. subsequently, we examined the net reclassification improvement (nri) and of the risk categories (> 3 mg / l, 3 mg / l) for the prediction of the 3-year event - free survival and the integrated discrimination improvement (idi) by adapting recent approaches to convert the numbers into suitable survival data. the nri measures the correctness of reclassification of patients based on their predicted probabilities of events using the new model with the option of imposing meaningful risk categories (> 3 the idi measures the new model 's improvement in average sensitivity without sacrificing average specificity. the multivariate logistic regression model was used for this analysis. a combination of the classical cardiovascular risk factors (age, sex, body mass index (bmi), low - density lipoprotein (ldl)/high - density lipoprotein ratio, smoking, diabetes, hypertension, and number of diseased vessels) was included in the basic model to derive the basic categories mg / l) was added into the new model based on the basic model. based on the inclusion and exclusion criteria, 577 cae patients were included in our study cohort, and we eventually obtained follow - up results for 540 (93.6%) of them. the longest follow - up duration was about 66 months, while the shortest was 12 months. during this follow - up period, 30 cvs12 cardiac deaths and 18 nonfatal myocardial infarctions comparisons of the baseline characteristics between the groups of patients with cvs and without cvs were shown in table 1. the patients with cvs were much older (62.87 10.01 vs. 56.68 10.95 months, p = 0.0026) and had a relatively lower left ventricular ejection fraction (55.38% 12.36% vs. 60.49% 9.93%, p = 0.0081) than those without cvs. however, there was no statistically significant difference between the groups in terms of sex, hypertension, hyperlipidemia, diabetes mellitus, smoking, family history of coronary heart diseases, prior myocardial infarctions, prior cerebral vascular diseases, gensini score, and medications. baseline characteristics of cae patients who had composite cardiovascular events and those who were events - free t - test value ; chi - square test value. aceis : angiotensin - converting enzyme inhibitors ; arbs : angiotensin receptor blockers ; bmi : body mass index ; chd : coronary heart disease ; cv : cardiovascular ; cvd : cerebral vascular disease ; lvef : left ventricular ejection fraction ; mi : myocardial infarction. comparisons of the routine laboratory examination results between groups with cvs and without cvs according to the binary classification (by the median level) and quartered (by quartiles) classification are shown in the supplementary materials [supplementary tables 1a and 1b ]. in the binary classification, the group with cvs had a larger proportion of parameters including left ventricular ejection fraction (79.3% vs. 49.7%, p = 0.0013)below the median level than the group without cvs. conversely, there was a smaller proportion of direct bilirubin (30.8% vs. 52.9%, p = 0.0263) below the median level in the group with cvs than the group without cvs. in the quartered classification, the following variables had statistical significance : the left ventricular ejection fraction, neutrophils, brain natriuretic peptide, and direct bilirubin. comparisons for composite cardiovascular events by the median of various routine laboratory examination results bnp : brain natriuretic peptide ; cv : cardiovascular events ; dbil : direct bilirubin ; hs - crp : high - sensitivity c - reactive protein ; ldl - c : low density lipiproten - cholesteral ; lvef : left ventricular ejection fraction. comparison for composite cardiovascular events by the quartile of various routine laboratory examination results bnp : brain natriuretic peptide ; cv : cardiovascular ; dbil : direct bilirubin ; hs - crp : high - sensitivity c - reactive protein ; ldl - c : low density lipiproten - cholesteral ; lvef : left ventricular ejection fraction. table 2 shows comparisons of the baseline characteristics between cae patients with hs - crp 3 mg / l and those with hs - crp > 3 mg / l. the patients with hs - crp > 3 mg / l showed a greater incidence of hypertension (35.6% vs. 26.9%, p = 0.0270) and a larger bmi (27.09 3.71 vs. 26.20 3.14 kg / m, p = 0.0036). in terms of medications, there was more aspirin usage in the group with hs - crp > 3 mg / l. there were no significantly statistical differences between the two groups in the other baseline characteristics. comparison of the baseline characteristics of the cae patients with hs - crp 3 mg / l and hs - crp > 3 mg / l t - test value ; chi - square test value. acei : angiotensin - converting enzyme inhibitor ; arbs : angiotensin receptor blockers ; bmi : body mass index ; cabg : coronary artery bypass graft ; chd : coronary heart disease ; cvd : cerebral vascular disease ; mi : myocardial infarction. the multivariable analysis of the association between an hs - crp > 3 mg / l vs. an hs - crp 3 mg / l and cvs was obtained with cox proportional hazard models [table 3 ]. after adjustment for the prognostic factors of cae identified by a previous study (i.e., age, diabetes mellitus and hyperlipidemia), a higher hs - crp level (> 3 mg / l) remained an independently significant predictor of cvs (hr : 2.33, 95% confidence interval [ci ] : 1.134.81, p = 0.0215). after further adjustment for brain natriuretic peptide and lymphocyte, an hs - crp level > 3 mg / l was still associated with a higher risk of cvs (hr : 2.11, 95% ci : 1.024.38, p = 0.0445). adjustment for bmi, neutrophils, left ventricle ejection fraction, direct bilirubin, and sex seemed to increase the strength of this association (hr : 2.99, 95% ci : 1.316.81, p = 0.0091). hrs (95% ci) of cardiovascular events in relation to baseline hs - crp (> 3 mg / l vs. 3 mg / l) among cae patients bmi : body mass index ; cae : coronary artery ectasia ; hs - crp : high - sensitivity c - reactive protein ; hrs : hazard ratios ; ci : confidence interval. model 1 diabetes mellitus and hyperlipidemia ; model 2 adjusted for the above variables plus age ; model 3 adjusted for the above variables plus brain natriuretic peptide ; model 4 adjusted for the above variables plus lymphocyte ; model 5 adjusted the above variables plus bmi, neutrophils and left ventricle ejection fraction ; model 6 adjusted for the above variables direct bilirubin ; model 7 adjusted for the above variables and plus gender. meier analysis of cv - free survival according to the hs - crp level (3 mg / l) is curved in [figure 1 ]. from the curve in figure 1a, it is apparent that the event - free survival rate of the patients with hs - crp > 3 mg / l differed from that with hs - crp 3 mg / l (log - rank test for trend, p = 0.0235). after adjusting for the age, gender, diabetes mellitus, hyperlipidemia, bmi, lymphocyte, neutrophils, natriuretic peptide, left ventricle ejection fraction, and direct bilirubin, the cumulative 66-month event - free survival rate of cae patients with hs - crp 3 mg / l remained considerably better than that of patients with hs - crp > 3 mg / l [hr = 2.66, 95% ci : 1.225.77, p = 0.014 ; figure 1b ]. kaplan meier curve for composite cardiovascular events by hs - crp (> 3 mg / l vs. 3 mg (a) the survival rate of the patients with hs - crp > 3 mg / l notably distinguished from those counterpart (log - rank test, p = 0.0235). (b) the cardiovascular events risk of patients with hs - crp > 3 mg / l was still much higher than those with hs - crp 3 mg / l (hr = 2.66, 95% ci : 1.225.77, p = 0.014). the adjusting variables include age, gender, diabetes mellitus, hyperlipidemia, body mass index, lymphocyte, neutrophils, natriuretic peptide, left ventricle ejection fraction, and direct bilirubin. hs - crp : high - sensitivity c - reactive protein ; hr : hazard ratio ; ci : confidence interval ; cae : coronary artery ectasia. the reclassification was assessed to further explore whether the hs - crp added to the predictive value of traditional risk factors for the outcomes of cae [table 4 ]. unexpectedly, the nri for hs - crp was merely 0.01 (p = 0.8798). however, the hs - crp yielded an idi of 0.02 (p = 0.033). the p value improved from 0.344 to 0.897 in the hosmer lemeshow test, which quantifies the extent to which the predicted probabilities match the actual experience. however, there was no improvement in the reclassification of hs - crp for the prediction of cardiovascular death or of nonfatal myocardial infarction. net reclassification improvement and integrated discrimination improvement for hs - crp mi : myocardial infarction ; bmi : body mass index ; ldl : low - density lipoprotein ; hdl : high - density lipoprotein ; nri : net reclassification improvement ; idi : integrated discrimination improvement ; the basic model comprised age, sex, bmi, ldl / hdl ratio, smoking, diabetes, hypertension, and number of diseased vessels. the present study assessed the prognostic value of hs - crp for patients with cae. the major finding of this study is that the hs - crp on admission is an independent predictor of the cardiovascular outcomes in cae patients. there has been relatively limited research on the outcome of cae and the prognosis for patients with the condition remained. three decades ago, the largest cohort study of cae to date found that the aneurysmal patients had a 5-year mortality rate of 26%. in 2004, baman. reported a 5-year mortality rate of 29.1% in a cohort of 276 cae patients however, in another study of 258 cae patients, the cardiovascular deaths over the follow - up period of 49 21 months only represented 2%. in the present study, we obtained follow - up data for 540 cae patients over a median follow - up period of 36 (37.41 15.88) months, and observed 12 (2.22%) cardiac deaths and 18 (3.33%) nonfatal myocardial infarctions. in light of these numbers a phenomenon that might be partially explained by the advances in medical therapy. in the present analysis, hs - crp > 3 mg / l was identified as an independent predictor of poor prognosis in patients with cae. however, there has been conflicting information about the ideal and incremental level of hs - crp for the prediction of cvs. in several studies, a median hs - crp value of 2 mg / l was regarded as the appropriate cutoff point for the identification of increased risks of cvs. however, more than 50% of adults and 41% of 20-year - olds in the united states have an hs - crp level > 2 mg / l. therefore, an hs - crp of 2 mg / l might not be an ideal cutoff point for risk stratification. the clinically applied threshold of hs - crp > 3 mg / l might be more suitable for the identification of high risks of future cardiovascular complications. in a study, patients with coronary artery disease were followed for a median of 5.0 years (5.1 0.3 years), and those with an hs - crp > 3 mg / l had a significantly higher coronary events risk than those with an hs - crp level 3 patients with stable angina whose hs - crp exceeded 3 mg / l were subjected to more frequent subsequent cardiovascular death, myocardial infarctions, and strokes. in the present study, we applied the cdc / aha hs - crp cutoff point (> 3 mg / l) for the identification of the higher risk group and demonstrated that an elevated level of hs - crp was associated with an increased risk of cardiovascular death and nonfetal myocardial infarction in cae patients. but the survival rate of cae patients is similar during 5-year 's follow - up, no matter with o - cad or not. consistent with this result, there was no significant difference of gensini score between the group with cvs and without cvs [table 1 ], indicating that the poor prognosis of cae was not associated with the severity of the concomitant o - cad. the present study demonstrated that an elevated level of hs - crp was associated with a higher risk of cvs, indicating that crp might be involved in the progression of cae. previous investigators have shown an increase in plasma crp in cae patients, and several reports have suggested that crp might contribute to the adverse cvs. at first, systematic inflammation as reflected in the concentration of crp preceded the onset of cvs rather than being a result of ischemia. second, crp could increase monocyte adhesion to endothelial cells and the secretion of matrix metalloproteinases, leading to endothelial dysfunction and medial destruction. third, the pro - thrombotic effects of crp were demonstrated in human as well as transgenic mouse. finally, the therapeutic inhibition of crp could counteract the increase in infarct size and cardiac dysfunction produced by the injection of human crp in rats. besides demonstrating the prognostic role of crp in cae patients, this study also had its clinical implications. consideration of hs - crp level could be used in the risk stratification of cae patients. irrespective of ldl cholesterol concentration, a higher hs - crp concentration has previously been associated with a higher coronary event rates. similarly, in this study, a higher hs - crp level indicated a poor prognosis in cae patients. therefore, consideration of hs - crp level might be helpful in tailoring the therapy to individual cae patients. this might have influenced the accuracy of the multivariable cox models and might limit the generalizability of the results. nevertheless, the present results suggested that crp might contribute to the progression of cae. second, the small value of the hs - crp nri for the outcomes might have resulted from the relatively small sample size and limited follow - up time. however, we found an idi of 0.02 (p = 0.033) and p value improvement in the hosmer lemeshow test ; these results were similar to those observed in cases of stable o - cad. finally, as we only used the hs - crp level on admission in the analyses, there was a lack of the longitudinal detection and continuous observation. however, considering the decade - to - decade consistency in crp values, the crp has been sufficiently suitable for the long - term prediction of cae patients prognosis. in conclusion, the hs - crp on admission was an independent predictor of cae patients adverse cvs in. in addition, this study suggested that the crp may play a role in cae, as a relationship was found between elevated hs - crp levels and poor cae prognosis. an hs - crp cutoff point of 3 mg / l might be considered for risk stratification in patients with cae. supplementary information is linked to the online version of the paper on the chinese medical journal website. this work was supported by a grant from the beijing municipal science and technology commission (no. this work was supported by a grant from the beijing municipal science and technology commission (no. | background : despite its severity, coronary artery ectasia (cae) is still poorly understood. high - sensitivity c - reactive protein (hs - crp) has been recognized as a prognostic factor in some cardiovascular diseases but not assessed in cae. the aim of this observational study was to investigate the prognostic value of hs - crp in cae.methods:our analysis evaluated the effect of the baseline hs - crp on cardiovascular events (cvs) (cardiac death and nonfetal myocardial infarction) in consecutively enrolled stable cae patients. we used the cox proportional hazards regression models to examine the association between baseline hs - crp level and follow - up cvs in cae. the net reclassification improvement and integrated discrimination improvement (idi) of hs - crp were also assessed.results:we obtained the follow - up results of 540 patients over a median follow - up period of 36 (37.41 15.88) months. the multivariable cox analysis showed that the hs - crp was a significant predictor of adverse outcomes in cae (hazard ratio [hr ] : 2.99, 95% confidence interval [ci ] : 1.316.81, p = 0.0091). in kaplan meier analysis, the group with hs - crp > 3 mg / l had a lower cumulative 66-month event - free survival rate (log - rank test for trend, p = 0.0235) and a higher risk of cvs (hr = 2.66, 95% ci : 1.225.77, p = 0.0140) than the group with hs - crp 3 mg / l. hs - crp added predictive information beyond that given by the baseline model comprising the classical risk factors (p value for idi = 0.0330).conclusions : a higher level of hs - crp was independently associated with cardiac death and nonfatal myocardial infarction in cae patients. the hs - crp level may therefore provide prognostic information for the risk stratification of cae patients. |
geriatricians in canada have long looked to our colleagues in the united kingdom for inspiration and guidance. a recent report by david oliver, catherine foot, and richard humphries on behalf of the king s fund raises many issues regarding current problems with the care for older adults in existing health - care systems and also suggests ways forward. given our long association and shared history (the debt that we owe includes many of our pioneering clinicians), there is reason to read making our health and care systems fit for an ageing population with care. here we hope not to summarize a lengthy and comprehensive review of many aspects of the health - care system, which are either problematic or promising in the care of frail older adults, but rather to highlight a few key issues which may help guide our thinking about the future of geriatric medicine in canada. one key shift in mindset argued for by oliver and colleagues is an increased focus on community - based and intermediate care as alternatives to acute - care hospitalization. hospital - centred care has such a strong culture that sometimes avoiding it can be more effective than trying to reform it. the framework of discharge to assess versus decide to admit presents a useful alternative to our current discharge to assess model, acute health needs are the focus of acute care encounters. patients are then discharged home, as soon as their condition has stabilized, for rapid follow - up of ongoing care and support needs by community - based clinicians. alternatively, clinicians can actively decide to admit patients who require admission for specific medical therapies, rather than having admission be the default path of least resistance. much stands to be gained from designing our systems of care to focus on care in the community and in the least acute setting possible, rather than subjecting older adults to the harms that are well - known in acute care and that typically have defied reform. solid systems of care in communities can also potentially streamline assessment processes and avoid duplication of efforts. some jurisdictions in the uk have even recognized that the assessment and therapy needs of older people living in their own homes do not take weekends off, leading to implementation of seven day care at home. (as wayne gretzky famously said) and get out in front of the move to community - based care. the important role remains for clinical specialists working in tandem with primary care systems and clinicians and (in an ideal world) an organized form of so - called intermediate care. such facilities aim to offer an environment in which rehabilitation and recuperation can be the primary focus, rather than settling onto the treadmill of yet more investigations which may add less benefit to frail patients then do solid clinical acumen, and a focus on improving function and meeting goals that are truly patient centered. it also means making routine care less hazardous for example, by avoiding the twin evils of over sedation and inadequate pain treatment and promoting early mobilization, proper nutrition, interprofessional collaborative practice, and early involvement of patients and families in setting goals of care. when it was introduced, intermediate care was quite controversial, as it appeared to harken back to the regrettable era in which geriatric medicine was viewed as an undertaking of care for second - rate patients in second - rate facilities by second - rate doctors. in a sharply worded 2001 bmj commentary, raymond tallis and grimley evans argued that in the operationalization of the uk national service framework for older people, the good intentions of clinical experts were sidetracked by the political agenda to keep old people out of hospital by reducing their inappropriate use of hospital beds, an agenda largely driven by cost savings but which had undertones of value judgments on the patient population, as well. in any event, renewed focus on good intentions and the evidence base (of reducing harmful interventions and environments which thrive in acute care hospitals) allows the benefits of intermediate care, with its focus on sensible medical care, rehabilitation, and re - enablement, to be realized. the idea of intermediate care might sound pejorative still, but it should be recognized that it can be either a (from care at home) or a step down (from acute care hospital). here, less is more : ideally, intermediate care is provided close enough to acute care that clinicians have an easy commute, but far enough away to allow them to avoid the temptation to over - investigate and treat what need not be investigated or treated. for many frail older people, the trap of access to invasive investigations that are too easy and too often - used, again by default, is a deep one. still, in an era in which patients labelled as social admissions have a high risk of death, we need to be alert that words matter, especially when they are meant to designate whole areas of activity ; they re not called brands for no reason. in recent years there has been an increasing focus on efforts to keep frail older adults out of emergency departments. while these efforts may be well intentioned, emergency health systems, including paramedics, ambulance services, and emergency departments, remain an important point of access to care when need is greatest. in consequence, we should seek not to turn people away who need help, but rather to create better pathways of care once they have reached out for assistance. for example, once a 911 call is made, if paramedics are trained and equipped to provide assessment and care on - site, a transfer to hospital may be avoided. even so, this can only work sustainably if care in the home does not end when the ambulance pulls away from the curb. clinical care programs focusing on rapid follow - up of older patients discharged from emergency departments (e.g., home visits by specialized clinicians trained in the principles of home - based comprehensive geriatric assessment [cga ]) show great promise in canadian settings and should be a focus for implementation and, importantly, evaluation and research. our current models of care for frail older adults have been heavily hospital - based. given that hospitals can do more harm than good for frail older adults, this is not un - problematic. alternatives include : keeping them out of hospital in the first place (geriatricians will have a pivotal role here, with familiar principles of cga and optimizing function, to which we would add a key role for advance care planning);making care less hazardous in the hospital (here we see a great role for intermediate care and attention to cultures of care which minimize iatrogenic and environmental harms) ; andattention to the interface between acute and long - term care this will have both clinical and administrative aspects with an emphasis on home supports that are flexible enough to meet the needs of users. keeping them out of hospital in the first place (geriatricians will have a pivotal role here, with familiar principles of cga and optimizing function, to which we would add a key role for advance care planning) ; making care less hazardous in the hospital (here we see a great role for intermediate care and attention to cultures of care which minimize iatrogenic and environmental harms) ; and attention to the interface between acute and long - term care this will have both clinical and administrative aspects with an emphasis on home supports that are flexible enough to meet the needs of users. the king s fund report challenges us to identify early priorities for change and quick wins. we also need to focus on what our brand will be, if we are to prosper, and not just compete, as canadian health care comes to grips with population ageing. what would be our quick win in a canadian context ? community - based care, while perhaps not entirely quick, could be that win. | a report from the united kingdom on making health and care systems fit for an ageing population proposes a range of interventions to make care better for older adults, especially those who are frail. here, we discuss the proposed shift for the acute care hospital to other models of care. the key for these models of care requires a fundamental shift to care that addresses the full range of an individual s needs, rather than being based around single diseases. how this might apply in the canadian context is considered. we emphasize strategies to keep people out of hospital but still receive needed care, make acute hospital care less hazardous, and improve the interface between acute and long - term care. |
a male patient was referred to a physician in a clinic with the chief complaint of abdominal pain for 2 3 days. the patient 's sister noted that the patient was a psychiatric patient diagnosed with depression, anxiety as well as drug addiction. the patient 's sister also noted that the patient had no verbal communication due to intentional omitting of speaking and denying all drugs for 7 days. considering the patient 's history, the patient also presented agitation, sleeplessness and increased appetite at that period, which matched the description of amphetamine withdrawal. this case was examined by the physician in charge and he found that the patient had voluntary abdominal guarding and poor cooperation with physicians. the patient was firstly suspected to be a possible case of drug withdrawal, and the abdominal pain was treated by oral and intravenous antispasmodic drugs. however, the patient had no better symptom. the patient was referred to the hospital and monitored at the emergency room for one more day. finally by observing the generalized guarding of abdomen and considering the laboratory results (negative urinalysis, neutrophilia from complete blood count), the patient was diagnosed as a possible case of appendicitis. acute appendicitis is a difficult - to - diagnose condition in many situations (4, 5). the diagnosis of acute appendicitis can be delayed in many cases and can cause problems. in this report, this case presents difficulty in diagnosis. the patient 's signs and symptoms of appendicitis are not classical and fully mimicked with the underlying psychiatric signs and symptoms. indeed, the abdominal pain can be an important presentation in the drug withdrawal case (6, 7). it should be noted for the importance of concealing a physical diagnosis by psychiatric history or mental states (3, 8). it is estimated that about one twentieth to one tenth of the psychiatric cases might have occulted somatic disorders (9, 10). therefore, this case report suggests that general practitioners should be aware of possible undetected physical disorders in psychiatric cases. | physical disorders can be seen in psychiatric patients. in addition, a delayed diagnosis can cause a serious complication of the physical disorder among such patients. in this report, a case of appendicitis in a psychiatric case with drug withdrawal symptoms was reported. |
cancers of the upper urinary tract (including renal parenchyma, renal pelvis and ureters) are rare, occurring in only 8% of all renal malignancies. furthermore, primary rscc is less commonly seen, with a prevalence of 1.35% of the malignancies of the upper urinary tract. rscc usually progresses insidiously, resulting in a late presentation ; such cancers present at a later clinical stage and appear to be a more aggressive disease when compared to other histological types. prognosis is usually poor with a mean survival period of 7 months, more so with neoplastic extension of the tumor into the inferior vena cava. surgical resection is the management of choice, as alternative modalities of treatment have not been proven to be effective. we report a case of a 56 year old gentleman with right rscc with tumor encasing the ivc, treated successfully with surgical resection. a 56-year - old man with a past medical history of hypertension, first presented to a district hospital with the complaint of hematuria. investigations done included an intravenous pyelogram, demonstrating a horseshoe kidney with right kidney staghorn calculi. the patient underwent an exploratory laparotomy with the primary intention of removing the staghorn calculi. intra - operatively, a large retroperitoneal mass was found, encasing the ivc down to the bifurcation of the iliac veins. in view of these unexpected findings subsequently, 6 cycles of carboplatin adjuvant chemotherapy was instituted to reduce the size of the remaining tumor. the patient then presented to our hospital for further treatment. at our hospital, physical examination did not reveal any significant findings, with no palpable masses or lower limb swelling. computer tomography (ct) scans of the chest, abdomen and pelvis (fig. 1a and b) showed a retroperitoneal mass measuring 7.6 cm by 7.0 cm by 4.0 cm in the right renal fossa, contiguous with the anterior aspect of the paravertebral muscle, with invasion into the inferior vena cava, right adrenal gland and right psoas muscle. the patient was electively admitted for exploratory laparotomy and resection of the right retroperitoneal tumor and ivc. intra - operatively, a large tumor was found involving the ivc, extending caudally to just above the confluence of the iliac veins and superiorly to just below the insertion of the hepatic veins, lateral to the aorta, and medial to the psoas muscle (fig. 2). upon further dissection, proximal and distal control of the ivc was obtained. the left renal vein was then isolated and clamped distal to the gonadal and lumbar veins, but as close to the ivc as possible ; the left kidney was observed to continue to produce urine, hence the decision was made to ligate the left renal vein close to the ivc. since the ivc clamping was well - tolerated by the patient, the ivc was resected enbloc with the tumor without reconstruction required. histology of the resected tumor showed moderately differentiated invasive squamous cell carcinoma, and margins were negative for malignancy. rscc is frequently associated with risk factors such as chronic inflammation, nephrolithiasis, a non - functioning kidney, horseshoe kidney, analgesic abuse and smoking. scc of the upper urinary tract is believed to arise via a process of squamous metaplasia of the urothelium. common presentations of rscc have been frequently described as one or a combination of the following : hematuria, hydronephrosis, nephrolithiasis, loin or flank pain, paraneoplastic syndromes. in our case, the patient had two of these risk factors that contributed to squamous metaplasia : staghorn calculi and a horseshoe kidney, and one of the described presentations of hematuria. diagnosis of rscc is commonly made after surgical resection, by histological analysis of the resected specimen. detection of the tumor on via imaging modalities is difficult because the common radiological features are those of renal calculi or hydronephrosis, both arising due to an obstructive process. several case reports used the non - invasive method of urine cytological to achieve the histological diagnosis, with confirmation after surgical resection. mainstay of treatment of rscc is still surgical resection, either by nephrectomy or nephroureterectomy, with clear margins. benefit from neoadjuvant and adjuvant radiotherapy and chemotherapy is small in the management of rscc. the spread to the surrounding vasculature is not uncommon as the patients tend to present late, with the spread including that of the hilar vessels and the ivc. in the last 20 years, only 11 cases of vascular involvement of the rscc tumor have been reported, of which 8 cases involved both renal vein and inferior vena cava, and 3 cases only the renal vein. however, the management of the vascular involvement of the tumor was not discussed in - depth in these cases. compared to renal cell carcinomas, where caval involvement is almost always limited to tumor thrombus within the lumen without significant vessel wall invasion, complete tumor resection can be accomplished without major inferior vena cava resection. this is done by removing the tumor within the vessel with limited exposure and thrombectomy techniques. however, in our case of rscc, the tumor invaded the entire ivc and thus oncologic resection requires complete caval excision. ivc resection without reconstruction can be successfully performed with the following caveat : good collateral circulation must be present in the form of the lumbar veins, adrenal veins, and gonadal veins. these pathways may be well developed in cases of tumor compression or rarely occlusion of the ivc. good collateral circulation ensures that ligation will be well tolerated without clinical evidence of venous hypertension. it is confirmed by first clamping the left renal vein and observing for good urine output, then clamping the ivc and observing that the patient 's blood pressure remains stable. test clamping is crucial because a sudden dip in the systolic blood pressure to approximately 80 mmhg would occur due to a sudden significant decrease in venous return in the case of poor collateral circulation. complete ivc occlusion without edema of the lower extremities post - operatively could be a predictor of the need for ivc reconstruction. in our patient, he presented with no signs of lower limb edema. if there should be no or poor urine output after clamping the renal vein, then the ivc should be reconstructed and the renal vein replanted. in the absence of potential intraoperative contamination, the ringed, reinforced polytetrafluoroethylene (ptfe) graft is our choice for ivc replacement. options for an autologous graft for circumferential replacement would include the superficial femoral vein. alternatively, a cryopreserved vein graft can be used. ivc resection in our case was successfully performed due to sufficient collateral circulations (gonadal veins, lumbar veins, adrenal veins) which would avoid the occurrence of renal failure, and allow the effective drainage of the remaining kidney. due to fulfillment of this caveat, preservation of the function of the kidney in this patient is of great importance as he has only 1 kidney remaining. in view of the late clinical stage of rscc at first presentation, with poor median survival times of 10 months or less, as well as the lack of effective adjuvant radiotherapy or chemotherapy, radical resection with clear margins may be the only method to prolong survival.. radical excision with clear margins en bloc with the tumor is feasible in selected cases. written informed consent was obtained from the patient for publication of this case report and accompanying images. a copy of the written consent is available for review by the editor - in - chief of this journal on request. lin zhimin involved in study design, data collection, data analysis and interpretation, writing the paper. chng jack kian involved in study design, data collection, data analysis and interpretation, writing the paper, revising the article critically for important intellectual content, final approval of the version to be submitted. soo khee chee helped for revising the article critically for important intellectual content, final approval of the version to be submitted.key learning pointsthe primary curative treatment of rscc is surgical resection by nephrectomy or nephroureterectomy with clear margins.occasionally, these margins may include surrounding vasculature such as the ivc, which should also be resected.however, the decision to resect the ivc without its reconstruction will depend on the presence of good collateral venous circulation already present in the patient.this can be predicted if the patient has complete ivc occlusion with no edema of the lower extremities.intra-operatively, test clamping the renal vein and the ivc while watching for changes in the systemic blood pressure and urine output will confirm this. the primary curative treatment of rscc is surgical resection by nephrectomy or nephroureterectomy with clear margins.occasionally, these margins may include surrounding vasculature such as the ivc, which should also be resected.however, the decision to resect the ivc without its reconstruction will depend on the presence of good collateral venous circulation already present in the patient.this can be predicted if the patient has complete ivc occlusion with no edema of the lower extremities.intra-operatively, test clamping the renal vein and the ivc while watching for changes in the systemic blood pressure and urine output will confirm this. the primary curative treatment of rscc is surgical resection by nephrectomy or nephroureterectomy with clear margins. occasionally, these margins may include surrounding vasculature such as the ivc, which should also be resected. however, the decision to resect the ivc without its reconstruction will depend on the presence of good collateral venous circulation already present in the patient. this can be predicted if the patient has complete ivc occlusion with no edema of the lower extremities. intra - operatively, test clamping the renal vein and the ivc while watching for changes in the systemic blood pressure and urine output will confirm this. | introductionrenal squamous cell carcinoma (rscc) is a rare tumor that is usually diagnosed late as a locally advanced malignancy with adjacent structure involvement. radical surgical resection with negative margins is the mainstay of treatment, as it is correlated with improved survival, while other modalities of treatment have been shown to have limited efficacy.presentation of casewe report a case of a 56 year old gentleman with right rscc with tumor encasing the inferior vena cava (ivc), treated successfully with surgical resection.discussionthe surgical management of vascular involvement of similar tumors has not been discussed in - depth in the literature. surgical resection of the ivc without reconstruction can be done successfully in the circumstance of good collateral circulation ; otherwise ivc resection with reconstruction will be necessary.conclusionradical resection with clear margins of rscc tumors with vascular involvement is feasible in selected circumstances. |
performance monitoring is a major executive function, which allows for an online adaptation of behavior according to internal goals and standards and includes the process of error monitoring. in order to accomplish goal - oriented behavior and prevent performance errors, we constantly control the outcome of our actions in order to detect a discrepancy between the expected (i.e., intended) and the real action - outcome, and continuously adjust our behavior accordingly. on the neurophysiological level, erroneous actions are accompanied by a frontocentral negativity (termed error negativity (ne) or error - related negativity (ern)) and a corresponding centroparietal positivity (error - positivity, pe). the ern typically occurs within the first 100 ms after an erroneous response, while the pe occurs within 200450 ms after an incorrect response. previous studies have shown that the medial frontal cortex (mfc) plays a key role in action monitoring. the premotor / supplementary motor area (brodman area 6) and caudal anterior cingulate cortex (acc) have been identified as main generators of the ern, whereas source localization studies with loreta (low resolution electromagnetic tomography) localized the generator of the pe within brodmann area 24 of the acc. these results suggest that the ern and pe stand for distinct components of error monitoring. while the ern is thought to be an early indicator of errors that is not dependent on conscious error detection, the pe component is more likely to reflect conscious aspects of error monitoring depending on error awareness. brain - injured patients and patients with psychiatric disorders have been found to show performance - monitoring deficits with a corresponding modulation of the electrophysiological correlates of error monitoring [69 ]. all these examples of performance monitoring dysfunctions caused by pathological changes of cortical excitability suggest that a modulation of medial frontal brain areas that are relevant for error processing and performance monitoring might be a valuable additional tool in the therapy of psychiatric disorders. noninvasive neurostimulation techniques such as tdcs permit to induce neuroplasticity in human brains and thus allow us to explore cortical modulation of neural networks. tdcs is a non - invasive, pain - free procedure that is able to modulate cerebral excitability by applying weak currents of ~1 ma through surface electrodes to the scalp. the basic principle of the method is that anodal stimulation with positive charging leads to a depolarization of the membrane potential and an increase of cortical excitability, while cathodal stimulation with negative charging leads to hyperpolarization of the resting membrane potential and a decreased firing rate of cortical neurons. accordingly, both protocols have been shown to result in modified amplitudes of different erp components. the first approaches that were taken with tdcs aimed at producing localized changes of motor cortex excitability. soon after these first proof - of - principle studies, further studies emerged that explored the modulation of neural networks implicated in human cognitive functions such as working memory, verbal fluency, or implicit learning, were originally designed to address patients with various neurological or psychiatric disorders, and were also conducted with a neuroergonomic mindset. based on these findings and considerations, our study aimed at investigating neurophysiological correlates of error monitoring (ern, pe) via eeg recordings during stimulation of the brain with weak direct current. based on previous functional imaging and erp studies that consistently indicated the acc (and neighboring regions) as the neuroanatomical source of both the ern and the pe, we realized an experimental setup in which the participants underwent dc stimulation over the medial frontal cortex while performing a modified version of the eriksen flanker task as an experimental paradigm to test response conflict and error monitoring during an eeg recording. according to previous studies investigating motor and cognitive functions, in which a dual - polarity effect for stimulation applied over different cortical areas emerged [1518 ], we hypothesize that stimulation with weak direct current over the mpfc might lead to an anodal - excitatory effect under the stimulated area with increased amplitudes of the ern and pe, whereas cathodal stimulation might have an inhibitory impact, resulting in smaller amplitudes of the ern and pe. a peculiarity of the analyzed event - related potentials is that source localization studies investigating neural generators contributing to the ern and pe revealed different subcomponents of the pe. van vean and carter described an early pe corresponding to caudal acc activation and a later pe with rostral acc and superior parietal cortex activation. furthermore, a study investigating to what extent erp correlates are related to error awareness showed an increased late pe for aware compared to unaware errors, whereas no dissociation between aware and unaware errors was found for the early pe. these results replicated a study by nieuwenhuis and colleagues. based on these findings indicating potentially different neural generators and functional significance of the late pe compared to the early pe a possible interfering effect between an increased excitability through stimulation over one of the tdcs electrodes and an inhibition effect on the brain area under the opposite electrode shall be taken into account. for example, it would be conceivable that an inhibition of the visual system occurs as a consequence of inhibition as one of our tdcs electrodes is placed between oz and the inion. therefore, we analyze the p1 as an early component of the event - related potential evoked within the visual cortex. with the present study, we intend to shed light upon stimulation effects of tdcs on error monitoring by investigating changes of the ern and pe systematically during anodal, cathodal, and sham stimulation. forty - eight healthy subjects (21 males, 27 females ; mean age : 23.9 years ; sd = 2.5, range 2030) participated in this experiment. we randomly assigned these subjects to three groups receiving either anodal stimulation (6 males, 11 females ; mean age : 24.2 years, sd = 2.7), cathodal stimulation (8 males, 7 females ; mean age : 24.0 years, sd = 2.1), or sham stimulation (7 males, 9 females ; mean age : 23.5 years, sd = 2.5). all participants received a verbal and written explanation of the purpose of the experiment and gave their written informed consent to participate in the study. the study was approved by the ethical review board of the medical faculty of the university of wuerzburg. exclusion criteria were self - reports of current or former neurological or psychiatric disorders, current or former use of medication affecting the central nervous system, pregnancy or a history of intracranial metal implantation, cochlea implant, or cardiac pacemaker. all subjects underwent neuropsychological tests including the center for epidemiological studies depression scale (ced - s) in its german version (ads - k, allgemeine depressionsskala) in its short version, the anxiety sensitivity index (asi-3), and the adult self report scale (asrs) as a screening for attention deficit hyperactivity disorder (adhd). in addition to that, mood changes were monitored using the positive and negative affect schedule (panas) before and after stimulating with tdcs. during the experiment, participants were sitting in a darkened and sound - attenuated cabin in front of a computer screen with eeg- and tdcs - electrode montage on the surface of their head as described below. first, they were asked to close their eyes and relax while a 3-minute resting eeg was recorded. following a short practice session of a modified version of the eriksen flanker task, we then started our anodal, cathodal, or sham dc stimulation with a total duration of 22 minutes. after a period of 2 minutes of forerun to maximize the effect of the stimulation, we instructed the participants to perform the eriksen flanker task during a period of 20 minutes while simultaneously recording the event - related potentials until the end of the dc stimulation. we thus used a so - called online approach, in which tdcs and eeg - recording overlapped in time, so that we could test how cortical stimulation instantaneously modulated the activity of the stimulated brain area. the experiment ended with another 3 minutes of resting eeg. for stimulation we used a dc stimulator by neuroconn, ilmenau (germany) approved for use in humans. during each tdcs trial, participants received either anodal, cathodal, or sham stimulation which is indistinguishable for the subjects (as described below). a pair of rectangular surface electrodes (5 cm 7 cm ; 35 cm) were coated with ten20 conductive paste (weaver and company, aurora co, usa) and then applied to the participants scalp (current density : 0.0286 ma / cm). following the literature, we positioned the tdcs electrodes according to the international 1020 system. as we intended to stimulate the medial prefrontal cortex (mpfc), we decided to place one electrode horizontally over fpz. as previous investigations have shown that maximizing the distance between both electrodes results in a decrease of current shunted through the head and an increase of current density in depth, we placed our second electrode between the inion and oz, also in a horizontal direction. placement of the electrodes was identical for sham and real stimulation. for anodal versus cathodal stimulation, the polarity of the frontal electrode was switched. at the beginning of the stimulation period, after that, a constant current of 1 ma was applied for a period of 22 minutes. current delivery of up to 2 ma has been shown to be safe and painless for healthy volunteers. the impedance was controlled by the stimulator and was below 20 k at all times. after 22 minutes of constant current, current was ramped out over another 10 seconds. for sham stimulation, the electrode placement, fade - in time, and current intensity were identical, but the stimulation was aborted / terminated after 2 minutes, that is, at the beginning of the eeg recording and performance of the eriksen flanker task. by starting sham stimulation exactly like a real stimulation, with an identical mild tingling that is felt on the skin under the electrode in the first seconds of real stimulation the eeg was recorded with an ac amplifier (mramp, brain products gmbh, munich, germany) and an acticap electrode system (brain products gmbh, munich, germany) with 32 electrodes. the electrodes were placed according to the international 1020 system with f7, f3, fz, f4, f8, fc5, fc1, fc2, fc6, t7, c3, cz, c4, t8, tp9, cp1, cp2, tp10, p7, p3, pz, p4, p8, p09, o1, oz, o2, and po10. all impedances of the electrodes were below 10 k and always below 5 k for the reference and ground electrode. eeg was recorded with a sampling rate of 1000 hz and a bandpass filter of 0.1100 hz as well as a notch filter of 50 hz. during the resting state eeg recordings at the beginning and at the end of the experiment, no tdcs was applied. in our experiment, we used a modified version of the eriksen flanker task, an experimental paradigm eliciting response conflict which is often used to study error - monitoring potentials. the participants sat in front of a monitor with a black background, where four different combinations of 5 arrow heads were presented (> > > >, > > >, < the participants were instructed to focus on the center arrow head while ignoring the flanking distracters, and to press a response button matching the direction of the central arrow with their right or left index finger as quickly and accurately as possible. 750 ms after their response a feedback signal indicated if their response was correct or not. a plus sign appeared for 500 ms if the answer was correct, a minus sign indicated an incorrect or missing response, and an exclamation mark indicated that the response was not given in time. prior to the beginning of the eeg recording, a timeframe for a correct and timely response was established by a practice session consisting of 48 trials during which the median reaction time for each participant was determined. in our experiment, the modified eriksen flanker task contained 280 trials presented in one continuous block. in the ongoing eeg, the presentation of the stimuli, the motor responses, and the feedback signals were tagged by different markers. participants underwent dc real or sham stimulation during the entire performance of the flanker task. to analyze the behavioral effects, we calculated the post - error slowing (pes), defined as reaction times in correct trials after a correct trial minus the reaction times in correct trial after an incorrect trial. the eeg data was analyzed with the brainvision analyzer version 2.0 (brain products, munich, germany). in a first step, the ocular electrodes were linked to one bipolar channel monitoring vertical eye movements. in a second step, data was rereferenced to an average reference and was then segmented into eeg epochs following correct or incorrect responses starting 100 ms before and ending 600 ms after the subject 's key press. based upon these eeg epochs, average erp waves were calculated for each participant after correct and incorrect responses. before that, eeg epochs with amplitudes exceeding 100 v or voltage steps of more than 100 v / sampling point were excluded by an automatic artefact rejection. subjects with anodal stimulation had 45.2 24.5 artefact - free epochs after incorrect responses and 140.9 32.3 artefact - free epochs after correct responses. participants with cathodal stimulation had 39.9 25.6 artefact - free epochs after incorrect responses and 105.3 44.4 artefact - free epochs after correct responses, while subjects with sham stimulation had 41.9 23.2 artefact - free epochs after incorrect responses and 139.4 46.9 artefact - free epochs after correct responses. groups did not differ significantly regarding the mean number of artefact - free epochs after incorrect responses (f = 0.19, p = 0.83), but after correct responses (f = 3.49, p < 0.05). this does not have a big influence on our findings, as we were mainly interested in epochs after incorrect responses. based on a visual inspection of the grand average waveforms, we individually calculated the mean amplitude for the time frames between 0 and 60 ms after correct and erroneous responses for the ern and the segments between 100 and 200 ms and between 200 and 300 ms after correct and incorrect responses for the pe. for both potentials, analyses were conducted for the central electrode position (cz), as the topographical maps (see figure 3) showed a brain electrical field distribution that was centred around cz for both the ern and the pe. the p1 responses as an indicator for an altered processing of visual information were defined as the maximum peak between 80 ms and 150 ms over three occipital electrodes (o1, o2, and oz according to the international 10/20 system for electrode placement). for statistical analysis, we used ibm spss statistics, version 19. for testing stimulation effects, we calculated an anova separately for the behavioural data, ern and pe with the factor condition (correct or erroneous responses) and tdcs group (cathodal, anodal, sham). in order to test the reaction time data for the phenomenon of posterror slowing, the factor condition comprised trials following correct responses and trials following incorrect responses for this dependent variable. univariate anovas were calculated for further analyses of main effects and interactions with planned comparisons comparing the two stimulation conditions with the sham condition using the fisher 's least significant difference (lsd). for the reaction time, a main effect of condition was found (f = 40.21, p < 0.001), with a significant increase of reaction times on trials following erroneous responses (464.5 60.6 ms) compared to trials following correct button presses (440.5 50.8 ms) across stimulation groups (posterror slowing). we did not observe a significant difference between stimulation groups (f = 2.04, p = 0.14) and no significant interaction between the factors group and condition with respect to the number of incorrect responses, no relevant difference between the three groups emerged (f = 1.53, p = 0.23) with a similar number of incorrect responses in participants of the anodal (41.4 18.9), cathodal (56.7 24.9) and sham group (46.6 30.5). posterror slowing (pes) was also directly analyzed as an indicator for a possible stimulation - induced behavioral effect. pes was not significantly influenced by the stimulation protocol (f = 0.041, p = 0.96 ; see also nonsignificant interaction effect above) ; specifically, pes was not significantly attenuated after cathodal stimulation (m = 23.07 26.30 ms) compared to anodal (m = 25.41 29.13 ms) or sham stimulation (m = 23.27 20.78 ms). for the ern (see figures 1 and 2), we calculated the mean amplitude over cz in the time segment of 060 ms after correct (m = 0.81 2.37 v) and erroneous (m = 2.32 2.93 v) responses revealing a significant increase of the amplitude after errors compared to correct answers (f = 66.8, p = 0.00001). no main effect of group (f = 0.91, p = 0.41) and no significant interaction effect of stimulation protocol and condition occurred (f = 0.85, p = 0.43). for the pe (see figure 1), we analyzed two time segments between 100 and 300 ms. with regard to the first time segment between 100 and 200 ms, we found a main effect condition (f = 53.10, p = 0.00001), indicating that mean pe amplitudes were higher for incorrect (m = 3.42 v 2.85) compared to correct (m = 0.84 v 2.48) responses ; no main effect for tdcs groups (f = 0.061, p = 0.94) and no interaction effect (f = 1.13, p = 0.33) were found. for the second time segment comprising the period between 200 and 300 ms, a main effect for condition was again found (f = 56.05, p = 0.0001), but no main effect for the type of stimulation could be observed (f = 1.19, p = 0.31). however, a significant interaction effect between tdcs group and condition additionally occurred (f = 3.23, p = 0.049). for further examination of the interaction effect (see figure 4) between the condition (correct or incorrect response) and the different stimulation groups, we used post hoc anovas to compare group effects for erroneous responses (f = 3.76, p = 0.03) and correct responses (f = 0.21, p = 0.81) separately and found a main effect for the erroneous condition only. planned post hoc comparison (lsd) for the erroneous condition showed no significant difference between anodal and sham stimulation (p = 0.92). however, comparing cathodal and sham stimulation, we found a significant difference (p = 0.019) with reduced pe amplitudes following cathodal stimulation, even after correction for multiple testing. analyzing the latency parameters (in the corresponding time window for the ern and for a time window including both time frames for the pe) for the ern, a significantly shorter latency after correct answers (m = 14.33 16.67 ms) compared to incorrect answers (m = 21.48 15.76 ms) was found (f = 8.34, p = 0.006). no significant main effect for the type of stimulation (f = 0.18, p = 0.84) and no significant interaction effect (f = 0.40, p = 0.67) were observed. the latency parameters for the pe revealed no main effect for the different types of stimulation (f = 1.16, p = 0.32) with similar latencies in the anodal (m = 168.73 10.84 ms), cathodal (144.63 11.54 ms), and sham group (m = 158.12 11.18 ms). latency of the pe after a correct reaction (m = 146.48 60.24 ms) was significantly shorter than that after an incorrect reaction (m = 168.88 45.03 ms) with f = 7.46 and p = 0.01. no interaction effect between condition and type of stimulation emerged (f = 1.07, p = 0.35). to check whether our tdcs electrode placement leads to a deficient visual processing, which might cause the effect on the pe, we calculated an analysis of variance (anova) for the p1 amplitudes which did not reveal a main effect group over o1 (f = 0.38, p = 0.68), o2 (f = 0.61, p = 0.54), or oz (f = 0.46, p = 0.63). the main purpose of our study was to shed light upon stimulation effects on error monitoring by applying tdcs during an eriksen flanker task and investigating the changes of the ern and pe systematically after anodal, cathodal, or sham stimulation. as expected, a main effect condition was observed for the ern and pe ; that is, the amplitudes of the ern and pe were significantly higher after incorrect responses than that after correct responses. for tdcs effects, we found that cathodal stimulation over the medial prefrontal cortex attenuated subcomponents of pe amplitudes compared to both anodal stimulation and sham stimulation, but no effect for the ern. we therefore conclude that tdcs shows an inhibition effect of cortical excitability during cathodal stimulation, while no enhancement of excitation by anodal stimulation could be observed. originally, the assumption that anodal stimulation increases cortical excitability whereas cathodal stimulation causes the opposite was based upon studies applying direct current stimulation over the human motor cortex [10, 29, 30 ]. however, the dual effect of anodal excitation and cathodal inhibition has not been reproduced in all subsequent studies testing effects of tdcs over nonmotor regions on cognitive functions. some studies describe an anodal excitation effect only, while others observed only a cathodal inhibition effect as we did. a recent meta - analysis reviewing publications of motor studies and cognitive studies with tdcs found a lot of heterogeneity particularly in cognitive studies and concluded that the probability to achieve the anodal - excitability and cathodal - inhibition effect in a cognitive study is only about 0.16. as a possible reason for this heterogeneity, the authors argue that cognitive tasks involve various cognitive regions of the brain. therefore, when modulating one part of this brain network, it is more difficult to induce any change in corresponding outcome measures than it would be for motor effects (e.g., concerning meps) which typically involve only the stimulated motor cortex. beyond that, the fact that a process as complex as the performance of a cognitive task, that involves various interactions between different brain regions, is so highly vulnerable to every external noise, making it extremely difficult to investigate the specific effects of tdcs and might be one reason for the finding of a cathodal inhibition effect only. normal mpfc (and we act on the assumption that our healthy participants all have a well functioning mpfc), a tdcs - induced impairment is possible due to cathodal inhibition, but that the same principle (with an opposite outcome) can not automatically be applied for anodal stimulation. mpfc with regard to error processing can not be enhanced by anodal stimulation due to a ceiling effect. in any case, we would like to summarize that, in the present study, the effect of tdcs stimulation was specific for cathodal stimulation and not a nonspecific effect of direct current application. another central issue of our study is the question of whether or not the brain region we targeted has actually been reached. as stated above, the surface of the cerebral cortex is folded, so that a large part of the cortex is located deep within the sulci where neurons are differently oriented. in early animal experiments, surface - anodal tdcs enhanced activity and surface - cathodal tdcs reduced activity of superficial cortical neurons, whereas neurons situated deep in the cortical sulci (and thus differently oriented) were oppositely affected. therefore, it is essential to take into account that not only electrode placement itself is an important parameter determining the electrical stimulation effects on the acc, but that the induced currents in the brain depend on tissue characteristics, which might even skew stimulation effects. one might ask in this context if current density was high enough to modify excitability. different calculations of current density distribution based on a spherical model of the head can help us to assess the current density during tdcs. calculations suggest that the average current flows in the expected direction independently of gyri and sulci of the brain and that an increasing distance between electrodes increases the current density in depth. furthermore, a minimum of 0.017 ma / cm has been described to be necessary to modify excitability by nitsche and paulus. the applied current density in our study was 0.029 ma / cm and the reference electrode was placed at a maximum distance from the first electrode over fpz, so that these parameters are in accordance with previous tdcs studies demonstrating a relevant effect of dc stimulation. nevertheless, computer - based head models would be useful to further analyze current distribution effects. another method that could be helpful to provide evidence for the influence of the stimulation on brain activity is electroencephalographic power spectrum analysis which has been used in recent studies to demonstrate that tdcs modulates resting state eeg parameters [3537 ]. in these combined eeg and tdcs studies, the power of different frequency bands was measured, indicating a direct impact of tdcs on oscillatory activity of the brain. keeser and colleagues stimulated the left prefrontal cortex by anodal tdcs and observed decreased delta activity over the left frontopolar cortex and enhanced beta activity over the right frontocentral cortex. loreta source localization revealed that the reduction of the delta power could be explained by a reduced activation in brodman area 25 and 32 (subgenual prefrontal and anterior cingulate cortex). these results confirm that cortical tdcs can indeed induce a modulation of deeper brain structures such as the acc, a key structure for error monitoring. with regard to our electrode placement, another aspect that has to be taken into consideration is an inhibition of the visual system as a result of a decreased cortical excitability under the electrode placed between oz and the inion. this deficient visual processing might lead to a modification of visual information that could be relevant for our behavior. therefore, we analysed the p1 as an early component of event - related potentials which are generated in the visual cortex and found no relevant difference for the amplitudes of the p1 in the three stimulation groups. we therefore assume that dc stimulation under the occipital electrode had no relevant effect on our experimental setting. the distance between the occipital electrode and oz seems to be large enough to avoid an undesirable modulation of the visual system another point that needs further consideration is the fact that no significant behavioral effects of tdcs were found in our study. generally speaking, goal - directed behavior includes the monitoring of ongoing actions on the one hand and adjustment of behavior on the other hand, both of which need to be linked at some point to organize behavior. neuroanatomically, there is evidence for a functional interaction between the mpfc and the lateral prefrontal cortex (lpfc), with prominent models of cognitive control assuming that the mpfc signals error detection to the lpfc where regulatory processes lead to adjustment of behavior. regarding posterror behavior, danielmeier and ullsperger describe that there are at least three types of post - error behavioral adjustment, that is, post - error - slowing (pes), post - error reduction of interference (peri), and post - error improvement of accuracy (pia), which partly take place in parallel. regarding pes, which was measured in our study, they assume that pes can be related to cognitive control processes and to inhibitory motor processes or reflect attentional reorientation. the expectation that pes should be attenuated by an inhibitory effect on the mpfc addresses the cognitive control theory according to which post - error adjustments are triggered by top - down signals. while some studies could show a correlation between pes and mpfc activation, other studies describe contradictory findings. as one possible reason for these inconsistent findings, it has been discussed that pes and mpfc are only linked indirectly via increased activity in the motor system. taken together, it should be noted that, when investigating posterror behavioral adjustments, the problem is that many adjustments are executed simultaneously. hence, measuring only mean reaction times as we did in our experiment is not always sufficient to reveal discrete behavioral changes, as it conceals temporal dynamics of error - monitoring processes. it can, for example, be difficult to distinguish the monitoring signal indicating the need for control from subsequent control implementation. to summarize, we restricted our behavioral analyses to effects on mean reaction times, thus providing an only incomplete picture of post - error behavioral adjustments by means of pes. therefore, relevant behavioral effects by tdcs interventions in our study were not necessarily expected and it can not be concluded that no post - error control implementation (or modulation thereof) has taken place. another argument which illustrates that behavioral data are sometimes not as sensitive as neural correlates comes from a preclinical study. in this study, we used the same flanker task to investigate whether error processing is deficient in students with high levels of adhd symptoms. as hypothesized, we found decreased pe amplitudes with an increased number of symptoms of inattention, but without an effect of adhd symptoms on the behavioral level of post - error slowing. in summary, the present study aimed at modulating medial frontal cortical areas relevant for error detection and action monitoring via tdcs. our results indicate that cathodal tdcs applied over the mpfc results in an attenuated cortical excitability reflected in a decreased amplitude of subcomponents of the pe. at this point, we could show an effect of single - session tdcs on the electrophysiological correlates of error monitoring in healthy subjects, even if it is rather small. nevertheless, further research is required to unravel whether the effect of the tdcs on the late pe is of functional relevance. based upon these investigations, transcranial direct current stimulation could become a future approach to modify the sensitivity of corresponding neural networks. future studies should be conducted to shed further light on the (patho)physiology of the underlying performance monitoring systems on cellular and system levels to allow for an optimization of stimulation - induced tdcs effects and to establish tdcs as a valuable therapeutic option for patients with error - monitoring dysfunctions. | background. in order to prevent future errors, we constantly control our behavior for discrepancies between the expected (i.e., intended) and the real action outcome and continuously adjust our behavior accordingly. neurophysiological correlates of this action - monitoring process can be studied with event - related potentials (error - related negativity (ern) and error positivity (pe)) originating from the medial prefrontal cortex (mpfc). patients with neuropsychiatric diseases often show performance monitoring dysfunctions potentially caused by pathological changes of cortical excitability ; therefore, a modulation of the underlying neuronal activity might be a valuable therapeutic tool. one technique which allows us to explore cortical modulation of neural networks is transcranial direct current stimulation (tdcs). therefore, we tested the effect of medial - prefrontal tdcs on error - monitoring potentials in 48 healthy subjects randomly assigned to anodal, cathodal, or sham stimulation. results. we found that cathodal stimulation attenuated pe amplitudes compared to both anodal and sham stimulation, but no effect for the ern. conclusions. our results indicate that cathodal tdcs over the mpfc results in an attenuated cortical excitability leading to decreased pe amplitudes. we therefore conclude that tdcs has a neuromodulatory effect on error - monitoring systems suggesting a future approach to modify the sensitivity of corresponding neural networks in patients with action - monitoring deficits. |
atherosclerosis is a multifactorial complex disease triggered and maintained by a low - level chronic inflammation of the arterial wall. the onset of atherosclerosis includes a dysfunction of endothelial cells, caused by a variety of external stimuli (e.g., hypertension, reactive oxygen species, or modified low - density lipoprotein (ldl) cholesterol). the damaged endothelium consequently begins to express more adhesive molecules, for example, vascular cell adhesion molecule 1 (vcam-1), leading to promoted adhesion and infiltration by immune system cells. the further development of atherosclerosis is influenced by a variety of risk factors, of which hyperlipidemia is considered one of the most important. severe hyperlipidemia promotes the progression of atherosclerosis and its end - points, that is, myocardial infarction or stroke, as shown in patients with familial hypercholesterolemia who suffer a myocardial infarction or stroke at a very early age [35 ]. key players in hyperlipidemia and atherogenesis development include ldl and high - density lipoprotein (hdl) cholesterol. ldl cholesterol may be considered a typical proatherogenic substance while hdl cholesterol is considered antiatherogenic [43, 44 ]. ldl particles are normally removed from circulation by ldl - receptors (ldl - r). in patients with hyperlipidemia, various molecular pathways involved in the lipid metabolism are affected, resulting in changes to circulating lipid levels. ldl - rs are often downregulated in such patients, which leads to the prolonged circulation of ldl particles in the bloodstream and subsequently to ldl modification, most commonly oxidation (oxldl) [1, 45, 46 ]. oxldl molecules may be effectively removed from circulation by scavenger receptors (sr) located on macrophages ; however, since this process is not controlled as well as ldl - r - mediated removal, it results in the formation of foam cells which are often identified in atherosclerotic lesions as promoting the development and formation of atherosclerotic plaques. in order to reverse the formation of atherosclerotic plaques, hdl particles are capable of ensuring reverse cholesterol transport, that is, cholesterol transport from peripheral tissues (e.g., atherosclerotic plaques macrophages) back to the liver. the improvement of reverse cholesterol transport via hdl could thus be beneficial for patients suffering from hyperlipidemia and atherosclerosis. the recognition of micrornas (mirnas, mirs), tiny noncoding rna molecules known to be involved in the posttranscriptional regulation of gene expression, facilitates the further understanding of the atherosclerosis process [4850 ]. mirnas are transcribed from corresponding genes located within intergenic regions or embedded within the introns of known protein - coding genes using rna polymerase ii / iii. subsequently, within the nucleus, pri - mir is cleaved with the enzyme drosha to precursor mirna (pre - mir) which is then transferred to cytoplasm via exportin-5/rangtp. in the cytoplasm, the pre - mir is cleaved with nuclease dicer, which results in the creation of a mirna duplex consisting of a mature mirna strand (mir) and a passenger mirna strand (mir). the mature mirna is usually more stable and is then loaded into the rna - induced silencing complex (risc) with argonaut (ago) proteins. within this complex, mature mirna binds to the 3-untranslated (3utr) region of its target mrnas, which results either in target mrna degradation (in case base complementarity is complete) or in a mrna blockade and the inhibition of protein translation (in case complementarity is incomplete) [49, 51 ]. although the mir strand is commonly degraded, some mir strands have been loaded into the risc as in the case of mature mirna strands, resulting in the inhibition of translation or degradation of other target mrnas. the posttranscriptional regulation of gene expression described above takes place within the cell (intracellularly). however, a novel class of recently described circulating mirnas may be found in the extracellular space [52, 53 ]. these mirnas may influence and further our understanding of atherosclerosis to a great extent, as they were found to be both stable (which makes them viable future biomarkers) and also functional in terms of facilitating the transport of mirna from one cell to another, thus enabling intercellular communication. this review aims to describe the roles of mirnas participating in the lipid and lipoprotein metabolism, with special emphasis placed on their possible involvement in the development and progression of atherosclerosis. the roles of circulating mirnas known to be involved in atherosclerosis will also be discussed briefly in order to provide the concluding rationale for the use of mirnas as possible atherosclerosis diagnostic and therapeutic tools. various molecules have previously been shown to play key regulatory roles in the lipid metabolism, including nuclear transcription factors : sterol regulatory element - binding protein (srebp), liver x receptor (lxr), or farnesoid x receptor (fxr). srebp, lxr, and fxr, along with other molecules including various mirnas, are closely involved in the orchestration of the proper course of the lipid metabolism. this section is dedicated to providing an overview of the functions of mir-33, mir-122, mir-27a / b, and several other mirnas (see table 1) which were shown to be involved in this complex regulatory network. in 2004, rodriguez. identified mir-33, embedded within intron 16 of the srebp gene ; however, it took several years of additional study to find out that, together with its host gene, mir-33 regulates the metabolism of cholesterol and fatty acids [7, 8, 11 ]. two members of the mir-33 family mir-33a and mir-33b which differ in only two nucleotides and which are embedded in the introns of srebp-2 and srebp-1, respectively, are present in humans. as mentioned in the introduction, during mirna biogenesis, pre - mir-33 (as well as any other pre - mirs) is cleaved with dicer, which leads to the creation of a mir-33 duplex composed of mature (mir-33) and passenger (mir-33) mirna strands. as shown by goedeke. in 2013, mir-33 is one of the examples where both strands are loaded into risc and consecutively execute their tightly related function, thereby affecting cholesterol metabolism [611 ], fatty acids metabolism [9, 58 ], and glucose metabolism / insulin signaling [9, 58, 59 ]. within the cholesterol metabolism, both mir-33 and mir-33 target atp - binding cassette a1 (abca1) and niemann - pick disease c1 (npc1), that is, molecules important for loading cholesterol into hdl particles and for cholesterol transport from the lysosomal compartment within the cell, respectively [6, 7, 9, 10 ]. mir-33 itself was further shown to target abcg1 in mice, which has a similar function to abca1, that is, enabling hdl formation and reverse cholesterol transport (e.g., cholesterol transport from atherosclerotic plaque macrophages back to the liver) ; however, this target was not confirmed in humans [6, 10 ]. interestingly, both abca1 and abcg1 are under the transcription control of lxr and mir-33 thus provides the connecting link between srebp - induced cholesterol synthesis and retention and lxr - mediated cholesterol efflux and reverse transport. in addition to above described mechanisms, mir-33 targets abcb11 and atp8b1, both of which are important molecules in cholesterol efflux into biliary ducts ; this targeting thus supports cholesterol retention caused by the upregulation of srebp and mir-33 in hepatocytes. this upregulation may be induced by extracellular signals including low circulating cholesterol levels or statin therapy (figure 1). confirmed targets for both mir-33 and mir-33 in the fatty acid metabolism include carnitine palmitoyltransferase 1a (cpt1a) and carnitine o - octaniltransferase (crot) furthermore, mir33 also targets hydroxyacyl - coa - dehydrogenase (hadbh) [8, 58 ], sirtuin-6 (sirt6), and amp - activated protein kinase subunit- (ampk), while mir-33 targets steroid receptor coactivator 1 (src1), src3, nuclear transcription factor y (nfyc), and receptor - interacting protein 140 (rip140). by regulating all of these molecules posttranscriptionally, both mir-33 and mir-33 reduce fatty acid oxidation when upregulated and vice versa, that is, stimulating the process when downregulated [9, 58 ]. needless to say, mir-33 also influences insulin signaling by targeting insulin receptor substrate 2 (irs-2), thereby affecting both lipid and glucose metabolisms, with the glucose metabolism also being affected by glucose-6-phosphatase (g6pc) and phosphoenolpyruvate carboxykinase (pck1) targeting. according to the above - described roles of mir-33 and mir-33 in the cholesterol, fatty acids, and glucose metabolism, the therapeutic downregulation of their signaling may be beneficial for patients suffering from atherosclerosis, as it would result in an increase of hdl levels and in a decrease in fatty acid and glucose levels. mir-122 was identified in 2002 by lagos - quintana. to be liver - specific, accounting for over 70 % of liver mirna content. it is located within exon 2 of the known noncoding rna gene hcr (gi : 51212) [56, 61 ]. this mirna is currently believed to be essential for hepatitis c virus replication, hepatocellular carcinoma biogenesis, and last but not least for the functioning of the lipid metabolism [1215, 64 ]. however, since its effects on the lipid metabolism were observed in studies using either antisense oligonucleotides (aso) [12, 13, 64 ] or knock - out animals [14, 15]both of which led to the inhibition of mir-122 function it is still not precisely determined whether the effect of mir-122 on the lipid metabolism is direct or indirect. the introduction of aso into experimental animals leads to the creation of stable heteroduplexes, is reversible, and shows no signs of hepatotoxicity. studies using aso to silence mir-122 showed that the introduction of anti - mir-122 leads to a decrease in plasmatic cholesterol levels in experimental animals [12, 13 ]. moreover, esau. observed that hepatic fatty acid oxidation is increased in anti - mir-122 animals, along with a decrease in both cholesterol and fatty acid synthesis. furthermore, the introduction of anti - mir-122 into a diet - induced obesity model led to the improvement of liver steatosis. microarray analysis and rt - pcr confirmation indicated that levels of an enormous number of mrnas in the liver are changed following anti - mir-122 delivery. one of these mrnas is srebp, which may imply a connection between mir-122 and mir-33/33 functions. a more prominent decrease in circulating levels of cholesterol and fatty acids was observed when mir-122a knockout animals were generated [14, 15 ]. on the other hand and contrary to results obtained in aso studies, lipids were found to accumulate in the liver, resulting in hepatosteatosis and liver inflammation, which in turn led to fibrosis and the occurrence of spontaneous tumors resembling hepatocellular carcinomas [14, 15 ]. the reintroduction of mir-122 led to a significant improvement of steatosis while also suppressing tumorigenesis [14, 15 ]. further studies are therefore needed in order to explain the differences observed between mir-122 silencing using aso and mir-122 knockdown. the effects of mir-27a on the lipid metabolism were extensively studied by shirasaki.. mir-27a was thus identified as targeting rxr, abca1, fasn, srebp1, srebp2, peroxisome proliferator - activated receptor (ppar), and ppar as well as apoa1, apob100, and apoe3, all of which are molecules significant for the lipid metabolism and some of which were mentioned above. mir-27b, having 27 predicted lipid metabolism - related targets, was identified as representing a posttranscriptional mirna hub, that is a connection point, for the various parts of the lipid metabolism. of these targets, ppar, angiopoietin - like 3 (angptl3), n - deacetylase - n - sulfotransferase 1 (ndst1), and mitochondrial glycerol-3-phosphate acyltransferase (gpam) were successfully validated. ppar and ccaat / enhancer - binding protein (c / ebp) are both important for adipocyte terminal differentiation and their downregulation caused by mir-27b results in an adipocyte differentiation blockade. an additional ppar transcription factor, that is, ppar, which regulates the expression of, for example, abca1 or abcg1 transporters, was also shown to be a putative target of mir-27b [17, 20 ]. needless to say, mir-27b levels may be altered in atherosclerotic patients as they are sensitive to hypoxia and circulating lipid levels and are upregulated in apoe mice. except for the three mirnas described above, a number of additional mirnas is also involved in the lipid metabolism (figure 2), though information about their effects is limited to a relatively small number of studies. mir-370 was identified as affecting mir-122 expression, which in turn affects the lipid metabolism through mir-122 targets. mir-370 moreover, in patients with hyperlipidemia and coronary artery disease (cad), levels of circulating mir-370 and mir-122 correlate positively with the severity of cad, thus indicating that these two mirnas may potentially be used as cad biomarkers. mir-144 is another recently identified mirna which affects the lipid metabolism [22, 23 ]. the promoter region of this mirna includes two fxr - binding sites and indeed fxr drives mir-144 upregulation, resulting in a decrease in abca1 transporter, thus inhibiting hdl formation. a similar effect may be observed in the case of lxr - activated macrophages and hepatocytes in high - fat diet - fed mice, indicating that both lxr and fxr control mir-144 expression and thus abca1 function. in both of the above mentioned studies, the silencing of mir-144 resulted in an increase in abca1 and hdl, that is, an effect similar to that of anti - mir-33 therapy [22, 23 ]. from a mirna point of view, the abca1 transporter itself is a very attractive molecule (figure 3) : its 3utr is remarkably long - over 3 kb and holds mirna - binding sites for mir-10b, mir-26, mir-27 [16, 70 ], mir-33 [6, 7, 10 ], mir-106b, mir-144 [22, 23 ], mir-145, mir-148, and mir-758. all of these mirnas clearly also have other targets (e.g., abcg1 for mir-10b), thus opening up space for extensive future research. additional mirnas with corresponding targets involved in various parts of the lipid metabolism which may affect atherosclerosis development are summarized in table 2. a very large number of micrornas have been described as playing a role in the atherosclerosis process (for a recent review, see). this section briefly discusses circulating mirnas known to be involved in intercellular communication within atherosclerosis [7376 ] and focuses specifically on circulating mirnas transported by hdl or ldl particles [53, 77 ]. unlike most of the above mentioned tissue or mirnas, circulating mirnas are present in extracellular space as well as in almost all bodily fluids : blood and its derivatives (i.e., serum and plasma), cerebrospinal fluid, saliva, urine, breast milk and colostrum, bronchial lavage, peritoneal and pleural fluid, seminal fluid, and tears. since the addition of synthetic mirnas directly into plasma leads to immediate degradation due to high rnase plasma activity, the search for mechanisms by which circulating mirnas are stabilized has been initiated. as a result, several mechanisms for mirna protection and transport were identified, including the packaging of mirnas into exosomes, microvesicles, and apoptotic bodies or the creation of stable complexes with ago proteins or lipoprotein particles. while some mirnas are released into circulation due to necrosis (e.g., mir-208 following myocardial infarction) or apoptosis (e.g., mir-126 following epithelial cell apoptosis), there is evidence of some mirnas being actively secreted by cells [53, 79, 84 ]. the profiles of circulating mirnas are thus not random and reflect the physiological and pathological states of various tissues. moreover, as bodily fluids are easily collectable, their utilization as disease biomarkers in the future is clearly a viable option. circulating mirna profiles have been shown to differ in patients suffering from atherosclerosis [77, 86, 87 ] and hyperlipidemia [66, 87 ]. it is thus very likely that these changes affect intercellular communication and contribute to the progression of atherosclerosis. one of the first studies to point out the different expression of circulating mirnas in the blood of cad patients was conducted by fichtlscherer.. this study indicated that levels of endothelial enriched mirnas, that is, mir-126, mir-17, and mir-92a, as well as inflammation - associated mirnas, for example, mir-155, are downregulated in cad patients. on the other hand, likely reflecting cardiac damage, cardiac - specific mirnas, mir-208a, and mir-133a were upregulated. following an examination of four possible mirna transport modalities (microparticles, exosomes, ago, and further noted that especially microparticles of cad patients generally present lower levels of mirnas as a result of decreased mirna loading into microparticles ; microparticles from cad patients were also shown to be less sufficient with respect to mirna delivery to cultivated cells (probably due to the lowered expression of developmental endothelial locus 1 (del-1), a known mediator of endothelial microparticle uptake). of the above mentioned mirnas, circulating mir-126 has already been identified as playing a role in intercellular communication [81, 89 ]. mir-126 is an endothelial cell enriched mirna crucial for proper vessel integrity and vascular development [73, 74 ] ; however, its possible involvement in the lipid metabolism was suggested on the basis of a described correlation between mir-126 and ldl circulating levels. during atherosclerosis, endothelial cells undergo both necrosis and apoptosis and mir-126 is subsequently released either in the form of apoptotic bodies or in a complex with the ago2 protein. apoptotic bodies were described as being transferred to surrounding endothelial cells protecting them from macrophage infiltration as a result of vcam1 downregulation. moreover, mir-126 delivery is inducing cxcl12 expression (through the downregulation of rgs16) which promotes progenitor cell recruitment and healing. on the contrary, ago2-transferred mir-126 enters vascular smooth muscle cells where it promotes their turnover, thereby promoting the atherosclerotic phenotype. furthermore, it was shown that monocytic mir-150 is transferred to endothelial cells in the form of microvesicles [75, 76 ], where it stimulates endothelial cell migration and promotes angiogenesis. the assessment of circulating mirnas from a biomarker perspective links the downregulation of the above mentioned circulating mir-126 to an increased risk of myocardial infarction. other potential biomarkers mirnas include mir-214, whose levels correlate with the severity of cad, and mir-21 and mir-221, whose levels have been shown to be higher and lower, respectively, in patients suffering from atherosclerosis / ischemic stroke. hdl and ldl particle levels (as well as the level of their cholesterol and mirna content) are commonly affected in dyslipidemia, hyperlipidemia, and metabolic syndrome patients. vickers. demonstrated that both hdl and ldl particles contain mirnas and that the profiles of hdl mirnas in healthy controls (with mir-135a, mir-188 - 5p, and mir-877 being the most abundant in hdl particles) differ from familial hypercholesterolemia patients (with mir-223, mir-105, and mir-106a occurring most frequently). of the above - mentioned mirnas, it is worth pointing out that mir-223 is the most common mirna transported within hdl molecules. mir-223 targets glut4, as experimentally validated in the heart, which may provide a connection between circulating lipoprotein content and insulin resistance. other mir-223 targets include scavenger receptor class b type i (sr - bi), nod - like receptor pyrin domain containing 3 (nlrp3), and intercellular adhesion molecule 1 (icam-1). sr - bi is crucial in the hdl cholesterol metabolism and its downregulation by mir-223 in human hepatic cells may result in decreased hdl cholesterol uptake, thus affecting reverse cholesterol transport. in addition to its function in reverse cholesterol transport, hdl cholesterol also has anti - inflammatory, antithrombotic, and antioxidative properties. the anti - inflammatory effect of hdl particles may be at least in part mediated by mir-223 targeting of nlrp3, a well - known inflammasome which responds to the various forms of cellular stress, and also by targeting icam-1 in endothelial cells. since mir-223 is not commonly transcribed in endothelial cells, its delivery by hdl particles represents a new anti - inflammatory mechanism for the protection of the endothelium against leukocyte infiltration. in the future, mir-223 may potentially be used as a mediator of other hdl functions. more information regarding mir-233 may be obtained from a recent review by haneklaus.. ldl mirna profiles have been shown to be more similar to exosomal mirnas content than to hdl mirna content. a study by wagner. indicated that ldl generally contains less mirnas than hdl, with the sole exception of mir-155 which exhibits higher levels in ldl than in hdl. mir-155 is a proinflammatory mirna and its conflicting role in atherosclerosis has only been described recently (see for a review). despite its conflicting role, the association of ldl with inflammation is a well - accepted fact and mir-155 may thus provide another key to this relationship [77, 101 ]. it is important to note the existence of studies which show that mirnas may be transferred from hdl particles to recipient cells [53, 77, 98 ]. a study by vickers. describes the sr - bi - mediated internalization of hdl particles with subsequent changes in the transcriptional regulation of the recipient cell. although a subsequent study by wagner. confirmed vickers ' results, in the case of in vitro models of endothelial cells, smooth muscle cells, and macrophages, the study indicated that this mirna uptake is not sufficient due to the low amounts of mirnas being transferred from hdl to target cells.. also showed that native hdl particles are able to cause transient downregulation of some mirna in the recipient cells, which is most likely caused by the pumping of mirnas into the hdl. in a very recent study by tabet., the incubation of endothelial cells with hdl particles caused the significant upregulation of hdl - abundant mir-223, thereby leading to icam-1 downregulation. hyperlipidemia is one of the most critical risk factors contributing to atherosclerosis, along with other well - known factors such as smoking, obesity, or insulin resistance. at present, most therapeutic strategies focus on lowering ldl - cholesterol, for example, by using statins, a strategy which has been known to lower patients ' mortality. however, a more complex approach, focusing on lowering the levels of circulating fatty acids and increasing the levels of hdl, is now being investigated. due to their multitargeting essence, mirnas may thus become very powerful tools, influencing all stages of the pathogenic process of hyperlipidemia / dyslipidemia and positively affecting the entire blood lipid spectrum of affected patients. at present, there are two main ways of using mirnas in therapy : the inhibition strategy uses antagomirs (sequences that bind to target mirna and block its function) while replacement therapy uses mirna mimics. most of the work in the field of cardiometabolic diseases has so far focused on mir-33 [104108 ]. indeed, this is one of the mirnas that regulus therapeutics is preparing for future clinical use in the treatment of atherosclerosis. since the effects of this mirna are mostly proatherosclerotic, as described above, antagomir therapy against mir-33 would be a reasonable choice [104106 ]. rodent models indicated that mir-33 affects the development of atherosclerosis ; however, the results are still not consistent across all research groups [104106, 108 ]. using ldl - receptor knockout mice (ldr - r), the short - term (4 weeks) application of anti - mir-33 led to an increase in hdl concentrations and increased reverse cholesterol transport, consequently leading to atherosclerosis regression. however, two longitudinal studies conducted since provided disparate results : a study by tyler. showed that ldr - r mice treated with anti - mir-33 for 14 weeks only exhibit a slight increase in hdl concentrations during the first two weeks, with no effect on hdl levels taking place during the following weeks. moreover, levels of circulating triglycerides were higher in anti - mir-33-treated animals at the end of the study and no significant increasing trend with respect to body weight was observed. the most recent study by rotlan. indicated that long - term (12 weeks) application of anti - mir-33 increases hdl concentrations with increased cholesterol efflux capacity, but only in chow diet - fed animals. moreover, atherosclerotic plaque sizes were significantly reduced, as was the content of infiltrating macrophages. since there are differences in design of both above - mentioned studies, especially regarding antagomir chemistry and the diet composition of experimental animals, additional studies are needed to reveal the sources of observed results variability. using a slightly different model with apob and mir-33 double knockout (apob mir-33) mice, horie. reported that mir-33 deficiency caused the upregulation of hdl and slowed the progression of atherosclerosis, that is, results similar to the application of anti - mir-33 by horie. however, since rodents lack one srebp and consequently one form of mir-33, the extent to which results obtained from rodents may be applied to humans remains somewhat questionable. experiments employing nonhuman primates (african green monkeys) were therefore performed, leading to the finding that anti - mir-33 therapy not only increased hdl cholesterol levels but also decreased the levels of circulating triglycerides, thus significantly reducing the risk of future atherosclerosis development. with respect to additional mirnas mentioned in this review, mir-122 also seems to be a promising tool for normalizing the lipid spectrum, especially as the effects of miravirsen currently the first mirna - based therapeutic used in the treatment of the hepatitis c virus infection in african green monkeys indicated positive hypolipidemic effects. the application of mir-126 also seems to be very promising, since the application of apoptotic bodies resulted in the regression of atherosclerotic plaques in experimental animals ; however, with respect to its possible proatherogenic effect via vascular smooth muscle cell activation, additional experimental work must be carried out prior to its potential clinical utilization. last but not least, mir-30c, a potential candidate for mirna mimic therapy, should also be mentioned : mir-30c is embedded within the intron of nfyc (mir-33 target) and has recently been described as affecting the lipid metabolism. the hepatic overexpression of mir-30c decreases lipid synthesis and downregulates circulating lipid levels and vice versa : the inhibition of mir-30c expression using antagomirs resulted in the acceleration of the atherosclerosis process in apoe mice. micrornas have repeatedly been shown to play key roles in various processes within the body, including the lipid metabolism. since the lipid metabolism regulatory networks are themselves extremely complex, the addition of mirnas to this intricate network clearly calls for a period of fine - tuning of the established links as well as a time for embarking on a search for new connections. since one mirna usually targets a group of genes and one gene may be targeted by a group of mirnas with other mirnas possibly embedded within corresponding introns, we might conclude by saying that the lipid metabolism is controlled by complex mirnas - mrnas - mirnas networks. nevertheless, understanding these complicated regulatory networks is only a matter of time and effort, both of which are necessary for the development of effective therapies for atherosclerosis as well as for the identification of new biomarkers which will not only reflect the severity of the disease but also predict its progression. | hyperlipidemia is a well - accepted risk factor in the development of atherosclerosis. micrornas (mirnas), a novel class of posttranscriptional regulators of gene expression, are involved in a variety of biological and pathological processes, including the regulation of the lipid metabolism and atherosclerosis. as our knowledge of mirnas expands, a new class of circulating mirnas has recently been described. it includes mirnas which may be found in various bodily fluids packaged in microvesicles / exosomes, or bound to specific transporting proteins. high - density lipoprotein (hdl) particles have been identified as one such carrier. as this class of mirnas likely plays a role in intercellular communication, it may also contribute to the atherosclerosis development and progression. this review aims to provide a comprehensive explanation of the roles of distinct mirnas involved in the regulation of the lipid metabolism. these micrornas seem to be promising therapeutic agents, as documented in rodents and african green monkeys. the second part of the review focuses on circulating mirnas and their involvement in the atherosclerosis, especially as their levels have been described as altered in patients with dyslipidemia / hyperlipidemia. special emphasis is placed on mirnas transported in a complex with hdl particles and on those which may be considered potential atherosclerosis biomarkers. |
the basal ganglia, a group of nuclei, are associated with a variety of functions, including movement, reward, and motivational processes (percheron., 1994 ; mink, 1996 ; delong and wichmann, 2007). the striatum, which is the major input station of the basal ganglia in the brain, is regulated in part by dopaminergic input from the substantia nigra and projects to the output nuclei of the basal ganglia via two pathways that work together to modulate behavior (mink, 1996 ; hikosaka., 2000). the striatum is made up 96% of medium spiny neurons which are gabaergic cells (yelnik., 1991). the gabaergic cells have da receptors which divide into two main branches- the d1 receptor (d1r)-expressing direct pathway and the d2 receptor (d2r)-expressing indirect pathway (bateup., 2010). the direct pathway projects to the substantia nigra pars reticulata (snpr) and the indirect pathway projects to the internal globus pallidus (gpe) and the stn (gerfen., patients with parkinson 's disease (pd) which is severe movement disorder show the loss of striatal dopamine and rats with lesions of the nigrostriatal dopamine pathway caused by 6-hydroxydopamine (6-ohda) serve as a model of pd (steg and johnels, 1993 ; redgrave. thus, the nigrostriatal dopamine pathway in the basal ganglia is important for motor control and classical models of proposed two efferent pathways have not been clear in part of gabaergic striatal motor behavior. here, we have explored whether gabaergic cells in the striatum are affected by specific excitation of d1 and d2 dopamine receptor subtypes and modulate locomotor activity. male c57bl/6j male mice 7 weeks of age were obtained from the orient co. (kyungki - do, korea), and they were housed for 1 week under a 12 : 12 h light - dark cycle in a temperature - controlled and humidity - controlled room. all animal care and testing conditions were in accordance with the iacuc (institutional animal care and use committee) in college of medicine, the catholic university of korea. hydrochloride salts of skf 38393 and quinpirole (ly 171555) were obtained from sigma aldrich (st. all drug doses were calculated as the free base and the drugs were dissolved in 0.9% saline vehicle. the locomotor activity was measured in a rectangular container (404045 cm) that was equipped with a video camera above the centre of the floor as described previously (chae., 2004). the walls and floor were made of clear plastic and they were painted with white. the locomotor activity was monitored by a video - tracking system using the smart program (panlab, barcelona, spain). mice were allowed to adapt themselves for 1 h in the container and the distance they travelled was recorded every 10 min throughout a 1-h baseline and for 1 h after treatment. the striatums were dissected from the mice and all samples were frozen at -70. gaba analysis was done using high performance liquid chromatography (hplc). the mobile phase consisted of 40% acetonitrile in 20 mm sodium acetate buffer (ph 4.5 with glacial acetic acid) with a flow rate of 0.7 ml / min. samples underwent pre - column derivatization with o - phthaldialdehyde (opt), and were detected with a fluorescence detector (excitation 350 nm, emission 450 nm). area was used to calculate results from a standard curve, with an internal standard (commercial -aminobutyric acid). statistical differences among groups were analyzed by one - way analysis of variance followed by the tukey 's post - hoc and lsd technique. male c57bl/6j male mice 7 weeks of age were obtained from the orient co. (kyungki - do, korea), and they were housed for 1 week under a 12 : 12 h light - dark cycle in a temperature - controlled and humidity - controlled room. all animal care and testing conditions were in accordance with the iacuc (institutional animal care and use committee) in college of medicine, the catholic university of korea. hydrochloride salts of skf 38393 and quinpirole (ly 171555) were obtained from sigma aldrich (st. louis, mo, usa). all drug doses were calculated as the free base and the drugs were dissolved in 0.9% saline vehicle. the locomotor activity was measured in a rectangular container (404045 cm) that was equipped with a video camera above the centre of the floor as described previously (chae., 2004). the walls and floor were made of clear plastic and they were painted with white. the locomotor activity was monitored by a video - tracking system using the smart program (panlab, barcelona, spain). mice were allowed to adapt themselves for 1 h in the container and the distance they travelled was recorded every 10 min throughout a 1-h baseline and for 1 h after treatment. at the end of behavioral measurements, the striatums were dissected from the mice and all samples were frozen at -70. gaba analysis was done using high performance liquid chromatography (hplc). the mobile phase consisted of 40% acetonitrile in 20 mm sodium acetate buffer (ph 4.5 with glacial acetic acid) with a flow rate of 0.7 ml / min. samples underwent pre - column derivatization with o - phthaldialdehyde (opt), and were detected with a fluorescence detector (excitation 350 nm, emission 450 nm). area was used to calculate results from a standard curve, with an internal standard (commercial -aminobutyric acid). statistical differences among groups were analyzed by one - way analysis of variance followed by the tukey 's post - hoc and lsd technique. the present study explored whether locomotor activity and gabaergic cells in the striatum are affected by specific excitation of dopamine d1 and d2 receptor subtypes. there was a dose - dependently (0, 1, 5 or 10 mg / kg) significant increase in the locomotor activity of the mice after treatment with skf 38393 or quinpirole as seen in fig. significant increases in activity were observed 10 min after injection of skf 38393. the higher dose (skf 38393 10 mg / kg) significantly increased activity at every time - point sampled over the 1hr test period [f(3,19) = 18.307, p<0.001 ]. skf 38393 is a synthetic compound which acts as a selective d1/d5 receptor partial agonist. most of previous studies have reported that dopamine d1 receptor agonists are stimulating locomotor activity (bruhwyler., 1991 ; mazurski and beninger, 1991). we observed a significant increase in locomotor activity of the mice injected with the dopamine d1 receptor agonist, skf 38393, compared to control injected with vehicle. the results confirm previous studies indicating that d1 agonist predominantly increase locomotor activity (molloy and waddington, 1985 and 1987 ; mazurski and beninger, 1991). also, dopamine d2 receptor agonist, quinpirole, significantly increases locomotor activity at 20 min after injecting quinpirole in dose dependent manner [f(3,17) = 14.48, p<0.001 ]. but, the role of dopamine d2 receptors in the locomotor activity of adult animals is ambiguous. for example, administration of quinpirole led to dose - dependent (0.05~1.0 mg / kg) increase of locomotion consistent with the present result (brown. however, in other studies, the effects of quinpirole in rodents have been shown to depend on dose and time after injection. at lower doses (0.1 mg / kg), decreases in activity, 2001 ; schindler., 2002) and at higher doses (0.5 - 10 mg / kg), increases in activity can be seen at 60 min after injection (horvitz., 2001). the doses in the current study were in high range and activity was measured immediately following injection. although biphasic pattern of quinpirole on locomotor inhibition followed by excitation is not unclear, the results confirm that higher doses of d2 receptor agonist increase locomotor activity. gaba level induced by skf 38393 was increased in the striatum [f(3,16)=11.827, p<0.001 ] (fig. 2) and gaba level induced by quinpirole was decreased [f(3,16)=2.05, p=0.15 ] (fig. 3). thus, dopamine d1 receptor agonist appeared to exert increase in gaba release and dopamine d2 receptor agonist appeared to inhibit gaba release in the striatum. the study of harsing and zigmond (1997) demonstrated that the overflow of gaba evoked by electrical field stimulation (8 hz) was increased two - fold by skf-38393 (10 microm), and electrically evoked gaba overflow was reduced 50% by quinpirole (10 microm) in the striatum. thus, our results support previous studies indicating that dopamine agonist can exert an excitatory influence on gaba release via d1 receptor and an inhibitory influence on gaba release via d2 receptor within the striatum. the striatum, which is the major input station of the basal ganglia in the brain, is regulated in part by dopaminergic input from the substantia nigra. the striatum is made up 96% of medium spiny neurons which are gabaergic cells (yelnik.. reduced dopamine innervation of the striatum results in hypokinesia and difficulty in initiating different motor patterns and enhanced striatal dopamine activity give rise to hyperkinesia (blair, 2003 ; grillner., 2005). these results provide inkling that the striatum has a important role in the selection of motor behavior (grillner., 2005). the gabaergic cells have da receptors which divide into two main branches- the d1 receptor (d1r)-expressing direct pathway and the d2 receptor (d2r)-expressing indirect pathway (bateup., 2010). the direct pathway projects to the substantia nigra pars reticulata (snpr) and the indirect pathway projects to the internal globus pallidus (gpe) and the stn (gerfen., striatal neurons are activated by dopaminergic innervations via d1 type receptors, it provides strong inhibition to the snpr and thereby disinhibits thalamic neurons in a motor center which are responsible for releasing locomotor. in the indirect pathway from the striatum via the gpe and the stn, striatal neurons activated by dopaminergic innervations via d2 type receptors inhibit thalamus ' neurons in a motor center that affect motor behavior (delong and wichmann, 2007). actually, most of previous experiments have reported that dopamine d1 receptor agonists are stimulating locomotor activity (bruhwyler., 1991 ; mazurski and beninger, 1991), however, the role of dopamine d2 receptors in the locomotor activity is ambiguous (horvitz., 2001 ; parkinsonism resulted from the loss of nigrostriatal dopamine is a movement disorder characterized by tremor, hypokinesia, rigidity, and postural instability (gerfen., 1990 ; delong and wichmann, 2007). the study on pd has been greatly facilitated in the 1-methyl4-phenyl-1,2,3,6 tetrahydropyridine (mptp) primate model of the disease by using metabolic imaging and electrophysiological studies. the mptp model has suggested that neuronal discharge is increased in the stn, gpi, and snr but decreased in the gpe, thus resulting in excessive inhibition of components of the motor circuit in the thalamus, cortex, and brainstem. these aspects of the model are generally supported by lesioning and inactivation studies, which have shown that inactivation of the stn or gpi increases the metabolic activity in cortical motor areas and improves bradykinesia and tremor in patients with pd. however, lesions of the thalamus do not lead to significant bradykinesia or akinesia, and lesions of the gpi do not result in dyskinesias (delong and wichmann, 2007). although this issue is complex and still unsettled, nigrostriatal gabaergic pathway in the basal ganglia is important for motor control. both skf 38393 and quinpirole dose - dependently increased locomotor activity but, gaba level in the striatum was clearly different in two agonists. our results provide insight into the selective control of the direct and indirect pathways to striatal gabaergic motor behaviors. specific gabaergic motor control of the direct and indirect pathways in the basal ganglia requires further investigations which will contribute to therapeutic understanding of motor function disorders. | the basal ganglia, a group of nuclei, are associated with a variety of functions, including motor control. the striatum, which is the major input station of the basal ganglia in the brain, is regulated in part by dopaminergic input from the substantia nigra. the striatum is made up 96% of medium spiny neurons which are gabaergic cells. gabaergic cells are known to contain da receptors which divide into two main branches- the d1 receptor (d1r)-expressing direct pathway and the d2 receptor (d2r)-expressing indirect pathway. the role of these two efferent pathways has not been clear in control of motor behaviors. to establish the influence of the different da subtypes on gabaergic systems in the striatum, d1 selective receptor agonist (skf 38393) and d2 selective receptor agonist (quinpirole) were administered to mice. skf 38393 and quinpirole were administered intraperitoneally in a volume of 0, 1, 5, 10 (mg / kg) and motor activity was assessed for 60 min immediately after the injection of da agonists. mice were sacrificed after behavioral test and the striatum in the brain were dissected for analysis of gaba level with hplc. both skf 38393 and quinpirole dose - dependently increased locomotor activity but, gaba level in the striatum was clearly different in two agonists. these findings provide insight into the selective contributions of the direct and indirect pathways to striatal gabaergic motor behaviors. |
negative change within the carotid artery is reportedly an independent risk factor for cardiovascular disease (cvd) and stroke1. several studies report an association of cvd risk with increased of carotid intima - media thickness (cimt)2,3,4 and luminal diameter (cld)5, 6. recently, a followed - up study reported that low carotid artery flow velocity (i.e. peak - systolic velocity [psv ] and end - diastolic velocity [edv ]) is associated with cvd risk in hypertensive patients7. another study focusing on risk factor evolution and cvd development demonstrated that low psv and edv were independently associated with future cvd8. a cross - sectional study comparing patients with ischemic stroke patients and subjects without stroke found an association between lower carotid flow velocity (fv) and increased stroke risk9. several cross - sectional studies reported that improved of oxygen uptake and walking speed is associated with preventing to the negative change of carotid arteries (in cimt or cld) in elderly3, 10. resistance exercise is effectively improves of physical performance such as muscle strength, agility and dynamic balance, flexibility, walking ability, and aerobic endurance in the elderly11,12,13. additionally, resistance exercise can improve body composition, including decreasing body fat mass or increasing of lean body mass in elderly populations11, 12. in contrast, studies on the effect of resistance exercise on arterial function demonstrated that resistance exercise improves vascular endothelial function and increases blood flow velocity in the brachial artery in healthy overweight women and young adults14, 15. also, resistance exercise is reported to decrease the cimt and increase the cld in the carotid artery in patients with chronic heart failure patients16. however, the effects of resistance exercise on carotid artery fv parameters are not yet known in healthy elderly men. therefore, we examined the effect of a 24 weeks resistance exercise program on carotid artery flow velocity in this population. in this study initially enrolled 42 healthy elderly men (age 65 years) without hypertension, hyperlipidemia, diabetes, history of cvd, or other diagnosed illness. twelve subjects were excluded for smoking (n=7), and regular participation in physical activity within the past 6 months (n=5). the remaining 30 elderly men were randomly divided into a control group (n=15) and a resistance exercise group (n=15). table 1table 1.the anthropometric characteristics, body composition and blood pressure of subjectsvariablescontrol group(n=15)exercise group(n=15)age (years)70.9 3.973.1 3.0height (cm)164.9 7.5164.8 5.4body mass (kg)64.5 8.066.0 6.1body mass index (kg / m)23.8 2.924.3 2.1percent body fat mass (%) 23.7 7.125.6 6.2skeletal muscle mass (kg)27.3 3.027.4 3.7systolic blood pressure (mmhg)127.7 6.7129.1 7.4diastolic blood pressure (mmhg)74.4 8.075.1 8.2values are means sd shows the participants physical characteristics. in accordance with the ethical standards of the declaration of helsinki, informed consent was obtained from all participants after they were provided with a detailed description of the study. values are means sd after measuring the subjects height and body mass, their body fat mass (fm) percent and skeletal muscle mass (sm) were measured by bioelectrical impedance analysis, using a body composition analyzer (inbody 370, biospace, seoul, south korea). body mass index (bmi) was calculated as weight (kg) divided by height squared (m). for the 2 days prior to measurement of body composition, subjects were asked to not engage in physical activities other than the activities they usually performed and to refrain from drinking or eating excessively. systolic blood pressure (sbp) and diastolic blood pressure (dbp) were measured using a mercury sphygmomanometer (hico, tokyo, japan) after 10 minutes of rest. upper and lower body muscle strength, agility / dynamic balance, flexibility, walking ability, and aerobic endurance were measured after a 10-minute warm up. muscle strength was measured by grip strength using a grip strength dynamometer (tkk-5401, japan) for the upper body and chair stand up for the lower body. chair stand up were scored based on the number of repetitions completed within 30 seconds. agility and dynamic balance was measured by the time up and go (tug, 2.44 m). participants were informed that this was a timed test and that the objective was to walk as quickly as possible (without running) around a cone and back to the chair. participants were instructed to take a deep breath and then breathe out while leaning forward as far as possible, without bending the knees. in addition, participants started walking two meters before the start line so that walking speed did not include the acceleration time. and maximum walking speed was defined as the ratio between distance and time. two - minute steps was measured as an alternative to the aerobic endurance test. participants score was the number of full steps completed in 2 minutes, raising each knee to a point midway between the patella and iliac crest. resistance exercises used in this study conformed to the guidelines of physical activity recommended for the elderly17. the resistance exercise was performed with green elastic exercises bands (thera - band, ohio, usa) for 3050 minutes per session, 3 days per week, with 1015 repetitions per set (weeks 112 : 1012 repetitions per set ; weeks 1324 : 1315 repetitions per set), 35 sets (weeks 112 : 3 sets, weeks 1324 : 5 sets, 1 minute rest between sets) for 14 items (elbow flexion, lateral raise, shoulder flexion and extension, biceps curl, chest press and flies, abdominal crunch, trunk extension, side bend, mini squat, leg press, calf raise, and ankle inversion)17, 18. participants performed a 10-minute warm and cool down before and after the exercise program, respectively. carotid artery variables were measured using b - mode ultrasound and a 10 mhz probe (logiq 3, ge healthcare, wauwatosa, wi, usa). cimt and systolic cdl were measured from the far wall of the distal common carotid 1 cm proximal to the carotid bifurcation. the cimt was defined as the distance from the lumen - intima interface to the intima - adventitia interface, and systolic cld was defined as the distance between the near and far wall intima - media interfaces19. for doppler spectral analysis, peak systolic flow velocity (psv) and end diastolic flow velocity (edv) were measured by continuous - wave doppler examination in the common carotid 13 cm proximal to the bifurcation8. wall shear rate (wsr) was calculated using to the following formula20:wsrpeak=4vpeak / cldwhere wsr is wall shear rate (s), vpeak is the peak systolic flow velocity and cld is systolic luminal diameter. statistical package for the social sciences (spss) ver. 17.0 chicago, il, usa) was used for statistical analysis, and results reported as mean and standard deviation. the student s t - test was used to assess differences in baseline variables. two - way factorial analysis of variance was used to compare parameters at baseline and after the 24 weeks of the study participation. when significant group time interactions were identified, paired t - tests were performed to detect differences between time points. table 2table 2.changed of body composition, blood pressure, physical function, and carotid artery variables in baseline and after 24 weeksvariablescontrol group (n=15)changeexercise group (n=15)changebaseline24 weekbaseline24 weekbody fat mass percent (%) 23.7 7.123.8 6.60.125.6 4.325.0 3.61.2skeletal muscle mass (kg)27.3 3.027.0 3.00.327.4 3.728.2 3.70.8systolic blood pressure (mmhg)127.7 6.7127.9 6.30.2129.1 7.4128.3 6.10.8diastolic blood pressure (mmhg)74.4 8.074.5 6.90.175.1 8.274.9 7.40.4left grip strength (kg)33.3 5.532.9 5.40.431.0 6.633.0 5.52.04right grip strength (kg)33.2 5.232.9 5.00.331.2 7.134.3 5.83.1chair stand up (repetitions/30 sec)16.3 3.616.1 3.00.216.3 3.418.2 3.11.9sit and reach (cm)10.0 6.19.9 6.00.18.9 7.89.8 7.50.9maximum walking speed (m / sec)1.67 0.31.64 0.30.031.58 0.21.67 0.30.09time up and go (sec)5.84 1.05.86 1.00.025.87 1.15.65 0.80.22two - minute step test (repetitions)101.4 13.1101.3 12.10.199.3 15.6103.1 12.93.9carotid intima media thickness (mm)0.71 0.110.71 0.100.00.71 0.080.71 0.070.0systolic carotid luminal diameter (cm)0.62 0.10.62 0.10.00.63 0.10.64 0.10.01peak systolic flow velocity (cm / sec)63.4 9.962.6 11.10.862.2 13.971.4 13.09.2end diastolic flow velocity (cm / sec)20.4 3.820.5 3.80.119.2 3.721.0 4.01.8wall shear rate (s)409.6 65.3403.7 74.65.9403.1 108.1453.9 116.750.8values are means sd. significantly different within group : p<0.05, p<0.01 ; significant group time interaction : p<0.05, p<0.01, p<0.001 shows changes of body composition, blood pressure, physical function, and carotid variables in baseline and after 24 weeks. fm percent (p<0.05), sm (p<0.01), and sbp (p<0.05) showed significant interactions. grip strength on the left (p<0.01) and right (p<0.001), chair stand up (p<0.01), sit and reach (p<0.05), maximal walking speed (p<0.01), tug (p<0.01), and two - minute step (p<0.01) had significant interactions. psv (p<0.001), edv (p<0.05), and wsr (p<0.05) showed significant interactions. however, in the dbp, cimt, and cld, interactions were no identified. values are means sd. significantly different within group : p<0.05, p<0.01 ; significant group time interaction : p<0.05, p<0.01, p<0.001 in the paired t - test results of the exercise group, fm percent, sbp, and tug were significantly decreased (p<0.05, each), and sm, left and right grip strength, chair stand up, sit and reach, maximal walking speed, and two - minutes step were significantly increased (p<0.01, each), also psv (p<0.01), edv (p<0.01), and wsr (p<0.05) were significantly increased after 24 weeks. body composition, blood pressure, and physical function variables showed no change in the control group. but in exercise group, dbp, cimt, and cld were no change, also in control group, all variables were no change. this study examined the effects of a 24-week resistance exercise program on carotid parameters in elderly men. the primary findings of this study are that the resistance exercise program increased pfv, edv, and wsr in this study population. decreased of carotid artery fv is associated with early progress of atherosclerosis, and stoke in elderly patients9. in addition, two recently cross - sectional studies reported that low psv and edv were independently associated with future dvd7, 8. the previous studies suggest that increase of psv and edv is associated with a potential prevention for cvd. studies on the effects of exercise training on arterial parameters demonstrated that resistance exercise increases blood flow in the femoral artery and increases flow mediated dilation of the brachial artery in adults14, 21, 22. resistance exercise is also reported to increase the flow velocity of the brachial and femoral artery in adults and older subjects15, 22. changes in brachial and femoral parameters due to resistance exercise are considered to significantly improve of peripheral artery function14, 15. however, effects of long - term resistance exercise on carotid artery fv have not been confirmed. several studies reported that carotid fv is increased during dynamic exercise or after acute high intensity exercise in young adults23, 24. a study of obese adults reported that resistance exercise alone could improve brachial artery endothelial function14. in the present study, this study demonstrated that long - term resistance exercise improves to age - related carotid fv in health elderly men. aging is reported as a major risk factor for decreased of carotid artery flow25. in the elderly, improvement of carotid fv by exercise low wsr is associated with increased cimt, and is directly associated with changes in carotid fv, viscosity, and cld26. in the current study, wsr was used as a surrogate marker of wall shear stress, and was calculated by systolic cld and psv26. we found that exercise resulted in increased psv, but there was no change in cld. two intervention studies in overweight or obese adults demonstrated that short- or long - term resistance training is not effective in improving cimt and cld14, 21. in this study, this result suggests that resistance exercise does not effectively improve cimt and cld in health elderly. two intervention studies demonstrated that resistance exercise using weightlifting machine is effectively improves of body composition and physical function in the elderly11, 12. other intervention study demonstrated that resistance exercise using elastic band is effectively improves physical fitness such as muscle function and balance ability in elderly women13. and resistance exercise using elastic band are simple and economical, and have safety advantages13. in this study, resistance exercise was to use elastic bands, and health - related indicators such as blood pressure as well as body composition and physical fitness variables were examined. this study showed that resistance exercise using elastic bands for 24 weeks is effectively improves of blood pressure as well as body composition and physical fitness variables in elderly. therefore, effects of resistance exercise on the carotid artery may be limited to elderly men. in conclusion, 24-week resistance exercise program, using elastic bands, effectively improves carotid flow velocity and wall shear rate in healthy elderly men. | [purpose ] the aim of this study was to examine the effect of resistance exercise on carotid intima - media thickness, luminal diameter, peak systolic flow velocity, end diastolic flow velocity, and wall shear rate in healthy elderly men. [subjects and methods ] thirty healthy elderly men (age 65 years) were randomly divided into a control (n=15) and resistance exercise (n=15) groups. the 24-week exercise intervention consisted of 3 days of resistance exercise per week using an elastic band per week. body composition, physical function, blood pressure, and carotid variables were measured at baseline and after 24 weeks. [results ] body fat percent, skeletal muscle mass, systolic blood pressure, grip strength, arm curl, chair stand up, sit and reach, maximum walking speed, time up and go, and two - minute step test showed significant interaction. peak systolic flow velocity, end diastolic flow velocity, and wall shear rate also showed significant interaction. [conclusion ] a 24-week resistance exercise program, using elastic bands, effectively improves carotid flow velocity and wall shear rate in healthy elderly men. |
congenital hypothyroidism in neonates and very young infants is usually caused by thyroid dysgenesis associated with an absent, ectopic, or hypoplastic thyroid gland, and can be detected by neonatal screening in the general population. although this illness itself is considered to be unchanged throughout the patient s life, it can be transient in certain cases, for example, infants of mothers with chronic autoimmune thyroiditis (1). hypothyroidism in young children is mostly caused by chronic autoimmune thyroiditis, but it is quite rare before the age of 3 (2). thomas. described four children, nine months to two years of age at the time of diagnosis, who had hypothyroidism that was most likely to have been caused by chronic autoimmune thyroiditis (3). trab, such as tsh - binding inhibitor immunoglobulin (tbii) and thyroid stimulating antibody (tsab), have been detected in most patients with hyperthyroidism due to graves disease. this patient trab changed from a blocking type to a stimulating type in association with the development of hyperthyroidism (4). in this report, we describe a first case with hyperthyroidism, who was diagnosed with ch at neonatal screening and since then had been treated for 13 yr with thyroid hormone. his mother was healthy, and his father had a clinical history of hyperthyroidism, which was treated with antithyroid drugs for one year when he was 42. the patient s birth weight was 2770 g, and his gestational age was 40 wk. at the age of 16 d, he was referred to our hospital because of positive results at neonatal screening for ch. the dried blood tsh at the ages of 5 and 12 d were 76.76 u / ml and 38.08 u / ml, respectively. at the age of 16 d, the serum levels of tsh, t4 and t3 were 91.0 u / ml (adult normal range : 0.45.0), 6.9 g / dl (adult normal range : 3.712.1) and 1.36 ng / ml (adult normal range : 0.71.8), respectively. the size of the right distal femoral epiphysis was 6 3 mm and that of the left was 6.5 4 mm on x - ray examination. he was diagnosed with subclinical congenital hypothyroidism and received hormone replacement therapy from the age of 34 d. the initial dose was 15 mg of desiccated thyroid a day. at the age of 55 d, the patient s serum level of tsh was 38.5 u / ml and serum level of free t4 was 0.94 ng / ml (adult normal range : 0.782.12). at the age of 18 mo, the scan demonstrated a thyroid gland normally located with homogeneous uptake of radioactive iodine ; the uptake rate was 15% (normal range, 1040%) at 24 h. the potassium thiocyanate discharge test showed 25%, and a defect in iodine organification was suspected. his growth spurt started at about the age of 13 and his adolescence was of the slightly delayed type.). at the age of 3, both the serum level of anti - microsome antibody and anti - thyroglobulin antibody were negative. at the age of 6, the medication was changed to l - thyroxine from desiccated thyroid. at the age of 8, the patient s iq score on wisc - r intelligence test was 133 (normal 105.4 20.7), and his evaluated bone age was delayed one year compared with his chronological age. the dosage of l - thyroxine was gradually increased as he grew and the maximum dose was 110 g / day at the age of 11 (fig. the dosage of thyroid hormone was gradually increased as he grew and the maximum dose was 110 g / day. at the age of 13 yr and 4 mo, the serum level of tsh dropped to an undetectable level.). until the age of 13, however, at the age of 13 yr and 4 mo, his serum level of tsh dropped to an undetectable level. the dosage of l - thyroxine was tapered off and eventually eliminated at the age of 14. the patient s height and weight were almost the mean until the age of 11. his growth spurt started at about the age of 13 and his adolescence was of the slightly delayed type. the dosage of thyroid hormone was gradually increased as he grew and the maximum dose was 110 g / day. at the age of 13 yr and 4 mo, the serum level of tsh dropped to an undetectable level. physical findings at the age of 14 were as follows : height, 165.1 cm ; weight, 50.2 kg ; blood pressure, 124/63 mmhg ; pulse rate, 109 beats / min. blood examination revealed the following data : free t4, 4.22 ng / dl (0.821.63) ; free t3, 12.0 pg / ml (2.04.9) ; tsh, less than 0.03 u / ml (0.414.01) ; trab, 62.5% ; anti - microsome antibody, 25600 ; anti - thyroglobulin antibody, negative. a thyroid scan demonstrated a diffuse goiter with homogeneous uptake of radioactive iodine ; the uptake rate was 60% at 24 h. having confirmed hyperthyroidism, therapy was started with antithyroid drugs (fig. one month after the start of therapy, the serum level of free t4 was normalized. after two months of therapy, the serum level of tsh had risen to a detectable level.). one month after that, the patient s serum level of free t4 was normalized, and the dosage of mmi was tapered. two months after the therapy, the patient s serum level of tsh had risen to a detectable level ; however trab was still high, and the dosage of mmi was tapered again and l - thyroxine therapy was added. one month after the start of therapy, the serum level of free t4 was normalized. after two months of therapy, the serum level of tsh had risen to a detectable level. the patient s height and weight were almost the mean until the age of 11. at annual x - ray examinations, bone ages were delayed only one year as compared with his chronological age, and the patient s growth spurt started at about the age of 13. his adolescence was of the slightly delayed type. at the age of 15, his height was 167 cm, and his weight was 57 kg (fig. the mental development of children with ch has been improved as a result of early detection by neonatal screening and an appropriate therapy (5, 6). newborns classified false positive at ch screening have a very high risk of subclinical hypothyroidism in infancy and early childhood (7). nevertheless, it is difficult to decide whether a case should be treated or not in cases such as transient hypothyroidism, transient hyperthyrotropinemia, mild congenital hypothyroidism, and persistent hyperthyrotropinemia at the early phase of consultation (8). the present case was considered subclinical ch with high tsh and normal t4 levels. thus thyroid hormone replacement therapy was started at the age of 34 d. the patient s serum levels of tsh were sometimes high, and as he grew, the dosage of thyroid hormone was escalated to a maximum dose of 110 g / day until the age of 11. his clinical course was consistent with that of permanent ch till the age of 13, and it is speculated that he suffered from an iodine organification defect at that time. van der gaag. found transplacental passage of maternal immunoglobulins may play a part in the pathogenesis of ch (9). kato. described two cases of ch detected by screening whose sera contained high levels of antibodies in early childhood, and concluded that the antibodies were not derived from maternal immunoglobulins but produced on their own (10). therefore we hypothesize that in the present case hypothyroidism was transient due to immaturity of iodine organification in the thyroid gland as nose. described previously (11), and that afterwards hyperthyroidism developed due to an autoimmune disease, and was diagnosed with the results of serum trab and the thyroid scan. it is also possible that the patient had several clones of antibodies against thyroid from his early infancy. although the patient s mother had no thyroid disease and his antibodies were negative in early childhood, a clonal change in his antibodies might have happened and their binding properties could have been altered from the blocking type to the stimulating type (4, 12). further analysis of thyroid function is apparently necessary to assign the immunological basis of this case and additional follow - up data should be accumulated during the treatment course of this patient. | we encountered a case with hyperthyroidism at the age of 14 who had been diagnosed with congenital hypothyroidism (ch) and had received thyroid hormone replacement therapy. at the age of 16 d, the patient was referred to our hospital because of positive results at neonatal screening for ch. serum level of tsh was 91.0 u / ml and serum level of t4 was 6.9 g / dl. the patient was diagnosed as having hypothyroidism, and hormone replacement therapy was started. thereafter the dosage of thyroid hormone was adjusted and increased gradually as he grew to a maximum dose of 110 g / day at the age of 11. until the age of 13, the patient s serum levels of tsh were within the normal range ; then, at the age of 13 yr and 4 mo, his serum level of tsh dropped to a level below the detectable range. the dosage of administered thyroid hormone was tapered off and eventually eliminated at the age of 14. a thyroid scan and a radioactive iodine uptake test demonstrated a diffuse goiter with homogeneous uptake of radioactive iodine ; the uptake rate was 60% at 24 h, and the serum level of tsh receptor antibody (trab) was 62.5% at that time. administration of an antithyroid drug was started after confirmation that our patient had developed hyperthyroidism. there have been no case reports similar to our case. |
quality of life (qol) is a broad, complex, multidimensional concept that incorporates psychological, economic, philosophical, socio - cultural and spiritual dimensions. studies done in patients with different chronic diseases like chronic renal failure, acquired immunodeficiency syndrome and psychiatry disorders had shown that different social and demographic factors affects quality of life of these patients. likewise, there are available literature showing significant adverse effects of tuberculosis on quality of life of patients. there is currently no study in the public domain on the quality of life of nigerian patients with tuberculosis. only few of the available literature on this subject have identified the predictors of the well - established poor quality of life outcomes among the patients with tuberculosis. this report is part of a self - sponsored, researchers initiated study that examined the quality of life of patients on treatment for pulmonary tuberculosis alongside adherence to therapy and adverse drug effects. it is aimed at identifying the factors influencing the quality of life of patients on treatment for pulmonary tuberculosis and the predictors of low quality of life scores in these patients. this is considered a needful step towards instituting a more wholistic care of pulmonary tuberculosis patients for better outcome in a population with high burden of the disease. the study was conducted at the chest unit of lagos state university teaching hospital, ikeja, lagos (lasuth) between may 2009 and september 2009. the hospital chest clinic receives an average of twelve new cases of tuberculosis per week and about fifty newly diagnosed with tuberculosis monthly. at the commencement of the study there were about two hundred and fifty - five patients receiving treatment out of which about one hundred and sixty nine were on directly observed therapy. ethical approval for the study was obtained from the ethics and research committee of the hospital and all study participants gave written informed consent. inclusion criteria were any patient with diagnosis of pulmonary tuberculosis either by sputum smear or culture or radiological features and registered for anti - tuberculosis treatment at the chest clinic of lasuth. the protocol and criteria for diagnosing and treating tuberculosis were based on the national tuberculosis control policy of the federal republic of nigeria, which was adapted from the world health organization (who) documents. the data collection tool was a structured questionnaire which had four sections ; a, b, c and d respectively. section a sought information on the socio - demographic characteristics of participants including age, sex, educational and employment status, religion and estimates of income and expenditure. section b obtained information on the clinical history, which included symptoms at presentation, alcohol use, smoking, co - morbidities, concomitant medications and adverse effects to drugs. section c obtained information on adherence to therapy while section d incorporated the assessment of the quality of life of participants using the world health organization (who) qol bref parameters. the whoqol - bref is an abbreviated version of the whoqol-100 instrument consisting of 26 questions, which assesses four specific domains of well - being namely physical health (domain 1), psychological health (domain 2), social relationship (domain 3) and the environment (domain 4). domain 1 incorporates the following facets : activities of daily living, dependence on medicinal substances and medical aid, energy and fatigue, mobility, pain and discomfort, sleep and rest, work capacity. domain 2 assesses bodily image and appearance, negative feelings, positive feelings, self - esteem, spirituality / religious / personal beliefs, thinking, learning, memory and concentration. domain 3 assesses personal relationships, social supports and sexual activities while domain 4 incorporates the following facets as well : financial resources, freedom / physical safety / security, accessibility and quality of health and social care, home environment, opportunity for acquiring new information and skills, participation in and opportunities for recreation and leisure activities, physical environment (pollution / noise / traffic / climate) and transport. domain scores were scaled in a positive direction of 1 to 5 with 5 being the most optimistic response. the four domain scores denote an individual s perception of quality of life in each particular domain. higher scores of 4 and 5 indicated a higher quality of life while lower scores below 3 indicated a low quality of life. the study tool was pre - tested on thirty patients with tuberculosis being managed in a separate public health facility and the necessary corrections based on the responses obtained were made. the corrections made included precoding the income and expenditure sections into various ranges of figures, which was the preferred mode of respondents in disclosing their financial status as against the initial open - ended questions. also, provision was made in the lists of symptoms and potential adverse drug reactions for participants to state items that were applicable to them but not captured in the instrument. the instrument was thereafter administered at the study site to consecutive patients who meet the inclusion criteria and had given written informed consent by the investigators assisted by three other trained facilitators who were house officers rotating through the chest unit of lasuth during the study period. all information collected from each respondent was entered into an ibm compatible computer and analyzed using commercially available statistical package stata version 10 (stata corp. continuous variables were expressed as means (standard deviation), categorical variables as proportions. the mean score of items in each domain of wellbeing described above was used to calculate the domain score. mean scores were then multiplied by 4 in order to make the domain scores compatible with the scores used in whoqol-100. following the transformation scales obtainable in the who - bref manual, a multivariate logistic regression analysis was performed to identify the independent predictors of low quality of life scores in the patients among the socio - demographic and economic factors. a low quality of life score in accordance with who - bref guideline was taken as a raw score of 21 or less in domain 1, 18 or less in domain 2, 9 or less in domain 3 and 24 or less in domain 4. these cut offs scores translates to a transformed score of 50 or less in all the domains. two hundred and sixty patients receiving treatment for tuberculosis took part in the study out of a total of three hundred and twenty five patients identified as potential participants during the study period. figures 1, 2 and 3 show the marital status by percentages, the educational levels attained and the employment status of the studied population respectively. the most prevalent co - morbidity was hiv / aids ; 40 (14.5%), followed by hypertension ; 15 (5.8%). others were diabetes mellitus ; 10 (3.8%), both asthma and seizure disorder with prevalence of 5 (1.9%) respectively. only 26 (10%) of the patients studied were current smokers while 5 (1.9%) of the patients were ex - smokers. only 50 (19.2%) of the participants were current alcohol users, 210 (80.8%) did not use alcohol. the highest mean transformed quality of life score was recorded in social relationship domain of health (70.8018.12) while the lowest was in the environmental domain (66.33 15.20). the mean transformed quality of life scores in the other domains of health included 67.4022.20 in the physical and 66.7516.60 in the psychological domains respectively. the mean quality of life scores in the various domains of health were compared by sexes, age ranges (< 50 years and 50 years) and the marital status as shown in table 1. both males and females did not differ with respect to the physical and environmental domains but the females had better quality of life in the psychological and social relationship aspects of quality of life. with the exemption of the environmental domain of health, younger age group (< 50 years) had superior health related quality of life in all other domains of health. the quality of life score in the physical domain was better in individuals with spouses compared with those without. in contrast, those without spouses fared better in the psychological domain of health than those with spouses. there were no differences in the social and environmental domains of quality of health with respect to marital status. tables 2 - 5 summarize the final multivariate logistic models for the independent predictors of low quality of life scores in the various domains. the predictors of low scores in the physical domain of health were low level of monthly income less than 14,999 naira (about us$ 93) relative to higher monthly incomes, being on treatment for other conditions, the duration of the illness and unemployment. the predictors of low scores in the psychological domain of health were age, male gender, low level of monthly income less than 14,999 naira (about us$ 93) and the duration of the illness. the predictors for low scores in both the social relationship and environmental domains of quality of health were mainly low monthly incomes less than 14,999 naira (about us$ 93) and duration of illness as shown in tables 4 and 5 respectively. tuberculosis studies have concentrated on clinical outcomes, only few studies have examined the impact of tuberculosis on patients quality of life. in the past few decades there has been a reawakening of the principle that health is a fundamental human right and a worldwide social goal that is essential to the satisfaction of basic human need. it is therefore very important to improve quality of life even in diseased states. in line with previous findings by several workers in some parts of africa and asia that there is a higher prevalence of tuberculosis among men than women, there were more males than females in the present population studied in a ratio of 2.7:1. while there were more males than females affected by this disease in this current study, both sexes fared comparably in the physical and environmental domains of health (table 1) but the females had superior psychological and social relationship indices of quality of health. muniyandi. using the sf 36 instrument of quality of life evaluation in a south indian population had reported lower scores in females compared with males in the mental and social domains in contrast to our present findings. this perhaps might be outcomes occasioned by either socio - cultural differences between the populations studied or the differences in the instruments used. within the nigerian black population studied, the socio - cultural norm is a bit repressive regarding the expression of views and feelings by the female gender. the presumption is that women are to be seen more and heard less, thus potentially causing poor expressions of their views and feelings. perhaps, this may have precluded the disclosure of their real states of health. on the positive note however, the observed superiority of the psychological and social health status in females in this study may be a reflection of a better coping skill by the females in dealing with the pressure and challenges of the disease. the female gender within the nigerian society in the contemporary times appears to be much given to issues of spirituality, religiosity, social networking and interpersonal relationships. the greater disposition of women to spirituality as a means of obtaining respite in disease states and its positive influence on their health have been documented by other workers outside the nigerian communities. in contrast, the lower scores in males in the social relationship domain may be reflective of the greater sensitivities of males towards matters affecting their personal relationships and sexual activities. since men are generally perceived as strong while women are reckoned as the weaker sex within the population studied, men are less likely to receive social support in disease states than women. the poorly developed formal or organized social support service for the sick in nigeria at present is also a possible contributory factor to these observations. social supports for the sick presently are almost limited to those provided by members of the immediate family of the sick and some religious organizations with unpredictable availability. in this study, the lower age group (< 50 years) had better quality of life in the physical, social relationship and psychological domains of health compared with those above the age of 50 years. with the exception of the social domain where no difference existed between the old and the young age groups. it is however worthy to note that the age cut - offs applied differ between these two studies and the instruments used also comprised of varied parameters. a possible explanation for these observations among our study population may be the fact that advancing age is often associated with degenerative changes and several other co - morbid conditions, which may significantly impair the quality of life of the patients. the younger patients being more economically active are likely to have better financial resources to access care, better quality of home environment, good social relationships and achievement of better self - esteem. these are likely to improve their long - term health outcomes when compared with the older patients. the younger age group is also more likely to have a better understanding of disease processes and better compliance with treatment modalities. these are additional factors that could potentially explain better quality of life in this age category. in this report, almost 56% of the population studied was without spouses (single, separated or widowed). those without spouses had a higher score in the psychological domain while those with spouses fared better in the physical domain of health related quality of life but both categories did not differ in the social and environmental domains respectively. there has been a consistent demonstration of poor quality of life associated with tuberculosis in practically all domains of health as well as improvements with treatment but only few studies have attempted to identify the factors predicting these established facts. this present study attempted filling this knowledge gap by evaluating the independent risk factors for the previously established low quality of life scores in all domains of health as summarized in tables 2 - 5. common predictors of low scores in all the domains of quality of health studied namely physical, psychological, social relationships and environmental health are low monthly incomes and advancing duration of the illness. apart from these common predictors of lower scores, advancing age and male gender predicts poor outcomes of psychological domain of health quality of life while the presence of co - morbidities or concomitant treatment for other conditions and unemployment are also predictive of lower quality of life scores in the physical domain of health. wang. had reported alongside other factors that duration of illness affects the quality of life of tuberculosis patients using the sf-36 instrument in a chinese population. this is in agreement with our present report showing duration of disease as a predictor of poor scores in all the domains. chang.in a review of the english literature had established the fact that a patient diagnosed with tuberculosis is less likely to find work or less likely to be able to work. this perhaps may explain our observation that unemployment is a predictor of low scores of physical health related quality of life. perhaps, it will be more logical to suggest that the impairment of activities of daily living, declining work capacity, sapped energy and fatigue experienced by tuberculosis patient makes it less likely for them to be able to work optimally. this is further complicated by the stigma attached to this disease state in our environment and the fear of a spread in work environment that makes it less likely for such individuals to be gainfully employed. while attempting to evaluate the differences in the quality of life between patients with active and inactive disease in an indian population came to the conclusions that male gender, being single, a higher educational status and absence of concomitant diseases are associated with higher scores of quality of life using the sf-36 instrument, and that age is negatively correlated while monthly income is positively correlated to the quality of life of patients with active disease. while their study differs in design and objective from our present report and different instruments the influence of the factors of age, monthly income and concomitant illnesses are in agreement with our findings while our study recorded higher scores for females in the psychological and social relationship domains as noted earlier for reasons earlier outlined. tuberculosis remains an important disease in nigeria and the overall effect of the disease is all encompassing. apart from being a significant cause of mortality and morbidity, its negative effects on the health related quality of life is enormous and might have been under - estimated and unattended. this study had identified some of the factors influencing the quality of life and independent predictors of low scores of quality of life in nigerian black patients with tuberculosis. it therefore underscores the importance of instituting appropriate measures to improve these aspects of health related quality of life in our efforts towards optimizing care and treatment outcomes. | there is paucity of information on the quality of life of patients with pulmonary tuberculosis in nigeria. this study assessed the factors influencing their quality of life and the independent predictors of low quality of life scores.two hundred and sixty consecutive patients with pulmonary tuberculosis seen at the lagos university teaching hospital were evaluated for health related quality of life using the world health organization quality of life instrument (whoqol - bref). sociodemographic characteristics of the patients were related to the various domains of quality of life and a multivariate logistic regression analysis was performed to identify the independent predictors of low quality of life scores in the patients.the mean age of the patients was 36.712 years. sex, age and marital status of patients were found to influence quality of life scores. the independent predictors of low quality of life scores were low monthly income, duration of the illness, concomitant illnesses, unemployment, advancing age and male gender. several socio demographic and economic factors influenced the quality of life of patients with tuberculosis and are predictive of poor scores. it is important to consider these factors when treating patients with tuberculosis to optimise outcome of care. |
it is well known that alcoholism can lead, in the long - term, to deficits in neurocognitive functions that involve memory, learning, visual - spatial orientation, psychometricity, and information processing, among other skills.1,2 in addition, previous authors have highlighted pronounced impairments in the recognition of affective and/or emotional information. such impairments promote deficits in social cognition and, consequently, in the adaptation and interaction of alcohol abusers with their social environment.36 these deficits occur because social cognition is one of the key aspects of emotional adaptive functioning. it is also an important nonverbal social skill that conveys messages about individuals emotional states at the moment of interaction, thus providing clues that aid the interpretation of behaviors.7 these deficits, together with the development of interpersonal problems, could become risk factors for the maintenance of an individual s cycle of alcohol abuse and/or dependence. they may induce relapses to drinking and hinder the processes of withdrawal, treatment, and recovery.810 given this situation, the majority of studies in the area that have aimed to verify and/or measure the presence of such deficits have employed tasks that involve recognition of basic facial expressions, such as anger, disgust, fear, and sadness (negative emotions), and happiness and surprise (positive emotions). these studies have primarily assessed one or more of the following three key variables : accuracy, latency time, and emotional intensity, pointing to some specific changes. in addition, smaller and more recent studies in this field have monitored brain electrical activity during the performance of cognitive tasks through the use of electroencephalogram instrumentation. these studies have shown that alcoholics exhibit lower brain activation in regions that mediate visual, auditory, and visual - motor processes and deficits in processing anger.1114 other studies have investigated the recognition of facial expressions during neuroimaging tests performed via functional magnetic resonance imaging techniques. these studies have indicated, for example, that alcoholics show lower brain activity in the cingulate, orbitofrontal, and insular cortex (regions that mediate emotional processing) during recognition of facial expressions of fear15 and disgust.6 in addition, marinkovic showed that alcoholic individuals have lower activation in the right amygdala and hippocampus upon negative and positive stimuli compared with nonalcoholics. these studies suggest that this deficient activation may underlie impaired processing of emotional faces in alcoholic individuals. considering the field of knowledge in question and the nonsystematization of findings, the present study consists of a systematic literature review of facial expression recognition by individuals with a history of alcohol abuse and dependence. this aim was achieved by reviewing clinical studies that included accuracy, latency time, and emotional intensity. this review was conducted in accordance with the preferred reporting items for systematic reviews and meta - analyses (prisma) statement17 and followed the instructions in the cochrane handbook for systematic reviews of interventions.18 a systematic search was performed in the psycinfo, pubmed, and scielo electronic databases using the following keywords : (alcohol or alcoholism or alcoholics) and (faces or facial) and (recognition or expression or emotional). the cut - off date for the search was february 6, 2014. the main aspects of the article inclusion and exclusion process are shown in figure 1. as observed in figure 1, a total of 1,145 articles were found. applying the inclusion and exclusion criteria, two researchers selected 26 articles for analysis in the current review.3,4,6,7,915,1933 in general, most of the studies were conducted in belgium (57.7%, n=15), beginning in the early 2000s (96%). only one study had a descriptive methodological design,30 with the remaining studies being of case - control design. the data are presented in table 1, which also shows the main sociodemographic and clinical characteristics of the samples. the majority of the clinical subjects were alcohol - abstinent individuals who were undergoing treatment. of these individuals, 80.8% were inpatients (n=21),3,4,7,9,1115,1926,28,3133 and 7.7% were outpatients (n=2).10,29 the samples ranged from eight to 52 subjects (mean 22.9 and median 24), with mean ages between 35.7 and 60.8 years (median 44.7 years) and varying education levels. prior consumption of alcohol ranged from 12.8 to 39.1 (mean 19) drinks per day. periods without alcohol consumption generally ranged from 18 (median 3) weeks. in two of the studies, this variability was greater, reaching up to 21 years.19,27 in terms of the control group, 88.5% of the studies (n=23) selected healthy subjects with no history of alcohol use from the general population. social drinkers were used as the control group in only two studies, and their alcohol consumption was 3.313 drinks per week.4,7 the control group sample sizes ranged from ten to 47 subjects (mean 23 and median 24), with ages ranging from 33.7 to 45.5 years (median 43.8 years) and variable education levels. most studies diagnosed alcohol abuse and/or dependence according to the diagnostic and statistical manual of mental disorders (dsm - iv ; n=25), with the exception of one study that used the dsm - iii - r.9 all subjects abstained from alcohol. furthermore, only one study utilized the structured clinical interview for dsm - iv axis i disorder.32 the controls were primarily healthy subjects from the general population without a prior history of alcohol dependence (n=23). exclusion criteria for both groups were as follows : presence of comorbidity with any axis i psychiatric disorder (n=17);3,4,912,14,20,22,2528,3033 presence of comorbidity with any axis ii psychiatric disorder (n=1);33 visual or hearing impairment (n=8);4,1114,2426 epilepsy (n=9);1114,2427,32 health problems in general (n=8);4,7,12,14,24,25,27,32 intellectual impairment (n=4);3,9,20,27 wernicke - korsakoff syndrome (n=2);26,27 and use of medications (n=2).21,32 five studies did not present their exclusion criteria.6,15,23,28,29 the main aspects related to types of stimuli and the procedures that the studies used to perform facial expression recognition tasks (fert) are summarized in table 2, which shows that the studies used a wide variety of stimuli and procedures. however, this diversity does not seem to have influenced the outcomes, as discussed below. the main results according to the outcome variables analyzed in the studies are listed in table 3. of the 23 studies that analyzed accuracy, 17 (73.9%) found at least some difference between the groups, indicating impairment in alcoholic individuals with regard to correctly identifying disgust (26%) and sadness (26%). however, 16 studies found no differences between the groups, indicating no impairment in alcoholic individuals with regard to identifying emotions, especially anger (43.7%). in addition, ten studies (43.5%) that evaluated accuracy found differing results for the same sample group. of the eight studies that evaluated the emotional intensity needed for emotion recognition, at least six found a difference in specific emotions. the group of alcoholics required higher intensities for emotion recognition, particularly for fear (50%) and anger (37.5%). however, in seven of these studies this difference was not observed, especially with regard to happiness (75%). finally, of the eleven studies that evaluated latency time, five (45.5%) found that alcoholics required more time for emotion recognition. all of the results presented were also analyzed while taking into account the different variables associated with the stimuli and procedures used in fert, ie, the methods chosen for data collection. despite the great diversity of employed methodologies, none of them seemed to have clearly interfered with the results. in other words, no particular result was associated with any specific stimulus and/or procedure. the influence of sociodemographic features, particularly the influence of male / female sex on fert performance, was also evaluated. of the four studies that analyzed this variable,9,10,23,27 only the study of frigerio found significant differences. this study indicated that women needed less emotional intensity than men to recognize facial expressions, regardless of whether they had a history of alcoholism. only the study by kornreich evaluated the influence of duration of alcohol abstinence on fert performance. this study found that alcoholics who abstained from alcohol for a longer period of time required a lower intensity to judge the emotion compared with recently detoxified alcoholics ; however, there was no improvement in accuracy. in addition, only the study by foisy evaluated the difference between a group of abstinent subjects undergoing treatment and a group of subjects who discontinued alcohol detoxification due to relapses. this study showed that the latter had lower accuracy, but no difference was observed in the emotional intensity required for recognition. in general, most of the studies were conducted in belgium (57.7%, n=15), beginning in the early 2000s (96%). only one study had a descriptive methodological design,30 with the remaining studies being of case - control design. the data are presented in table 1, which also shows the main sociodemographic and clinical characteristics of the samples. the majority of the clinical subjects were alcohol - abstinent individuals who were undergoing treatment. of these individuals, 80.8% were inpatients (n=21),3,4,7,9,1115,1926,28,3133 and 7.7% were outpatients (n=2).10,29 the samples ranged from eight to 52 subjects (mean 22.9 and median 24), with mean ages between 35.7 and 60.8 years (median 44.7 years) and varying education levels. prior consumption of alcohol ranged from 12.8 to 39.1 (mean 19) drinks per day. periods without alcohol consumption generally ranged from 18 (median 3) weeks. in two of the studies, this variability was greater, reaching up to 21 years.19,27 in terms of the control group, 88.5% of the studies (n=23) selected healthy subjects with no history of alcohol use from the general population. social drinkers were used as the control group in only two studies, and their alcohol consumption was 3.313 drinks per week.4,7 the control group sample sizes ranged from ten to 47 subjects (mean 23 and median 24), with ages ranging from 33.7 to 45.5 years (median 43.8 years) and variable education levels. most studies diagnosed alcohol abuse and/or dependence according to the diagnostic and statistical manual of mental disorders (dsm - iv ; n=25), with the exception of one study that used the dsm - iii - r.9 all subjects abstained from alcohol. furthermore, only one study utilized the structured clinical interview for dsm - iv axis i disorder.32 the controls were primarily healthy subjects from the general population without a prior history of alcohol dependence (n=23). exclusion criteria for both groups were as follows : presence of comorbidity with any axis i psychiatric disorder (n=17);3,4,912,14,20,22,2528,3033 presence of comorbidity with any axis ii psychiatric disorder (n=1);33 visual or hearing impairment (n=8);4,1114,2426 epilepsy (n=9);1114,2427,32 health problems in general (n=8);4,7,12,14,24,25,27,32 intellectual impairment (n=4);3,9,20,27 wernicke - korsakoff syndrome (n=2);26,27 and use of medications (n=2).21,32 five studies did not present their exclusion criteria.6,15,23,28,29 the main aspects related to types of stimuli and the procedures that the studies used to perform facial expression recognition tasks (fert) are summarized in table 2, which shows that the studies used a wide variety of stimuli and procedures. however, this diversity does not seem to have influenced the outcomes, as discussed below. the main results according to the outcome variables analyzed in the studies are listed in table 3. the results concerning accuracy were highly divergent. of the 23 studies that analyzed accuracy, 17 (73.9%) found at least some difference between the groups, indicating impairment in alcoholic individuals with regard to correctly identifying disgust (26%) and sadness (26%). however, 16 studies found no differences between the groups, indicating no impairment in alcoholic individuals with regard to identifying emotions, especially anger (43.7%). in addition, ten studies (43.5%) that evaluated accuracy found differing results for the same sample group. of the eight studies that evaluated the emotional intensity needed for emotion recognition, at least six found a difference in specific emotions. the group of alcoholics required higher intensities for emotion recognition, particularly for fear (50%) and anger (37.5%). however, in seven of these studies this difference was not observed, especially with regard to happiness (75%). finally, of the eleven studies that evaluated latency time, five (45.5%) found that alcoholics required more time for emotion recognition. all of the results presented were also analyzed while taking into account the different variables associated with the stimuli and procedures used in fert, ie, the methods chosen for data collection. despite the great diversity of employed methodologies, none of them seemed to have clearly interfered with the results. in other words, the influence of sociodemographic features, particularly the influence of male / female sex on fert performance, was also evaluated. of the four studies that analyzed this variable,9,10,23,27 only the study of frigerio found significant differences. this study indicated that women needed less emotional intensity than men to recognize facial expressions, regardless of whether they had a history of alcoholism. only the study by kornreich evaluated the influence of duration of alcohol abstinence on fert performance. this study found that alcoholics who abstained from alcohol for a longer period of time required a lower intensity to judge the emotion compared with recently detoxified alcoholics ; however, there was no improvement in accuracy. in addition, only the study by foisy evaluated the difference between a group of abstinent subjects undergoing treatment and a group of subjects who discontinued alcohol detoxification due to relapses. this study showed that the latter had lower accuracy, but no difference was observed in the emotional intensity required for recognition. the present study aimed to systematize the literature on recognition of basic facial expressions by alcoholic subjects in terms of the following outcome variables : accuracy, emotional intensity, and latency time. one noteworthy finding is that these studies were conducted recently and were primarily developed by european researchers, with a group of researchers from belgium being responsible for 57.7% of the studies (n=15). homogeneity in the group of researchers who have studied the topic and the significantly diverse methodologies used across studies could have considerably influenced the results. however, despite the great variability of stimuli and procedures in the reviewed studies, a qualitative initial analysis indicated that these variables did not have a direct influence on the studied outcomes. specifically, different results did not display a direct relationship with any of these variables. none of the studies included subjects in the clinical groups who were consuming alcohol at the time of measurement. it is also noteworthy that a small number of subjects were examined in both the clinical groups (852) and the control groups (1047). namely, the following variables stand out : male / female sex of the respondent, given that women recognize both positive and negative emotions more accurately and more rapidly than men;34 age of the respondent, given that adults above the age of 45 years tend to wrongly identify facial stimuli more often than do younger subjects;35 education level of the respondent, as individuals with lower education levels identify facial expressions of fear and disgust less accurately than individuals with higher education levels;36 and type of task used, because dynamic tasks have greater ecological validity than do static tasks, given that the former involve movement and are thus more similar to the actual stimuli.3739 only four studies used an intelligence test to screen the sample, and just one study considered the presence of comorbidity with axis ii personality disorders when assessing exclusion criteria. this observation warrants attention because the literature indicates that the presence of both cognitive deficits and a specific personality disorder can negatively impact fert performance.4045 these variables are particularly important when considering alcoholics, because cognitive deficits may be associated with degeneration of specific brain areas due to chronic and excessive alcohol use.40,41,46 the same approach is valid for personality disorders, as comorbidity rates (especially with antisocial and borderline personality disorders) are considerable, reaching levels greater than 50%.4345 some studies indicated alcoholics greater impairment in fert, while others did not differentiate between their clinical and control groups. for sadness3,9,10,28,30 and disgust,3,9,13,20,30,33 which are considered negative emotions, there was a slight tendency towards impairment in the group of alcoholics. the same result was observed for emotional intensity, as some studies found that alcoholics were less sensitive in fert3,9 and required greater emotional intensity to judge anger7,9,23 and fear.7,9,26,31 the justification given for such positive findings was that the chronic use of alcohol caused changes in the brain structures involved in processing visual - spatial information and the perception of, for example, nonverbal signals,9,20 especially with regard to negative and/or aversive emotions.19,28,30 in addition, it has been found that alcoholics show dysfunction in the right cerebral hemisphere, which is responsible for processing negative emotions.19,47 thus, some authors support the hypothesis that impairments in social cognition are consequences of deficits in the central nervous system and that they even become a reason for maintaining the vicious cycle of drinking.2,3,9,13,20 unlike the variables of accuracy and emotional intensity, studies have shown greater homogeneity for latency time. specifically, alcoholics require more time to judge emotions as a whole.11,30,31,3335,41 this difference suggests that chronic use of alcohol may impair cognitive functions, such as the speed of processing of emotional information and attention level while performing a task. thus, alcoholics needed more time to focus on the task and complete it.4,12,14,27,29 overall, most justifications for the presence of impairments are related to neurocognitive function.1,2 in contrast, the hypothesis used to explain the lack of differences in the three outcome variables (accuracy, intensity, and latency time) between the groups in terms of fert is associated with the different methodological procedures used. according to fein some paradigms may be more sensitive than others in detecting differences between groups. studies that used simpler tasks, such as those in which the subject was offered the possibility of classifying emotions as high (70%) or low (30%) intensity or in which the subject answered yes or no as rapidly as possible after recognizing the emotion displayed,15,23 found no differences between groups. conversely, studies that used more complex tasks, such as requesting the subject to classify the intensity of an emotion using a seven - point likert scale or to choose one of four options of available emotions,10,19 found differences between groups. more complex tasks that require more effort from the subjects are able to demonstrate impairment, whereas simpler tasks can level all individuals and thus underestimate the possible deficits. in addition, other hypotheses underpinning the lack of differences between groups suggest that impairments in the ability to recognize emotions may be independent of alcohol abuse. such impairments may be associated with other factors, such as primary impairment, which is due to altered emotional intelligence21 or the genetic history of the individual. further, this genetic history is capable of potentially leading to an increased predisposition to the development of abnormalities in the brain regions involved in emotional processing.9 as an example, in the study reported by schandler preschool children from families with alcoholic individuals exhibited deficits in processing visual - spatial information. despite the inconclusive results, it is important to consider the judgment deficits mentioned because they may have a negative impact on the social life of the individual who abuses or is dependent on alcohol this potential impact becomes even more relevant because the impairments related to social cognition are not restricted to the variables that were analyzed in the current study. it is also known that alcoholics have a tendency to overestimate emotions7 and show response biases toward negative emotions.11,12,22,23 considering this set of impairments, alcoholics are more vulnerable to displaying inappropriate reactions in social situations. thus, they may experience difficulties in interpersonal relationships and social isolation, and even become involved in fights and/or aggression, which can reduce their quality of life and reinforce their continued alcohol use.8,20 the presented data demonstrate divergent results across the relevant studies. therefore, rather than reaching definite conclusions, only trends can be identified. the current study showed that this line of research is recent and restricted to small groups of researchers who do not use standard methodology. these inconsistencies further complicate direct comparison between studies because, as previously noted, the number of variations between the stimuli and procedures adopted is high. most of the studies were performed in european countries, limiting potential generalizations of the findings to other sociocultural contexts. however, context is an important variable in the etiology of alcoholism.49,50 attention must be paid to other critical points in the studies, such as : adoption of intellectual screening tests ; ascertainment of comorbidity, particularly with personality disorders ; the lack of samples arising from different sociocultural contexts ; and the lack of samples comprising subjects who are currently consuming alcohol. future research can still delineate this field of knowledge, providing more accurate evidence on whether alcoholism influences social cognition. nevertheless, some of the findings herein regarding the negative effect of alcohol use on the recognition of emotions have clinical implications. such implications should be considered in both the treatment of alcoholism and the prevention of relapse, with the aim of minimizing the negative impacts of the distorted interpretation of feelings and/or emotions.19,27 | backgroundalcohol abuse and dependence can cause a wide variety of cognitive, psychomotor, and visual - spatial deficits. it is questionable whether this condition is associated with impairments in the recognition of affective and/or emotional information. such impairments may promote deficits in social cognition and, consequently, in the adaptation and interaction of alcohol abusers with their social environment. the aim of this systematic review was to systematize the literature on alcoholics recognition of basic facial expressions in terms of the following outcome variables : accuracy, emotional intensity, and latency time.methodsa systematic literature search in the psycinfo, pubmed, and scielo electronic databases, with no restrictions regarding publication year, was employed as the study methodology.resultsthe findings of some studies indicate that alcoholics have greater impairment in facial expression recognition tasks, while others could not differentiate the clinical group from controls. however, there was a trend toward greater deficits in alcoholics. alcoholics displayed less accuracy in recognition of sadness and disgust and required greater emotional intensity to judge facial expressions corresponding to fear and anger.conclusionthe current study was only able to identify trends in the chosen outcome variables. future studies that aim to provide more precise evidence for the potential influence of alcohol on social cognition are needed. |
a 60-year - old woman (height, 150 cm ; weight, 58 kg) was scheduled for aortic and mitral valve repairs with maze procedure for mixed aortic and mitral valvular heart disease with atrial fibrillation (af). the preoperative electrocardiogram showed af with ventricular rates of 60 - 100/min and left ventricular hypertrophy. transthoracic echocardiography (tte) and cardiac computed tomography (ct) revealed an ejection fraction of normal range and a dilated left atrium (la) and ventricle, as well as moderate aortic regurgitation and moderate mitral stenosis and regurgitation. coagulation profiles were as follows : prothrombin time (pt) 14.9 s, international normalized ratio (inr) 1.14, activated partial thromboplastin time (aptt) 35.2 s, and fibrinogen 255 mg / dl. upon arrival at the operation room, after establishing routine invasive arterial blood pressure and noninvasive patient monitoring (electrocardiography, pulse oximetry, bispectral index, and cerebral oximetry), anesthesia was induced and maintained using target - controlled infusion of propofol (target concentration, 1.2 - 1.3 g / ml) and remifentanil (target concentration, 10 - 20 ng / ml). muscle relaxation was achieved with the administration of a bolus of rocuronium under the guidance of peripheral monitoring of neuromuscular transmission. then a pulmonary artery catheter (swan - ganz ccombo cco / svo2, edwards lifesciences, irvine, ca, usa) was inserted after anesthesia induction. tee probe (6 t probe, ge healthcare, waukesha, wi, usa) was inserted. tee (vivid 7, ge healthcare, waukesha, wi, usa) revealed no intracardiac thrombus, as was seen in the preoperative tte and cardiac ct. the activated clotting time (act) before cpb was 140 s. cpb was initiated after heparin 300 units / kg was injected, and act above 450 s was achieved. during cpb for 211 min, the act was checked every 60 min and maintained above 450 s with additional heparin 2,000 units given 60 min after cpb started. aortic and mitral valve repairs using bovine pericardium, a mitracon strip (mitr - lift, sciencity, wonju - shi, kangwon - do, korea), and a sinotubular junction ring, and following the maze procedure, were successfully performed without unexpected events. defibrillation with 50 j was applied and tee was performed to evaluate aortic and mitral valve and regional wall motion abnormality. the core temperature reached 36 and weaning of cpb was attempted. at that time, a mobile hyper - echogenic mass in the la was detected via tee (fig. it had a distinct border and different echogenic density than that of blood or the atrial wall. at that point, the act was checked and recorded at 504 s. rotation thromboelastometry (rotem, tem innovations, munich, bayern, germany) showed hypocoagulability, with clotting time (ct) of 972 sec (normal 100 - 240 sec), clot formation time (cft) of 330 sec (normal 30 - 110 sec), -angle 33.5 (normal 70 - 83), and maximum clot firmness (mcf) of 49.8 mm (normal 50 - 72 mm). after discussions with the cardiac surgeons, cpb was re - started for surgical confirmation and proper management of a mobile hyper - echogenic mass. left atriotomy revealed that the mass was a thrombus, 15 20 mm in size with an irregular spherical surface (fig. protamine was injected for neutralization of heparin and an act of 124 s was recorded. during cpb, three units of packed red blood cells (rbcs) were transfused. after weaning from cpb, eight units of platelet concentrates, three units of fresh frozen plasma (ffp), and three units of rbcs were transfused. on completion of the operation, weaning from cpb was accomplished uneventfully. the patient was transferred to the intensive care unit (icu). in the icu, mild coagulopathy was observed with pt 18.1 s, inr 1.46, aptt 35.2 s, fibrinogen 189 mg / dl, d - dimer 5.40 mcg / ml, and platelets 72000/mcl. after 3 days, the patient made an uneventful recovery and was transferred to a general ward. intracardiac thrombus during or just after cpb have rarely been reported. in one such rare case, gillham and tousignant reported severe acute thrombosis of a mechanical aortic valve prosthesis while the patient was fully heparinized on cpb. multiple interacting prothrombotic factors, such as use of aprotinin [2 - 4 ], acquired antithrombin iii deficiency, prolonged duration of cpb, post - protamine status, transfusion of blood components, disseminated intravascular coagulation, preoperative congestive heart failure, biological glue, and multiple prosthetic surfaces, may contribute to intracardiac thrombus during or just after cpb. the report by gillham and tousignant in addition, the patient was resistant to heparin and an antifibrinolytic drug was also administered. in our case, aprotinin was not administered, nor were any antifibrinolytic drugs, and the patient had no known coagulation disorders. no blood components, except rbcs, were transfused before cpb weaning. biological glue for aortic and mitral valve repairs was not used. therefore, the prolonged duration of cpb (211 min) might have contributed to the intracardiac thrombus in this case. congested pulmonary venous blood, related to mitral regurgitation, might become sticky during an extended cpb. the patient had no right - to - left cardiac shunt, such as a patent foramen ovale. therefore, the intracardiac thrombus would have originated from the left cardiac chamber itself or the pulmonary veins. sudden development of refractory hypotension with a rapid rise in pulmonary artery pressures within 10 min after infusion of protamine and while closing the sternum might be key signs of right heart thrombus. transesophageal echocardiography is a useful tool for the diagnosis and evaluation of intracardiac thrombus. in particular, the evaluation of posterior structures of the heart, such as the la and left atrial appendage (laa), is much easier with tee. the sensitivity and specificity of tee for thrombus in the la have been reported as 93 - 100% and 99 - 100% [7 - 9 ], respectively. however, it is important to distinguish between intracardiac thrombus and artifacts or pitfalls during tee examination. kim. reported that folding of the right atrium appeared as a mass - like thrombus via tee. pressman and figueredo also reported misdiagnosis of the inverted laa as an la thrombus. a large hypertrophic trabecula, stagnant blood, or a warfarin ridge can also be confused for an intracardiac thrombus. in our case, however, the mobile hyper - echogenic mass with a clear - cut margin was determined conclusively to be a thrombus. the mass was separate from the adjacent la wall, so it could be distinguished from pectinate muscle, trabeculations, and inverted laa. it could be differentiated from suture materials because it had no connection with the ring of the mitral valve annuloplasty and was less echogenic than suture materials. in conclusion, abrupt formation of intracardiac thrombus with full heparinization can occur. for early detection of an intracardiac thrombus and prevention of detrimental outcomes, meticulous | intracardiac thrombus during cardiopulmonary bypass (cpb) with full heparinization is very rare but fatal. a 60-year - old woman was scheduled for aortic and mitral valve repairs with a maze procedure for mixed aortic and mitral valvular heart disease with atrial fibrillation. preoperative transthoracic echocardiography and cardiac computed tomography showed moderate aortic regurgitation and moderate mitral stenosis with regurgitation. there was no intracardiac thrombus. aortic and mitral valve repairs with the maze procedure were successfully performed without unexpected events. during cpb weaning, a mobile hyper - echogenic mass in the left atrium was detected on transesophageal echocardiography. after cardiac arrest, it was surgically removed. on completion of the operation, weaning from cpb was accomplished uneventfully. the patient fully recovered and was discharged from the intensive care unit on her third postoperative day. |
postural control refers to the sensorimotor control that maintains center of pressure (cop) within the base of support when postural sway occurs due to active or external forces1. patients with stroke show a pattern of increased postural sway during quiet standing due to motor, sensory, and cognitive impairments2, 3, which increases the risk of falls, as well as limits their ability to independently perform daily life activities4,5,6. many studies have reported that providing additional sensory information to patients with balance impairment results in improved postural control7,8,9. one of the methods is using a computer screen to provide visual feedback on the displacement of cop. however, this method has its limitations for home - use because of its high cost10. visual feedback training using a mirror is a method that can lead to improvements in postural control by providing feedback on induced movements through a reflection of the body image in the mirror11. hlavackova.12 reported that when visual feedback was obtained by transfemoral amputees from a mirror placed in front of them, a significant decrease was observed in the subsequent measurement of sway distance. moreover, a study of the elderly that measured the effects of visual feedback from a mirror reported significant improvement in the mediolateral postural sway10. many studies have reported that mirror therapy is effective for motor learning in patients with stroke13,14,15,16. few studies have been conducted on the effects of visual feedback from a mirror on the balance ability of patients with stroke. in addition, most of the studies only measured the effect on stable surfaces. hence, there is a need for studies on the effects of visual feedback on unstable surfaces. this study aimed to measure the effects of visual feedback from a mirror on the balancing ability of patients with stroke on various supporting surfaces. fifteen patients with hemiparetic stroke were recruited for this study from myongii chonnhey hospital. the inclusion criteria for subjects were as follows : patients who were diagnosed with first onset of unilateral hemisphere stroke, could stand independently for 1 minute on a stable surface, had no visual deficit, had no vestibular deficit, and were able to understand and follow simple verbal instructions. table 1table 1.subject characteristics (n=15)meansdgender (male / female)9/6age (years)54.9 10.9height (cm)165.7 8.3weight (kg)63.7 8.0post - stroke duration (mo)12.9 4.7paretic side (right / left)8/7lesion type (hemorrhage / ischemia)7/8mmse26.15 1.83mmse : mini mental state examination shows a list of general characteristics of the subjects. after being informed about the study, all subjects agreed to participate and signed a consent form. mmse : mini mental state examination the subjects were asked to stand, barefoot and with their heels separated by a distance of 8.4 inch on a force plate. experimental trials included three visual (eyes closed, eyes open, and mirror feedback) and two support surface (stable and unstable) conditions. in the eyes open condition, the subjects were asked to fix their gaze on the wall 1 m in front of them, at the eye level. in the mirror feedback condition, the subjects were able to visualize their frontal reflected image in a mirror placed on the wall 1 m in front of them12. for the trials on an unstable surface, the subjects stood on a balance pad (airex, aalen, germany)17. the foot positions were marked on the forceplate and maintained constant between the trials. the effect of muscle fatigue was minimized by providing a 1-minute rest between measurements. all subjects wore a harness and a therapist stood behind each of them for safety. the subject s balance ability was measured using a force platform (wii balance board [wbb ], nintendo, kyoto, japan). the size of the wbb with four load cells was 45 cm 26.5 cm. this instrument is reported to have a high test - retest reliability (intraclass correlation coefficient [icc ] = 0.660.94) and construct validity (icc=0.770.89)18. data was exchanged between the wbb and a laptop using the built - in bluetooth and balancia software (balancia v2.0, mintosystems, seoul, republic of korea). the sampling rate was set at 50 hz, and 12 hz low pass filtering was performed. balancia software is reported to have a high interrater reliability (icc=0.890.79) and intrarater reliability (icc=0.920.70)19. in order to compare balance ability in different conditions, data were analyzed using one - way repeated measures analysis of variance (anova). the least significant difference post hoc test was used to examine the differences within each trials. for all directions, cop distance and speed increased when the subjects stood on the stable surface with their eyes closed. during stance on the stable surface, no significant differences were observed in cop distance and speed between the eyes open and mirror feedback conditions (table 2table 2.center of pressure (cop) in patients with stroke during stance under three conditions on a stable surfaceeyes closedeyes openmirror feedbackcop distance (cm)anteroposterior58.324.036.813.036.911.3mediolateral43.612.836.28.936.19.3total 80.827.657.716.758.916.2cop speed (cm / s)anteroposterior2.91.21.80.71.80.6mediolateral2.20.61.80.51.90.5total4.01.42.90.82.90.8values are expressed as meansd. significant difference compared with the eyes closed condition. significant difference compared with the mirror feedback condition during stance on the unstable surface, an effect of condition was observed along the mediolateral direction with a smaller mediolateral cop distance in the mirror feedback than in the eyes open and eyes closed conditions, whereas no effect of condition was observed along the anteroposterior direction. cop speed was significantly reduced by mirror feedback when the subjects stood on the unstable surface (table 3table 3.center of pressure (cop) in patients with stroke during stance under three conditions on an unstable surfaceeyes closedeyes openmirror feedbackcop distance (cm)anteroposterior84.924.647.914.643.910.3mediolateral74.123.348.513.742.18.3total 125.237.175.820.867.513.5cop speed (cm / s)anteroposterior4.92.532.40.731.80.6mediolateral3.71.22.40.72.10.4total6.82.93.81.03.40.7values are expressed as meansd. significant difference compared with the eyes closed condition. values are expressed as meansd. significant difference compared with the eyes closed condition. in this study we examined the effects of visual feedback from a mirror for patients with stroke in a standing position on various supporting surfaces. the sway distance and speed were the highest when the subjects were standing on a stable surface with their eyes closed, whereas no significant difference was observed in all directions when the mirror feedback was obtained with their eyes open. in a study of amputees that examined the effect of visual feedback from a mirror, this was attributed to the improved balance ability through the visual information reflected in the mirror that acted as a sensory substitution for diminished proprioception from the injured limb12. furthermore, visual feedback from a mirror helps in learning accurate motions through adjustment of errors observed during task performance20. a study that used visual feedback in conducting balance training in patients with stroke also reported that such training improved weight distribution and balance ability21. however, in this study, no significant improvement effect was observed from visual feedback for subjects who could maintain a standing position on their own for at least 1 minute on the stable surface with relatively small postural sway. horak.22 indicated that dependency on the vestibular organs and vision increased for postural control as the surface became more unstable. a study on the effects of providing additional somatic sensory information for balance in the elderly also reported that greater improvements were observed on a more unstable surface with increased postural sway23. accordingly, the effect of visual feedback from a mirror on the postural sway on unstable surfaces was observed in this study. it has been reported that mediolateral sway is significantly correlated with falls and can be a predictive factor for falls24, 25. therefore, improving postural control in this direction is important for reducing the incidence of falls26. mediolateral sway can be recognized as the error associated with the movement that deviates from the body s centerline, while anteroposterior sway can be visually recognized through changes in the sizes of images reflected in the mirror. 10 reported that when visual feedback from a mirror was obtained by the elderly, significant improvement was observed only in the mediolateral direction, and the authors attributed this to the threshold difference in the visual recognition of mediolateral and anteroposterior sway. decreased mediolateral sway distance and speed was observed when visual feedback was obtained from a mirror, compared to the condition in which the eyes were either closed or open, but the findings were not statistically significant. moreover, since the anteroposterior sway was not large enough to show changes in the size of the image, a significant difference based on the visual feedback was not exhibited. the visual feedback from a mirror for patients with stroke led to a significant decrease in the postural sway on surfaces that are more unstable, where the sway distance and speed had increased. however, generalization of the result is difficult due to the small number of subjects. in addition, because the subjects were recruited regardless of fall experience, a correlation of visual feedback with falls could not be determined. therefore, future studies should examine the effects of visual feedback from a mirror in dynamic states such as sit to stand, and visual feedback training using a mirror on balance and falls in patients with fall experience. | [purpose ] this study aimed to examine the effects of a visual feedback obtained from a mirror on balance ability during quiet standing in patients with stroke. [subjects ] fifteen patients with stroke (9 males, 6 females) enrolled in the study. [methods ] experimental trials (duration, 20s) included three visual conditions (eyes closed, eyes open, and mirror feedback) and two support surface conditions (stable, and unstable). center of pressure (cop) displacements in the mediolateral and anteroposterior directions were recorded using a force platform. [results ] no effect of condition was observed along all directions on the stable surface. an effect of condition was observed on the unstable surface, with a smaller mediolateral cop distance in the mirror feedback as compared to the other two conditions. similar results were observed for the cop speed. [conclusion ] visual feedback from a mirror is beneficial for improving balance ability during quiet standing on an unstable surface in patients with stroke. |
hemangiomas are generally classified into capillary, cavernous, mixed and sclerosing types according to the type of blood cells they are composed. hemangiomas are mostly seen in the head and neck region and thought to originate from endothelial progenitor cells. oral capillary hemangiomas consist small - sized, and thin walled capillary - like vessels, which are lined with a layer of endothelial cells and usually are localized on oral soft tissues. clinically, capillary hemangiomas are soft, small - sized, lobulated, or solitary lesions with a color range between red and blue due to the profundity of the lesion. oral capillary hemangiomas are rarely seen in adults and mainly localized on oral mucosa or gingiva. the intraosseous form of capillary hemangioma is an uncommon entity and reported to be seen in the metacarpal, frontal, and temporal bones. in this report, an unusual case of intraosseous capillary hemangioma of the mandible was presented with radiological and histological features. a 68-year - old female patient referred to our clinic for further examination of the radiolucent cyst - like lesion on her mandible. the clinical examination was normal, and the patient had no complaints regarding the lesion. the lesion was located on left canine - premolar region with sclerotic curly borders that is suggestive of a benign lesion [figure 1 ]. the sclerotic boundaries of the lesion were prominently revealed on the axial ct section [figure 2 ]. panoramic radiography revealed radiolucent cyst - like lesion with irregular sclerotic borders localized at the mandibular canine - premolar region axial computed tomography section reveals irregular, nonuniform sclerotic borders of the lesion vertical and sulcular incisions were performed to expose the operation site. a direct approach to the lesion was provided with surgical burs with copious saline irrigation. surgical curettage was performed with unexpected moderate bleeding of the lesion [figure 3 ]. the surgical specimen has a solid structure with bluish - brown color [figure 4 ]. a provisional diagnosis of central giant cell granuloma was made due to the intraoperative unexpected bleeding. histological examination revealed numerous small - sized vessels that are consistent with capillary vessels [figure 5 ]. a single layer of endothelial lining was present in the proliferating capillary vessels [figure 6 ]. bleeding of the lesion can be clearly seen postoperative appearance of the surgical specimen capillary hemangioma consisting of proliferated, small - sized blood vessels (he 40) proliferated blood vessels lined by a single layer of bland endothelial cells (he 100) intraosseous hemangiomas of the jaws are benign vasoformative neoplasms. they are asymptomatic and mostly discovered incidentally on plain radiographs. intraosseous hemangiomas are commonly localized in calvaria and spine and affects long bones and other skeletal bones less frequently. patients with high- pressure hemangiomas often report a sense of pulsation at the related region. reported two cases of cellular hemangioma, which may correspond to capillary hemangioma on the mandible in their study according to a previously suggested classification system. several cases of cavernous intraosseous hemangiomas of the jaws were reported with clinical and histopathological features. a preoperative arteriogram is recommended for screening of the supplying vascular structures and observation of soft tissue extension. trabecular thickening and sclerotic punctate areas which are called polka - dots can be seen on ct examinations of skeletal intraosseous hemangiomas. plain radiography and ct findings of intraosseous mandibular hemangiomas include unilocular radiolucency with sclerotic rims, resembling a jaw cyst or sunburst or honeycomb appearance radiating from central to the periphery with or without radiopaque areas. capillary intraosseous hemangioma in the current report showed irregular, but well - defined borders in both panoramic radiography, and ct imaging which is consistent with reports of intraosseous mandibular cavernous hemangioma in the literature. if the lesion is asymptomatic or superficial and cause no esthetical problems, they can be left untreated. in general, surgical excision with or without preoperative embolization is suggested in the treatment of intraosseous or soft tissue hemangiomas. preoperative embolization was not considered due to the small size and indolent radiographic appearance of the lesion. however, capillary hemangioma of the mandible has been an uncommon and undefined entity. to our knowledge, radiographic findings of the lesion are similar with a cavernous form of intraosseous mandibular hemangioma. ct imaging of intraosseous hemangiomas enables the clinician to examine the borders and content of the lesion more carefully, and helps the surgeon to decide the treatment modality that is suitable for the current case. | intraosseous hemangioma is a benign vascular neoplasm, which is mostly seen in vertebrae, maxillofacial bones, and long bones. intraosseous hemangioma is rarely seen on jaw bones compared to other skeletal bones and usually occurs in the cavernous form. capillary intraosseous hemangioma of jaws is an uncommon form of intraosseous hemangioma and has not been thoroughly described so far. in this study, a case of capillary intraosseous hemangioma of the mandible was presented with relevant literature review. |
lupus vulgaris is the most common morphological presentation of cutaneous tb that can present as papular, nodular, plaque, ulcerative, vegetating, and tumid forms. it often originates from an underlying focus of tb, typically in a bone, joint or lymph node, and spreads by either contiguous extension of the disease from underlying affected tissue, or by hematogenous or lymphatic spread. it is a paucibacillary type of cutaneous tb and occurs in a patient of a moderate immunity. a typical feature of lupus vulgaris is its extremely chronic course, characterized by a slow and steady growth of the lesion over a period of years. unusual variants include the frambesiform, gangrenous, ulcerovegetating, lichen simplex chronicus, myxomatous, and sporotrichoid types. herein we report a rare sporotrichoid presentation of the disease. a 28-year - old female with family history of tb presented with multiple, asymptomatic, raised skin lesions of variable size and shape over her right lower limb. lesions first appeared on the upper surface of her right foot 12 years ago [figure 1 ] after a thorn prick. thereafter, they extended steadily upward to her inner thigh, increasing both in number and size. there was a history of scarring at one end of the lesions and extension from the other. examination of the right lower limb revealed polysized plaques of 4 - 8 cm diameter with central scarring and peripheral nodularity extending in a linear array from the dorsum of the lateral three toes to the medial aspect of ankle joint, knee joint, and medial aspect of the upper thigh in a sporotrichoid pattern [figure 2 ]. histopathology revealed hyperkeratosis, acanthosis and elongation of the rete ridges with dense dermal granulomas comprising epithelioid cells, langhan 's type giant cells and chronic inflammatory cells, supporting a diagnosis of lupus vulgaris [figure 3 ]. plaque from dorsum of the foot in a sporotrichoid pattern plaque in sporotrichoid pattern histopathology showing granulomas comprising epitheloid cells and langhan 's type giant cells (h and e stain, 40) a final diagnosis of sporotrichoid - lupus vulgaris was made and the patient referred to the government tb clinic for category i dots. sporotrichoid form of lupus vulgaris is an unusual variant that mimics sporotrichosis, a subcutaneous fungal disease. bacilli follow the lymphatic channels and during transit, provoke cutaneous granulomatous inflammation resulting in a linear array of papular, nodular and ulcerative lesions over time. it has been shown that sporotrichoid form is more common in children than in adults. the efficient lymphatic drainage in children and high physical activity that makes them prone to trauma may be responsible for this form. as it is a complex process and takes time | lupus vulgaris is the most common presentation of cutaneous tuberculosis in india and can present as papular, nodular, plaque, ulcerative, vegetating, and tumid forms. unusual variants include the frambesiform, gangrenous, ulcerovegetating, lichen simplex chronicus, myxomatous, and sporotrichoid types. we describe a rare sporotrichoid presentation of lupus vulgaris on the leg of a 28-year - old female of 12 years duration. |
a 65-year - old female visited korea university anam hospital complaining of chest pain, palpitation, and dyspnea. on the basis of computed tomography, she was diagnosed with takayasu s arteritis including a large aneurysm (58 mm) on the aortic distal arch (fig. because the patient strongly refused surgery, we performed thoracic endovascular aortic repair (tevar) with left subclavian artery (lsca) to left common carotid arterial transposition (fig. after tevar, the patient s symptoms improved, and she was discharged on postoperative day 10 with a normal chest x - ray (fig. the patient returned to the hospital complaining of moderate dyspnea on postoperative day 19, and the follow - up chest x - ray showed a severe left pleural effusion (fig. after the insertion of a chest tube, postoperative chylothorax was confirmed by a pleural fluid analysis. conservative management with a fat - free diet and nil per os was attempted for 2 weeks, but there was no remarkable improvement. therefore, we administered a subcutaneous injection of octreotide (0.1 mg) every 8 hours for 2 weeks ; however, even these injections had no effect. surgical treatment was also considered, but given the possibility of unsuccessful repair due to the uncertainty of the exact site of the thoracic duct leakage and the patient s strong refusal, it could not be our next option. therefore, we performed an intranodal lymphangiogram using lipiodol (poppy seed oil used as a radio - opaque contrast agent to outline structures in radiological investigations) on postoperative day 46. a total volume of 3 to 6 ml of lipiodol was injected into each lymph node at the inguinal area under the guidance of ultrasonography. during the fluoroscopy, the lipiodol had migrated to the retroperitoneal lymphatics but did not advance beyond the l3 level. however, the chest x - ray taken 3 days after the thoracic duct embolization (tde) revealed that the lipiodol had migrated up to the subclavian lymphatics (fig. the chest tube drainage suddenly decreased on the 3rd day after tde, and we were finally able to remove the chest tube on the 13th day after tde (fig. postoperative chylothorax is a rare but serious complication of the thoracic and esophageal surgical procedure. further, a significant loss of immunoglobulins, t lymphocytes, and proteins into the pleural cavity results in immunosuppression. conservative treatments include drainage of the pleural effusion, a diet including medium - chain triglycerides (mcts), total parenteral nutrition (tpn), and injection of somatostatin analogs like octreotide. an mct diet and tpn reduce the chyle s flow, and somatostatin analogs reduce the intestinal chyle production. in case the high - output chylothorax responds poorly to conservative management, surgical treatment such as thoracic duct ligation, pleuroperitoneal shunt, pleurodesis, or pleurectomy is required. lymphangiography has also been considered a treatment of chylothorax, being less invasive than surgery and having a success rate of about 80% (table 1) [36 ]. the mechanism is thought to be caused by lipiodol, which produces an inflammatory process and occludes the chyle leak. complications of lymphangiography are pulmonary oil embolism, hypersensitivity, and lymphatic obstruction, but these are rare and usually minor. in our case, postoperative chyle leakage was not reduced or improved despite the trial of conservative management and octreotide injection. therefore, we performed an intranodal lymphangiogram and tde with lipiodol. through this case, we verified that tde with lipiodol could be considered an alternative for the treatment of postoperative chylothorax, if conservative medical treatment is unsuccessful and surgical treatment is not possible. | chylothorax is a rare postoperative complication of a thoracic surgical procedure. here, we report a case of chylothorax after thoracic endovascular aortic repair with debranching for the distal arch aneurysm of the aorta. first, the patient was treated by a medical method (nil per os, fat - free diet, and octreotide), but this method failed. the patient strongly refused surgical treatment. therefore, we tried to occlude the thoracic duct by lymphangiography lipiodol, and this line of treatment was successful. |
accessory fissures in the lungs are common congenital variations, which occur due to lack of obliteration of fissures separating individual bronchopulmonary segments during the development. presence of accessory fissures should be documented in the radiological report as they affect the surgical planning, especially in pulmonary malignancies. we report a case of non - azygos accessory fissure between the apical and the anterior segments of the right upper lobe, associated with inferior and superior accessory fissures in the right lower lobe, which was detected in the ct - portion of positron emission tomography - computed tomography (pet - ct). a 40-year - old woman with a known diagnosis of extra - nodal (bone marrow, spleen, and pleural fluid) stage iv diffuse large b - cell lymphoma was referred for baseline pet - ct scan before the initiation of treatment. pet - ct scan showed diffuse increased fluorodeoxyglucose uptake in the marrow consistent with known marrow involvement by lymphoma, in addition to splenomegaly. incidentally noted in the ct portion of the pet - ct was an accessory fissure in the right upper lobe. the dedicated ct scan of the chest demonstrated the fissure better than the ct portion of the pet - ct, due to lack of breathing artifact and the accentuation caused by the pleural effusion. the accessory fissure was between the apical and anterior segments of the right upper lobe [figures 1 and 2 ]. the contrast - enhanced ct scan showed normal location and course of the azygos vein [figure 1 ]. in addition, the patient also had inferior and superior accessory fissures in the right lower lobe [figures 3 and 4 ]. (a) axial ct image shows the non - azygos accessory fissure in the right upper lobe (arrows), (b) contrast - enhanced axial ct scan shows the normal location of the azygos vein. (a) axial, (b) coronal reformatted and (c) sagittal reformatted images show the non - azygos accessory fissure in the right upper lobe (arrows), between the apical and anterior segments. right pleural effusion is seen extending into the posterior portion of the major fissure in the sagittal reformatted image. (a) axial, (b) coronal reformatted and (c) sagittal reformatted images show the inferior accessory fissure in the right lower lobe (double arrows). extension of pleuraleffusion in to major fissure (long arrow), and superior accessory fissure (short thick arrow) is revealed in the sagittal reformatted image. (a) axial, (b) coronal reformatted and (c) sagittal reformatted images of the follow - up ct scan after the resolution of pleural effusion show the superior accessory fissure in the right lower lobe (arrows). accessory fissures generally occur between bronchopulmonary segments, as a cleft of varying depth lined by visceral pleura. they are more common in fetal and neonatal lung specimens than in adult lung specimens. during the development, the lung tissue grows as multiple bronchopulmonary buds with fissures separating individual bronchopulmonary segments. later, the fissures separating individual bronchopulmonary segments become obliterated except the major (oblique) and minor (horizontal) fissures in a fully developed lung. the accessory fissures are not well demonstrated in conventional ct examinations, due to thick slices and orientation of the fissures relative to the scan plane. high - resolution computed tomography (hrct) demonstrates the accessory fissures at a higher frequency compared to conventional ct scan with thicker sections due to better spatial resolution as a result of narrow collimation and high - spatial resolution reconstruction algorithm. multi - detector computed tomography (mdct) has even higher sensitivity for detection of accessory fissures, with incidence of accessory fissures being similar to anatomical studies due to further thin cuts, faster speed, and volumetric acquisition. common accessory fissures include the inferior accessory fissure (demarcates the medial basal segment of the lower lobe), left minor fissure (demarcates the lingula), and superior accessory fissure (demarcates the superior segment of lower lobes). less common accessory fissures include the fissures between medial and lateral segments of middle lobe, between superior and inferior segments of lingula, between anterobasal and laterobasal segments of lower lobes, between apicoposterior and anterior segments of left upper lobe, and azygos fissure (resulting from the abnormal course of the azygos vein). in a retrospective study of 150 cases by cronin., using mdct, the incidence of accessory fissures was found to be : superior accessory fissure 6%, inferior accessory fissure 12.7%, left minor fissure 16%, fissure between medial and lateral segments of middle lobe 5.3%, fissure between superior and inferior segment of lingula 2.7%, fissure between anterobasal and laterobasal segment 3.3%, and azygos fissure 0.7%. our patient had an accessory fissure between the apical and the anterior segments of the right upper lobe. accessory fissure in the right upper lobe other than due to the anomalous course of azygos vein is very rare. gowrinath., reported a case of non - azygos accessory fissure between the apical and the posterior segments of right upper lobe. tzn., described double accessory fissures in the upper lobe of the right lung which are likely variation of an azygos fissure (double azygos fissures), since their configurations and locations were similar. to the best of our knowledge, non - azygos accessory fissure between the apical and the anterior segments of right upper lobe, associated with superior and inferior accessory fissures of the right lower lobe has not been described in the literature. the pleural fissures can act as an anatomic barrier to the spread of inflammatory or neoplastic disease. accessory fissure may cause diagnostic confusion as it can limit the spread of disease within the lung, mimicking atelectasis, scar, mass, or loculated pleural effusion in radiographs. although the accessory fissures are incidental findings detected on radiographs or ct scan, they are important as they present an anatomic barrier to the spread of inflammatory or neoplastic disease as well as mimic lesions. recognition of the accessory fissures provides additional information for segmental localization of pulmonary lesions, as well as help in surgical planning. | accessory fissures in the lungs are common congenital variations, usually detected as incidental findings in radiographs or ct scan. accessory fissures can act as an anatomic barrier to the spread of inflammatory or neoplastic disease, as well as due to the variant anatomy, mimic lesions. it is important to recognize the presence of accessory fissures, as they affect surgical planning of pulmonary lobectomy and segmentectomy. accessory fissure in the right upper lobe other than due to the anomalous course of azygos vein is very rare. we report a case of non - azygos accessory fissure, between the apical and the anterior segments of right upper lobe, along with superior and inferior accessory fissures in the right lower lobe. |
the senescence - accelerated mouse (sam) is a group of inbred mouse strains that are used as animal models of senescence acceleration and age - associated disorders. during sister - brother mating of akr / j mice obtained from jackson laboratories (me, usa) by the department of pathology, chest disease research institute (now the institute for frontier medical sciences), kyoto university (kyoto, japan), dr. takeda and his colleagues became aware that most of the mice in certain litters demonstrated senescent phenotypes, presenting as a lack of activity, hair loss and lack of sheen, skin lesions, increased lordokyphosis, and premature death. selective breeding, based on senescence scores, life span, and pathobiological phenotypes, was then carried out, leading to the development of nine senescence - accelerated - prone (samp) strains, and three senescence - accelerated - resistant (samr) strains. each samp strain exhibits accelerated senescence characteristics. among these strains, samp8 and samp10 have age - related deficits in learning and memory [36, 45, 55, 56, 65, 70 ], emotional disorders [35, 65 ], and altered circadian rhythm. since these phenotypes are accelerated with aging, samp8 and samp10 are frequently used as models for studying age - related changes in higher brain function. in contrast, samp6 is predominantly used as a model of senile osteoporosis, since mice exhibit low bone mass, and slow bone loss. after 4 months of age, samp6 has global low bone density, marrow osteogenic defects, and deficits in endocortical mineralizing surface, as well as reduced femoral weight, and calcium and phosphorus levels. however, an aging - related increased expression of s100, a factor underlying the increased risk of alzheimer s disease, in the brain of samp6 was reported, compared with samr1, suggesting possible central nervous system alterations in samp6. we therefore decided to study whether samp6 was also a model of senescence - related brain alterations and diseases. since the bone mineral density of samp6 is highest at 4 months of age, this is thought to be the age at which these mice have their optimal body function, while the median survival time of samp strains is 9.7 months. we therefore performed a battery of behavioral analyses using 1- (juvenile), 46- (adult), and 812-month - old (old) samp6 and age - matched samr1 to study age - related changes in behavioral characteristics (table 1table 1.summary of behavioral characteristics of samp6 compared with age - matched samr1.behavioralcharacteristicsbehavioral testsjuvenileadultold1 mo 4 mo6 mo8 mo12 moactivityopen field testhigh high high home cage activity testhigh low y - maze testhigh high high elevated plus maze testhigh high high light - dark exploration testhigh high high motor coordinationwire - hanging test (score)low low low wire - hanging test (time)low low low rotating rod test (static version)low low low rotating rod test (accelerating version)low low low anxietyelevated plus maze test (open arm entry)low low low elevated plus maze test (time)low low low light - dark exploration testlow low low marble - burying testlow low low depressiontail suspension testlow low low learning and memoryy - maze testhigh high high novel object recognition testhigh novel object location testhigh win - shift eight - arm radial maze testhigh morris water maze (reference memory)similar similarmorris water maze (working memory)low low : p<0.05 compared with age - matched samr1. : p<0.01 compared with age - matched samr1. c) similar : the performance of samp6 is similar to that of samr1.). : p<0.05 compared with age - matched samr1. : p<0.01 compared with age - matched samr1. c) similar : the performance of samp6 is similar to that of samr1. open field, home cage activity, y - maze, elevated plus maze, and light - dark exploration tests all revealed that samp6 exhibits higher motor activity compared with samr1. in the open field test, the distance traveled by samp6 in 25 min was greater than that travelled by age - matched samr1. in the y - maze test, the total number of arm entries of samp6 was significantly higher than age - matched samr1 at 4 and 8 months, while a similar trend was observed when mice were 1 month of age. similarly in the elevated plus maze test, the total number of arm entries of samp6 was significantly higher than age - matched samr1. in the light - dark exploration test, samp6 exhibited a significantly increased total number of transitions compared with age - matched samr1. since behavioral changes are already apparent at 1 month of age, it is likely that this is an innate behavioral characteristic of samp6. in the home cage activity test, the total activity of 6-month - old samp6 during a 24-h period was significantly higher than samr1. in contrast, the total activity of 12-month - old samp6 tended to be lower than age - matched samr1, and was significantly lower than 6-month - old samp6. the higher motor activity of samp6 is observed until 8 months of age, after which motor activity begins to decline, and is detectably lower at 12 months of age. results of the wire hanging and rotating rod tests revealed that samp6 had an innate motor coordination deficit. in the wire - hanging test, the mean score and latency to fall of 1- and 8-month - old samp6 were significantly lower than age - matched samr1 (unpublished data). in contrast, no significant difference either in the score or latency to fall off was detected between samp6 and samr1 at 4 months of age. in the rotating rod test, the latency of samp6 to fall off an accelerating rod was significantly shorter than samr1 at 18 months of age [43 and unpublished data ]. however, in a 3-rpm constant speed, 1- and 8-month - old samp6 tended to fall off faster than age - matched samr1 (unpublished data), while 4-month - old samp6 had improved latency. since there was no difference between the grip strength of samp6 and samr1 at 18 months of age [43 and unpublished data ], the motor coordination deficit observed in samp6 is unlikely to be caused by reduced grip strength. reduced anxiety of samp6, compared with samr1, was revealed by results of the elevated plus maze, light - dark exploration, and marble - burying tests. in the elevated plus maze test, samp6 spent significantly greater periods of time on, and more frequently entered, the open arms compared with age - matched samr1 at 18 months of age. in the light - dark exploration test, samp6 spent significantly longer in the light box than age - matched samr1. finally in the marble - burying test, the number of marbles buried by samp6, and the length of time they spent marble - burying, were significantly higher than age - matched samr1. in samp6, the time spent on the open arms and the number of open arm entries in the elevated plus maze test this suggests that there is an age - associated decrease in the difference between the anxiety levels of samp6 and samr1. in contrast, there was no age - dependent change in the time spent in the light box in the light - dark exploration test, the number of marbles buried or the time of marble - burying behavior in the marble - burying test from 1 to 8 months of age in samp6. the reason why samp6 exhibited age - associated decrease in anti - anxiety behavior in elevated plus maze test, but not in light - dark exploration or marble - burying tests, might be that elevated plus maze test gives animals stronger load compared with the other two behavioral tests and samp6 has an age - dependent anxiety specifically related to elevation. the tail suspension test revealed that samp6 has innate anti - depressant activities compared with samr1. specifically, the immobility time of samp6 was significantly shorter than age - matched samr1 at 18 months of age, but the difference in anti - depressant activities gradually decreased as the mice aged. however, since samp6 are hyperactive, it is unclear whether their shortened immobility time in the tail suspension test is specifically due to depression - related mechanisms. the y - maze, novel object recognition, object location, and delayed spatial win - shift eight - arm radial maze tests all revealed that samp6 has enhanced spatial learning and memory compared with samr1. in the y - maze test, the spontaneous alteration behaviors of 4- and 8-month old samp6 were significantly higher, while the behavior of 1-month - old samp6 tended to be increased, compared with age - matched samr1. in the novel object recognition test, 4-month - old samp6 showed a significantly higher exploratory preference for the novel, rather than old, object compared with samr1. in the object location test, 4-month - old samp6 showed a significantly increased exploratory preference for the displaced object compared with age - matched samr1. in the delayed spatial win - shit eight - arm radial maze test, 4-month - old samp6 had a greater improvement in the percentage of correct choices during days 26 of nine consecutive days, compared with samr1. overall, samp6 mice exhibited enhanced spatial learning and memory, and this behavioral characteristic was not affected by aging. in contrast, liu. previously reported a working memory deficit of 4- and 8-month - old samp6 in the morris water maze test compared with age - matched samr1. however, since the water maze and y - maze tests measure different behavioral paradigms, these results can not be compared directly. the y - maze test is based on the natural tendency of mice to alternate their choice of arms, whereas the water maze test is a stress paradigm based on aversive motivation [11, 14 ]. it is possible that the reduced anxiety of samp6 affects their performance in each test in a different way. in the y - maze test, it could positively influence performance by increasing the motivation to explore, whereas in the morris water maze test, it may negatively influence working memory, since this test uses an aversive stimulation as the reinforcer for memory. the neurotransmitters dopamine and serotonin control motor activity, emotional behavior, and the process of working memory [6, 10, 18, 26, 32, 52, 53, 72, 73 ]. in addition, glutamate n - methyl - d - aspartate (nmda) receptors are well known to play a role in many forms of learning and memory [7, 30, 39, 48, 51 ]. among the nmda receptor (nr) family, the nr2b subunit is crucial for long - term potentiation (ltp) [4, 17, 67, 69 ], while the alpha calcium / calmodulin dependent protein kinase ii (camkii)/ nr2b - containing nmda receptor signaling pathway is important in maintaining synaptic plasticity and spatial cognition [20, 24, 25, 59 ]. we therefore studied these ltp - related molecules, as well as dopamine and serotonin, in samp6. western blotting revealed increased expression of the dopamine - biosynthesizing enzyme tyrosine hydroxylase (th), as well as serine-40-phosphorylated th, in the striatum and nucleus accumbens (nac) of 1-month - old samp6 compared with age - matched samr1. measurement of dopamine and its metabolites using high performance liquid chromatography (hplc) revealed that the concentrations of dopamine and homovanilic acid (hva) in the cortex, hva in the striatum, dopamine and hva in the cerebellum, and dopamine, 3-methoxytyramine (3-mt), and hva in the nac were all significantly higher in 6-month - old samp6 than in samr1 [43 and unpublished data ] (table 2table 2.concentrations of dopamine, serotonin, and their metabolitesregiondopamine (ng / g tissue)dopac (ng / g tissue)hva (ng / g tissue)samr1samp6samr1samp6samr1samp6cortex78.94 13.04189.70 38.22 34.51 2.9736.16 7.4049.03 3.4978.16 10.77hippocampus9.71 3.058.99 1.199.78 2.3211.02 0.689.74 2.1610.81 1.30striatum2,970.74 206.822,672.13 264.84677.58 54.96551.19 38.93252.55 10.90353.50 26.24nucleus accumbens339.23 90.00772.49 58.903.69 1.574.06 0.9958.31 9.42136.9 2.35brain stem54.75 5.0062.02 10.3727.86 2.7129.39 3.1752.09 3.7733.53 2.14cerebellum1.38 0.122.64 0.200.74 0.090.91 0.183.28 0.358.12 0.89region3-mt (ng / g tissue)5-ht (ng / g tissue)5-hiaa (ng / g tissue)samr1samp6samr1samp6samr1samp6cortex77.39 11.5768.69 14.78249.11 17.64337.98 23.00 428.121 32.016634.85 42.97hippocampus4.43 1.183.26 0.70193.30 18.85220.03 18.68777.90 46.551,090.00 64.74striatum507.46 42.51582.66 77.35325.12 19.14329.93 38.28738.92 55.831,099.21 100.69nucleus accumbens47.33 17.77167.14 33.19 285.94 35.44440.91 32.19 1,194.36 68.351,284.98 161.26brain stem27.90 2.6433.98 3.59481.84 40.00451.00 16.121,423.29 95.18922.33 39.30cerebellum1.22 0.191.35 0.3133.11 1.0346.39 3.0483.23 5.66196.83 12.27data are expressed as mean sem. in contrast, the concentration of hva in the samp6 brainstem was significantly lower than age - matched samr1. finally, increased expression of the dopamine receptor 1 (d1) and dopamine transporter (dat) in the striatum, dopamine receptor 3 (d3) in the nac, and d1 and d3 in the cerebellum were seen in samp6 mice, as assessed by western blotting. p<0.05 ; p<0.01. a d1 agonist, skf82958 (6-chloro-7, 8-dihydroxy-3-allyl-1-phenyl-2, 3, 4, 5-tetrahydro-1-phenyl-1h-3-benzazepine hydrobromide), was administered to 6- and 12-month - old samp6, samr1, and akr / j (the original strain of sam), to compare the sensitivity of this receptor among these strains. treatment with skf82958 significantly increased the motor activity of 6-month - old samp6 compared with age - matched akr / j and samr1. moreover, the d1 sensitivity of 12-month - old akr / j and samr1 was similar to their corresponding 6-month - old mice, whereas the d1 sensitivity of 12-month - old samp6 was significantly lower than at 6 months of age. these results revealed that samp6 has a higher d1 sensitivity as adult, but then undergo an age - related decline. western blotting revealed elevated expression levels of the serotonin - biosynthesizing enzyme tryptophan hydroxylase (tph), as well as serine-58-phosphorylated tph, in the brain stem of 1-month - old samp6 compared with age - matched samr1. the measurement of serotonin and its metabolite using hplc revealed that the concentration of serotonin in cortex, nac, and cerebellum, and the concentration of 5-hydroxyindole acetic acid (5-hiaa) in cortex, hippocampus, striatum, and cerebellum, were all significantly higher in 6-month - old samp6 compared with age - matched samr1 (table 2). in contrast, the concentration of 5-hiaa in the brain stem of samp6 was significantly lower than samr1 (table 2). the hallucinogenic chemical 1-[2, 5-dimethoxy-4-iodophenyl]-2-aminopropane (doi), a serotonin receptor 2a (5-ht2ar) agonist, activates extracellular signal - regulated kinase 1/2 (erk1/2) signaling accompanied by head - twitching behavior. although doi increased the head - twitch response in a dose - dependent manner in both 8-week - old samp6 and age - matched samr1, the responses of samp6 treated with 0.3 and 1.0 mg / kg doi were significantly greater than the responses of samr1 administered identical doses. in addition, the phospho - erk1/2 and phospho - camp - responsive element - binding protein (creb) levels in samp6 treated with 0.3 and 1.0 mg / kg doi were significantly higher than samr1 given identical doses of doi. these results suggest that the 5-ht2a - erk1/2-creb signaling pathway is enhanced in samp6. four - month - old samp6 has increased expression of the nr2b subunit in the forebrain, and camkii in the hippocampus compared with age - matched samr1. on the other hand, there was no difference in nr1 and nr2a subunits, or the glur1 subunit of the -amino-3-hydroxy-5-methyl-4-isoxazoleproprionic acid receptor (ampa receptor) [41, 64 ], as revealed by western blotting. these results suggest that the nr2b - containing nmda receptor and camkii signaling pathways are enhanced in samp6. animals treated with ()-3-(2-carboxypiperazin-4-yl)-propyl-1-phosphonic acid (cpp), an nmda receptor antagonist, were subjected to the y - maze and novel object recognition tests to determine whether nmda receptors are associated with the enhanced short - term memory of samp6. in the y - maze test, the spontaneous alternation behavior of 4-month - old samp6 was significantly higher than that of age - matched samr1 at each dose tested (0, 5, and 10 mg / kg), and was similar to the results of the y - maze test in untreated mice. in samr1, treatment with 10 mg / kg cpp significantly impaired the alternation performance compared with untreated mice, while the spontaneous alternation behavior of samp6 was reduced only slightly after treatment with10 mg / kg cpp. in the retention phase of the novel object recognition test, samr1 injected with 10 mg / kg cpp exhibited a significantly reduced exploratory preference compared with untreated mice. while the exploratory performance of samp6 treated with 10 mg / kg cpp showed a tendency to be reduced, their performance was still greater than samr1. western blotting revealed increased expression of the dopamine - biosynthesizing enzyme tyrosine hydroxylase (th), as well as serine-40-phosphorylated th, in the striatum and nucleus accumbens (nac) of 1-month - old samp6 compared with age - matched samr1. measurement of dopamine and its metabolites using high performance liquid chromatography (hplc) revealed that the concentrations of dopamine and homovanilic acid (hva) in the cortex, hva in the striatum, dopamine and hva in the cerebellum, and dopamine, 3-methoxytyramine (3-mt), and hva in the nac were all significantly higher in 6-month - old samp6 than in samr1 [43 and unpublished data ] (table 2table 2.concentrations of dopamine, serotonin, and their metabolitesregiondopamine (ng / g tissue)dopac (ng / g tissue)hva (ng / g tissue)samr1samp6samr1samp6samr1samp6cortex78.94 13.04189.70 38.22 34.51 2.9736.16 7.4049.03 3.4978.16 10.77hippocampus9.71 3.058.99 1.199.78 2.3211.02 0.689.74 2.1610.81 1.30striatum2,970.74 206.822,672.13 264.84677.58 54.96551.19 38.93252.55 10.90353.50 26.24nucleus accumbens339.23 90.00772.49 58.903.69 1.574.06 0.9958.31 9.42136.9 2.35brain stem54.75 5.0062.02 10.3727.86 2.7129.39 3.1752.09 3.7733.53 2.14cerebellum1.38 0.122.64 0.200.74 0.090.91 0.183.28 0.358.12 0.89region3-mt (ng / g tissue)5-ht (ng / g tissue)5-hiaa (ng / g tissue)samr1samp6samr1samp6samr1samp6cortex77.39 11.5768.69 14.78249.11 17.64337.98 23.00 428.121 32.016634.85 42.97hippocampus4.43 1.183.26 0.70193.30 18.85220.03 18.68777.90 46.551,090.00 64.74striatum507.46 42.51582.66 77.35325.12 19.14329.93 38.28738.92 55.831,099.21 100.69nucleus accumbens47.33 17.77167.14 33.19 285.94 35.44440.91 32.19 1,194.36 68.351,284.98 161.26brain stem27.90 2.6433.98 3.59481.84 40.00451.00 16.121,423.29 95.18922.33 39.30cerebellum1.22 0.191.35 0.3133.11 1.0346.39 3.0483.23 5.66196.83 12.27data are expressed as mean sem. in contrast, the concentration of hva in the samp6 brainstem was significantly lower than age - matched samr1. finally, increased expression of the dopamine receptor 1 (d1) and dopamine transporter (dat) in the striatum, dopamine receptor 3 (d3) in the nac, and d1 and d3 in the cerebellum were seen in samp6 mice, as assessed by western blotting. p<0.05 ; p<0.01. a d1 agonist, skf82958 (6-chloro-7, 8-dihydroxy-3-allyl-1-phenyl-2, 3, 4, 5-tetrahydro-1-phenyl-1h-3-benzazepine hydrobromide), was administered to 6- and 12-month - old samp6, samr1, and akr / j (the original strain of sam), to compare the sensitivity of this receptor among these strains. treatment with skf82958 significantly increased the motor activity of 6-month - old samp6 compared with age - matched akr / j and samr1. moreover, the d1 sensitivity of 12-month - old akr / j and samr1 was similar to their corresponding 6-month - old mice, whereas the d1 sensitivity of 12-month - old samp6 was significantly lower than at 6 months of age. these results revealed that samp6 has a higher d1 sensitivity as adult, but then undergo an age - related decline. western blotting revealed elevated expression levels of the serotonin - biosynthesizing enzyme tryptophan hydroxylase (tph), as well as serine-58-phosphorylated tph, in the brain stem of 1-month - old samp6 compared with age - matched samr1. the measurement of serotonin and its metabolite using hplc revealed that the concentration of serotonin in cortex, nac, and cerebellum, and the concentration of 5-hydroxyindole acetic acid (5-hiaa) in cortex, hippocampus, striatum, and cerebellum, were all significantly higher in 6-month - old samp6 compared with age - matched samr1 (table 2). in contrast, the concentration of 5-hiaa in the brain stem of samp6 was significantly lower than samr1 (table 2). the hallucinogenic chemical 1-[2, 5-dimethoxy-4-iodophenyl]-2-aminopropane (doi), a serotonin receptor 2a (5-ht2ar) agonist, activates extracellular signal - regulated kinase 1/2 (erk1/2) signaling accompanied by head - twitching behavior. although doi increased the head - twitch response in a dose - dependent manner in both 8-week - old samp6 and age - matched samr1, the responses of samp6 treated with 0.3 and 1.0 mg / kg doi were significantly greater than the responses of samr1 administered identical doses. in addition, the phospho - erk1/2 and phospho - camp - responsive element - binding protein (creb) levels in samp6 treated with 0.3 and 1.0 mg / kg doi were significantly higher than samr1 given identical doses of doi. these results suggest that the 5-ht2a - erk1/2-creb signaling pathway is enhanced in samp6. four - month - old samp6 has increased expression of the nr2b subunit in the forebrain, and camkii in the hippocampus compared with age - matched samr1. on the other hand, there was no difference in nr1 and nr2a subunits, or the glur1 subunit of the -amino-3-hydroxy-5-methyl-4-isoxazoleproprionic acid receptor (ampa receptor) [41, 64 ], as revealed by western blotting. these results suggest that the nr2b - containing nmda receptor and camkii signaling pathways are enhanced in samp6. animals treated with ()-3-(2-carboxypiperazin-4-yl)-propyl-1-phosphonic acid (cpp), an nmda receptor antagonist, were subjected to the y - maze and novel object recognition tests to determine whether nmda receptors are associated with the enhanced short - term memory of samp6. in the y - maze test, the spontaneous alternation behavior of 4-month - old samp6 was significantly higher than that of age - matched samr1 at each dose tested (0, 5, and 10 mg / kg), and was similar to the results of the y - maze test in untreated mice. in samr1, treatment with 10 mg / kg cpp significantly impaired the alternation performance compared with untreated mice, while the spontaneous alternation behavior of samp6 was reduced only slightly after treatment with10 mg / kg cpp. in the retention phase of the novel object recognition test, samr1 injected with 10 mg / kg cpp exhibited a significantly reduced exploratory preference compared with untreated mice. while the exploratory performance of samp6 treated with 10 mg / kg cpp showed a tendency to be reduced, their performance was still greater than samr1. results of the behavioral tests revealed that samp6 exhibits innate behavioral alterations ; specifically higher motor activity, motor coordination deficit, lower anxiety, anti - depressant activity, and enhanced learning and memory. the higher motor activity of samp6 was observed until the adult stage, at which point motor activity began to decline. by later old ages, mice had lower motor activity, suggesting that this characteristic of samp6 undergoes an accelerated senescence - like pattern. the marked motor coordination deficit of samp6 was observed at juvenile and old ages, while a slight amelioration in the motor coordination deficit was seen in adult mice, suggesting that the motor coordination of samp6 also exhibits an accelerated senescence - like pattern. in contrast, the differences in anxiety and anti - depressant activity between samp6 and samr1 decreased gradually with age, suggesting that these actions of samp6 are a result of an alternative pattern of age - related change. the expression of th and phosphorylated th were increased in the striatum and nac of juvenile samp6, suggesting these regions had an increase in the concentration of dopamine. in addition, the concentration of dopamine in the nac of adult samp6 was significantly higher than in samr1. it was reported previously that increased dopamine release in the nac is related to hyperactivity [13, 74 ], and this is thought to be an underlying mechanism causing the higher motor activity in samp6. since d1 is known to modulate motor activity [15, 37, 50, 63, 68 ] and striatal d1 plays a role in locomotor activity, the increased expression of d1 in the striatum, coupled with an over - active d1 signaling cascade, in adult samp6 may also explain the higher activity of this strain. in addition, the accelerated senescence - like decrease in motor activity of old samp6 may be explained by the apparent decrease in the sensitivity of d1 that was observed in aged, compared with adult, samp6. since it was reported that the injection of a d2/d3 agonist into lobules 9 and 10 of the cerebellar cortex, where d2 is not expressed, induced balance and motor coordination disturbance in the rotarod test, increased d3 expression in the cerebellum of adult samp6 was thought to be one of the mechanisms that contributed to the deficit in motor coordination. however, further examination of d3 expression in the cerebellum of juvenile and old samp6 is needed to evaluate whether altered d3 expression is involved in the accelerated senescence - like alteration of this behavior. the expression of tph and phosphorylated tph were increased in the brainstem of juvenile samp6, suggesting elevated serotonin concentrations in the juvenile samp6 brain. in addition since serotonin levels in the cortex and nac are related to low anxiety and anti - depressant activity [8, 22, 23, 71 ], this may be a mechanism by which samp6 mice exhibit these behavioral changes. in addition, increased expression of d3 in the nac may be involved in the anti - depressant activity of adult samp6, since the d3 receptor in nac was reported to play a role in anti - depressant activity. however, measuring the serotonin concentration and d3 expression in juvenile and old samp6 brains is necessary to determine whether the altered levels of serotonin and d3 are involved in the age - related changes of anxiety and anti - depressant activity in samp6. the increased dopamine and serotonin concentrations in the cortex of adult samp6 were also thought to contribute to the enhanced memory of samp6, since these monoamines are known to modulate working memory [6, 10, 32, 53 ]. in addition, adult samp6 mice demonstrated increased expression of nr2b in the forebrain, and camkii in the hippocampus, while elevated phosphorylation of nr1 and camkii was also observed. although these results suggest that these pathways may be involved in the enhanced memory of adult samp6, additional studies of the mechanisms and pathways involved in this behavioral property using juvenile and old samp6 are needed. in contrast, elevated level of s100 was reported to cause decreased working memory. the working memory deficit of samp6 reported by liu. might be due to an age - related increased expression of s100 in the brain. several quantitative trait loci (qtls) for senile - osteoporosis - related parameters were reported in samp6 [3, 38, 46, 47, 49, 57, 58 ] suggesting that the senile osteoporosis observed in samp6 is caused by some genetic alterations. spontaneous genetic alteration (s) near these qtls might have been co - fixed in samp6 through selective breeding, leading to the alterations in the dopamine, serotonin, and ltp - related - molecule systems as described above. since neurotransmission systems of dopamine, serotonin, and glutamate are known to affect one another [1, 5, 16, 28, 33, 61, 62 ], a genetic alteration related to these neurotransmitter pathways might trigger the multiple molecular and behavioral alterations in samp6. identifying qtls for behavioral characteristics of samp6 | the senescence - accelerated mouse (sam) was developed by selective breeding of the akr / j strain, based on a graded score for senescence, which led to the development of both senescence - accelerated prone (samp), and senescence - accelerated resistant (samr) strains. among the samp strains, samp6 is well characterized as a model of senile osteoporosis, but its brain and neuronal functions have not been well studied. we therefore decided to characterize the central nervous system of samp6, in combination with different behavioral tests and analysis of its biochemical and pharmacological properties. multiple behavioral tests revealed higher motor activity, reduced anxiety, anti - depressant activity, motor coordination deficits, and enhanced learning and memory in samp6 compared with samr1. biochemical and pharmacological analyses revealed several alterations in the dopamine and serotonin systems, and in long - term potentiation (ltp)-related molecules. in this review, we discuss the possibility of using samp6 as a model of brain function. |
the design and methods of this multicenter, randomized controlled trial have been detailed elsewhere (8,20) and will be briefly reported here. locally appointed ethics committees approved the research protocol, and participants gave written informed consent. the ides involved 22 outpatient diabetes clinics throughout italy between october 1, 2005, and march 31, 2006. each center was connected with a metabolic fitness center, a dedicated facility where patients trained under the supervision of an exercise professional. sedentary patients with type 2 diabetes, according to the definition of the american diabetes association (21) and who fulfilled the international diabetes federation criteria for the metabolic syndrome (22), were eligible for this study. of the 691 eligible patients, 85 were excluded for various reasons and 606 were recruited and randomized to supervised training plus structured exercise counseling (exe group ; n = 303) versus a control group that received counseling alone as part of standard care (con group ; n = 303) for 12 months. randomization was stratified by center and, within each center, by age (< 60 vs. 60 years) and type of diabetes treatment (diet with or without oral agents vs. insulin) using permuted - block randomization software. physicians and patients were not blinded to group assignment, whereas sample blinding at the central laboratory was achieved using bar codes. subjects from both groups received structured, individualized counseling (23) aimed at achieving the currently recommended amount of pa (24) by encouraging any type of commuting, occupational, home, and leisure - time pa. the training program for the exe group consisted of 150 min / week in two supervised sessions of progressive mixed (aerobic and resistance) training (8,20). aerobic training was performed at 5570% of predicted vo2max using a treadmill, step, elliptical, arm, or cycle - ergometer. the exercise load for the equipment was calculated to achieve prescribed exercise intensity, expressed as percentage of vo2max, by the use of standard equations (25). resistance training was performed at 6080% of predicted 1 repetition maximum (1-rm) and consisted of four resistance exercises, comprising a thrust movement on the transverse plane (chest press or equivalent), traction movement on the frontal plane (lateral pull down or equivalent), squat movement (leg press or equivalent), trunk flexion for the abdominals, and three stretching positions. intensity was adjusted according to improvements in predicted vo2max and 1-rm, as recorded throughout the study. in addition, caloric expenditure was increased progressively by 0.1-kcal / kg body weight / session every month. standard care consisted of a treatment regimen aimed at achieving optimal glycemic, lipid, blood pressure (bp), and body weight targets, as established by current guidelines, and including diet prescription and glucose-, lipid-, and bp - lowering agents, as needed (8,20). for ethical reasons and to test the real - world applicability of the ides results, the treatment regimen was adjusted according to results of biochemical tests performed locally at 3-month intervals, and changes in type, number, and dosage of drugs were recorded. secondary outcomes included improvements in other modifiable cvd risk factors, change in the number and/or dosage of glucose-, lipid-, and bp - lowering drugs, uk prospective diabetes study (ukpds) global chd 10-year risk scores, health - related quality - of - life, and the relationship between changes in physical fitness and modifiable cvd risk factors. results of this trial have been reported elsewhere (8,9), except those concerning the relation of physical fitness with modifiable cvd risk factors. at baseline, the volume of pa was assessed retrospectively using the minnesota leisure time physical activity questionnaire (26). the amount of pa was evaluated prospectively by asking patients to fill in a daily diary based on the range of activities considered in this questionnaire. volume was calculated by multiplying the metabolic equivalent (met) scores corresponding to each minnesota code (8), by time in hours per week spent in each activity, and expressed as mets h week. for aerobic exercise, energy expenditure during supervised sessions was calculated automatically by the machines from workload (i.e., the combination of speed and slope for treadmill, steps per minute for step and power for ergometer), using standard equations (25). for resistance exercise, a conservative estimate of 3 mets h was established, based on direct measurements in subjects with type 2 diabetes (27). the following modifiable cvd risk factors were evaluated at baseline and end - of - study : hba1c, fasting blood glucose and serum insulin, waist circumference, bmi, bp, triglycerides, total and hdl cholesterol, and high - sensitivity c - reactive protein (hs - crp). biochemical tests were performed at the central laboratory, at baseline, and end - of - study, and locally, throughout the study period, to adjust treatment regimen (8,20). the homeostasis model assessment - insulin resistance (homa - ir) index was calculated by the formula : homa - ir = [insulin (in pmol / l) fpg (in mmol / l)]/156.3, whereas ldl cholesterol was estimated by the equation : ldl cholesterol (in mmol / l) = total cholesterol [hdl cholesterol + (triglycerides/2.17) ], as previously reported (20). global chd 10-year risk scores were calculated using the ukpds risk engine (28). parameters of physical fitness (i.e., cardiorespiratory fitness, strength, and flexibility) were evaluated at baseline, end - of - study, and in the exe group, also during the study period, to adjust training loads (8,20). assessment of cardiorespiratory fitness consisted of a submaximal vo2max evaluation, (i.e., at 80% of the predicted maximal heart rate [= 220 age ]). it was preferred to a maximal test, because 1) the latter can not be performed without a cardiologist, according to italian law ; and 2) heart rate varies linearly with vo2 to the point of maximum exertion, thus allowing extrapolation of the actual vo2max value. the test was preceded by two consecutive run - in sessions to become familiar with testing devices and protocols. all patients performed the test at the treadmill, which was preferred to the cycloergometer to avoid early muscle exhaustion in untrained subjects, using a protocol modified form the balke and ware procedure (29). indirect calorimetry was used to measure vo2 by the use of a gas exchange analyzer (fitmate, cosmed, rome, italy), with concurrent assessment of heart rate. for patients taking medications that affect heart rate, such as -adrenergic blockers, the borg rate of perceived exertion scale was used (version 110). patients were stopped at the perceived value of 56 (hard), corresponding to a heart rate of 7089% (30). for strength assessment, a test was performed with the following modalities : thrust movement on the transverse plane (chest press or equivalent), traction movement on the frontal plane (lateral pull down or equivalent), and squat movement (leg press or equivalent). although the 1-rm test is the most reliable test for evaluating the maximal dynamic strength of a muscle or group of muscles, because of the very low fitness profile of patients enrolled in this study, a 58 maximal repetition test was preferred, for safety (to avoid maximal loads to the joint structures) and validity (untrained subjects are not always able to properly reach their 1-rm) reasons. then, 1-rm was predicted from the weight loaded and the number of repetitions executed after a proper warm up using the brzycki equation (31). results were expressed as upper body (average of chest press and lateral pull down) and lower body (leg press) strength. a standard bending test was executed to assess hip and truck flexibility (8,20). patients stood on a step with legs fully extended and were asked to bend the torso forward to try to touch the ground with their fingertips. the test was performed three times, and the distance between the finger and the ground was measured by the exercise specialist at the third attempt. baseline to end - of - study changes (expressed as median and interquartile range [iqr ]) in total pa, cvd risk factors, and total chd risk score were calculated by quintiles of changes in physical fitness parameters (i.e., vo2max and upper and lower body strength and flexibility) and analyzed using kruskal - wallis one - way anova. a test for linear trend was also applied. a value of p < 0.05 was considered statistically significant. to encompass the entire range of fitness values, the whole cohort of 606 patients to assess whether improvements in fitness predicted changes from baseline in hba1c, other cvd risk factors, and chd risk score, independently of body weight loss, multiple regression analyses were applied, with baseline to end - of - study changes in each modifiable cvd risk factor as a dependent variable. covariates were the baseline value of each cvd risk factor, the change in each fitness parameter (and, for upper and lower body strength and flexibility, also in vo2max), change in bmi, body weight, or waist circumference to assess dependence on body weight loss, and study arm, to account for the independent effect of intervention. additional regression analyses were performed with pa / exercise volume as the covariate forced in the model or, to account for change in medication throughout the 12-month period, with treatment at baseline and treatment initiation during the study included in the model as dichotomous (yes vs. no) variables. the ides involved 22 outpatient diabetes clinics throughout italy between october 1, 2005, and march 31, 2006. each center was connected with a metabolic fitness center, a dedicated facility where patients trained under the supervision of an exercise professional. sedentary patients with type 2 diabetes, according to the definition of the american diabetes association (21) and who fulfilled the international diabetes federation criteria for the metabolic syndrome (22), were eligible for this study. of the 691 eligible patients, 85 were excluded for various reasons and 606 were recruited and randomized to supervised training plus structured exercise counseling (exe group ; n = 303) versus a control group that received counseling alone as part of standard care (con group ; n = 303) for 12 months. randomization was stratified by center and, within each center, by age (< 60 vs. 60 years) and type of diabetes treatment (diet with or without oral agents vs. insulin) using permuted - block randomization software. physicians and patients were not blinded to group assignment, whereas sample blinding at the central laboratory was achieved using bar codes. subjects from both groups received structured, individualized counseling (23) aimed at achieving the currently recommended amount of pa (24) by encouraging any type of commuting, occupational, home, and leisure - time pa. the training program for the exe group consisted of 150 min / week in two supervised sessions of progressive mixed (aerobic and resistance) training (8,20). aerobic training was performed at 5570% of predicted vo2max using a treadmill, step, elliptical, arm, or cycle - ergometer. the exercise load for the equipment was calculated to achieve prescribed exercise intensity, expressed as percentage of vo2max, by the use of standard equations (25). resistance training was performed at 6080% of predicted 1 repetition maximum (1-rm) and consisted of four resistance exercises, comprising a thrust movement on the transverse plane (chest press or equivalent), traction movement on the frontal plane (lateral pull down or equivalent), squat movement (leg press or equivalent), trunk flexion for the abdominals, and three stretching positions. intensity was adjusted according to improvements in predicted vo2max and 1-rm, as recorded throughout the study. in addition, caloric expenditure was increased progressively by 0.1-kcal / kg body weight / session every month. standard care consisted of a treatment regimen aimed at achieving optimal glycemic, lipid, blood pressure (bp), and body weight targets, as established by current guidelines, and including diet prescription and glucose-, lipid-, and bp - lowering agents, as needed (8,20). for ethical reasons and to test the real - world applicability of the ides results, the treatment regimen was adjusted according to results of biochemical tests performed locally at 3-month intervals, and changes in type, number, and dosage of drugs were recorded. secondary outcomes included improvements in other modifiable cvd risk factors, change in the number and/or dosage of glucose-, lipid-, and bp - lowering drugs, uk prospective diabetes study (ukpds) global chd 10-year risk scores, health - related quality - of - life, and the relationship between changes in physical fitness and modifiable cvd risk factors. results of this trial have been reported elsewhere (8,9), except those concerning the relation of physical fitness with modifiable cvd risk factors. at baseline, the volume of pa was assessed retrospectively using the minnesota leisure time physical activity questionnaire (26). the amount of pa was evaluated prospectively by asking patients to fill in a daily diary based on the range of activities considered in this questionnaire. volume was calculated by multiplying the metabolic equivalent (met) scores corresponding to each minnesota code (8), by time in hours per week spent in each activity, and expressed as mets h week. for aerobic exercise, energy expenditure during supervised sessions was calculated automatically by the machines from workload (i.e., the combination of speed and slope for treadmill, steps per minute for step and power for ergometer), using standard equations (25). for resistance exercise, a conservative estimate of 3 mets h was established, based on direct measurements in subjects with type 2 diabetes (27). the following modifiable cvd risk factors were evaluated at baseline and end - of - study : hba1c, fasting blood glucose and serum insulin, waist circumference, bmi, bp, triglycerides, total and hdl cholesterol, and high - sensitivity c - reactive protein (hs - crp). biochemical tests were performed at the central laboratory, at baseline, and end - of - study, and locally, throughout the study period, to adjust treatment regimen (8,20). the homeostasis model assessment - insulin resistance (homa - ir) index was calculated by the formula : homa - ir = [insulin (in pmol / l) fpg (in mmol / l)]/156.3, whereas ldl cholesterol was estimated by the equation : ldl cholesterol (in mmol / l) = total cholesterol [hdl cholesterol + (triglycerides/2.17) ], as previously reported (20). global chd 10-year risk scores were calculated using the ukpds risk engine (28). parameters of physical fitness (i.e., cardiorespiratory fitness, strength, and flexibility) were evaluated at baseline, end - of - study, and in the exe group, also during the study period, to adjust training loads (8,20). assessment of cardiorespiratory fitness consisted of a submaximal vo2max evaluation, (i.e., at 80% of the predicted maximal heart rate [= 220 age ]). it was preferred to a maximal test, because 1) the latter can not be performed without a cardiologist, according to italian law ; and 2) heart rate varies linearly with vo2 to the point of maximum exertion, thus allowing extrapolation of the actual vo2max value. the test was preceded by two consecutive run - in sessions to become familiar with testing devices and protocols. all patients performed the test at the treadmill, which was preferred to the cycloergometer to avoid early muscle exhaustion in untrained subjects, using a protocol modified form the balke and ware procedure (29). indirect calorimetry was used to measure vo2 by the use of a gas exchange analyzer (fitmate, cosmed, rome, italy), with concurrent assessment of heart rate. for patients taking medications that affect heart rate, such as -adrenergic blockers, the borg rate of perceived exertion scale was used (version 110). patients were stopped at the perceived value of 56 (hard), corresponding to a heart rate of 7089% (30). for strength assessment, a test was performed with the following modalities : thrust movement on the transverse plane (chest press or equivalent), traction movement on the frontal plane (lateral pull down or equivalent), and squat movement (leg press or equivalent). although the 1-rm test is the most reliable test for evaluating the maximal dynamic strength of a muscle or group of muscles, because of the very low fitness profile of patients enrolled in this study, a 58 maximal repetition test was preferred, for safety (to avoid maximal loads to the joint structures) and validity (untrained subjects are not always able to properly reach their 1-rm) reasons. then, 1-rm was predicted from the weight loaded and the number of repetitions executed after a proper warm up using the brzycki equation (31). results were expressed as upper body (average of chest press and lateral pull down) and lower body (leg press) strength. a standard bending test was executed to assess hip and truck flexibility (8,20). patients stood on a step with legs fully extended and were asked to bend the torso forward to try to touch the ground with their fingertips. the test was performed three times, and the distance between the finger and the ground was measured by the exercise specialist at the third attempt. baseline to end - of - study changes (expressed as median and interquartile range [iqr ]) in total pa, cvd risk factors, and total chd risk score were calculated by quintiles of changes in physical fitness parameters (i.e., vo2max and upper and lower body strength and flexibility) and analyzed using kruskal - wallis one - way anova. a test for linear trend was also applied. a value of p < 0.05 was considered statistically significant. to encompass the entire range of fitness values, the whole cohort of 606 patients was considered. to assess whether improvements in fitness predicted changes from baseline in hba1c, other cvd risk factors, and chd risk score, independently of body weight loss, multiple regression analyses were applied, with baseline to end - of - study changes in each modifiable cvd risk factor as a dependent variable. covariates were the baseline value of each cvd risk factor, the change in each fitness parameter (and, for upper and lower body strength and flexibility, also in vo2max), change in bmi, body weight, or waist circumference to assess dependence on body weight loss, and study arm, to account for the independent effect of intervention. additional regression analyses were performed with pa / exercise volume as the covariate forced in the model or, to account for change in medication throughout the 12-month period, with treatment at baseline and treatment initiation during the study included in the model as dichotomous (yes vs. no) variables. subjects from the ides cohort had a mean age of 58.8 years (sd 8.5), a median diabetes duration of 6 years (iqr 310), and a male - to - female ratio of 58/42. baseline values for vo2max, upper and lower body strength, and flexibility were 25.9 6.2 ml / kg / min, 40.0 16.6 kg, 107.3 68.5 kg, and 11.7 9.8 cm, respectively. as previously reported (8), the median attendance of the supervised exercise sessions in the exe group was 80.3% (iqr, 7599%). moreover, vo2max (mean difference 2.8 ml / kg / min [95% ci 2.13.5 ], p < 0.001) and flexibility (4.6 cm [5.7 to 3.6 ]) improved more markedly in exe than in con subjects, whereas upper (11.0 kg [9.512.5 ]) and lower (30.8 kg [25.135.6 ]) body strength increased significantly only in exe participants (8) (supplementary fig. changes in vo2max, and upper and lower body strength (tables 1, 2, and 3) were significantly and linearly associated with variation in pa volume, hba1c, bmi, waist circumference, hs - crp, total chd risk score, and, inversely, with change in hdl cholesterol. in addition, flexibility was significantly associated with these parameters (p < 0.0001 for trend), except for hba1c (p = 0.003) and hs - crp (p = 0.041 ; data not shown). less significant associations were found for vo2max with insulin and homa - ir, for upper body strength with ldl cholesterol, and for lower body strength with insulin, homa - ir, and total and ldl cholesterol. associations with insulin and homa - ir remained after excluding the 73 individuals on insulin treatment, which significantly influences these parameters. baseline to end - of - study changes (median and iqr) in pa volume, cvd risk factors, and total chd risk score by quintiles of vo2max baseline to end - of - study changes (median and iqr) in pa volume, cvd risk factors, and total chd risk score by quintiles of upper body strength baseline to end - of - study changes (median and iqr) in pa volume, cvd risk factors, and total chd risk score by quintiles of lower body strength regression analyses (table 4) showed that changes in vo2max predicted a reduction in hba1c, waist circumference, hs - crp, and total chd ukpds risk score, and an increase in hdl cholesterol, independently of study arm and change in bmi. in addition, changes in upper body strength predicted improvements in hba1c, waist circumference, hs - crp, and total chd risk score, whereas an increase in lower body strength predicted only amelioration of hs - crp, independently of study arm, and changes in bmi and vo2max. when changes in bmi and vo2max were excluded from the model, lower body strength was also significantly associated with waist circumference reduction (p = 0.039). finally, improved flexibility predicted changes in waist circumference and hdl cholesterol, again independently of study arm, and changes in bmi and vo2max. multiple regression analyses of association of baseline to end - of - study changes in physical fitness parameters with variation in selected cvd risk factors and total chd risk score in these analyses, bmi was significantly associated with changes in hba1c, and waist circumference, but not hdl cholesterol, hs - crp, or total ukpds chd risk score, whereas study arm predicted changes in all of these variables with most combinations of fitness components and measures of adiposity as covariates (data not shown). results were similar when bmi values were substituted for body weight as a covariate in the regression models (data not shown). in contrast, when waist circumference was included in the model as a measure of adiposity in place of bmi or body weight, an independent association of vo2max and flexibility with cvd risk factors was no longer observed, except for a reduction in hs - crp (p = 0.017) and an increase in hdl cholesterol (p = 0.018), respectively, whereas strength, particularly upper body, continued to predict hba1c (p = 0.016), hs - crp (p = 0.005), and total chd risk score (p < 0.0001). finally, all fitness parameters no longer predicted changes in cvd risk factors when pa / exercise volume was forced in the model, whereas associations remained significant when change in medication was included as a covariate. this report shows that pa / exercise - induced improvements in physical fitness, particularly in cardiorespiratory fitness and upper body strength, significantly predict changes in several modifiable cvd risk factors and in the total ukpds chd 10-year risk score, independently of study arm, change in bmi or body weight, and, in case of strength, also of vo2max and waist circumference. a previous meta - analysis of small - sized studies showed that structured aerobic exercise training improves cardiorespiratory fitness in subjects with type 2 diabetes, along with a reduction of hba1c (32). moreover, cardiorespiratory and/or muscular fitness correlated with changes in hba1c in sedentary diabetic individuals performing supervised aerobic and/or resistance training (33). our data indicate for the first time that in these subjects, pa / exercise - induced amelioration of physical fitness is linked to improvements in a wide range of modifiable cvd risk factors in addition to hba1c, thus resulting in a significantly reduced estimated total chd 10-year risk. these factors included waist circumference, insulin, homa - ir, hdl cholesterol, and hs - crp, which are the metabolic and inflammatory abnormalities related to central fat distribution in subjects with type 2 diabetes and the metabolic syndrome (34). interestingly, waist circumference and homa - ir were also independent predictors of hba1c reduction in the ides participants (8). taken together, these observations are consistent with the inverse association of cardiorespiratory fitness with the prevalence of type 2 diabetes (35) and the metabolic syndrome (36) as well as of low levels of pa with traditional and nontraditional cvd risk factors (37) in the general population. a very important finding of our study is that the relationship of changes in physical fitness with improvements in modifiable cvd risk factors was independent of body weight loss, although fitness correlated significantly with bmi and waist circumference. this observation, which is consistent with the lack of interaction between fitness and fatness (38), supports the concept that fitness ameliorates the unfavorable cvd risk factor profile driven by increased adiposity through mechanisms independent, at least partly, of weight loss. these mechanisms seem to involve enhanced muscle fuel supply and storage, which increase insulin sensitivity (33), as well as production of myokines, which act locally in a paracrine fashion and also as hormones in other organs of the body, including fat, to improve metabolism and reduce inflammation (39). a role for muscle independent of central fat distribution is strongly supported by the observation that muscular fitness, at variance with cardiorespiratory fitness, predicted changes in modifiable cvd risk factors even after adjustment for waist circumference, a measure of visceral adiposity. these findings suggest that lifestyle interventions aimed at reducing cvd risk in subjects with type 2 diabetes should target improvement of fitness, in addition to weight loss, and that strategies including diet plus pa / exercise would be more effective than at the same level of achieved bmi. in this view, physical fitness may represent a surrogate outcome in these subjects, especially in individuals who struggle to lose weight. however, although pa is the main determinant of physical fitness, as shown in our study by the strong association between these two parameters and by the disappearance of association between fitness and modifiable cvd risk factors after adjustment for pa / exercise volume, genetic factors also play a role in individuals with the low - fitness phenotype. it is unclear whether specific pa programs may reverse low - fitness in these subjects and whether those who fail to improve fitness with exercise still receive health benefits from training (40). finally, improvements of cardiorespiratory and muscular fitness appeared to exert at least partly independent effects on modifiable cvd risk factors, according to the observation that relation of strength, particularly upper body, with these parameters remained significant when vo2max and also waist circumference were forced in the model as covariates. moreover, because the exe subjects followed a supervised mixed (aerobic and resistance) training program, whereas the con participants performed predominantly aerobic pa (8), this is also in keeping with the association of study arm with improvements in modifiable cvd risk factors, although relation of fitness with these parameters occurred independently of it. this supports the finding that, given the same volume of pa, the combination of aerobic and resistance training is more effective than either one alone in reducing cvd risk in subjects with type 2 diabetes (6,7) and suggests that this is dependent of the concurrent improvement in cardiorespiratory and muscular fitness. strengths of this study are that the ides was multicenter, thus less dependent on local factors, and of a larger size and longer duration than other exercise intervention trials in patients with type 2 diabetes (6,7). a potential limitation of this trial is the unblinded design, although it is impossible to keep assignment to supervised training hidden to both patients and physicians. in addition, in our study, although patients from both groups received specific dietary prescriptions and adherence to diet was verified at intermediate visits, diet was not considered in the data analysis. in conclusion, this analysis of data from the ides shows that pa / exercise - induced increases in physical fitness predict improvements in cvd risk factors and estimated chd 10-year risk in subjects with type 2 diabetes independently of body weight loss and, for muscular fitness, also of waist circumference reduction. these findings indicate the need for targeting fitness, particularly muscular, in these individuals, especially in subjects who struggle to lose weight, by implementing specific training programs including resistance exercise. | objectivephysical fitness is inversely related to mortality in the general population and in subjects with type 2 diabetes. here, we present data concerning the relationship between changes in physical fitness and modifiable cardiovascular risk factors in subjects with type 2 diabetes from the italian diabetes and exercise study.research design and methodssedentary patients with type 2 diabetes (n = 606) were enrolled in 22 outpatient diabetes clinics and randomized to twice - a - week supervised aerobic and resistance training plus exercise counseling versus counseling alone for 12 months. baseline to end - of - study changes in cardiorespiratory fitness, strength, and flexibility, as assessed by vo2max estimation, a 58 maximal repetition test, and a hip / trunk flexibility test, respectively, were calculated in the whole cohort, and multiple regression analyses were applied to assess the relationship with cardiovascular risk factors.resultschanges in vo2max, upper and lower body strength, and flexibility were significantly associated with the variation in the volume of physical activity, hba1c, bmi, waist circumference, high - sensitivity c - reactive protein (hs - crp), coronary heart disease (chd) risk score, and inversely, hdl cholesterol. changes in fitness predicted improvements in hba1c, waist circumference, hdl cholesterol, hs - crp, and chd risk score, independent of study arm, bmi, and in case of strength, also waist circumference.conclusionsphysical activity / exercise - induced increases in fitness, particularly muscular, predict improvements in cardiovascular risk factors in subjects with type 2 diabetes independently of weight loss, thus indicating the need for targeting fitness in these individuals, particularly in subjects who struggle to lose weight. |
the seven country study, conducted in the 1950s by ancel keys, described the foods and beverages frequently consumed in the mediterranean area(1). the mediterranean dietary pattern (mdp) identified in that study, was characterized as a dietary pattern rich in plant - based foods (vegetables, fruits, cereals, legumes, nuts, seeds and olives), moderate to high intake of fish and seafood, moderate consumption of eggs, poultry and dairy products (preferably yogurt and cheese), low consumption of red meat, and a moderate intake of alcohol (preferably wine during meals). in addition, olive oil was the main source of added fat (2). in 2010, experts, led by the mediterranean diet foundation and the forum on mediterranean food cultures, developed a consensus position on a new revised mdp pyramid for adult populations(3). the new pyramid was similar to the previous dietary pattern, but it also incorporated social and cultural elements, such as regular physical activity, adequate rest and conviviality, characteristic of the mediterranean way of life. studies in adult populations have consistently found that the mdp and its components are inversely associated with cardiovascular risk factors or cardiovascular disease (4,5), metabolic syndrome (6), obesity (7,8), type 2 diabetes (9), some types of cancer (10), and even global mortality (11,12). less is known about adherence to the mdp and how it relates to health among children and adolescents. some aspects of the mdp are not applicable to children, such as regular consumption of alcohol. the enkid study in spain developed the kidmed index to measures the adherence to the mdp among children and adolescents (13,14). recently published cross - sectional studies have used the kidmed index to describe the adherence of european adolescents to the mdp and also presented correlations of the kidmed index with some socioeconomic, demographic or lifestyle factors (15,16). other cross - sectional studies using the kidmed index have suggested an inverse association of the mdp with obesity or metabolic syndrome criteria (17,18), as well as a direct association between the mdp and life quality score (19,20) in european children and adolescents. data are lacking on adherence to the mdp among american youths and on its relation with weight status and weight gain among children or adolescents in the united states. moreover, longitudinal studies in children and adolescents are needed to examine the beneficial effect of the mdp on weight change in these populations. the aim of this study was to assess the association of baseline adherence to the mdp with 23 year change in body mass index (bmi) among adolescents. secondly, we aimed to study the association of 23 year changes in adherence to the mdp with changes in bmi in both the same and the subsequent 23 year period over a 7-year follow - up. the ongoing growing up today study (guts) ii cohort was established in 2004 to assess relations of diet and activity to height velocity and weight gain. participants were recruited by sending letters to 20 700 women in the nurses health study ii who had children aged 815 years. the letter explained the purpose of the study and asked the nurse for permission to invite her child(ren) to participate. invitation letters and questionnaires were mailed to 8 826 girls and 8 454 boys whose mothers granted consent. a total of 6 002 girls and 4 916 boys returned completed questionnaires, thereby assenting to participate. follow - up questionnaires were sent in the fall of 2006 and 2008 and winter 2011. bmi (kg / m) was calculated using self - reported weight and height, which has been found to be valid among preadolescents and adolescents (2123). the outcome in the analyses was change in bmi during each time period (i.e., 20042006, 20062008, and 20082011), which was calculated as the difference in bmi between the end and the beginning of the time interval. a previous study found that although adolescents and young adults consistently under - reported their weight, because their underreporting was consistent over time, weight change, calculated from self - reported weight, is accurate (24). the kidmed index (13), was developed to measure adherence to the mdp among children and youths. this index consists of 16 domains, 12 positive (+ 1 point vs. 0 points) and 4 negative (1 point vs. 0 points). based on their score (from 4 to 3 points), need to improve to adhere better to the mdp (from 4 to 7 points) or optimal mdp (from 8 to 12 points) (14). dietary intake was assessed by the youth / adolescent questionnaire (25) in each wave of guts 2. we modified the kidmed index (m - km) (table 1) to make it more appropriate for an american population. the primary modification was establishing an upper limit in those domains in which a high intake has been associated with weight gain (i.e., refined grains). in addition, because many cereals in the united states are high in sugar and low in whole grains, the cereal criterion was modified to be servings of cereal with less than 10 g of sugar. both physical activity and sedentary behavior have been associated with weight change and other health indicators in children and adolescents(26,27). in each questionnaire, participants were asked to recall the hours per week within each season they engaged over the past year in 18 specific activities. from that information, we calculated the metabolic equivalent (mets - hours) per week each participant spent in physical activities(28). the met expresses the energy cost of physical activities as a multiple of the resting metabolic rate(29). sedentary behavior was calculated as the sum of the hours per week participants spent over the past year watching television, using the computer, surfing on the net and reading / doing homework. the dietary information, time spent in physical activities and sedentary behavior were assessed at the beginning of each time interval. total energy intake has been suggested as one, but not the only, determinant of change in bmi. therefore, we conducted secondary analyses (model 2) in which we additionally adjusting for total energy intake. the study was approved by the human subjects committee at brigham and women s hospital, and the analyses presented in this article were approved by the institutional review boards at brigham and women s hospital. we used several approaches to investigate the association between the m - km score and bmi change. our primary analysis examined associations of baseline quartiles of the m - km score in each time period with change in bmi (e.g., 2004 m - km and 20042006 change in bmi). we also examined (1) the association of quartiles of 23 year change in m - km score with concurrent 23 year change in bmi (e.g., 20042006 change in both m - km and bmi) and (2) association of quartiles of 23 year change in m - km score with subsequent 23 year change in bmi (e.g., 20042006 change in m - km and 20062008 change in bmi). the analysis assessing baseline m - km score as a predictor of change in bmi was adjusted for baseline age, sex, bmi at the beginning of the period, physical activity, sedentary time and time of follow - up. the models examining the association between change in m - km score and change in bmi were also adjusted for baseline m - km score at the beginning of the period. finally, the model assessing the association between change in m - km score and subsequent change in bmi was also adjusted for change in bmi in the previous time interval. a possible interaction between baseline m - km and change in m - km score was also studied. in the model 2 we additionally adjusted the analysis for quintiles of total energy intake. in a sensitive analysis we examined whether there were interactions between adherence to the m - km index at baseline and age, sex, weight status, physical activity, and sedentary time. we also evaluated the relative importance of each domain in the m - km by subtracting alternatively one domain at a time (or two when necessary) and calculating the association of baseline adherence to the m - km minus one domain (or two when necessary) with change in bmi over the next 23 years. to preserve the comparability, we multiplied the coefficients obtained in these analyses by 15/16 (or 14/16 when two domains had been subtracted). (30) analyses were conducted with sas software (version 9.3 sas institute, cary, nc, usa). as the analyses were based on changes in bmi between two consecutive periods, only participants with data from two consecutive questionnaires were eligible for analysis. in all the analyses we used generalized estimating equation with repeated measures within subjects (2004, 2006, 2008 and 2011) and clustering among siblings. the ongoing growing up today study (guts) ii cohort was established in 2004 to assess relations of diet and activity to height velocity and weight gain. participants were recruited by sending letters to 20 700 women in the nurses health study ii who had children aged 815 years. the letter explained the purpose of the study and asked the nurse for permission to invite her child(ren) to participate. invitation letters and questionnaires were mailed to 8 826 girls and 8 454 boys whose mothers granted consent. a total of 6 002 girls and 4 916 boys returned completed questionnaires, thereby assenting to participate. follow - up questionnaires were sent in the fall of 2006 and 2008 and winter 2011. bmi (kg / m) was calculated using self - reported weight and height, which has been found to be valid among preadolescents and adolescents (2123). the outcome in the analyses was change in bmi during each time period (i.e., 20042006, 20062008, and 20082011), which was calculated as the difference in bmi between the end and the beginning of the time interval. a previous study found that although adolescents and young adults consistently under - reported their weight, because their underreporting was consistent over time, weight change, calculated from self - reported weight, is accurate (24). the primary exposure was adherence to the mdp. the kidmed index (13), was developed to measure adherence to the mdp among children and youths. this index consists of 16 domains, 12 positive (+ 1 point vs. 0 points) and 4 negative (1 point vs. 0 points). based on their score, participants were classified as having : very low quality dietary pattern (from 4 to 3 points), need to improve to adhere better to the mdp (from 4 to 7 points) or optimal mdp (from 8 to 12 points) (14). dietary intake was assessed by the youth / adolescent questionnaire (25) in each wave of guts 2. we modified the kidmed index (m - km) (table 1) to make it more appropriate for an american population. the primary modification was establishing an upper limit in those domains in which a high intake has been associated with weight gain (i.e., refined grains). in addition, because many cereals in the united states are high in sugar and low in whole grains, the cereal criterion was modified to be servings of cereal with less than 10 g of sugar. both physical activity and sedentary behavior have been associated with weight change and other health indicators in children and adolescents(26,27). in each questionnaire, participants were asked to recall the hours per week within each season they engaged over the past year in 18 specific activities. from that information, we calculated the metabolic equivalent (mets - hours) per week each participant spent in physical activities(28). the met expresses the energy cost of physical activities as a multiple of the resting metabolic rate(29). sedentary behavior was calculated as the sum of the hours per week participants spent over the past year watching television, using the computer, surfing on the net and reading / doing homework. the dietary information, time spent in physical activities and sedentary behavior were assessed at the beginning of each time interval. total energy intake has been suggested as one, but not the only, determinant of change in bmi. therefore, we conducted secondary analyses (model 2) in which we additionally adjusting for total energy intake. the study was approved by the human subjects committee at brigham and women s hospital, and the analyses presented in this article were approved by the institutional review boards at brigham and women s hospital. we used several approaches to investigate the association between the m - km score and bmi change. our primary analysis examined associations of baseline quartiles of the m - km score in each time period with change in bmi (e.g., 2004 m - km and 20042006 change in bmi). the lowest quartile of m - km was the reference group. additionally, we examined associations using continuous baseline m - km score. we also examined (1) the association of quartiles of 23 year change in m - km score with concurrent 23 year change in bmi (e.g., 20042006 change in both m - km and bmi) and (2) association of quartiles of 23 year change in m - km score with subsequent 23 year change in bmi (e.g., 20042006 change in m - km and 20062008 change in bmi). the analysis assessing baseline m - km score as a predictor of change in bmi was adjusted for baseline age, sex, bmi at the beginning of the period, physical activity, sedentary time and time of follow - up. the models examining the association between change in m - km score and change in bmi were also adjusted for baseline m - km score at the beginning of the period. finally, the model assessing the association between change in m - km score and subsequent change in bmi was also adjusted for change in bmi in the previous time interval. a possible interaction between baseline m - km and change in m - km score was also studied. in the model 2 we additionally adjusted the analysis for quintiles of total energy intake. in a sensitive analysis we examined whether there were interactions between adherence to the m - km index at baseline and age, sex, weight status, physical activity, and sedentary time. we also evaluated the relative importance of each domain in the m - km by subtracting alternatively one domain at a time (or two when necessary) and calculating the association of baseline adherence to the m - km minus one domain (or two when necessary) with change in bmi over the next 23 years. to preserve the comparability, we multiplied the coefficients obtained in these analyses by 15/16 (or 14/16 when two domains had been subtracted). (30) analyses were conducted with sas software (version 9.3 sas institute, cary, nc, usa). as the analyses were based on changes in bmi between two consecutive periods, only participants with data from two consecutive questionnaires were eligible for analysis. in all the analyses we used generalized estimating equation with repeated measures within subjects (2004, 2006, 2008 and 2011) and clustering among siblings. at baseline 81.4% of the sample were classified as poorly adherent to the m - km index (median=1 point), 17.8% as moderately adherent (median=5 points), and 0.75% as highly adherent (median=8 points) (table 2). we found a higher percentage of boys within the lowest category (46.3%) compared to the moderate (39.51%) and the high category (39.02%) of adherence to the m - km index. at baseline, participants in the category of poorly adherent to the m - km index had a higher bmi (mean=20.4 kg / m), exhibited a more sedentary behavior (mean=41 hours / week), and engaged in less physical activity (mean=81.35 mets - h / week) than those in the moderate category (20.1 kg / m, 36.40 hours / week and 93.33 mets - h / week, respectively) or in the high category (19.8 kg / m, 35.16 hours / week and 94.55 mets - h / week, respectively). we found that youth in the category of high adherence to the mdp reported a higher energy intake (2 442 kcal / day) compared to their peers in the moderate and the poor adherence categories (2 240 and 2 090 kcal / day respectively). when the m - km score was modeled as a continuous variable, a two - point increase in baseline adherence was associated with a significant relative decrease in bmi over the next 23 years (= 0.04, 95% confidence interval (ci) 0.07 to 0.02). this association remained the same for the majority of times when we alternatively subtracted one domain (or two when necessary) from the m - km score. when m - km score was categorized in quartiles (table 3) we found that, compared to the lowest level (q1) of adherence to the mdp, youth in the third (q3) and fourth (q4) quartiles (m - km score median + 2 and + 4 respectively), exhibited significantly smaller gains in bmi over the next 23 years (= 0.09, 95%ci 0.17 to 0.00 and = 0.12, 95%ci 0.20 to 0.04 respectively), independent of sex, age, bmi at baseline, physical activity, sedentary time and time of follow - up. similar results were found when we additionally adjusted for total energy intake. in further analyses, we examined a 23 year change in m - km score as a predictor of 23 years change in bmi over the 7 years of follow - up. first, using models adjusted for sex, age, physical activity, sedentary time, time of follow - up and both bmi and m - km score at baseline, we assessed the association between 23 year change in the m - km score and concurrent change in bmi (table 4). compared to youth in the q1 of m - km score change (scores change from 10 to 2), we found that adolescents in q2 (scores change from 1 to 0), q3 (scores change + 1) and q4 (scores change from + 2 to + 10), had significantly smaller concurrent gains in bmi (= 0.22 kg / m, 95%ci 0.31 to 0.13 ; = 0.21 kg / m, 95%ci 0.31 to 0.12 ; and = 0.30 kg / m, 95%ci 0.40 to 0.20, respectively). the p - for - trend across the quartiles was highly significant (p<0.001). the association was not modified by m - km score at baseline (p for interaction=0.21 in the model adjusted for total energy intake). in addition, we assessed the association between 23 year change in the m - km score and change in bmi in the subsequent 23 year period using models adjusted for sex, age, physical activity, sedentary time, time of follow - up, baseline m - km score, and change in bmi in the previous time interval (table 5). compared to youth in the first quartile (q1) of m - km score change (scores change from 10 to 2), we found that adolescents in q3 (scores change from 0 to + 1) and q4 (scores change from + 2 to + 10), had smaller gains in bmi (= 0.18 kg / m, 95%ci 0.31 to 0.04 ; = 0.24 kg / m, 95%ci 0.38 to 0.09 ; respectively) (p - for - trend=0.002). the association was not modified by m - km score at baseline (p for interaction=0.14 in the model adjusted for total energy intake). in a sensitive analysis (figure 1) we found that a two - point increase in the baseline adherence to the m - km index had a stronger association with changes in bmi over the next 23 years among youth above the bmi median than their leaner peers (p - for - interaction=0.01). no other significant interactions were found in the analyses examining possibly differences by gender, age, or level of physical activity or sedentary time. we found that compared to a sample of spanish children and adolescents, relatively few youth in this prospective study of children and adolescents in the united states strongly adhered to the mdp (14). however, similarly to the spanish study, we found that adolescents who adhered to the mdp or increased their adherence had smaller bmi gains than their peers. although the clinical relevance of the association we found may seem small, our results are consistent with those reported by previous cross - sectional studies in european children and adolescents that suggested an inverse association of the adherence to the mdp with waist circumference, waist - to - height ratio (17), and bmi (31). a recently published clinical trial among youth in mexico found that obese children and adolescent randomly assigned to the mdp showed an improvement in bmi compared to those assigned to a standard diet after a 16-week intervention (32), but we are unaware of any other longitudinal studies of mdp in youth. thus, our study is the first prospective study with a long follow - up period assessing the association between the adherence to the mdp and bmi change among adolescents. our observation that increases in adherence to the mdp were associated with smaller bmi gains might be analogous to the findings from a 2-year trial which randomly assigned moderately obese adults to a mdp, low - carbohydrate, or low fat diet group and found that both the mdp and low carbohydrate diet groups had significantly greater weight losses than those assigned to the low - fat diet group (7). not only did we observe an inverse association between 23 year change in adherence to the mdp and simultaneous 23 year change in bmi, but also we found an inverse association with bmi change in the subsequent 23 year period. our results suggested that promoting the mdp might be a pragmatic tool to prevent excessive weight gain among adolescents. however, after having adjusted our analyses for total energy intake, our results suggest that other mechanisms may be also involved. energy balance may be a better explanation for changes in bmi than total energy intake. in our study we found that youth in the highest category of adherence to the mdp reported higher total energy intake than their peers in the categories of medium and low adherence to the mdp, but they also reported lower sedentary time and higher physical activity, which may lead to a greater total energy expenditure. besides, some studies suggest that macronutrient composition of diet can affect energy expenditure (33) and that the quality of some nutrients (especially fats and carbohydrates), and not only their quantity, should be considered when assessing the effect of any dietary pattern on heath status (34). our observation that the m - km score had a stronger association with bmi change among heavier youth suggests that the mdp may be considered as a useful dietary recommendation for overweight and obese adolescents. the youth / adolescent questionnaire has been validated and the observed correlations are similar to those observed in validation studies of food frequency questionnaires among adults (25), however, it was not specifically designed to measure the kidmed index, which made it difficult to directly assess some of the domains. in order to make the index appropriate for studying youth in the united states, we modified some domains of the original kidmed index and created the m - km index, which, as of today, has not been formally validated. our results suggest that the relative importance of each individual domain may be small since the association of two - point increase in baseline adherence to the m - km index and change in bmi over the next 23 years was similar regardless of which 12 domains we subtracted from the index. besides, the guts 2 participants are predominantly white children of nurses, which potentially limits generalizability of the results to non - white children and adolescents. although adolescents and young adults are known to underreport their weight, they are consistent in under - reporting, thus the weight change based on serial self - reports of weight and height has been found to be very accurate (24). finally, although we have adjusted for potential confounding factors, since this is an observational study, we can not completely rule out the possible existence of residual confounding. despite these limitations, this study has numerous strengths, including a large sample, the longitudinal design and the use of repeated measures. moreover, in contrast to several studies in adult populations that have used sample - median based indexes, the score in the m - km index is built according to absolute cut - off points, making it possible the comparability between different samples. moreover, the results were robust even after having adjusted for energy intake, and did not differ when assessing association with concurrent or subsequent bmi change. we prospectively analyzed eating habits and other life - style factors in children and adolescents in the guts 2 cohort in order to assess the association of adherence to the mdp and 2-y change in bmi over a 7-y of follow - up. we found that, according to the m - km index, relatively few participants in this study strongly adhered to the mdp. nevertheless, our results suggest that, independently of other factors, a higher adherence to the mdp was associated with smaller gains in bmi among children and adolescents. moreover, 23 year change in the m - km score was independently associated with 23 year changes in bmi in both the concurrent and subsequent 23 year period. | backgroundamong adults, the mediterranean dietary pattern (mdp) is inversely related to body mass index (bmi). data are lacking on adherence to the mdp among youth in the united states and whether the mdp is related to weight change in that group.objectiveto assess whether adherence to the mdp was associated with bmi change among adolescents. to examine temporality we studied the association between baseline and 23 year changes in adherence to the mdp with concurrent changes in bmi, as well as subsequent changes in bmi over a 7-year period.methodswe prospectively followed 6 002 females and 4 916 males in the growing up today study 2, aged 815 in 2004, living across the united states. data were collected by questionnaire in 2004, 2006, 2008, and 2011. dietary intake was assessed by the youth / adolescent questionnaire. the kidmed index was derived to measure the adherence to the mdp. we used generalized estimating equations with repeated measures within subjects to assess the association between mdp and bmi change.resultsa two - point increment in the kidmed index was independently associated with a lower gain in bmi (0.04 kg / m2 ; p=0.001). a greater increase in adherence to the kidmed index was independently related to a lower gain in bmi in both the concurrent (p - for - trend<0.001) and the subsequent period (p - for - trend=0.002).conclusionsadherence to mdp was inversely associated with change in bmi among adolescents. 2-year improvement in adherence to mdp was independently associated with less steep gain in the bmi in both the concurrent and the subsequent period. |
some of the earliest of these experimental preimpregnated fiber - reinforced composites (frcs) designed for dental applications were based on glass - reinforced thermoplastics by goldberg. in the year 1994. he studied the flexural property, stress relaxation and hydrolytic stability of frc based on thermoplastic matrices, types of fibers, and fiber volume fractions. the flexural modulus and strength was improved when polycarbonate was reinforced with 42 volume percent of glass fibers. the apparent flexural modulus of all composites decreased with span length in the range of clinical interest. the prevalent mode of failure for all frc investigated was brittle failure under flexure loading. although researches have been revolving around improvisation of the mechanical properties of frc, most of the clinical failures were the result of debonding of the retainers from the tooth surface. a subsequent clinical trial by altieri. in 1994 evaluated the use of preimpregnated glass - reinforced polycarbonate as the framework for acid - etched fixed partial dentures (fpds). fourteen 3 u restorations were placed both in anterior and posterior locations using adhesive techniques and no tooth preparation. review after 9 years showed that, three restorations were still in service. all 11 failures were associated with separation in the region of the tooth restoration interface indicating the need for adequate mechanical properties of frcs for use in prosthodontic applications. these problems were resolved by switching to a bisphenol glycidyl methacrylate based resin as the matrix for the frcs. in 1997, samadzadeh. studied the effect of the addition of chopped length of high modulus polyethylene fibers on the fracture resistance of frc. he concluded that the fracture resistance improved with the addition of polyethylene fibers. in 2002, freilich. evaluated of 39 light and heat polymerized fixed partial bridges made with a substructure of preimpregnated, unidirectional frc, veneered with a hybrid particulate composite. each of the prosthesis was assessed for surface integrity, anatomical contour, marginal integrity, and structural integrity. the survival rate was 95% for prostheses made with a high - volume substructure, when patients with severe parafunctional habits were excluded. this study shows that a unidirectional, preimpregnated frc can be used successfully to make bridges of variable retainer designs that last up to 4 or more years when a high - volume substructure is used. in 2003, li. studied the failure modes and failure locations of the direct frc dental bridge structures with and without adjacent teeth experimentally. it is found that the bonded interface is indeed the weakest region in the composite bridges. also, it is suggested that the composite resin reinforced with high modulus polymer fibers and the presence of adjacent teeth could significantly increase the structural strength and stiffness of the bridge and therefore improve its clinical performance. in 2003, li. did a finite element (fe) study on frc bridges. the fe model adopted was constructed from computer tomography images of a physical bridge specimen. the analysis showed stress concentration at the pontic - abutment interface, which results in failure at the interface. the numerical analysis of the bridge structure reveals that a high stress concentration occurs around the incisal portion of the adhesive interfaces between the pontic and abutment. in 2005, visser and rensburg did a study to review frc as an alternative to tooth replacement in south africa. although the use of frcs for this purpose is relatively new in south africa, 5 years clinical results are very promising (vallitu 2004). it is not necessary to prepare adjacent teeth, so the biological costs are low. in fact, it makes more sense to conserve as much as possible that part of the tooth which displays the best bonding surface in the oral cavity, that is, the enamel of the tooth. additionally, as this technique is reversible it allows other restorative options to be evaluated at a later time. studied the stress distribution in anterior adhesive fixed dental prosthesis and at tooth / framework interface. the design of fpd consists of retainers in maxillary central and canine and pontic lateral incisor. two different materials were compared : isotropic au - pd alloy and anisotropic continuous unidirectional e - glass frc. a three - dimensional fe model of 3 u fpd with 154 n loading was analyzed to determine the stress distribution at fpd and adhesive interface. the general observation was that the frc - fpd provided more even stress distribution from the occluding contact point to cement interface than did metal - fpd. used optical coherence tomography (oct) compared to scanning electron microscopy and optical microscopy to evaluate qualitatively crack propagation and final fracture in restorative composite materials with fiber - reinforcement after cyclic loading. the results indicated that the deformation occurred in the dental composite and fiber in the direction of the force. this clinical study evaluated the behavior of inlay fixed partial dentures (ifpd) with conventional and modified framework designs over a period of 1248 months. forty - one glass frc ifpds were made to replace one missing maxillary or mandibular tooth. group (19 samples) 1 had parallel fibers while group 2 (22 samples) had parallel as well as woven fibers. all restorations were evaluated by color match, marginal discoloration, secondary caries, surface texture, marginal adaptation, fracture, and postoperative sensitivity. group 1 showed a 16% fracture failure rate ; group 2 showed a 5% failure rate. studied the bonding properties of two types of frc posts cemented into root canals of molars. prefabricated carbon / graphite frc posts with cross - linked polymer matrix and individually formed glass frc posts with interpenetrating polymer network polymer matrix were compared. the push - out force increased with increased height of dentin disc in all groups. unlike the other posts, there were no adhesive (postcement) failures with the individually formed glass frc posts, suggestive of an improvised interfacial adhesion of cement to these posts. malferrari. in 2003 did a prospective clinical follow - up and evaluated the acceptability of quartz - fiber - reinforced epoxy posts used in endodontically treated teeth over a 30-month period. in 132 patients, displacement, detachment, or fracture of posts ; core or root fracture ; and crown or prosthesis de - cementation were considered as the parameters of clinical failure. patients were re - evaluated at 6, 12, 24, and 30 months. after 2 weeks, one cohesive failure was observed and recall after 2 months showed two adhesive failures. all three failures occurred during removal of the temporary crown at the cement dentin interface. over a 30-month period, the success rate was 1.7% but however, it was possible to successfully replace the restoration in all three failed cases. e - glass fiber (e stands for electric) is a recent advancement in frc. e - glass fiber is made of aluminoborosilicate glass with < 1 wt% alkali oxides. recent studies by zhang and matinlinna in 2011 have proved that e - fibers are able to maintain strength properties over a wide range of conditions, relatively insensitive to moisture and chemical - resistant. | fiber - reinforced composite (frc), prostheses offer the potential advantages of optimized esthetics, low wear of the opposing dentition and the ability to bond the prosthesis to the abutment teeth, thereby compensating for less - than - optimal abutment tooth retention and resistance form. these prostheses are composed of two types of composite materials : fiber - composites to build the substructure and hybrid or micro fill particulate composites to create the external veneer surface. this article reviews the various types of frcs and its mechanical properties. |
since the last description of rebase in the 2003 nar database issue (1), there has been considerable growth in the size of the database primarily due to the large number of restriction modification (rm) genes that can be found in the sequence databases. more than 200 bacterial and archaeal genomes are available from genbank (2) and it is now clear that rm systems are much more common than had once seemed likely. mainly, this is because of the difficulty of detecting type i systems or solitary dna methyltransferases by biochemical or genetic assay. putative rm genes identified in these genomes are named systematically according to recently published nomenclature rules (3) and all have the suffix the rebase website (http://rebase.neb.com/rebase/rebase.html) summarizes all information known about every restriction enzyme and their associated proteins. this includes source, commercial availability, sequence data, crystal structure information, cleavage sites, recognition sequences, isoschizomers and methylation sensitivity. within the reference section of rebase, links are maintained to the full text of all papers whenever that is freely available on the web. rebase includes links to genbank and pubmed, and ncbi 's linkout utility uses rebase, pubmed and genbank record numbers to hook directly into rebase 's enzyme, sequence, reference and genome data. links to other major databases such as swissprot (4), pdb (5) and pfam (6) are also maintained. there are currently 3681 biochemically characterized restriction enzymes in rebase and of the 3612 type ii restriction enzymes, 588 are commercially available, including 221 distinct specificities from a total of 253 total specificities known. as can be seen from figure 1, the major growth in rebase during the previous two years has been in the number of putative genes for rm system components. more than 620 restriction enzyme genes and 2200 dna methyltransferase genes can be identified in genbank entries. the method used to identify putative rm genes in dna sequences has three fundamental components : the rebase database itself, an expert - derived set of rm system features and a computer program designed to spot these features in anonymous sequences. each sequence analyzed is checked for its overall sequence similarity to rebase gene sequences. for dna methyltransferase sequences, which are the primary indicator of an rm system, the presence, proper order and characteristic spacing of well - conserved motifs suggest the candidates. the more widely divergent genes of the restriction enzymes reside close to the genes for their cognate methyltransferases. such associations point to potential restriction enzyme genes, even when they lack any similarity to genes of known enzymes. publicly available sources of non - eukaryotic sequences are also analyzed frequently by this system. specialized information is available from the rebase lists icon and information about the sensitivity of restriction enzymes to dna methylation can be found by clicking on the rebase methylation sensitivity icon. in the latter case, the data is shown in double - strand format so that the effects of hemi - methylation and double - strand methylation are clearly differentiated. nebcutter analyzes dna sequences for the presence of restriction enzyme recognition sites (7). rebsites will generate theoretical digests of an input dna with each of the 253 known specificities. rebpredictor is a tool for predicting restriction enzyme recognition sites that is an updated version of tables (8) and a specific blast (9) option permits a new sequence to be analyzed for rm genes. the rebase genomes icon leads to data for the currently sequenced 193 bacterial and 21 archaeal genomes. schematic representations of the whole genomes and the individual rm system within them are available and, from the pages showing the sequence schematics, there are links to the major database entries for these genes as well as links that will identify the closest neighboring sequences. this can be extremely useful in making predictions about the recognition sequence specificity of newly sequenced systems. this whole section of rebase provides a valuable resource for the annotation of the rm genes in a newly sequenced bacterial genome, particularly given the large numbers of rm systems that are often found. scientists interested in using the sequence information in rebase to annotate microbial genomes are encouraged to contact the rebase staff. special thanks are due to the many individuals who have so kindly contributed their unpublished results for inclusion in this compilation and to the rebase users who continue to steer our efforts with their helpful comments. this database is supported by the national library of medicine (lm04971) and new england biolabs. | rebase is a comprehensive database of information about restriction enzymes, dna methyltransferases and related proteins involved in restriction modification. it contains both published and unpublished work with information about recognition and cleavage sites, isoschizomers, commercial availability, crystal and sequence data. experimentally characterized homing endonucleases are also included. additionally, rebase contains complete and up - to - date information about the methylation sensitivity of restriction endonucleases. an extensive analysis is included of the restriction modification systems that are predicted to be present in the sequenced bacterial and archaeal genomes from genbank. the contents of rebase are available by browsing from the web (http://rebase.neb.com/rebase/rebase.html) and through selected compilations by ftp (ftp.neb.com) and as monthly updates that can be requested via email. |
a 25-year - old, 68 kg, bmi 27.64 kg / m, asa ii primigravida, was taken up for emergency caesarean section for meconium - stained liquor and fetal distress. she was a known case of preeclampsia and her blood pressure was controlled on methyl dopa 250 mg po thrice daily. her preoperative hematologic investigations were all within normal limits (hb, 10.8 g% ; tlc, 5700/mm ; platelets, 2.2 million / mm ; s. bilirubin, 0.85 mg% ; blood urea, 42 mg% ; inr, 1.13 ; pt (test), 13 s ; pt (control), 14 s ; pttk (test), 36 s ; and pttk (control), 35 s. her urine was positive for albumin. an informed consent was taken after explaining all anesthetic concerns to the patient and her relatives. before induction she was conscious, oriented with blood pressure 143/88 mmhg, pulse rate 101/ min, and oxygen saturation 98% on room air. in view of acute fetal distress (urgency grade i), it was decided to administer general anesthesia for the caesarean section. she was preoxygenated with 100% o2 for 3 min and rapid sequence intravenous induction performed with 250 mg thiopentone, 100 mg succinylcholine, using sellick 's maneuver, and the surgery was started. oxytocin infusion was started at the rate of approximately 0.04 iu / min after a bolus of 5 iu. however, the patient went into postpartum hemorrhage (pph) due to uterine atony, which did not even respond to an increase in the rate of oxytocin infusion. the surgeons decided to administer prostaglandin f2-alpha carboprost trometamol 0.25 mg (prostodin, astrazeneca, india) intramyometrial. within 12 min of its administration airway pressures shot up to 55 cm and the oxygen saturation fell to 88%, although her pph was now controlled. her blood pressure fell to 92/54 mmhg with a pulse rate of 110/ min but was successfully restored with the administration of a total volume of 3 l of crystalloids. she was immediately administered hydrocortisone (200 mg) and deriphyllin (110 mg) and nebulised with salbutamol 2.5 mg diluted in 4 ml saline. auscultation of the chest now revealed minimal rhonchi but the appearance of fine crepitations, especially at the bases. a diagnosis of acute pulmonary edema was made and the patient was given frusemide 40 mg along with morphine 6 mg intravenous stat. after completion of surgery, neuromuscular blockade was not reversed and the patient was shifted to icu for further management. in the icu she was nursed in the head up position, frusemide 40 mg was repeated and she was electively ventilated. over the next 4 h, the pulmonary edema steadily resolved, chest became clear on auscultation and her arterial blood gas analysis revealed normal gas exchange. pph is defined as excessive bleeding from the genital tract following the delivery of the baby. it is called primary if it occurs within 24 h of the delivery or secondary if after that. the who defines pph as bleeding in excess of 500 ml within the first 24 h after delivery. pph is a major cause of maternal death worldwide and is a major contributor to maternal mortality and morbidity in third world countries. a number of medical and surgical interventions are used to control the bleeding in case of pph. parenteral prostaglandins have shown promise, but their use has been limited by side effects. in dire situations, intramyometrial injection of prostaglandin f2-alpha has been used with apparently dramatic effects. intrauterine irrigation with pg f2-alpha has also been used. prostodin (15-methyl pg f2-alpha) acts as a smooth muscle stimulant and is a recognized second - line agent for use in the management of postpartum uterine atony unresponsive to oxytocin / ergometrine. it is an analog of pg f2-alpha (dinoprost) with a longer duration of action than its parent compound, attributed to its resistance to inactivation by oxidation at the 15-position. available in single - dose vials of 0.25 mg, it may be administered by deep intramuscular injection or, alternatively, by direct intramyometrial injection. the latter route of administration is achieved either under direct vision at caesarean section or trans - abdomen or trans - vaginal following vaginal delivery and has the advantage of a significantly quicker onset of action. peripheral intramuscular injection yields peak plasma concentrations at 15 min in contrast to less than 5 min for the intramyometrial route. hayashi. reported infrequent and mild side effects, including nausea, vomiting, and diarrhea. sudden collapse and death have been reported by cares and jordan following the use of pg f2-alpha intra - amniotic for abortion. found a 40% increase in cardiac output in pregnant anesthetized women during infusion of 300 g of pg f2-alpha with an increase in pulmonary arterial pressure, doubling of pulmonary vascular resistance and increase in airway resistance. reported the development of marked arterial desaturation within 510 min of the administration of 15 methyl pg f2-alpha, secondary to intrapulmonary shunt. five patients required ventilator support for variable durations. cardiovascular collapse along with left heart failure has been reported with overdose of intramyometrial prostodin, the possible etiology being a combination of acute pulmonary hypertension with decreased left ventricular end - diastolic pressure and decreased cardiac output. in our case, the cause of pulmonary edema could be either fluid overload or the administration of prostodin. three liters of crystalloids were transfused for a loss of approximately 11.5 l of blood. development of pulmonary edema immediately after the injection of prostodin points toward it being responsible for the edema. although pulmonary edema after the administration of prostaglandins is common in patients with pre - existing cardiac disease, it has also been reported in patients with normal heart. it may be prudent to use first - line uterotonics to control pph as far as possible. prostaglandin analogs, whenever used, should be used carefully, along with good monitoring and preferably under the cover of diuretics. | a 25 year old, 68 kg, primigravida, was taken up for emergency caesarean section for meconium stained liquor and fetal distress. she was a known case of pre eclampsia and her blood pressure was controlled on tab methyl dopa. she was administered general anaesthesia. after delivery of baby she went into postpartum hemorrhage which was controlled with intramyometrial prostodin. but immediately after its administration she went into acute pulmonary edema. |
reactive perforating collagenosis is a rare perforating disorder.it is characterised by collagen bundles perforating the epidermis. reactive perforating collagenosis (rpc) is a rare form of transepidermal elimination (tee) disorder in which there is extrusion of altered collagen from the epidermis. rpc can exist in two forms ; the commoner acquired form and the rare familial form. in the familial form, the lesions manifest in early childhood is not associated with pruritus and usually spontaneously resolves. we herein report a rare case of rpc in a young child with similar complaints in sibling. a 4 year old boy presented with complaints of multiple, recurrent, dark coloured raised lesions on face, elbows and outer aspect of both legs of 2 years duration. the lesions would start as skin coloured papules which later developed dark central material. some of the lesions would heal on its own in about a month leaving behind residual hyperpigmentation. patient 's mother complained that she had noticed new lesions occurring at sites of trauma. there was history of similar complaints in his elder brother who was staying with his grandparents. dermatological examination revealed multiple, discrete, symmetrical, hyperpigmented, hyperkeratotic papules distributed over face, both elbows and lateral aspect of both legs [figure 1 ]. hyperkeratotic papules with central plugging over elbows and evidence of koebnerisation similar lesions on lower limbs routine lab investigations were normal. epidermis showed a hyperkeratotic crater filled with keratin, few polymorphonuclear leucocytes and occasional acellular basophilic fibrous strands. the adjacent papillary dermis showed vertically oriented collagen bundles perforating the epidermis [figure 3 ]. the perforating collagen bundles were better delineated on van gieson stain [figure 4 ]. based on clinical and histopathological features, the lesions showed some flattening with therapy but the patient continued to get new lesions at sites of minor trauma. histopathology of skin lesions revealing epidermal parakeratosis and perforating bundles of collagen (h and e, 40) perforating collagen bundles evident in van gieson stain (van gieson stain, 40). there are four different types of perforating disorders and all are characterized by transepidermal elimination of altered dermal substances. they are kyrle 's disease, perforating folliculitis, elastosis perforans serpiginosa and reactive perforating collagenosis. the inherited form of rpc is associated with a positive family history in about two thirds of patients. consanguinity in parents is present in some cases with an autosomal recessive mode of inheritance, though dominant types have also been mentioned. there is a slight male preponderance with siblings being affected as in our case. in the acquired variant, the lesions manifest after the age of eighteen years and are usually associated with itching. it is also associated with hypothyroidism, hyperparathyroidism, liver disorders, hodgkin 's disease, neurodermatitis, hiv and iga nephropathy. the morphology of lesions is similar in both the entities and consists of umbilicated papules and nodules that can be skin coloured, erythematous or hyperpigmented and characteristically have a central keratotic plug. koebnerisation is commonly seen as in our patient. in genetically predisposed individuals, trauma results in altered collagen and scratching induces lesions and common sites of involvement are the accessible and trauma prone sites, as seen in our patient also. research has shown that in most cases no abnormality exists in the ultrastructure of the extruded collagen, but histochemical changes may be present. histologically, early lesions show variable acanthosis and accumulation of collagen, which is basophilic in dermal papillae. mature lesions show characteristic features of rpc where there is plug of parakeratotic material, basophilic debris and degenerated collagen lying within cup - shaped depressions in epidermis. as the condition resolves the important treatment options are topical retinoids, topical corticosteroids, intralesional steroids, psoralen ultra violet - a, narrow band uv - b (puva, nbuvb) and allopurinol. the familial form can also be associated with pruritus and may not spontaneously resolve as in our patient, which is not reported before. reactive perforating collagenosis can be rarely familial.the familial form can also be associated with pruritus and may not spontaneously resolve as in our patient. the familial form can also be associated with pruritus and may not spontaneously resolve as in our patient. | a 4 year old boy presented with history of itchy raised lesions on body of 2 years duration. though parental consanguinity was not present, his elder brother had similar complaints. dermatological examination revealed multiple hyperpigmented papules with a central keratotic plug distributed mainly over face and extensors of upper and lower extremities. koebnerisation was present. skin biopsy revealed perforating collagen bundles in the upper dermis and epidermis which was confirmed by van gieson staining. patient was being treated with topical retinoids and intralesional corticosteroids with minimal relief. |
birth defects occur as a result of genetic problems caused by mutations in one or more genes, chromosomal aneuploidy or environmental factors during the gestational period. cytogenetic disorders occur in about 2% of pregnancies in women older than 35 years, 1% of live births and 6% of still births. it is evident that more than 50% of first trimester spontaneous abortions are due to chromosomal abnormalities. in india, almost half a million babies are born annually with malformations ; the figure for down syndrome (trisomy 21) is 21,000 (21) or 1/1150 births. moreover, in pregnancy with ultrasound detected malformations, its incidence is much higher and varies from 17% to 27%. the most common cause of spontaneous abortion is numerical chromosome imbalances (aneuploidies), particularly of chromosomes 13, 14, 15, 16, 18, 21, 22, and x. aneuploidies of five particular chromosomes (13, 18, 21, x, y) accounts for 95% of the chromosomal aberrations that lead to infants born with congenital defects. therefore, it is essential in prenatal diagnostics to analyze chromosomal abnormalities by utilizing procedures such as amniocentesis and chorionic villus sampling (cvs) for early detection of potential birth defects, particularly in high risk pregnancies. the conventional full karyotype of amniocytes and cytotrophoblasts is labor intensive, time consuming and requires highly skilled personnel for accurate analysis. internationally, the turnaround rate for numerical aberration detection, with respect to chromosomes 13, 18, 21, x, and y, using rapid fluorescence in situ hybridization (fish) on amniocytes, has tremendously decreased from few hours, 2 h to 48 h over a period of time. currently, most laboratories perform rapid tests for aneuploidy such as fish as part of a combination test with traditional cytogenetics for prenatal diagnosis in india. recent development of newer techniques have guaranteed a significantly shortened turnaround time for obtaining results in prenatal diagnosis. these modern techniques include the aforementioned fish method, multi - primed in situ labeling (multi - prins), quantitative fluorescence polymerase chain reaction (qf - pcr) and multiplex ligation - dependent probe amplification (mlpa). there have been few studies on the applications of molecular cytogenetics for prenatal diagnostics in india. moreover, there have been no publications in this area following the printing of the aforementioned articles, as per the medline search till december, 2010. the aim of the present study was to evaluate the accuracy of the rapid fish technique for the early detection of numerical aberrations of chromosomes 13, 21, 18, x, and y in interphase nuclei of uncultured amniocytes / cytotrophoblast cells in 163 high - risk pregnancies in comparison with conventional cytogenetics. prenatal diagnosis was performed on 163 (162 singlet 01 twin) high - risk pregnancies. samples were obtained from amniotic fluid (129), chorionic villus (31), cord blood (2) and fetal urine (1). a retrospective study was conducted on the tests conducted over the course of approximately 4 years, beginning from year 2006 to 2010, at the department of fetal medicine and immunology and molecular biology, indraprastha apollo hospitals, new delhi. the indications of high - risk pregnancies suggested for further prenatal testing for detection of numerical chromosome aberrations are depicted in table 1. samples for invasive prenatal diagnosis were taken only after proper genetic counseling and signing of the consent form (pre - conception and prenatal diagnostic techniques [prohibition of sex selection ] amendment act, 2002) by both patient and clinician. indications for prenatal diagnosis the sample was taken either through cvs (at 11 - 13 weeks) or an amniocentesis (at 16 - 18 weeks) under ultrasound guidance by the fetal medicine department. after procedure 10 - 20 ml of amniotic fluid or 5 - 10 mg of chorionic villus was obtained from each patient depending on the gestation stage at the time of sampling. amniotic fluid and chorionic villi samples were then subjected to fish and full karyotype or only fish, for chromosome analysis as per request of clinician. a rapid fish analysis was performed on interphase cell preparation as described below (from amniotic fluid, chorionic villus, fetal urine, and cord blood sample). altogether standard culture and harvesting methods for chromosome preparations along with g - banding were followed for amniotic fluid and chorionic villus sample. the fish analysis was performed on uncultured amniocytes using dna probes specific for chromosomes 13, 18, 21, x and y using us food & drug administration (fda) cleared aneuvysion kit. five milliliter to ten milliliter of amniotic fluid was centrifuged (1000 rpm, 5 min) and the pellet was suspended in 5 ml 1x trypsin/ ethylene diammine tetra acetate (edta) (biological industries israel, cat 03 - 051 - 58) and incubated for 30 min at 37c. after centrifugation, the pellet was resuspended in 7 ml 0.075 m kcl and incubated at 37c for 15 min. after addition of a few drops of carnoy 's fixative (methanol : acetic acid [3:1 ]), the pellet was centrifuged, and resuspended in carnoy 's fixative for washing at least three times. subsequently, the cells were incubated at 20c for 20 min in 5 ml carnoy 's fixative and the preparation was completed with a final centrifugation. chorionic villous cells five to ten milligram (1 - 2 pieces) of villus are cleaned in rosewell park memorial institute (rpmi) medium in 35 mm petridish and are transferred to 15 ml centrifuged tube and incubated in 5 ml 1x trypsin / edta and kept at 37c for 10 min. after incubation centrifugation was done at 1000 rpm for 10 min to remove the supernatant and further incubate in 0.075 m kcl (hypotonic solution) at 37c for 40 min. after incubation we add few drops of carnoy 's fixative, then pellet was centrifuged, and resuspended in fixative for washing at least three times. finally, the villi are dissociated by adding 60% acetic acid followed by continuous vortexing and mixing to get isolated cells. urine sample was collected in 15 ml centrifuged tube and is centrifuged at 1000 rpm for 10 min. supernatant was discarded and pellet was washed three times in 1x phosphate buffer saline (pbs). after washing, we add in 0.075 m kcl (hypotonic solution) and incubate at 37c for 30 min. after incubation, we add few drops of fixative, followed by centrifugation and resuspension in fixative. cells are then washed further at least for three times to get clean white pellet of cells. one milliliter to two milliliter of cord blood sample was collected in 15 ml centrifuged tube and washed to remove debris by adding 1x pbs which is centrifuged at 1000 rpm for 10 min. after washing to the sample, we add in 0.075 m kcl (hypotonic solution) and incubated at 37c for 30 min. after incubation, we add few drops of fixative, then centrifuged to get pellet, finally resuspended in fixative followed by washing at least for 3 times. rapid fluorescence in situ hybridization (fish) was performed on uncultured amniocytes / cvs sample using dna probes specific for chromosomes 13, 18, 21, x and y following modified standardized protocol through rapid aneuploidy screening by aneuvysion kit (abbott / vysis ; downers grove, il). after interphase cell preparation, cells were resuspended in 200 l of carnoy 's fixative (methanol : acetic acid [3:1 ]) and dropped on a clean cold slides kept at 4c. we drop about ~50 l of cell suspension on each of the two separate hybridization areas marked with the glass marker. slides were then taken for fish procedure, first the slides are dipped for 10 min at 37c the slides in 2x ssc [3 m sodium chloride (fisher scientific cat. no 17556) ] then slides are dipped for 10 min at 37c into protease solution (43 l 12n hcl, 25 mg pepsin [sigma - aldrich cat. no p6887 ] in 50 ml milliq water) followed by in 1x pbs for 5 min. then slides are dipped in neutral buffer formalin buffer (180 mg mgcl2.6h20 [amresco cat. no 0288 - 100 g ], 1 ml 37 - 41% w / v formaldehyde [merck cat. min at room temperature (rt) followed by in 1x pbs for 5 min and then are dehydrated in series of 70%, 85% and 100% ethanol for 5 min each. finally, slides are air dried before addition of probe 13, 21 and x, y, 18 in both the hybridization area followed by co - denaturation of slide and probe at 90c for 5 min. the slides are then kept for hybridization at 37c for overnight incubation in air tight humidified box. next day, the post - hybridization washings was carried out in 0.4x ssc/03% np-40 at 73c for 2 min followed by 2x ssc/0.1% np-40 for 30 sec. subsequently slides are air dried and counterstained with 8 l 4, 6-diamidino-2-phenylindole (dapi) containing anti - fade and a cover slip. the slides are then incubated at 20c for at least 10 min prior to signal enumeration under the fluorescence microscope. the signal analysis was carried out using an olympus fluorescent microscope model bx60 equipped with a 100-watt mercury bulb, 100x plane apochromatic objective and single band pass filter for dapi, fluorescein-5-and / or-6 isothiocyanate (fitc) and tetramethyl rhodamine isothiocyanate (tritc) and a dual band pass filter for tritc and fitc (olympus japan). image acquisition was performed with an epifluorescence microscope (olympus bx 60) with a cooled charge - coupled device (ccd) camera with karyotype software package (cytovision, applied imaging, sunderland, uk). turn around time for getting fish results in our cases was 48 - 72 h from time of receipt of the sample. we exclusively utilized an fda - approved fish test kit for rapid aneuploidy screening in uncultured amniocytes and chorionic villus sample ; the aneuvysion kit (commercially available from abbott / vysis ; downers grove, il) consisted of three satellite dna probes for chromosomes enumeration probes x, y, and 18 (cep x, cep y, and cep 18) and two locus - specific identifier probes for 13q14 (lsi13) and 21q22.13 ~ 22.2 (lsi 21). the three centromeric probes and the two locus - specific probes were applied to the samples in two separate hybridizations on the glass slide. results were enumerated on the counting of 50 interphase nuclei per target and are reported as the number and percentage of nuclei with 1, 2, 3, 4, and > 4 signals for cep 18, lsi 13, and lsi 21 and as the number and percentage of nuclei with x, y, xx, xy, xxy, xyy, xxx, and other, for cep x / y. the criteria for reporting the cutoff level by for fish data a case was classified as informative normal for a specific chromosome if in more than 90% of the nuclei from each chromosomal (autosome / sex chromosome) hybridization demonstrated two normal disomic signal pattern. a case was considered as informative abnormal if more than 70% of the nuclei from each chromosome (autosome / sex chromosome) showed 3 signals or aberrant signal pattern. in cases where we observe 10 - 60% aberrant signal pattern amniotic fluid culture five milliliter to ten milliliter of amniotic fluid was centrifuged and supernatant was discarded, pellet was resuspended in 1 ml of gibco amniomax-ii complete medium (cat no.11269 - 016). cells are then seeded in t25 culture flask with additional 5 ml medium kept at 37c with 5% co2 and growth of the cells was monitored for next 6 - 7 days. after the flask become confluent with the cell growth we add 100 l colcemid solution, 10g / ml (biological industries, cat. after incubation 5 ml of 1x trypsin - edta was added at rt for 5 min for cell dissociation. entire content including cells are transferred in the centrifuge tube and centrifuged at 1000 rpm for 10 min, supernatant is discarded pellet is further resuspended in 7 ml of hypotonic solution (0.075 m kcl + 0.0052 m tri - sodium citrate in 1:1 ratio). the cells are incubated at 37c for 25 min and cell and are fixed with few drops of fixative after incubation and further washing is carried out with carnoys fixative until we get the white pellet of cells. then cell pellet is dropped on cold clean slides and aged for overnight at 65c and then taken for banding with standard protocol through trypsin - geimsa banding. image acquisition was performed with an epifluorescence microscope (olympus bx 60) with a cooled ccd camera with karyotype software package (cytovision, applied imaging, sunderland, uk) and 20 metaphase were captured for karyotype analysis. turn around time for getting karyotype through conventional cytogenetics in amniotic fluid sample was 3 - 4 weeks from time of receipt of the sample depending on the growth of amniocytes. chorionic villus culture five milligram to ten milligram (1 - 2 pieces) of villus is thoroughly cleaned in rpmi medium in 35 mm petridish to remove the maternal decidua to avoid the maternal cell contamination. cleaned villi are transferred in a centrifuge tube and pre - warmed (37c) collagenase (solution type iii [sigma cat. c0255 ], 500 u / ml) is added and the incubated at 37c water bath for 30 - 40 min until the supernatant become granular (leading to small pieces of cytotrophoblast). after complete digestion of the villi tube is centrifuged and supernatant is discarded, pellet is then resuspended in 1 ml of changes medium (irvine scientific cat. cells are then seeded in t25 culture flask with additional 5 ml medium and kept at 37c with 5% co2 and growth of the cells is monitored for next 6 - 7 days till the flask become confluent with the cell growth. the harvesting and fixation of the cells was carried out as per the standard protocol as described above for amniotic fluid culture. after harvesting cell pellet is dropped on clean cold slides and taken for banding with standard protocol through trypsin - geimsa banding. turnaround time for getting metaphase preparation and subsequently getting results through conventional cytogenetics in chorionic villus sample was 3 - 4 weeks. five milliliter to ten milliliter of amniotic fluid was centrifuged (1000 rpm, 5 min) and the pellet was suspended in 5 ml 1x trypsin/ ethylene diammine tetra acetate (edta) (biological industries israel, cat 03 - 051 - 58) and incubated for 30 min at 37c. after centrifugation, the pellet was resuspended in 7 ml 0.075 m kcl and incubated at 37c for 15 min. after addition of a few drops of carnoy 's fixative (methanol : acetic acid [3:1 ]), the pellet was centrifuged, and resuspended in carnoy 's fixative for washing at least three times. subsequently, the cells were incubated at 20c for 20 min in 5 ml carnoy 's fixative and the preparation was completed with a final centrifugation. chorionic villous cells five to ten milligram (1 - 2 pieces) of villus are cleaned in rosewell park memorial institute (rpmi) medium in 35 mm petridish and are transferred to 15 ml centrifuged tube and incubated in 5 ml 1x trypsin / edta and kept at 37c for 10 min. after incubation centrifugation was done at 1000 rpm for 10 min to remove the supernatant and further incubate in 0.075 m kcl (hypotonic solution) at 37c for 40 min. after incubation we add few drops of carnoy 's fixative, then pellet was centrifuged, and resuspended in fixative for washing at least three times. finally, the villi are dissociated by adding 60% acetic acid followed by continuous vortexing and mixing to get isolated cells. urine sample was collected in 15 ml centrifuged tube and is centrifuged at 1000 rpm for 10 min. supernatant was discarded and pellet was washed three times in 1x phosphate buffer saline (pbs). after washing, we add in 0.075 m kcl (hypotonic solution) and incubate at 37c for 30 min. after incubation, we add few drops of fixative, followed by centrifugation and resuspension in fixative. cells are then washed further at least for three times to get clean white pellet of cells. one milliliter to two milliliter of cord blood sample was collected in 15 ml centrifuged tube and washed to remove debris by adding 1x pbs which is centrifuged at 1000 rpm for 10 min. after washing to the sample, we add in 0.075 m kcl (hypotonic solution) and incubated at 37c for 30 min. after incubation, we add few drops of fixative, then centrifuged to get pellet, finally resuspended in fixative followed by washing at least for 3 times. rapid fluorescence in situ hybridization (fish) was performed on uncultured amniocytes / cvs sample using dna probes specific for chromosomes 13, 18, 21, x and y following modified standardized protocol through rapid aneuploidy screening by aneuvysion kit (abbott / vysis ; downers grove, il). after interphase cell preparation, cells were resuspended in 200 l of carnoy 's fixative (methanol : acetic acid [3:1 ]) and dropped on a clean cold slides kept at 4c. we drop about ~50 l of cell suspension on each of the two separate hybridization areas marked with the glass marker. slides were then taken for fish procedure, first the slides are dipped for 10 min at 37c the slides in 2x ssc [3 m sodium chloride (fisher scientific cat. no 17556) ] then slides are dipped for 10 min at 37c into protease solution (43 l 12n hcl, 25 mg pepsin [sigma - aldrich cat. no p6887 ] in 50 ml milliq water) followed by in 1x pbs for 5 min. then slides are dipped in neutral buffer formalin buffer (180 mg mgcl2.6h20 [amresco cat. no 0288 - 100 g ], 1 ml 37 - 41% w / v formaldehyde [merck cat. 61780850001730 ] in 39 ml 1x pbs) for 5 min at room temperature (rt) followed by in 1x pbs for 5 min and then are dehydrated in series of 70%, 85% and 100% ethanol for 5 min each. finally, slides are air dried before addition of probe 13, 21 and x, y, 18 in both the hybridization area followed by co - denaturation of slide and probe at 90c for 5 min. the slides are then kept for hybridization at 37c for overnight incubation in air tight humidified box. next day, the post - hybridization washings was carried out in 0.4x ssc/03% np-40 at 73c for 2 min followed by 2x ssc/0.1% np-40 for 30 sec. subsequently slides are air dried and counterstained with 8 l 4, 6-diamidino-2-phenylindole (dapi) containing anti - fade and a cover slip. the slides are then incubated at 20c for at least 10 min prior to signal enumeration under the fluorescence microscope. the signal analysis was carried out using an olympus fluorescent microscope model bx60 equipped with a 100-watt mercury bulb, 100x plane apochromatic objective and single band pass filter for dapi, fluorescein-5-and / or-6 isothiocyanate (fitc) and tetramethyl rhodamine isothiocyanate (tritc) and a dual band pass filter for tritc and fitc (olympus japan). image acquisition was performed with an epifluorescence microscope (olympus bx 60) with a cooled charge - coupled device (ccd) camera with karyotype software package (cytovision, applied imaging, sunderland, uk). turn around time for getting fish results in our cases was 48 - 72 h from time of receipt of the sample. we exclusively utilized an fda - approved fish test kit for rapid aneuploidy screening in uncultured amniocytes and chorionic villus sample ; the aneuvysion kit (commercially available from abbott / vysis ; downers grove, il) consisted of three satellite dna probes for chromosomes enumeration probes x, y, and 18 (cep x, cep y, and cep 18) and two locus - specific identifier probes for 13q14 (lsi13) and 21q22.13 ~ 22.2 (lsi 21). the three centromeric probes and the two locus - specific probes were applied to the samples in two separate hybridizations on the glass slide. results were enumerated on the counting of 50 interphase nuclei per target and are reported as the number and percentage of nuclei with 1, 2, 3, 4, and > 4 signals for cep 18, lsi 13, and lsi 21 and as the number and percentage of nuclei with x, y, xx, xy, xxy, xyy, xxx, and other, for cep x / y. the criteria for reporting the cutoff level by for fish data is adopted from the previous established criteria. a case was classified as informative normal for a specific chromosome if in more than 90% of the nuclei from each chromosomal (autosome / sex chromosome) hybridization demonstrated two normal disomic signal pattern. a case was considered as informative abnormal if more than 70% of the nuclei from each chromosome (autosome / sex chromosome) showed 3 signals or aberrant signal pattern. in cases where we observe 10 - 60% aberrant signal pattern amniotic fluid culture five milliliter to ten milliliter of amniotic fluid was centrifuged and supernatant was discarded, pellet was resuspended in 1 ml of gibco amniomax-ii complete medium (cat no.11269 - 016). cells are then seeded in t25 culture flask with additional 5 ml medium kept at 37c with 5% co2 and growth of the cells was monitored for next 6 - 7 days. after the flask become confluent with the cell growth we add 100 l colcemid solution, 10g / ml (biological industries, cat. after incubation 5 ml of 1x trypsin - edta was added at rt for 5 min for cell dissociation. entire content including cells are transferred in the centrifuge tube and centrifuged at 1000 rpm for 10 min, supernatant is discarded pellet is further resuspended in 7 ml of hypotonic solution (0.075 m kcl + 0.0052 m tri - sodium citrate in 1:1 ratio). the cells are incubated at 37c for 25 min and cell and are fixed with few drops of fixative after incubation and further washing is carried out with carnoys fixative until we get the white pellet of cells. then cell pellet is dropped on cold clean slides and aged for overnight at 65c and then taken for banding with standard protocol through trypsin - geimsa banding. image acquisition was performed with an epifluorescence microscope (olympus bx 60) with a cooled ccd camera with karyotype software package (cytovision, applied imaging, sunderland, uk) and 20 metaphase were captured for karyotype analysis. turn around time for getting karyotype through conventional cytogenetics in amniotic fluid sample was 3 - 4 weeks from time of receipt of the sample depending on the growth of amniocytes. chorionic villus culture five milligram to ten milligram (1 - 2 pieces) of villus is thoroughly cleaned in rpmi medium in 35 mm petridish to remove the maternal decidua to avoid the maternal cell contamination. cleaned villi are transferred in a centrifuge tube and pre - warmed (37c) collagenase (solution type iii [sigma cat. c0255 ], 500 u / ml) is added and the incubated at 37c water bath for 30 - 40 min until the supernatant become granular (leading to small pieces of cytotrophoblast). after complete digestion of the villi tube is centrifuged and supernatant is discarded, pellet is then resuspended in 1 ml of changes medium (irvine scientific cat. cells are then seeded in t25 culture flask with additional 5 ml medium and kept at 37c with 5% co2 and growth of the cells is monitored for next 6 - 7 days till the flask become confluent with the cell growth. the harvesting and fixation of the cells was carried out as per the standard protocol as described above for amniotic fluid culture. after harvesting cell pellet is dropped on clean cold slides and taken for banding with standard protocol through trypsin - geimsa banding. turnaround time for getting metaphase preparation and subsequently getting results through conventional cytogenetics in chorionic villus sample was 3 - 4 weeks. five milliliter to ten milliliter of amniotic fluid was centrifuged (1000 rpm, 5 min) and the pellet was suspended in 5 ml 1x trypsin/ ethylene diammine tetra acetate (edta) (biological industries israel, cat 03 - 051 - 58) and incubated for 30 min at 37c. after centrifugation, the pellet was resuspended in 7 ml 0.075 m kcl and incubated at 37c for 15 min. after addition of a few drops of carnoy 's fixative (methanol : acetic acid [3:1 ]), the pellet was centrifuged, and resuspended in carnoy 's fixative for washing at least three times. subsequently, the cells were incubated at 20c for 20 min in 5 ml carnoy 's fixative and the preparation was completed with a final centrifugation. chorionic villous cells five to ten milligram (1 - 2 pieces) of villus are cleaned in rosewell park memorial institute (rpmi) medium in 35 mm petridish and are transferred to 15 ml centrifuged tube and incubated in 5 ml 1x trypsin / edta and kept at 37c for 10 min. after incubation centrifugation was done at 1000 rpm for 10 min to remove the supernatant and further incubate in 0.075 m kcl (hypotonic solution) at 37c for 40 min. after incubation we add few drops of carnoy 's fixative, then pellet was centrifuged, and resuspended in fixative for washing at least three times. finally, the villi are dissociated by adding 60% acetic acid followed by continuous vortexing and mixing to get isolated cells. urine sample was collected in 15 ml centrifuged tube and is centrifuged at 1000 rpm for 10 min. supernatant was discarded and pellet was washed three times in 1x phosphate buffer saline (pbs). after washing, we add in 0.075 m kcl (hypotonic solution) and incubate at 37c for 30 min. after incubation, we add few drops of fixative, followed by centrifugation and resuspension in fixative. cells are then washed further at least for three times to get clean white pellet of cells. one milliliter to two milliliter of cord blood sample was collected in 15 ml centrifuged tube and washed to remove debris by adding 1x pbs which is centrifuged at 1000 rpm for 10 min. after washing to the sample, we add in 0.075 m kcl (hypotonic solution) and incubated at 37c for 30 min. after incubation, we add few drops of fixative, then centrifuged to get pellet, finally resuspended in fixative followed by washing at least for 3 times. rapid fluorescence in situ hybridization (fish) was performed on uncultured amniocytes / cvs sample using dna probes specific for chromosomes 13, 18, 21, x and y following modified standardized protocol through rapid aneuploidy screening by aneuvysion kit (abbott / vysis ; downers grove, il). after interphase cell preparation, cells were resuspended in 200 l of carnoy 's fixative (methanol : acetic acid [3:1 ]) and dropped on a clean cold slides kept at 4c. we drop about ~50 l of cell suspension on each of the two separate hybridization areas marked with the glass marker. slides were then taken for fish procedure, first the slides are dipped for 10 min at 37c the slides in 2x ssc [3 m sodium chloride (fisher scientific cat. no 17556) ] then slides are dipped for 10 min at 37c into protease solution (43 l 12n hcl, 25 mg pepsin [sigma - aldrich cat. no p6887 ] in 50 ml milliq water) followed by in 1x pbs for 5 min. then slides are dipped in neutral buffer formalin buffer (180 mg mgcl2.6h20 [amresco cat. no 0288 - 100 g ], 1 ml 37 - 41% w / v formaldehyde [merck cat. 1x pbs) for 5 min at room temperature (rt) followed by in 1x pbs for 5 min and then are dehydrated in series of 70%, 85% and 100% ethanol for 5 min each. finally, slides are air dried before addition of probe 13, 21 and x, y, 18 in both the hybridization area followed by co - denaturation of slide and probe at 90c for 5 min. the slides are then kept for hybridization at 37c for overnight incubation in air tight humidified box. next day, the post - hybridization washings was carried out in 0.4x ssc/03% np-40 at 73c for 2 min followed by 2x ssc/0.1% np-40 for 30 sec. subsequently slides are air dried and counterstained with 8 l 4, 6-diamidino-2-phenylindole (dapi) containing anti - fade and a cover slip. the slides are then incubated at 20c for at least 10 min prior to signal enumeration under the fluorescence microscope. the signal analysis was carried out using an olympus fluorescent microscope model bx60 equipped with a 100-watt mercury bulb, 100x plane apochromatic objective and single band pass filter for dapi, fluorescein-5-and / or-6 isothiocyanate (fitc) and tetramethyl rhodamine isothiocyanate (tritc) and a dual band pass filter for tritc and fitc (olympus japan). image acquisition was performed with an epifluorescence microscope (olympus bx 60) with a cooled charge - coupled device (ccd) camera with karyotype software package (cytovision, applied imaging, sunderland, uk). turn around time for getting fish results in our cases was 48 - 72 h from time of receipt of the sample. we exclusively utilized an fda - approved fish test kit for rapid aneuploidy screening in uncultured amniocytes and chorionic villus sample ; the aneuvysion kit (commercially available from abbott / vysis ; downers grove, il) consisted of three satellite dna probes for chromosomes enumeration probes x, y, and 18 (cep x, cep y, and cep 18) and two locus - specific identifier probes for 13q14 (lsi13) and 21q22.13 ~ 22.2 (lsi 21). the three centromeric probes and the two locus - specific probes were applied to the samples in two separate hybridizations on the glass slide. results were enumerated on the counting of 50 interphase nuclei per target and are reported as the number and percentage of nuclei with 1, 2, 3, 4, and > 4 signals for cep 18, lsi 13, and lsi 21 and as the number and percentage of nuclei with x, y, xx, xy, xxy, xyy, xxx, and other, for cep x / y. the criteria for reporting the cutoff level by for fish data is adopted from the previous established criteria. a case was classified as informative normal for a specific chromosome if in more than 90% of the nuclei from each chromosomal (autosome / sex chromosome) hybridization demonstrated two normal disomic signal pattern. a case was considered as informative abnormal if more than 70% of the nuclei from each chromosome (autosome / sex chromosome) showed 3 signals or aberrant signal pattern. in cases where we observe 10 - 60% aberrant signal pattern amniotic fluid culture five milliliter to ten milliliter of amniotic fluid was centrifuged and supernatant was discarded, pellet was resuspended in 1 ml of gibco amniomax-ii complete medium (cat no.11269 - 016). cells are then seeded in t25 culture flask with additional 5 ml medium kept at 37c with 5% co2 and growth of the cells was monitored for next 6 - 7 days. after the flask become confluent with the cell growth we add 100 l colcemid solution, 10g / ml (biological industries, cat. after incubation 5 ml of 1x trypsin - edta was added at rt for 5 min for cell dissociation. entire content including cells are transferred in the centrifuge tube and centrifuged at 1000 rpm for 10 min, supernatant is discarded pellet is further resuspended in 7 ml of hypotonic solution (0.075 m kcl + 0.0052 m tri - sodium citrate in 1:1 ratio). the cells are incubated at 37c for 25 min and cell and are fixed with few drops of fixative after incubation and further washing is carried out with carnoys fixative until we get the white pellet of cells. then cell pellet is dropped on cold clean slides and aged for overnight at 65c and then taken for banding with standard protocol through trypsin - geimsa banding. image acquisition was performed with an epifluorescence microscope (olympus bx 60) with a cooled ccd camera with karyotype software package (cytovision, applied imaging, sunderland, uk) and 20 metaphase were captured for karyotype analysis. turn around time for getting karyotype through conventional cytogenetics in amniotic fluid sample was 3 - 4 weeks from time of receipt of the sample depending on the growth of amniocytes. chorionic villus culture five milligram to ten milligram (1 - 2 pieces) of villus is thoroughly cleaned in rpmi medium in 35 mm petridish to remove the maternal decidua to avoid the maternal cell contamination. cleaned villi are transferred in a centrifuge tube and pre - warmed (37c) collagenase (solution type iii [sigma cat. c0255 ], 500 u / ml) is added and the incubated at 37c water bath for 30 - 40 min until the supernatant become granular (leading to small pieces of cytotrophoblast). after complete digestion of the villi tube is centrifuged and supernatant is discarded, pellet is then resuspended in 1 ml of changes medium (irvine scientific cat. cells are then seeded in t25 culture flask with additional 5 ml medium and kept at 37c with 5% co2 and growth of the cells is monitored for next 6 - 7 days till the flask become confluent with the cell growth. the harvesting and fixation of the cells was carried out as per the standard protocol as described above for amniotic fluid culture. after harvesting cell pellet is dropped on clean cold slides and taken for banding with standard protocol through trypsin - geimsa banding. turnaround time for getting metaphase preparation and subsequently getting results through conventional cytogenetics in chorionic villus sample was 3 - 4 weeks. of the total, 163 patients who underwent prenatal diagnosis, the median maternal age was 32 years (sd 5.3) (range 18 - 45) ; the median gestational age was 18 weeks (sd 6.9) (range 14 - 24 weeks). detection of chromosomal abnormalities in high - risk pregnancies was accomplished via both / or fish, conventional cytogenetics. in our study, the indications for prenatal diagnosis includes, positive triple test n = 49 (30.0%), abnormal ultrasonography (usg) n = 44 (27.0%), advanced maternal age + abnormal triple test n = 23 (14.0%), only advanced maternal age n = 11 (7.0%), triple test + abnormal usg n = 08 (5.0%), first trimester screening n = 07 (5.0%), -thalassemia carrier parents n = 03 (2.0%), chromosome abnormality in family n = 04 (2.0%) and other 's n = 14 (8.0%) [table 1 ]. of the total 163 samples received, 116 patients requested both cytogenetic and fish analysis of fetal cells (amniocytes / chorionic villus and cord blood). the samples were taken from amniotic fluid (90), chorionic villus (24), and umbilical cord blood (2) processed for cytogenetics and fish technique as per the standard procedure described above. successful results were obtained in 106 patients by both cytogenetics and fish where we observed 96 (82.7%) informative normal for five major chromosome abnormalities (13, 21, 18, x, and y) and 7 (6%) informative abnormal including trisomy 21 in four patients [figure 1 ], monosomy x in two patients [figure 2 ] and trisomy 13 in one patient [figure 3 ]. all the normal and abnormal results obtained through fish were later confirmed and correlated with cytogenetic studies. in three patients, we could get the structural abnormalities through conventional cytogenetics we got 46, xx inv (9) (p11q12), 47, xx inv (9) (p11q12) + 13, and 46, xx 15ps +, all results including trisomy 13, which could be picked up in fish except structural rearrangements. as per our reporting criteria for fish signal enumeration of the 116 patients taken for both fish and cytogenetics, three patients were suspicious mosaic giving aberrant fish signals between 10% and 60% of nuclei with three spectrum orange signals resulting in trisomy for chromosome 21. these cases were reported as uninformative through fish within our established criteria after final fish signal analysis after analyzing more number of nuclei. these conventional cytogenetics results in three suspected mosaic cases turned out to have normal karyotype after analyzing more than 20 metaphases. details of all the patients with chromosome abnormalities detected through conventional cytogenetics and fish are shown in table 2. patient p1 with cytogenetics 47, + 21 showing trisomy 21 with three spectrum orange signals for chromosome 21 and two spectrum green signal for chromosome 13 after doing fluorescence in situ hybridization in amniocytes nuclei patient p2 with cytogenetics karyotype showing 45 showing only one spectrum green signal for chromosome x after doing fluorescence in situ hybridization in amniocytes nuclei patient p5 with representative cytogenetics karyotype 47 inv (9) (p11q12) + 13 showing trisomy 13 with three spectrum green signals for chromosome 13 and two spectrum orange signal for chromosome 21 details of patients with chromosome abnormalities through conventional cytogenetics and fish in ten patients, cytogenetic analyses was incomplete due to culture failure of fetal cells ; seven failures came from chorionic villus samples ; two came from umbilical cord blood ; one from amniotic fluid. we did fish in all the ten cases of failed cytogenetics and no aneuploidy for the five chromosomes 13, 18, 21, x, and y was observed in all cases. the diagnostic detection rate for only five chromosome analyzed through fish in 116 patients was 97.5% as we got 03 uninformative cases, which were suspected mosaic and diagnostic detection rate with conventional cytogenetics was 91.4% due to 10 cases of culture failures. in 116 cases analyzed for both cytogenetic and fish had an aneuploidy detection rate of 100% for identifying chromosomal abnormalities with 100% signal hybridization efficiency of probe in all the attempted cases. out of total 163 samples only fish test was carried out in 47 patients with normal disomic signal for chromosomes in 44 (94%) patients and 2 (5%) abnormal cases of trisomy 21 and 1 (1%) case was of suspected mosaic. to summarize all the results obtained out of total 163 patients through both / or cytogenetics and fish, there were 140 (92%) patients normal for at least five common chromosome abnormality and 09 (5.5%) abnormal cases (06 trisomy 21, 02 monosomy x, and 01 trisomy 13) and 04 (2.5%) cases were suspicious mosaic through fish [table 3 ]. our study was designed to aid both the patient and clinician in management of the high risk pregnancies by providing timely, accurate results on chromosomal abnormalities via fish as well as conventional karyotyping. rapid and accurate detection of chromosomal aneuploidies has been demonstrated by several researchers which compared aneuploidy detection by interphase fish for chromosome 13, 18, 21, x, and y with conventional cytogenetics. there have been few reports in the area of prenatal diagnostics for chromosomal disorders from india. after the publication of the previously mentioned articles, few studies have been reported even after several years in which molecular cytogenetic techniques such as fish have been utilized on indian patients for prenatal diagnosis. in this study, we did fish in 163 patients and got informative results in all the patients through both / or cytogenetics and fish. in our study group 85% of cases were normal for at least five common chromosome abnormalities and 6.0% were abnormal and 2.5% cases were considered to be suspicious mosaic through fish. we got aneuploidy rate of 6.0% and diagnostic detection rate of 97.5% by fish due to four uninformative cases. 116 cases analyzed by both cytogenetic and fish had an aneuploidy detection rate of 100% as we got results for all the five major chromosome abnormalities tested in all cases including in the failed conventional cytogenetics. accurate determination of sensitivity, specificity and positive and negative value was not possible due to lack of follow - up data with postnatal karyotype and due to small numbers of cases for identifying chromosome aberrations by both fish and routine cytogenetics. there were no false - positive or false - negative for autosomal or sex chromosomal results within our established criteria of reporting fish signals. among the 116 patients taken for both fish and cytogenetic three cases were considered suspicious mosaic giving aberrant fish signals between 10% and 60% of nuclei within our established reporting criteria as described above. in these cases additional 200 nuclei were counted to confirm the signals and routine cytogenetics analysis was performed on larger number of metaphases. after conventional cytogenetics results in these three suspected mosaic cases turned out to have normal karyotype after analyzing more than 20 metaphases and no mosaic cell line were observed. there was one additional case where fetal urine cells were obtained and only fish was carried out resulting in 15% aberrant signal pattern and cytogenetic analysis was not possible due to inappropriate sample for routine cytogenetics analysis [table 3 ]. the american college of medical genetics (acmg, 2000) and the american society of human genetics (ashg) have published guidelines endorsing the use of fish tests for prenatal testing. whenever 10 - 60% cells express the same signal pattern suggestive or aneuploidy suspect 's mosaicism and are considered uninformative through fish. in these cases, fish study is recommended by analyzing additional 100 - 200 nuclei with extended cytogenetic analysis. in these cases of suspicious mosaic through fish with aberrant signals, it is wise to report them as inconclusive or uninformative test and waits for confirmation by standard karyotyping. acmg also states that prenatal fish tests provide highly accurate results for select chromosomal abnormalities and fish results can be reported to the physician before the conventional chromosome analysis results are available. similar to other areas of diagnostic testing, it recommends that irreversible decisions to act on positive results should be supported by two of the three possible pieces of information, i.e., fish, conventional cytogenetics and clinical information. in our four patients, proper genetic counseling was carried out by clinician and was discussed with the available options to the patient. after counseling three patients decided to terminate the pregnancy in lieu of the indications for prenatal diagnosis and one patient decided to continue the pregnancy and gave a live birth, postnatal karyotype results was not done till the compilation of the results. in three cases, we got the structural abnormalities through conventional cytogenetics method, which could not be identified through fish as the technique has limitation in identifying the structural aberrations and chromosome abnormalities other than five chromosomes included in the panel. however, in the second case we could detect trisomy 13 with three spectrum green signal through fish. in the third case we obtained increase in the length of the satellite on the short arm of chromosome 15 and all the results in these cases correlated with the fish study. interphase fish analysis for prenatal detection of the common aneuploidies for chromosome 13, 18, 21, x, and y is accurate and reliable test. however, patient is thoroughly counseled by the clinician what this specific test can do and can not do. aneuploidies of chromosome other than 13, 18, 21, x, and y, structural aberrations, ring or marker chromosomes and many mosaic states are theoretically undetectable by routine interphase fish testing and therefore, it does not substitute for complete standard cytogenetics. interphase fish for detection of the common aneuploidies misses about 30% of all chromosome abnormalities detectable by standard cytogenetics even with 100% accuracy of the test. it is evident that considerable percentage of missed cases would include some de novo clinically significant abnormalities like balanced translocation or marker chromosomes. hence, one of the major limitations of interphase fish analysis is to provide information regarding only the specific probe loci used. so the patients are counseled for doing classical cytogenetics in conjunction to fish for identification of rearrangements to reveal the mechanism of aneuploidy (translocation vs. trisomy) for planning future pregnancies. through conventional cytogenetics we could get informative results in 91.4% cases as there were ten cases of culture failures resulting in 8.6% of culture failure rate (10 cases out of 116), which is very high as compared to the previous studies. out of 10 culture failures in the study there were seven cvs samples, two amniotic fluid and one cord blood samples. culture failure rate in only amniotic fluid samples was 1% comparable to the other world - wide studies, which reported a culture failure rate of < 1%. the culture failure problem was mainly in cvs samples included in initial part of standardization process. however, we could assist these patients by getting information about at least five chromosomes through fish, which were found to be normal and subsequently patient was counseled for failed culture report by the clinician in lieu of indications for prenatal diagnosis. conventional cytogenetics is currently standard prenatal diagnostic test and is routinely offered to patients having increased risk of carrying chromosomally abnormal fetuses. the traditional gold standard for prenatal diagnosis of chromosome abnormalities is metaphase analysis through g banding. the primary advantages of standard cytogenetic analysis are the ability to detect aneuploidies as well as structural chromosomal aberration with great accuracy. karyotyping requires isolation of metaphase chromosomes from cultured fetal cells and therefore is time consuming. though, the reporting time has decreased considerable in last few decades, conventional karyotyping still requires 7 - 14 days of which culture is the most time consuming. however, cultures required for karyotyping can, at times, fail to grow sufficiently. the lengthy turnaround time for the conventional method is not acceptable to many parents and obstetricians especially, during the second half of pregnancies because, in many countries, the legal limit of pregnancy termination is 20 - 22 weeks. hence, there is a need for a speedy alternative method and these factors have led investigators to seek other methods for identifying chromosomal abnormalities quickly through alternative techniques like rapid fish. fish involves hybridization of fluorescently labeled specific probes to the patient 's chromosomal dna and followed by signal detection using a fluorescent microscope. fish can be applied in both interphase and metaphase cells and therefore, does not require cultures cells for diagnosis and it is a very useful technique for rapidly determining the number of chromosomes in interphase cell using chromosome specific probes. aneuploidies of chromosomes x, y, 13, 18, and 21 and account for about 65% of all chromosomal abnormalities and encompasses approximately 95% of chromosome abnormality cases, which accompany birth defects in newborns. with the introduction of multicolor, commercially available, highly specific and reliable probes significantly enhanced the overall performance of the test with quality control reagents as well as techniques in the development of standardized protocol leading to quality assurance in reporting the results. in our study, we exclusively used fda cleared aneuvysion assay kit (vysis, inc.) to enumerate chromosomes 13, 18, 21, x, and y in amniocytes and chorionic villus cells. early receipt of normal disomic results through rapid fish has a positive effect on the mother by reducing anxiety as it 's a reliably fast method for detecting numerical chromosomal aberrations in prenatal diagnosis and now subsequently been implemented as a routine diagnostic procedure in high - risk pregnancies for fetal aneuploidy in india. fish using probes specific for chromosome 13, 18, 21, x, and y has the potential to obtain results quickly and thus are capable of reducing parental anxiety and guiding further obstetric management. one may argue that cost benefit issues will direct towards abandoning the expensive cytogenetic analysis in favor of the faster, less expensive fish technique. rapid fish with aneuvysion probes (13, 18, 21, x and y) is a preliminary test ; it is often used in conjunction with full karyotype analysis the present study using fish probes specific for chromosome 13, 18, 21, x and y has the potential to find answers quickly (48 - 72 h) and is capable of reducing parental anxiety and of guiding further with better obstetric management in india. although fish is used as a preliminary test, it reduces the anxiety that parents feel during a pregnancy. it 's comparatively low sensitivity, due to its limitations as discussed in identifying only the most common aneuploidies and structural rearrangements, makes this analysis helpful only in conjunction with conventional cytogenetics. we hope in coming year in india, we could move forward to new molecular cytogentics methods like qf - pcr, mlpa and prenatal chips using array - comparative genomic hybridization (cgh), which definitely offers a number of advantages over conventional cytogenetic analysis and fish. however, the increasing cost of prenatal diagnosis associated with newer molecular techniques will be a limiting factor for better management of high - risk pregnancies in india. | background and objective : women with high - risk pregnancies are offered prenatal diagnosis through amniocentesis for cytogenetic analysis of fetal cells. the aim of this study was to evaluate the effectiveness of the rapid fluorescence in situ hybridization (fish) technique for detecting numerical aberrations of chromosomes 13, 21, 18, x and y in high - risk pregnancies in an indian scenario.materials and methods : a total of 163 samples were received for a fish and/or a full karyotype for prenatal diagnosis from high - risk pregnancies. in 116 samples both conventional culture techniques for getting karyotype through g - banding techniques were applied in conjunction to fish test using the aneuvysion kit (abbott molecular, inc.), following standard recommended protocol to compare the both the techniques in our setup.results:out of 116 patients, we got 96 normal for the five major chromosome abnormality and seven patients were found to be abnormal (04 trisomy 21, 02 monosomy x, and 01 trisomy 13) and all the fish results correlated with conventional cytogenetics. to summarize the results of total 163 patients for the major chromosomal abnormalities analyzed by both / or cytogenetics and fish there were 140 (86%) normal, 9 (6%) cases were abnormal and another 4 (2.5%) cases were suspicious mosaic and 10 (6%) cases of culture failure. the diagnostic detection rate with fish in 116 patients was 97.5%. there were no false - positive and false - negative autosomal or sex chromosomal results, within our established criteria for reporting fish signals.conclusion:rapid fish is a reliable and prompt method for detecting numerical chromosomal aberrations and has now been implemented as a routine diagnostic procedure for detection of fetal aneuploidy in india. |
the optimal visualisation of vocal cords during fibreoptic intubation may be utilised for the nares - vocal cord distance (nvd) estimation, which is a very useful measurement for blind nasal intubation, positioning of the nasopharyngeal airway (npa) or of endotracheal tube as npa and positioning of temperature sensor. the present study was conducted to measure nvd and to correlate with various external body parameters in indian population. after approval from hospital ethical committee, this prospective study was conducted on 100 patients (50 male and 50 female), american society of anesthesiologists physical status i - ii, in the age group of 1860 years who presented for elective surgery under general anaesthesia. the exclusion criteria were patient 's refusal, body mass index > 35, reactive airway disease, difficult airway, high risk for aspiration and patient with history of nasal bleed or rhinitis or polyp or snoring or bleeding diathesis. all patients included in the study were explained the whole procedure and an informed written consent was taken. the following measurements were taken : height, nares to tragus of ear distance (ned)-from lateral border of the nares to tragus of ear, nares to angle of mandible distance (nmd)-lateral border of nares to angle of mandible, sternal length (sl) distance - from sternal notch to lower border of xiphisternum, thyro - mental distance (tmd)-upper margin of thyroid cartilage to chin distance in full extension, sterno - mental distance (smd)-sternal notch to chin distance in full extension, arm span (as)-physical measurement of the length from one end of an individual 's arm (measured at the fingertips) to the other when raised parallel to the ground at shoulder height at 180 angle to each other, using measuring tape. the age, gender, height and weight of all patients routine monitors were attached (electrocardiogram, pulse oximeter, non - invasive blood pressure) and intravenous access established using 18-gauge intravenous cannula. nasal decongestant xylometazoline (otrivin) 23 drops were instilled in both nostrils 10 min before induction of anaesthesia. injection glycopyrrolate 0.2 mg, injection midazolam 2 mg and injection pethidine 0.5 mg / kg body weight were given intravenously 2 min prior to induction of anaesthesia. anaesthesia was induced with intravenous injection propofol 2 mg / kg and vecuronium bromide 0.1 mg / kg body weight was used for neuromuscular blockade. patient was ventilated with 100% oxygen and 11.5% isoflurane using aladdin 's vapourizer with bain 's circuit for 5 min. a well lubricated fiberoptic bronchoscope (fob) (karl storz, outer diameter 5.2 mm) continuous insufflation of oxygen at 4 l / min via working channel of fob was given during the procedure. the fob was marked with tape at the nares when the tip of the fob was positioned precisely between the cords, with head in neutral position. the length between the mark and tip of fob was measured, corresponding to nvd. the data according to gender were analysed and compared using two sample unpaired two tailed t - test. the power analysis was done retrospectively, observing relationship between nvd and external body parameters (assuming strong positive significant correlation of nvd with external body parameters (r = 0.001) for 100 consecutive patients with = 0.05, power 80%). the correlation between nvd and external body parameters was determined by pearson 's correlation coefficient and its statistical significance was determined by two sample unpaired two tailed t - test. a p < 0.05 was taken as cut point for level of statistical significance. linear regression analysis of the measured data was performed and the relationships between the nvd and following parameters : height, ned, nmd, tmd, smd, sl and as were analysed. on analysis of the demographic profile, the height and weight were greater in males than in females. the mean age of males and females (years) was 33.98 11.35, 36.86 11.31, respectively. the ned, nmd, smd, tmd, sl, and as were greater in males than females. the mean nvd of males was 18.50 1.5 cm and females was 15.9 1.1 cm [table 1 ]. demographic data and other body parameters of the patients both in males and females the correlation of nvd with height, sl and as was statistically significant (< 0.001) and regression lines were derived which are shown in figures 13, respectively. the correlation coefficient for the nvd to sl (r = 0.759) was higher than the nvd to as (0.561) and least with height (r = 0.463) in males [table 2 ]. the correlation coefficient for the nvd to sl (r = 0.801) was higher than the nvd to height (0.555) and least with as (r = 0.499) in females [table 2 ]. the correlation of nvd with ned, nmd, tmd and smd was not statistically significant in both the groups. after combining the groups (n = 100) the correlation coefficients for the nvd to external body parameters in decreasing order are as follows : sl (r = 0.887), height (r = 0.791), as (r = 0.769), weight (r = 0.531), smd (r = 0.466), ned (r = 0.459), nmd (r = 0.391), tmd (r = 0.379) [table 3 ]. we chose parameters for regression lines which had significant correlation with nvd in male, female and combined group. the formulae for the regression lines in the combined group were : nvd (cm) = 0.627 + 0.962 sl (cm), nvd (cm) = 0.135 height (cm) 4.471 or nvd (cm) = 0.119 as (cm) 2.946. relationship between the nares - vocal cord (y - axis) and the height (x - axis) relationship between nares - vocal cord (y - axis) and sterna length (x - axis) relationship between nares - vocal cord (y - axis) and arm span (x - axis) correlation of nvd with various external body parameters in males and females correlation of nvd with various parameters in total patients (n=100) in our study, the correlation of nvd to the sl, as and body height was significant in all the groups. the pearson 's correlation coefficient for the nvd to other body parameters was in decreasing order of sl, as, height in males and sl, height, as in females. this suggests that sl can be a better predictor for nvd estimation in both males and females. in individual groups,. however, on combining the groups, significant correlation between nvd and other external body parameters was found [table 3 ]. a similar study in the past found a significant correlation of nvd with both height and ned but not with nmd. in our study, relationship of nvd with ned did not show significant correlation in both males and females groups. however, it had strong correlation with nvd when we combined male and female data (n = 100) which was similar to above study, where male and female data were combined to correlate with nvd. in contrast to that study, our study showed a significant correlation of nvd with nmd in the combined group ; however, nmd had insignificant correlation with nvd in both males and females group. this type of study has not been carried out / published in indian population and the difference in the results might be attributed to the racial differences in skeletal makeup. were, nv length (cm) = 0.113 height (cm) 1.245 or nv length (cm) = 1.158 ne distance (cm) + 1.498. as height of the nose may be individualised or show ethnic variations, we took the lateral border of the nares for measurement. in 2008, a study was conducted in which nasotracheal intubation was performed and while inserting the tube as the give was felt suggesting passage into pharynx the position of the tube was marked black at the external nares. at the time of extubation when the patient was spontaneously ventilating under deep anaesthesia, the nasal tube was withdrawn until the black line became visible. the tube was then left in situ as a nasal airway while the patient emerged from anaesthesia. the distance from the drawn line to the tube tip was measured (lt distance). the mean lt distance was 14 1.4 cm in males and 12.4 1.4 in females. there was a correlation between lt distance and patient height (r = 0.4, p = 0.02). in addition, knowing the nvd can be useful for a blind naso - tracheal intubation. blind conscious nasal intubation is useful for an urgent intubation outside the operating room when mouth opening or neck movement is limited or prohibited. the correlation coefficients for the nvd to external body parameters in decreasing order were as follows : sl, height, as, weight, smd, ned, nmd, and tmd in the combined group ; whereas when gender was taken into consideration nvd correlated significantly with sl, height, and as and not with the other parameters. | background and aims : the optimal visualisation of vocal cords during fibreoptic intubation may be utilised for the nares - vocal cord distance (nvd) estimation. the present study was conducted to measure nvd and to correlate with various external body parameters.methods:this study was conducted on 50 males and 50 females. we measured nvd and analysed its relationship with height, nares to tragus of ear distance (ned), nares to angle of mandible distance (nmd), sternal length (sl), thyro - mental distance (tmd), sterno - mental distance (smd) and arm span (as).results : the mean nvd of the males was 18.5 1.5 cm, and that of the females was 15.9 1.1 cm. the relationship between the nvd and body height (males p = 0.001, r = 0.463, females p = 0.000, r = 0.555), sl (males p = 0.000, r = 0.463, females p < 0.000, r = 0.801) or as (males p = 0.000, r = 0.561, females p = 0.000, r = 0.499) showed a significant correlation but ned, nmd, tmd, smd did not. after combining male and female groups, (n = 100), the correlation of nvd with external body parameters is as follows sl (r = 0.887), height (r = 0.791), as (r = 0.769), weight (r = 0.531), smd (r = 0.466), ned (r = 0.459), nmd (r = 0.391), tmd (r = 0.379).conclusion : the relationship of nvd to external body parameters had strong correlation in all parameters in the combined group ; whereas when gender was taken into consideration nvd correlated significantly only with sl, height and as. |
access to high quality reproductive health services is of primary concern in cambodia due to high levels of maternal mortality and morbidity over the last two decades.13 high utilization of the private sector to meet reproductive health needs, especially for abortion, has complicated efforts to document access and to accurately describe maternal survival there.46 the royal government of cambodia has assigned a high priority to improving maternal survival, including the development and implementation of the fast track initiative road map for reducing maternal and newborn mortality 20102015,7 and the devotion of considerable resources to meeting goals identified in the national strategy. the prime minister of cambodia announced in 2010 that the highest health priority in the nation was the reduction of maternal mortality. the fast track initiative s key interventions are ensuring that women deliver in health facilities, have access to high quality emergency services, and utilize family planning methods. these interventions will hopefully contribute to cambodia s reported decline of morbidity due to unsafe abortions as well as decrease overall incidence of unsafe abortion, which remains high in many low resource settings.8,9 misoprostol is an inexpensive, heat - stable, and widely available prostaglandin that is registered worldwide for both gastric ulcer and obstetric gynecologic use, and may be an important tool in the arsenal of interventions to promote maternal survival.10,11 lifesaving interventions utilizing misoprostol at the community level have been implemented in settings with high levels of maternal morbidity and mortality particularly where post - partum hemorrhage is prevalent and public facilities under - resourced and in many countries the drug has been socially marketed through the private sector as part of a medication abortion regimen.1214 while the drug has proved to be a potentially vital resource for reduction of maternal mortality, controversy over the use of the drug has often related to its potential use as an abortifacient in settings with legal, social, or other restrictions on abortion.15 abortion is legal in cambodia16 and misoprostol is registered in the country for treatment of gastric ulcers. in addition, the combination drug medabon (mifepristone / misoprostol) is licensed for medical abortion by trained providers and socially marketed through the concept foundation (bangkok, thailand) and population services international (washington, dc, usa).17 despite its legal status, misoprostol is not part of the public health sector reproductive service strategy. contraceptive prevalence is relatively low in cambodia, with 35% of women using a modern method and 50% using any method, while a significant number of women are still delivering outside of health facilities more than half of women in rural areas.3 thus, the use of misoprostol, both for prevention of post - partum hemorrhage and abortion services, could be beneficial for maternal survival. although estimates of abortion in the country are difficult to obtain, it is projected that the majority of women seeking abortions obtain them through the private sector each year, including medication abortion using misoprostol.18 nearly 80% of women who had an abortion did so in a private sector clinic or in a private home setting in 2010.3 private providers are widely used by the cambodian population and a pattern of sequential care seeking is common, with drug retailers often being the first point of contact for health and reproductive care. meessen used household surveys to investigate choice of medical provider in cambodia s pluralistic health system and found that drug retailers were utilized most frequently followed by private practitioners and finally public providers.19 ozawa and walker also investigated provider preference, considering the role of trust in deciding between public or private providers.20 the results suggested that the interpersonal relationship between patient and provider influences care seeking in cambodia in effect, decisions were based on individual relationship rather than the perception of the organization or facility in which the provider worked.20 in one study of unmarried migrant cambodian women, self - induced abortion was the birth control of choice.4 participants in that study reported stigma and judgment encountered at health clinics and preferred to seek abortion drugs from pharmacists and street vendors to protect their confidentiality. some providers in the same study described abortion as an opportunity to supplement their income, and it is possible that not all women who were given medication abortion received proper instructions or gestational screening needed for safe use of the method. in a study assessing regional availability of misoprostol, asia was found to have a large and growing market for misoprostol - only drugs and high registration for obstetric gynecologic use.21 of the world regions, asia has not only the largest selection of misoprostol brands, but provides them at the lowest cost.21 however, in countries where misoprostol is widely available without proper instruction and supervision of health providers, there are concerns about the potential for an increase in maternal fetal complications and misuse, potentially impacting maternal health.2224 in order to understand how the potential controversies over the use of misoprostol may be impacting its use within existing reproductive health services, particularly with regard to the private sector, this study set out to gather perceptions of cambodian and international stakeholders involved in reproductive health service programming. 1) program managers and staff of international organizations, 2) program managers and staff of local non - governmental health organizations, and 3) pharmaceutical industry personnel around the role of misoprostol in private sector reproductive health in cambodia. methods included interviews with participants and analysis of country level reports on reproductive health produced by the ministry of health and non - governmental organizations. semi - structured expert interviews were conducted with 21 participants from july to august 2011. data was coded and themes were analyzed using nvivo qualitative analysis software (version 10:2012 ; qsr international pty ltd, doncaster, vic, australia). the interviews were conducted by an experienced researcher in english (due to fluency by all participants) who analyzed the data, ensured consistency of data with key informants, and kept all transcripts secure. informed consent was obtained from all participants interviewed during the study and ethics approval to interview individuals was granted by the internal review board of the lead author s institution at the time the study was conducted. misoprostol is widely available in cambodia and is sold in private pharmacies, though primarily it is found in combination with mifepristone as a medical abortion product socially marketed through the concept foundation and population services international.17 there are several thousand pharmacies in phnom penh alone and misoprostol - only drugs were reported to be widely available, costing around $ 7 for the premium brand, cytotec (pfizer inc, new york, ny, usa). participants stated that pharmacies will often decide if they are comfortable selling the product to a particular individual on the basis of whether there is concern the pharmacy might be censured for sale of the product without a prescription. the dominant theme that emerged from interviews with stakeholders was controversy over the use of misoprostol in cambodia. the overwhelming majority of participants interviewed noted that although misoprostol is available in the country, it has not been prioritized in the public sector as a tool to reduce maternal mortality. analysis of the cambodia safe motherhood clinical management protocols25 and the emergency obstetric care strategy 2010201526 confirmed that misoprostol is not included or mentioned at all as an uterotonic agent for prevention and treatment of post - partum hemorrhage or for medical abortion. however, the government has approved a combination misoprostol plus mifepristone drug, medabon (concept foundation, bangkok, thailand), only for use by licensed providers for medication abortion in clinics.17 participants unanimously agreed that historically misoprostol has caused controversy in cambodia and, as a result of that, is not a high priority in the overall strategy for reproductive health at present. one of the reasons for controversy cited by the majority of participants was a case in 2008 of maternal death as the result of a missed ectopic pregnancy for which the provider had prescribed misoprostol for medical abortion. although the case was clearly identified as a missed ectopic pregnancy and not a death due to the use of misoprostol, it caused concern among policymakers. one informant stated that even though it was the ectopic pregnancy which was responsible for the case, and international investigation was completed, the damage was done for misoprostol all study participants reported a degree of concern in discussing the topic of misoprostol as it had become a sensitive issue in the context of public and private health services as a result of the case. [misoprostol ] is important but is probably not on anyone s agenda right now. a second controversy regarding misoprostol that emerged from interview data was the debate over whether prioritizing misoprostol through policies or programs could undermine the national effort to strengthen safe delivery services. some participants noted that the country - wide focus on strengthening facility - based delivery, including provision of oxytocin as an uterotonic and the routine provision of active management of the third stage of labor, lessened the need for misoprostol as a tool to prevent post - partum hemorrhage. due to a spectacular rise in facility based births over the last several years, misoprostol may be a moot point for prevention of post - partum hemorrhage oxytocin is available at community level facilities and approximately 90% of women are receiving active management of the third stage of labor (program officer for a multilateral donor). furthermore, one participant related the reluctance on the part of the national policy makers to promote the use of misoprostol to fear that it could jeopardize facility delivery if women and families preferentially used misoprostol in the home or community, rather than accessing public services. the participant went on to note that roads and transportation are becoming more accessible and many programs are in place to reduce the burden of post - partum hemorrhage without needing to make misoprostol available more widely. one staff member of a local non - governmental organization stated that in the past, international organizations had pressed national policymakers to introduce misoprostol at the community level, but that the effort failed due to divergent opinions on the impact it could have on facility - based treatment using skilled attendants. the general consensus among those interviewed, however, was that misoprostol was an important option in the arsenal against maternal death and should be given more attention at the national level. according to one participant, women are still dying in the villages during childbirth, [the country ] could still reduce the maternal mortality rate if misoprostol was being used at the community level (staff member of an international non - governmental). one interviewee pointed out that although the cambodia demographic and health survey data show reductions in maternal mortality from 2005 to 2010, the ratio is likely to be underreported due to problems with accurate reporting of deaths at community and facility level and due to high utilization of private providers, especially for abortion. another perception of several participants was that private providers might prefer misoprostol not be available because of the loss of income from surgical abortions. medication abortion, induced either by misoprostol alone or in combination with mifepristone, and whether supervised or not, is much less expensive for patients than vacuum aspiration abortion costing on average between $ 5$7 for medication abortion in phnom penh versus $ 30$200 for surgical abortion. one study participant described the problem of a public health system with low salaries for health providers that may encourage them to steer women towards more costly surgical abortion in private clinics. participants from pharmaceutical entities noted that the cambodian drug market is a saturated and competitive one within a growing economy and has the added complication of very porous national borders that allow smuggling of pharmaceutical products from nearby countries. interviewees noted that there are copycat drugs and a multitude of outlets that sell products such as misoprostol without proper counseling. it was also noted that pharmacies are starting to be regulated more strictly and in the future unregistered pharmacies and drug sellers may be closed down due to government enforcement. according to participants, there are other issues that may hamper the use of misoprostol and impact on demand for the product. pharmaceutical informants noted that doctors often dispense directly from their offices and pharmacy owners also preferentially recommend products that are under promotion by pharmaceutical distributors in order to ensure the best profit margins. other participants noted that some doctors prescribe medicines using codes so that patients can not learn the names of drugs and request them at pharmacies and others use drug cocktails in order to prevent patients from self - medication. one interesting point mentioned by pharmaceutical informants was that cambodian clients may consider chinese or indian pharmaceutical products to be inferior to korean, philippine, and especially european ones, making cost an issue. additionally, wholesalers of pharmaceutical products may be a key point of information for consumers and are a key entry point into the markets. misoprostol is widely available in cambodia and is sold in private pharmacies, though primarily it is found in combination with mifepristone as a medical abortion product socially marketed through the concept foundation and population services international.17 there are several thousand pharmacies in phnom penh alone and misoprostol - only drugs were reported to be widely available, costing around $ 7 for the premium brand, cytotec (pfizer inc, new york, ny, usa). participants stated that pharmacies will often decide if they are comfortable selling the product to a particular individual on the basis of whether there is concern the pharmacy might be censured for sale of the product without a prescription. the dominant theme that emerged from interviews with stakeholders was controversy over the use of misoprostol in cambodia. the overwhelming majority of participants interviewed noted that although misoprostol is available in the country, it has not been prioritized in the public sector as a tool to reduce maternal mortality. analysis of the cambodia safe motherhood clinical management protocols25 and the emergency obstetric care strategy 2010201526 confirmed that misoprostol is not included or mentioned at all as an uterotonic agent for prevention and treatment of post - partum hemorrhage or for medical abortion. however, the government has approved a combination misoprostol plus mifepristone drug, medabon (concept foundation, bangkok, thailand), only for use by licensed providers for medication abortion in clinics.17 participants unanimously agreed that historically misoprostol has caused controversy in cambodia and, as a result of that, is not a high priority in the overall strategy for reproductive health at present. one of the reasons for controversy cited by the majority of participants was a case in 2008 of maternal death as the result of a missed ectopic pregnancy for which the provider had prescribed misoprostol for medical abortion. although the case was clearly identified as a missed ectopic pregnancy and not a death due to the use of misoprostol, it caused concern among policymakers. one informant stated that even though it was the ectopic pregnancy which was responsible for the case, and international investigation was completed, the damage was done for misoprostol all study participants reported a degree of concern in discussing the topic of misoprostol as it had become a sensitive issue in the context of public and private health services as a result of the case. one participant stated, [misoprostol ] is important but is probably not on anyone s agenda right now. a second controversy regarding misoprostol that emerged from interview data was the debate over whether prioritizing misoprostol through policies or programs could undermine the national effort to strengthen safe delivery services. some participants noted that the country - wide focus on strengthening facility - based delivery, including provision of oxytocin as an uterotonic and the routine provision of active management of the third stage of labor, lessened the need for misoprostol as a tool to prevent post - partum hemorrhage. due to a spectacular rise in facility based births over the last several years, misoprostol may be a moot point for prevention of post - partum hemorrhage oxytocin is available at community level facilities and approximately 90% of women are receiving active management of the third stage of labor (program officer for a multilateral donor). furthermore, one participant related the reluctance on the part of the national policy makers to promote the use of misoprostol to fear that it could jeopardize facility delivery if women and families preferentially used misoprostol in the home or community, rather than accessing public services. the participant went on to note that roads and transportation are becoming more accessible and many programs are in place to reduce the burden of post - partum hemorrhage without needing to make misoprostol available more widely. one staff member of a local non - governmental organization stated that in the past, international organizations had pressed national policymakers to introduce misoprostol at the community level, but that the effort failed due to divergent opinions on the impact it could have on facility - based treatment using skilled attendants. the general consensus among those interviewed, however, was that misoprostol was an important option in the arsenal against maternal death and should be given more attention at the national level. according to one participant, women are still dying in the villages during childbirth, [the country ] could still reduce the maternal mortality rate if misoprostol was being used at the community level (staff member of an international non - governmental). one interviewee pointed out that although the cambodia demographic and health survey data show reductions in maternal mortality from 2005 to 2010, the ratio is likely to be underreported due to problems with accurate reporting of deaths at community and facility level and due to high utilization of private providers, especially for abortion. another perception of several participants was that private providers might prefer misoprostol not be available because of the loss of income from surgical abortions. medication abortion, induced either by misoprostol alone or in combination with mifepristone, and whether supervised or not, is much less expensive for patients than vacuum aspiration abortion costing on average between $ 5$7 for medication abortion in phnom penh versus $ 30$200 for surgical abortion. one study participant described the problem of a public health system with low salaries for health providers that may encourage them to steer women towards more costly surgical abortion in private clinics. participants from pharmaceutical entities noted that the cambodian drug market is a saturated and competitive one within a growing economy and has the added complication of very porous national borders that allow smuggling of pharmaceutical products from nearby countries. interviewees noted that there are copycat drugs and a multitude of outlets that sell products such as misoprostol without proper counseling. it was also noted that pharmacies are starting to be regulated more strictly and in the future unregistered pharmacies and drug sellers may be closed down due to government enforcement. according to participants, there are other issues that may hamper the use of misoprostol and impact on demand for the product. pharmaceutical informants noted that doctors often dispense directly from their offices and pharmacy owners also preferentially recommend products that are under promotion by pharmaceutical distributors in order to ensure the best profit margins. other participants noted that some doctors prescribe medicines using codes so that patients can not learn the names of drugs and request them at pharmacies and others use drug cocktails in order to prevent patients from self - medication. one interesting point mentioned by pharmaceutical informants was that cambodian clients may consider chinese or indian pharmaceutical products to be inferior to korean, philippine, and especially european ones, making cost an issue. additionally, wholesalers of pharmaceutical products may be a key point of information for consumers and are a key entry point into the markets. in settings where facility - based care is improving rapidly but maternal mortality from post - partum hemorrhage and unsafe abortion remain relatively high, misoprostol could have a role in promoting maternal survival. controversies and legitimate concerns on the part of stakeholders provide some answers for the omission. while misoprostol has been successfully used to address maternal mortality from post - partum hemorrhage, cambodian stakeholders mentioned concerns related to possible decreases in health facility delivery. misoprostol has been used in nepal without compromising increases in facility - based delivery where oxytocin is available.13 and, although the maternal mortality ratio has decreased significantly in cambodia, further declines could be made as nearly 30% of women are still giving birth without a skilled attendant and 46% outside of a health facility particularly in rural areas with low levels of educational attainment.3 regarding use of misoprostol for medication abortion, stakeholders stated that some providers persuade women to opt for surgical abortion due to higher profits reducing the demand for misoprostol as it is used with mifepristone for medical abortion. however, a recent study suggested that the cost of the two procedures may be equivalent in settings where women require follow - up treatment after medication27 and another study noted that women undergoing medication abortion reported more negative experiences of care and lower acceptability,28 suggesting that factors unrelated to provider preference may be at work. a much larger, quantitative study would have been necessary to understand the exact distribution, prescribing practices, and purchasing behaviors of misoprostol, and thus was beyond the scope of this study. misoprostol is available in the country and is sold in pharmacies primarily in combination with mifepristone, which complicates efforts to understand the role of misoprostol - only drugs. ultimately, the extent to which misoprostol is utilized in a particular reproductive health setting will depend on many factors, including demand for the drug from providers and individuals, and the historical context of use of the drug. documenting the legitimate concerns among stakeholders involved in reproductive health programming and services can shed light on reasons for not including misoprostol in a national strategy when maternal survival can be improved. | the study aimed to explore perceptions of stakeholders regarding misoprostol use in cambodia, a setting with high maternal mortality. semi - structured expert interviews were conducted with 21 participants in the capital, phnom penh. the sample included participants involved in providing reproductive health services through international and local health agencies and the pharmaceutical industry. a theme of controversy over the role of misoprostol in the context of reproductive health services emerged, along with a need to reconcile legitimate viewpoints in order to understand the place of misoprostol in the cambodian reproductive health setting. understanding stakeholder perspectives on misoprostol can shed light on the drug s role in reproductive health programming where maternal mortality is high and health facilities are still improving. |
the patient was a 13-day - old male infant 1,350 g at birth, who was born by cesarean delivery. pulmonary surfactant was administered via an endotracheal tube twice because of respiratory distress syndrome and the newborn was provided with mechanical ventilation for 35 hours. the patient received oxygen by hood until the sixth day of life, and received 2.5 mg injections of aminophylline every 12 hours because of apnea diagnosed on the eighth day of life. gavage feeding was discontinued and bile excretion was noted. before the surgery, the vital signs were stable. there were no abnormalities on the ecg or chest x - ray. on the day of surgery, standard monitoring (electrocardiogram, noninvasive blood pressure and peripheral pulse oxygen saturation) was performed. injection of 500 ml of 10% dextrose water + nacl 15 meq + heparin 500 iu 8 ml / hr was carried out via the internal jugular vein using a 24 gauge catheter and was maintained at 10 - 0 ml / hr during the surgery. an 8 vol% of sevoflurane was administered and then maintained with a 3 vol% of sevoflurane. fresh gas flow was maintained with o2 1 l / min and air 4 l / min. injection of 1 mg of rocuronium was administered because there was no difficulty with mask ventilation. two minutes later, intubation with a 2.0 mm i d (internal diameter) endotracheal tube was attempted. the tube was checked and intubation attempted again with the same endotracheal tube, two minutes later. the tube was fixed at 7 cm the tube was cut from 12 cm to reduce the dead space. after cutting the tube, there was no change in the depth ; ventilation could not be provided and there were no breath sounds. the endotracheal tube was removed and mask ventilation was provided again. the tube was fixed at 7 cm and cut from 12 cm to reduce the dead space. after cutting the tube, one - lung ventilation was suspected, so manual ventilation was attempted, changing the depth of the endotracheal tube. after the intubation, ventilation was successful and breath sounds were detected bilaterally, in addition, to regular capnography of the etco2. the tube was fixed at 7 cm and cut from 12 cm to reduce the dead space. however, this time the ventilation was successful. injections with 0.05 mg of pyridostigmine and 0.01 mg of glycopyrrolate were provided and spontaneous ventilation occurred. after surgery, the duration for anesthesia was 2 hr 30 min and the operation was 2 hr. there was no specific change in the bp or hr. two hours after surgery, the endotracheal tube was removed because the respirations were stable. however, rigid bronchoscopy was not performed for confirmation, because there were no specific symptoms at that time. cough, inspiratory stridor, and recurrent pneumonia are symptoms associated with tracheomalacia ; the most severe symptom is apnea. in most cases, symptoms improve spontaneously and patients require conservative care. however, if severe apnea develops, recurrent pneumonia, or extubation failure, surgery is needed. tracheomalacia is frequently associated with other congenital anomalies such as an esophageal stricture or tracheoesophageal fistula. it is also associated with tumors that can press on the trachea, connective tissue disorders and long - term high pressure ventilator care. common symptoms associated with a tracheoesophageal fistula include dyspnea during feeding, cyanosis, and aspiration pneumonia caused by regurgitation of food or saliva ; this can be diagnosed by failure of attempts to insert a nasogastric tube. the diagnosis is usually made immediately after birth or within 15 days of life. the h - type of tracheoesophageal fistula, which is not associated with an esophageal stricture, may have no specific symptoms until adulthood. however, in this case, a tracheoesophageal fistula was ruled out because the patient had gavage tube feeding and there were no specific signs on the gastrograffin test. ventilation was not successful with a 2.0 mm i d tube or a cut 2.5 mm i d tube in this case. the relationship between the flow, the tube and gas in a straight tube is explained by the hagen - poiseuille equation. the hagen - poiseuille equation is as follows : v = pr4/8ul (v = flow and = 3.1416, p = pressures, r = radius of tube, l = length of tube, u = viscosity of gas). a tube with a smaller radius has greater flow ; the flow was greatest for the 2.0 mm i d tube and slowest with the 3.0 mm i d tube. according to the bernoulli effects, pressure decreases as the flow increases, at narrow points. turbulent flow occurs at the end of the tube where the radius of the tube changes. the relationship between the flow and the pressure is as follows : v p. it is assumed that the obstruction of the airway was caused by the pressure outside of the tube. flow increases with the 2.0 mm i d tube more than with 3.0 mm i d tube. the faster flow passes to the end of the tube and the pressure inside of the tube decreases when the faster flow passes the narrow point caused by the tracheomalacia. at that moment, obstruction of the airway occurs due to pressure outside of the tube. in this case, ventilation was not successful immediately after the tube was cut to reduce the dead space when a 2.5 mm i d tube was used. ventilation failure after cutting the tube was caused by obstruction of the airway due to a decrease in the pressure. the decrease in pressure was caused by shortening of the length of the tube which increases the flow rate ; then, faster flow passes through the narrow segment. reported that with a 4.0 mm i d tube, there is a 22% decrease in the resistance when the length of tube was changed to 11.3 cm from 20.7 cm. the decrease of the pressure by 22% was associated with shortening of the length of the endotracheal tube. for endotracheal tubes smaller than the 4.0 mm i d tube, the decrease in the radius is associated with a rapid increase in the pressure. an increase in the gas flow from 5 l / min to 10 l / min causes an increase of pressure from 81.2 h2o / l / sec to 139.4 h2o / l / sec in a 2.5 mm i d tube while the pressure changes from 3.1 h2o / l / sec to 4.6 h2o / l / sec in a 6.0 mm i d tube. in this case, the 2.5 mm i d tube length was changed from 18 cm to 12 cm and the 3.0 mm i d tube length was changed from 19 cm to 12 cm. the flow in the tube was not laminar flow but turbulent flow, which is not directly proportional to the pressure or length. the decrease in pressure was 18% and 19%, each, according to the relationship between the length of laminar flow and the pressure. disappearance of the parabola form, with turbulent flow, can lead to an increase in the pressure. it is assumed that the decrease of pressure is lower with turbulent flow than with laminar flow. during manual ventilation, 5 l / min was used ; however, the fresh gas flow rate was briefly more than 10 l / min. this patient received mechanical ventilator care and oxygen hood treatment before surgery ; there were no abnormal symptoms associated with respiration. reported that 95% of patients with tracheomalacia have no symptoms until two to three months after birth. thus, when obstruction of the airway occurs during induction of general anesthesia, tracheomalacia should be suspected. it is important to select the radius and length of a tube carefully when endotracheal intubation is performed in a patient with tracheomalacia. | tracheomalacia is a malformation of the tracheal membranosa. it is maintained during spontaneous breathing but can be altered by bronchoscopy or positive airway pressure. tracheomalacia is associated with a high mortality and may cause prolonged intubation and ventilation. here, the case of a 13-day - old infant with jejunoileal stenosis that had surgery is reported. during induction of general anesthesia, endotracheal intubation was attempted several times with different sized endotracheal tubes. airway obstruction occurred after the endotracheal intubation. after the airway was maintained, the operation was completed. tracheomalacia was diagnosed after otolaryngology evaluation postoperatively. |
for example, stomach, liver, and colon cancer are common in patients with inflammatory colitis. there is considerable correlation between the prognosis of various cancers and specific inflammatory markers and cytokines as well as systemic, nonspecific inflammatory markers such as c - reactive protein (crp). crp is a general marker of inflammation, and it is known to be correlated with cancer risks. also, crp is reported to have usability as a biomarker in urologic cancer. for example, elevation of crp levels, which indicates the presence of a cancer - associated systemic inflammatory response, is linked to lower survival in patients with urologic cancers, including renal cell carcinoma and cancers of upper urinary tract, bladder, and prostate. inflammation has been shown in prostate biopsy tissues, prostatectomy specimens, and chips from transurethral resection of the prostate. the existence of crp can be checked through immunochemical examination of the cytoplasm and nucleus of prostate cancer tissue. macrophage inhibitory cytokine-1 (mic-1), also known as prostate - derived factor, is a molecule of the transforming growth factor- super family and has been associated with the progression of various types of diseases, including prostate cancer. inflammation - associated cytokines may play a critical role in the functional regulation of the mic-1 gene in the early stages of prostate cancer development. prostate cancer cell - induced cytokine production by peripheral blood mononuclear cells (pbmcs) and interleukin (il)-6 is involved in the development of prostate cancers. pbmcs are capable of carrying out an " immune - modulatory dialogue " with colon cancer cells expressed by an increased production of proinflammatory cytokines by the pbmcs. the expression of il-7 and il-15 genes in prostate tissue and corresponding serum titers are significantly increased in patients with early stage prostate cancer as compared with patients with benign prostatic hyperplasia (bph). analysis of the results of recent articles suggests that inflammation influences the occurrence of prostate cancer. we hypothesized that a correlation may exist between inflammation and prostate cancer according to the serum crp level in patients undergoing transrectal biopsy of the prostate because of a rising prostate - specific antigen (psa) level. from january 2009 to march 2012, we retrospectively reviewed 710 patients who visited our urology department and were diagnosed as having psa over 4.0 ng / ml and prostate volume over 20 ml. patients who had acute infections, rheumatoid arthritis, gout, asthma, chronic lung disease, myocardial infarction, or apoplexy or who had taken nonsteroidal anti - inflammatory drugs were exempted from the research because these variables can impact crp. after we applied the exclusion criteria, we chose 63 patients with prostate cancer and 140 patients with bph for the case - control analysis. the 63 patients are diagnosed with prostate cancer underwent computed tomography, magnetic resonance imaging, and bone scan. twenty - six patients underwent radical retropubic prostatectomy and one patient underwent a pelvic lymph node dissection. also, prostate cancer was found in two patients after transurethral resection of the prostate. the clinical stage of prostate cancer was described by the tumor - node - metastasis (tnm) stage, and the prostate cancer patients were classified into two groups according to the tnm classification. patients below t2 were assigned to group a, and patients above t3 were assigned to group b. we used t - tests to examine the correlation between crp and bph and prostate cancer. we conducted analysis of variance inspection to compare the crp level of the bph group, prostate cancer group a, and prostate cancer group b. a p - values below 0.05 indicated statistical significance. the turbid immune assay was used to measure high - sensitivity crp (hs - crp). we designated the results in mg / l, and the limit of determination was 0.02 the crp level was determined by the natural logarithm of c - reactive protein (lncrp) level. their average age was 64.59.28 years (meanstandard deviation [sd ] ; range, 44 to 91 years). the average age of the 140 bph patients was 62.29.04 years (range, 48 to 91 years). the average age of the 63 prostate cancer patients was 67.28.98 years (range, 44 to 79 years). prostate cancer stages were distributed as follows : 2 patients t1, 41 patients t2, 9 patients t3, and 11 patients t4. there was a statistically significant difference between the two groups (p<0.05) (fig. 1). considering the prostate cancer stages, the mean lncrp level of prostate cancer group a was 5.091.38 mg / l, and that of group b was 5.241.58. the mean lncrp level of the bph group differed from the lncrp level of group a (p<0.05). there was also a significant difference in lncrp level between the bph group and prostate cancer group b (p<0.05) (fig. 2). there was no correlation between psa and crp level (p=0.12). even though a causal role of chronic inflammation, recurrent inflammation, or infection is not yet established in prostate cancer, inflammation is considered to contribute to the carcinogenesis process. the role of inflammation includes effects on cytokines and growth factors that participate in tumor growth, the induction of cyclooxygenase-2 in macrophages and the epithelium, and, last, generation of reactive oxygen species causing mutation and nitro - oxidant materials related to tumor growth. infiltration of chronic inflammation is very common in the peripheral zone of the prostate where most prostate cancer occurs. although differing in histology and medical terminology, show epithelial cell proliferation as a group. in these lesions, the heterogeneous expression of the gstp1 gene is likely to be damaged by oxygen. in a study in genetically modified mice that develop prostate cancer, the incidence of prostate cancer was significantly lower in mice supplemented with celecoxib, a cox-2 inhibitor, than in mice not given celecoxib. the results of this study suggest that celecoxib may have a role in chemoprevention of prostate cancer. also, it shows that controlling inflammation can reduce the occurrence of cancer. a positive correlation between serum crp and tumor stage a correlation is also observed between the rise crp and faster progression of the tumor. in addition, this study confirmed the existence of crp in the cytoplasm and nucleus of prostate cancer patients by immunochemical test. crp is clearly an independent predicting factor of cancer - specific survival in prostate cancer patients. crp is clearly confirmed as a factor predicting overall survival of castration - resistant prostate cancer patients treated with docetaxel. rising plasma crp suggests a poor prognosis. future prospective study should include a larger population of patients for more accurate results. to classify pathological inflammation levels, the serum hs - crp level of the prostate cancer group was higher than that of the bph group. inflammation may be correlated with prostate cancer on the basis of the serum hs - crp level. | purposec - reactive protein (crp) is a general marker for inflammation and it has been associated with prostate cancer. we hypothesized that a correlation may exist between crp and prostate cancer in patients undergoing transrectal biopsy of the prostate because of rising prostate - specific antigen (psa) levels.materials and methodsfrom january 2009 to march 2012, we retrospectively reviewed 710 patients who visited our urology department and were diagnosed as having a psa value over 4.0 ng / ml. patients with acute infections, rheumatoid arthritis, gout, asthma, chronic lung disease, myocardial infarction, or apoplexy and those who had taken nonsteroidal anti - inflammatory drugs were exempted from the research because these variables could have impacted crp. after we applied the exclusion criteria, we selected 63 patients with prostate cancer and 140 patients with benign prostatic hyperplasia (bph).resultsa total of 203 patients were observed : 140 patients had bph, and 63 patients had prostate cancer. prostate cancer patients were divided into two groups by tumor - node - metastasis classification. the patients below t2 were group a, and those above t3 were group b. the natural logarithm of c - reactive protein (lncrp) differed between the bph group and the prostate cancer group. the lncrp also differed between the bph group and prostate cancer groups a and b (p<0.05).conclusionsthe serum crp level of the prostate cancer group was higher than that of the bph group. inflammation may be correlated with prostate cancer according to the serum crp level. |
chemotherapy is known to be a critical remedy for tumors, and cyclophosphamide (cp) is used as a common chemotherapeutic drug for cancer and immunosuppression for nephritic disorders and lupus erythematosus, while negative roles of cp on male reproductive functions have been widely recognized for many years, which result in dose reduction of antineoplastic drugs and leads to a decline of chemotherapeutic effects (1 - 3). hence, weakening toxic damage of cp on normal tissues and increasing dose of cp for elevation of therapeutic effects in patients have been taken as purposes for developing cytoprotectors to be used as assistant drugs for chemotherapy. in recent years we proved squid ink polysaccha- rides (sip), a type of glycosaminoglycan with a unique structure -[3glca1 - 4(galnac1 - 3)-fuc1]n (4, 5), to have antioxidative activities and chemoprotective roles in vitro and/or in vivo (6 - 10). our previous investigations revealed that the chemoprotective activities of sip were observed in liver, lung, heart, kidney, marrow, and testis of model animals exposed to cp through improving antioxidant abilities of the organs (6), which implies that sip can prevent testis from cp - induced oxidative stress damage. nrf2 (nf - e2-related factor 2) is an important transcription factor that binds to ares that are important gene regulatory elements of many phase ii drug - metabolizing / detoxification enzymes as well as cellular defensive enzymes and regulates anti - oxidative stress and plays a concernful role in eliminating intracellular superfluous reactive oxygen species (ros) and improves antioxidant ability (11). some bioactive substances have been proved to activate nrf2 to relieve or prevent diseases correlated to oxidative stress, such as astaxanthin (12) and curcumin (13, 14). however, it is still unknown whether sip impairs cp - caused testicular damage through activating nrf2 to upregulate expression of antioxidative enzyme genes and phase ii enzyme genes subjected to maintaining redox equilibrium. in this study live squids purchased from a local aquatic products market were sacrificed to harvest fresh ink sacs that were then stored at -28 c for future use. according to our previous methods (6), ink collected from sacs thawed at 4 c and was suspended with ph 6.7 pbs, and was then ground and ultrasonically treated. the resultant ink solution was stored at 4 c for 24 hr and was then centrifuged at 14000 g for 1 hr at 4 c. the supernatant was subjected to enzymolysis with 1% papain in pbs (ph 6.7) at 60 c for 24 hr, and was then mixed with a 1/4 volume liquid mixture of chloroform and n - butanol (v / v, 4/1) followed by stirring for 30 min on a magnetic stirrer plate. after centrifugation at 5000 g for 15 min, the supernatant was re - digested with papain, the digestion process was performed twice. sip in the resulting supernatant was precipitated with four volumes of absolute alcohol, and was subjected to freeze - drying in a vacuum. following habituation for 1 week, sexually mature male kunming mice purchased from the experimental animal centre of guangdong medical college were allocated to four groups (ten mice per group) : a control group, a cp - treated group, a sip - treated group, and a co - treated group (sip and cp). the sip dose was 80 mg / kg body weight, once a day for a continuous ten week period, and the cp dose was 15 mg / kg body weight, once a week (again for a continuous ten week period). testes were collected from mice that were sacrificed by breaking neck vertebrae and were quickly cleaned with ice - cold normal saline. testis was minced and homogenated in ice - cold normal saline with a glass homogenizer. the harvested supernatant was denatured in protein sample buffer for 5 min in boiling water. after sds - page, protein was transferred to nitrocellulose membrane and then probed with monoclonal antibody, against nrf2 (cell signaling), -actin (cell signaling), keap-1 (cell signaling), hdac2 (cell signaling), p - pkc (cell signaling), nqo-1 (abcam), or ho-1 (abcam), which would be captured by the secondary antibody conjugated with horseradish peroxidase (santa cruz). live squids purchased from a local aquatic products market were sacrificed to harvest fresh ink sacs that were then stored at -28 c for future use. according to our previous methods (6), ink collected from sacs thawed at 4 c and was suspended with ph 6.7 pbs, and was then ground and ultrasonically treated. the resultant ink solution was stored at 4 c for 24 hr and was then centrifuged at 14000 g for 1 hr at 4 c. the supernatant was subjected to enzymolysis with 1% papain in pbs (ph 6.7) at 60 c for 24 hr, and was then mixed with a 1/4 volume liquid mixture of chloroform and n - butanol (v / v, 4/1) followed by stirring for 30 min on a magnetic stirrer plate. after centrifugation at 5000 g for 15 min, the supernatant was re - digested with papain, the digestion process was performed twice. sip in the resulting supernatant was precipitated with four volumes of absolute alcohol, and was subjected to freeze - drying in a vacuum. following habituation for 1 week, sexually mature male kunming mice purchased from the experimental animal centre of guangdong medical college were allocated to four groups (ten mice per group) : a control group, a cp - treated group, a sip - treated group, and a co - treated group (sip and cp). the sip dose was 80 mg / kg body weight, once a day for a continuous ten week period, and the cp dose was 15 mg / kg body weight, once a week (again for a continuous ten week period). testes were collected from mice that were sacrificed by breaking neck vertebrae and were quickly cleaned with ice - cold normal saline. testis was minced and homogenated in ice - cold normal saline with a glass homogenizer. the harvested supernatant was denatured in protein sample buffer for 5 min in boiling water. after sds - page, protein was transferred to nitrocellulose membrane and then probed with monoclonal antibody, against nrf2 (cell signaling), -actin (cell signaling), keap-1 (cell signaling), hdac2 (cell signaling), p - pkc (cell signaling), nqo-1 (abcam), or ho-1 (abcam), which would be captured by the secondary antibody conjugated with horseradish peroxidase (santa cruz). to determine roles of nrf2 in mice testis treated with sip and/or cp, in this study we detected the expression level of nrf2 gene in testis and the results were presented in figure 1. the data showed that cp obviously decreased protein content of nrf2 in testes of model mice. our data declared apparently an insignificant result that pkc was not phosphorylated in testes of mice exposed to cp. however in sip - treated mice degree of pkc phosphorylation was markedly improved, meanwhile expression level of nrf2 gene was increased sharply in testes, the similar positive effects of sip were observed in testes of cp - administered mice. contents of nrf 2 protein and activation level of protein kinase c (pkc) in testes of mice. values with different lowercase superscripts mean significant difference (p<0.05), those with different capital letters are extremely different (p<0.01) in comparison with cp - treated mice, a marked increase of expression of keap1 gene in testes from sip - exposed and co - treated mice. for a regulatory enzyme that can stabilize nrf2 protein through deacetylation, expression content of hdac2 gene was not affected by cp in mice testes, but obvious increases of the protein content of hdac2 were observed under stimulation of sip that is presented in mice of both sip- and co - treated groups (figure 2). contents of keap-1 and histone deacetylase 2 (hdac2) proteins in testes of mice. values with different lowercase superscripts mean significant difference (p<0.05), those with different capital letters are extremely different (p<0.01) as shown in figure 3, data showed that cp did not obviously change expression level of ho-1 gene but sharply declined the content of nqo-1 protein in testes, and that sip not only markedly improved contents of ho-1 and nqo-1 in normal mice, also significantly increased levels of the two proteins in cp - treated mice. contents of heme oxygenase 1 (ho-1) and quinone oxidoreductase 1 (nqo-1) proteins in testes of mice. values with different lowercase superscripts mean significant difference (p<0.05), those with different capital letters are extremely different (p<0.01) acrolein, a cyclophosphamide s metabolite induces body to produce superfluous ros that cause tissues to undergo oxidative stress and/or apoptosis (15). to avoid the damages induced by cp or other oxidative stressors, cells develop a series of signal regulative mechanisms to keep intracellular redox equilibrium (16), nrf2/are is one of their important pathways. under normal conditions, nrf2 is kept fairly low level in cytoplasm through binding to keap1 or rapid degradation. however stimulation by drugs or other oxidative stressors can elevate dissociative content of nrf2, release from keap1 or up - regulating expression of nrf2 gene, which enters the nucleus to bind are of the downstream genes and then to stimulate expression of the genes, such as phase ii enzyme genes, antioxidant enzyme genes and protein kinase genes, which results in immediate detoxication and maintaining intracellular homeos - tasis. nrf2 widely distributed in any of various organs plays a concernful role in protection of the organs, deletion or active disturbance of the factor should lead cells to more sensitivity to oxidative stress (17). this study revealed that cp reduced protein content of nrf2 in testis which was in accordance with tripathi s report (18). presently, it is known that nrf2 is phosphorylated by pkc to be activated (19, 20). although pkc failed to be phosphorylated in cp - exposed mice testis, it was activated under treatment together with sip. nrf2 was regulated by other upstream molecules besides pkc, such as keap1 and hdac2., nrf2 is degraded through ubiquitin - proteasome pathway after the protein is bound in the neh 2 domain by keap1 (21), and is separated from keap1 for reasons such as phosphorylation of pkc on nrf2 (19, 20), to play biological roles. in this paper we found sip increased content of keap1 protein, which may be originated from positive feedback regulation by increase of nrf2 protein content, which would be subjected to binding and decreasing dissociative nrf2 protein in cytoplasm and combined nrf2 protein bound to ares in nucleus (22). the results suggested that sip not only improved expression of keap1 gene in testes of normal mice, but also positively affected contents of the protein in testes of chemotherapeutic mice, which was subjected to resisting expression increase of nrf2 gene. hdac2 is an enzyme that can deacetylate nrf2 protein to harvest stabilized protein that can activate the downstream effective molecules (23, 24), such as antioxidative enzymes and phase ii enzymes. according to the data, cp did not change hdac2 content in testes, but sip significantly improved the expression level of hdac2 gene in both sip- and co - treated mice. although our data have proved upstream regulatory factors of nrf2 were affected by stimulation of sip, the regulation was just acted on nrf2 protein. this paper discovered that sip interfered with contents of nrf2 protein as determined by western blotting, which was similar to present reported antioxidants, such as green tea (25), astaxanthin (12) and curcumin (13, 14), and the metallic element zinc (26). the increase in nrf2 protein may be originated from improvement of expression of nrf2 gene caused by sip. from above mentioned information, activated nrf2 protein plays roles through activating downstream effective molecules, which contain many enzymes, such as heme oxygenase 1 (ho-1) and quinone oxidoreductase 1 (nqo-1), which are two important enzymes in antioxidation and detoxification. background researchers reported that nrf2 binds to are through using bzip (basic leucine zipper, a domain found in many dna binding eukaryotic proteins) to form dimers with maf (a transcription factor) and then activate the downstream genes, ho-1 and nqo-1 ; expression levels of the two genes were positively correlated with the nrf2 gene (27 - 29). this study showed that sip effectively changed effects of cp on expression levels of ho-1 and nqo-1 genes in testes. summarily, in this study we firstly found that sip employed the nrf2/are signal pathway to activate downstream target genes, ho-1 and nqo-1, to exert preventive roles against cp - induced damage on mice testis, and that pkc acted as an upstream regulator that participated in the regulative process on nrf2. in addition, two other upstream molecules, keap1 and hdac2, were also vital proteins in the process of regulation of sip on activity of nrf2. thus, we can conclude that sip triggers nrf2/are signal cascades via regulating pkc, keap1 and hdac2, whereas we are still ignorant of the accurate regulative mechanisms of sip on pkc, keap1 and hdac2, which would be an important content in our future research. this study showed that sip reduces cp - induced testicular damage via nrf2/are activation pathway in mice. to our knowledge this study is the first to report that intervention of sip on cp - mediated testicular damage is connected with nrf2/are signalling pathway, which suggests that nrf2/are may be an important signalling pathway that is used by sip to weaken chemotherapeutic drugs - induced damage of male reproductive ability. further investigation is necessary to learn more details about the regulatory mechanisms, the results would be helpful to developing sip as a potential chemotherapeutic adjuvant drug. | objective(s):cyclophosphamide (cp) toxicity on testis was hampered by squid ink polysaccharide (sip) via restoration of antioxidant ability in our previous investigations. this study investigated roles of nrf2/are signal pathway in testis of treated mice.materials and methods : male kunming mice were employed to undergo treatment with sip and/or cp. protein levels of nrf2, keap-1, histone deacetylase 2 (hdac2), quinone oxidoreductase 1 (nqo-1), and heme oxygenase 1 (ho-1) and phosphorylation level of protein kinase c (pkc) in testis were evaluated by western blotting.results:data showed that sip elevated expressions of nqo-1 and ho-1 genes, two downstream target molecules of nrf2, via activating nrf2 to play preventive roles on cp - treated testis, and further discovered that upstream regulators of nrf2, keap-1, hdac2, and pkc, were concerned with the regulation of nrf2.conclusion:these results suggest that sip could effectively weaken cp - associated testicular damage via nrf2/are signal pathway. |
an esthetic wire coated with a tooth - colored plastic material, such as a synthetic fluorine - containing resin or an epoxy resin composed mainly of polytetraflueroethlyene, has been used to satisfy esthetic demands. several problems involving the wearing or peeling of the outer coatings of coated wires have been identified. kusy (1997) found that coated, colored wires are routinely damaged by mastication forces and the activity of oral enzymes within 3 weeks of their use in vivo. elayyan, silikas and bearn (2008) reported that surface roughness of coated archwires increased after use in vivo. kaphoor and sundareswaran (2012) reported that the forces of some coated wires were significantly lower than those of uncoated wires. other authors also encountered difficulties with such coated archwires, claiming that the color tended to change with time and that the coating split during use in the mouth, exposing the underlying metal. in addition, the evaluation of wire properties, such as force and smoothness, would be valuable because the sliding of a wire with problematic surface properties, such as the durability of the coating material, may be inferior to that of an uncoated wire. some reports have described the influence of wire sliding against a single piece of bracket with soaking solution and the relationship between the cross - sectional dimensions of the wire and load deflection. we initially use small wires, such as a 0.012-inch nickel - titanium (ni - ti) wire, because use of low - friction brackets is widespread. in the initial stages of orthodontic treatment, the wire used must produce a continuous force without interference. although the sliding resistance (interference) of the wire depends on its size as compared to the bracket slot room, the relationship between force and resistance is important because it affects the movement of the teeth. during leveling of dental arches with irregularities, if the force produced by the wire is less than the friction resistance, as interference, the dental arch must be expanded until the placement at which the resistance is released is reached. thus, expansion of the dental arch in an extraction case can lead to poor - quality treatment, such as a prolonged duration. ni - ti wires are categorized into two types (austenitic and martensite types) according to mechanical properties and fabrication. although both have excellent springback properties, austenitic ni - ti wires also have shape memory and superelasticity. thus, this issue should be examined using small ni - ti wires with different mechanical properties, and for plain and coated small wires, because coated wires may have sliding issues. the purpose of this study was to evaluate the relationship between mechanical properties and friction in small esthetic (including plated) ni - ti wires using a dental arch model designed with linguoversion of the lateral incisor in the arch and an iso bending test, and to compare esthetic and unesthetic wires. five esthetic (three coated and two plated) and two small plain ni - ti (base sizes of 0.012 and 0.014 inches) wires were used (figure 1). a three - point bending test was carried out using the end 30 mm of each archwire. to investigate the relationship between force and deflection in the bending of ni - ti wires, briefly, we performed the three - point bending test with an interfulcrum distance of 10 mm, a crosshead speed of 7.5 mm / min, and a temperature of 361c using a testing machine (5567 ; instron, norwood, ma, usa) because the ni - ti wire used displayed no linear elastic behavior during unloading at temperatures up to 50c. next, we measured the force - deflection curve of each wire and obtained unloading bending forces at deflections of 3.0, 2.0, 1.0, and 0.5 mm during unloading. the base wires a-1 to a-5 and p-1 were austenitic ni - ti, and p-2 was martensite ni - ti (abb. : abbreviation) to assess friction resistance between brackets and wires in the dental arch, static friction force was measured. we placed each wire in low - friction passive - ligating brackets (t-21 ; tomy international, tokyo, japan ; slot size, 0.022 inch ; composition, bracket : polyethylene terephthalate etc, slot cap : polyacetal), which were aligned to a dental arch form plate model (figure 2) with 0.5, 1.0, 2.0, or 3.0 mm displacement at the lateral incisor and the arch - form plate. the brackets and the end of the wire were placed in the air - chucks of the testing machine (5567 ; instron ; figure 3). we applied tensile loading under a crosshead speed of 0.5 mm / min and measured the maximum loading as the static friction force. a dental arch - form plate model designed for the linguoversion of the lateral incisor in the arch a test of static frictional force. a dental archform plate and the end of an archwire, placed in the arch, are held by the air - chucks of the testing machine descriptive statistics, including means and standard deviations, were calculated for the unloading bending force and static friction force using statistical analysis software (ver. 16.0 ; spss, chicago, il, usa) additionally, the scheff test and games - howell test were used for multiple comparisons among the products. a p value < 0.05 was considered to indicate statistical significance. bending forces produced from the wires and friction forces at displacements of 3, 2, 1.0, and 0.5 mm during unloading are shown in tables 1 - 4. at a displacement of 0.5 mm, unloading bending forces were 27.8 - 85.6 cn and friction forces were 7.0 - 50.5 cn. at a displacement of 1.0 mm, unloading bending forces were 42.7 - 123.2 cn and friction forces were 11.2 - 93.6 cn. unloading bending forces at a displacement of 2.0 mm were 50.3 - 165.4 cn and friction forces were 96.1 - 444.9 cn. at a displacement of 3.0 mm, unloading bending forces were 53.5 - 164.5 cn and friction forces were 164.4 - 950.7 cn. unloading bending and friction forces in each wire, except the 0.014-inch p-2 wire, did not differ significantly. different letters (roman type : unloading bending force group ; italics : friction force group) indicate a significant difference (p<0.05) within the single - wire - size and identical - force groups unloading bending and friction forces at a displacement of 1.0 mm s.d. : different letters (roman type : unloading bending force group ; italics : friction force group) indicate a significant difference (p<0.05) within single - wire - size and identical - force groups unloading bending and friction forces at a displacement of 2.0 mm s.d. : different letters (roman type : unloading bending force group ; italics : friction force group) indicate a significant difference (p<0.05) within the single - wire - size and identical - force groups unloading bending and friction forces at a displacement of 3.0 mm s.d. : different letters (roman type : unloading bending force group ; italics : friction force group) indicate a significant difference (p<0.05) within the single - wire - size and identical - force groups the relationships between unloading bending and friction forces for each wire size are shown in figures 4 and 5. for 0.012- and 0.014-inch wires, all unloading bending forces at 0.5 and 1.0 mm were larger than friction forces. however, all friction forces at displacements exceeding 2.0 mm were larger than the unloading bending forces. unloading bending forces at 0.5 and 1.0 mm were larger than friction forces, but all friction forces at displacements exceeding 2.0 mm were larger than unloading bending forces relationships between unloading bending and friction forces for 0.014-inch wires at the leveling stage, tooth movement behavior depends on the force produced by the sliding wire and the friction resisting it. in this experiment, the friction force at displacements exceeding 2.0 mm was larger than the force caused by the wire. that is, teeth are likely to move with the expansion of the dental arch up to a displacement of 1.0 mm. resistance to sliding has been reported to be slightly greater in the wet state than in the dry state. even if our experiments were performed in the wet state, the relationship should not differ because most friction forces at displacements exceeding 2.0 mm were markedly larger than unloading bending forces. regarding the friction force, many studies have reported the use of experimental models to measure the force of a wire drawn from a bracket. on the other hand, henao and kusy (2004) used a lower typodont malocclusion model with damon brackets, and reported friction forces of 250 - 675 cn with a 0.014-inch ni - ti wire. kim, kim and baek (2008) reported that the static friction force of a 0.014-inch austenitic ni - ti wire was 89.5 - 2249.0 cn in a mandibular typodont with 0 - 3.0 mm tooth displacement, identical to that used in this study. however, kim, kim and baek(2008) used a mandibular typodont with lateral incisors that could be displaced lingually. in our experiment, friction forces with the 0.014-inch wire were 11.4 - 950.7 cn. thus, if our dental arch model had bilateral tooth displacement, the friction force would be approximately doubled, although the ability to determine the actual friction force is limited in many cases by the simplicity of the model. regarding the experimental model, we used a mandibular dental arch that was placed in passive self - ligating brackets to measure friction force. the interfulcrum distance, which is standardized to 10.0 mm according to iso 15841, matches the interbracket distance in mandibular anterior teeth. kim, kim and baek (2008) and henao and kusy(2004, 2005) reported friction forces obtained with bimaxillary models. although friction force depends on the degree of tooth displacement and the brackets used, the force in the maxillary arch must be smaller than that in the mandibular arch because the interbracket distance in the mandible is shorter. however, additional experiments are needed to understand the relationship between the maxillary dental arch and friction resistance because the force produced by the wire must also be smaller. with regard to the relationship between periodontal tissue and orthodontic force, schwartz (1932) reported that a safe force for tooth movement was 20 - 26 g / cm. using a rat experiment model, noda,. (2000) found that the optimal force corresponding to a human premolar was 41.4 g. in this experiment, the smallest unloading bending force produced by the wire was 27.8 cn. the force produced from a wire in the three - point bending test is translated as reciprocal action. because the force that reaches the teeth becomes half of the unloading bending force, the forces of all 0.012-inch wires at a displacement of 0.5 mm and those of some 0.012-inch wires at a displacement of 1.0 mm were likely of doubtful use for optimal tooth movement. in product comparisons, no significant difference in unloading bending or friction force was detected between esthetic and p-1 wires or among esthetic wires. however, significant differences in force - deflection curves were detected between plain p-1 and p-2 ni - ti wires. the p-2 wire (nitinol classic) is a stabilized (work - hardened) martensitic ni - ti wire, whereas the p-1 and other wires have curves that convey superelasticity, resulting in an almost even force during unloading. thorstenson and kusy (2002) reported that the regression lines in the sliding of a stabilized martensitic ni - ti wire differed from those of active austenitic ni - ti wires. in our study, at a displacement of 3.0 mm, the ratio between the friction and unloading bending forces of a 0.014-inch p-2 wire was the largest among wires, and the friction force was approximately 5.8-fold larger than the unloading bending force. thus, the surface treatment of the wire used is likely unimportant for austenitic ni - ti wires. furthermore, the stabilized martensitic ni - ti wire, which exhibited a larger ratio, is not likely to be superior to other wires with respect to the relationship between force and friction, at least within the limitations of this experiment. within the limitations of this study, the following conclusions were reached : because the friction force at displacements exceeding 2.0 mm is larger than the force produced by the wire, teeth are likely to move with the expansion of the dental arch up to a displacement of 1.0 mm. no significant difference in unloading bending or friction force was detected between esthetic and austenitic plain ni - ti wires. the ratio between friction and unloading bending forces was smaller for austenitic ni - ti wires than for martensitic ni - ti wires ; thus, austenitic ni - ti wires are likely more appropriate for clinical use. | the relationship between orthodontic force and friction produced from an archwire and brackets affects the sliding of the wire in the leveling stage.objectivethe purpose of this study was to evaluate the relationship between force and friction in a small esthetic nickel - titanium (ni - ti) wire. material and methodsfive esthetic wires (three coated and two plated) and two small, plain ni - ti wires (0.012 and 0.014 inches) were used. we performed a three - point bending test according to iso 15841 and the drawing test with a dental arch model designed with upper linguoversion of the lateral incisor in the arch (displacements of 0.5, 1.0, 2.0 and 3.0 mm), and evaluated the relationship between them. resultsunloading bending forces of all wires at displacements of less than 1.0 mm were larger than friction forces, but all friction forces at displacements exceeding 2.0 mm were larger than unloading bending forces. the arch likely expands when displacement from the proximal brackets exceeds 1.0 mm. the friction force of a martensite 0.014-inch ni - ti wire was significantly greater than those of the other esthetic and austenitic wires. conclusionsa wire with the smallest possible friction force should be used in cases with more than 1.0 mm displacement. |
nephrotic syndrome results in loss of plasma proteins and various other macromolecules in the urine leading to their deficiencies. many of the physiologically important molecules which exist in the plasma, bound to plasma proteins, are also carried away and are lost in the urine. the common abnormalities arising as a result of heavy proteinuria include hypothyroidism, vitamin d deficiency, and iron deficiency. while urinary loss of vitamin - d - binding globulin and transferrin accounts for their respective deficiencies, the exact cause of hypothyroidism in nephrotic syndrome appears to be complex. initially it was thought that these individuals are metabolically euthyroid, as evidenced by their normal plasma free t4 (ft4) levels and free t3 (ft3) levels. the decrease in total t4 (tt4) was often attributed to the urinary loss of thyroid binding globulin (tbg) and the resulting increase in unbound hormone suppressing further thyroid hormone secretion from the gland. as the thyroid gland function is regulated by thyroid - stimulating hormone (tsh) secreted from the pituitary gland, the levels of this hormone are expected to be low in the above case. however tsh levels were found to be very high in nephrotic syndrome and the increase in tsh correlates well with the degree of proteinuria. this leads to the possibility that significant amounts of thyroid hormones are also lost in proteinuric states resulting in a total body negative balance. in situations of long standing heavy proteinuria, it results in clinically significant hypothyroidism. whether the hypothyroidism of nephrotic syndrome remains an innocent bystander or plays an active part in the further course of the disease is yet to be understood. in most glomerular diseases, the renal injury is largely initiated by immunological mechanisms. however, once the injury is inflicted, subsequent progression to glomerulosclerosis and renal failure is mediated by nonimmunological factors like intraglomerular and systemic hypertension, tubuloglomerular feedback, glomerular hypertrophy and hyperfiltration, proteinuria, hyperlipidemia, and presence of extra renal disease. in recent years, researchers have been looking at reactive oxygen species (ros) or oxidative stress as mediators of progressive glomerular injury [24 ]. renal sources of ros are activated macrophages, vascular cells, and various glomerular cells. ros may affect cells of the host organism, especially at sites of inflammation, in addition to playing a role in the defence system against other agents. the effect plays a role in a variety of renal diseases such as glomerulonephritis and tubulointerstitial nephritis, which can contribute to porteinuria and other conditions. ros are also thought to contribute to the pathogenesis of ischemia reperfusion injury in the kidney [5, 6 ]. conversely, the kidney is not only an organ for metabolism and elimination of th but also a target organ of some of the iodothyronines ' actions. thyroid dysfunction causes remarkable changes in glomerular and tubular functions and electrolyte and water homeostasis. hypothyroidism is accompanied by a decrease in glomerular filtration, hyponatremia, and an alteration of the ability for water excretion [79 ]. hypertension, diabetes, and proteinuria are well - recognized risk factors for progressive kidney function loss. however, despite excellent antihypertensive and antidiabetic drug therapies, which also often lower urinary protein excretion, there remains a significant reservoir of patients with chronic kidney disease who are at high risk for progression to end - stage kidney disease. in order to ascertain whether the hypothyroidism of nephrotic syndrome has any role to play in glomerulosclerosis, we decided to estimate the thyroid hormone levels and markers of oxidative stress in patients with nephrotic syndrome, those in complete or partial remission and in healthy control subjects. we also tried to evaluate the correlation between oxidative stress and thyroid function in patients with the nephrotic syndrome in the remission phase as well as in a persistent proteinuric state (figure 1). the present study was carried out in the radiation medicine centre, bhabha atomic research centre (barc), mumbai, in collaboration with the department of nephrology, king edward vii memorial hospital (kem), parel, mumbai. a total of 80 subjects were enrolled in the study of whom 60 patients included in the patients were either in complete remission or had persistent proteinuria at the time of the study and 20 normotensive, nonproteinuric, healthy individuals formed the control group. the inclusion criteria were (a) age between 12 and 50 years, (b) documented nephrotic syndrome (defined as proteinuria of more than 3.5 gm/24 hr/1.73 m and (c) body surface area or any proteinuria associated with significant hypoalbuminemia, defined as serum albumin less than 2.5 gm / dl) at the time of enrolment to the study. regrouping of the 80 subjects, based on their 24-hour urinary protein excretion, the subjects were divided into four groups, control (0.15 gms/24 h), remission (0.09 0.03 gms/24 h), subnephrotic (1.22 0.90 gms/24 h) and nephrotic (5.07 1.36 gms/24 h). both the patient and the control groups underwent a detailed study of history recording followed by complete physical examination with the purpose of ruling out secondary causes of glomerulonephritis and evidence of any systemic illness or infective focus. nephrotic syndrome occurring as a part of systemic disease such as diabetes mellitus, active infection, sepsis, smoking, alcoholism, and drug abuse and patients who had received steroids or immunosuppressant drugs within the 6-month period before enrolment were included the study. we studied thyroid function and estimated (a) tri - iodothyronine (t3), (b) thyroxine (t4) by radioimmunoassay (ria), and (c) thyroid - stimulating hormone (tsh) by immunoradiometric assay (irma) using in - house methods for t3 and t4 assays and brit kits for tsh. estimation of lipid peroxidation (lpx) and antioxidant enzymes (superoxide dismutase (sod), glutathione peroxidase (gpx), and catalase) in serum samples was as follows. malondialdehyde content, the end product of the free radicals initiating lipid peroxidation, was measured by using thiobarbituric acid reactivity as described by uchiyama and mihara. sod was measured by the method of s. marklund and g. marklund as modified by nandi and chatterjee. catalase degrades hydrogen peroxide, which can be determined by the decrease in absorbance at 240 nm in a spectrophotometer. all the parameters of antioxidant enzymes and lipid peroxidation are summarized in table 1, and bar graphs in figure 2 depict the parameters of oxidative stress in nephrotic syndrome. the serum lpx levels the were lowest in the remission and subnephrotic groups with significantly maximum value in the nephrotic group. serum gpx was significantly higher in all the three groups in comparison to control group. the serum sod levels were significantly lower in the subnephrotic and nephrotic groups in comparison to control group, and also catalase levels were significantly higher in all three groups in comparison to control with the minimum value in the nephrotic group. the estimates of tt3, tt4, and tsh are summarized in table 2. as can be seen in table 2, tt3 and tt4 levels were significantly lower and tsh was significantly higher in nephrotic syndrome than control group. all results are expressed as the mean sd. the data between control and test groups was compared using unpaired student 's t - test. the balance of reduction and oxidation (redox) of free radicals in the body is important to maintain health. the data suggest that the endogenous antioxidant enzymes serve as a mechanism of self - defense to prevent glomerular injury. superoxide dismutase enzyme is involved in catalyzing superoxide anion - free radical to produce hydrogen peroxide and singlet oxygen. we have observed the decrease in sod activity in nephrotic syndrome patients because superoxide anion produced during normal metabolic process could not be completely scavenged by the sod. it is quite possible that it may accumulate and cause the initiation and propagation of lipid peroxides. a decreased production of h2o2 would result in increased activity of catalase enzymes since hydrogen peroxide is hydrolyzed by catalase. both superoxide free radical and hydroperoxides can be generated within cells and could cause irreversiblility in activation of gsh peroxidase. gsh peroxidase functions to metabolize h2o2 created in the dismutation of superoxide radical and protects cell membranes for lipid peroxidation. the serum levels of thyroid hormones were significantly lower in nephrotic patients compared to control, while the serum tsh levels were significantly higher as expected due to pituitary 's response to the decreased hormone levels. nephrotic syndrome is accompanied by changes in the concentrations of th due primarily to loss of protein in the urine. acute kidney injury and chronic kidney disease are accompanied by notable effects on the hypothalamus - pituitary - thyroid axis. finally, data from a recent research suggest that th, especially t3, can be considered as a marker for survival in patients with kidney disease. there is a concomitant statistically significant decrease in circulation of t4 and t3 levels and increase in serum tsh. the nature and severity of the original insult may possibly play role in contributing to the oxidative stress associated with nephrotic syndrome. other than the decrease in thyroid function due to nephrotic syndrome (a form of nonthyroid illness), loss of thyroid - hormone - binding proteins in urine could be another cause of the decrease in serum t3 and t4 levels. bulucu. have studied the oxidative stress status in adult nephrotic syndrome by determining plasma selenium levels, erythrocyte and plasma gpx activities, erythrocyte cu - zn sod, and erythrocyte and plasma levels of malondialdehyde (mda). the 20 nephrotic syndrome patients had lower activities of sod compared to controls, while erythrocyte and plasma levels of mda were higher in the nephrotic syndrome groups. zachwieja.studied the total antioxidant status and mean antioxidant activity in 82 children with nephrotic syndrome of 416 years. the study suggested that reduced antioxidant activity in nephrotic syndrome may be related to lipid abnormalities. examined the antioxidant status of 18 children with steroid sensitive nephrotic syndrome. in their study, the authors concluded that the majority of abnormal findings can be attributed to the hyper lipidemia of nephrotic syndreme (ns). another study estimated the antioxidant status and reliable factor involved in antioxidant protection in children with nephrotic syndrome. the study suggested an increase in lipid peroxidation and insufficient antioxidant defense in nephrotic syndrome. the author concluded that, during remission, there is a tendency for the gsh - gssg redox system to normalize. reported that abnormalities in thyroid function are seen in patients with proteinuria. specifically, tsh levels were higher in patients with proteinuric renal diseases when compared with controls. adlkofer. examined the thyroid function of 13 patients with proteinuria and normal serum creatinine level (group 1) and 15 patients with proteinuria and increased creatinine level (group 2). the daily urinary t4 and t3 excretion was much higher in group 1 patients than in group 2 patients (37.1 25.9 nmol versus 17.5 8.7 nmol for t4 and 3.3 1.6 nmol versus 1.1 0.8 nmol for t3, resp.) and correlated in both groups with the protein loss. feinstein. showed that the reduced serum levels of tt4 and tt3 in these patients may be due to decreased binding to and/or concentration of serum carrier proteins, and, as in acute and chronic renal failure, patients with nephrotic syndrome with normal renal function have normal total and increased free rt3 values in association with reduced tt3 levels. hypothyroidism is also known to be accompanied by a decrease in glomerular filtration, hyponatremia, and an alteration of the ability for water excretion, which may indirectly reduce loss of protein through urine [79 ]. in hypothyroidism, thyroid hormone levels are very low, which suggests the possible direct involvement of free radical scavengers and lipid peroxidation. increased glutathione peroxidase activity could be a compensatory mechanism in response to increased oxidative stress [25, 26 ]. proteinuria results in loss of thyroid hormones, most probably caused by loss of thyroxine - binding globulin along with t4 bound to it, thus stimulating tsh production. our data suggests that nephrotic syndrome patients may benefit from antioxidant therapy along with thyroid hormone supplement. | background. the present study is to look for a correlation between oxidative stress and thyroid function in patients with the nephrotic syndrome in the remission phase as well as in a persistent proteinuric state. introduction. nephrotic syndrome is a form of chronic kidney disease due to which blood loses protein through the urine. we wanted to know if there was an increased loss of thyroid hormones in urine affecting thyroid function. methods. 60 patients with nephrotic syndrome and 20 healthy non - proteinuric individuals as control subjects were enrolled in the study. we measured their serum tri - iodothyronine, thyroxine and thyroid - stimulating hormone. estimation of lipid peroxidation (lpx) catalase, superoxide dismutase (sod), and glutathione peroxidase (gpx) were carried out by standard methods. results. tsh was elevated in the nephrotic patients compared to controls, while tt4 and tt3 were significantly lower in the patients than in controls. lipid peroxidation and gpx were significantly higher in the nephrotic syndrome patients than in the controls, while sod and catalase were significantly lower than in patients than in the control subjects. conclusion. nephrotic patients can lose significant amounts of thyroid hormones along with protein in urine, which can affect thyroid status, but this is reversible on remission. |
a 43-year - old woman, with no significant previous medical history, was admitted due to fever, chills, and headache which she had been experiencing for the past several days. her laboratory work showed a cell count of 20 /l with 38% neutrophils on cerebrospinal fluid analysis, and elevated levels of serum troponin i (11.59 ng / ml) and creatine kinase - mb (17.6 ng / ml). her transthoracic echocardiography (tte) showed severe rheumatic aortic stenosis (as) with mild aortic regurgitation (ar) and a normal left ventricular (lv) systolic function. we needed a complete tee for further evaluation, but the patient refused the examination. eventually, a diagnosis of infective endocarditis was made via tte finding with clinical correlation. when the patient was admitted, an antibiotic therapy was performed for the control of infection. brain magnetic resonance imaging showed multiple embolic infarctions in the frontal, parietal lobe and left corpus callosum. after 5 days of antibiotic treatment under the suspicion of ie, subsequent atrial flutter and acute pulmonary edema developed. serum troponin i (48.14 ng / ml) and creatine kinase - mb (81.3 ng / ml) were elevated more compared to the results at the admission. an emergent aortic valvuloplasty was decided. intraoperative tee examination confirmed severe as and relatively fresh 1.5 cm vegetation on lcc of the av with frequent diastolic prolapse into the aortic root (fig. 2), but it did not cause cardiac failure ; the ejection fraction (ef) was 55 % by modified simpson 's method. tee showed the vegetation to be in good position across the av (video 1 and 2). the surgeon confirmed the state of av as severe commissural fusion, severe thickening with relatively fresh 1.5 cm vegetation, and left coronary ostium partial occlusion by the vegetation. the patient was weaned from cpb without any hemodynamic instability or changes in st segment on electrocardiography (ecg). the patient 's cardiac output was 4.0 - 5.4 l / min and cardiac index was 2.3 - 3.1 l / min / m, and there was no change in st segment of 12-lead ecg immediately after the operation in the intensive care unit. the cardiologist confirmed well - functioning of prosthetic mechanical av and akinesia of apical cap with normal lv ef (59%) via tte. nonetheless, the anesthesiologist should consider the possibility of coronary compression due to periannular aortic valve abscess and pseudoaneurysms, and coronary embolism or obstruction of the coronary ostium due to the vegetation, to be able to make the diagnosis using tee when the patients with ie present acute hemodynamic disturbance, sign of acs, or myocardial ischemia. the patient in this study could have been diagnosed as acs, because of the angina, high serum troponin i (48.14 ng / ml), and creatine kinase - mb (81.3 ng / ml) occurring during the early phase. however, there was no evidence of rwma in the intraoperative tee. we assumed that the vegetation prolapsed into the left coconary ostium, and that it induced a partial occlusion of the left coronary ostium and a spontaneous escape of the vegetation from the ostium. the major echocardiographic findings for the diagnosis of ie are vegetation, abscess, and new dehiscence of prosthetic valve. the vegetation is the most important lesion for the diagnosis of ie, and an oscillating mass attached to valvular structure is a typical characteristic of vegetation. another major echocardiographic finding for endocarditis is the perivalvular abscess, which is presented by reduced echo density without color flow detected inside. the patient was diagnosed as ie due to presence of the oscillating vegetation on av, but there was no abscess formation. vegetation may cause direct occlusion of the coronary artery, especially in the case of av vegetation. the anesthesiologist should check both the left and right coronary ostia via midesophageal (me) short - axis view of the aortic valve, and the right coronary ostium via an me long - axis view. if the vegetation is large (> 10 mm) and movable or fragile, it can increase the incidence of embolism. another cause of coronary embolism is lv mural thrombi which can be seen in a spontaneous echo contrast. spontaneous echo contrast is definitive sign of slackened blood flow which is considered as a prothrombotic condition. a thrombus shows well - defined margins and discrete echo dense mass throughout systole and diastole. echocardiographic contrast perfusion imaging may be useful in confirming the vascularity of cardiac masses and in differentiating the vascular tumors from benign tumors and thrombi. in the rare cases of myocardial ischemia associated with coronary obstruction due to the vegetation in ie patients, echocardiographic findings may present a new rwma, although there was no rwma in our case. the tee is helpful for finding the etiology in the patient with ie, who is presented with acs, and the management of the complication can be different according to the mechanisms. furthermore, the intraoperative tee could present the unknown or new lesions that were not discovered by the preoperative tte, although the new findings from tee may not affect the method of the operation. midesophageal short - axis view of aortic valve. relatively fresh 1.5 cm vegetation on the left coronary cusp of the aortic valve is prolapsing into the left coronary ostium during diastole and partially occluded left coronary ostium. unfortunately, the video clip associated with the disturbance of the coronary circulation was not recorded, but there is no evidence for obstruction of coronary circulation or left ventricular wall motion abnormality. la ; left atrium, ra ; right atrium, lco ; left coronary ostium. midesophageal long - axis view of aortic valve. as noted in the still image, the vegetation attached on the left coronary cusp of the aortic valve is frequently prolapsing into the aortic root during diastole. lv ; left ventricle, lcc ; left coronary cusp, rcc ; right coronary cusp. | a 43-year - old woman was admitted due to fever, chills, and headache for several days and was diagnosed as infective endocarditis. intraoperative transesophageal echocardiography (tee) examination confirmed severe aortic stenosis and showed relatively fresh 1.5 cm vegetation on the left coronary cusp of the aortic valve (av) with frequent diastolic prolapse into the aortic root. this mobile vegetation partially occluded left coronary ostium, but it did not cause cardiac failure. tee showed the vegetation to be in good position across the av. the av replacement with removal of vegetation and mitral valvuloplasty were performed. the patient was weaned from cardiopulmonary bypass without any hemodynamic instability or changes in st segment on electrocardiography. she was discharged on the 28th postoperative day without any complication. |
six rnase - free, hplc - purified 5-phosphorylated mirna oligoribonucleotides were synthesized (integrated dna technologies) for the analytical portion of this study, corresponding to hsa - mir-16 (5-phospho - uagcagcacguaaauauuggcg - oh-3), hsa - mir-141 (5-phospho - uaacacugucugguaaagaugg - oh-3), hsa - mir-135b (5-phospho - uauggcuuuucauuccuauguga - oh-3), hsa - mir-205 (5-phospho - uccuucauuccaccggagucug - oh-3), hsa - mir-210 (5-phospho - cugugcgugugacagcggcuga - oh-3) and hsa - mir-375 (5-phospho - uuuguucguucggcucgcguga - oh-3). stock solutions of 10 m synthetic oligonucleotide in rnase - free / dnase - free water were prepared according to the concentrations and sample purity quoted by the manufacturer (based on spectrophotometry analysis). to minimize uncertainty resulting from pipetting, all dilutions where the volumetric dilution factor exceeded 2 (see supplementary table 1, dilutions 14) were performed on an analytical balance, such that the predicted copies going into the standard curves could be accurately scaled using a gravimetric dilution factor. all further dilutions for the standard curve (supplementary table 1, dilutions 511) were performed volumetrically. approximately 55,000 copies per 20 l pcr reaction with nine intermediate twofold serial dilutions and additional no template controls (ntcs ; zero copies) were examined. dilution series for each of the synthetic mirnas were made in either rnase / dnase - free h2o or in healthy human donor plasma rna solution to provide a constant background of endogenous mirnas. our modified procedure used for isolating mirnas from plasma with mirneasy kits (qiagen) has been described previously. to ensure a homogenous plasma rna solution for use as diluent, multiple plasma rna extraction batches collected using this protocol were pooled and mixed by gentle pipetting, then divided into 60-l aliquots and stored at 80 c until use. rt of input mirnas (supplementary table 1, dilutions 511) was conducted using reagents from the taqman mirna reverse transcription kit and 60 target - specific rt primers (both from applied biosystems, inc.). the kit contains the following components that, together with the stem - loop primers and rnase / dnase - free h2o, comprise what is forthwith referred to as rt mix (numbers in parentheses are final volumes in a 10-l rt reaction containing 8 l rt mix) : 10 rt buffer (1 l), rnase inhibitor (0.12 l), 100 mm each dntp (0.1 l), multiscribe reverse transcriptase (0.66 l), 60 rt primer (0.17 l), rnase / dnase - free h2o (5.95 l). the volumetric ratio of rt mix to input mirna solution was 4:1, and triplicate 10 l rt reactions (supplementary fig. 1) for each point of the curves were taken from a corresponding well - mixed stock solution of a given concentration (34 l total volume ; 7 l input mirna). the reverse transcription thermal - cycling procedure for triplicate 10 l rts used holds at 16 c for 30 min, then 42 c for 30 min and 85 c for 5 min (tetrad2 peltier thermal cycler ; bio - rad). 7 l of rt product for each concentration was thoroughly mixed by pipette resuspension with 133 l solutions containing master mix (bio - rad, 70 l of 2 mix), the target - specific taqman real time pcr primer probe set (applied biosystems, 2.33 l of 60 solution) and rnase / dnase - free h2o (60.67 l). from this bulk solution, triplicate pcr reactions were carried out using both ddpcr (20 l pcr reaction) and real - time pcr (5 l pcr reaction), such that both ddpcr and real - time pcr reactions had identical concentrations of synthetic mirna oligonucleotides. real - time pcr experiments were performed on an applied biosystems viia 7 instrument with the following thermal - cycling procedure ; 95 c for 10 min, followed by 40 cycles of 95 c for 15 s and 60 c for 1 min (1.6 c / s ramp rate) as specified in the taqman microrna assay protocol provided by the manufacturer (applied biosystems). to provide the best possible analysis of the raw real - time pcr data for comparison to ddpcr, real - time pcr data collected in this manner were analyzed with the viia 7 instrument software v1.0 using three separate conventional approaches and compared side by side to deduce which method gave the lowest variability (data not shown). when using the first method, we examined the effect of using a universal baseline and threshold to aid data consistency across the study. the baseline was set between 8 cycles and 20 cycles (to base this on the background signal found in early cycles of amplification) with a manual fluorescence threshold of 20,000 relative fluorescence units (rfus) with rox (carboxy - x - rhodamine passive reference dye) normalization disabled (ddpcr master mix does not contain rox dye). in the second method, the threshold was manually set by the operator to exclude spurious noise and intersect the exponential amplification portion of the fluorescence curve as centrally as possible. the third method used the viia 7 signal processing algorithm to automatically call baseline and threshold, with rox normalization disabled. method 3 was found to give the lowest variability between pcrs, and therefore this method was used for analysis of all data derived from real - time pcr analysis of ddpcr reaction mixtures. note that data derived from the standard real - time pcr protocol (i.e., used to analyze clinical specimens) was analyzed using its corresponding data analysis procedure, which was identical to method 3 above with the exception of inclusion of rox normalization. curves that did not show typical exponential amplification morphology were included in the presentation of the whole data (fig. 2) but were excluded from subsequent summary operating characteristic and statistical analysis (supplementary figs. 36 and supplementary tables 25) to provide the best possible estimate of real - time pcr performance. undetermined cycle thresholds were arbitrarily set to 40 as a limiting estimate of the maximum possible abundance of target. target abundance relative to the mean of highest concentration tested was determined by pfaffl analysis of the cycle - threshold (ct) data, using the empirically determined pcr efficiency for each mirna. in the case of the standard curves generated for the analysis of clinical specimens, limit of quantification (loq) was defined as the lowest concentration tested that remained above or equal to the lower limit of linear range of the assay (lllr) and above or equal to the limit of detection (lod). linear range was determined by runs - testing, removing successive dilution points until the p value was > 0.05, indicating no significant deviation from linearity (prism version 5.0c software). lod was defined as bi + ksbi, where bi equals the mean of the no - template controls, sbi is s.d. of no - template controls, and k = 2.479 (99% confidence interval). the ddpcr system, workflow, operating characteristics and analytical performance has been recently described in detail by some of the authors of this paper in two recent publications, but a brief summary of this technology follows. at the start of these studies, the instrument and reagents used were manufactured by quantalife, inc., which was subsequently acquired by bio - rad, inc. each 20 l pcr reaction (see above) was loaded into an 8-channel, single - use consumable droplet generation cartridge. 60 l of oil containing emulsion - stabilizing, biocompatible surfactant was loaded into adjacent oil wells, and the microfluidic chip was loaded into a beta - series prototype droplet generator (dg). the dg applies a vacuum to the outlet well creating a pressure difference across the cartridge that simultaneously partitions the sample present in each of the 8 wells into 20,000 monodisperse droplets of accurately known volume. the resulting water - in - oil emulsions were pipette - transferred from the outlet well to a 96-well polypropylene plate (eppendorf), sealed with foil and then amplified to endpoint using a tetrad2 peltier thermal cycler (bio - rad) and the cycling protocol : 95 c for 10 min then 40 cycles of 95 c for 15 s and 60 c for 1 min (2.5 c / s ramp rate) with a final 10 min hold at 98 c. plates containing amplified droplets were loaded into an early - access, beta - version of the commercially available qx100 droplet reader (bio - rad), which aspirates droplets from the 96-well plate, one well at a time, and streams them single - file (1,500 droplets / s) past a two - color fam / vic (fam and vic fluorescence dyes, life technologies corp.) discrimination between droplets that did not contain target (negatives) and those that did (positives) was achieved by applying a global fluorescence amplitude threshold. for all of the mirna assays, the global fluorescence threshold was set at 4,000 relative fluorescence units (rfus) regardless of the assay efficiency. concentration estimates () were based on the fraction of droplets where amplification has occurred (p) modeled as a poisson distribution (equation (1)). because each droplet is an independent pcr reaction vessel of equal and defined volume, the droplets of technical replicates (triplicate wells) can be pooled to create a metawell. to compute total 95% confidence intervals about concentration estimates of metawells (comprised of previously described poisson 95% cis and real world error ; concentration differences between wells) we applied the following meta - analysis techniques. given k replicates with concentrations m1, m2, mk and poisson variances v1, v2, vk, respectively, we define the weight (w) of replicate i as reciprocal of its variance as let m be the weighted average of concentrations and consider the following random variable that measures fluctuation of concentrations around this weighted mean : this is the sum of squares of approximately standard normal random variables and can therefore be approximated as a chi - squared distribution. the mean of the distribution is the number of degrees of freedom (df = k 1). if t is less than df, we say that there is no additional real - world variance. if t is more than df, then it suggests there is additional real - world variance r = t df. as t is based on standard normal variables, we scale back r to r in original units after applying an appropriate correction factor : we can add r to poisson variance to give total variance for each replicate. we redefine the weight of each replicate as : from which we can compute the total uncertainty around the metawell as the final estimate m is recomputed as weighted average of concentrations with new weights. by setting r to 0 this meta - analysis is a statistically rigorous method to test the existence of real - world error in a group of replicate droplet digital pcr wells (us patent application 20130017551). all of these data - analysis methods are implemented in the quantasoft (1.1.1.0) data analysis package, installed with the droplet reader. human serum samples from individuals with metastatic prostate cancer and prostate - cancer negative controls were collected after written informed consent was obtained. all participants signed a university of washington human subjects committee approved informed consent form for a peripheral blood draw and the research was approved and supervised by the university of washington and fred hutchinson cancer research center institutional review boards. prostate - cancer negative donors were recruited among individuals undergoing screening for prostate cancer and found to be negative by digital - rectal examination (dre) and serum psa analysis. individuals with metastatic prostate cancer were recruited among previously diagnosed patients undergoing treatment at the university of washington (seattle). a smaller cohort of clinical specimens corresponding to n = 20 advanced prostate cancer cases and n = 20 healthy controls was analyzed (previously, n = 25 each group). the patient specimens studied here were distinct from (not a subset of) those we studied previously. using the population - variance data from the previous study, we performed a power calculation and determined that n = 12 individuals per group would result in 81% power to detect a difference in means of fourfold (alpha = 0.05, two tails). we chose to analyze specimens from n = 20 individuals per group, as this was above the minimum predicted by the power calculation, feasible and simplified the technical work relative to the previous study. the experimenter was kept blinded to case status (i.e., cancer versus control). for comparing the performance of ddpcr to real - time pcr in the clinical specimens synthetic mir-141 standard curves used in this portion of the study were made using ms2 carrier rna, which leads to improved circulating mirna precision in real - time pcr analyses and therefore was included to provide the best possible real - time pcr performance to compare with ddpcr. ddpcr showed superior precision (supplementary fig. 8), consistent with our results displayed in figure 1a, b and comparable limits of quantification (supplementary table 7) for mir-141 in the analyses of these standard curves. owing to limited serum rna volume for the large number of replicates needed for this study, we diluted the initial serum rna specimens by a factor of 1.5. to allow a direct comparison of performance between ddpcr (which uses bio - rad ddpcr supermix for probes, 186 - 3010) and standard circulating mirna real - time pcr (which uses abi taqman universal pcr mastermix no ung, 4326614), differences in the reagent volumes used between the bio - rad ddpcr and the standard circulating mirna real - time pcr protocols needed to be accommodated to achieve the same concentration of cdna in each comparable reaction across the methods (supplementary fig. 7). as a result of these necessary adjustments, the concentration of input cdna analyzed per reaction for both ddpcr and real - time pcr methods was ultimately about tenfold lower than that used previously. after reverse transcription, the cdnas corresponding to the sets of standard curves (supplementary fig. 8) and the 40 clinical specimens (fig. 2) were each split into six aliquots for subsequent pcr reactions (see below). three of these six cdna aliquots were added to abi master mix for subsequent real - time pcr, and the remaining three were added to bio - rad mastermix to conduct ddpcr and real - time pcr (fig. l ddpcr master mix for each sample was divided into three 20 l aliquots for analysis by ddpcr and three 5 l aliquots for analysis by real - time pcr. the prepared 20 l standard real - time pcr master mix for each sample was divided into 3 5 l aliquots for analysis by real - time pcr (fig. 2 and supplementary fig. 7). for the analysis of clinical specimens, ddpcr triplicates were combined into a single metawell before poisson analysis and recovery correction by caenorhabditis elegans recovery - yield mirna spike - ins. for real - time pcr, the concentration of analyte was calculated by ct comparison to the standard curve, and results were presented as the mean of the pcr triplicates corrected by c. elegans spike - ins. statistical significance was determined by mann - whitney analysis (95% confidence intervals, two tails) and receiver operating characteristic (roc) analysis was performed using prism 5.0c software. six rnase - free, hplc - purified 5-phosphorylated mirna oligoribonucleotides were synthesized (integrated dna technologies) for the analytical portion of this study, corresponding to hsa - mir-16 (5-phospho - uagcagcacguaaauauuggcg - oh-3), hsa - mir-141 (5-phospho - uaacacugucugguaaagaugg - oh-3), hsa - mir-135b (5-phospho - uauggcuuuucauuccuauguga - oh-3), hsa - mir-205 (5-phospho - uccuucauuccaccggagucug - oh-3), hsa - mir-210 (5-phospho - cugugcgugugacagcggcuga - oh-3) and hsa - mir-375 (5-phospho - uuuguucguucggcucgcguga - oh-3). stock solutions of 10 m synthetic oligonucleotide in rnase - free / dnase - free water were prepared according to the concentrations and sample purity quoted by the manufacturer (based on spectrophotometry analysis). to minimize uncertainty resulting from pipetting, all dilutions where the volumetric dilution factor exceeded 2 (see supplementary table 1, dilutions 14) were performed on an analytical balance, such that the predicted copies going into the standard curves could be accurately scaled using a gravimetric dilution factor. all further dilutions for the standard curve (supplementary table 1, dilutions 511) were performed volumetrically. approximately 55,000 copies per 20 l pcr reaction with nine intermediate twofold serial dilutions and additional no template controls (ntcs ; zero copies) were examined. dilution series for each of the synthetic mirnas were made in either rnase / dnase - free h2o or in healthy human donor plasma rna solution to provide a constant background of endogenous mirnas. our modified procedure used for isolating mirnas from plasma with mirneasy kits (qiagen) has been described previously. to ensure a homogenous plasma rna solution for use as diluent, multiple plasma rna extraction batches collected using this protocol were pooled and mixed by gentle pipetting, then divided into 60-l aliquots and stored at 80 c until use. rt of input mirnas (supplementary table 1, dilutions 511) was conducted using reagents from the taqman mirna reverse transcription kit and 60 target - specific rt primers (both from applied biosystems, inc.). the kit contains the following components that, together with the stem - loop primers and rnase / dnase - free h2o, comprise what is forthwith referred to as rt mix (numbers in parentheses are final volumes in a 10-l rt reaction containing 8 l rt mix) : 10 rt buffer (1 l), rnase inhibitor (0.12 l), 100 mm each dntp (0.1 l), multiscribe reverse transcriptase (0.66 l), 60 rt primer (0.17 l), rnase / dnase - free h2o (5.95 l). the volumetric ratio of rt mix to input mirna solution was 4:1, and triplicate 10 l rt reactions (supplementary fig. 1) for each point of the curves were taken from a corresponding well - mixed stock solution of a given concentration (34 l total volume ; 7 l input mirna). the reverse transcription thermal - cycling procedure for triplicate 10 l rts used holds at 16 c for 30 min, then 42 c for 30 min and 85 c for 5 min (tetrad2 peltier thermal cycler ; bio - rad). 7 l of rt product for each concentration was thoroughly mixed by pipette resuspension with 133 l solutions containing master mix (bio - rad, 70 l of 2 mix), the target - specific taqman real time pcr primer probe set (applied biosystems, 2.33 l of 60 solution) and rnase / dnase - free h2o (60.67 l). from this bulk solution, triplicate pcr reactions were carried out using both ddpcr (20 l pcr reaction) and real - time pcr (5 l pcr reaction), such that both ddpcr and real - time pcr reactions had identical concentrations of synthetic mirna oligonucleotides. real - time pcr experiments were performed on an applied biosystems viia 7 instrument with the following thermal - cycling procedure ; 95 c for 10 min, followed by 40 cycles of 95 c for 15 s and 60 c for 1 min (1.6 c / s ramp rate) as specified in the taqman microrna assay protocol provided by the manufacturer (applied biosystems). to provide the best possible analysis of the raw real - time pcr data for comparison to ddpcr, real - time pcr data collected in this manner were analyzed with the viia 7 instrument software v1.0 using three separate conventional approaches and compared side by side to deduce which method gave the lowest variability (data not shown). when using the first method, we examined the effect of using a universal baseline and threshold to aid data consistency across the study. the baseline was set between 8 cycles and 20 cycles (to base this on the background signal found in early cycles of amplification) with a manual fluorescence threshold of 20,000 relative fluorescence units (rfus) with rox (carboxy - x - rhodamine passive reference dye) normalization disabled (ddpcr master mix does not contain rox dye). in the second method, the threshold was manually set by the operator to exclude spurious noise and intersect the exponential amplification portion of the fluorescence curve as centrally as possible. the third method used the viia 7 signal processing algorithm to automatically call baseline and threshold, with rox normalization disabled. method 3 was found to give the lowest variability between pcrs, and therefore this method was used for analysis of all data derived from real - time pcr analysis of ddpcr reaction mixtures. note that data derived from the standard real - time pcr protocol (i.e., used to analyze clinical specimens) was analyzed using its corresponding data analysis procedure, which was identical to method 3 above with the exception of inclusion of rox normalization. curves that did not show typical exponential amplification morphology were included in the presentation of the whole data (fig. 2) but were excluded from subsequent summary operating characteristic and statistical analysis (supplementary figs. 36 and supplementary tables 25) to provide the best possible estimate of real - time pcr performance. undetermined cycle thresholds were arbitrarily set to 40 as a limiting estimate of the maximum possible abundance of target. target abundance relative to the mean of highest concentration tested was determined by pfaffl analysis of the cycle - threshold (ct) data, using the empirically determined pcr efficiency for each mirna. in the case of the standard curves generated for the analysis of clinical specimens, limit of quantification (loq) was defined as the lowest concentration tested that remained above or equal to the lower limit of linear range of the assay (lllr) and above or equal to the limit of detection (lod). linear range was determined by runs - testing, removing successive dilution points until the p value was > 0.05, indicating no significant deviation from linearity (prism version 5.0c software). lod was defined as bi + ksbi, where bi equals the mean of the no - template controls, sbi is s.d. of no - template the ddpcr system, workflow, operating characteristics and analytical performance has been recently described in detail by some of the authors of this paper in two recent publications, but a brief summary of this technology follows. at the start of these studies, the instrument and reagents used were manufactured by quantalife, inc., which was subsequently acquired by bio - rad, inc. each 20 l pcr reaction (see above) was loaded into an 8-channel, single - use consumable droplet generation cartridge. 60 l of oil containing emulsion - stabilizing, biocompatible surfactant was loaded into adjacent oil wells, and the microfluidic chip was loaded into a beta - series prototype droplet generator (dg). the dg applies a vacuum to the outlet well creating a pressure difference across the cartridge that simultaneously partitions the sample present in each of the 8 wells into 20,000 monodisperse droplets of accurately known volume. the resulting water - in - oil emulsions were pipette - transferred from the outlet well to a 96-well polypropylene plate (eppendorf), sealed with foil and then amplified to endpoint using a tetrad2 peltier thermal cycler (bio - rad) and the cycling protocol : 95 c for 10 min then 40 cycles of 95 c for 15 s and 60 c for 1 min (2.5 c / s ramp rate) with a final 10 min hold at 98 c. plates containing amplified droplets were loaded into an early - access, beta - version of the commercially available qx100 droplet reader (bio - rad), which aspirates droplets from the 96-well plate, one well at a time, and streams them single - file (1,500 droplets / s) past a two - color fam / vic (fam and vic fluorescence dyes, life technologies corp.) detector sampling at 100 khz. discrimination between droplets that did not contain target (negatives) and those that did (positives) was achieved by applying a global fluorescence amplitude threshold. for all of the mirna assays, the global fluorescence threshold was set at 4,000 relative fluorescence units (rfus) regardless of the assay efficiency. concentration estimates () were based on the fraction of droplets where amplification has occurred (p) modeled as a poisson distribution (equation (1)). because each droplet is an independent pcr reaction vessel of equal and defined volume, the droplets of technical replicates (triplicate wells) can be pooled to create a metawell. to compute total 95% confidence intervals about concentration estimates of metawells (comprised of previously described poisson 95% cis and real world error ; concentration differences between wells) we applied the following meta - analysis techniques. given k replicates with concentrations m1, m2, mk and poisson variances v1, v2, vk, respectively, we define the weight (w) of replicate i as reciprocal of its variance as let m be the weighted average of concentrations and consider the following random variable that measures fluctuation of concentrations around this weighted mean : this is the sum of squares of approximately standard normal random variables and can therefore be approximated as a chi - squared distribution. the mean of the distribution is the number of degrees of freedom (df = k 1). if t is less than df, we say that there is no additional real - world variance. if t is more than df, then it suggests there is additional real - world variance r = t df. as t is based on standard normal variables, we scale back r to r in original units after applying an appropriate correction factor : we can add r to poisson variance to give total variance for each replicate. we redefine the weight of each replicate as : from which we can compute the total uncertainty around the metawell as the final estimate m is recomputed as weighted average of concentrations with new weights. by setting r to 0 this meta - analysis is a statistically rigorous method to test the existence of real - world error in a group of replicate droplet digital pcr wells (us patent application 20130017551). all of these data - analysis methods are implemented in the quantasoft (1.1.1.0) data analysis package, installed with the droplet reader. human serum samples from individuals with metastatic prostate cancer and prostate - cancer negative controls were collected after written informed consent was obtained. all participants signed a university of washington human subjects committee approved informed consent form for a peripheral blood draw and the research was approved and supervised by the university of washington and fred hutchinson cancer research center institutional review boards. prostate - cancer negative donors were recruited among individuals undergoing screening for prostate cancer and found to be negative by digital - rectal examination (dre) and serum psa analysis. individuals with metastatic prostate cancer were recruited among previously diagnosed patients undergoing treatment at the university of washington (seattle). a smaller cohort of clinical specimens corresponding to n = 20 advanced prostate cancer cases and n = 20 healthy controls was analyzed (previously, n = 25 each group). the patient specimens studied here were distinct from (not a subset of) those we studied previously. using the population - variance data from the previous study, we performed a power calculation and determined that n = 12 individuals per group would result in 81% power to detect a difference in means of fourfold (alpha = 0.05, two tails). we chose to analyze specimens from n = 20 individuals per group, as this was above the minimum predicted by the power calculation, feasible and simplified the technical work relative to the previous study. the experimenter was kept blinded to case status (i.e., cancer versus control). for comparing the performance of ddpcr to real - time pcr in the clinical specimens synthetic mir-141 standard curves used in this portion of the study were made using ms2 carrier rna, which leads to improved circulating mirna precision in real - time pcr analyses and therefore was included to provide the best possible real - time pcr performance to compare with ddpcr. ddpcr showed superior precision (supplementary fig. 8), consistent with our results displayed in figure 1a, b and comparable limits of quantification (supplementary table 7) for mir-141 in the analyses of these standard curves. owing to limited serum rna volume for the large number of replicates needed for this study, we diluted the initial serum rna specimens by a factor of 1.5. to allow a direct comparison of performance between ddpcr (which uses bio - rad ddpcr supermix for probes, 186 - 3010) and standard circulating mirna real - time pcr (which uses abi taqman universal pcr mastermix no ung, 4326614), differences in the reagent volumes used between the bio - rad ddpcr and the standard circulating mirna real - time pcr protocols needed to be accommodated to achieve the same concentration of cdna in each comparable reaction across the methods (supplementary fig. 7). as a result of these necessary adjustments, the concentration of input cdna analyzed per reaction for both ddpcr and real - time pcr methods was ultimately about tenfold lower than that used previously. after reverse transcription, the cdnas corresponding to the sets of standard curves (supplementary fig. 8) and the 40 clinical specimens (fig. 2) were each split into six aliquots for subsequent pcr reactions (see below). three of these six cdna aliquots were added to abi master mix for subsequent real - time pcr, and the remaining three were added to bio - rad mastermix to conduct ddpcr and real - time pcr (fig. l ddpcr master mix for each sample was divided into three 20 l aliquots for analysis by ddpcr and three 5 l aliquots for analysis by real - time pcr. the prepared 20 l standard real - time pcr master mix for each sample was divided into 3 5 l aliquots for analysis by real - time pcr (fig. 2 and supplementary fig. 7). for the analysis of clinical specimens, ddpcr triplicates were combined into a single metawell before poisson analysis and recovery correction by caenorhabditis elegans recovery - yield mirna spike - ins. for real - time pcr, the concentration of analyte was calculated by ct comparison to the standard curve, and results were presented as the mean of the pcr triplicates corrected by c. elegans spike - ins. statistical significance was determined by mann - whitney analysis (95% confidence intervals, two tails) and receiver operating characteristic (roc) analysis was performed using prism 5.0c software. supplementary figure 1| detailed schematic diagram of workflow to determine ddpcr operating characteristics relative to real time pcr. standard curves were prepared by two -fold serial dilution (supplementary table 1) of synthetic mirna stock oligonucleotides into either water or plasma rna solution background matrices. each dilution series contained a no -template control (matrix only) as a final point. reverse transcription (rt) of each standard curve was performed in triplicate followed by triplicate analysis of each rt by both ddpcr and real time pcr. the gradient of shading in the plate row icons represents the standard curve concentration gradient. the same homogenous reaction mixture (cdna + mastermix + primers / probe) was used for ddpcr and real time pcr, thus affording an analysis - platform - specific comparison of the two methods. for each of the six mirnas studied here, the entire workflow including preparation of standard curves the graphs show side - by - side results generated from ddpcr and real time pcr analysis of dilution series of representative synthetic mirna oligonucleotides in water or plasma rna matrices. for each mirna, the results are organized by color, where each color represents one replicate (preparation) of the complete workflow outlined in supplementary figure 1 and shape represents pcr reactions de rived from individual rts (rt1 = circle, rt2 = square, rt3 = triangle). this amounts to nine pcrs per color for each point of the standard curve (1 preparation 3 rts 3 pcrs). ddpcr data is presented as absolute concentration measured (left -axis) and relative concentration normalized to the mean average of all data for dilution point 1 (right -axis). as absolute quantification is not possible by real time pcr, results are displayed as relative concentration normalized to the mean average of all data for dilution point 1 and transformed from cycle -threshold (ct) space to linear space by pfaffl -analysis utilizing the empirically determined pcr efficiency of each assay. relative (normalized) r esults between ddpcr and real time pcr analysis are therefore directly comparable on the graphs. the statistical parameters used to generate the box and whisker plots (gray) for the combined data were median (center line), 25 and 75 percentiles (box), 10 and 90 percentiles (whiskers). some clear outliers corresponding to failed replicate wells of real time pcr (e.g. mirna-135b plasma rna matrix) were excluded from subsequent computation of analytical figur es of merit given in supplemental figures 3 - 6 and supplemental tables 2 - 5. note : the obscured dilution response for mir -16 is because this mirna is present endogenously in plasma rna at levels above the maximum synthetic oligonucleotide input. coefficients of variation determined for both methods for each of the eleven oligonucleotide standard curve dilution points are displayed. coefficient of variation measured at the level of pcr (across -pcr % cv) was determined by calculating the s.d. within each set of pcr triplicates (n = 9), dividing each of these by their respective mean values and then expressing the result as the overall mean of these individual % cv estimates. % cv measured at the level of reverse transcription (across - rt % cv) was determined by calculating the s.d. across all pcr data derived from a set of rt triplicates (n = 3), dividing this by the corresponding mean and then expressing the result as the mean of these individual % cv estimates. % cv measured at the level of preparation (across - preparation % cv) was determined by calculating the s.d. across all the pcr data derived from the three preparative replicates, dividing the result by the corresponding mean and expressing this value. the data clusters consistently above the line of identity, showing consistently higher % cv in the case of real time pcr. note : % cv for real time pcr was calculated using linear - scale values (relative quantification) rather than ct values in order to be directly comparable to ddpcr % cv as ddpcr data is ou tput on a linear scale. therefore real time pcr % cv values displayed here are higher than if calculated using ct values. coefficient of variation at the level of pcr (across -pcr % cv) was determined by calculating the s.d. within each set of pcr triplicates (n = 9), dividing each of these by their respective mean values and then expressing the result as the overall mean and s.d. of these individual % % cv at the level of reverse transcription (across - rt % cv) was determined by calculating the s.d. across all pcr data derived from a set of rt triplicates (n = 3), dividing this by the corresponding mean and then expressing the result as the mean and s.d. of these individual % % cv at the level of prepar ation (across - preparation % cv) was determined by calculating the s.d. across all the pcr data derived from the three preparative replicates, dividing the result by the corresponding mean and expressing this value. note : % cv for real time pcr was calculated using linear - scale values (relative quantification) rather than ct values in order to be directly comparable to ddpcr % cv as ddpcr data is output on a linear scale. therefore real time pcr % cv values displayed here are higher than if calculated using ct v alues. supplementary figure 5| ddpcr shows consistently lower variation relative to real time pcr measured across - pcr, across - rt or across - preparation replicates (water matrix). mean % cv data from supplementary figure 2 presented in trendline format with ddpcr and real time pcr data plotted on opposing y -axes and a common x - axis. note : % cv for real time pcr was calculated using linear - scale values (relative quantification) rather than ct values in order to be di rectly comparable to ddpcr % cv as ddpcr data is output on a linear scale. therefore real time pcr % cv values displayed here are higher than if calculated using ct values. supplementary figure 6| ddpcr shows consistently lower variation relative to real time pcr measured across - pcr, across - rt or across - preparation replicates (plasma rna matrix). mean % cv data from supplementary figure 2 presented in trendline format with ddpcr and real time pcr data plotted on opposing y - axes and a common x - axis. note : % cv for real time pcr was calculated using linear - scale values (relative quantification) rather than ct values in order to be di rectly comparable to ddpcr % cv as ddpcr data is output on a linear scale. therefore real time pcr % cv values displayed here are higher than if calculated using ct values. supplementary figure 7| schematic illustrating the quantitative details of the workflow used in figure 2. rna was reverse transcribed as for analysis by ddpcr or a standard real time pcr method. individual cdna aliquots were prepared for analysis using ddpcr master mix or standard real time pcr master mix on each of three separate days. standard real time pcr master mix was analyzed only by real time pcr (these reagents are not compatible with ddpcr analysis). to enable appropriate quantitative comparison, the concentration of input rna (as cdna) for ddpcr and real time pcr was kept constant (i.e. cdna concentration input into the pcr corresponded to 0.01 l rna solution per l pcr reaction). supplementary figure 8| operating characteristics of ddpcr and real time pcr for measuring the circulating cancer biomarker mirna, mir-141. synthetic mirna oligonucleotide standard curves were prepared, reverse -transcribed and analyzed as described in methods and supplementary figures 2 and 7. results are presented as the concentration determined by poisson -metawell analysis of ddpcr triplicates or the mean concentration of three real time pcr replicates, respectively. supplementary table 1| dilution protocol used to produce the standard curves for mirnas (figure 1, supplemental figures 2 and 8) and their predicted concentration in a pcr reaction assuming 100% rt efficiency and an accurate known concentration of the synthetic mirna supplied by the vendor. supplementary table 2| coefficients of variation (% cv) for ddpcr and real time pcr (water matrix). coefficient of variation measured at the level of pcr (across -pcr % cv) was determined by calculating the s.d. within each set of pcr triplicates (n = 9), dividing each of these by their respective mean values and then expressing the result as the overall mean of the individual % cv estimates. % cv at the level of reverse transcription (across - rt % cv) was determined by calculating the s.d. across all pcr data derived from a set of rt triplicates (n = 3), dividing this by the corresponding mean and then expressing the result as the mean of these individual % cv estimates. % cv measured at the level of dilution series p reparation (across - preparation % cv) was determined by calculating the s.d. across all the pcr data derived from the three preparative replicates, dividing the result by the corresponding mean and expressing this value. reduction in cv was calculated as the difference between the real time pcr cv (cvrealtime) and ddpcr cv (cvddpcr) divided by the real time pcr cv and expressed as a percentage : reduction in cv = (cv real time cvddpcr)/(cvreal time). note : % cv for real time pcr was calculated using linear - scale values (relative quantification) rather than ct values in order to be directly comparable to ddpcr % cv as ddpcr data is output on a linear scale. therefore real time pcr % cv values displayed here are higher than if calculated using ct values. supplementary table 3| coefficients of variation (% cv) for ddpcr and real time pcr (plasma rna matrix). coefficient of variation measured at the level of pcr (across -pcr % cv) was determined by calculating the s.d. within each set of pcr triplicates (n = 9), dividing each of these by their respective mean values and then expressing the result as the overall mean of the individual % cv estimates. % cv at the level of reverse transcription (across - rt % cv) was determined by calculating the s.d. across all pcr data derived from a set of rt triplicates (n = 3), dividing this by the corresponding mean and then expressing the result as the mean of these individual % cv estimates. % cv measured at the level of dilution series p reparation (across - preparation % cv) was determined by calculating the s.d. across all the pcr data derived from the three preparative replicates, dividing the result by the corresponding mean and expressing this value. reduction in cv was calculated as the difference between the real time pcr cv (cvreal time) and ddpcr cv (cvddpcr) divided by the real time pcr cv and expressed as a percentage : reduction in cv = (cv real time cvddpcr)/(cvreal time). note : % cv for real time pcr was calculated using linear - scale values (relative quantification) rather than ct values in order to be directly comparable to ddpcr % cv as ddpcr data is output on a linear scale. therefore real time pcr % cv values displayed here are higher than if calculated using ct values. operating characteristics based on ddpcr and real time pcr analysis of synthetic mirna oligonucleotides (water matrix). limit of quantification (loq) was defined as the lowest concentration tested that remained above or equal to the limit of detection (lod) and above or equal to the lower limit of linear range of the assay (lllr). lod was defined as = bi + ksbi, were bi = mean of the no - template controls, sbi = standard deviation of no - template controls, k = 2.479 (99% confidence interval). lod determinations here are likely to be biased in favor of real time pcr, as undetermined cts are set uniformly to 40, artificially lowering sbi estimates for real time pcr. lllr was determined by runs - testing, removing successive lowest dilution points until the p - value was > 0.05, indicating no significant deviation from linearity. supplementary table 5| operating characteristics based on analysis of synthetic mirna oligonucleotides (plasma rna matrix). limit of quantification (loq) was defined as the lowest concentration tested that remained above or equal to the limit of detection (lod) and above or equal to the lower limit of linear range of the assay (lllr). lod was defined as = bi + ksbi, were bi = mean of the no - template controls, sbi = standard deviation of no - template controls, k = 2.479 (99% confidence interval). lod determinations here are likely to be biased in favor of real time pcr as undetermined cts = 40, artificially lowering sbi estimates for real time pcr. lllr was determined by runs - testing, removing successive lowest dilution points until the p - value was > 0.05, indicating no significant deviation from linearity. note : operating characteristics for mir-16 could not be determined in plasma rna matrix, as the endogenous abundance of mir -16 in plasma rna is higher than the maximum concentration of synthet ic oligonucleotide examined. the mean average of the number of copies detected across all ddpcr data for a given mirna at the 250 -copy input dilution were divided by the predicted 250 input copies and expressed as a percentage. supplementary table 7| operating characteristics of ddpcr and real time pcr for mir -141 measurement. lod determinations here are likely to be biased in favor of real time pcr as uniformly setting undetermined cts = 40 would artificially lower sbi estimates for real time pcr as previously described. supplementary table 8| day - to - day variability of mir-141 quantification from clinical samples (ddpcr master mix analyzed by ddpcr and real time pcr). % cv : coefficient of variation calculated from replicates over 3 days (percentage). fold - change of % cv was calculated as the ratio of % cv for real time pcr results to % cv for ddpcr results. supplementary table 9| day - to - day variability of mir-141 quantification from clinical samples (ddpcr vs. standard real time pcr). % cv : coefficient of variation calculated from replicates over 3 days (percentage). fold -change of % cv was calculated as the ratio of % cv for real time pcr results to % cv for ddpcr results. | nanoliter - sized droplet technology paired with digital pcr (ddpcr) holds promise for highly precise, absolute nucleic acid quantification. our comparison of microrna quantification by ddpcr and real - time pcr revealed greater precision (coefficients of variation decreased by 3786%) and improved day - to - day reproducibility (by a factor of seven) of ddpcr but with comparable sensitivity. when we applied ddpcr to serum microrna biomarker analysis, this translated to superior diagnostic performance for identifying individuals with cancer. |
gastric carcinoma is the second most common cause of cancer - related death in iran. the most important advancement in the epidemiology of gastric adenocarcinoma is the identification of its relationship with helicobacter pylori infection which has been reported by several well - designed cohort studies. persistent h. pylori infection usually results in chronic gastritis followed by gastric atrophy, metaplasia, dysplasia, and subsequently malignancy. therefore, atrophic gastritis is an extremely important precancerous phenomenon and its early diagnosis is essential in order to stop its progress by performing prompt treatment and surveillance. atrophic gastritis is defined as a loss in the gastric glands that logically leads to a reduction in their productions. for instance, corpus and antral atrophy mainly affects pepsinogen i (p - i) and gastrin secretion, respectively. in addition, p - ii is released from all parts of the stomach and impacted wherever the atrophy occurs. recent studies have shown that decreased serum levels of these biomarkers may be valuable in screening for gastric atrophy. moreover, these serological methods are easy, inexpensive, and noninvasive compared to other routine methods such as endoscopy and histologic investigations. there is a well - known diversity in gastric cancer epidemiology between different geographical areas. for instance, the relative risk (95% ci) of gastric atrophy for gastric cardia cancer is 2.72 (1.67 - 4.44) and 3.07 (1.95 - 4.83) for studies from asia and europe / the usa, respectively. bearing in mind these differences, we hypothesized that the adequacy of serum biomarkers of gastric atrophy may also show geographical difference. to our knowledge, only two relevant studies had been conducted in iran. in the first, haj - sheykholeslami. concluded that the biomarkers are not useful for determining premalignant lesions, which contrasts with the general universal expectation. in the more recent study, nasrollahzadeh. investigated fundic atrophy and non - atrophic pan - gastritis and found the biomarkers as stable screening tests. these opposing findings clarify that the topic of serum biomarkers of gastritis is still a point of debate in the iranian population. therefore, this study aimed to investigate the diagnostic accuracy of serum biomarkers in detecting atrophic gastritis in iranian dyspeptic patients living in north - east iran. the patients were referred to the gastroenterology outpatient clinic of ghaem university hospital in mashhad, iran, during 2010. all the participants were dyspeptic patients in need of an upper endoscopic investigation and gastric biopsy. the use of proton pump inhibitors and h2 blockers were prohibited 1 week and 48 h before endoscopy, respectively. regarding the operative link for gastritis assessment (olga) proposal, five biopsy samples were taken from the greater and lesser curvatures of the distal antrum, the lesser curvature at the incisura angularis, and the anterior and posterior walls of the proximal corpus. the study was conducted according to the ethical standards committee of mashhad university of medical sciences, which complies with the provisions of the world medical association 's declaration of helsinki. mashhad university of medical sciences supported and financed the project (# 89083). informed consents were obtained from the study participants. endoscopic biopsy specimens were fixed in 10% formalin, embedded in paraffin, cut in serial sections, and stained with hematoxylin and eosin. the histologic examination was performed by a well - experienced pathologist as the gold standard method of detecting atrophy. the olga protocol was used to define and score the severity of atrophy. in olga staging, the atrophy could be either metaplastic or non - metaplastic. after fasting, 5 ml of blood was obtained from the brachial vein centrifuged, and serum samples were analyzed for gastrin 17 (g-17), p - i, p - ii, and anti - helicobacter antibody. all measurements were carried out using enzyme - linked immunosorbent assay kits purchased from biohit (helsinki, finland). the kolmogorov smirnov and levene tests were applied to verify normal distribution and the equality of variances, respectively. student t - test or its nonparametric counterpart (mann wittney u - test) was used to compare the mean among groups. receiver operating characteristic (roc) analysis was used to calculate the diagnostic indices and optimal cut - off values for g-17, p - i, p - ii, and p - i / ii ratio. all analyses were performed using spss v. 13 (spss inc, chicago, usa). the patients were referred to the gastroenterology outpatient clinic of ghaem university hospital in mashhad, iran, during 2010. all the participants were dyspeptic patients in need of an upper endoscopic investigation and gastric biopsy. the use of proton pump inhibitors and h2 blockers were prohibited 1 week and 48 h before endoscopy, respectively. regarding the operative link for gastritis assessment (olga) proposal, five biopsy samples were taken from the greater and lesser curvatures of the distal antrum, the lesser curvature at the incisura angularis, and the anterior and posterior walls of the proximal corpus. the study was conducted according to the ethical standards committee of mashhad university of medical sciences, which complies with the provisions of the world medical association 's declaration of helsinki. mashhad university of medical sciences supported and financed the project (# 89083). informed consents were obtained from the study participants. endoscopic biopsy specimens were fixed in 10% formalin, embedded in paraffin, cut in serial sections, and stained with hematoxylin and eosin. the histologic examination was performed by a well - experienced pathologist as the gold standard method of detecting atrophy. the olga protocol was used to define and score the severity of atrophy. in olga staging after fasting, 5 ml of blood was obtained from the brachial vein centrifuged, and serum samples were analyzed for gastrin 17 (g-17), p - i, p - ii, and anti - helicobacter antibody. whenever storing was necessary all measurements were carried out using enzyme - linked immunosorbent assay kits purchased from biohit (helsinki, finland). the kolmogorov smirnov and levene tests were applied to verify normal distribution and the equality of variances, respectively. student t - test or its nonparametric counterpart (mann wittney u - test) was used to compare the mean among groups. receiver operating characteristic (roc) analysis was used to calculate the diagnostic indices and optimal cut - off values for g-17, p - i, p - ii, and p - i / ii ratio. all analyses were performed using spss v. 13 (spss inc, chicago, usa). a total of 67 men (50.8%) and 65 women (49.2%) entered the study. the mean age (sd) of the study patients was 45.8 (15.8) years, ranging from 17 years to 82 years. histologic examination showed that 48 (36.4%) patients had atrophic gastritis, among which 22 had concurrent metaplasia, mostly in the antrum (81.8%). the antral atrophy and pan - atrophy (involving all parts of the stomach) were seen in 79.2% and 18.8% of the patients, respectively. only one patient (2.1%) the percentage of involved patients illustrated a decreasing trend as the olga stage increased (58.3%, 27.1%, 8.3%, and 6.3% in stages i, ii, iii, and iv, respectively). the average age of patients with atrophy was higher than that of patients without atrophy (53.7 years vs. 41.3 years, p = 0.001). the mean (sd) serum levels of g-17, p - i, p - ii, and the p - i / ii ratio were 13.1 6.1, 162.2 44.8, 22.0 10.6, and 9.2 5.7, respectively.. serum level of some markers according to different status of patients comparing the mean levels of serum biomarkers in atrophic and non - atrophic patients, there was no significant difference in p - i between the two groups, whereas the differences were significant for g-17, p - ii, and p - i / ii (p = 0.005, p = 0.02, and p = 0.04, respectively). patients with atrophy were significantly more affected with the infection (36 of 48, p = 0.0001). there was also a significant positive association between the severity of infection and atrophy (p = 0.001), as well as between the severity of infection and metaplasia (p = 0.035). in h. pylori negative patients, the mean (sd) serum levels of g-17, p - i, p - ii, and the p - i / ii ratio were 14.2 9.6, 161.6 42.4, 23.0 11.0, and 9.1 6.0, respectively. there were no significant differences between infected and non - infected patients in different serum biomarkers. moreover, there were no significant differences between infected and noninfected patients with atrophy in terms of different biomarkers. roc curves were drawn for g-17, p - i, p - ii, and p - i / ii ratio [figure 1 ]. the results of roc analysis and the corresponding diagnostic indices are summarized in table 2. receiver operating characteristic curves generated with gastrin 17 (line), pepsinogen ii (upper dashed line), and pepsinogen i / ii ratio (lower dashed line) for detecting gastric atrophy in dyspeptic patients summary of the receiver operating characteristic curve analysis for atrophy identification by the serum biomarkers patients with atrophy were significantly more affected with the infection (36 of 48, p = 0.0001). there was also a significant positive association between the severity of infection and atrophy (p = 0.001), as well as between the severity of infection and metaplasia (p = 0.035). in h. pylori negative patients, the mean (sd) serum levels of g-17, p - i, p - ii, and the p - i / ii ratio were 14.2 9.6, 161.6 42.4, 23.0 11.0, and 9.1 6.0, respectively. there were no significant differences between infected and non - infected patients in different serum biomarkers. moreover, there were no significant differences between infected and noninfected patients with atrophy in terms of different biomarkers. roc curves were drawn for g-17, p - i, p - ii, and p - i / ii ratio [figure 1 ]. the results of roc analysis and the corresponding diagnostic indices are summarized in table 2. receiver operating characteristic curves generated with gastrin 17 (line), pepsinogen ii (upper dashed line), and pepsinogen i / ii ratio (lower dashed line) for detecting gastric atrophy in dyspeptic patients summary of the receiver operating characteristic curve analysis for atrophy identification by the serum biomarkers in the studied population, there was a significant association between gastric atrophy and serum levels of p - ii, p - i / ii ratio, and g-17. cao., investigating 458 participants in china, found similar results regarding g-17 and p - i / ii, but not p - ii. on the contrary likewise, pimenov and coworkers from russia reported a negative correlation between the severity of gastric atrophy and serum p - i levels, as well as p - i / ii ratio. in two other studies, one by germana. from italy and the other by storskrubb. from sweden, the investigators reported p - i, p - ii, p - i / ii, and g-17 as powerful diagnostic tests for early detection of atrophy, which was in accordance with our results except for p - i serum level. the dissimilarity among these findings might be the result of differences in methods used for selection of participants and/or the possible differences in the severity of atrophy among the patients. most of the studies have reported that p - i serum level is associated with atrophy, which is in contrast with our results. this may be due to the small size of the participants with pan - atrophy or fundus / body - predominant atrophy in the current study. the only similar study conducted on iranian population is carried out by haj - sheykholeslami. in tehran, the capital of iran. they investigated 481 first - degree relatives of gastric cancer patients, as a high - risk population. they demonstrated that the patients with gastric atrophy had higher p - ii and lower p - i / ii levels compared to normal ones. nonetheless, p - i and g-17 were not significantly different between groups, except for a higher g-17 in patients with corpus atrophy. their study was mostly concentrated on gastric inflammation and corpus - predominant atrophy and metaplasia, whereas our study was mainly focused on antral atrophy. in fact, only one corpus - predominant and nine pan - atrophic specimens were present in the current study. in addition, their patients were asymptomatic relatives of gastric cancer patients, but our patients were all nonrelative dyspeptic patients from the general population. the overall accuracy of g-17, p - ii, and p - i / ii ratio in discriminating atrophic from non - atrophic specimens was 69%, 64%, and 66%, respectively. reported a sensitivity of 72% and a specificity of 67% in detecting intestinal metaplasia among participants, whereas in another study from japan, by ijima., high accuracy, sensitivity, and specificity (94%, 95%, and 93%, respectively) in discriminating atrophy have been reported. the higher diagnostic indices in the ijima 's study were possibly because of the more advanced technology used for the detection of the biomarkers serum levels. storskrubb. from sweden reported a sensitivity and specificity of 71% and 98%, respectively. in another study, zhang. from china reported that a combination of serum anti - helicobacter antibody, gastrin, and pepsinogen has a sensitivity and specificity of 87.5% and 100%, respectively. on the contrary, some researchers have found non - significant or weak results. among them is a study by ricci. from italy in which they reported that serum gastrin (total and g-17) and p - i and p - ii (and their ratio) are not able to discriminate patients without atrophy from those with antrum - predominant atrophic gastritis. likewise, colarossi. from peru demonstrated that none of the biomarkers could discriminate between patients with and without atrophy. these findings are in contrast with our results as well as most of other studies. this discrepancy is probably related to the selection of participants who have been chosen among asymptomatic patients. in another study by sita a very low sensitivity of about 20% was reported, which renders the biomarkers practically useless. regarding the studies from iran, including our study in mashhad and those by haj - sheykholeslami. in tehran, it appears that the sensitivities of g-17, p - ii, and p - i / ii in the iranian population are lower than that in other studies from different geographical areas (lower than 50%). thus, these biomarkers may not be adequate screening tests for practical purposes in the iranian population. in a more recent study from iran, nasrollahzadeh. they found p - i (sensitivity : 61.9%, specificity : 94.8%) and p - i / ii ratio (sensitivity : 75.0%, specificity : 91.0%) are useful in screening fundic atrophy. they also found that p - ii was 84.2% sensitive and 45.4% specific to distinguish non - atrophic pan - gastritis. the mean serum levels of all the studied biomarkers were higher than the expected levels provided by the manufacturer of the testing kit. this difference may be due to nutritional or genetic differences between iranian and the manufacturer 's population. moreover, all of our patients had gastric inflammation which has a positive effect on serum levels of these biomarkers, as indicated by haj - sheykholeslami. there was a high prevalence of h. pylori infection (> 50%) among dyspeptic patients, which was in accordance to the results of other studies. however, the prevalence reported by cao and colleagues from china was much higher (> 85%), which may be partly related to their investigated subjects who were patients with ulcer, gastric atrophy, or cancer. the prevalence of h. pylori infection among atrophic patients in the current study was about 80%, which is similar to the cao. there was also a significant positive relationship between the stage of metaplasia or atrophy and the severity of h. pylori infection. p - i, p - ii, p - i / ii ratio, and g-17 are potential serologic biomarkers for screening atrophic gastritis, but convincing evidence is not still available to support their routine clinical use among the iranian population. | background : gastric carcinoma is the second most common cause of cancer - related death in iran. it is well - known that atrophic gastritis is a major risk factor for gastric cancer, which leads to variations in the serum levels of gastrin 17 (g-17), pepsinogen i (p - i), and pepsinogen ii (p - ii). the aim of this study was to investigate the diagnostic accuracy of these serum biomarkers in the early detection of atrophic gastritis.materials and methods : a total of 132 dyspeptic patients underwent upper endoscopy and biopsies were taken. the biopsy specimens were evaluated as the gold standard according to operative link for gastritis assessment staging system. serum levels of g-17, p - i, and p - ii were investigated using enzyme - linked immunosorbent assay. receiver operating characteristic (roc) analysis was used to calculate the diagnostic indices and optimal cut - off values using statistical package for the social sciences spss statistical software.results:a total of 67 men and 65 women were analyzed, among which 48 (36.4%) had atrophic gastritis. the mean age was 45.8 (15.8) years. roc curve analysis demonstrated that the biomarkers (including pepsinogen i / ii [p - i / ii ] ratio), except for p - i, are diagnostically significant in detecting gastric atrophy. the area under the curve (95% confidence interval [ci ]) for g-17, p - i, p - ii, and p - i / ii ratio were 0.65 (0.55 - 0.76), 0.42 (0.32 - 0.53), 0.62 (0.52 - 0.72), and 0.61 (0.50 - 0.72), respectively. however, the diagnostic indices were low (sensitivity < 50%, specificity < 90%). the prevalence of helicobacter pylori infection was significantly higher in patients with atrophy against those without atrophy (75.0% vs. 57.4%, p value < 0.0001).conclusion : in the studied population, the serum biomarkers of atrophic gastritis are not useful screening tests due to their low sensitivity. |
we stood at the bedside of a tiny infant in the neonatal intensive care unit. another member of our infectious disease team had just gotten off the phone with the microbiology lab : a yeast had grown from the blood culture. when i told the residents, he has a one in four chance of dying from this infection, they did not believe me. despite antifungal therapy our patient highlights the urgent need for new, potent antifungal therapies. here in the united states, our outstanding care of vulnerable populations, such as very low birth weight infants and bone marrow transplant recipients, means that these individuals no longer succumb to their primary diseases but live on with increased susceptibility to opportunistic pathogens, particularly fungi. in resource - limited settings, the need for safe, inexpensive, oral antifungal therapies is even more pressing. according to the world health organization, there are now 35 million individuals living with hiv ; of these, over 70% live in sub - saharan africa, and only half receive antiretroviral therapy (1). as a result, opportunistic pathogens that are thankfully rare in the developed world are still both common and severe there. critical among these is the central nervous system pathogen cryptococcus neoformans, a ubiquitous environmental yeast, which causes 1 million cases of meningitis in immunocompromised hosts each year. because the expensive intravenous therapies that comprise the standard of care are unavailable, mortality rates are high, and over half of these patients die. new antifungal development has been slowed by several challenges, many of which are shared by efforts directed against other eukaryotic pathogens of the developing world, such as the malaria parasite. these obstacles are in large part scientific ; it is inherently more difficult to identify compounds that selectively harm eukaryotic microbes, since so many essential cellular processes are indeed well conserved from yeasts to humans. in addition, new agents to treat cryptococcal meningitis must cross the blood - brain barrier, a challenge met by only a small minority of existing antimicrobials. however, the economic challenges to new antifungal development for the developing world are also substantial. there is little drive to invest significant research and development funds into new pharmaceuticals for resource - limited countries when the expected financial return on investment is negligible. one strategy to reduce the considerable expense of anti - infective development is the concept of drug repurposing. investigators screen for new activities present in compounds that are known to be pharmacologically active and, in many cases, are already approved for clinical use. hits from these screens are, by definition, drug - like molecules that are typically excellent scaffolds for medicinal chemistry optimization, even if they are not immediately suitable for their new purpose. in addition, pharmaceutical companies often have panels of similar compounds from their own development efforts already synthesized and waiting on the shelf, and academic investigators may be able to piggyback on those previous research programs. drug repurposing can be an outstanding starting point for product development and may also illuminate novel biology. for example, a recent screen for compounds with in vitro activities against the diarrhea pathogen cryptosporidium parvum identified antiparasitic activity in the widely used statin class of cholesterol - lowering drugs, thus revealing an unexpected dependence in this protozoan on host isoprenoid biosynthesis (2). however, drug repositioning screens are often far more difficult to interpret biologically, since the molecular mechanisms of action of many agents are obscure. such was the case for the repurposing screen that identified unexpected antifungal activity in the estrogen receptor antagonist tamoxifen. while tamoxifen has chemical features that are ideal for a new antifungal treatment it is orally bioavailable and accumulates in the brain and within lysosomes the molecular mechanism of its antifungal activity was not clearly defined. in an extensive and multidisciplinary effort, butts. define the mechanisms of action of the estrogen receptor antagonist tamoxifen and related compounds (the triphenylethylenes) as new therapies against cryptococcus neoformans (3). in this study, the authors report the key early preclinical efficacy studies, which demonstrate the promise of this new class of antifungals. a major limitation of the currently available oral anticryptococcal agent fluconazole is that this compound arrests the growth of cryptococcus but does not kill the yeast directly. importantly, the authors demonstrate that the triphenylethylenes not only are fungicidal in combination with fluconazole but also inhibit the intraphagocytic growth of the yeast and already show promise in a mouse model of central nervous system cryptococcal infection. previous studies on the triphenylethylenes had suggested that tamoxifen and related compounds might interfere with calcium homeostasis (46). this was a promising hypothesis, as the calcium - dependent serine - threonine phosphatase calcineurin is a well - validated target for antifungal development (reviewed in reference 7). calcineurin inhibitors, such as the popular immunosuppressants cyclosporine (csa) and tacrolimus (fk506), have potent activities against c. neoformans, which requires calcineurin for growth at elevated temperatures and therefore mammalian pathogenesis (8). using multiple lines of investigation, butts. establish that the antifungal effects of tamoxifen and its analogs are mediated, at least in part, through direct inhibition of c. neoformans calmodulin (cncam1), a calcineurin activator (fig. 1). cncam1 protein interacts directly with the triphenylethylenes, which inhibit cncam1-mediated calcineurin activation in vitro. cellular overexpression of cncam1 decreased sensitivity to this group of compounds, also supporting the finding that cncam1 is a direct target in vivo. consistently with these findings, the triphenylethylenes interfere with cellular functions downstream of calcineurin, which is known to be required for c. neoformans virulence. genetic screening also revealed an apparent second, related target, calmodulin - like protein (cml1, cnag_05655), whose deletion led to compound resistance. calmodulin is an activator of the serine - threonine phosphatase calcineurin, which is required for virulence in the pathogenic fungus cryptococcus neoformans. calcineurin is the target of the commonly used immunosuppressants cyclosporine a (csa) and tacrolimus (fk506), which also inhibit mammalian calcineurin in t cells. the current study provides a strong foundation for future medicinal chemistry efforts to optimize the triphenylethylene scaffold in developing novel antifungal agents. preliminary structure - activity relationships among the tamoxifen analogs indicate that potency against the cncam1 target is well correlated with antifungal activity. by starting with a compound class that is orally bioavailable, with intracellular activity and an optimal tissue distribution pattern, there is real hope that we may cut the time and cost of drug development and bring forward a new anticryptococcal agent for the developing world. | abstractnew antifungals are needed, particularly in the developing world, to treat life - threatening fungal infections, such as cryptococcosis. drug repurposing is one strategy to identify new drug - like compounds, but it is often difficult to identify a mechanism of action. here we discuss the outstanding effort by butts. to identify calmodulin as an antifungal target of repurposed estrogen receptor antagonists [a. butts, k. koselny, y. chabrier - rosell, c. p. semighini, y. c. s. brown,., mbio 5(1):e00765 - 13, 2014, doi:10.1128/mbio.00765 - 13 ]. the authors show that these compounds bind to and directly inhibit fungal calmodulin and also reduce fungal burden in an animal disease model. these studies thus establish both the key preclinical efficacy and the antifungal mechanism of action, which will allow these compounds to progress toward development of novel antifungal therapies. |
the influenza a h1n1 (2009) virus affected thousands of children in catalonia (spain) in fall 2009 (10001200 infections per 100 000 inhabitants aged 27 were considered as poor quality samples for viral load determination. the reactions were performed and analyzed by using the lightcycler 480 system (roche molecular diagnostics). descriptive statistics of noncontinuous variables were reported in terms of absolute frequencies and percentages, and data comparisons were performed using pearson chisquare test or fisher exact test when the expected count in any category was 27 were considered as poor quality samples for viral load determination. the reactions were performed and analyzed by using the lightcycler 480 system (roche molecular diagnostics). descriptive statistics of noncontinuous variables were reported in terms of absolute frequencies and percentages, and data comparisons were performed using pearson chisquare test or fisher exact test when the expected count in any category was 27 (11/93) or they were diagnosed in other institutions (12/93) and were not retested. viral load was determined within a median of 3 days after onset of respiratory symptoms (iqr : 15). we established two different groups regarding to vlad and duration of illness at the moment of sampling : those who had been with symptoms for four or less days and those who had symptoms for five or more days (median, 60 log10 copies / ml (iqr : 4668) versus 47 (3957) ; p = 002) (figure 1). the viral load was inversely correlated to the days after the onset of fever (spearman rho = 036 ; p 45 log10 copies / ml. most of the patients (66/70, 94%) received oseltamivir during hospitalization immediately after collecting the sample for viral load determination. children had been widely described as a population with an increased risk of severe disease by influenza a h1n1 (2009). the immunopathology may play an important role in the severely affected children apart from the virusmediated component of disease, which is the focus of this study. the literature published about these two components of the novel influenza disease in hospitalized children is scarce. viral load at diagnosis may be a biomarker of severity, as described previously for other respiratory virus, including h5n1 influenza virus,, vlad can be easily extrapolated with the same realtime rtpcr used for the diagnosis of infection without almost adding any extra economic cost. in our study, vlad within the first days of symptoms was not a good biomarker of severity. nonetheless in patients with 5 or more days of symptoms, vlad was an accurate parameter distinguishing the patients who required mv from those who did not required it. it is known that the lag time between the onset of symptoms and the initiation of antiviral treatment determines a different clinical response in influenza a h1n1 (2009) infections., in patients within the first days of symptoms, early initiation of oseltamivir could have protected them from developing a more severe respiratory disease, and probably this may be one of the reasons for not finding the vlad values as an accurate parameter in distinguishing the most severe cases in that group. on the other hand, the treatment has proved to be effective in decreasing viral load, suggesting that those patients with high viral loads after several days of symptoms could have benefited from an earlier treatment. in this series, as reported previously for seasonal and pandemic influenza,,, vlad was at high level in those patients in whom sample was collected during the first days of symptoms. higher influenza a h1n1 (2009) viral loads had been observed in patients with fever and in those with pneumonia, in comparison with patients without systemic symptoms.. observed a lower clearance of viral load in patients younger than 13year old, but they did not find in them a higher rate of severe disease, defined in that study as having chest xray opacities or meningoencephalitis. in our series, to have a high vlad with 5 days of symptoms conferred a twofold increase in the risk of mv. this result could be in relation with the observed lower viral load clearances in patients with more severe disease in other series.,, the main limitation of the study is the small sample size. detection of oseltamivirresistant strains was not systematically performed, although resistant strains were a minority during the pandemic period. it would also be interesting to determine the clinical utility of serial analysis of viral load for each individual case, but it may be difficult to be introduced as a regular clinical practice in pediatrics. based on our observations, we conclude that vlad in patients with several days of clinical symptoms (5 days in our study) was associated with the severity of influenza a h1n1 (2009) disease. further studies in different settings are needed to identify the weighted role of the direct viral damage and the immunopathology in pediatric patients with influenza a h1n1 (2009) disease. | please cite this paper as : launes. (2012) viral load at diagnosis and influenza a h1n1 (2009) disease severity in children. influenza and other respiratory viruses 6(601), e89e92.to assess viral load at diagnosis (vlad) as a biomarker of novel influenza disease severity, epidemiologic and clinical data of admitted patients < 18 years old with influenza a h1n1 (2009) infection and respiratory symptoms were prospectively collected in a single pediatric tertiary hospital, from weeks 3051 of 2009. seventy patients were included. vlad in children who had symptoms for 5 days was an accurate parameter distinguishing the patients who required mechanical ventilation (mv) from those who did not required it (area under the roc curve : 073 ; p = 003). having < 45 log10 copies / ml with 5 days of symptoms was associated with a lower risk of requiring mv. |
interferon - alpha (ifn-), which is the main therapeutic agent used for chronic hepatitis c virus (hcv) infection, is associated with side effects such as flu - like symptoms, hematologic abnormalities and thyroid disease. prospective studies have shown that up to 40% of patients with hcv infection develop thyroid antibodies during ifn- therapy (1), and around 15% develop thyroid disease (2). according to tomer. (3), interferon - induced thyroiditis (iit) can be classified as either autoimmune or non - autoimmune. autoimmune iit includes the de novo production of thyroid autoantibody without clinical disease, hashimoto 's thyroiditis, and graves ' disease, while non - autoimmune iit presents as destructive thyroiditis or non - autoimmune hypothyroidism (3). the development of thyrotoxicosis during ifn- treatment may be due to silent destructive thyroiditis or graves ' disease. the development of graves ' disease is a less common side effect of ifn- therapy than is destructive thyroiditis. moreover, destructive thyroiditis followed by graves ' disease associated with ifn- therapy occurs very rarely. only four cases of destructive thyroiditis followed by graves ' disease asso ciated with ifn- treatment have been reported in the literature (4, 5). herein, we report a recent case of pegylated ifn- (pegifn-)-induced destructive thyroiditis followed by transient graves ' disease in a patient with hcv infection. a 31-yr - old woman with hepatitis c - associated chronic active hepatitis proven on liver biopsy received pegifn- (schering - plough, korea) 2b 100 g weekly and ribavirin 800 mg daily from june 2009 to may 2010. prior to pegifn- therapy, laboratory testing revealed normal concentrations of total t3 at 2.25 nm / l (normal range : 1.1 to 2.9 nm / l), tsh at 1.011 mu / l (normal range : 0.35 to 5.50 mu / l), and free t4 at 15.18 pm / l (normal : 9 to 26 pm / l), in addition to negative titers of antimicrosomal antibody (msab) at 18 u / ml (negative < 60 u / ml) and antithyroglobulin antibody (tgab) at 26.7 u / ml (negative < 60 u / ml). within two months of pegifn- therapy initiation seven months into therapy (january 2010), the patient developed mild tremors and palpitation however she had no fever or pain. she has no personal and family history of thyroid dysfunction and no specific medication history. she also had not received any test that could interfere with the thyroid scan uptake. results of repeated laboratory tests indicated elevated total t3 at 4.26 nm / l, suppressed tsh at 0.009 mu / l, normal total t4 at 148.005 nm / l (normal : 64 to 154 nm / l), and negative titers of msab at 27.1 u / ml and tgab at 31.1 u / ml. thyrotropin - binding inhibitory immunoglobulin (tbii) was also negative at 2.6 u / l (normal range : 0 to 10 u / l). based on these findings, we diagnosed the patient with interferon - induced destructive thyroiditis and prescribed propranolol 20 mg / d for one month. two months later (march 2010), a follow - up thyroid function test demonstrated further decline in total t3 at 3.353 nm / l, tsh at 0.013 mu / l and total t4 at 128.7 nm / l. she continued pegifn- therapy for an additional four months, for a total treatment duration of 12 months. two months after the end of therapy (july 2010), she complained of hand tremors, fatigability, and 3 kg of weight loss. laboratory tests revealed a total t3 of 12.288 nm / l, tsh of 0.004 mu / l, free t4 of 79.92 pm / l, and a tbii titer of 13.0 u / l. both thyroid glands were diffusely enlarged with increased vascularities and had heterogeneous echogenicities (fig. 2). the diagnosis of graves ' disease was made, and the patient started treatment with methimazole and propranolol. after nine months of antithyroid drug therapy (april 2011), her thyroid function tests showed normalized total t3 at 2.095 nm / l, tsh at 0.009 mu / l, free t4 at 21.36 pm / l, msab at 40.9 u / ml and tbii at 3.4 u / l. ifn- is an immunoregulatory cytokine that is currently used as a therapeutic agent for chronic hcv infection. the most common adverse effects of ifn- are muscle aches and fatigue, but more difficult to manage are the psychological side effects such as depression, anxiety, irritability, sleep disturbance, and difficulty concentrating (6). the association between interferon and thyroid disease was reported as early as 1985 (7). since then, numerous studies have reported a high incidence of thyroid abnormalities in patients treated with interferon (8, 9). for many years it was assumed that side effects associated with ifn- therapy were due to immune dysregulation. however, while immune mechanisms must play a role in the development of iit, the predilection to the thyroid and the non - autoimmune manifestations of iit suggest that direct effects of ifn- on the thyroid play a major role in the etiology of iit (10). the most common clinical manifestation of iit is hashimoto 's thyroiditis. hashimoto 's thyroiditis is most likely to occur during the course of treatment and has been reported in 45%-60% of patients with pre - existing thyroid autoantibodies (tabs) compared to 3%-5% of those with no circulating thyroid antibodies prior to interferon treatment (11). tabs can develop de novo during ifn therapy or their levels can increase during ifn therapy. the majority of individuals who develop de novo tabs due to ifn- therapy remain tabs - positive after treatment is completed. the incidence of de novo tabs in interferon - treated hcv patients ranges from 10% to 40% (1, 2, 12), and tabs develop more frequently in women treated with ifn- than in men. her tgab titer progressively increased from 26.7 u / ml to 31.1 u / ml during ifn- therapy and remained weakly positive at 63.9 u / ml after the treatment period. classical destructive thyroiditis initially presents as transient thyrotoxicosis with decreased radionuclide uptake, which develops in three phases, followed inconsistently by a hypothyroid phase that eventually resolves spontaneously within several weeks to months. graves ' disease is characterized by overt hyperthyroidism with the presence of thyroid stimulating hormone receptor antibody (tshrab) and/or diffusely increased radioactive iodine uptake. ifn--induced graves ' disease is less common than is destructive thyroiditis, affecting 1%-2% of patients during ifn- therapy and can manifest following inf- therapy completion (13, 14). typically, ifn--induced graves ' disease patients present with symptomatic thyrotoxicosis and do not go into remission upon completion or cessation of ifn- therapy. in our patient, her free t4 concentration was normalized after one month of antithyroid drug treatment ; however, her tsh level remained suppressed after nine months of antithyroid drug therapy. destructive thyroiditis developed in our case after seven months of ifn- therapy, and graves ' disease was diagnosed after treatment completion. our case is similar to only one previously reported case. in 1995, koizemi. (4) described a woman who, after three months of ifn- therapy, successively developed transitory thyrotoxicosis, followed three months later by recurrent hyperthyroidism and the development of high tshrab titers. in this case, thyroid peroxidase antibody (tpoab), tgab, and tshrab titers were elevated at the time of ifn- therapy cessation, and symptoms of graves ' disease developed four months later. however, bohbot. (5) reported three patients with classical destructive thyroiditis followed by graves ' disease manifesting during ifn- therapy. in those cases, the time to the appearance of the destructive hyperthyroidism phase was 4 - 6 months, with the graves ' disease phase arising at 8 - 11 months. it is unclear how ifn- induces graves ' disease, but the underlying mechanism is thought to be causally related to autoimmunity. some cases of transient thyrotoxicosis followed by graves ' hyperthyroidism not associated with ifn- therapy have been reported (15 - 17). in those cases, destruction of thyroid tissues and release of autoantigens could have resulted in altered immunotolerance, and the subsequent production of thyroid stimulating antibody may have caused hyperthyroidism. however, we observed a rare side effect of ifn- therapy as ifn--induced destructive thyroiditis followed by transient graves ' disease in a patient with hcv infection. | interferon - induced thyroiditis (iit) is a major clinical problem for patients receiving interferon - alpha (ifn-) therapy. but, destructive thyroiditis followed by graves ' disease associated with ifn- therapy is very rarely reported. herein, we report a rare case of pegylated ifn- (pegifn-) induced destructive thyroiditis followed by graves ' disease in a patient with hcv infection. a 31-yr - old woman suffered from chronic active hepatitis c and was treated with pegifn- and ribavirin for 12 months. results of a thyroid function test and autoantibody levels were normal before ifn- therapy was initiated. destructive thyrotoxicosis appeared seven months after the initiation of ifn- therapy, followed by graves ' thyrotoxicosis two months after the cessation of therapy. the diagnoses of destructive thyroiditis and graves ' disease were confirmed by the presence of tsh receptor antibodies in addition to tc-99 m scintigraphy findings. the patient 's antithyroglobulin antibody titer increased gradually during ifn- therapy and remained weakly positive after ifn- therapy was discontinued. |
bevacizumab is a recombinant humanized monoclonal antibody that selectively blocks the activity of vascular endothelial growth factor (vegf) receptor. the addition of bevacizumab to first or second line chemotherapy was associated with longer overall survival (os) and progression free survival (pfs) in metastatic colorectal patients. the adverse events associated with bevacizumab include hypertension, proteinuria, thromboembolism, impaired wound healing, bleeding, perforation, reversible leukoencephalopathy syndrome, skin rash, and infusion - related hypersensitivity reactions. we present here a case of fatal necrotizing fasciitis in a patient during bevacizumab treatment for colorectal cancer. low anterior resection with ileostomy was performed for rectal mass 5 cm from anus. according to the tumor, node, metastases classification, the pathological stage of the carcinoma was t3n1m0 (stage iiia). the patient was treated with adjuvant 45 gy chemoradiotherapy with 5-fluorouracil 225 mg / m daily and then fluorouracil - leucovorin - oxaliplatin (folfox4) regimen. after two cycles of folfox4 regimen, serum carcinoembryonic antigen levels had increased. in the radiologic evaluation with chest and abdominal computed tomography, new liver metastases in both lobes the hepatic metastases were unresectable, hence the patient shifted to regimen of 5-fluorouracil - leucovorin - irinotecan (folfiri). after 12 courses of the folfiri regimen every 2 weeks, the chemotherapy was stopped due to the stable liver metastases. because of the new metastatic lesions in the liver and pelvic recurrence, bevacizumab added to folfiri regimen. after 10 days of the third cycle of the folfiri - bevacizumab regimen, the patient was admitted with fever, weakness, abdominal pain and erythema of the proximal side of right thigh. the laboratory evaluation revealed a white blood cell count of 22.000/l (normal value 4,400 - 11,000/l) with increased c - reactive protein to 160 mg / l (normal value : 0 - 10 mg / l). the magnetic resonance imaging (mri) of the pelvis showed widespread significant air - fluid level abscess in the tissues of right gluteus maximus, gluteus minimus and vastus muscles. ultrasonography - guided drainage of the abscess was performed and 10f pigtail catheter was inserted to the abscess location. the microbiological culture of the material was revealed vancomycin - resistant enterococcus (vre), escherichia coli, and bacteroides fragilis. patient responded to treatment for initial few days, but on the 7 day of the antibiotic treatment, acute renal failure and septic shock was developed. necrotizing fasciitis is an uncommon severe soft tissue infection involving the subcutaneous fat and fascia. there are an estimated 3.5 cases of necrotizing fasciitis per 100,000 persons, with a case - fatality rate of 24% despite immediate treatment. severe and acute onset of the pain at the infectious site is the most common clinical presentation. the risk factors of necrotizing fasciitis are diabetes mellitus, malnutrion, trauma, operative interventions, and nonsteroidal anti - inflammatory drugs (nsaids) usage. rarely, necrotizing fasciitis can develop due to all - trans - retinoic acid, bisphosphonates, and radiotherapy. in addition, necrotizing fasciitis has also been reported in renal transplant recipient who treated with fk506. serious adverse events with bevacizumab treatment were hemorrhage, gastrointestinal perforation, and arterial thromboembolic events. one of the pathophysiologic mechanism of necrotizing fasciitis is subcutaneous arteries thrombosis and tissue ischemia, bevacizumab can be the etiologic factor for this. the naranjo probability score revealed that it was probable (+ 5) that bevacizumab might be responsible for necrotizing fasciitis. we believe that in our patient, necrotizing fasciitis is due to bevacizumab treatment because there was no additional risk factor and there is temporal relationship between necrotizing fasciitis and bevacizumab treatment. in conclusion, we presented fatal necrotizing fasciitis in a patient during bevacizumab treatment for rectal cancer. although precise mechanism is not clear, necrotizing fasciitis is a fulminant disease and can be observed during bevacizumab treatment. | bevacizumab is a recombinant humanized monoclonal antibody that selectively blocks the activity of vascular endothelial growth factor (vegf) receptor and it is used in metastatic colorectal patients. we present here a case of fatal necrotizing fasciitis in a patient during bevacizumab treatment for colorectal cancer. in our review of the literature, necrotizing fasciitis was not reported before or during bevacizumab treatment. |
although fat embolization may occur in almost all patients with pelvic or long bone fractures ; in most cases it is sub - clinical.12 the reported incidence of fat embolism syndrome in long bone fractures is 0.5 - 11% and up to 30% in bilateral femoral fractures.345 cerebral fat embolism syndrome where the clinical manifestation is dominated by neurological dysfunction is rare and only scarcely reported. 6 reported two cases with prolonged coma due to cerebral fat embolism which required ventilatory support for 2 and 3 weeks duration. we report two such cases which recovered completely despite rapid initial deterioration and prolonged coma. although clinical pictures are well reported, our cases are unique that both presented with normal neurology to the hospital and had neurological worsening due to cerebral fat embolism phenomenon 24 - 48 h prior to surgery without associated respiratory distress. both needed ventilation for a prolonged period and had poor mentation at the time of discharge. furthermore, during the followup they showed complete recovery to normal and social life ; highlighting the fact that prolonged intensive care and good rehabilitation can lead to normal neurology despite poor clinical picture initially. a 20-year - old male presented 7 h following a road traffic accident (rta) with closed fracture of mid - shaft tibia and fibula involving both his legs. on arrival patient was conscious and oriented with a glasgow coma scale (gcs) - 15/15. blood investigations were normal except for raised serum lactate (5.7 mmol / l). two hours after admission (9 h since injury), patient became drowsy with a blood pressure of 116/74 mmhg, oxygen saturation further 4 h later patient became lethargic and comatose with the gcs falling to 8/15. patient was intubated and ventilated and was on supportive treatment with neuro - monitoring. magnetic resonance imaging (mri) of the brain revealed multiple well defined tiny hyperintense lesions on t2 and fluid - attenuated inversion - recovery sequences with restricted diffusion bilaterally scattered in the subcortical white matter, centrum semiovale, basal ganglia, thalami and cerebellum suggestive of multiple tiny infarcts due to fat embolism [figure 1 ]. chest x - ray which was initially clear, revealed minimal bilateral diffuse haziness only after 3 days [figure 2 ]. fractures of both bones of both legs were stabilized by external fixation on 4th day after injury. patient regained consciousness only after 2 weeks, but had poor higher mental functions such as slurred speech, poor cognition and disturbed memory. gcs had improved to 13/15 and ventilator support was gradually weaned and withdrawn at 3 weeks. later at 4 weeks (since injury), external fixator removal and interlocking nailing was carried out for fractures of both the tibiae. at 10 weeks postinjury, patient was conscious and oriented, but with poor cognition. at 5 months, patient had regained full neurological recovery and fractures of both bones of both the legs united [figure 3 ]. neurological recovery was evaluated by glasgow outcome scale (gos)7 and mini - mental state examination (mmse),8 which showed good recovery and normal cognition respectively. mri of the brain repeated at 10 months postinjury revealed resolution of previously visualized hyperintense lesions except in the periventricular region without any diffusion restriction pattern [figure 3 ]. (a) radiograph of leg bones with ankle joint (anteroposterior views) showing fractures in both legs (b and c) t2w magnetic resonance imaging of the brain (arrow) showing multiple well defined tiny hyperintense lesions suggestive of cerebral fat embolism (arrow) (a) radiograph of chest, which was normal initially ; (b) bilateral diffuse haziness after 3 days (arrow) (a) radiograph of leg bones (anteroposterior views) showing well united fractures of both legs ; (b and c) t2w magnetic resonance imaging of brain repeated 10 months postinjury shows incomplete, but significant resolution of previous hyperintense lesions (arrow) a 28 year old male presented with rta and sustained closed fracture of the right femur. he was admitted in the evening at 6 pm and was planned for interlocking nailing the following day. next day morning at 7 am, patient was found to be drowsy and ct of the brain was carried out, which was reported to be normal. the pulse rate was 114/min, blood pressure was 122/84 mmhg with an oxygen saturation of 86% at room air. within 3 h, consciousness of patient rapidly deteriorated with the gcs falling to 7/15 and he required intubation and ventilation to maintain oxygen saturation. clinically, a diagnosis of fat embolism syndrome was made after ruling out head injury, hypotension, electrolyte and metabolic disturbances. the fracture was then stabilized by an external fixator on the 2 day after injury. chest x - ray, was initially normal and showed bilateral diffuse haziness after 2 days [figure 4 ]. since consciousness did not improve even after 6 days, mri of the brain was done, which confirmed cerebral fat embolism [figure 4 ]. as there was continued requirement of mechanical ventilation with positive end expiratory pressure, tracheostomy was done. mechanical ventilation was continued for 5 weeks until he regained consciousness with the gcs improving to 11/15. gradual weaning was carried out with t - piece and ventilation support was discontinued at 6 weeks. external fixator removal and interlocking nailing was carried out for fracture femur at 8 weeks since injury. neurologically, patient had poor cognition and spasticity initially, which gradually improved and the patient returned to his original job. at 6 months, postinjury the patient had good neurological recovery (gos) and normal cognition (mmse). (a) initial radiograph of chest ; (b) radiograph of chest repeated after 2 days reveals diffuse haziness (arrow) compared to initial radiograph ; (arrow) (c) magnetic resonance imaging of brain shows features of cerebral fat embolism (arrow) a 20-year - old male presented 7 h following a road traffic accident (rta) with closed fracture of mid - shaft tibia and fibula involving both his legs. on arrival patient was conscious and oriented with a glasgow coma scale (gcs) - 15/15. blood investigations were normal except for raised serum lactate (5.7 mmol / l). two hours after admission (9 h since injury), patient became drowsy with a blood pressure of 116/74 mmhg, oxygen saturation further 4 h later patient became lethargic and comatose with the gcs falling to 8/15. patient was intubated and ventilated and was on supportive treatment with neuro - monitoring. magnetic resonance imaging (mri) of the brain revealed multiple well defined tiny hyperintense lesions on t2 and fluid - attenuated inversion - recovery sequences with restricted diffusion bilaterally scattered in the subcortical white matter, centrum semiovale, basal ganglia, thalami and cerebellum suggestive of multiple tiny infarcts due to fat embolism [figure 1 ]. chest x - ray which was initially clear, revealed minimal bilateral diffuse haziness only after 3 days [figure 2 ]. fractures of both bones of both legs were stabilized by external fixation on 4th day after injury. patient regained consciousness only after 2 weeks, but had poor higher mental functions such as slurred speech, poor cognition and disturbed memory. gcs had improved to 13/15 and ventilator support was gradually weaned and withdrawn at 3 weeks. later at 4 weeks (since injury), external fixator removal and interlocking nailing was carried out for fractures of both the tibiae. at 10 weeks postinjury, patient was conscious and oriented, but with poor cognition. at 5 months, patient had regained full neurological recovery and fractures of both bones of both the legs united [figure 3 ]. neurological recovery was evaluated by glasgow outcome scale (gos)7 and mini - mental state examination (mmse),8 which showed good recovery and normal cognition respectively. mri of the brain repeated at 10 months postinjury revealed resolution of previously visualized hyperintense lesions except in the periventricular region without any diffusion restriction pattern [figure 3 ]. (a) radiograph of leg bones with ankle joint (anteroposterior views) showing fractures in both legs (b and c) t2w magnetic resonance imaging of the brain (arrow) showing multiple well defined tiny hyperintense lesions suggestive of cerebral fat embolism (arrow) (a) radiograph of chest, which was normal initially ; (b) bilateral diffuse haziness after 3 days (arrow) (a) radiograph of leg bones (anteroposterior views) showing well united fractures of both legs ; (b and c) t2w magnetic resonance imaging of brain repeated 10 months postinjury shows incomplete, but significant resolution of previous hyperintense lesions (arrow) a 28 year old male presented with rta and sustained closed fracture of the right femur. he was admitted in the evening at 6 pm and was planned for interlocking nailing the following day. he had no other injuries and was fully conscious at admission. next day morning at 7 am, patient was found to be drowsy and ct of the brain was carried out, which was reported to be normal. the pulse rate was 114/min, blood pressure was 122/84 mmhg with an oxygen saturation of 86% at room air. within 3 h, consciousness of patient rapidly deteriorated with the gcs falling to 7/15 and he required intubation and ventilation to maintain oxygen saturation. clinically, a diagnosis of fat embolism syndrome was made after ruling out head injury, hypotension, electrolyte and metabolic disturbances. the fracture was then stabilized by an external fixator on the 2 day after injury. chest x - ray, was initially normal and showed bilateral diffuse haziness after 2 days [figure 4 ]. since consciousness did not improve even after 6 days, mri of the brain was done, which confirmed cerebral fat embolism [figure 4 ]. as there was continued requirement of mechanical ventilation with positive end expiratory pressure, tracheostomy was done. mechanical ventilation was continued for 5 weeks until he regained consciousness with the gcs improving to 11/15. gradual weaning was carried out with t - piece and ventilation support was discontinued at 6 weeks. external fixator removal and interlocking nailing neurologically, patient had poor cognition and spasticity initially, which gradually improved and the patient returned to his original job. at 6 months, postinjury the patient had good neurological recovery (gos) and normal cognition (mmse). (a) initial radiograph of chest ; (b) radiograph of chest repeated after 2 days reveals diffuse haziness (arrow) compared to initial radiograph ; (arrow) (c) magnetic resonance imaging of brain shows features of cerebral fat embolism (arrow) gurd and wilson9 reported that fat embolism syndrome typically develops between 12 h and 72 h after the injury in young adults. this was seen in our cases also where they were completely normal neurologically at presentation and rapidly deteriorated in the next 9 - 12 h. diagnosis of fat embolism syndrome is by and large clinical and is characterized by the classical triad of petechial rash, respiratory distress and neurological dysfunction.9 however, this triad may not be present in all patients and poses a diagnostic challenge.10 both our cases had profound neurological dysfunction at presentation, but had no petechial rash. although they had no respiratory distress at presentation, dysfunction was manifested by worsening hypoxia detected by pulse oxymetry. cases where the neurological manifestations are predominant are referred to as cerebral fat embolism syndrome.511 cerebral manifestations are highly variable and nonspecific. this includes headache, lethargy, irritability, delirium, stupor, convulsions, focal deficits or coma.11 these features may be seen even with head injury, substance abuse, polytrauma and sedative medication, making the diagnosis of cerebral fat embolism difficult.12 cerebral fat embolism has been reported in young adults between 18 and 39 years.561012131415161718192021 the two patients, we report here are also in the same age group. although, neurological deterioration in many reported patients was postoperative following intramedullary nailing for long bone fractures;561013141516 onset prior to surgery has also been reported as seen in our patients.101217181920 mri is helpful in diagnosis of cerebral fat embolism and also to exclude other causes of deterioration.121721 parizel.19 reported that diffusion weighted mri characterized by bright spots on a dark background helps in early diagnosis. in the cases reported in literature, the duration of ventilatory support ranged up to a maximum of 3 weeks, but our patients required prolonged ventilation support for 3 and 6 weeks respectively. butteriss.13 emphasized the role of neurotoxicity and metting.21 highlighted the occurrence of delayed coma due to cerebral fat embolism in association with head injury. complete neurological recovery has been reported in many case reports at 3 weeks to 4 months after the initial insult. our two patients also had delayed, but complete recovery after 5 and 6 months respectively. manousakis.20 studied the cognitive outcome in cerebral fat embolism and reported that neuropsychological evaluation was normal except for borderline frontal dysfunction at the end of 4 months. pfeffer and heran14 although reported poor outcome in cerebral fat embolism associated with restricted diffusion in mri, there was clear evidence of intraoperative hypoxia and hypotension in their cases, which might have contributed to the poor outcome. metting.21 reported persistent cognitive dysfunction in patient with cerebral fat embolism associated with head injury. mueller.15 reported poor outcome in fulminant cerebral fat embolism associated with atrial septal defect. early suspicion of fat embolism syndrome should be raised when there are subtle changes in consciousness, tachycardia, tachypnea and evidence of hypoxemia picked up by pulse oxymetry for early suspicion. cytological examination of urine for fat globules is not sensitive and its absence does not rule out fat embolism syndrome as was seen in our patients.22 dongfeng.,23 in a retrospective multicenter study, emphasized early diagnosis for good outcome in cerebral fat embolism. treatment of cerebral fat embolism syndrome is essentially supportive.16 cerebral edema plays a major part in neurological deterioration in fulminant type of cerebral fat embolism syndrome.6 neurological manifestations in fat embolism syndrome can be worsened by associated primary head injury or secondary brain damage due to cerebral hypoxia, which may occur due to acute respiratory distress syndrome or low gcs. meyer.5 has reported that any intention to withdraw supportive measures must be tempered until the patient is at least 1 month from the date of injury and the brain magnetic resonance image shows no sign of improvement. however in one of our patient, ventilation was required for 42 days and finally the patient recovered completely. this proves that there is no limit for supportive treatment in cerebral fat embolism syndrome considering the excellent prognosis. the cognitive dysfunction following cerebral fat embolism is reported to be similar to hypoxic brain injury,2024 which if avoided during management has excellent outcome. cerebral fat embolism syndrome has to be strongly considered in young adults with long bone and pelvic fractures presenting with rapid deterioration of neurological status in the absence of head injury. magnetic resonance imaging of the brain is helpful for early diagnosis in isolated cerebral fat embolism. importance of its early recognition lies in the fact that despite grave presentation, rapid worsening and late neurological recovery ; the prognosis is very good with intensive care and rehabilitation. prevention of secondary brain damage due to hypoxia is essential to avoid permanent neurological sequelae. | fat embolism syndrome presenting primarily with cerebral manifestations is rarely reported. we report here two such patients who showed complete recovery following initial deterioration. the aim of these reports is to highlight that prolonged intensive care and good rehabilitation can lead to normal neurologic recovery despite poor clinical picture initially. the importance of adequate oxygenation to prevent secondary brain damage is emphasized during prolonged recovery. |
initial laboratory values were : wbc 2900/l, anc 900/l, hemoglobin 12.0 g / dl, mcv 95 fl, and platelet count of 156,000/l. creatinine, ast, alt, bilirubin, tsh, iron, total iron binding capacity, ferritin, and vitamin b12 levels were normal. past medical history was significant for coronary artery disease, ulcerative colitis, and stage ii esophageal adenocarcinoma treated with neoadjuvant concomitant radiation plus carboplatin and paclitaxel followed by ivor - lewis esophagectomy. postoperative esophagocutaneous fistula formation led to long - term reliance on jejunal feeding for all caloric intake. his medications were lorazepam, aspirin, amiodarone, lisinopril, balsalazide, metoprolol, and vitamin b12. amiodarone was discontinued. a repeat cbc after 1 month showed wbc 2600/l, anc 200/l, hemoglobin 12.7 g / dl, mcv 107 fl, and platelet count of 174,000/l. a second repeat cbc after 2 months following discontinuation of amiodarone showed : wbc 2900/l, anc 300/l, hemoglobin 11.0 g / dl, mcv 114 fl, and platelets 193,000/l. examination of a bone marrow aspirate and biopsy specimen revealed nor mocellular bone marrow with progressive trilineage hematopoiesis, mild erythroid hyperplasia, with megaloblastoid features, and vacuolated erythroid cells, highly suspicious for myelodysplastic syndrome (figs1 and 2). additional laboratory evaluation included rheumatoid factor 12, esr 30, crp 0.4, serum zinc level 86 g / dl (60130) and serum copper < 10 g / dl (70140). a cbc after 1 month revealed wbc 7600/l, anc 5400/l, hemoglobin 12.2 g / dl, mcv 120 fl, and platelet count 246,000/l. ceruloplasmin and cytochrome oxidase are both copper - containing enzymes essential for heme synthesis 3. typical morphological findings in peripheral blood and bone marrow aspirate in copper deficiency can mimic myelodysplastic syndrome 1. bone marrow aspirate in both conditions may show dysplasia in the erythroid precursors such as large size, nuclear multilobulation, and nuclear budding as well as the presence of ring sideroblasts. unlike myelodysplastic syndrome, the bone marrow aspirate in copper deficiency characteristically shows cytoplasmic vacuoles within erythroid and myeloid precursors 2. furthermore, karyotyping in cases of copper deficiency does not reveal cytogenetic features characteristic of myelodysplastic syndrome. copper is present in common foods including meat, fish, nuts, seeds, and legumes, and therefore deficiency from dietary inadequacy is rare 4. most copper absorption occurs in the stomach and proximal duodenum, although the more distal small intestine can also absorb copper. problems with copper absorption leading to deficiency should be considered in patients who have history of gastric bypass or gastrectomy, are receiving chronic parenteral nutrition or tube feeding, or on zinc supplementation and develop pancytopenia and/or myeloneuropathy. however, per the mayo clinic the daily recommended intake for adults is 1.52.5 mg / day. copper is available in both intravenous (cupric chloride) and tablet forms. in this patient, we hypothesize that the long - term use of jejunal feeding led to a nutritional deficiency of copper and consequent pancytopenia. currently, there is a national shortage of intravenous copper ; therefore we elected to attempt correction of his copper deficiency with higher doses of oral copper. copper deficiency represents a rare but treatable cause of anemia and neutropenia that may be mistaken for myelodysplastic syndrome. therefore, patients with a history of abdominal surgery who present with new found anemia and neutropenia with bone marrow biopsy showing dysplastic changes with no cytogenetic abnormalities should have copper levels checked. recognition of copper deficiency as the cause of these blood abnormalities is critical to appropriately treat this disorder. | key clinical messagecopper deficiency is a rare cause of pancytopenia that may be mistaken for myelodysplastic syndrome. cytoplasmic vacuolization in erythroid and myeloid precursors is found on bone marrow examination. patients with a history of abdominal surgery who present with anemia and neutropenia with dysplastic changes should have copper levels checked. |
antibiotic therapy directed against multiresistent bacteria is a significant cost driver in clinical medicine. due to various reasons, the costs of new antibiotics are comparatively high and some multiresistant bacteria can or should only be treated with new antibiotics. moreover, most complicated bacterial infections requiring long treatment durations occur in the hospital setting, often in intensive care units. it is a well established notion that prolonged length of stay in the hospital (los), the time spent in intensive care units (icu days) and the hours of mechanical ventilation (hmv) are the main cost drivers in this setting [1 - 6 ]. the evaluation of the economical effectiveness of pharmacological therapies is gaining more and more importance. while most of these pharmacoeconomical analyses are intended to show effectiveness of a new drug versus the current standard - of - care from a healthcare system perspective (cost - effectiveness studies, prospective modelling, using quality - adjusted - lifeyears (qualys) and other parameters), these studies do not necessarily answer the budget - related questions of clinicians or even the administrators in a hospital [7 - 10 ]. finally, in most developed countries so - called diagnosis - related groups (drg) are used for hospital budgeting, reimbursement or resource allocation. drgs are payment groups that determine the reimbursement for a certain type of patient group that was found to be economically homogenous. for example, the germany system provides drg - directed payment for respiratory tract infections with or without " complications or comorbidities (cc) ". the following table gives an overview of drgs for respiratory tract infections, their cost - weights, their payment (assuming a base price for cost weight 1.0 of 2,900.-) and the related length of stay (los) in hospital, see table 1. overview of drg e77 - respiratory tract infections drgs are common instruments for hospital reimbursement or in most developed countries in the world. nearly every country in europe has drg - systems in use. without drilling too deep into the complicated german drg system and translating all the drg - denominators, we point out, that drg payments for one particular set of conditions - like respiratory tract infections - vary according to various cost - modifiers. one of these factors is the occurence of multiresistent bacteria (see bold letters in the table). however, the payment for a given drg is fixed at a certain amount. the german costing study includes annually calculated average costs in a matrix of cost types (such as staff, pharmaceuticals, etc.) and cost centers (such as normal ward, or, icu, etc.). this results in a costing matrix with up to 100 so - called cost modules. moreover a national los " benchmark " is available, and these data are published in the internet (for each drg). after the introduction of drgs, optimizing the los has turned out as an important lever to achieve higher profitability. yet, this notion has not yet been fully acknowledged by everyone in the medical community. as an example, table 2 shows the cost matrix of e77b - respiratory infections with complex diagnosis or catastrophic cc, w / o complex intensive care for children, with treatment of multiresistent bacteria, hospital stay longer than 72 hrs cost matrix for drg e77b based on the known " limits " that must be observed to avoid losing money in drg - reimbursed treatments, analyses can be done on an individual hospital 's data to determine whether the current treatment strategies in a hospital lead to a sustainable balance of cost and medical need. coming from this idea, the development of a drg - based approach to the analysis of infections and the prove - of - concept were the major questions to be dealt with in this publication. as in drg - based payment systems, the coding of diagnoses as primary (the reason why the patient got admission to the hospital) and secondary (relevant complications and comorbidities that caused resource consumption) diagnoses is the cornerstone of finding the correct drg, we assumed that the coding quality in terms of completeness and accuracy pretty well reflects the clinically relevant situation, especially in case of infections. we developed an algorithm that contains over 100 icd - codes representing infections and/or bacterial pathogens. hospital - acquired versus community - acquired infections were assumed to be represented by the assignment as " primary " (or main) diagnosis or " secondary " diagnosis. moreover, we tried to rule out coding errors such as the implausible use of the same icd code as primary and secondary diagnosis. hospital acquired pneumonias (hap) may be indicated by a special icd - code (u69.00 !) used to distinguish between community acquired pneumonia (cap) and hap in the german system. using the minimal basic dataset (mbds) of a country - in germany 21-data - for one hospital or a set of hospitals, it is possible to " decode " infections from the drg data. table 3 displays the basic data model used to retrieve information on infections and bacterial pathogens from coded icd-10 data. entity relationship model of the " decoding infections " database as in some cases, bacterial pathogens are part of the icd - code of the infections, counting infections and the bacteria involved respect this fact by listing some icd - codes as infections and as bacteria. see table 4 for an example. association of bacterial pathogens and icd - codes using this methodology, we were able to decode infections from routine drg data. after implementation of these data in a business information warehouse (bi) software, it is now possible to answer the following questions : - which infections caused by which bacteria occur in the hospitals ? - which los is associated to which infection and does it imply a risk of losing reimbursement for the hospital ? - which drgs are the ones most likely impacted by infections ? once identified, the drgs with a high number of infections or those patients that cause the highest loss in drg - reimbursement due to infections may be further analyzed. in peer reviews, the antibiotic therapy strategy for each case may be compared against the expected cost average in the respective drg, the actual cost and the potential cost outcome achieved by using a different therapeutic strategy. differences in length of stay that cause inefficiency can be detected and assigned to various types of infections. table 5 shows an overview of certain infections and the los of patients having these infections compared to the los of patients being in the hospital without an infection. los with and without infections without infections : 7,3 days (green block line) with hospital acquired pneumonia (hap) 21 - 28 days (pink line) if the los is higher with an infection, this does not necessarily imply that there is an economic loss for the hospital, as expensive cases usually also entail more revenue. by knowing that los is the key cost driver in a drg - based system, an analysis can be performed how many patients meet the average los (alos) of the drg - as defined by the national benchmark - and how many patients stay longer. those patients staying longer are the patients that cost more than the hospital is reimbursed for. tables 6 and 7 display los curves (absolute = red curve, cumulative = brown curve) for 1) all patients in a hospital and 2) patients having a postoperative infection such as wound infections, peritonitis or other or - related infections : los for all patients of a hospital - good result : 76% of all patients can be discharged before reaching the alos (mvd in the figure) los distribution for patients with postoperative infections although the national alos of these drgs is 21.9 days (indicating that the drg - reimbursement is higher than the hospital average) only 50% of these patients can be discharged before alos. that means half of the patients cost presumably more than the hospital is being reimbursed for. using individual patient cases for analysis, the individual drg may be used and the actual antibiotic therapy strategy may be compared versus an optimum setting. quite often it is possible to show that a state - of - the art therapy causes less cost. table 8 shows a case simulation for a given drg - result (a13e - mechanical ventilation 95 - 250 hrs). by examining the medical record, the reviewers found that by optimizing antibiotic therapy (i.e. starting the eventually effective therapy with tigecycline 3 days earlier) the icu - stay and the los could have been 2 days shorter. moreover, by starting the adequate therapy earlier, three days of ineffective and expensive therapy (in this case meropenem plus ciprofloxacin) could have been avoided. in the end, the hospital would have had small gain in this drg rather than a loss as in the original situation. comparing national standard cost (section " inek - daten " in the picture) with actual cost (section " ist - situation ") shows that the hospital spends more than it is reimbursed (-1,881.23). by simulating the case with the optimized therapy option (section " variante " in the picture) the economic result shows a surplus of 1,223.10. drg and individual case - based simulation of optimized antibiotic therapy strategies the findings of other studies and the results from the data easily can be reproduced also in the results of individual case reviews. the main cost drivers are : - length of stay in hospital possible reason : delayed start of effective antibiotic therapy - complications related to antibiotic therapy most frequent : renal failure - use of inadequate antibiotics that turn out to be in effective - prolonged duration of mechanical ventilations decoding infections from drg routine data is feasible, comparatively easy and can be done with little effort of time and expenses as the data are easily available for each hospital. validations in several hospitals were done by using the results and reviewing selected medical records to verify whether the " decoded " infection was actually mentioned in the record. very little variances were found to be due to coding variations. while germany has coding standards for diagnoses and procedures, errors may still occur. the actual accuracy of the coding is very good. according to the medical services of the statuary health insurance in germany (mds) 11% of all hospital drg reimbursements are claimed to be wrong and in 40% of the claims actual errors are found. that means that nearly 96% of the coding is correct, as no claim is issued or no error is found. it is clearly possible to identify cases that are more expensive than the drg system recommends. in many of these cases, sound medical reasons caused the extended los, but there is a substantial part of the reviewed cases that suggest opportunities to optimize the antibiotic therapy strategy. analysis on the basis of drg routine data is an easy way to " decode " infections in a hospital setting and directly connect them to economic results. establishing a peer review of the medical records of cases producing financial loss may identify opportunities to optimize treatment strategies. los, number of complications, icu - days and hours of mechanical ventilation are good endpoints to be used in the assessment of the economical effects of individual antibiotics. alos : average length of stay in a given drg, basis for determining whether a patient causes more costs than reimbursement ; cap : community acquired pneumonia ; cc : complications and comorbidities, conditions (like secondary diagnoses) that cause higher resource consumption ; drg : diagnoses related groups, systems to classify patients based on their resource consumptions ; hap : hospital acquired pneumonia ; hmv : hours of mechanical ventilation ; icu - days : treatment days on an intensive care unit ; los : length of stay in hospital ; mds : medical services of the statuary health insurance in germany ; qaly : quality adjusted life years ; w : with ; w / o : without. | the cost of treatments especially in conditions where multiresistant bacteria are involved are a major issue in times where in most developed countries in the world payment systems based on diagnoses - related - groups (drg) are in place. there is great evidence that especially the length of stay in hospital (los), the time in the intensive care unit (icu - days) and the hours of mechanical ventilation (hmv) are major cost drivers.while established methods of pharmacoeconomical analyses focus on the efficiency of drugs from healthcare system perspective, these data are often not sufficient for improving treatment strategies in a given hospital context.we developed a system that allows the analysis of patients with severe infections on the basis of routine data that is also used for reimbursement. these data contain a lot of information concerning the clinical conditions. by using the icd - coding we developed an algorithm which allows the detection of patients with infections and gives information on the potential financial outcome of these patients. by using the analysis it is possible to identify subsets of infections and the patient records that had a potentially negative drg - result, i.e. the costs are higher than the reimbursement. when identified the patient records undergo a peer review, where the clinical situation and the antibiotic therapy are reviewed by medical experts. in case simulations it is possible to find out if a different therapeutic approach, e.g. by different choices in initial (empirical) antibiotic treatment would have caused other outcomes.data driven analyses together with peer reviews of patient records are a useful tool to examine antibiotic treatment strategies and to establish changes that again can be reviewed on a regular basis. doing this a continous improvement process can be established in hospitals which can lead to a better balance of clinical and economical outcomes in patients with severe infections. moreover these analyses are helpful in assessing the literature on economical benefits of new therapies. |
phacoemulsification and recent advances in cataract surgery techniques led to improved postoperative outcomes. nowadays, along with the improvement in biometry and corneal topography in preoperative examination, patients presenting with cataract can be diagnosed with corneal ectasias, i.e. keratoconus (kc) or pellucid macular degeneration (pmd), a diagnosis that was difficult to be confirmed before. kc is a relatively common, noninflammatory, progressive disorder of unknown etiology, characterized by steepening of the cornea and corneal ectasia, concluding in cone - shaped protrusion of the cornea. it is considered to involve each layer of the cornea and often leads to high myopia and high astigmatism. kc patients usually present in their teenage years or twenties, complaining of progressive visual blur and distortion secondary to myopia and high astigmatism. pmd is an idiopathic, noninflammatory corneal thinning disorder, characterized by an inferior band of corneal thinning with ectasia of the cornea in and around the thinned area and is associated with significant irregular myopic astigmatism. nevertheless, mild cases of kc or pmd may remain undiagnosed until patients are examined for the presence of cataract. pmd and kc treatment may differ according to the stage of the disease, but spectacles or rigid gas - permeable contact lenses are tried initially in kc or pmd eyes, especially in the early to moderate stages. additionally, several treatment modalities have been used for patients with kc or pmd, including lamellar keratoplasty, penetrating keratoplasty, intrastromal corneal ring segments, corneal collagen cross - linking or phakic intraocular lens (iol) implantation, depending on patients age [3, 5, 6, 7, 8, 9 ]. some authors have also used excimer laser in patients with kc, but the safety of this procedure remains controversial. interestingly enough, toric iols have been considered to provide an opportunity to achieve the best distance visual acuity and spectacle independence in cataract patients with high corneal astigmatism, but few reports have been published about toric iols in cataract patients with kc or pmd [11, 12, 13, 14, 15, 16, 17 ]. in light of this, our purpose was to examine the efficacy of toric iol implantation in cataract patients with high astigmatism due to kc or pmd. three cataract patients with kc and pmd (5 eyes) are presented, in which phacoemulsification with toric iol implantation was used to correct high astigmatism, comparing refraction (objective and subjective), visual acuity and corneal topography before and after cataract surgery in a long - term follow - up of 1828 months. a 57-year - old woman presented to our ophthalmology outpatient clinic with a gradually decreased visual acuity in both eyes because of posterior subcapsular cataract. on presentation, best spectacle - corrected visual acuity (bcva) was 2/10 in the right eye and 4/10 in the left eye, with 3.75 3.50 165 and 1.00 3.50 6 subjective refraction in the right and left eye, respectively. automated refractometry showed 4.75 4.25 164 with k1 44.00 at 180 and k2 46.5 at 90 in the right eye and 10.75 5.00 5 with k1 46.00 at 179 and k2 49.75 at 89 in the left eye. corneal topography was performed using orbscan (bausch and lomb inc., rochester, n.y., usa) and revealed a central corneal thickness of 533 mm and an inferior temporal displacement of the thinnest point (512 mm), indicative of kc in both eyes (fig. keratometry (k) values for the steep and flat axis were 47.25 d at 86 and 44.00 d at 176, respectively, in the right eye, and 49.8 d at 84 and 45.6 d at 174, respectively, in the left eye. it is important to mention that kc was stable in this patient for the last 2 years, which had been confirmed by previous corneal topographies. biometry was performed with the iol master (carl zeiss meditec, jena, germany) to calculate the iol power for emmetropia using the sanders - retzlaff - kraff theoretical (srk / t) formula. a web - based toric iol calculator program was used to determine the optimal cylinder power and alignment axis of the iol (available at http://www.acrysoftoriccalculator.com) (fig. 1c). a standard phacoemulsification with toric iol implantation (acrysof sn60t7 alcon, ltd., usa), with a spherical power of 19.5 d and a cylinder power of 4.50 d at the iol plane aligned at 84, was performed in the right eye. in the left eye, a toric iol (acrysof sn60t8) with a spherical power of 16.0 d and a cylinder power of 5.25 d at the iol plane, postoperatively, the bcva was 9/10 with 0.50 sph in the right eye and 8/10 with 1.50 sph in the left eye, which remained stable at the 18-month and 24-month follow - up for the right and left eye, respectively. corneal topography remained almost stable, with k values for the steep and flat axis of 47.5 d at 90 and 43.7 d at 180, respectively, in the right eye, and 50.0 d at 94 and 46.0 d at 4, respectively, in the left eye. the toric iol alignment axis, as determined by slit - lamp biomicroscopy, remained at the same degrees at the end of the follow - up for both eyes (fig. 1d). a 72-year - old woman presented to our outpatient clinic with decreased visual acuity in both eyes. the bcva was 4/10 in both eyes with + 1.00 4.25 90 and + 1.00 5.00 91 in the right and left eye, respectively. automated refractometry showed + 1.50 5.25 106 with k1 40.25 at 92 and k2 54.75 at 2 in the right eye and 8.0 98 with k1 41.75 at 106 and k2 49.50 at 16 in the left eye. 2a, b), which had been known and stable for the last 3 years. k values for the steep and flat axis were 39.28 d at 93 and 54.7 d at 3, respectively, in the right eye, and 39.7 d at 106 and 48.3 d at 16, respectively, in the left eye. a standard phacoemulsification with toric iol was performed in both eyes. in the right eye, a toric iol (acrysof sn60t9) with a spherical power of 9.5 d and a cylinder power of 6.00 d at the iol plane was implanted at an axis of 3. in the left eye, a toric iol (acrysof sn60t9) with a spherical power of 16.5 d and a cylinder power of 6.0 d at the iol plane was implanted at 14. postoperatively, the bcva was 7/10 with 2.50 80 in the right eye and 8/10 with 1.50 100 in the left eye, which remained stable at the 24- and 28-month follow - up for the right and left eye, respectively. corneal topography remained almost stable, with k values for the steep and flat axis of 53.3 d at 180 and 38.5 d at 90, respectively, in the right eye, and 48.6 d at 15 and 39.9 d at 105, respectively, in the left eye. the toric iol alignment axis, as determined by slit - lamp biomicroscopy, was at 5 in the right eye and at 15 in the left eye (fig. the patient was satisfied with the postoperative visual outcomes at the end of the follow - up. a 72-year - old man presented to our outpatient clinic with decreased visual acuity in the right eye due to cataract. the bcva was 3/10 with 2.00 2.00 60. automated refractometry showed 8.00 3.25 58 with k1 42.25 at 62 and k2 45.5 at 152 in the right eye. k values for the steep and flat axis were 47.3 d at 155 and 42.9 d at 65, respectively. a standard phacoemulsification was performed and a toric iol (acrysof sn60t5) with a spherical power of 15.5 d and a cylinder power of 3.00 d at the iol plane was implanted. postoperatively, the bcva was 9/10 with 0.50 0.50 73 in the right eye which remained stable in the 1-year follow - up. corneal topography remained almost stable, with k values for the steep and flat axis of 47.1 d at 155 and 42.8 d at 65, respectively. the patient was satisfied with the postoperative visual outcomes at the 18-month follow - up. altogether, in all cases, there was a significant improvement in bcva, as well as in refraction, which remained stable over time, as illustrated in table 1. specifically, in subjective refraction, all patients achieved bcva from 7/10 to 9/10 with up to 2.50 cyl. no iol misalignment or other complications occurred and all patients were satisfied by the postoperative outcome. written informed consent a 57-year - old woman presented to our ophthalmology outpatient clinic with a gradually decreased visual acuity in both eyes because of posterior subcapsular cataract. on presentation, best spectacle - corrected visual acuity (bcva) was 2/10 in the right eye and 4/10 in the left eye, with 3.75 3.50 165 and 1.00 3.50 6 subjective refraction in the right and left eye, respectively. automated refractometry showed 4.75 4.25 164 with k1 44.00 at 180 and k2 46.5 at 90 in the right eye and 10.75 5.00 5 with k1 46.00 at 179 and k2 49.75 at 89 in the left eye. corneal topography was performed using orbscan (bausch and lomb inc., rochester, n.y., usa) and revealed a central corneal thickness of 533 mm and an inferior temporal displacement of the thinnest point (512 mm), indicative of kc in both eyes (fig. keratometry (k) values for the steep and flat axis were 47.25 d at 86 and 44.00 d at 176, respectively, in the right eye, and 49.8 d at 84 and 45.6 d at 174, respectively, in the left eye. it is important to mention that kc was stable in this patient for the last 2 years, which had been confirmed by previous corneal topographies. biometry was performed with the iol master (carl zeiss meditec, jena, germany) to calculate the iol power for emmetropia using the sanders - retzlaff - kraff theoretical (srk / t) formula. a web - based toric iol calculator program was used to determine the optimal cylinder power and alignment axis of the iol (available at http://www.acrysoftoriccalculator.com) (fig. 1c). a standard phacoemulsification with toric iol implantation (acrysof sn60t7 alcon, ltd., usa), with a spherical power of 19.5 d and a cylinder power of 4.50 d at the iol plane aligned at 84, was performed in the right eye. in the left eye, a toric iol (acrysof sn60t8) with a spherical power of 16.0 d and a cylinder power of 5.25 d at the iol plane, postoperatively, the bcva was 9/10 with 0.50 sph in the right eye and 8/10 with 1.50 sph in the left eye, which remained stable at the 18-month and 24-month follow - up for the right and left eye, respectively. corneal topography remained almost stable, with k values for the steep and flat axis of 47.5 d at 90 and 43.7 d at 180, respectively, in the right eye, and 50.0 d at 94 and 46.0 d at 4, respectively, in the left eye. the toric iol alignment axis, as determined by slit - lamp biomicroscopy, remained at the same degrees at the end of the follow - up for both eyes (fig. a 72-year - old woman presented to our outpatient clinic with decreased visual acuity in both eyes. the bcva was 4/10 in both eyes with + 1.00 4.25 90 and + 1.00 5.00 91 in the right and left eye, respectively. automated refractometry showed + 1.50 5.25 106 with k1 40.25 at 92 and k2 54.75 at 2 in the right eye and 8.0 98 with k1 41.75 at 106 and k2 49.50 at 16 in the left eye. 2a, b), which had been known and stable for the last 3 years. k values for the steep and flat axis were 39.28 d at 93 and 54.7 d at 3, respectively, in the right eye, and 39.7 d at 106 and 48.3 d at 16, respectively, in the left eye. a standard phacoemulsification with toric iol was performed in both eyes. in the right eye, a toric iol (acrysof sn60t9) with a spherical power of 9.5 d and a cylinder power of 6.00 d at the iol plane was implanted at an axis of 3. in the left eye, a toric iol (acrysof sn60t9) with a spherical power of 16.5 d and a cylinder power of 6.0 d at the iol plane was implanted at 14. postoperatively, the bcva was 7/10 with 2.50 80 in the right eye and 8/10 with 1.50 100 in the left eye, which remained stable at the 24- and 28-month follow - up for the right and left eye, respectively. corneal topography remained almost stable, with k values for the steep and flat axis of 53.3 d at 180 and 38.5 d at 90, respectively, in the right eye, and 48.6 d at 15 and 39.9 d at 105, respectively, in the left eye. the toric iol alignment axis, as determined by slit - lamp biomicroscopy, was at 5 in the right eye and at 15 in the left eye (fig. the patient was satisfied with the postoperative visual outcomes at the end of the follow - up. a 72-year - old man presented to our outpatient clinic with decreased visual acuity in the right eye due to cataract. the bcva was 3/10 with 2.00 2.00 60. automated refractometry showed 8.00 3.25 58 with k1 42.25 at 62 and k2 45.5 at 152 in the right eye. k values for the steep and flat axis were 47.3 d at 155 and 42.9 d at 65, respectively. a standard phacoemulsification was performed and a toric iol (acrysof sn60t5) with a spherical power of 15.5 d and a cylinder power of 3.00 d at the iol plane was implanted. postoperatively, the bcva was 9/10 with 0.50 0.50 73 in the right eye which remained stable in the 1-year follow - up. corneal topography remained almost stable, with k values for the steep and flat axis of 47.1 d at 155 and 42.8 d at 65, respectively. the patient was satisfied with the postoperative visual outcomes at the 18-month follow - up. altogether, in all cases, there was a significant improvement in bcva, as well as in refraction, which remained stable over time, as illustrated in table 1. specifically, in subjective refraction, all patients achieved bcva from 7/10 to 9/10 with up to 2.50 cyl. no iol misalignment or other complications occurred and all patients were satisfied by the postoperative outcome. in this case series, we present 3 cases with cataract and high astigmatism due to nonprogressive kc (2 eyes) or pmd (3 eyes), who underwent cataract extraction and toric iol implantation. the principal message is that all patients showed a marked improvement in bcva and subjective refraction, while corneal topography findings remained stable during the follow - up period of 1828 months. therefore, phacoemulsification with toric iol implantation seems to be an effective method in correcting high astigmatism in cataract patients with stable kc or pmd. although there are several new effective techniques to correct astigmatism due to kc or pmd, the correction of high astigmatism in cataract patients presenting with kc or pmd continues to be challenging. reduced visual acuity due to kc or pmd is initially managed with spectacles or contact lenses, either toric or rigid gas - permeable lenses, to mask the irregular astigmatism. intracorneal ring segments (icrs) have recently been approved for reduction of myopia and irregular astigmatism due to kc, improving objective visual outcomes and restoring functional vision [3, 7 ]. nevertheless, icrs have been reported to present complications, such as epithelial defects, anterior and posterior perforations during channel creation, extension of incision toward the visual axis, shallow placement of implants, infectious keratitis, stromal thinning, epithelial breakdown, corneal melting or intrastromal deposits, and are not used as a primary treatment in cataract patients [3, 7 ]. furthermore, after icrs implantation, high refractive errors may remain and most patients require spectacles or contact lenses again. on the other hand, phakic iols or artisan phakic iols were used for the correction of astigmatism in young patients with kc, providing encouraging results, although they could only be used in cases with stable kc [3, 6 ]. an option in patients with kc and a clear natural lens is refractive lens exchange with a toric iol implantation in the capsular bag. in addition, corneal collagen cross - linking was used effectively to stabilize the biomechanically weakened collagen in kc ; however, this technique can only be used in young patients and its effect is not distributed homogenously over the corneal depth. interestingly, few cataract patients with kc or pmd and toric iol implantation for the correction of astigmatism have been reported [4, 5, 13, 14, 15, 16 ]. cataract surgery with a toric iol implantation can be a suitable option to correct high levels of astigmatism and myopia in patients with kc if the risk of progression is minimal [4, 18, 19 ]. before implanting the toric iol, a careful history taking is needed to explore the level of bcva the patient had before cataract formation occurred and to determine whether signs of kc progression are present [18, 19 ]. risk factors that have been associated with progression of kc include young age, a positive family history of kc, steep keratometric values at baseline, changes in refractive error and possibly eye rubbing. in practice, clinical findings and corneal topography abnormalities, such as a high central k value and an increased amount of steepening of the inferior cornea compared with the superior cornea, may be used to assess the risk of progression. because of the age of the 3 patients presented in our case series, we regarded the risk of progression to be minimal. acrysof toric iol is considered to be one of the most commonly used toric iol in cataract surgery. it has been found to be effective in the reduction of refractive astigmatism, providing good visual outcomes. the acrysof toric iol is available in cylinder powers up to 6.0 d (sn60t9) at the iol plane, corresponding to 4.11 d at the corneal plane. it is hydrophobic acrylic with open - loop modified l - haptics and 6.0 mm optic diameter. the axis marks on the iol indicate the flat meridian of the toric component on the posterior surface of the iol. another challenge in cataract patients with kc or pmd with high astigmatism and myopia is iol power calculation. corneal topography is a valuable diagnostic tool for diagnosing subclinical kc, providing data for kc screening and progression of the disease, including anterior and posterior evaluation and best - fit sphere, corneal pachymetry, as well as k values. because of the irregular astigmatism in our patients, we used the k values and axis obtained with the orbscan and then compared them with those derived from the iol master, finding no significant differences. compared the srk ii and srk / t iol formulas in patients with kc and suggested that the srk ii formula might provide the most accurate iol power in patients with mild kc. however, in moderate and severe kc, iol calculations were less accurate and no differences in calculation formulas could be found. as far as the axis is concerned, we have not seen any iol rotation, in line with other studies suggesting that iol rotation is < 4. a potential limitation pertains to the fact that the number of cases reported here is not adequate enough to prove the efficacy of this method for the correction of astigmatism in cataract patients with kc or pmd. moreover, one should take into account that the improvement in bcva derives not only from the correction of refractive astigmatism due to kc, but also from the removal of cataract. in conclusion, our case series suggests that phacoemulsification with toric iol implantation in cataract patients with stable kc or pmd seems to be effective in correcting high astigmatism and achieving optimal visual outcomes. additionally, orbscan is considered an accurate tool for obtaining k values, showing no significant differences compared to iol master. further studies with a larger sample size should be performed to confirm the long - term efficacy and stability of toric iol implantation in patients with cataract and a presumably stable kc or pmd. | our purpose was to examine the long - term efficacy of toric intraocular lens (iol) implantation in cataract patients with high astigmatism due to corneal ectasia, who underwent phacoemulsification cataract surgery. five eyes of 3 cataract patients with topographically stable keratoconus or pellucid macular degeneration (pmd), in which phacoemulsification with toric iol implantation was used to correct high astigmatism, are reported. objective and subjective refraction, visual acuity measurement and corneal topography were performed in all cases before and after cataract surgery. in all cases, there was a significant improvement in visual acuity, as well as refraction, which remained stable over time. specifically, in subjective refraction, all patients achieved visual acuity from 7/10 to 9/10 with up to 2.50 cyl. corneal topography also remained stable. postoperative follow - up was 1828 months. cataract surgery with toric iol implantation seems to be safe and effective in correcting astigmatism and improving visual function in cataract patients with topographically stable keratoconus or pmd. |
to report a case of frosted branch angiitis (fba) secondary to neuro - behet. description, diagnosis, angiogram imaging and follow - up of a 28-year - old female with fba. frosted branch angiitis is a clinical term applied to three conditions : infiltration of vessels by malignant cells, and sheathing of vessels either secondary to an active disorder or subsequently to a previous inflammatory disease. our patient 's history of two optic neuropathies and the lack of demyelinating signs in neuroimaging made us consider fba in the context of neuro - behet. recognition of the category of fba from the clinical signs is essential to establish the correct diagnosis and prescribe the appropriate treatment. frosted branch angiitis (fba) has been classically considered a disorder characterized by acute panuveitis with vasculitis. fba onset is sudden and patients complain of painless vision loss, floaters and photopsias. severe vascular sheathing, as seen on a fundus image, is characteristic of this disorder. it is generally associated with retinal edema and deep retinal hemorrhages. since its first description in 1976, the term frosted branch angiitis has been indistinctly used in the literature to describe different conditions where fundus imaging discloses an unusual thick sheathing surrounding the retinal vessels. a 28-year - old female presented to our department complaining of progressive visual loss in both eyes (ou) for 2 days. she had a personal history of anterior ischemic optic neuropathy in the right eye (od) 5 years ago. the ophthalmic examination disclosed decreased visual acuities (va) ou : 20/200 od and 20/120 in the left eye (os). the intraocular pressure ou was normal along the process. on slit - lamp examination, inflammation was seen in the anterior chamber (cells 2 +) and in the vitreous (cells 2 +) ou. fundus examination showed severe sheathing of retinal vessels, retinal hemorrhages, roth 's spots and macular edema ou (fig. the intense and acute flare of vasculitis led us to consider a case of fba, and a set of proofs were requested. serology for hepatitis b and c viruses, human immunodeficiency virus (hiv), syphilis, cytomegalovirus (cmv), epstein - barr virus (ebv), toxoplasma and mantoux test were negative as well as anti - nuclear and anti - neutrophil cytoplasmic antibodies. next, computerized tomography (ct) and magnetic resonance imaging (mri) were requested to rule out involvement of the central nervous system and demyelinating disease, respectively. neither did disclose any abnormality. finally, the pathergy test was performed and was positive (erythematous papules 3.5 mm 48 h after the prick). the suspected diagnosis was fba secondary to behet 's disease and neuroimaging did not demonstrate demyelinating signs. (weight : 65 kg, cyclosporine dose : 4.6 mg / kg / day), dexamethasone eye drops each 2 h and homatropine eye drops t.i.d. only 24 h after starting steroids, the inflammation of the vessels improved considerably (fig. improvement was also seen on fluorescein angiography (fa) which disclosed macular edema ou, no vasculitis, and late peripapillary staining 1 day after the inflammation started. seven days after the regimen started, the patient remained with the same va ou, but the inflammation enhanced both in the anterior chamber (cells 0.5 +) and in the vitreous (cells 0.5 +). moreover, funduscopy disclosed a macular star, temporal atrophy on the optic nerve and temporal peripheral hemorrhages associated with exhausted vessels at that level ou (fig. the patient was kept on that regimen until 3 weeks later when steroids were tapered slowly during 3 months. four months after her problems started, the patient presented a significant va improvement (od 20/20 and os 20/20) and no intraocular inflammation. ocular fundus imaging disclosed some hard exudates where macular stars were and mottling of the retinal pigment epithelium at the fovea level. fa only showed an ischemic zone in the temporal retina which produced a peripheral scotoma in the visual fields performed (fig. 2). the patient remained relapse - free for over 1 year, then immunomodulatory therapies (imts) were slowly tapered. however, after 9 months when she was on 100 mg a day of that regimen, decreased vision and scotomas od were noted. after a complete examination and imaging tests, she was diagnosed with ischemic posterior optic neuropathy. the patient started again with steroids, and cyclosporine was increased until 300 mg a day, which totally restored va in 7 days. thus, our patient is currently diagnosed with and followed - up like a case of neuro - behet. first described this disorder in 1976 in a 6-year - old boy with severe bilateral white sheathing of all retinal vessels, which inspired the term frosted branch angiitis. just around 60 cases worldwide have been published up to date. the prevalence of this disorder depends on the country : in japan affected patients are usually aged 616 years. on the other hand, the reports on cases published from other countries, mostly caucasian individuals, described a late onset of this disorder (usually in the third decade). there are several agents and disorders which have been postulated to be causal agents or triggering factors of this entity (table 1). the term frosted branch angiitis became confusing over time because it was used to denote an specific disorder as well as just a kind of funduscopic image. the term remained confusing until 1997 when kleiner postulated a new differentiation and classification. the first one, frosted branch appearance, denotes a funduscopic image in entities such as leukemia and lymphoma. in these disorders, this appearance is due to infiltration of the vessel walls by malignant cells and not by an inflammatory process. the second category of fba is called frosted branch response, in which a real vasculitis secondary to active infections or autoimmune diseases is observed (table 1). the third category is acute idiopathic frosted branch angiitis, which affects healthy young individuals who have had a infectious precedent which is held capable of causing a subsequent vascular inflammation. this precedent responsible for triggering that secondary vasculitis usually is a flu - like illness, but hepatitis b vaccination, mumps, swine flu vaccination, and bacterial infection can also be responsible for initiating the inflammatory process. therefore, a hypersensitivity to microbial antigens is the hypothesis most accepted in this subtype of fba. 1). if a specific causal agent is found, it will have to be treated at the same time. on the other hand, if an autoimmune disease is the cause of the fba, imts will be the first choice. according to kleiner 's classification skin folliculitis, recurrent aphthous ulcers, positive pathergy and hla b51 suggest the possibility of an underlying behet 's disease. furthermore, the patient met the requirements according to the international criteria for the diagnosis of behet 's disease and cases secondary to this disease have been published. in fact, the two cases of optic neuropathy support the theory of neuro - behet. the second flare of neuritis when cyclosporine was tapered would also support the diagnosis. moreover, there have already been cases of optic neuritis in neuro - behet [6, 7 ]. on the other hand, the typical neurologic manifestations and neuroimaging signs of neuro - behet therefore, our patient will be monitored closely and biologic therapies are, up to the present, stopped. the patient is currently on 300 mg of cyclosporine a day (weight : 65 kg, dose : 4.6 mg / kg / day) and is asymptomatic again. two other cases of fba secondary to behet 's disease have already been published [9, 10 ]. one case was treated with oral prednisolone and colchicine, which proved effective to control the inflammation. the other case was a pregnant patient in whom it was not possible to use any immunomodulatory therapy and where the disease spontaneously resolved. in our case we could have used other imts but we decided to use cyclosporine because we had had good results with it in behet cases. in summary, recognition of the correct category of fba from the clinical signs is essential to prescribe appropriate treatment. that is, in frosted branch appearance cases, therapeutic procedures to treat the malignant disorder should be the main goal. in frosted branch response cases, finding and treating for acute idiopathic fba cases, treating the ocular finding in order to avoid later complications should be our main aim. thus, we have to keep in mind the characteristic fundus images for each category in order to choose the proper treatment. | purposeto report a case of frosted branch angiitis (fba) secondary to neuro-behet.methodsdescription, diagnosis, angiogram imaging and follow - up of a 28-year - old female with fba.resultsfrosted branch angiitis is a clinical term applied to three conditions : infiltration of vessels by malignant cells, and sheathing of vessels either secondary to an active disorder or subsequently to a previous inflammatory disease. our patient 's history of two optic neuropathies and the lack of demyelinating signs in neuroimaging made us consider fba in the context of neuro-behet.conclusionrecognition of the category of fba from the clinical signs is essential to establish the correct diagnosis and prescribe the appropriate treatment. |
the students were assured that scores obtained by them in this study would not be counted for internal assessment of university. a sample size analysis was done at the initiation of the study. as per our pilot study, the standard deviation of marks was estimated to be approximately two. based on a two tailed a of 0.05 and power of 80%, it was determined that 64 students were required to detect 1 of difference in the outcome variable. on the assumption of an overall rate of loss to follow up of about 10% the topic for the tutorial was chemotherapy. as per institute timetable and distribution of students, of total students (n = 171), roll numbers 170 were in group a and 71 onward were in group b. after the completion of series of lecture classes on chemotherapy, a preintervention test on the topic was taken for all the students. the groups were allotted either slot intervention or cts controls, following toss of a coin. students from interventional group (slot) were divided into small teams, each team having five or six students. each team selected a team leader who was to collect the subtopic(s) of the preceding lecture topic (chemotherapy) for their team. each team was given instructions to study the given subtopic(s) and prepare five multiple choice questions (mcqs) in powerpoint format so that they could be presented in the slot session. the students were to contact the lecturers (who had a prior training in preparing mcqs) for any clarification regarding the preparation of mcqs for slot. a flowchart depicting division of group to teams and allocation of subtopic for the first slot session is shown in figure 1. a format of mcq slides given as a guide to the teams who were preparing for their slot session is illustrated in figure 2. model flowchart depicting division of interventional group into teams and allocation of respective subtopics for the first session of student - led objective tutorial format of multiple choice question slides for student - led objective tutorial session on the allotted day of the tutorial, students of all the teams of interventional group (slot) assembled in the department lecture hall. session for team 14 was conducted on the 1 day of tutorials (teams 512 represented audience). session for team 58 was conducted on the 2 day of tutorials (teams 912 and 14 represented audience). session for team 912 was conducted on the 3 day of tutorials (teams 18 represented audience). the teams were invited to take their seats as per their number got through lots. the students of group a were communicated in advance that individual and team winners would be appreciated at the end of slot session so that they would come prepared for the topic of that day. the first mcq was posed by the leader of team 1 directly to team 2. the other teams, namely, 3 and 4 observed. the time given for direct question was 1 min and indirect question was 10 s. the marks given were 15 for direct correct answer. if the question was unanswered by team 2, the question was passed on to subsequent teams in pursuit of getting correct answer. it passed to team 3, and if team 3 answered it right, 10 marks were given. if team 3 did not answer it correctly, it passed to team 4, and if they answered it right, they got 5 marks. the next slide displayed the correct answer even if team 4 gave the wrong answer. there was a decrease in the award of marks as question passed because the subsequent teams could exclude the previous distractors. team 1 continued the second question starting from team 3 and the third question from team 4 so that each team had a chance to get direct question. the slot session went on for 6080 min. at the end of slot session for that particular day, the individual and team winners were called on the dais and appreciated with a round of applause. similar sessions went on for three consecutive tutorial classes and all the seventy students of group a got a chance to be in groups who prepared and presented mcqs. the scores achieved by teams in slot were only to enhance learning and develop competitive spirit. they were neither counted in the analysis of this study nor for internal assessment of university. at the end of the third slot session, a prevalidated and pretested anonymous questionnaire was distributed to the students to know their perceptions on slot. the responses were obtained on a 5 point likert scale (1 for strongly disagree to 5 for strongly agree). open ended questions, for example, the best aspects and areas for improvement of slot were also included in the questionnaire. the students were divided into 5 teams with 14 or 15 students in each team. there was a teacher (cum facilitator) for each team who divided each team further into 3 subteams containing 4 or 5 students in each subteam. the teacher posed short questions on the allotted topic which the subteams had to answer in turns. they were mainly teacher centric. at the end of all tutorial sessions (both slot and ct) for chemotherapy, a postintervention test was taken for both a and b group students. the pattern and questions in all, our study went on for five tutorial classes which included a preintervention test, three slot sessions (or three ct for controls), and a postintervention test. whitney test was used for comparing differences between groups a and b, and wilcoxon matched pairs signed ranks test was used to compare pre and post intervention scores. hence, for ethical reasons, slot was conducted for control group also, after the completion of our study. students from interventional group (slot) were divided into small teams, each team having five or six students. each team selected a team leader who was to collect the subtopic(s) of the preceding lecture topic (chemotherapy) for their team. each team was given instructions to study the given subtopic(s) and prepare five multiple choice questions (mcqs) in powerpoint format so that they could be presented in the slot session. the students were to contact the lecturers (who had a prior training in preparing mcqs) for any clarification regarding the preparation of mcqs for slot. a flowchart depicting division of group to teams and allocation of subtopic for the first slot session is shown in figure 1. a format of mcq slides given as a guide to the teams who were preparing for their slot session is illustrated in figure 2. model flowchart depicting division of interventional group into teams and allocation of respective subtopics for the first session of student - led objective tutorial format of multiple choice question slides for student - led objective tutorial session on the allotted day of the tutorial, students of all the teams of interventional group (slot) assembled in the department lecture hall. session for team 14 was conducted on the 1 day of tutorials (teams 512 represented audience). session for team 58 was conducted on the 2 day of tutorials (teams 912 and 14 represented audience). session for team 912 was conducted on the 3 day of tutorials (teams 18 represented audience). the teams were invited to take their seats as per their number got through lots. the students of group a were communicated in advance that individual and team winners would be appreciated at the end of slot session so that they would come prepared for the topic of that day. the first mcq was posed by the leader of team 1 directly to team 2. the other teams, namely, 3 and 4 observed. the time given for direct question was 1 min and indirect question was 10 s. the marks given were 15 for direct correct answer. if the question was unanswered by team 2, the question was passed on to subsequent teams in pursuit of getting correct answer. it passed to team 3, and if team 3 answered it right, 10 marks were given. if team 3 did not answer it correctly, it passed to team 4, and if they answered it right, they got 5 marks. the next slide displayed the correct answer even if team 4 gave the wrong answer. there was a decrease in the award of marks as question passed because the subsequent teams could exclude the previous distractors. team 1 continued the second question starting from team 3 and the third question from team 4 so that each team had a chance to get direct question. the slot session went on for 6080 min. at the end of slot session for that particular day, the individual and team winners were called on the dais and appreciated with a round of applause. similar sessions went on for three consecutive tutorial classes and all the seventy students of group a got a chance to be in groups who prepared and presented mcqs. the scores achieved by teams in slot were only to enhance learning and develop competitive spirit. they were neither counted in the analysis of this study nor for internal assessment of university. at the end of the third slot session, a prevalidated and pretested anonymous questionnaire was distributed to the students to know their perceptions on slot. the responses were obtained on a 5 point likert scale (1 for strongly disagree to 5 for strongly agree). open ended questions, for example, the best aspects and areas for improvement of slot were also included in the questionnaire. the students were divided into 5 teams with 14 or 15 students in each team. there was a teacher (cum facilitator) for each team who divided each team further into 3 subteams containing 4 or 5 students in each subteam. the teacher posed short questions on the allotted topic which the subteams had to answer in turns. they were mainly teacher centric. at the end of all tutorial sessions (both slot and ct) for chemotherapy, the pattern and questions were same as preintervention test. in all, our study went on for five tutorial classes which included a preintervention test, three slot sessions (or three ct for controls), and a postintervention test. whitney test was used for comparing differences between groups a and b, and wilcoxon matched pairs signed ranks test was used to compare pre and post intervention scores. students should not be deprived of the benefits of a successful intervention. hence, for ethical reasons, slot was conducted for control group also, after the completion of our study. all the 2 year undergraduates (n = 141) consented for participating in the study. the interventional group slot (n = 70) was group a while control group ct was group b (n = 71). there was no difference in preintervention marks of both groups (5.1 2 vs. 5 2, p = 0.97). there were some students who were absent in preintervention test and some in postintervention test. on pairing, it was found that 65 students of group a (interventional group) were present in both tests while 66 from group b (control group) were in both tests. the mean marks of students in group a improved considerably (from 5.1 2 to 11.2 1.8, p < 0.0001). in group b, they improved only to some extent (from 5 2 to 7.2 2, p < mean marks obtained by students in pre- and post - intervention tests the total faculty requirement for ct was five, while for slot, it was three (one tutor and two lecturers). feedback was taken from students (n = 67) who were present in the third session of slot [table 2 ]. students (78%) agreed that they learned better in slot when compared to ct and that it involved active learning in groups. the opinion of teachers (n = 12) on slot is presented in table 3. feedback on slot was also positive from teachers, but they opined that preparation for slot is time consuming and needs costly equipment. students feedback (positive)$ on student - led objective tutorial (n=67) opinions of teachers on student - led objective tutorial (n=12) it was compared with ct in terms of improving the academic performance of students. in our pilot study, we had randomized all the students of interventional group to various teams. hence, in the present study, students of group a (n = 70) were divided into teams in line with their roll numbers. the seating arrangement (on seats i iv) of four teams who presented mcqs for that particular slot session in the lecture hall was randomized. in our study, the mean marks of students in group a improved by 31% (from 5.1 to 11.2). in group b, our study is similar to a study which also states that knowledge retention improves with interactive teaching learning. it is also similar to a study, in which group activity was strongly correlated with students grades in exams. however, it differs from another study that shows no differences in outcomes for directed and self directed learning. our study also differs from another study which states that small group tutorials can lead to more satisfaction but may not give better exam results. in our study, there was an improvement in control group (ct) also, probably, because of self learning skills of students and possibly because of some motivated students who had prepared the topic that was given a week in advance. in our study, student learning occurred not only during slot preparation (intragroup) but also during the presentation (intergroup). as there were teams and audience, the content reached all of them uniformly the students (61%) enjoyed working with a team and contributed to teams success. in another study, the physicians in small group session performed better than the lecture or in large groups. another study mentions that students self directedness was more in small and medium size groups but not in large groups. in yet another study, learning accounted for 80% of the interactions in group tutorials this shows that group learning improves academic performance. in our study, during slot sessions, the lecturers guided the discussions and intervened if there was a need for clarification. a majority of students (60%) agreed that guidance by lecturers during slot sessions was useful. in another study in australia, students had an intragroup discussion and the tutor facilitated discussions and clarified their queries but did not lead it or take it over. in another study in sri lanka, scenarios were used for subject discussion while faculty only moderated and guided the discussion. a study mentions that a good tutor needs to have qualities such as establishing rapport with students, allowing adequate time for discussion, has content expertise to guide the students well. in our study, in their feedback on slot, students mentioned of such qualities in teachers and were satisfied with their guidance. whenever a new teaching method is introduced our students also faced a few difficulties in the first slot session, for example, in preparing mcqs, preparing powerpoint slides, etc. some students (39%) complained that all the team members did not actively contribute to mcq preparation or cooperate out of the classroom. difficult personalities, lack of cooperation or interaction can inhibit group function. a study shows that about 96% of graduates, who were student tutors previously, were active participants of academic programs. this could help the groups analyze and learn from their behaviors. in our study, students (78%) agreed that they learned better in slot when compared to ct. in yet another study, students (79%) perceived that modified tutorials improved understanding as compared to traditional teaching methods which is similar to our study. in our study, 63% students wanted to have more slot sessions which is less than another study, in which most of the students (79%) wanted similar sessions in future. looking at the enthusiasm of students, we conducted slot sessions for subsequent batches in our department, whenever it was feasible. in open ended questions, slot induced active participation by the students. the best aspects of slot, as mentioned by students (76%), were that it improved learning skills. the areas where slot can be improved, as mentioned by students, were either to reduce the time allotted for slot or to have them when there was at least a month for their terminal exams. the academic benefit of slot sessions was that the teams prepared mcqs related to their subtopic, and to score more, they also prepared other subtopics. intergroup interactions and competitive spirit were also distinctly observed in yet another study at wardha. in ct, if group size is large, they become mini lecture sessions. in such situations, the students hardly get a chance to reply to questions posed and improve communication skills. some students who do not come prepared for the tutorial and could easily go unnoticed. in ct, tutors with different experience and knowledge, conduct tutorials on the same topic, so students are subjected to some amount of bias. in contrast, in slot, there is uniformity in sharing of information by the entire class. slot also helps students in improving skills for answering mcqs which could help them in future competitive exams. short video and audio clips can be hyperlinked to make slot, a multimedia tutorial. the strength of the study is that intervention (slot) has been compared with control (ct) prospectively. slot is student centric and an active learning method involving group work, while in ct, learning is mainly passive and teacher centric. slot is an interesting method of conducting tutorials that promote active learning through group work. | objectives : students learn in a better way if they are involved in active learning. hence, the study was designed to introduce student - led objective tutorials (slots) as an alternative to conventional tutorials (cts) in pharmacology and to compare slot and ct on outcomes such as improved score in tests, active involvement of students, and faculty requirement of each.materials and methods : didactic lectures taken on a topic in pharmacology were followed by a preintervention test for a batch of the 2nd year medical undergraduates. they were allotted either in slot or ct group. for a slot session, students of group a (interventional group) were divided into teams and each team prepared five multiple choice questions on the given topic in powerpoint format, which were presented to other teams and audience. the proceedings were facilitated by two lecturers. group b undertook ct (controls). a postintervention test was then taken for both groups. feedback was sought from students and teachers on slot.results:the total marks for the test were 20. the mean marks in group a improved by 31% (from 5.1 to 11.2). in group b, they improved by 11% (from 5 to 7.2). academic performance following slot was better than ct. students (63%) favored slot as it stimulated their interest in the topic, improved self - learning skills, and teamwork. the teachers also favored slot for similar reasons.conclusion:slot leads to greater satisfaction and better performance in tests. slot is an effective alternative to ct to promote active learning among students through group work. it helps overcome the logistic difficulties due to faculty shortage. |
in varied contexts, the assessment of alcohol misuse needs screening efforts, and in those positive, for subsequent evaluation of severity. screening is necessary to identify subjects at risk particularly in the early phase of drinking. it helps in identifying both hazardous and harmful users. in general, the screening instruments are sensitive to low - level misuse of a substance, suitable for detecting potential abuse, and dependence but may not necessarily be a measure of severity by themselves. there have been many screening instruments available to screen problem drinkers. in india alcohol use disorder identification test (audit), cage, and michigan alcoholism screening test (mast) have been commonly used. the severity instruments are useful in subjects with significant misuse and also help monitor treatment outcomes, but may not be sensitive to low - level use. the interview formats include alcohol section of the schedules for clinical assessment in neuropsychiatry and addiction severity index. the questionnaire method has depended on severity of alcohol dependence data (sadd) and severity of alcohol dependence questionnaire (sadq). as mentioned above, it was primarily designed to identify people with hazardous and harmful consumption before the onset of physical dependence or psychological problems. it is 10 items instrument derived from a 150 item interview schedule. after a detailed statistical analysis and face validity, 10 items were selected which assess three conceptual domains that include alcohol consumption (items 13), dependence (items 46), and alcohol - related problems (items 710). it has been validated in six countries, standardized cross - nationally, and has cross - cultural applicability. it is the only instrument designed to be used internationally, focuses on recent use of alcohol and consistent with the international classification of disease tenth revision 's (icd-10) definition of harmful use and dependence pattern. it has been used by indian researchers, and has been validated in the urban community in the north india. there are many studies, which have used audit in the general population, family practice and primary care centers ; however, there are only a few studies in clinical groups where the audit scores are high. w.h.o has also divided the audit scores into four zones (07, 815, 1619, 2040) and suggest that higher levels such as 2040 require referral to specialist center for diagnostic evaluation and further management. however, few studies have demonstrated that audit can be used as a severity scale beyond its role as a screening instrument. studied the utility of audit as a severity measure after incorporating it with a health risk screening questionnaire. they found that it was able to identify at - risk drinkers and alcohol - dependent individuals in primary care settings. donovan. demonstrated that audit can be used as a brief and a sensitive index of severity of dependence in alcohol - dependent individuals in outpatient treatment settings. using a secondary data analysis of a cross - sectional study of adult family medicine outpatients found that men in the audit severity zones of 510, 1114, and 1540 was able to predict past - year of alcohol dependence ranging from 18% to 87% and three - fourth of those in the highest zone (1540) met the standardized interview criteria for the past - year alcohol dependence. found that audit was able to discriminate dependent patients (with audit 13 for males, sensitivity 70.1%, specificity 95.2%, positive predictive value (ppv) 85.7%, negative predictive value (npv) 94.7%, and for females sensitivity 94.7%, specificity 98.2%, ppv 100%, npv 99.8%) ; and hazardous drinkers (with audit 7, for males sensitivity 83.5%, specificity 79.9%, ppv 55.0%, npv 82.7% ; and with audit 6 for females, sensitivity 81.2%, specificity 93.7%, ppv 64.0%, npv 72.0%) compared to mast and cage in a primary care settings. an epidemiological survey by guo. in the tibetan population concluded that audit performed better as a screening instrument for alcohol abuse than for alcohol dependence. sadq is a 20 item questionnaire based on the concept of alcohol dependence syndrome formulated by edwards and gross. according to them, alcohol dependence is a unitary syndrome centered on the drive to consume alcohol, and this drive is focused upon the need to drink to avoid or alleviate alcohol withdrawal. the original sadq is divided into five sections corresponding to (i) physical withdrawal symptoms, (ii) affective symptoms of withdrawal, (iii) craving and withdrawal relief drinking, (iv) typical daily consumption and (v) reinstatement of withdrawal symptoms after a period of abstinence. previous studies have used various biological parameters for screening and evaluating the severity of alcoholism. such measures include mean corpuscular volume, aspartate aminotransferase (ast), alanine aminotransferase (alt), gamma - glutamyltransferase (ggt), and uric acid. studies have argued that severity and screening instruments are better than biological markers alone and are lesser expensive. many studies have tried a combination of questionnaires and biochemical markers. in a study by dolman and hawkes, they found that using a combination of audit, ast, and ggt increased the sensitivity to 70.6%, specificity to 98.8%, ppv to 54.5%, and npv to 99.4% compared to other combinations. audit and sadq were used as part of a recent study, in a variety of inpatients who reported using alcohol heavily. in this report, we have attempted to address the issue of whether audit and sadq assess overlapping or different aspects of alcohol dependence. primarily, we have explored audit as a severity measure in the indian context by studying its association with sadq. we have also compared the nature of the relationships of each of the measures with independent clinical and biochemical markers related to alcohol use. male patients between the age group of 20 and 50 years who got admitted for alcohol - related problems in medical, surgical, orthopaedics and psychiatric wards in a tertiary care center were interviewed. subjects who scored 8), most of the studies are done on community samples, very few on subjects with established dependence and only few studies have validated audit concurrently with measures of problem severity. based on the above findings, we feel that audit does not demonstrate the ability to detect certain clinical aspects of alcoholism. however, audit may still be useful in studies where the focus is on the severity of medical aspects of alcoholism. on the other hand, sadq is more useful in studies where the focus is on clinical variables of alcoholism such as family history, ages of onset, and duration of alcohol dependence. in our study, more than ggt, the tb, cb, ast, and ast / alt ratio were found to be significantly different between the wards. expectedly, subjects from the nonpsychiatry ward had more liver dysfunction than those in psychiatry ward. audit total score was correlating with both bilirubin (tb and cb), but the sadq did not. this supports the idea that audit is more likely to succeed than sadq in identifying significant physical dysfunction associated with alcoholism. a study by potamianos. has reported that sadq correlated well with ethanol consumption but not with hematological parameters or hepatic toxicity. similarly in another study by wodak., it was found that severity of alcohol dependence correlated with alcohol intake but negatively correlated with liver disease ; thus, suggesting that audit scores relate better with physical parameters. a study by smith. found that the sadq detected severe alcohol dependence in only 9% of alcohol liver disorder group compared to 76% in the detoxification group, thereby suggesting that patients with severe ald may not have as many features of dependence as seen in those admitted primarily for behavioral reasons. the ald group were found to be older (mean 50 years), consumed lower levels of alcohol (348 units/30 days), and had a later age of onset. in fact, many authors have attempted to screen for dependence using different cut - offs on audit ranging from 11 to 24 but no consensus has been reached. despite the study by rubinsky., audit scores that can best predict the severity of alcohol use disorders or the presence of dependence with physiological manifestations as defined by icd-10, are yet to be firmly established. based on previous studies and our own findings, we are inclined to believe that audit may be able to screen for medical complications of alcohol use disorders, but may not detect severity based on other clinical aspects of alcoholism. a community - based study using audit along with known severity indicators may help address this question comprehensively. from the above, it appears that sadq and audit may be tapping two differing impacts of heavy alcohol use clinical and biomarkers. it appears that audit may prove useful as a tool to assess severity in those with medical complications. some of the limitations of this study are that it was a post hoc analysis of another study ; we included patients whose audit scores were more than 8 and not the full spectrum of audit. our study was not primarily designed to confirm if two subtypes of alcohol - related problems exist at all. the two scales, audit and sadq may be assessing two different aspects of dependence. sadq could be more useful in studies looking at withdrawal related severity and clinical variables of alcoholism ; audit could be more suitable for a more comprehensive evaluation of alcoholism - related medical problems. this needs to be confirmed in larger unselected samples from different community and clinical settings. | background and objectives : we have analyzed extant data to see if alcohol use disorder identification test (audit) and severity of alcohol dependence questionnaire (sadq) assess overlapping aspects of alcoholism, and how they relate to lab measures of alcoholism.materials and methods : consecutive male patients between 20 and 50 years were recruited from varied departments of a general hospital. audit and sadq, as well as liver function tests, were part of the data obtained.results:despite, a significant correlation between total scores of sadq and audit (= 0.188, p < 0.021) and some of their sub - scores. sadq scores alone were significantly correlating with clinical variables of alcoholism such as family history and age of onset ; audit did not. on the other hand, audit total scores correlated with total and conjugated bilirubin, while sadq did not.interpretation and conclusion : our data suggests that the two scales, audit and sadq may be tapping into two different outcomes of increased alcohol use namely clinical and biochemical markers, respectively. sadq could be useful in studies looking at withdrawal related severity and clinical aspects of alcoholism ; while audit could be more suitable for studies looking at alcoholism - related medical morbidity. this needs to be confirmed in larger unselected samples from different community and clinical settings. |
in this issue of critical care, totapally. evaluated the effect of albuterol on tidal breathing loops of 20 infants with respiratory syncytial virus (rsv) bronchiolitis. they found that the wheeze score and the pulmonary function tests were not significantly affected by albuterol. this is the latest of 12 randomised controlled trials in 12 years, involving 843 infants, that evaluated the effect of bronchodilators on bronchiolitis. after so many trials, have we resolved whether bronchodilators have a role in the management of bronchiolitis, and have pulmonary function measurements been helpful ? of the 12 most recent randomised controlled trials published in english, evaluating the effect of salbutamol or albuterol on bronchiolitis, nine (75%) showed that bronchodilators had no effect. in three of these studies, some difference had been observed, yet it resulted in only a small transient improvement in the acute clinical score and had no effect on hospital admission rates or duration of stay in hospital. in one of these three studies, ex - premature infants who might have had some mild underlying chronic lung disease, which might have resulted in the response to bronchodilators, were not excluded. several studies reported an increase in heart rate or a decrease in oxygen saturation after salbutamol or albuterol. the effect of ipratropium bromide (either alone or in combination with salbutamol or albuterol) on bronchiolitis has been evaluated in four recent randomised controlled trials and none has shown any significant effect. in contrast, there have been five published randomised controlled trials in the last 10 years, involving 225 infants, evaluating the effect of nebulised adrenaline (epinephrine) on bronchiolitis. all five (100%) have shown significant clinical improvement in infants with bronchiolitis, with decreases in oxygen requirement, respiratory rate, wheeze and retractions. the incidence of side effects is no more frequent with nebulised adrenaline than with salbutamol. the 90-minute heart rate was often significantly lower in the adrenaline group, and although pallor was noted more frequently it was transient and of no known clinical significance. these results suggest that mucosal swelling and mucous plugging make a greater contribution to the increased airway resistance observed in bronchiolitis than constriction of bronchial smooth muscle. barr. found a beneficial effect of inhaled adrenaline in an infant with rsv bronchiolitis who was also receiving -adrenergic receptor blockade with propranolol. this indicates that it was most probably the -adrenergic stimulation that was improving airway obstruction by inducing arteriolar vasoconstriction in the airway mucosa and thus reducing bronchial mucosal thickness. of the 12 randomised studies evaluating the effect of bronchodilators on bronchiolitis, only in those by totapally. and sly. were any pulmonary function measurements made. totapally used tidal breathing flow - volume loops to assess the effect of albuterol on infants with bronchiolitis, and they found no significant change. two main calculations were made : the exhaled time to reach peak expiratory flow as a fraction of total expiratory time (tptef / te) and the tidal volume exhaled at peak tidal expiratory flow as a fraction of total tidal volume (vptef / ve). the time needed to reach peak tidal expiratory flow is highly influenced by the activity of the laryngeal abductors and adductors, abdominal and intercostal expiratory muscles, post - inspiratory activity of the diaphragm and intercostal muscles, and vagal nerve tone. changes in these muscle activities could cause significant alterations in tptef / te independently of changes in the resistance and compliance of airways and lung. thus tptef / te is an insensitive measure of airway function in infants and children in comparison with vmaxfrc (maximal flow at functional residual capacity produced by forced expiration as a result of a rapid chest compression) and other more invasive techniques. sly. performed a randomised trial of salbutamol in infants with bronchiolitis and measured vmaxfrc and found no significant change. sanchez also conducted pulmonary function tests in a crossover trial comparing salbutamol with racemic adrenaline. as in other studies, administering salbutamol resulted in no change, whereas adrenaline significantly decreased pulmonary resistance. sanchez. used a more invasive technique, measuring transpulmonary pressures (with an oesophageal catheter), flow and volume to determine pulmonary resistance by a least - mean - square technique. they excluded breaths in which the leak was greater than 10%, the correlation coefficient was less than 0.95 or the tidal volume was less than 0.5 ml / kg, to eliminate the analysis of shallow breaths and artefacts. leaks around the mask or around an uncuffed endotracheal tube can cause major errors in the pulmonary function measurements and lead to gross overestimation of compliance and resistance. the inspired and expired volumes need to be within 10% of each other to allow an accurate analysis. ideally, absolute lung volume should also be measured to help in the interpretation of resistance changes ; however, this is invasive and difficult to perform. although totapally. should be commended for performing pulmonary function measurements to assess further the effect of albuterol on infants with bronchiolitis, the pulmonary function results need to be interpreted with a degree of caution. however, in view of the general lack of effect of bronchodilators in bronchiolitis in other studies, i do not think that any significant effect of albuterol on pulmonary function was missed in this study. it also highlights the urgent need for a simple non - invasive test that can measure lung function in infants more accurately. in summary, there is no compelling evidence that bronchodilators have a role in the routine management of infants with bronchiolitis. there is better evidence for the use of nebulised adrenaline, which results in a reduction of the airway mucosal oedema, leading to symptomatic improvement, improved pulmonary function and shorter hospital admissions. rsv = respiratory syncytial virus ; tptef / te = exhaled time to reach peak expiratory flow as a fraction of total expiratory time ; vmaxfrc = maximal flow at functional residual capacity produced by forced expiration as a result of a rapid chest compression ; vptef / ve = tidal volume exhaled at peak tidal expiratory flow as a fraction of total tidal volume. | over the past 12 years there have been 12 randomised control trials, involving 843 infants, evaluating the effect of salbutamol or albuterol on bronchiolitis. of these, nine (75%) showed that bronchodilators had no effect. in three studies a small transient improvement in the acute clinical score was seen. ipratropium bromide had no significant effect. there have been five recent randomised trials involving 225 infants, evaluating the effect of nebulised adrenaline (epinephrine) on bronchiolitis. all five (100%) have shown significant clinical improvement, with reductions in oxygen requirement, respiratory rate and wheeze after nebulised adrenaline. two showed lower hospital admission rates and earlier discharge with adrenaline. a significant improvement in pulmonary resistance was observed after nebulised adrenaline but not after salbutamol or albuterol. currently there is no compelling evidence that bronchodilators have a role in the routine management of infants with bronchiolitis. there is better evidence for the use of nebulised adrenaline. |
guidelines for group b streptococcus (gbs) originally established in 1996 (and reaffirmed in 2002 and 2010) by the centers for disease control and prevention (cdc) identify asymptomatic infants born to mothers who were colonized with gbs but received 6 hours, or maternal fever of 37.5c, intrapartum antibiotic prophylaxis of 4-hour duration [79 ]. yet in these studies no neonates whose mothers received any duration of intrapartum antibiotic prophylaxis developed gbs disease. two of these trials looked specifically if shorter durations of intrapartum antibiotics were of benefit and noted that if mothers received at least 2 hours of antibiotic therapy, rates of infant colonization were reduced when compared to no treatment [7, 9 ]. however, a systematic review of the medical literature did not find evidence that those infants whose mothers had 38.0c) ; hypothermia (60 breaths per minute) ; apnea (cessation of respiration for > 20 seconds) ; bradycardia (2 but 2 hours, the newborn colonization rate (2.9%) approached the rate seen in infants whose mothers received > 4 hours of therapy (1.2%). however, this study had some limitations in that intrapartum antibiotic therapy was administered 12 hours after the start of labor (the time required for a rapid gbs test result to be available) and that 43% of mothers had at least one risk factor for gbs disease. the findings of our study suggest that women colonized with gbs, without other risk factors, whose infants receive < 4 hours of intrapartum antibiotic prophylaxis are at greater risk of gbs disease compared to those newborns whose mothers were given 4 hours of therapy. infants that received < 4 hours of intrapartum antibiotic prophylaxis for maternal gbs colonization carried over a twofold increase in risk for the clinical diagnosis of neonatal sepsis. when the duration of maternal intrapartum antibiotic was correlated with neonatal clinical outcomes, a higher rate of the diagnosis of clinical sepsis this observation is in accord with studies from women colonized with gbs with intrapartum risk factors that durations of intrapartum antibiotic prophylaxis of at least 2 hours may have some benefit [5, 6 ]. in a small prospective observation trial evaluating the effects of intrapartum antibiotic prophylaxis in 70 gbs positive mothers with intrapartum risk factors, the only cases of gbs sepsis were in infants whose mothers received 2.5 hours of antibiotic prophylaxis. further, in a case - control study evaluating the effectiveness of risk - based intrapartum antibiotic prophylaxis for gbs sepsis, if intrapartum antibiotic prophylaxis was given 2 hours before delivery, the effectiveness for prevention of gbs disease was 89%. in the present study, the two infants diagnosed with gbs sepsis had mothers who received less than 2 hours of intrapartum antibiotic prophylaxis. pharmacokinetic studies of -lactam antibiotics utilized for maternal prophylaxis for intrapartum gbs would suggest that bactericidal levels in fetal blood are achieved as early as 3 minutes with higher levels persisting for up to 2 hours [1820 ]. why then do not durations of < 2 hours of maternal intrapartum antibiotic prophylaxis reduce neonatal gbs disease equivalent to longer antibiotic durations ? it has been suggested that cases of neonatal gbs sepsis that occur with short durations of maternal antibiotic prophylaxis may represent fetal exposure to gbs in utero prior to antibiotic administration when tissue injury by gbs may not be quickly reversible [18, 20 ]. what minimal duration of intrapartum antibiotic therapy for gbs prophylaxis is adequate to prevent neonatal gbs disease can not be determined from the current study. although no difference was noted in the number of cases of infant clinical sepsis whose mothers received 2 hours but < 4 hours compared to adequate duration of intrapartum antibiotics (i.e., 4 hours), there was insufficient numbers to rule out a type ii error. the study is retrospective and relied on an administrative database (i.e., icd-9 codes) to identify women and infants treated for gbs colonization. since, a standardized definition of clinical sepsis was not predefined, this finding must be interpreted with caution. selection bias may have played a role in these results. since by definition, infants that received < 4 hours of intrapartum antibiotic prophylaxis were considered at - risk, the physicians involved in their care may have had a lower clinical threshold to monitor these infants for closer evaluation and ultimately label them with the diagnosis of sepsis. the rate of neonatal clinical sepsis in our study in this at - risk group was similar to the 1% rate noted in previous studies. further, review of infant medical records that were diagnosed with clinical sepsis confirmed diagnostic criteria utilized in previous reports, although past studies may have similar risks of bias [1214 ]. although we would have expected symptomatic newborns to have returned for readmission to the pediatric unit at the study hospital, it is possible that some infants who became ill after discharge could have returned to another area hospital for treatment. finally, the extrapolations of the results of the current study are limited since it was conducted at one institution in a single city. on the other hand, the strengths of this study warrant attention. women who were gbs colonized without other risk factors were exclusively evaluated, which represents the majority of gbs positive mothers. a large number of asymptomatic, at - risk infants were managed by 350 pediatricians which may allow for a more generalizability of these study results. the cohort study design is less prone to selection bias and residual confounding and the effect size of the association of 4 hours of intrapartum antibiotic therapy on reducing neonatal clinical sepsis (adjusted relative risk 0.35) indicates a range that merits further consideration. we examined a large cohort of women who were gbs carriers without other risk factors. it appears that infants whose mothers receive < 4 hours of intrapartum antibiotic prophylaxis for gbs colonization are at an increased risk for being diagnosed with clinical sepsis. larger studies are needed to determine whether shorter specific durations of maternal antibiotic prophylaxis will reduce this risk. | background. infants born to mothers who are colonized with group b streptococcus (gbs) but received < 4 hours of intrapartum antibiotic prophylaxis (iap) are at - risk for presenting later with sepsis. we assessed if < 4 hours of maternal iap for gbs are associated with an increased incidence of clinical neonatal sepsis. materials and methods. a retrospective cohort study of women - infant dyads undergoing iap for gbs at 37-week gestation who presented in labor from january 1, 2003 through december 31, 2007 was performed. infants diagnosed with clinical sepsis by the duration of maternal iap received (< or 4-hours duration) were determined. results. more infants whose mothers received < 4 hours of iap were diagnosed with clinical sepsis, 13 of 1,149 (1.1%) versus 15 of 3,633 (0.4%), p =.03. multivariate logistic regression analysis showed that treatment with 4 hours of iap reduced the risk of infants being diagnosed with clinical sepsis by 65%, adjusted relative risk 0.35, ci 0.160.79, and p =.01. conclusion. the rate of neonatal clinical sepsis is increased in newborns of gbs colonized mothers who receive < 4 hours compared to 4 hours of iap. |
vitamin e is a family of compounds that has long been thought to have biological properties that may prevent prostate and other cancers. of these compounds, -tocopherol is the most bioavailable in humans and, according to the institute of medicine, is the only form of vitamin e that has been demonstrated to reverse vitamin e deficiency and is the most predominant form that is maintained in plasma and tissues. thus, -tocopherol is the most thoroughly examined with respect to its potential beneficial health effects. the alpha - tocopherol, beta - carotene cancer prevention (atbc) study, a large randomized controlled trial of vitamin e and -carotene supplementation in male finnish smokers, found that vitamin e supplementation led to 32% lower prostate cancer incidence, particularly of more aggressive disease. results from two subsequent large controlled trials were not confirmatory, however, with the selenium and vitamin e cancer prevention trial (select) finding 17% higher prostate cancer incidence in men given vitamin e and the physicians ' health study ii (phs ii) showing no effect of vitamin e supplementation. several explanations for the divergent trial findings include the substantial difference in the -tocopherol dose (ranging from 50 iu to 400 iu daily) and possible selective vitamin e - prostate cancer protective effects in cigarette smokers or for more advanced disease. biologic mechanisms have also been investigated, including alterations in circulating androgens or vascular endothelial growth factors [6, 7 ], yet our understanding of the effects of -tocopherol supplementation on risk of developing cancer remain incomplete. metabolomic profiling is a relatively new laboratory analytical tool that measures an array of low molecular weight biochemicals in a variety of matrices including blood. agnostic approaches such as genome - wide association studies have discovered new biological associations between specific genes or their biologic pathways and human disease, including cancer, as well as other phenotypes. similarly, examination of the human metabolome offers the potential to discover molecular species relevant to various diseases [911 ], characteristics (e.g., energy balance and bmi), and environmental exposures (e.g., diet, smoking, and vitamin supplementation) [13, 14 ]. metabolomic profiling may also help elucidate how vitamin e supplementation impacted prostate cancer incidence in the aforementioned trials. to our knowledge, only two studies have examined the biological response to supplementation with -tocopherol in healthy individuals and both had very small sample sizes (n = 10) and short durations of supplementation (2 and 4 weeks, resp.) [16, 17 ]. one additional study examined patients with nonalcoholic steatohepatitis (nash) who had been randomized to vitamin e or placebo and compared those whose disease responded to vitamin e to those who did not respond ; this study also had a small sample size (n = 16 in each group). our understanding of the biochemical effects of long - term -tocopherol supplementation therefore remains incomplete. in the present study, we quantitatively examined the pre- and postenrollment fasting serum metabolome of 100 men randomized to receive long - term -tocopherol supplementation and 100 men who did not receive -tocopherol in the atbc study. the atbc study was a double - blind, placebo - controlled cancer prevention trial designed to test whether supplementation with -tocopherol or -carotene influenced cancer incidence. participants were recruited between 1985 and 1988 in southwestern finland and were males between the ages of 5069 years old and who smoked at least 5 cigarettes per day at enrollment. trial participants (n = 29,133) were randomized to one of four groups based on a 2 2 factorial design : (1) -tocopherol (all - rac--tocopheryl acetate (ata), 50 mg / day), (2) -carotene (20 mg / day), (3) both supplements, or (4) placebo. compliance which was estimated on the basis of residual capsule counts was excellent, with 80% of participants taking more than 95% of their capsules. overnight fasting blood samples were collected from all participants at baseline, and on - study samples were collected annually from a random sample of participants. the atbc study was approved by institutional review boards at both the us national cancer institute and the finnish national public health institute ; written informed consent was obtained from all trial participants. for the present analysis, 50 men were randomly sampled from each trial intervention group for a total sample of 200 individuals ; participants were classified as either receiving the trial -tocopherol supplement (i.e., ata alone or ata plus -carotene) or not (i.e., placebo or -carotene alone). men included in the current study sample had to (1) have both pre- and postrandomization fasting serum sample available with the follow - up sample collected at least 1 year after the baseline blood collection (mean = 3.3 years, range 1.06.9 years) and start of supplementation and (2) be cancer - free for at least 5 years after the follow - up blood collection. we required the participants to be cancer - free for 5 years after follow - up blood collection to minimize the possibility of reverse causation, that is, changes in the circulating metabolome resulting from undiagnosed cancer. metabolomic profiling was conducted on baseline and follow - up serum samples at metabolon, inc. (durham, nc), using an untargeted analysis capturing a broad array of low molecular weight compounds as described in detail previously [13, 20 ]. briefly, samples were extracted and prepared for either uplc / ms / ms or gc / ms. raw data was extracted, peak - identified, and qc processed as described previously [20, 21 ]. for qa / qc purposes, additional samples were included with each day 's analysis including extracts of a pool of well - characterized human serum, extracts of a pool created from a small aliquot of the experimental samples, and process blanks. qc samples were spaced evenly among the injections and all experimental samples were randomly distributed throughout the run with baseline and follow - up samples from each individual analyzed in the same batch. the median and interquartile range of the intraclass correlation coefficient (icc) across the metabolites was 0.84 (0.520.96) ; these iccs are similar to those seen previously in samples analyzed by this laboratory. a total of 516 compounds were identified in our samples ; any compound with more than three missing observations in either the baseline or follow - up sample was excluded, leaving 500 metabolites for analysis. metabolites were then grouped into 9 mutually exclusive chemical classes (amino acids, carbohydrates, cofactors and vitamins, energy metabolites, lipids, nonstandard amino acids, nucleotides, peptides, and xenobiotics) based on the available literature. in order to account for batch variability, normalized metabolite levels were then log - transformed and missing values were imputed to the minimum of nonmissing values. in our primary analysis, we modeled the association between change in log - metabolite levels and trial assignment (i.e., ata versus no ata) by linear regression. secondary analyses were conducted stratifying by number of cigarettes smoked per day, alcohol consumption, duration of supplementation with ata, trial -carotene supplementation, and baseline serum -tocopherol concentration. the threshold for statistical significance for our main analysis was 0.0001022495 based on a bonferroni correction for 500 tests to obtain a family - wise - error - rate (fwer) of 0.05 or 0.00021 based on a permutation correction. for the latter, we calculated the minimum p value for each of 10,000 permuted datasets, where we permuted the group assignment, and found the 0.05 quantile to be 0.00021. we further examined whether a particular chemical class of metabolites was over- or underrepresented among our top metabolites. for this analysis, we categorized metabolites as below a p value of 0.05 (yes / no) and as belonging to a chemical class (yes / no) and then used fisher 's exact test to determine whether the representation among the top metabolites was statistically significant at the threshold of 0.0056 based on a bonferroni correction for 9 tests. all analyses were performed using sas version 9.1.3 (sas institute, cary, nc). characteristics of the study population by trial ata assignment are shown in table 1. with the exception of 42% higher serum -tocopherol concentrations at follow - up in vitamin e supplemented men, there were no differences by intervention arm, as would be expected based on the randomized design of the atbc study. table 2 presents findings for the 24 metabolites that changed in response to the ata supplementation with a statistical significance of p 0.10). in this randomized controlled trial of male smokers, we identified five metabolites whose relative concentrations changed significantly in response to long - term supplementation with all - rac--tocopheryl acetate (ata). to our knowledge, this is the largest study and the only one of long - term supplementation to examine the change in the human serum or plasma metabolome in response to supplementation with this vitamin e compound. as anticipated and previously reported, -tocopherol concentrations increased significantly in response to the atbc trial vitamin e supplementation, while concentrations of -tocopherol and -tocopherol decreased. prior studies have shown such reductions in -tocopherol and -tocopherol concentrations during -tocopherol supplementation [23, 24 ]. the two strongest effects on serum metabolites we observed were substantially elevated concentrations of -cehc sulfate and -cehc glucuronide. -cehc is an end - product -tocopherol metabolite generated through serial -oxidation and -oxidation by cytochrome p450 (cyp) enzymes, particularly cyp4f2, cyp3a4, and cyp3a5, which may be upregulated by all vitamin e compounds through activation of the nuclear pregnane x receptor (pxr), although the role of pxr remains controversial [25, 26 ]. these metabolic products are subsequently glucuronidated or sulfated for excretion by udp - glucuronosyltransferases (ugt) and sulfatases, respectively, which appear to occur once an individual 's capacity for hepatic incorporation of -tocopherol into low - density lipoprotein (ldl) particles has been reached. based on this, circulating -cehc has been suggested as a biomarker of optimum -tocopherol status [28, 29 ]. this suggests that the circulating and tissue - specific concentrations of -cehc and its glucuronide and sulfate metabolites are dependent upon the dose of -tocopherol administered, as well as an individual 's ldl concentrations and level of oxidative stress. in fact, cigarette smoking, which increases the latter, has been associated with -cehc concentrations. interestingly, -cehc may have independent anticarcinogenic effects that -tocopherol does not exhibit, including being strongly anti - inflammatory. this may be consistent with the hypothesis that the conflicting prostate cancer clinical trial findings for -tocopherol supplementation could be due to either the different vitamin e doses administered or the cigarette smoking status of the trial populations. an inverse association was observed between vitamin e supplementation and risk of prostate cancer in the atbc study, which administered 50 iu / day and included only men who were current smokers at enrollment. in contrast, there was no supplement effect in the phs ii which administered 400 iu every other day and included mostly nonsmokers, and higher prostate cancer incidence was observed in select among mostly nonsmoking men receiving 400 iu daily. to our knowledge, neither circulating -cehc nor its conjugated metabolites have been examined in relation to risk of prostate or other cancers. two previous studies of metabolomic profile changes in response to -tocopherol supplementation in healthy participants did not identify any of the top five serum metabolites observed here [16, 17 ], possibly due to one or more differences in the study methodologies. for example, both prior studies supplemented participants for only 14 days, as compared with an average of 3.3 years in the present analysis. also, the -tocopherol doses and preparations differed greatly from the atbc study, with one administering 400 mg of rrr--tocopheryl acetate daily and the other feeding participants 55 g of almonds for 7 days followed by 600 iu / day of all - rac--tocopheryl acetate (with no washout period). our sample size was much larger than either of the previous studies ; that is, n = 200 individuals (100 each in the ata and no ata groups) as compared with 10 vitamin e - supplemented individuals in each prior study (and no placebo control groups). the study comparing metabolomic profiles in nash patients who did and did not respond to vitamin e supplementation also did not identify any of our top metabolites as being associated with vitamin e treatment response. although not formally statistically significant, three structurally similar amino acids beta - alanine, ornithine, and n6-acetyllysine as well as glutarylcarnitine, decreased during ata supplementation. whether serum changes in these metabolites are related to the oxidative degradation of the ata phytyl side - chain (e.g., through upregulation of cyp3a activity) or to an effect of the resulting two - carbon acetyl groups on fatty acid and possibly acetyl - coenzyme a, metabolism is not known. exploration of the pathway(s) through which vitamin e impacted these biochemical alterations could inform our understanding of both vitamin e metabolism and the effect of vitamin e on prostate carcinogenesis. strengths of the present analysis include the parent trial 's randomized controlled design and our measurement of metabolomics profiles both before and after supplementation in both the supplemented and unsupplemented groups. we employed a relatively large sample size, participants were supplemented for at least a year and an average of more than three years, and serum was obtained after an overnight fast. study limitations included an all caucasian male smoker population and the ability to test only one dose and preparation of -tocopherol based on the parent atbc trial. in this analysis of presupplementation versus on - study serum metabolomic profiles nested within a large controlled trial of vitamin e, we found the presence of several molecules that were quantitatively altered by chronic supplementation with ata, including two conjugated metabolites of -cehc. further study of -cehc and its metabolites in relation to risk of prostate and other cancers in humans is warranted ; in particular, examination of which enzymes (e.g., cyps, ugts, or sulfatases) may be upregulated during supplementation with -tocopherol. in addition, comparison of pre- and postsupplementation metabolomic profiles between this study and other clinical trials of -tocopherol supplementation conducted in different populations or using different dosages or preparations (e.g., select) may shed light on the apparently discordant prostate cancer findings across the trials. | background. the alpha - tocopherol, beta - carotene cancer prevention (atbc) study, a randomized controlled cancer prevention trial, showed a 32% reduction in prostate cancer incidence in response to vitamin e supplementation. two other trials were not confirmatory, however. objective. we compared the change in serum metabolome of the atbc study participants randomized to receive vitamin e to those who were not by randomly selecting 50 men from each of the intervention groups (50 mg / day all - rac--tocopheryl acetate (ata), 20 mg / day -carotene, both, placebo). methods. metabolomic profiling was conducted on baseline and follow - up fasting serum (metabolon, inc.). results. after correction for multiple comparisons, five metabolites were statistically significantly altered (is the change in metabolite level expressed as number of standard deviations on the log scale) : -cehc sulfate (= 1.51, p = 1.45 1038), -cehc glucuronide (= 1.41, p = 1.02 1031), -tocopherol (= 0.97, p = 2.22 1013), -tocopherol (= 0.90, p = 1.76 1011), and -tocopherol (= 0.73, p = 9.40 108). glutarylcarnitine, beta - alanine, ornithine, and n6-acetyllysine were also decreased by ata supplementation (range 0.40 to 0.36), but not statistically significantly. conclusions. comparison of the observed metabolite alterations resulting from ata supplementation to those in other vitamin e trials of different populations, dosages, or formulations may shed light on the apparently discordant vitamin e - prostate cancer risk findings. |
polymerdrug conjugates are established as one of the first - generation nanomedicines for the treatment of cancer. their use facilitates the uptake and transport of therapeutic agents and creates a dose - differentiation between the treatment target and the rest of the body, due to the fact that macromolecules can accumulate passively in solid tumor tissue by the phenomenon called enhanced permeability and retention (epr) effect.(1) the enhanced drug accumulation in tumor tissue increases the therapeutic effect while reducing nonspecific side - effects. moreover, the intracellular trafficking mechanism of polymerdrug conjugates renders drug efflux pumps ineffective.(5) to obtain such multifunctional capabilities, polymerdrug conjugates have been designed to consist of (a) a nonimmunogenic and biocompatible water - soluble polymer backbone such as poly(ethylene glycol) or n-(2-hydroxypropyl)methacrylamide (hpma) copolymers,(6) (b) therapeutically active molecules, (c) linkers between the polymer backbone and the active molecule that are stable in blood circulation and release the free drug at target sites, and (d) a targeting moiety to mediate biomolecular recognition. the main advantages of hpma copolymerdrug conjugates over their low molecular weight drugs (reviewed in kopeek,(6) putnam and kopeek,(8) kopeek.,(5) duncan,(9) cuchelkar and kopeek,(10) pan and kopeek(11)) include the following : (1) enhanced water solubility of poorly soluble or insoluble drugs with concomitant improvement of drug bioavailability ; (2) long - lasting circulation in the bloodstream ; (3) decreased nonspecific toxicity of the conjugated drug and immunogenicity of the targeting moiety;(14) (4) increased passive and/or active accumulation of the drug at the site of its action by the epr effect and/or by targeting, respectively ; (5) active uptake by fluid - phase pinocytosis (nontargeted polymer - bound drug) or receptor - mediated endocytosis (targeted polymer bound drug) ; (6) the potential to overcome efflux pump - mediated mechanism of drug resistance ; and (7) ability to deliver several active components with different properties to the same target site that enhance the specific activity of the main drug. the incorporation of targeting moieties, such as monoclonal antibody (mab) or antibody fragment, into hpma copolymerdrug conjugates results in specific delivery and enhancement of the amount of the polymeric conjugate being internalized by receptor - mediated endocytosis.(23) consequently, the intracellular concentration of the polymeric conjugates is enhanced with concomitant increase in antitumor activity.(17) moreover, the polymer modification of mab or antibody fragments reduces their immunogenicity and extends their circulating half - lives. the use of antibody fragments provides a better control of the structure of hpma copolymer conjugates compared to full - length mab. the unique sulfhydryl group near the c terminus of fab fragments has provided a convenient way for coupling to hpma copolymers containing maleimide groups and allow the antigen - binding site to be more approachable. to improve the therapeutic outcome and reduce the toxicity of anticancer agents, a novel concept of combining chemotherapy and photodynamic therapy (pdt), using hpma copolymer bound drugs, was developed.(27) the in vivo studies on two cancer models, neuro 2a neuroblastoma induced in a / j mice(28) and human ovarian carcinoma heterotransplanted in nude mice, demonstrated that combination therapy with hpma copolymer - bound dox (doxorubicin) and hpma copolymer - bound mce6 (mesochlorin e6 monoethylenediamine) produced tumor cures which could not be obtained with either chemotherapy or pdt alone. furthermore, significantly lower nonspecific toxicities were observed when compared to low molecular weight drugs. previously, in vitro studies of the binary combination of free and hpma copolymer - bound sos [2,5-bis(5-hydroxymethyl-2-thienyl)furan, nsc 652287 ], dox, and mce6 in the treatment of human a498 renal carcinoma cells using the median - effect method showed that these combinations displayed synergistic - to - additive effects, depending on the cytotoxic mechanisms of each agent.(31) in the present study, fab-targeted and nontargeted hpma copolymerdrug (sos and mce6) conjugates for combination chemotherapy and pdt against human ovarian ovcar-3 carcinoma cells were synthesized. its mechanism of action consists of disrupting the p53-hdm-2 (human double minute-2) interaction, resulting in an increased p53 accumulation, thereby inducing cell cycle arrest and apoptosis. for pdt the second - generation synthetic photosensitizer, mce6, was used. photosensitizer molecules can be activated by specific wavelength of light and interact with molecular oxygen to produce reactive singlet oxygen, causing irreversible photodamage to cells resulting in cell death.(36) the antibody fab fragment was prepared from ov - tl16 antibody, which recognizes the oa-3 surface antigen, also known as cd47 or iap (integrin - associated protein), overexpressed on most human ovarian carcinoma cells. it was hypothesized that a combination of these agents may produce synergistic effects and has higher efficiency than each agent alone. accordingly, the efficiency of free, nontargeted, and fab fragment - targeted hpma copolymer - bound sos and mce6 against ovcar-3 cells as single agents and in combination was evaluated. the combination index (ci) analysis was used to quantify the synergism, antagonism, and additive effects of drug combinations. sos was kindly supplied by the drug synthesis and chemistry branch, developmental therapeutics program, division of cancer treatment and diagnosis, national cancer institute. all other chemicals were purchased from sigma chemical co. (st. louis, mo). cells were cultured in rpmi 1640 medium (sigma) containing 10 g / ml insulin (sigma) supplemented with 10% fetal bovine serum (hyclone laboratories, logan, ut), at 37 c in a humidified atmosphere of 5% co2 (v / v). the ov - tl16 antibody was produced as described previously.(44) briefly, the ov - tl16 antibody was produced by in vitro cartridge bioreactor (cellulosic - mps, spectrum laboratories, rancho dominguez, ca) culture of ov - tl16 hybridoma cells with serum free hybridoma medium (gibco life sciences, carlsbad, ca). the antibody was purified by applying the supernatant of cell suspension harvested from bioreactor to a protein g sepharose 4 fast flow column (pharmacia, piscataway, nj), equilibrated with binding buffer (0.01 m na2hpo4, 0.15 m nacl, 0.01 m edta ph 7.2). the antibody was dialyzed (mol wt cutoff 68 kda) against phosphate buffered saline (pbs) overnight at 4 c. the antibody fab fragment was prepared freshly as described previously. the ov - tl16 antibody in 0.1 m citric buffer ph 4.0 was digested by 10% (w / w) pepsin (sigma) for 2.5 h at 37 c to give f(ab)2. the f(ab)2 was reduced to fab with 20 mm cysteine (sigma) in 20 mm tris buffer ph 8.5 for 1 h at 37 c. p - gflg - mce6 was prepared as described previously.(28) briefly, the conjugate was synthesized using a polymer analogous reaction in two steps. first, the polymer precursor (p - gflg - onp) was prepared by radical precipitation copolymerization of hpma and n - methacryloylglycylphenylalanylleucylglycine p - nitrophenyl ester (ma - gflg - onp). second, mce6 was bound to p - gflg - onp by aminolysis of reactive onp groups in n, n - dimethylformamide (dmf). the reaction solution was precipitated into a mixture of acetone : ether (3:2 (v / v)). the dried precipitate was dissolved in methanol and purified on a sephadex lh-20 column with methanol/0.5% acetic acid as the elution solvent. the product was dissolved in deionized (di) water, dialyzed overnight and lyophilized. the structure and characterization of nontargeted polymer conjugates are summarized in scheme 1a and table 1. determined by uv spectrophotometry in methanol : 395 = 158000 m cm for mce6, and 358 = 33000 m cm for sos. apparent molecular weight (mw) of polymers was estimated by size exclusion chromatography using akta / fplc (pharmacia) system equipped with a superose 6 column, calibrated with polyhpma fractions. pbs buffer ph 7.3 + 30% (v) acetonitrile and 0.1 m acetate buffer ph 5.5 + 30% (v) acetonitrile were used for polymer conjugates containing mce6 and polymer conjugates containing sos, respectively. determined by ninhydrin assay. determined by 5-((2-(and-3)-s-(acetylmercapto)succinoyl)amino)fluorescein assay (samsa assay, molecular probes). determined by spectrophotometric determination of fitc (497 = 73 000 m cm in 0.1 m sodium borate buffer). fluorescently labeled targeted conjugates were prepared by reacting p-(gflg - mce6)-fab and p- (gflg - sos)-fab (table 2) with 5-sfx. p - gflg - sos (scheme 1a) was synthesized by binding of sos to the p - gflg - onp polymer precursor via an ester linkage.(31) briefly, p - gflg - onp was dissolved in dmf and mixed with dmf solution of sos. 4-dimethylaminopyridine (dmap) was added, and the reaction was allowed to proceed for 72 h in the dark at room temperature. the product was isolated, after reduction of volume, by precipitation into a mixture of acetone : ether (3:1 (v / v)). the precipitate was dissolved in methanol and applied to a sephadex lh-20 column with methanol as the mobile phase. first, a polymerizable derivative of mce6, n - methacryloylglycylphenylalanylleucylglycine mce6 (ma - gflg - mce6),(25) was synthesized by reacting ma - gflg - onp (60 mg, 0.103 mmol) with mce6 (63.5 mg, 0.093 mmol) in dmf (2 ml). the reaction solution was stirred at room temperature in the dark for 2 h. n, n-diisopropylethylamine (dipea ; 18 l, 0.103 mmol) was added and stirring continued overnight. 1-amino-2-propanol (8 l, 0.103 mmol) and a small amount of tert - octylpyrocatechol were added and dmf was removed under reduced pressure. the residue was isolated using a sephadex lh-20 column with acetone : methanol : acetic acid (2:1:0.1) as the mobile phase. the product fraction was evaporated to dryness, washed with ether, collected by filtration, and dried under vacuum. the molecular weight (mw) of ma - gflg - mce6 was 1083.6 da as determined by electrospray ionization mass spectrometry (esi - ms). second, the polymeric precursor p-(gflg - mce6)-nh2 was prepared by radical copolymerization of hpma(47) (107.6 mg, 0.751 mmol), n-(3-aminopropyl)methacrylamide hydrochloride (apma, 16.27 mg, 0.091 mmol ; polysciences, warrington, pa), and ma - gflg - mce6 (76.9 mg, 0.068 mmol) in methanol (1.8 ml) at 50 c for 48 h, using 2,2-azobisisobutyronitrile (aibn ; 19.27 mg) as the initiator. the polymerization mixture contained 12.5 wt % of monomers and 1.2 wt % of aibn. the molar ratio of hpma : apma : ma - gflg - mce6 was 82.5:10:7.5. the residue was precipitated in a mixture of acetone : ether (1:2 (v / v)). the precipitate was dissolved in water, dialyzed (mol wt cutoff 68 kda) against di water and lyophilized. third, polymeric precursor p-(gflg - mce6)-mal was prepared by reacting p-(gflg - mce6)-nh2 (55 mg, 0.026 mmol nh2 group) with succinimidyl trans-4-(maleimidomethyl)cyclohexane-1-carboxylate (smcc ; 17.36 mg, 0.052 mmol) (soltec ventures, beverly, ma) and dipea (13 l, 0.078 mmol). the mole ratio of nh2:smcc : dipea was 1:2:3. p-(gflg - mce6)-nh2 was dissolved in 0.3 ml of dmf and smcc in 0.9 ml of dmf. the residue was dissolved in a small volume of methanol and purified on a sephadex lh-20 column eluted with a mixture of methanol and 0.1% acetic acid. the copolymer band was collected, evaporated and precipitated into a mixture of acetone : ether (1:1). first, ma - gflg - onp (278.6 mg, 0.480 mmol) and sos (200 mg, 0.680 mmol) were dissolved in tetrahydrofuran (thf ; 15 ml). the reaction mixture was stirred at room temperature in the dark for 72 h. the mixture was concentrated under reduced pressure. the excess free drug was recovered by elution with acetone : hexane (2:1), and the fractions were collected by eluting with acetone and then with methanol. the mw of ma - gflg - sos was 734.2 da as determined by esi - ms. second, polymeric precursor, p-(gflg - sos)-nh2, was synthesized by copolymerization of hpma (141.3 mg, 0.987 mmol), apma (14.2 mg, 0.079 mmol), and ma - gflg - sos (50 mg, 0.068 mmol) in dmf (1 ml) and acetone (0.5 ml) at 50 c for 48 h, using aibn (19.7 mg) as the initiator. the molar ratio of hpma : apma : ma - gflg - sos was 87:7:6. third, polymeric precursor p-(gflg - sos)-mal was prepared by using the same procedure as for p-(gflg - mce6)-mal. p-(gflg - sos)-nh2 (145 mg, 0.040 mmol nh2 groups) and smcc (26.41 mg, 0.079 mmol) were dissolved separately in dmf (2.5 ml and 0.5 ml, respectively). the product was applied on a sephadex lh-20 column and eluted with methanol without acetic acid. the product was precipitated and filtered off, with a yield of 130 mg (76%). the targeted conjugates were prepared by dissolving p-(gflg - mce6)-mal or p-(gflg - sos)-mal precursor in 20 mm mes buffer ph 6.5 and reacting with freshly prepared fab fragment (polymer : fab weight ratio = 1:2) overnight in the dark at 4 c. the product was purified on a deae sepharose fast flow ion exchange column (pharmacia), eluted using 20 mm bis - tris buffer ph 6.5 with a gradient nacl concentration of 00.5 m. the fraction corresponding to conjugate was confirmed by size exclusion chromatography using superose 6 (hr 10/30) column. the structure and composition of polymer conjugates are summarized in scheme 1b and table 2. mce6 and sos contents determined by uv spectrophotometry in methanol : 395 = 158000 m cm for mce6, 358 = 33000 m cm for sos. calculated from the composition of polymer (molecular ratio of drug, polymer, and fab). 6-(fluorescein-5-carboxamido)hexanoic acid succinimidyl ester (5-sfx ; 0.1 mg, 0.170 mol) was dissolved in dimethylsulfoxide (25 l) and di water (100 l). the polymer precursor p-(gflg - mce6)-nh2 or p-(gflg - sos)-nh2 (3 mg, 1 mol of nh2) was dissolved in di water (300 l). the mixture was stirred at room temperature in the dark for 1 h. saturated na2hpo4 (20 l) was added to stop the reaction. sos was dissolved in pbs containing cyclodextrin (5% (w / v) cyclodextrin in pbs/1 mg of sos) to enhance the solubility of sos.(48) p - gflg - sos, p-(gflg - mce6)-fab, and p-(gflg - sos)-fab were prepared in pbs. other samples (mce6 and p - gflg - mce6) were prepared in di water. all stock solutions were freshly prepared and gradually diluted with rpmi 1640 culture medium before use. fifty thousand ovcar-3 cells were subcultured into an eight - chamber slide and incubated for 2 days at 37 c in a humidified atmosphere of 5% co2. the cells in each chamber were exposed to fluorescein - labeled copolymer conjugates (at 20 m fitc equivalent) at 37 c for 1 h in the dark. cells were fixed with 2% paraformaldehyde for 20 min at room temperature and washed twice with pbs. the chamber slide was covered with a cover slide utilizing antifade reagent (molecular probes). the cell internalization of fluorescently labeled hpma copolymer conjugates was imaged using a zeiss (thornwood, ny) lsm 510 confocal imaging system. ovcar-3 cells (75,000 cells / well) were seeded into a 24-well plate and incubated for 24 h at 37 c in a humidified atmosphere of 5% co2. cells in each well were exposed to the fluorescein - labeled copolymer conjugates (at 20 m fitc equivalent) at 37 c for 1 h in the dark. the cell monolayer was rinsed twice with ice - cold pbs and detached from the well surface by incubation with tryple express (gibco) for 2 min. the cells were suspended with ice - cold pbs containing 0.2% fbs, maintained in suspension on ice in the dark and processed for flow cytometry utilizing facscan instrument (becton dickinson). control cells were not exposed to the sample to assess the endogenous fluorescence of the cells. additional experiments were performed at 0 c (on ice) to demonstrate the surface binding of targeted conjugates. ovcar-3 cells, growth medium and the fluorescein - labeled conjugates (at 10 m fitc equivalent) were precooled on ice before experiments. the cells were exposed to conjugates for 2 h, then the medium containing conjugates was discarded, and cells were washed extensively with cold pbs and processed for flow cytometry as described above. the drug concentration that inhibited cell growth by 50% compared with control cells (ic50) was determined using a modified 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (mtt) assay.(49) cells were seeded in 96-well flat bottom microplates at a density of 10,000 cells / well in 200 l of rpmi 1640 medium and allowed to grow for 30 h. the cells were then exposed to various concentrations of each free drug alone (mce6 and sos), each nontargeted copolymer conjugate (p - gflg - mce6 and p - gflg - sos), each targeted copolymer conjugate [p-(gflg - mce6)-fab and p-(gflg - sos)-fab ], or their sequential combinations (n = 6 in single experiment). the different treatment protocols are shown in scheme 3. during the cells exposure to drug(s), they were incubated at 37 c in a humidified atmosphere of 5% co2 and in the dark condition. after 4 days of exposure for sos and its conjugates or 1 day of exposure for mce6 and its conjugates, the drugs were removed, cells were washed with warm pbs and the medium (300 l) was replaced. for cell growth inhibition studies using mce6, p - gflg - mce6, or p-(gflg - mce6)-fab (alone or in combinations), the cells were irradiated with three tungsten halogen lamps through a 650 nm band - pass filter at 3.0 mw / cm for 30 min. after an additional 1 day or 4 days in culture for sos and its conjugates or for mce6 and its conjugates, respectively, medium was removed and replaced with 100 l of fresh medium and 10 l of sterile - filtered mtt solution (5 mg / ml in pbs). after incubating for 24 h, 150 l of 20% (w / v) sodium dodecyl sulfate in water was added to each well and incubated overnight. the following day, the absorbance of each well was read at 570 nm with a reference wavelength at 630 nm. untreated cells served as a 100% cell viability control, and the media served as background reference. growth inhibition was expressed as the growth of drug - treated cells related to that of untreated control cells. (a) cells were treated with single agents : different concentrations of mce6, sos, or their conjugates. (b) cells were treated with sequential combinations of sos or hpma copolymersos conjugates, followed by treatment with mce6 or hpma copolymermce6 conjugates. in combination treatment studies, ovcar-3 cells were treated with a dose range of sos for 4 days followed by a dose range of mce6 for 1 day, and irradiated for 30 min (n = 6 in single experiment), as shown in scheme 3. after each step the drug was removed and the cells were washed with warm pbs. drug interaction and ci were determined using median - effect analysis according to the method of chou and talalay. the median - effect equation describes doseeffect relationships, which is expressed by fa / fu = (d / dm) or log(fa / fu) = m log(d) m log(dm) where fa and fu are the fraction affected [1 (absorbance of treatment well average of absorbance of blanks)/(average of absorbance of untreated cell wells average of absorbance of blanks) ] and unaffected (fu = 1 fa) by the dose or concentration d, dm is the median - effect dose (ic50) that inhibits the cell growth by 50%, and m is the coefficient signifying the shape of the doseeffect relationship. based on the logarithmic conversion, the plot of x = log(d) versus y = log(fa / fu) is called the median - effect plot and dm is calculated from the antilog of the x - intercept. the ci describes the interaction between two drugs and quantitates the synergism, antagonism or additive effects. the ci is determined by the equation ci = [(d)1/(dx)1 ] + [(d)2/(dx)2 ] where (dx)1 and (dx)2 are the doses of drug 1 alone and drug 2 alone that inhibit the cell growth x%, respectively. (d)1 and (d)2 are for doses in combination that also inhibit x%. the ci values were calculated for different values of fa and plotting the ci values as a function of fa values, using compusyn software (combosyn inc., ci 1 indicate synergism, additivity, and antagonism, respectively. all mean values are presented as means standard deviation (n = 6 in a single experiment). the structures of hpma copolymer conjugates, p - gflg - mce6, p - gflg - sos, p-(gflg - mce6)-fab, and p-(gflg - sos)-fab, are shown in scheme 1. the drugs, mce6 and sos, were bound to the hpma copolymer backbone via a gflg spacer, stable in the bloodstream, but susceptible to enzymatically catalyzed hydrolysis in the lysosomal compartment of the cells. for fab attachment, the amino groups of apma monomer units in hpma copolymer precursors were first converted to maleimido groups by reaction with a heterobifunctional agent, smcc (scheme 2), followed by attachment of fab via thioether bonds. for some experiments, the characteristics of hpma copolymer precursors, nontargeted hpma copolymer conjugates, fab-targeted hpma copolymer conjugates, and fluorescently labeled conjugates are summarized in tables 1 and 2. p - gflg - mce6, p - gflg - sos, p-(gflg - mce6)-fab, and p-(gflg - sos)-fab conjugates contained 2.9, 3.4, 2.0, and 5.0 drug molecules per macromolecule, respectively. p-(gflg - mce6)-fab and p-(gflg - sos)-fab had drug : polymer : fab molecular ratios of approximately 2:1:1 and 5:1:1, respectively. the mw of fab-targeted copolymer conjugates were 2.2 to 2.8 times higher than those of nontargeted conjugates. unlike low molecular weight drugs that enter cells by diffusion through the plasma membrane several basic internalization mechanisms, clathrin - mediated endocytosis, caveolae - mediated endocytosis, clathrin- and caveolin - independent endocytosis, and macropinocytosis have been identified. to a greater or lesser extent, two or more distinct mechanisms coexist when a single cell type internalizes macromoleculedrug conjugates.(55) studies on the subcellular fate of hpma copolymerdrug conjugates demonstrated that the conjugates are lysosomotropic and will accumulate in the lysosomal compartment of the cell. tijerina., using subcellular fractionation, determined the localization of a considerable fraction of hpma copolymermce6 conjugates in the lysosomal compartment of human ovarian carcinoma a2780 cells.(56) omelyanenko. used ph dependent fluorescence of fitc to display the lysosomotropism of fitc - labeled hpma copolymers containing n - acylated galactosamine in hepg2 hepatocarcinoma cells.(57) recently, the uptake mechanism of hpma copolymerdox conjugate in human ovarian carcinoma ovcar-3 cells was studied by confocal fluorescence microscopy and by colocalization experiments with substrates specific for a particular internalization mechanism. the results suggested that the hpma copolymerdox conjugate is internalized via both clathrin- and caveolae - mediated endocytosis.(55) the biorecognition and cellular uptake of p-(gflg - mce6)-(fab-fitc) and p-(gflg - sos)-(fab-fitc) was studied using confocal microscopy (figure 1) and flow cytometry (figures 2 and 3). after a 1 h exposure of ovcar-3 cells to hpma copolymer conjugates at 37 c, the intracellular concentrations of targeted polymer conjugates containing mce6 and sos were significantly higher when compared to nontargeted conjugates. both confocal microscopy images and flow cytometry profiles displayed very similar results. confocal image of fixed ovcar-3 cells incubated with fluorescein - labeled hpma copolymer conjugates in rpmi 1640 culture medium for 1 h in the dark. (a) p-(gflg - mce6)-fitc, (b) p-(gflg - sos)-fitc, (c) p-(gflg - mce6)-(fab-fitc), and (d) p-(gflg - sos)-(fab-fitc). flow cytometry profiles of ovcar-3 cells incubated with fluorescein - labeled hpma copolymer conjugates in rpmi 1640 culture medium for 1 h in the dark. (a) control cells, (b) p-(gflg - mce6)-fitc, (c) p-(gflg - sos)-fitc, (d) p-(gflg - sos)-(fab-fitc), (e) p-(gflg - mce6)-(fab-fitc). flow cytometry profiles of ovcar-3 cells incubated with fluorescein - labeled hpma copolymer conjugates in rpmi 1640 culture medium for 2 h in the dark at 0 c. (a) control cells, (b) p-(gflg - mce6)-fitc, (c) p-(gflg - sos)-fitc, (d) p-(gflg - sos)-(fab-fitc), (e) p-(gflg - mce6)-(fab-fitc). however, at 37 c two processes, biorecognition at surface and internalization by endocytosis, are operative. to clearly demonstrate the biorecognition of targeted conjugates by the cd47 antigen, ovcar-3 cells were exposed to conjugates at 0 c. flow cytometry data at 0 c, at conditions that suppress endocytosis, demonstrated the biorecognition of p-(gflg - mce6)-fab and p-(gflg - sos)-fab conjugates by ovcar-3 cells (figure 3). after incubation of ovcar-3 cells with targeted and nontargeted conjugates for 2 h, no increase in fluorescent intensity (when compared to controls not exposed to any conjugates) in cells incubated with p - gflg - mce6 and p - gflg - sos was observed. in contrast, higher fluorescent intensities were detected in cells incubated with targeted (fab containing) conjugates p-(gflg - mce6)-fab and p-(gflg - sos)-fab. presumably, the fluorescent signals were derived from membrane associated conjugates as a result of fabcd47 interactions. these results indicated the biorecognition of hpma copolymer conjugates containing the fab antibody fragment by ovcar-3 cells. the results of confocal microscopy are consistent with the internalization of targeted hpma copolymer conjugates via receptor - mediated endocytosis, and of the nontargeted conjugates, containing hydrophobic drugs, by fluid - phase pinocytosis and adsorptive pinocytosis, concurrently. the data are consistent with our previous results on the determination of binding constants of ov - tl16 antibody targeted hpma copolymers toward ovcar-3 cells.(58) the affinity constant, ka, of free antibody was 8 10 m, whereas the ka for the p-(gg - mce6)-fab was 3 10 m. the minor decrease in the affinity may be a result of chemical modification and/or steric hindrance of the polymer chain upon the formation of the antibodyantigen complex. the growth inhibitory effects of mce6, sos, p - gflg - mce6, p - gflg - sos, p-(gflg - mce6)-fab, and p-(gflg - sos)-fab as single agents on ovcar-3 cells were evaluated after drug exposure using the mtt assay. the ic50 values for the free drugs, nontargeted and targeted hpma copolymer conjugates are shown in table 3. the 1-day mce6 exposure and 4-day sos exposure have been selected based on preliminary experiments on the relationship between exposure time and cell inhibition effect (data not shown). after 1-day mce6 exposure and 4-day sos exposure, the cells were more susceptible to mce6 than sos about 2 times. it is interesting to note the enormous difference in the activity of sos toward ovcar-3 cells and toward the human a498 renal cell line.(31) our previous study on human renal a498 cells demonstrated that free sos and p - gflg - sos conjugates were effective individually and in combination with free dox and p - gflg - dox or free mce6 and p - gflg- mce6, respectively.(31) the ic50 values for mce6 toward both cell types (ovcar-3 and a498(31)) were similar. however, sos was very effective toward a498 cells (ic50 = 3 nm),(31) but its activity toward ovcar-3 was about 670 times lower. these data are consistent with the results of the nci anticancer drug screen consisting of a panel of 60 human cancer cell lines. rivera. showed that after a 2-day continuous exposure to sos, ovcar-3 cells were less sensitive to sos than the a498 cells.(35) these results reflect the different p53 status in these cell lines. the inhibitory effect of sos is mediated through p53 ; the disruption of the p53-hdm-2 interactions results in increasing p53 accumulation in tumor cells.(33) it was demonstrated that the p53 status of a498 cells and ovcar-3 cells is wild - type and mutant, respectively.(59) however, the study of the p53 gene in human ovarian carcinoma cell lines by yaginuma and westphal showed that the wild - type p53 protein was detectable in ovcar-3 cells by immunoprecipitation analysis.(60) these reports indicated that ovcar-3 cells can be inhibited by higher concentrations of sos, but have a considerably lower sensitivity when compared to the a498 cell line. ic50 and dm values are the means sem (n = 6 in single experiment). the ic50 doses of nontargeted conjugates, p - gflg - mce6 and p - gflg - sos, were higher than those of free mce6 and sos, respectively. these results reflect the different mechanisms of cell entry of free drugs vs copolymer conjugates.(61) in contrast, the targeted p-(gflg - mce6)-fab conjugate was 2 and 9 times more effective than mce6 and p - gflg - mce6, respectively. the cytotoxicity data with mce6 conjugates were in agreement with biorecognition data and internalization mechanisms (figures 1, 2 and 3). there was a discrepancy in data obtained for p-(gflg - sos)-fab. this conjugate showed faster internalization (figure 1) and moderately better biorecognition (figure 2) than p - gflg - sos ; however, it possessed a slightly weaker inhibitory effect than p - gflg - sos (table 3). after long exposure times the intracellular drug content of targeted and nontargeted conjugates may be similar.(62) furthermore, the efficacies of sos and its conjugates might be limited by the problem of sos trafficking to the subcellular compartments where p53 is mainly located, such as nucleus and mitochondria.(63) subcellular targeting is very important for some active agents and macromolecular therapeutics that have to be transported to their assigned cell organelles. once those molecules are delivered to the cytosol, various approaches to locate drugs in a particular subcellular organelle have been performed, such as the use of nuclear localization peptides, cell - penetrating peptides,(65) lipophilic cationic moieties,(2) and mitochondrial localization agents.(66) the oa-3 surface antigen (cd47 or iap) was chosen as delivery target in this study because it is overexpressed in about 90% of the ovarian tumors and only weakly expressed in normal tissue.(39) a panel of anti - cd47 mabs used in the study of mawby., such as nbts / bric-125 (bric-125), nbts / bric-126 (bric-126) and nbts / bric-154 (bric-154), showed an extremely broad tissue distribution, not only in ovarian carcinomas studied, but also in all hematopoietic cells, mesenchyme and epithelia at multiple sites.(38) on the contrary, the tissue distribution of i - labeled ov - tl16 mab in ovcar-3 bearing nude mice 48 h after iv injection studied by boerman. demonstrated that i - labeled ov - tl16 mab possessed tumor / nontumor ratio of about 315.(39) furthermore, the mab ov - tl3 used by campbell. to define oa3 showed little or no reactivity with normal tissues but reacted with most ovarian carcinomas.(40) slobbe. studied the structure of ov - tl3 and ov - tl16 antibodies and reported that both mabs are able to bind to same epitopic regions on the ovarian carcinoma membrane antigen oa3, although structurally different in their vh regions.(67) the basis for the difference between mabs used in the study of mawby. and boerman. or campbell. one possibility is that an unusual amino acid sequence in the oa3 isoforms is expressed in ovarian cancer cells, and that ov - tl3 and ov - tl16 recognize epitopes in this sequence.(38) the investigation of possible synergistic, additive, or antagonistic effects of sequential combinations of sos+mce6, p - gflg - sos+p - gflg - mce6, or p-(gflg - sos)-fab+p-(gflg - mce6)-fab against the ovarian carcinoma ovcar-3 cell line was performed in vitro by exposing cells to sos or its conjugates for 4 days, followed by exposure of cells to mce6 or its conjugates for 1 day, and finally, a 30 min irradiation. this sequential combination was chosen because the optimal exposure times of sos / p - gflg - sos / p-(gflg - sos)-fab and mce6/p - gflg - mce6/p-(gflg - mce6)-fab were different (4 days for sos and 1 day for mce6), as mentioned above. the dose ratios of each combination (table 4) were based on their respective ic50 concentrations from table 3 as a series of 2-fold dilutions from 4 to 0.03125 times ic50. figure 4 shows the composite doseresponse curves and median - effect plots of ovcar-3 cells, indicating the antiproliferative effects of single agents and their combinations. the doseresponse curves for combined treatment were obtained by plotting % cell viability (y) vs the combined dose of two single agents (x). the median - effect plots of single agents and combinations were derived from the linear part of doseresponse curves. the dose ratio and dm values of the combination treatments are shown in table 4. the ic50 dose of each drug in combinations was significantly lower than those of each drug as single agents (compare tables 3 and 4). these results clearly indicate that all of the combination treatments were effective against ovcar-3 cells. dm values are the means sem (n = 6 in single experiment). doses of drug a and drug b were calculated approximately from the dm of each combination and dose ratio. dose response curves and median - effect plots of ovcar-3 cells treated with mce6, sos, p - gflg - mce6, p - gflg - sos, p-(gflg - mce6)-fab, and p-(gflg - sos)-fab as single agents and sequential combinations at constant ratios of their respective ic50 concentrations. the ci analysis was used to assess the drugdrug interaction of the sequential combinations of free drugs, nontargeted and targeted copolymer conjugates toward ovcar-3 cells in vitro. in the ci analysis, values of ci 1 indicate synergy, additivity, and antagonism, respectively. figure 5 shows the combination index plots (faci plots) over all inhibition effect levels (fa = 0.050.95 or 595% of inhibition effect) in ovcar-3 cells. the sequential combinations of sos+mce6 and p - gflg - sos+p - gflg - mce6 yield ci values lower than 1 over the entire range of cytotoxicity, indicating very strong synergistic to synergistic effects. the p-(gflg - sos)-fab+p-(gflg - mce6)-fab combination also displayed a strong synergism for fa values up to about 0.85, but showed synergistic effect and nearly additive effect at fa = 0.9 and 0.95, respectively. chemotherapeutic drugs and their hpma copolymer conjugates were gradually diluted at the ratio of their ic50 values as a series of 2-fold dilutions from 4 to 0.03125 times ic50 and ovcar-3 cells exposed to drugs ci 1 indicate synergism, additive effect, and antagonism, respectively. the vertical bars indicate the 95% confidence intervals based on sequential deletion analysis (sda) and can be generated by using compusyn software. the drug interactions may depend on the differences of drugs in the combination, such as physicochemical properties, the mechanisms of action, and the drug exposure schedules. sos and mce6 are hydrophobic low molecular weight molecules, but both have different mechanisms and sites of action. sos acts on p53 and dna while mce6 can cause damage to biological molecules by generation of reactive oxygen species. in our previous study, we compared the simultaneous combination of p - gflg - sos+p - gflg - mce6 to sos+mce6 against the human renal a498 carcinoma cell line. after 16 h cell exposure to the combinations, both combinations displayed synergism for fa up to 0.8, but showed slight antagonism and near additivity at fa = 0.95.(31) many researchers have studied the antitumor activities following different drug exposure schedules. for example, the simultaneous and sequential exposures of irofulven with oxaliplatin or cisplatin against human breast, colon, and ovarian cancer cell lines showed that the sequence oxaliplatin followed by irofulven displayed better synergistic effect than the other schedules.(68) combination chemotherapy and pdt with free sos and mce6, their nontargeted and fab-targeted hpma copolymer conjugates in human ovarian carcinoma ovcar-3 cells was evaluated. sequential combinations of these therapeutics produced very strong synergism to nearly additivity in the treatment of ovcar-3 cells. the synergistic effects ranked in the order p - gflg - sos+p - gflg - mce6 > sos+mce6 > p-(gflg - sos)-fab+p-(gflg - mce6)-fab. these data support continued in vivo investigations of sos and mce6 combinations to determine the antitumor activity for the treatment of ovarian cancer. aibn, 2,2-azobisisobutyronitrile ; apma, n-(3-aminopropyl)methacrylamide hydrochloride ; ci, combination index ; dm, median - effect dose ; di, deionized ; dipea, n, n-diisopropylethylamine ; dmap, 4-dimethylaminopyridine ; dmf, n, n - dimethylformamide ; dox, doxorubicin ; epr, enhanced permeability and retention ; gflg, glycylphenylalanylleucylglycine ; hpma, n-(2-hydroxypropyl)methacrylamide ; ic50, concentration that inhibited cell growth by 50% as compared with control cell growth ; ma, methacryloyl ; mab, monoclonal antibody ; mw, weight average molecular weight ; mce6, mesochlorin e6 monoethylenediamine disodium salt ; mtt assay, modified 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide assay ; onp, p - nitrophenoxy ; p, hpma copolymer backbone ; pdt, photodynamic therapy ; p - gflg - mce6, hpma copolymermce6 conjugate ; p-(gflg - mce6)-fab, antibody fab fragment targeted hpma copolymermce6 conjugate ; p - gflg - onp, hpma copolymer precursor containing reactive p - nitrophenyl ester groups at side chain termini ; p - gflg - sos, hpma copolymersos conjugate ; p-(gflg - sos)-fab, antibody fab fragment targeted hpma copolymersos conjugate ; 5-sfx, 6-(fluorescein-5-carboxamido)hexanoic acid succinimidyl ester ; smcc, succinimidyl trans-4-(maleimidomethyl)cyclohexane-1-carboxylate ; sos, 2,5-bis(5-hydroxymethyl-2-thienyl)furan ; thf, tetrahydrofuran. | the biological activities of sequential combinations of anticancer drugs, sos thiophene (sos) and mesochlorin e6 monoethylenediamine (mce6), in the form of free drugs, nontargeted n-(2-hydroxypropyl)methacrylamide (hpma) copolymerdrug conjugates, p - gflg - mce6 and p - gflg - sos (p is the hpma copolymer backbone and gflg is the glycylphenylalanylleucylglycine spacer), and fab-targeted hpma copolymerdrug conjugates, p-(gflg - mce6)-fab and p-(gflg - sos)-fab (fab from ov - tl16 antibodies complementary to cd47), were evaluated against human ovarian carcinoma ovcar-3 cells. mce6, sos, p - gflg - mce6, p - gflg - sos, p-(gflg - mce6)-fab, and p-(gflg - sos)-fab, when used as single agents or in binary combination, exhibited cytotoxic activities against ovcar-3 cells, as determined using a modified mtt assay. the binding and internalization of p-(gflg - mce6)-fab and p-(gflg - sos)-fab by ovcar-3 cells were visualized by confocal microscopy and flow cytometry. the results confirmed an enhanced biorecognition by ovcar-3 cells of fab-targeted hpma copolymer conjugates over nontargeted conjugates. the median - effect analysis and the determination of the combination index (ci) were used to describe the drug interaction and quantify the synergism, antagonism, or additivity in anticancer effects. the sequential combinations of sos+mce6 and p - gflg - sos+p - gflg - mce6 displayed very strong synergism to synergism in the entire range of cell inhibition levels (fa = 0.5 0.95). the p-(gflg - sos)-fab+p-(gflg - mce6)-fab exhibited a strong synergism for fa values up to about 0.85, but showed synergistic effect and nearly additive effect at fa = 0.9 and 0.95, respectively. these observations support the continuation of in vivo investigations of these conjugates for the treatment of ovarian cancer. |
postinfectious obliterative bronchiolitis (ob) is an uncommon and severe form of chronic obstructive lung disease that occurs in children after lower respiratory tract injury. () in terms of diagnosis, there are no specific signs or symptoms of postinfectious ob. clinical and imaging findings are used in combination with laboratory test results in order to identify the cause and rule out other forms of chronic lung disease. the diagnostic criteria for postinfectious ob are as follows : severe acute bronchiolitis / viral pneumonia during the first 3 years of life in previously healthy children ; evidence of persistent airway obstruction after the acute event, identified by physical examination, pulmonary function testing, or both ; chest x - ray findings of obstructive lung disease ; a mosaic pattern and air trapping (at) on chest ct scans ; and exclusion of other chronic lung diseases progressing to permanent respiratory symptoms. (,) histologically, ob is characterized by the presence of granulation tissue plugs in the small airway lumen, complete small airway destruction, or both. () showed that ob is histologically characterized by a constrictive pattern with varying degrees of inflammation and airway obliteration, ranging from minimal bronchiolar inflammation to complete obliteration of the bronchioles and bronchi by fibrotic tissue. indirect signs of obstruction, such as macrophage accumulation, bronchiectasis, mucus accumulation, and hyperinflation, are always present. although there have been several reviews of studies examining long - term sequelae of adenovirus pneumonia, (,) few studies have examined ct findings in children with ob. (,) some of these studies have reported that abnormal ct findings in such children can predict abnormal lung function later in life. () it has been reported that hrct is an important diagnostic tool for the evaluation of pulmonary damage in patients with ob. () the volume of an organ (or the volume of abnormal parts of an organ) can be determined by the use of helical ct images and attenuation coefficient values or densities on the hounsfield scale, expressed in hounsfield units (hu). this method is known as volumetric ct densitometry or ct densitovolumetry, (,) and it can be used in order to measure the volume of areas of lung with low attenuation (i.e., at), as well as total lung volume (tlv), in children with ob. in addition, it can be used in order to measure the percentage of at relative to tlv (at%) with the use of thresholds to differentiate normal lung areas from ob areas. it has been shown that at% is a major contributing factor to chronic persistent airflow obstruction in asthma. (,) the clinical course following the onset of ob is variable and depends on the volume of affected lung tissue. () measures of clinical status and of the ability to perform physically demanding activities - such as the number of hospital admissions or missed school days, walk test distance, nutritional status, and oxygen saturation (so2) at rest or during exercise - facilitate the selection of appropriate clinical interventions. (,) because the prognosis of ob patients depends not only on patient behavior but also on functional impairment and the extent of anatomical damage, clinicians should gather information regarding the extent and type of anatomical abnormalities. bronchiectasis, atelectasis, lobar collapse, and areas of low density are known consequences of postinfectious ob, and hrct is the best method of examining such lesions, (,,) all of which can influence the clinical status of patients and their pulmonary function test results. (,,) previous studies have shown that low attenuation areas correlate well with pulmonary function test results in patients with at of various causes.(-) however, to our knowledge, no studies have shown a correlation of ct densitovolumetry findings with pulmonary function in children with ob. (,,) our objective was to describe the correlation between the volume of areas of at and pulmonary function test results in children with ob. in addition, we compared at% values with so2 values, pulmonary function test results, and clinical scores in those children in an attempt to obtain objective measurement criteria for ob. this was a prospective study including all of the children treated at our postinfectious ob clinic for more than 5 years and having clinically stable ob and symptom onset before the age of 2 years. the study protocol was approved by the local research ethics committee, and the parents or legal guardians of all participants gave written informed consent. the diagnosis of ob was based on the identification of chronic obstructive respiratory symptoms appearing after an episode of lower respiratory tract infection before the age of 2 years in previously healthy children. (,) all clinical diagnoses were confirmed by characteristic findings on contemporary hrct scans. the inclusion criteria were as follows () : acute bronchiolitis / viral pneumonia before the age of 2 years in previously healthy children ; evidence of persistent airway obstruction after the acute event, identified by physical examination, pulmonary function testing, or both, the obstruction being unresponsive to at least 2 weeks of treatment with systemic corticosteroids and bronchodilators ; radiological findings of obstructive lung disease, including hyperinflation, atelectasis, bronchial wall thickening, and bronchiectasis, as well as a mosaic perfusion pattern and at on ct scans ; and absence of other chronic lung diseases progressing to persistent respiratory symptoms, including tuberculosis, cystic fibrosis, bronchopulmonary dysplasia, immunodeficiency, asthma, and severe alpha-1 antitrypsin deficiency. the exclusion criteria were as follows : being unable to undergo pulmonary function testing or ct without sedation ; being unable to hold breath for the duration of ct scanning ; having disease exacerbation 4% during the 6mwt (0 = negative and 1 = positive) ; 13) the fev1/fvc ratio ; and 14) percent predicted fev1 (fev1% ; > 80% = 0 ; 61 - 80% = 1 ; 41 - 60% = 2 ; 50%, reasonable / good if it was 30 - 50%, and poor if it was 5% were considered to indicate severe disease expression. moreover, at%dm values of 1 - 10% were considered to indicate moderate disease expression, and at%dm values > 10% were considered to indicate severe disease expression. the magnitude of variability in at%950 and at%dm guided the selection of values to differentiate between moderate and severe disease expression (figure 3). figure 3 scatter plot illustrating the distribution of patients according to the percentage of air trapping relative to total lung volume (at%), which was calculated for a fixed threshold of 950 hu (at%950) and for thresholds set by subjective analysis based on density masks (at%dm). note that at%dm allows better discrimination among the grades of disease severity (i.e., grade 1, normal / mild ; grade 2, moderate ; and grade 3, severe), especially for moderate disease (at% > 1%) and severe disease (at% > 10%). note also that the stratification of disease severity changed from normal / mild to moderate in 1 patient (case 10) and from moderate to severe in 1 patient (case 14) depending on the method for selectin g the threshold. figure 4 distribution of the observations of the percentage of air trapping relative to total lung volume (at%), calculated for a fixed threshold of 950 hu - at%950-(red squares) and for thresholds selected with the aid of density masks - at%dm-(blue squares), including the corresponding linear regression lines. the distribution suggests that patients with fev1% above 70% had only mild anatomical damage as measured by quantification of areas of air trapping or hyperinflation. some patients with fev1% in the range of 50% or less had only mild disease as measured by at%950, a finding that highlights the limitations of a threshold of 950 hu for the assessment of patients with obliterative bronchiolitis. the correlation between fev1% and at%dm was much better, as shown by the regression line. of the 19 patients, 2 had normal clinical scores, 7 had clinical scores 10. in the evaluation of the nutritional status, 8 patients had z scores 0.05). regarding pulmonary function parameters, mean fvc was 75 20% (range, 43 - 106%), mean fev1% was 58 20% (range, 36 - 100%), and mean fev1/fvc was 72 16% (range, 49 - 107%). regarding ct densitovolumetry parameters, mean tlv was 3,009 1,184 ml (range, 1,252 - 6,673 ml). the 6mwd was longer in those with larger normal lung volumes (r = 0.53). mean shrink volume was 1,174 789 ml (range, 182 - 3,471 ml), and mean percentage of shrink volume was 36 13% (range, 9 - 63%). mean at%dm was 7.28 9% (range, 0.03 - 24.67%), and mean at%950 was 2.4 3% (range, in 9, 5, and 5 of the 19 patients, at%dm was classified as normal or mild, moderate, and severe, respectively (points above the gray line in figure 3). in 10, 5, and 4 of the 19 patients, at%950 was classified as normal or mild, moderate, and severe, respectively (points above the blue line in figure 3). we found a correlation between at%dm and at%950, as evidenced by r = 0.83 (or r = 0.93 after the exclusion of one outlier). no significant correlation was found between the percentage of shrink volume and at%dm or between the percentage of shrink volume and at%950. the correlations of ct densitovolumetry parameters with clinical scores, pulmonary function test results, and 6mwt parameters are summarized in table 1. table 1 shows the correlation values for each parameter before and after the exclusion of outliers. an uncommon and severe form of chronic obstructive lung disease in children and adults, ob results from lower respiratory tract injury. () the diagnosis of postinfectious ob in children is based on a history of lower respiratory tract infection (usually an acute viral infection), followed by persistent chronic obstructive lung disease. (,) hrct is an excellent method for the identification of anatomical damage following the onset of the disease, such damage including areas of low attenuation, areas of consolidation / atelectasis, bronchial wall thickening, bronchiectasis, and mosaic perfusion. in addition, expiratory hrct scans can assist in confirming the presence of at. however, hrct allows only a subjective assessment of the extent of the disease and is dependent on the experience and skill of radiologists. (,) our study demonstrated that the 6mwd was longer in patients with larger normal lung (r = 0.53). in addition, we found that at%950 showed significant correlations (before and after the exclusion of outliers, respectively) with the clinical score (r = 0.72 ; 0.80), fvc (r = 0.24 ; 0.59), fev1 (r = 0.58 ; 0.67), and fev1/fvc (r = 0.53 ; r = 0.62), as did at%dm with the clinical score (r = 0.58 ; r = 0.63), so2 at rest (r = 0.40 ; r = 0.61), 6mwt_so2 (r = 0.24 ; r = 0.55), fvc (r = 0.44 ; r = 0.80), fev1 (r = 0.65 ; r = 0.71), and fev1/fvc (r = 0.41 ; r = 0.52). these data suggest that objective ct measurements adequately represent clinical scores and functional impairment in ob. ct densitovolumetry has been proven to overcome this limitation and is a standard recommendation for the quantification of other lung diseases in which the proportion between pulmonary air and the lung parenchyma is increased, therefore decreasing lung density. (,) areas of decreased attenuation can also result from decreased perfusion of hypoventilated alveoli distal to obstructed bronchioles. the main finding on expiratory ct scans is a geographic heterogeneity of lung attenuation (mosaic attenuation pattern), which is seen in 40 - 80% of patients. (,) the abnormalities can be subtle on inspiratory ct scans, being usually easier to detect on expiratory ct scans. () in a previous study of the correlation between pulmonary function abnormalities and the extent of hrct features of ob, significant relationships were found only between fev1 and the number of bronchopulmonary segments affected by bronchiectasis. () confirmed that the extent of decreased attenuation was independently associated with a reduction in fev1. in contrast, bronchial wall thickening was independently associated with the presence of at (as measured by rv / tlc). in patients with sauropus androgynus - associated ob, pulmonary function test results were more closely correlated with at than with any other ct parameter. () to our knowledge, the present study is the first to demonstrate significant correlations of at% with clinical scores and pulmonary function test results. the quantification of areas of abnormally low attenuation is an important diagnostic tool for ob, and the technique has substantial advantages over the traditional subjective assessment of hrct images.(-) the quantification of anatomical damage is important in patients with ob ; ct densitovolumetry can measure lung volumes directly and therefore aid clinicians in making decisions regarding patient quarantining and the aggressiveness of treatment. in the present study, clinical scores were moderately correlated with fvc and fev1/fvc (r ~ 0.5). although there was a stronger correlation between clinical scores and fev1 (r = 0.8), these findings are possibly biased because pulmonary function test results were included in the clinical score parameters. additionally, both measures of at% were significantly correlated with clinical scores (r 0.6) ; the strength of those correlations increased when outliers were eliminated (censored at%950, r = 0.8), which suggests that it might increase further in larger series. we found that inspiratory ct scans were much more informative than expiratory ct scans regarding the presence of at. the extent of at areas might have been underestimated on the expiratory ct scans because of the higher expiratory lung density. the 950 hu threshold was validated for emphysema quantification in adult patients, and we used it in the present study despite our conviction that segmentation at this level would result in an underestimation of areas of low attenuation in children, especially in the absence of hyperinflation / emphysema. () although histopathological findings were unavailable for our patients, previous studies (,) have examined correlations between imaging findings and histopathological findings in patients with ob. in addition, our clinical score has yet to be validated, its clinical application requiring further investigation. in conclusion, anatomical damage to the lungs as measured by ct (i.e., at%) correlated significantly with clinical scores and pulmonary function test results. after our censoring of extreme values, at%dm showed stronger correlations than did at%950. determinar as correlaes entre o volume de aprisionamento areo em relao ao volume pulmonar total (aa%) e parmetros clnicos e funcionais em crianas com bronquiolite obliterante (bo). tcnicas de ps - processamento de imagem foram usadas em imagens de tc de 19 crianas com bo para quantificar aa% por meio de um limiar fixo de 950 uh (aa%950) e de limiares selecionados por meio de mscaras de densidade (aa%md). os pacientes foram divididos em trs grupos, de acordo com a gravidade de aa%. foram examinadas as correlaes entre aa% e a saturao de oxignio (so2) em repouso, a distncia percorrida no teste de caminhada de seis minutos (dtc6), a so2 mnima durante o teste de caminhada de seis minutos (so2_tc6), a cvf, o vef1, a relao vef1/cvf e parmetros clnicos. a dtc6 foi maior nos pacientes com maiores volumes pulmonares normais (r = 0,53). na amostra como um todo, encontramos (antes e depois da excluso de valores extremos, respectivamente), correlaes estatisticamente significativas entre aa%950 e o escore clnico (r = 0,72 ; 0,80), a cvf (r = 0,24 ; 0,59), o vef1 (r = 0,58 ; 0,67) e a relao vef1/cvf (r = 0,53 ; r = 0,62), bem como entre aa%md e o escore clnico (r = 0,58 ; r = 0,63), a so2 em repouso (r = 0,40 ; r = 0,61), a so2_tc6 (r = 0,24 ; r = 0,55), a cvf (r = 0,44 ; r = 0,80), o vef1 (r = 0,65 ; r = 0,71) e a relao vef1/cvf (r = 0,41 ; r = 0,52). os resultados deste estudo mostram que aa% correlaciona - se significativamente com escores clnicos e testes de funo pulmonar em crianas com bo. a bronquiolite obliterante (bo) ps - infecciosa uma forma incomum e grave de doena pulmonar obstrutiva crnica que ocorre em crianas aps uma agresso ao trato respiratrio inferior. () no tocante ao diagnstico, no h sinais ou sintomas especficos de bo ps - infecciosa. achados clnicos e de imagem so usados em conjunto com resultados de testes laboratoriais para identificar a causa e descartar outras formas de doena pulmonar crnica. os critrios diagnsticos para bo ps - infecciosa so os seguintes : bronquiolite aguda grave / pneumonia viral durante os 3 primeiros anos de vida em crianas previamente saudveis ; evidncia de obstruo persistente das vias areas aps o evento agudo, identificada por meio de exame fsico, teste de funo pulmonar ou ambos ; achados de doena pulmonar obstrutiva na radiografia de trax ; padro em mosaico e aprisionamento areo (aa) na tc de trax e excluso de outras doenas pulmonares crnicas que progridem para sintomas respiratrios permanentes. (,) histologicamente, a bo caracterizada pela presena de tampes de tecido de granulao no lmen das pequenas vias areas, destruio completa das pequenas vias areas ou ambas. () mauad. () mostraram que a bo histologicamente caracterizada por um padro constritivo com diversos graus de inflamao e obliterao das vias areas, desde inflamao bronquiolar mnima at obliterao completa dos bronquolos e brnquios por tecido fibrtico. sinais indiretos de obstruo, tais como acmulo de macrfagos, bronquiectasia, acmulo de muco e hiperinsuflao, esto sempre presentes. embora vrias revises tenham examinado as sequelas em longo prazo da pneumonia por adenovrus, (,) poucos estudos examinaram os achados tomogrficos em crianas com bo. (,) alguns desses estudos relataram que achados tomogrficos anormais nessas crianas podem predizer a presena de funo pulmonar anormal anos mais tarde. () relatou - se que a tcar uma importante ferramenta diagnstica para avaliar o dano pulmonar em pacientes com bo. () o volume de um rgo (ou o volume de partes anormais de um rgo) pode ser determinado por meio de imagens de tc helicoidal e valores do coeficiente de atenuao ou densidades na escala de hounsfield, em unidades hounsfield (uh). esse mtodo conhecido como densitometria e anlise volumtrica pulmonar por tc ou densitovolumetria pulmonar por tc (,) e pode ser usado para medir o volume de reas pulmonares com baixa atenuao (ou seja, aa) e o volume pulmonar total (vpt) em crianas com bo. alm disso, pode ser usado para medir a porcentagem de aa em relao ao vpt (aa%) por meio de limiares para diferenciar reas pulmonares normais de reas de bo. demonstrou - se que aa% contribui sobremaneira para a obstruo ao fluxo areo persistente e crnica na asma. () a funo pulmonar permanece anormal durante longos perodos aps um episdio de bo. (,) o curso clnico aps o aparecimento de bo varivel e depende do volume do tecido pulmonar afetado. () medidas do estado clnico e da capacidade de realizar atividades fsicas intensas - medidas como o nmero de internaes hospitalares ou de dias de aula perdidos, a distncia percorrida em testes de caminhada, o estado nutricional e a saturao de oxignio (so2) em repouso ou durante o exerccio - facilitam a seleo de intervenes clnicas apropriadas. (,) como o prognstico dos pacientes com bo depende no s de seu comportamento, mas tambm do comprometimento funcional e da extenso do dano anatmico, os clnicos devem reunir informaes sobre o tipo de anormalidade anatmica e sua extenso. bronquiectasia, atelectasia, colapso lobar e reas de baixa densidade so conhecidas consequncias da bo ps - infecciosa, e a tcar o melhor mtodo para examinar tais leses, (,,) as quais podem influenciar o estado clnico dos pacientes e seu desempenho nos testes de funo pulmonar. (,,) estudos anteriores demonstraram que reas de baixa atenuao correlacionam - se bem com os resultados de testes de funo pulmonar em pacientes com aa de causas variadas. (-) no entanto, at onde sabemos, nenhum estudo mostrou uma correlao entre achados de densitovolumetria pulmonar por tc e funo pulmonar em crianas com bo. (,,) nosso objetivo foi descrever a correlao entre o volume de reas de aa e os resultados de testes de funo pulmonar em crianas com bo. alm disso, comparamos os valores de aa% aos valores de so2, aos resultados dos testes de funo pulmonar, e aos escores clnicos observados nessas crianas, na tentativa de obter critrios objetivos de medio de bo. trata - se de um estudo prospectivo incluindo todas as crianas que foram atendidas em nossa clnica de bo ps - infecciosa durante mais de 5 anos e que apresentavam bo clinicamente estvel e incio dos sintomas antes da idade de 2 anos. o protocolo do estudo foi aprovado pelo comit de tica em pesquisa da instituio, e todos os pais ou responsveis assinaram um termo de consentimento livre e esclarecido. o diagnstico de bo baseou - se na identificao de sintomas respiratrios obstrutivos crnicos aps um episdio de infeco do trato respiratrio inferior antes da idade de 2 anos em crianas anteriormente saudveis. (,) todos os diagnsticos clnicos foram confirmados por achados caractersticos em tcar contempornea. os critrios de incluso foram os seguintes () : bronquiolite aguda / pneumonia viral antes dos 2 anos de idade em crianas previamente saudveis ; evidncia de obstruo persistente das vias areas aps o evento agudo, identificada por meio de exame fsico, teste de funo pulmonar ou ambos e sem resposta a pelo menos 2 semanas de tratamento com corticosteroides sistmicos e broncodilatadores ; achados radiolgicos de doena pulmonar obstrutiva, incluindo hiperinsuflao, atelectasia, espessamento das paredes brnquicas e bronquiectasia, alm de padro de perfuso em mosaico e aa na tc ; ausncia de outras doenas pulmonares crnicas que progridem para sintomas respiratrios persistentes, incluindo tuberculose, fibrose cstica, displasia broncopulmonar, imunodeficincias, asma e deficincia grave de alfa-1 antitripsina. os critrios de excluso foram os seguintes : incapacidade de se submeter aos testes de funo pulmonar ou tc sem sedao ; incapacidade de segurar a respirao durante todo o exame de tc ; exacerbao da doena 95% = 0 ; 90 - 94% = 1 e 95% = 0 ; 90 - 94% = 1 e 4% durante o tc6 (0 = negativo e 1 = positivo) ; 13) relao vef1/cvf e 14) vef1 em porcentagem do previsto (vef1% ; > 80% = 0 ; 61 - 80% = 1 ; 41 - 60% = 2 ; 50%, razovel / boa se = 30 - 50% e ruim se 5% foram considerados indicativos de grave expresso da doena. alm disso, valores de aa%md de 1 - 10 % foram considerados indicativos de moderada expresso da doena, e valores > 10% foram considerados indicativos de grave expresso da doena. a magnitude da variabilidade de aa%950 e aa%md orientou a seleo de valores para distinguir doena moderada de doena grave (figura 3). figura 3 grfico de disperso ilustrando a distribuio dos pacientes de acordo com a porcentagem de aprisionamento areo em relao ao volume pulmonar total (aa%), calculada com um limiar fixo de 950 uh (aa%950) e com limiares estabelecidos por anlise subjetiva baseada em mscaras de densidade (aa%md). nota - se que aa%md permite melhor discriminao dos graus de gravidade da doena (ou seja, grau 1, normal / leve ; grau 2, moderada e grau 3, grave), especialmente doena moderada (aa% > 1%) e grave (aa% > 10%). de normal / leve para moderada em 1 paciente (caso 10) e de moderada para grave em 1 paciente (caso 14) dependendo do mtodo usado para selecionar o limiar. todas as variveis foram analisadas por meio do coeficiente de correlao produto - momento de pearson. as correlaes foram determinadas antes e depois da excluso de valores extremos (figura 4). os valores de r e p foram calculados separadamente para dados censurados e no censurados. foram tambm calculadas as correlaes com os resultados dos testes de funo pulmonar e escores clnicos. figura 4 distribuio das observaes da porcentagem de aprisionamento areo em relao ao volume pulmonar total (aa%), calculada com um limiar fixo de 950 uh - at%950 - (quadrados vermelhos) e com limiares selecionados com o auxlio de mscaras de densidade - aa%md - (quadrados azuis), incluindo as linhas de regresso linear correspondentes. a distribuio sugere que os pacientes com vef1% acima de 70% apresentavam dano anatmico leve conforme medido pela quantificao das reas de aprisionamento areo ou hiperinsuflao. alguns pacientes com vef1% na faixa de 50% ou menos tinham doena leve conforme medida por aa%950, um achado que evidencia as limitaes do limiar de 950 uh para avaliar pacientes com bronquiolite obliterante. a correlao entre vef1% e aa%md foi muito melhor, como mostra a linha de regresso. dos 19 pacientes, 2 apresentaram escores clnicos normais, 7 apresentaram escores clnicos 10. na avaliao do estado nutricional, 8 pacientes apresentaram escore z 0,05). no tocante aos parmetros de funo pulmonar, a mdia da cvf foi de 75 20% (variao : 43 - 106%), a mdia do vef1% foi de 58 20% (variao : 36 - 100%) e a mdia da relao vef1/cvf foi de 72 16% (variao : 49 - 107%). no tocante aos parmetros da densitovolumetria pulmonar por tc, a mdia do vpt foi de 3.009 1.184 ml (variao : 1.252 - 6.673 ml). a dtc6 foi maior nos pacientes com maiores volumes pulmonares normais (r = 0,53). a mdia do volume de encolhimento foi de 1.174 789 ml (variao : 182 - 3.471 ml), e a mdia da porcentagem do volume de encolhimento foi de 36 13% (variao : 9 - 63%). a mdia de aa%md foi de 7,28 9% (variao : 0,03 - 24,67%), e a mdia de aa%950 foi de 2,4 3% (variao : 0,03 - 8,67%). em 9, 5 e 5 dos 19 pacientes, aa%md foi classificada em normal ou leve, moderada e grave, respectivamente (pontos acima da linha cinza na figura 3). em 10, 5 e 4 dos 19 pacientes, aa%950 foi classificada em normal ou leve, moderada e grave, respectivamente (pontos acima da linha azul na figura 3). encontramos uma correlao entre aa%md e aa%950, evidenciada por r = 0,83 (ou r = 0,93, aps a excluso de um valor extremo). no encontramos correlao significativa entre a porcentagem do volume de encolhimento e aa%md ou entre a porcentagem do volume de encolhimento e aa%950. as correlaes dos parmetros de densitovolumetria pulmonar por tc com os escores clnicos, resultados dos testes de funo pulmonar e parmetros do tc6 esto resumidas na tabela 1. a tabela 1 mostra os valores de correlao para cada parmetro, antes e depois da excluso de valores extremos. a figura 4 ilustra as correlaes de aa%md e aa%950 com os parmetros no densitomtricos. a bo uma forma incomum e grave de doena pulmonar obstrutiva crnica em crianas e adultos que resulta de uma agresso ao trato respiratrio inferior. () o diagnstico de bo ps - infecciosa em crianas baseia - se em uma histria de infeco do trato respiratrio inferior (geralmente uma infeco viral aguda) seguida de doena pulmonar obstrutiva crnica persistente. (,) a tcar um excelente mtodo para a identificao de dano anatmico aps o incio da doena, incluindo reas de baixa atenuao, reas de consolidao / atelectasia, espessamento das paredes brnquicas, bronquiectasia e perfuso em mosaico. alm disso, imagens de tcar expiratria podem ajudar a confirmar a presena de aa. no entanto, a tcar permite apenas uma avaliao subjetiva da extenso da doena e depende da experincia e habilidade dos radiologistas. (,) nosso estudo demonstrou que a dtc6 foi maior em pacientes com maior pulmo normal (r = 0,53). alm disso, encontramos correlaes significativas (antes e aps a excluso de valores extremos, respectivamente) entre aa%950 e o escore clnico (r = 0,72 ; 0,80), a cvf (r = 0,24 ; 0,59), o vef1 (r = 0.58 ; 0.67) e a relao vef1/cvf (r = 0,53 ; r = 0,62), bem como entre aa%md e o escore clnico (r = 0,58 ; r = 0,63), a so2 em repouso (r = 0,40 ; r = 0,61), a so2_tc6 (r = 0,24 ; r = 0,55), a cvf (r = 0,44 ; r = 0,80), o vef1 (r = 0,65 ; r = 0,71) e a relao vef1/cvf (r = 0,41 ; r = 0,52). esses dados sugerem que medidas tomogrficas objetivas representam adequadamente escores clnicos e comprometimento funcional na bo. provou - se que a densitovolumetria pulmonar por tc supera essa limitao e uma recomendao - padro para a quantificao de outras doenas pulmonares nas quais a proporo entre o ar pulmonar e o parnquima pulmonar maior, diminuindo, portanto, a densidade pulmonar. (,) reas de atenuao reduzida tambm podem resultar da diminuio da perfuso de alvolos hipoventilados distais aos bronquolos obstrudos. o principal achado da tomografia expiratria uma heterogeneidade geogrfica da atenuao pulmonar (padro de atenuao em mosaico), observado em 40 - 80% dos pacientes. (,) as alteraes podem ser sutis nas imagens de tc inspiratria ; so geralmente mais fceis de detectar em imagens de tc expiratria. () em um estudo anterior da correlao entre alteraes da funo pulmonar e a extenso das caractersticas de bo na tcar, foram encontradas relaes significativas somente entre vef1 e o nmero de segmentos broncopulmonares afetados por bronquiectasia. () confirmaram que a extenso da diminuio da atenuao associou - se independentemente a uma reduo do vef1. em contraste, o espessamento das paredes brnquicas associou - se independentemente presena de aa (medida por vr / cpt). em pacientes com bo associada a sauropus androgynus, os resultados dos testes de funo pulmonar correlacionaram - se mais com aa do que com qualquer outro parmetro tomogrfico. () at onde sabemos, o presente estudo o primeiro a demonstrar correlaes significativas entre aa% e escores clnicos e resultados de testes de funo pulmonar. a quantificao das reas de atenuao anormalmente baixa uma importante ferramenta para o diagnstico de bo, e a tcnica tem vantagens substanciais sobre a tradicional avaliao subjetiva de imagens de tcar.(-) a quantificao do dano anatmico importante em pacientes com bo ; a densitovolumetria pulmonar por tc capaz de medir volumes pulmonares diretamente e, portanto, ajudar os clnicos a tomar decises sobre a quarentena de pacientes e a agressividade do tratamento. no presente estudo, os escores clnicos correlacionaram - se moderadamente com a cvf e a relao vef1/cvf (r ~ 0,5). embora a correlao entre os escores clnicos e o vef1 tenha sido mais forte (r = 0,8), esses resultados so possivelmente tendenciosos, pois os resultados dos testes de funo pulmonar foram includos nos parmetros do escore clnico. alm disso, ambas as medidas de aa% correlacionaram - se significativamente com os escores clnicos (r 0,6) ; a fora dessas correlaes aumentou quando foram eliminados os valores extremos (aa%950 censurada : r = 0,8), o que sugere que pode aumentar ainda mais em sries maiores. as imagens de tc inspiratria foram muito mais informativas que as de tc expiratria no tocante presena de aa. a extenso das reas de aa pode ter sido subestimada nas imagens de tc expiratria por causa da densidade pulmonar expiratria maior. o limiar de 950 uh foi validado para a quantificao do enfisema em pacientes adultos, e ns o usamos no presente estudo no obstante nossa convico de que a segmentao nesse nvel resultaria em subestimao das reas de baixa atenuao em crianas, especialmente na ausncia de hiperinsuflao / enfisema. () embora no tivssemos os achados histopatolgicos em nossos pacientes, estudos anteriores (,) examinaram as correlaes entre achados de imagem e achados histopatolgicos em pacientes com bo. alm disso, nosso escore clnico ainda no foi validado ; so necessrios mais estudos para sua aplicao clnica. em suma, o dano anatmico aos pulmes medido por meio de tc (ou seja, aa%) correlacionou - se significativamente com escores clnicos e resultados de testes de funo pulmonar. aps a censura de valores extremos, aa%md apresentou correlaes mais fortes do que aa%950. | objective : to determine whether air trapping (expressed as the percentage of air trapping relative to total lung volume [at% ]) correlates with clinical and functional parameters in children with obliterative bronchiolitis (ob). methods : ct scans of 19 children with ob were post - processed for at% quantification with the use of a fixed threshold of 950 hu (at%950) and of thresholds selected with the aid of density masks (at%dm). patients were divided into three groups by at% severity. we examined at% correlations with oxygen saturation (so2) at rest, six - minute walk distance (6mwd), minimum so2 during the six - minute walk test (6mwt_so2), fvc, fev1, fev1/fvc, and clinical parameters. results : the 6mwd was longer in the patients with larger normal lung volumes (r = 0.53). we found that at%950 showed significant correlations (before and after the exclusion of outliers, respectively) with the clinical score (r = 0.72 ; 0.80), fvc (r = 0.24 ; 0.59), fev1 (r = 0.58 ; 0.67), and fev1/fvc (r = 0.53 ; r = 0.62), as did at%dm with the clinical score (r = 0.58 ; r = 0.63), so2 at rest (r = 0.40 ; r = 0.61), 6mwt_so2 (r = 0.24 ; r = 0.55), fvc (r = 0.44 ; r = 0.80), fev1 (r = 0.65 ; r = 0.71), and fev1/fvc (r = 0.41 ; r = 0.52). conclusions : our results show that at% correlates significantly with clinical scores and pulmonary function test results in children with ob. |
a 20-year - old boy presented to the emergency department with sudden onset severe left flank pain for a week and no associated vomiting or urinary symptoms. he had a history of per - rectal bleeding 6 months earlier for which he was evaluated elsewhere. an ultrasound done elsewhere the previous day was suggestive of a left perinephric mass, hence a contrast enhanced computed tomography (ct) of the abdomen was performed. it revealed an 8 7 cm hyperdense lesion in the perinephric space displacing the kidney anteriorly, with an intensely enhancing lesion adjacent to the hemorrhage, indicating an arterial aneurysm with surrounding hemorrhage [figure 1 ]. it revealed multiple small left renal arterial aneurysms with no active bleeding [figure 2a ]. it also revealed similar aneurysms in the superior mesenteric and lumbar arteries [figure 2b ]. anti - nuclear antibodies, hepatitis b and c serology were negative, and complement levels were normal. a diagnosis of pan was made and he was started on steroids and mycophenolate mofetil, as well as anti - hypertensive medication. he was well at 9 months follow - up and ct angiogram showed no beading of the renal vasculature [figure 3 ]. computed tomography of the abdomen showing perinephric hematoma (arrow) with adjacent intensely enhancing lesion suggestive of an aneurysm (arrowhead) abdominal arteriography (a) left renal arteriogram showing multiple small aneurysms involving segmental and interlobar branches of renal artery (arrows) (b) aortogram showing involvement of superior mesenteric and lumbar vasculature (arrows) follow - up computed tomography angiogram with no beading of renal vasculature (arrows) spontaneous perinephric hemorrhage (wunderlich syndrome) is a rare condition with a wide - ranging etiology. zhang. in their meta - analysis reported on 165 such cases. of these, 101 (62.2%) were secondary to the rupture of renal tumors, with angiomyolipoma being the most common cause. they reported five cases of bilateral spontaneous hemorrhage and all of these were secondary to pan. pan is a multi - system necrotizing vasculitis that involves small and medium sized vessels. the kidneys are affected in 80% cases with hypertension, proteinuria and ultimately renal functional deterioration being the most common manifestations. it is secondary to the rupture of arterial aneurysms that usually involve the renal artery, and its segmental and interlobar divisions. nephrectomy is associated with a high mortality rate (50%) in the acute setting. angiography with selective embolization allows preservation of renal parenchyma and is now the treatment of choice in cases of active bleeding. a reduction or resolution in aneurysms has been noted following immunosuppressive therapy and is probably due to the decline in inflammation of the vessel wall. per - rectal identified gastrointestinal manifestations, and the need for a surgical consult as an independent predictor of mortality in pan. | we report the case of a young man who presented with spontaneous left perinephric hematoma and per - rectal bleeding. evaluation revealed renal and superior mesenteric arterial aneurysms secondary to polyarteritis nodosa (pan). computed tomography and angiographic findings are presented. the aetiology of spontaneous perinephric hemorrhage along with relevant features of pan are discussed. |
gardner described a syndrome consisting of hereditary intestinal polyposis with osteomas and multiple cutaneous and subcutaneous lesions in 1953.1 this syndrome has since been modified by the addition of other features such as osteomas, supernumerary teeth, dental abnormalities, fibrous dysplasia of the skull, fibromas, desmoid tumours, epidermoid cysts and a number of malignant tumors.24 the most important feature of the gardner s syndrome is the association of multiple colonic polyps (familial adenomatous polyposis coli - fap) with sebaceous cysts and jaw osteomas. the significance of this dominantly inherited condition to the dentist is that the colonic polyps usually undergo malignant change by the fourth decade and the extra - intestinal lesions may be apparent before those in the bowel.5 although these are often subclinical oral manifestations could be diagnostical. as such, early detection of multiple jaw osteomas and/or multiple sebaceous cysts (particularly on the scalp) may lead to appropriate further investigation and treatment which might be life saving. as the syndrome is genetically inherited, diagnosis of this condition also has implications for other family members.5,6 skeletal abnormalities, the most common of which are osteomas, are an essential component of gardner syndrome. the benign tumours are characterized by slow, continuous growth,4 and occur most frequently in the mandible, the outer cortex of the skull and the paranasal sinuses. the angle of the mandible is a particularly diagnostic site.7 the osteomas may be either exostoses, often referred to as peripheral osteomas, or endostoses, which are detectable only radiographically. the radiographic appearance of either type is a localized radiopaque lesion with a sharp border. another type of lesion has been described, which appears as a large and diffuse radiopaque cotton wool - like area in either jaw, and is referred to as a widespread radiopaque lesion.8 dental abnormalities are present in around 30% of patients with gardner syndrome, and may include supernumerary teeth, compound odontomas, hypodontia, abnormal tooth morphology and impacted or unerupted teeth. the highest incidence of dental abnormalities is found in patients with multiple osteomas, but dental changes may be determined in the absence of skeletal lesions, and the dental anomalies are not secondary to bony changes.9 the principal cutaneous lesions in gardner syndrome are multiple epidermoid cysts, present in around 50%65% of patients. the cysts arise prior to puberty and occur primarily on the face, scalp and extremities.10 desmoid tumors may occur in the skin of the anterior abdominal wall or intra - abdominally. desmoid tumours are slow growing deep fibromatoses that are histologically benign and have no metastatic potential.11 other cutaneous lesions that have been described in gardner syndrome include fibroma, lipoma, leiomyoma, neurofibroma, basal cell carcinoma and pigmented skin lesions.12 only unique and specific findings are observed in dental and skeletal structures, which can easily be diagnosed by an orthodontist or a general dentist. therefore, the aim of this report is to present new cases of this syndrome, to evaluate it from an orthodontic perspective, and to bring this rare anomaly to the attention of the orthodontic community. a 21-year - old male patient, one of two siblings, presented to our department with dental deficiencies, chewing and aesthetic concerns and asymmetry that had newly emerged in his face. anamnesis taken from the patient established that his mother and sister had been diagnosed with gardner syndrome., we determined an angle class i molar relationship, and we observed that a large number of permanent tooth eruptions had not been completed in the anterior and posterior regions. no anomaly was observed in any intraoral soft tissue (figures 1 and 2). at radiological examination, congenital deficiency in the right and left upper central teeth, delayed eruption in the maxillary and mandibular canines and 1 and 2 premolars and supernumerary teeth were observed. there was an increase in density in the structure of the bony trabecular and smooth - nerve radiological formations in the right condyle region and right and left lower jaw angulus region (figures 3 and 4). the 24-year - old female patient of the two siblings presented to our department with a desire for a more regular structure. the patient stated at anamnesis that she had undergone more than 15 general surgical operations. congenital deficiency of the permanent canine tooth in the left lower jaw, and delayed eruption in the 1 canine and 2 premolars in the upper jaw and in the 1 and 2 premolars in the lower jaw were observed. microdontia was observed in the left upper 2 molar, and a buried and irregular root morphology in the 3 molar in the left lower jaw (figures 5 and 6). variations in the bone trabecular structure and regular radiopaque lesions in the condylar region were observed. following medical consultations, both sibling patients commenced treatment with the scheduling of orthodontic, surgical and prosthetic therapy (figures 7 and 8). a 21-year - old male patient, one of two siblings, presented to our department with dental deficiencies, chewing and aesthetic concerns and asymmetry that had newly emerged in his face. anamnesis taken from the patient established that his mother and sister had been diagnosed with gardner syndrome., we determined an angle class i molar relationship, and we observed that a large number of permanent tooth eruptions had not been completed in the anterior and posterior regions. no anomaly was observed in any intraoral soft tissue (figures 1 and 2). at radiological examination, congenital deficiency in the right and left upper central teeth, delayed eruption in the maxillary and mandibular canines and 1 and 2 premolars and supernumerary teeth were observed. there was an increase in density in the structure of the bony trabecular and smooth - nerve radiological formations in the right condyle region and right and left lower jaw angulus region (figures 3 and 4). the 24-year - old female patient of the two siblings presented to our department with a desire for a more regular structure. the patient stated at anamnesis that she had undergone more than 15 general surgical operations. congenital deficiency of the permanent canine tooth in the left lower jaw, and delayed eruption in the 1 canine and 2 premolars in the upper jaw and in the 1 and 2 premolars in the lower jaw were observed. microdontia was observed in the left upper 2 molar, and a buried and irregular root morphology in the 3 molar in the left lower jaw (figures 5 and 6). variations in the bone trabecular structure and regular radiopaque lesions in the condylar region were observed. following medical consultations, both sibling patients commenced treatment with the scheduling of orthodontic, surgical and prosthetic therapy (figures 7 and 8). gardner syndrome, which has an autosomal dominant character and emerges in relation to the x gene, has an incidence ranging between 1 in 4,000 and 1 in 12,000, depending on region.13 it is caused by a dominantly inherited mutation in the adenomatous polyposis coli gene localized on chromosome 5.14 several of these manifestations occur in the oral and maxillofacial region and may be determined during routine dental examination. while a solitary osteoma of the jaw is a common incidental finding in dental panoramic radiography, if more than three such lesions are found this is highly suggestive of gardner syndrome.14 similarly, dental abnormalities such as supernumerary, absent or unerupted teeth and odontomas are often determined in routine radiography.14 in addition to clinical palpation, dental panoramic radiography is very a effective means of detecting the multiple osteomas of the jaws that are a characteristic of gardner syndrome.15 the general dental practitioner may be the first health care professional to suspect such a diagnosis. osteomas and odontomas generally emerge in the paranasal sinuses and mandible, particularly in the angulus and corpus regions.1618 pain is rarely observed at these patients and it is asymptomatic. osteomas and odontomas are generally observed in the post - pubertal period.17 lesions cause facial asymmetry as a result of expansion. they manifest themselves as well defined radio - opacities as a result of routine radiological investigations while inside the medullary bone before cortical expansion. radiologically, periosteal and endosteal osteomas reveal themselves as well defined nervous sclerotic radiopaque lesions.1920 after diagnosing these osteomas and adontomas, they must be resected under general anesthesia, because of the unreachable regions like paranasal sinuses, condylar and angular region. also, recurrence of osteomas and odontomas after inadequate surgery could be seen and to eliminate possible occurrence, several surgeries could be performed. orthodontic treatment is not a valuable option for these patients because osteomas and the increased density of the bone would inhibit tooth movement. the density of the bone is so dense to erupt impacted tooth so surgical extraction would be the most suitable alternative. after extraction of all impacted tooth conventional partial or total prosthetic rehabilitation must be performed. histopathological evaluation of resected tissues following surgical intervention, followed by other dental procedures are recommended. although characteristic findings are observed in dental and skeletal structures, which can easily be diagnosed, it is often overlooked by many medical and dental professionals. | gardner syndrome is a rare, autosomal dominant syndrome. it will follow a positive course with diagnosis and treatment by medical and dental specialists. orthodontists or general dental physicians can easily diagnose the syndrome through radiological images taken in addition to dental and skeletal findings. the aim of this study was therefore to report two cases of this syndrome and to evaluate it from an orthodontic perspective in order to attract the attention of orthodontists to this rare anomaly. |
hsv infection is a well - known, chronic persistent viral infection of varying recurrence rate. it has been reported that hsv can be the cause of esophagitis, as seen in immunodeficient patients under therapeutic immunosuppression [2, 3 ]. although the risk of a hsv infection appears to be correlated to a degree of depression of the cellular immune system, hsv infection is a rare condition after organ transplantation and consecutive immunosuppression therapy. hsv manifestations after transplantation have been described ; however, usually a time delay between organ transplantation and hsv infection corresponding with the time necessary for the achievement of full therapeutic immunosuppression is seen. the herpes virus group consists of the herpes zoster virus and the herpes simplex virus [1, 4 ], the former occurring much more often as a painful post - transplant infection [5, 6, 7 ]. infections or recurrences of hsv after transplantation are much more uncommon and comprise case reports describing esophagitis and nephritis [8, 9 ]. hsv manifestations as esophagitis are extremely rare ; they have been seen in singular cases after kidney [8, 9, 10 ], liver, heart and bone marrow transplant. it was itoh. who investigated the relationship between histopathological features and hsv associated esophagitis after transplantation. reporting on 1,307 autopsies covering a 10-year period, they detected a prevalence of 1.4% (14 out of 1,307). a hsv related ulcer of the gastroesophageal junction after transplantation has not been reported so far. we describe the very rare case of a seronegative herpes simplex induced ulcer occurring in the early postoperative phase after liver transplantation. a 64-year - old man with a cryptogenic child pugh c liver cirrhosis suffered from hepatic encephalopathy, massive ascites, splenomegaly and consecutive thrombocytopenia and anemia. on postoperative day 1 diffuse bleeding mandated relaparotomy, further complicated by systemic coagulopathy and transfusion requirements of 44 units of rpc, 118 units of ffp and 12 units of thrombocytes. a consecutive abdominal compartment syndrome and a hepatorenal syndrome necessitated haemodialysis for 5 days, during which programmed relaparotomies and abdominal washouts were performed. at day 10, the patient reported dysphagia for liquids and solids without pain on swallowing, nausea and vomiting. on esophagogastroduodenoscopy a huge ulcer situated at the gastroesophageal junction was discovered as well as moderate gastritis with normal duodenum mucosa (fig. the histopathological examination of biopsies taken from the border and center of the ulcer showed epithelial lesions rich in fibroblasts and capillaries which were highly suspicious of viral infection. the picture was enlarged by megacaryocytes with large lobulated nuclei showing milk glass foggy karyoplasm. on immunohistochemical analysis a distinct positive reaction for ntb - hsv antibodies was seen (fig. histopathological and immunohistochemical examinations showed a squamous cell epithelium with focal exasperated hsv loci without any sign of neoplasia. immediate systemic antiviral therapy was started with acyclovir (15 mg / kg / day) plus high - dose ppi (esomeprazole) (50 mg twice a day) led to a complete remission of all clinical gastrointestinal symptoms within 48 h. the following course was uneventful ; repeated endoscopy seven days later revealed a complete remission of the previous ulcer of the gastroesophageal junction. the patient was discharged in good health to the outpatient department with a good hepatorenal function. a 64-year - old man with a cryptogenic child pugh c liver cirrhosis suffered from hepatic encephalopathy, massive ascites, splenomegaly and consecutive thrombocytopenia and anemia. on postoperative day 1 diffuse bleeding mandated relaparotomy, further complicated by systemic coagulopathy and transfusion requirements of 44 units of rpc, 118 units of ffp and 12 units of thrombocytes. a consecutive abdominal compartment syndrome and a hepatorenal syndrome necessitated haemodialysis for 5 days, during which programmed relaparotomies and abdominal washouts were performed. at day 10, the patient reported dysphagia for liquids and solids without pain on swallowing, nausea and vomiting. on esophagogastroduodenoscopy a huge ulcer situated at the gastroesophageal junction was discovered as well as moderate gastritis with normal duodenum mucosa (fig. the histopathological examination of biopsies taken from the border and center of the ulcer showed epithelial lesions rich in fibroblasts and capillaries which were highly suspicious of viral infection. the picture was enlarged by megacaryocytes with large lobulated nuclei showing milk glass foggy karyoplasm. on immunohistochemical analysis a distinct positive reaction for ntb - hsv antibodies was seen (fig. histopathological and immunohistochemical examinations showed a squamous cell epithelium with focal exasperated hsv loci without any sign of neoplasia. immediate systemic antiviral therapy was started with acyclovir (15 mg / kg / day) plus high - dose ppi (esomeprazole) (50 mg twice a day) led to a complete remission of all clinical gastrointestinal symptoms within 48 h. the following course was uneventful ; repeated endoscopy seven days later revealed a complete remission of the previous ulcer of the gastroesophageal junction. the patient was discharged in good health to the outpatient department with a good hepatorenal function. hsv infection is a common and life - long infection ; it may recur at any time as a reaction to different stimuli. the possible association between hsv-1 infection and duodenal ulcer in immunocompromised patients has been described before. up to now, esophageal or esophagogastric ulcers following therapeutic immunosuppression have not yet been described. this is more than surprising, taking into account reports which describe hsv esophagitis after kidney transplantation, allogeneic liver transplantation, heart transplantation and bone marrow transplantation. report hsv hepatitis 4 years after transplantation, it could be speculated that ulceration would occur during the same period mentioned. nevertheless, we report the case of a hsv ulcer of the gastroesophageal junction 17 days after allogeneic liver transplantation, which was diagnosed by endoscopy, histopathology and immunohistochemistry. it is known that hsv infections can occur in immunocompromised patients and lead to concomitant seropositivity. while in these patients preventive acyclovir medication may be applied, our patient had not been diagnosed with hsv infection before and was hsv - pcr negative. antiviral medication was started in our patient from the date of confirmation of the hsv infection on. in general it has been known that patients with combined hepatorenal dysfunctions have an increased risk for reactivation of hsv. furthermore, cd4+/cd8 + depleted patients with liver cirrhosis have an increased risk for hsv recurrence [5, 6, 7 ]. prophylactic antiviral medication can be chosen at least in patients at risk for cmv infection. late infectious sequelae may thus be avoided, while costs and drug side effects may simultaneously increase. in our patient we report the early postoperative reactivation of hsv, leading to ulcer in an uncommon place. this might be due to a combination of hepatorhinorrhagia and massive transfusion which may have led to profound immunosuppression in our patient, although therapeutic immunosuppression was shown to be within therapeutic range. the massive bleeding may have led to the depletion of cd4+/cd8 + cells in our patient, which further added to the immunocompromised state. it can not be excluded that intraoperative hypotension and systemic catecholamine application added to a mucosal hypoperfusion state with impaired microcirculation, thus increasing the vulnerability of the gastroesophageal junction. this may have led to a locally reduced immune surveillance in the gastrointestinal tract, which is regularly exposed to local microtraumata and infectious agents. we could not identify any causative factor leading to the lesion in the esophagus nor elsewhere in the gastrointestinal tract. it is not known whether h2 blocking agents improve the healing in uncomplicated hsv ulcers. we feel that especially patients on steroids need mucous protection, thus the drug doses of ppi were doubled with diagnosis of hsv ulcer. nevertheless, despite massive transfusion, immunocompromised situation and programmed relaparotomies, the patient recovered without sequelae, even in terms of immunocompetence. the single ulcer found at the gastroesophageal junction was the only expression of hsv reactivation. it was macroscopically impossible to deduce the hsv infection from the ulcer visualized on endoscopy. astonishingly polymerase chain reaction revealed a negative serum anti - hsv titre pre- and postoperatively. this case report demonstrates that even in the early postoperative phase after transplantation, hsv ulcer of the gastroesophageal junction can occur. herpes ulcer, although very uncommon, must be added to the differential diagnosis in early postoperative ulcers of the gastroesophageal junction in immunocompromised patients. fast diagnosis and targeted therapy may lead to a full and unproblematic recovery, as seen in this patient. as it may be difficult to confirm a hsv lesion by serum sample analysis alone all authors certify that they have no commercial association that might pose a conflict of interest in connection with the submitted article, and disclose any financial and personal relationship with other people and organisations that could influence their work. | herpes simplex infection is characterized by acute or subacute infection, often followed by a chronic carrier state. consecutive recurrences may flare up if immunocompromise occurs. herpes simplex associated esophagitis or duodenal ulcer have been reported in immunocompromised patients due to neoplasm, hiv / aids or therapeutically induced immune deficiency. here we report the case of an hsv - dna seronegative patient who developed grade iii dysphagia 13 days after allogeneic liver transplantation. endoscopy revealed an esophageal - gastric ulcer, and biopsy histopathology showed a distinct fibroplastic and capillary ulcer pattern highly suspicious for viral infection. immunohistochemistry staining revealed a distinct nuclear positive anti - hsv reaction. antiviral therapy with acyclovir and high - dose ppi led to a complete revision of clinical symptoms within 48 h. repeat control endoscopy after 7 days showed complete healing of the former ulcer site at the gastroesophageal junction. although the incidence of post - transplantation herpes simplex induced gastroesophageal disease is low, the viral hsv ulcer may be included into a differential diagnosis if dysphagia occurs after transplantation even if hsv - dna pcr is negative. |
patients with elevated levels of antiphospholipid antibodies (apl) often experience pregnancy complications comprising recurrent spontaneous abortions, intrauterine growth retardation, and preeclampsia, suggesting that these antibodies may influence embryonic implantation and induce thrombosis of the uteroplacental vasculature. the international classification criteria for antiphospholipid syndrome (aps) connect the occurrence of obstetric complications and/or thrombosis together with persistence of apl in aps. laboratory criteria for aps include lupus anticoagulants (la), anticardiolipin antibodies (acl), and antibodies against 2-glycoprotein i (anti-2gpi). apl are believed to be associated with aps ; however the lack of evidence confirming their diagnostic applicability so far prevents their inclusion into classification criteria. in recent years, many studies demonstrated the association of antiprothrombin antibodies with the pathogenesis of aps [24 ] and some of them proposed their beneficial role for aps diagnosis [57 ]. these antibodies can be detected by an elisa targeting prothrombin alone (apt - a) or targeting phosphatidylserine / prothrombin complex (aps / pt) ; however the latter are more frequently found in patients with aps [4, 9, 10 ]. our group reported on an in - house aps / pt elisa as the optimal method for the determination of clinically relevant antiprothrombin antibodies exhibiting the highest proportion of la in our population of patients. clinical relevance of antiprothrombin antibodies was mainly described for patients with aps and thrombosis but very few studies reported their association with adverse pregnancy outcomes. a comprehensive review of antiprothrombin antibodies and pregnancy / obstetric / miscarriages / fetal loss revealed 12 studies, comprising 1031 patients and 988 controls (table 1). half of these studies failed to find any significant association between antiprothrombin antibodies and pregnancy morbidities [1216 ]. on the contrary, akimoto. presented strong and specific association between various types of antiprothrombin antibodies with severe preeclampsia and spontaneous abortion. only the study from bertolaccini. differentiated among different obstetric complications and showed a significant association of both aps / pt and apt - a with unexplained death of a morphologically normal fetus beyond 10th week of gestation. the clinical significance of antiprothrombin antibodies in patients with adverse pregnancy outcome was later confirmed also by marozio., who investigated apt - a, and vlagea. who investigated aps / pt. furthermore, our group has recently reported that aps / pt is the strongest independent risk factor for obstetric complications compared to la, acl, and anti-2gpi. however, no reports to date were found describing association of antiprothrombin antibodies with unexplained consecutive miscarriages in the first trimester of pregnancy. therefore, the present study aims to investigate the association of aps / pt with a history of specific idiopathic pregnancy complications in a larger group of patients and to determine whether the presence of aps / pt is associated with an increased risk of obstetric manifestations relevant for aps. this study included 402 sera samples which were prospectively collected from 211 consecutive female patients (median age 33 years, iqr : 7 years) referred between 2005 and 2013 to our clinic due to possible obstetric aps (table 2). among them 169 had obstetric manifestations included in the aps classification criteria. specifically, 64 patients had three or more unexplained consecutive miscarriages before 10th week of gestation (wg), 72 patients experienced unexplained death of a morphologically normal fetus past 10th wg, and 33 patients gave premature birth to a morphologically normal neonate before 34th wg due to eclampsia, preeclamsia, or placental insufficiency. among 33 preterm deliveries, 10 cases experienced fetal death as a result of either placenta abruptions or growth retardations with any morphological abnormalities being excluded. there were 16 cases with induced deliveries because of preeclampsia or eclampsia and 7 spontaneous preterm deliveries. the remaining 42 patients experienced less than three miscarriages before 10th wg and did not meet the aps classification criteria. the majority of patients had received the results of genetic analysis at the time of their visit to our clinic and the patients with confirmed abnormalities were excluded from the study. as a control group we included 87 healthy female blood donors (median age 42 years, iqr : 18 years) without a history of underlying autoimmune disease, bleeding disorders, thrombosis, and/or pregnancy morbidity. all patients had their sera collected during their clinical examination in the department of rheumatology (university medical centre, ljubljana). participants signed an informed consent and the study was approved by the national medical ethics committee, ljubljana, slovenia. plasma samples were analyzed using coagulation analyzer bcs siemens according to the guidelines valid at the time the study started. simplified dilute russell 's viper venom test (drvvt) was performed using la 1 screening reagent and la 2 confirmatory reagent (siemens) following manufacturer 's instructions. a drvvt ratio (la1 screen / la2 confirmation) above 1.2 activity of la was quantified as follows : low positive (la1/la2 = 1.21.5), medium (la1/la2 = 1.52.0), and high positive (la1/la2 > 2.0). this was performed following previously described protocol and validated method. specifically, the assays average inter- and intra - assay coefficients of variations were < 3.3% and < 8.2%, respectively. the diagnostically relevant cut - off of aps / pt was set on the 99th percentile of 222 blood donors. briefly, phosphatidylserine was coated on polystyrene microtitre plates (medium binding, costar, cambridge, ma, usa) and incubated overnight at 4c. after blocking with tris - buffered saline (tbs) containing 1% bovine serum albumin (bsa) and 5 mm cacl2 (1% bsa - tbs - ca) plates were washed in tbs containing 0.05% tween-20. human prothrombin (10 mg / l) (enzyme research laboratories, uk) and patients ' sera diluted 1 : 100 in 1% bsa - tbs - ca were applied to wells immediately one after the other and incubated for 1 hour at room temperature (rt). afterwards, plates were washed and incubated with alkaline phosphatase - conjugated goat anti - human igg or igm (acsc, westbury, usa) for 30 minutes at rt. after the last wash para - nitrophenylphosphate (sigma chemical company, usa) in diethanolamine buffer (ph 9.8) was applied as substrate and od405 was kinetically measured by microtitre plate reader (tecan, grdig, austria). these were determined in sera by an in - house solid phase acl elisa. briefly, polystyrene microtitre plates (medium binding, costar, cambridge, ma, usa) were coated with cardiolipin (sigma, st. louis, usa) and blocked with 10% fetal bovine serum (fbs) (sigma, st. louis, usa) in phosphate - buffered saline (pbs). after washing with pbs, diluted samples in 10% fbs - pbs were applied and incubated for 2.5 hours at rt. briefly, high binding polystyrene microtitre plates coated with 50 ul / well of 2gpi (10 the plates were then washed with pbs containing 0.05% tween-20 (pbs - tween) and incubated with samples diluted in pbs - tween for 30 minutes at rt. the receiver operating characteristic (roc) analysis and the area under the curve (auc) were used to assess the diagnostic performance of the measured marker(s). the results of multivariate logistic models were approximated by odds ratio with its 95% confidence interval (or [95% ]). every patient positive for any of the tested apl was tested again at least 12 weeks after their first visit and only permanently elevated levels of apl were considered as a positive result. overall, 169 patients experienced pregnancy morbidity defined by aps criteria and 41 (24%) of them showed permanent positivity for at least one of the measured apl. the highest prevalence was found for acl and aps / pt (13%) while the prevalence for la and anti-2gpi was lower (7%) (table 3). eleven patients (6.5%) were aps / pt positive while being negative for all other tested apl. six of them had recurrent abortions before 10th wg, two experienced an unexplained death of a morphologically normal fetus past 10th wg, one delivered prematurely, and two experienced both recurrent abortions and premature birth. considering sydney revised laboratory criteria of aps, 17.8% (30/169) of patients were positive for la or acl and/or anti-2gpi. among them, 22 were treated with low - molecular - weight heparin (lmwh) and low dose aspirin (lda) which resulted in a successful pregnancy. six women had no subsequent pregnancies ; three of them experienced successful pregnancy prior to aps pregnancy complications. when adjoined, the aps / pt results revealed an additional 6.5% (11/169) of patients with adverse pregnancy outcome that was positive for apl. the frequency of apl among 42 patients who experienced less than three miscarriages before 10th wg (and did not meet aps classification criteria) was very low and did not show differences from healthy women. statistical analyses could not find any association of higher levels of apl being more strongly associated to adverse pregnancy outcome. when analyzing each of the three categories of pregnancy morbidity included in the aps classification criteria only aps / pt antibodies were statistically significantly associated with either of three types of adverse pregnancy outcome (p < 0.03, age adjusted) (table 4). in fact, these are the only apl with the significantly higher frequency in patients experiencing recurrent abortion before 10th wg compared to healthy women. on the contrary acl and la were associated with obstetric complications appearing late in pregnancy ; however they did not show any association with early pregnancy morbidity. age - adjusted analyses were performed in order to estimate the relative risk of positive outcome in different apl tests (la, acl, anti-2gpi, and aps / pt) to obstetric complications characteristic for aps presented as or with 95% confidence interval. as shown in table 5, only acl and aps / pt antibodies presented an elevated risk for obstetric complications (or 7.4 [95% ci 1.634.5 ] and or 7.4 [95% ci 1.535.2 ], resp.). in our group of 169 patients, 12 (6%) had a history of thrombosis and the prevalence of all tested apl was higher among them as compared to healthy controls (p < 0.01). excluding these 12 patients from logistic regression analyses showed that frequencies of acl and aps / pt antibodies were still significantly higher as compared to healthy controls (p = 0.04 and p = 0.015, resp.). while several studies evaluated apl positivity in aps patients with a history of thrombosis only a few studies established an association of different apl with individual obstetric abnormalities distinctive for aps. the question arises whether the same profile of apl occurs in aps patients with a history of thrombosis compared to obstetric aps. there is general consensus to screen for la, acl, and anti-2gpi, but the role of other autoantibodies remains controversial. therefore, the necessity to perform more cohort studies in order to determine the incidence of noncriteria apl in pregnancy loss was suggested. since then, our group focused on evaluating the prevalence of aps / pt antibodies among female patients experiencing different obstetric complications during their pregnancies. we found an overall prevalence of aps / pt of 13.0%, acl of 12.4%, la, and anti-2gpi less than 8.0% in our group of patients with obstetric complications characteristic for aps. both aps / pt and acl were significantly more prevalent in our cohort of patients compared to healthy blood donors. however, acl correlated only with late pregnancy morbidity and prematurity while aps / pt were the only antibodies associated with early recurrent pregnancy loss, as well as with late pregnancy morbidity and prematurity. our findings are in line with clark. who suggested that acl - associated early recurrent pregnancy loss be withdrawn from the classification criteria due to inconsistent prevalence of acl in this population and an increasing body of evidence points to the fact that this clinical manifestation of aps is distinct from late loss or early delivery with placental infarction. however, according to our results, determining aps / pt in association with early recurrent pregnancy loss may be beneficial. we found 7% (11/169) of patients to be aps / pt positive and negative for all other tested apl and 63% (7/11) of them experienced early recurrent pregnancy loss. only one published study also confirmed association of antiprothrombin antibodies to early pregnancy loss ; however it differed from the current study in that they measured apt - a and included patients whose pregnancies ended spontaneously within 20th wg. considering the sydney revised laboratory criteria of aps, only 17.8% (30/169) of patients in our study were positive for la or acl and/or anti-2gpi, but when aps / pt was evaluated as an additional parameter, 24.8% (41/169) of patients were apl positive. we have also determined the frequency of apl among 42 patients who experienced less than 3 miscarriages before 10th wg and did not meet aps classification criteria. in line with our expectations the prevalence of all apl in this group was very low (< 7%) and was not different from frequencies found in healthy women. more than half of the articles were published before 2006, when new revised classification criteria were accepted. five studies tested only apt - a antibodies, which are (according to newer data) less significant for aps [3, 12, 14, 17, 21 ]. among five larger studies, recruiting more than 100 patients, three showed significant association of aps / pt or apt - a with obstetric complications [3, 18, 21 ] ; one did not find any significant association ; however they only measured apt - a antibodies, and one was performed before 2006 and recruited patients with more than two recurrent miscarriages, instead of three. conflicting data in the literature and the lack of studies investigating the role of antiprothrombin antibodies in obstetric aps led us to study the occurrence of these antibodies in different early and late adverse pregnancy outcomes. who reviewed 120 studies investigating la, acl, and anti-2gpi and provided an overall apl frequency estimated as 6% for pregnancy morbidity. found the mean titer of antiprothrombin-1 antibodies in patients with spontaneous abortions to be greater than in normal pregnant women. however, subsequent studies failed to show any association of antiprothrombin antibodies (apt or aps / pt) with early recurrent pregnancy loss [1416 ].. found correlation between aps / pt and fetal death beyond 10th wg but not to early pregnancy loss or to prematurity. marozio. reported a positive correlation between apt - a and adverse late pregnancy outcome. two recent studies [19, 20 ] found correlation between aps / pt and obstetric abnormalities ; however neither specified the types of pregnancy complications. our study did not confirm the association of either anti-2gpi or la with any of the adverse pregnancy outcomes. this is in line with conclusions of the systematic review, implying that there is currently insufficient data to establish any significant link between anti-2gpi and pregnancy morbidity. also, in the study by clark., which included 2257 women attending a high - risk pregnancy clinic, less than 1% of patients with early recurrent miscarriage tested positive for la, while on the other hand patients positive for la had a significantly more frequent history of thrombosis. possibly, la and anti-2gpi are far more associated with thrombotic aps than obstetric aps, while acl and aps / pt appear to be associated with both types of aps. the diagnostic accuracy of individual apl for pregnancy losses defined by aps classification criteria, determined by auc, was low, ranging from 0.499 for anti-2gpi to 0.549 for acl or aps / pt (table 5). in our previous study, auc for different apl and aps (either thrombotic or obstetric) varied from 0.88 for igg acl to 0.55 for igm anti-2gpi, while otomo. certain patients with clinical symptoms significant for aps, fulfilling clinical criteria, are negative for all tested apl and within this group aps / pt despite lower auc could improve the diagnoses of aps increasing sensitivity of the total apl. so far, the mechanism by which antiprothrombin antibodies might be involved in morbidity during pregnancy has not been clarified. it has been suggested that they may lead to pregnancy loss by the promotion of microvascular placental thrombosis, which was supported by histological findings. placental trophoblast is the main organ in which phosphatidylserine is highly exposed on the outer leaflet of the membrane. during embryonic and placental differentiation a disruption of the lipid asymmetry occurs, leading to exposure of phosphatidylserine on the outer surface. antiprothrombin antibodies might crosslink prothrombin on the cell surface where they could complicate pregnancy by complement activation or by interfering with signaling which seems to be an essential factor for disease manifestation from the results of the in vivo experiments. an increased number of apoptotic events of giant cells in the phosphatidylserine - exposed ectoplacenta were observed, which may lead to insufficient development of the placenta resulting in embryo small for date or fetal loss. on the other hand, it has been observed that, in mice, prothrombin plays an important role in the development of the embryo and that prothrombin deficiency results in embryonic and neonatal lethality. there is no doubt that clarification of the pathways in which antiprothrombin antibodies are involved in the pathogenesis of aps needs to be further investigated, but nevertheless it has been shown that patients treated for aps have good pregnancy outcomes. a review by marchetti. concluded that screening for high - risk aps patients is necessary to improve their pregnancy outcome, and we showed that apl profile screening including aps / pt, in addition to la, acl, and anti-2gpi, could enable better evaluation of high - risk aps patients and possibly predict further pregnancy losses. similarly, ulcova - gallova. suggested that determination of apl only against cardiolipin in patients with reproductive failure is not sufficient for obstetric - gynecology diagnosis ; therefore the investigation of aps / pt in this group of patients could be warranted. aps / pt are associated with adverse pregnancy outcome irrespective of other antiphospholipid antibodies. therefore, aps / pt measurement might improve the evaluation of patients with early recurrent pregnancy loss, undiscovered by other apl tests. further studies including a larger number of patients with pregnancy complications and/or reproductive failure and apparently healthy donors are needed to determine the independent effects of various antiphospholipid antibodies, as well as aps / pt, and confirm their potential use in clinical practice. | objective. to determine the prevalence and clinical association of anti - phosphatidylserine / prothrombin antibodies (aps / pt) in patients with a history of pregnancy complications relevant to antiphospholipid syndrome (aps). materials and methods. two hundred and eleven patients with a history of (a) three or more consecutive miscarriages before 10th week of gestation (wg) (n = 64), (b) death of a morphologically normal fetus beyond 10th wg (n = 72), (c) premature birth of a morphologically normal neonate before 34th wg due to eclampsia, preeclamsia and placental insufficiency (n = 33), and (d) less than three unexplained consecutive miscarriages before 10th wg (n = 42). subjects sera were analyzed for lupus anticoagulant (la), anti - cardiolipin (acl), anti-2-glycoprotein i (anti-2gpi), and aps / pt antibodies. results. 41/169 (24.3%) of patients were positive for at least one measured apl. the highest prevalence was found for aps / pt and acl (13.0% and 12.4%, resp.) followed by la (7.7%) and anti-2gpi (7.1%). 11/169 with aps - related obstetric manifestations had only aps / pt. 17.8% of patients were positive for la or acl and/or anti-2gpi ; however when adding the aps / pt results, an additional 7% of patients could be evaluated for aps. conclusion. aps / pt are associated with recurrent early or late abortions and with premature delivery irrespective of other apl. |
most primary head and neck cancers are mucosal lesions, and their mucosal extent can be far better evaluated by the clinician than with ct or mri. indeed, imaging plays little role in the initial detection and characterisation of head and neck malignancies. however, these tumours do have the tendency to spread submucosally, and this extension into the deeply lying tissue planes is sometimes impossible to detect by clinical examination. metastatic adenopathies can be identified, sometimes still in a subclinical stage or at places not accessible by clinical examination, such as in the retropharyngeal or paratracheal lymph nodes. all these findings can profoundly influence the staging and management of the patient with head and neck cancer. finally, imaging may be used to monitor tumour response and to try to detect recurrent or persistent disease before it becomes clinically evident, possibly with a better chance for successful salvage. clinically, these lesions may remain asymptomatic for a long period ; at presentation, the disease is often advanced. the characteristic symptoms are sore throat, referred otalgia and dysphagia, but frequently a neck lump (due to metastatic neck adenopathies) is the presenting symptom. the t - staging is determined by tumour size, tumour extent and the presence of hemilaryngeal fixation. early piriform sinus tumours may be very subtle ; images obtained during a modified valsalva manoeuvre (while letting the patient blow against closed lips) may be helpful. larger cancers appear as soft - tissue masses, often involving the anterior, lateral and posterior walls of the piriform sinus. soft - tissue thickening or obliteration of the deep fat planes behind the level of the true vocal cord signifies involvement of the piriform sinus apex. inferior extension into the postcricoid area may occur submucosally and, therefore, is endoscopically undetectable. lateral extension may result in extrapharyngeal spread into the neck ; the large neck vessels are then at risk of becoming involved by the primary tumour. cancer of the posterior hypopharyngeal wall commonly appears as a flat but often widespread mass lesion, which may extend into the lower oropharynx. cancer originating in the postcricoid area is rare. besides superior spread within the hypopharynx and extrapharyngeal spread, also involvement of the cervical oesophagus may be seen. these cancers may invade the prevertebral muscles ; ct and mri have a high true - negative but also high false - positive rate in diagnosing such posterior tumour spread. at least 60% of patients with hypopharyngeal cancer present with clinically positive nodal metastases. in a small minority of patients, the primary cancer may at that stage be clinically occult, and may be detected by imaging. at least 75% will have neck adenopathies at some time during the course of disease. apart from clinical examination, minimal screening for distant metastasis at first presentation should include chest x - ray. ct of the chest is the next step when a suspect abnormality is seen on the plain film. chest ct seems justified in advanced stages of the primary tumour and/or bulky neck disease. in borderline - resectable disease, fdg - pet scan may be considered to exclude occult distant disease. postcricoid cancer is treated by total laryngopharyngectomy and reconstruction, usually with a pectoralis major myocutaneous flap. if the tumour extends to the oesophagus, an oesophagectomy is also required. in cancer confined to the piriform sinus or with minimal extension beyond it, if the apex is involved, the risk of laryngeal invasion is high and a total laryngopharyngectomy has to be performed. low - volume hypopharyngeal cancer can be effectively treated by radiation therapy. as in laryngeal cancer, ct (or mri) is helpful in assigning patients to a favourable group for radiation treatment, by providing an estimate of tumour volume. it appears that patients with bulky disease at the piriform apex on imaging have a less favourable local outcome after radiotherapy. cancer of the cervical portion of the oesophagus is relatively rare, comprising 35% of all oesophageal cancer. as the lumen of the cervical oesophagus is smaller, these symptoms usually occur earlier than in hypopharyngeal cancer. oesophagography is used to further define the position and extension of the cancer and degree of obstruction. ct / mri are useful to further define the intra- and extraluminal extent of the lesion. the primary drainage nodes of the cervical oesophagus are the paratracheal nodes. as the general lymphatic flow in the upper oesophagus the incidence of nodal metastasis depends on the length of the primary lesion ; lesions more than 5 cm long show adenopathies in 90% of cases. distant metastasis is frequently present at presentation, most commonly to the lungs / mediastinum (in about 30% of patients) and liver (about 15%). the high incidence of nodal and distant metastases in patients with cervical oesophageal cancer warrants an extensive pre - operative imaging work - up, including fdg - pet if available. in more than 75% of cases, when technically feasible, the cancer is surgically treated (oesophagectomy), including pharyngolaryngectomy when no safe margin with the upper oesophageal sphincter can be obtained. response to chemoradiotherapy as assessed by serial fdg - pet is strongly correlated with pathological response and survival ; such a correlation was not found for ct and endoscopic ultrasound. overall, the 5-year survival of cervical oesophageal cancer is low (between 10 and 20%). hypopharyngeal and cervical oesophageal cancer are nearly always squamous cell carcinomas. at presentation, hypopharyngeal cancer commonly presents with neck nodal disease, and the primary tumour may be clinically occult. subclinical submucosal cancer spread is common in both locations, and may be detected by ct / mri. fdg - pet is a useful technique to stage cervical oesophageal cancer, and to assess response to chemoradiotherapy. hypopharyngeal and cervical oesophageal cancer are nearly always squamous cell carcinomas. at presentation, hypopharyngeal cancer commonly presents with neck nodal disease, and the primary tumour may be clinically occult. subclinical submucosal cancer spread is common in both locations, and may be detected by ct / mri. fdg - pet is a useful technique to stage cervical oesophageal cancer, and to assess response to chemoradiotherapy. | hypopharyngeal cancer, and particularly cervical oesophageal cancer, are infrequent tumours. imaging methods assist in pre - treatment planning by better defining the extension of the lesions, by detecting subclinical neck adenopathies, as well as distant metastasis. in selected cases, imaging is also useful for treatment response assessment and surveillance. |
ewing 's sarcoma is a relatively rare malignant bone neoplasm that usually occurs in children and young adults and involves the major long bones, pelvis, and ribs. however, primary pulmonary ewing 's sarcoma / primitive neuroectodermal tumor (es / pnet) is extremely rare. to the best of our knowledge, only eight cases of primary pulmonary es / pnet have been reported in the literature (1 - 4). a 67-yr - old man visited with a lung mass that had been detected incidentally on chest roentgenogram taken during the national insurance screening program. the chest pa and left lateral films revealed an approximately 4-cm sized well - defined mass at the left lower lobe (fig. computed tomography showed a mass with a smooth margin and the tumor had well enhanced linear opacity inside of the contrast enhancement. the mass was not connected to the pleurae, chest walls, or other adjacent organs (fig. the origin of the mass and metastasis was verified by examining the whole body bone scan, pet / ct scan with 2-[f ] fluoro-2-deoxy - d - glucose (fdg), and brain magnetic resonance imaging (mri). on bone scan, there were no active skeletal lesions. the fdg - pet scan revealed intense and homogenous hypermetabolic activity with a metabolic defect at the left lower lobe of the lung. except for the lung lesion, there was no abnormal hypermetabolic lesions or metabolic defects. therefore we confirmed the lung was the primary focus of the mass, and there were no distant metastases. a percutaneous needle biopsy was performed with 19 g thru cut needle under fluoroscopic guidance. hematoxylin and eosin (h - e) staining showed a solidly packed round cell pattern with a striking uniformity. the individual cells had a small round to ovoid nucleus with a distinctly unclear membrane, fine powdery chromatin, and one or two minute nucleoli. some of the cells had irregularly vacuolated cytoplasm secondary to glycogen deposition, which was positive for periodic acid schiff (pas) stain (fig. the other markers including cytokeratin (ck), small cell lung cancer (sclc), chromogranin, ck7, ck19, and thyroid transcription factor 1 (ttf-1) were all negative. vimentin, synaptophysin, and p63 stained focally, and more than 90% of the cells were positive for ki-67 labeling. all the pathological findings were compatible with a es / pnet of primary pulmonary origin. after pathological diagnosis, surgical resection of the left lower lobe of the lung was done. serial sections of the lung showed that the cut surface had a well demarcated round whitish soft mass, which had extensive tumoral necrosis. it was 5 cm apart from the nearest bronchial resection margin and 0.5 cm from the nearest visceral pleura (fig. 3). using the tissue obtained after surgical resection, fluorescence in situ hybridization (fish) was performed using the lsi ewing sarcoma breakpoint region 1 (ewsr1) 22q12 dual color break apart rearrangement probe and revealed ewsr1 22q12 rearrangement in 82% (164 out of 200 cells) (fig. ultimately, the diagnosis was established to be a 4-cm sized es / pnet arising primarily from the lung with no regional invasion to the bronchi, visceral, or parietal pleurae. in addition, there was no perihilar lymph node invasion (all 4 of 4) or distant metastasis. after surgery, the patient was administered with combination chemotherapy with vincristin, actinomycin, and cyclophosphamide. since the first description of es and extraskeletal ewing 's sarcoma by james ewing and tefft., these two conditions have been confused histologically with other small cell tumors, including pnet (5, 6), but recent immunoperoxidase and cytogenic studies indicated that pnet and es are the same entity showing varying degrees of neuroectodermal differentiation, and they were categorized into a group known as the ewing family of tumors (7). the es / pnet family is an uncommon malignant neoplasm, and shares common histological features of closely packed small primitive round cells. it most often arises in the soft tissues and bones but has rarely been reported in other sites, such as the ovary, testis, uterus, kidney, pancreas, palate, myocardium, and lung (1, 7 - 10). the morphological features of intrapulmonary tumors are similar to those of the es / pnet in a variety of other locations. in this case the patient was 67 yr old, which was an unusual age compared with previously reported es / pnet cases. most of them were from child to young adults except one case (4). the diagnosis of a tumor is made using several modalities such as light microscopy, immunohistochemistry, and cytogeneteics (1). immunohistochemical and histochemical staining positive for glycogen (pas, 80%), neuron - specific enolase (60%), s-100 protein (50%), and mic-2 marker (90%), as well as negative findings for leukocyte common antigen, epithelial membrane antigen, cytokeratin, desmin, vimentin, myoglobin, and glial fibrillary acidic protein are indicative of es / pnet (11, 12). among them, the p30/32 cell surface antigen (also known as the mic2 gene product), which can be detected by antibodies such as hba71 and o13, and the reciprocal translocation of the long arms of chromosomes 11 and 22 t (11;22)(q24;q12), which results in the formation of chimeric transcripts of ews / fli-1, are believed to be characteristic of this family of tumors (1). in this case the mic-2 immunoreactivity and rearrangement of ewsr1 were observed. because primary pulmonary es / pnet is very rare, we tested several markers for small cell carcinomas such as ck, sclc, chromogranin, ck7, ck19, and ttf-1, which were all negative. ultimately, fish revealed an ewsr1 22q12 rearrangement, which confirmed the diagnosis cytogenetically. the most common ct finding of es / pnet reported is a heterogeneously enhancing mass. occasionally, a central, non - enhancing, low - density area is seen within the mass (12). in our case, well - enhanced linear opacity was observed inside the mass. in the fdg - pet scan, the suv was 6.22, which is comparable with that in a previous study of ewing sarcoma (suv of 4.542.79). in the diagnosis of es / pnet, a fdg pet scan is not diagnostic, but the sensitivity and specificity of the examination is quite high, 96% and 78%, respectively (13). the treatment of es / pnet is aggressive with the most effective treatment being a surgical resection with combination chemotherapy and high - dose radiation therapy. when resectable, the surgical excision must be wide in accordance with classic oncological principles (14, 15). a lobectomy including the mass lesion was performed and combination chemotherapy was subsequently administered. in conclusion, we experienced a primary pulmonary es / pnet. although the primary pulmonary es / pnet is an extremely rare soft tissue sarcoma, it should be considered in the differential diagnosis of a primary pulmonary mass. | extraskeletal ewing 's sarcoma (ees) is a branch of neuroectodermal tumor (pnet), which is very rare soft tissue sarcoma. we report a case of ees / pnet arising is the lung of a 67-yr - old man. computed tomography, bone scintigraphy, and positron emission tomography confirmed the mass to have a primary pulmonary origin. the mass showed positive reactivity in the periodic acid schiff (pas) stain and mic-2 immunoreactivity in immunohistochemical stain. fluorescence in situ hybridization (fish) was performed, which revealed an ewsr1 (ewing sarcoma breakpoint region 1) 22q12 rearrangement. the diagnosis was confirmed both pathologically and genetically. the mass lesion was resected, and the patient is currently undergoing chemotherapy. |
vascular smooth muscle cells (vsmcs) are one of the major cellular components of blood vessel wall where they exist in a differentiated contractile phenotype to maintain vascular tone. vsmcs within adult blood vessels proliferate at an extremely low rate, display very low synthetic activity, and express a unique set of contractile proteins such as smooth muscle myosin heavy chain (smmhc), smooth muscle -actin (-sma), sm22, and calponin, etc.,. during embryonic development, vsmcs can be differentiated from various sources of progenitor cells. for example, vsmcs of large arteries near the heart originate from the neural crest cells of the ectoderm, whereas other vsmcs are believed to be derived from mesoderm - derived mesenchymal cells. among the mesoderm - derived vsmcs, coronary vsmcs are reported to come from the proepicardial organ ; vsmcs of the root of the pulmonary artery and the lung artery stem from the second heart field. a detailed description about smc diversity and origins can be found in an elegant review published a few years ago. unlike either skeletal or cardiac myocytes that are terminally differentiated, vsmcs preserve remarkable plasticity and may undergo reversible alterations in phenotype in response to changes in local environmental cues. when contractile vsmcs collected from human or animal artery are cultured in vitro, they immediately transform into proliferative or dedifferentiated vsmcs and begin to proliferate under various conditions. these transformed cells show the same characteristics as the proliferative vsmcs observed in vivo, including the inability to contract and secretion of extracellular matrix (ecms) such as collagen, elastin and proteoglycans. similarly, upon injury due to angioplasty, stent implantation, or bypass surgery, vsmcs dedifferentiate and re - enter the cell cycle. they exhibit an increased rate of proliferation, migration, and synthesis of ecms, and at the same time, display a decrease in the expression of vsmc contractile proteins. this dedifferentiated, proliferative phenotype plays a major pathophysiologic role in the development of atherosclerosis, hypertension, restenosis after angioplasty or bypass, diabetic vascular complications, and transplantation arteriopathy. a large number of environmental cues including growth factors, inflammatory mediators, matrix component, and cell - cell interactions have been shown to regulate vsmc proliferation and differentiation. transforming growth factor- (tgf-) is among the most potent soluble growth factors that promote vsmc differentiation. the effects of tgf- on vsmc proliferation remain controversial. it has been reported that tgf- exerted a growth - inhibitory effect on vsmcs by inducing cell cycle arrest at g1 phase,. have shown that tgf- promotes proliferation of cultured vsmc, which is consistent with recent findings that tgf- increases vsmc proliferation through the smad3 and erk mapk pathways,. in addition to tgf-, other growth factors including platelet - derived growth factor (pdgf), fibroblast growth factor-2 (fgf-2) and epidermal growth factor (egf) have also been shown to stimulate vsmc proliferation or help maintain a dedifferentiated smc phenotype,. however, it is now believed that vsmc differentiation and proliferation are not necessarily mutually exclusive, and cell cycle exit may not necessarily lead to vsmc differentiation. a great example is that heparin, a powerful inhibitor of vsmc growth both in vitro and in vivo, has no effect on differentiation of human vsmc. these results show that cessation of proliferation alone is not sufficient to promote smc differentiation. moreover, during late embryogenesis and postnatal development, vsmcs exhibit an extremely high rate of proliferation, yet they undergo a rapid rate of induction of multiple vsmc differentiation marker genes,. have reported that proliferation and differentiation of vsmc precursors occurs simultaneously during the development of the vessel wall. these cells cease dna synthesis, accumulate dna damages, and eventually undergo cell death in a p53-dependent manner. in cancer cells, depletion of cdc7 has been demonstrated to cause an abortive s phase, leading to p53-independent apoptotic cell death or aberrant mitosis. in contrast, in untransformed cells, cdc7 depletion results in a reversible arrest in g1, and cells remain in a viable non - proliferative state,. on the other hand, overexpression of cdc7 cdc7 is a serine - threonine kinase and was first identified in budding yeast as a mutant defective in the initiation of dna replication, conserved from yeast to humans,. cdc7 is activated by binding to a regulatory protein called either dumbbell former 4 (dbf4) or activator of s phase kinase (ask). cdc7 plays a very important role in cell cycle progression through the g1/s transition and is critical for the initiation, but not the elongation, of dna replication in the mitotic cell cycle. initiation of dna replication in eukaryotes requires an assembly of various replication proteins at the origin of the replication in order to form a pre - replicative complex (prerc). these proteins include origin recognition complex (orc), cdc6, cdc45, minichromosomal maintenance (mcm) proteins, dna polymerase, and single - stranded dna binding protein, etc. however, prerc can not induce replication unless an additional cue is provided from upstream cell cycle events. this cue is protein phosphorylation mediated by cdc7-dbf4 and cyclin - dependent kinase (cdk),. cdk is essential for g1/s transition although its target for s phase initiation has not been elucidated. it is also unclear if cdc7 and cdk act in parallel or in the same pathway for s phase initiation. recent evidences show that cdk including cdk2-cyclin e can phosphorylate human cdc7 and ask proteins in vitro. a potential phosphorylation site mutation (t376a) in cdc7 this critical threonine 376 residue appears to be phosphorylated by cdk2-cyclin e, cdk2-cyclin a, and cdc2-cyclin b in vitro, providing a possible functional link between cdk and cdc7. moreover, one - hybrid assays in yeast indicate that dbf4 protein is tethered at the origins of dna replication, strongly suggesting that the cdc7 kinase complex is present on chromatin and is in association with replication complexes at the origin. the cdc7 kinase complex along with cdk is known to be the ultimate trigger of chromosomal replication in yeast. activation of mcm2 - 7 unwinds the origin of dna replication and allows the priming of leading and lagging strands by dna polymerase. the mcm2 - 7 complex is an important target of cdc7 kinase. genetic studies also demonstrate that mcm2 is a physiologically important substrate of cdc7. dbf4 recruits cdc7 to mcm2 because dbf4, but not cdc7, directly binds to mcm2. interestingly, de - phosphorylation of mcm2 causes a loss of phosphorylation by cdc7 in yeast, suggesting that prior phosphorylation of the mcm substrate is a prerequisite for cdc7 target site recognition. the efficacy of mcm2 phosphorylation by cdc7 is significantly increased when the substrate is pre - phosphorylated by cdk2. these results suggest that cdk and cdc7 work together to achieve efficient phosphorylation of mcm2 in the complex for initiation of dna replication. phosphorylation of mcm2 by cdc7-dbf4 and cdk is likely to create direct binding sites for other factors such as cdc45, or cause a structural change in the mcm2 - 7 complex that is important for activation of the helicase,,. initiation of dna replication is a crucial decision point during cell proliferation and lies at the convergence point of complex networks of signaling molecules that have evolved to specify when and where cells divide in an organism. cdc7 not only lies at an integration point for mitogenic signaling pathways, but also plays a key role in maintaining genomic stability through intra - s - phase checkpoint pathways in response to dna damage and delayed replication fork progression. the molecular mechanisms underlying vsmc differentiation have been extensively studied including transcriptional, post - transcriptional, and posttranslational regulations. although it is well established that smc differentiation and proliferation can be regulated simultaneously, the molecular mechanisms governing these two somewhat uncompromised processes, however, are less well studied. most growth factors block vsmc differentiation while inducing vsmc proliferation, or vice versa, but thrombin has been shown to induce vsmc proliferation and increase the expression of vsmc marker genes even though the detailed mechanism remains to be determined. we found that tgf- can also simultaneously induce differentiation and proliferation in the initial phase of vsmc differentiation. cdc7 expression is significantly upregulated by tgf- although cdc7 level is normally constant throughout the cell cycle,. conversely, overexpression of cdc7 promotes expression of early vsmc marker genes such as -sma, sm22, and calponin, demonstrating the dual role of cdc7 in vsmc differentiation and proliferation. cdc7 is required for tgf--mediated activation of -sma and sm22 promoters though cdc7 does not directly bind to promoter dna. cdc7 function in vsmc marker gene transcription appears to be dependent on smad3, a well - known tgf- signaling intermediate and transcription factor important for vsmc differentiation. in fact, cdc7 promotes smad3 binding to smad - binding element in vsmc gene promoters by physically interacting with smad3, leading to activation of the marker gene transcription. in addition to the direct effect on marker gene transcription, cdc7 also indirectly regulates marker gene transcription by enhancing smad3 accumulation in the nuclei, which is achieved by enhancing the expression or stability of smad nuclear retention factor taz. in addition to smc marker gene, cdc7 has been shown to regulate the transcription of a meiosis - specific transcriptional activator, ntd80 in yeast. cdc7-dbf4 promotes ndt80 transcription by relieving repression mediated by a complex of sum1, rfm1, and a histone deacetylase hst1. the other roles of cdc7 in meiosis include facilitating the premeiotic dna replication and the initiation of recombination. although dbf4, the regulatory subunit of cdc7, is required for vsmc proliferation during differentiation, dbf4 is not involved in vsmc differentiation because knockdown of dbf4 by its specific shrna has no effect on vsmc marker gene expression. because the differentiation and proliferation occur simultaneously via different mechanisms (fig. 1), vsmc marker gene activation and cell cycle progression may take place concurrently in the same cells, which requires further careful investigation. nevertheless, it is reasonable to believe that cells use cell cycle regulators to control another important cellular process to accomplish the high rates of vsmc differentiation and proliferation during late embryogenesis and postnatal development. klf4 is a member of the kruppel family of transcription factors and one of the four induced - pluripotential stem cell pluripotency factors,. the combined retroviral - mediated overexpression of klf4 and sox2, oct4 and c - myc in differentiated cells can convert the cells into embryonic stem cell - like cells. although klf4 is not normally expressed in healthy adult smcs, it is rapidly induced during smc phenotypic modulation following vascular injury, or in cultured vsmc while treated with pdgf - bb or oxpls,. klf4 binds to g / c repressor elements in vsmc marker genes, and is critical in mediating the down - regulation of these genes during vsmc phenotypic modulation in vivo and in vitro. 1), including reducing serum response factor binding to carg box, decreasing myocardin expression, and recruiting histone deacetylases to silence gene transcription, etc.,,. smc - specific knockout of klf4 causes a transient delay in injury - induced repression of vsmc differentiation markers, which is likely due to the absence of klf4 binding to g / c repressor. the transient but not long - term repression of vsmc genes may be due to a compensatory effect of other klfs such as klf5, klf13 and/or klf1571. interestingly, although klf4 suppresses vsmc gene expression, klf4 smc - specific knockout in mice enhances neointimal formation in response to vascular injury, which is caused by increased vsmc proliferation in artery media, suggesting that klf4 inhibits vsmc proliferation. the underlying mechanism is that klf4 binds to klf4 binding site and recruits p53 to bind to p53 binding site in the promoter / enhancer of the cell cycle inhibitor p21 and thus induces p21 expression, leading to inhibition of vsmc proliferation (fig. interacts with smad3 and enhances smad3 binding to sbe in vsmc marker gene promoter, resulting in activation of smc gene transcription and vsmc differentiation. cdc7 binds to dbf4, and cdc7/dbf4 phosphorylates mcm located on orc, leading to initiation of dna replication and vsmc proliferation. klf4 blocks srf binding to carg box, decreases myocardin expression, and recruits histone deacetylases to silence vsmc marker gene transcription and thus suppresses vsmc differentiation. vsmc differentiation and proliferation are separate but concurrent processes that may be regulated independently and simultaneously with a high possibility of crosstalk between their controls. cdc7 simultaneously stimulates vsmc differentiation and cell proliferation, indicating that cell cycle regulators may play an important role in synchronizing these two seemingly paradoxical processes. therefore, it is highly likely that other cell cycle regulators are also involved in regulating both vsmc differentiation and proliferation during vsmc development. although klf4 suppresses both vsmc differentiation marker and cell proliferation, it would be interesting to determine if klf4 exerts these effects simultaneously during vsmc phenotypic modulation or differentiation from progenitors. in addition, it is important to define how cells balance the activities of cdc7 and klf4 in vsmc differentiation and proliferation. the answers to these questions or identification of other novel mechanisms shall increase our understanding of vsmc biology during late embryonic development and vascular remodeling in pathological conditions. | vascular smooth muscle cell (vsmc) differentiation and proliferation are two important physiological processes during vascular development. the phenotypic alteration from differentiated to proliferative vsmc contributes to the development of several major cardiovascular diseases including atherosclerosis, hypertension, restenosis after angioplasty or bypass, diabetic vascular complications, and transplantation arteriopathy. since the vsmc phenotype in these pathological conditions resembles that of developing vsmc during embryonic development, understanding of the molecular mechanisms that control vsmc differentiation will provide fundamental insights into the pathological processes of these cardiovascular diseases. although vsmc differentiation is usually accompanied by an irreversible cell cycle exit, vsmc proliferation and differentiation occur concurrently during embryonic development. the molecular mechanisms simultaneously regulating these two processes, however, remain largely unknown. our recent study demonstrates that cell division cycle 7, a key regulator of cell cycle, promotes both vsmc differentiation and proliferation through different mechanisms during the initial phase of vsmc differentiation. conversely, krppel - like factor 4 appears to be a repressor for both vsmc differentiation and proliferation. this review attempts to highlight the novel role of cell division cycle 7 in tgf--induced vsmc differentiation and proliferation. the role of krppel - like factor 4 in suppressing these two processes will also be discussed. |
it s the lone researchers who generally explore scientific frontiers, but groups of people with various areas of expertise come together to consolidate advances. as new knowledge arises, these groups solidify standards that provide the platform for the next frontiers. the battles between jonas salk and albert sabin to find a vaccine for poliomyelitis are well documented. funding from the national foundation for infantile paralysis fueled the competition, and secrecy hid fundamental errors that openness might have quickly revealed. the competition strengthened each researcher s commitment to his approach, but it perhaps caused a significant delay in finding a vaccine when both salk and sabin initially ignored the findings of dr. dorothy horstmann, the woman who discovered the actual path of the viral entry.2 on the other hand, an effective model of collaboration functioned between 1993 and 1996, when the national institutes of health (nih) funded work on the multicenter animal spinal cord injury study (mascis). eight leading spinal - cord - injury laboratories in the united states worked together to develop and validate the first standardized rat model of spinal - cord injury. in addition to developing the model, mascis scientists developed outcome measures such as the basso, beattie, bresnahan (bbb) locomotor scale and white - matter sparing, both of which became standards in the field. the first project of its kind funded by the nih, mascis proved that people in different laboratories can work together to develop approaches and to standardize procedures, thus enhancing the work of each of the individual researchers. the current model of individual principal investigators competing with each other for funding, and the consequent lack of collaboration, not only is expensive and inefficient but also forces scientists into undesirable binary thinking that invariably accompanies competitive endeavors. what your competitor is doing automatically becomes off - limits. a much better approach to developing new scientific discoveries would be to offer increased funding of projects that both enhance collaboration and stimulate individual initiative. biotechnology has become the buzzword of the 21st century ; an entire industry has arisen around the term. but biology and technology do nt always work well together. one example is the dichotomy between the electrical stimulation and cellular transplantation approaches to restoring function to people who are paralyzed. implemented by engineers who think in terms of electrical current, voltage, and resistance, a whole field has been built around functional electrical stimulation (fes)using computers to deliver electrical signals to muscles and treating human muscles like robotic components. in contrast, cellular transplantation is the brainchild of biologists, who think in terms of synapses, neurotransmission, and metabolism. as with fes fueled at the end of the 20th century by the discovery of stem cells, this field has been dominated by paranoia and fanciful thinking illustrated in the film star wars : the clone wars (2008). biology and technology must work together in practical and realistic ways to restore meaningful function based on the best available technology and understanding of biology. a recent example provides a clear illustration of a fruitful marriage between biology and technology. each field provides a best - of - class solution to the problem of restoring function after spinal - cord injury. for example, lu demonstrated that rivers of axons can grow across the transection site of a rat spinal cord if you implant mesenchymal cells to form a bridge, inject the response - element binding protein camp to motivate neurons to grow the axons, and induce the neurons on the other side of the gap to express growth factors and come hither signals. likewise, liu showed that silencing a single gene called pten can stimulate rivers of axons to grow across the injury sites in mouse spinal cords. the problem was that the rats and mice did not recover motor function even though thousands of axons grew across the injury site and made connections with neurons above and below it. the regenerated axons were new, and they probably were not connecting to the neurons in the same way the old axons had. thus, the brain had no idea which buttons to push to move specific muscles or how to interpret incoming signals. in fact, the most successful mobility training programs for those with spinal - cord injury are those that involve prolonged repetitive activation of desired movements as often as six hours a day, six days a week, for six months or more. such intensive training is not only expensive but also unavailable to the majority of those who would need it. why is such intensive training necessary for functional recovery ? it turns out that learning requires repetitive activation of synaptic connections. in donald hebbs5 book, the organization of behavior : a neuropsychological theory (1949) specifically, hebb said, when an axon of cell a is near enough to excite cell b and repeatedly or persistently takes part in firing it, some growth process or metabolic change takes place in one or both cells such that a 's efficiency, as one of the cells firing b, is increased. neurons that fire together, wire together, the hebbian principle has become a leading theory of neuronal learning. the formation and consolidation of synapses or connections requires synchronized activity from sensory and central sources. today most people carry in their pocket or purse more computer power than what once filled an entire room of mainframes. brain - to - machine interface has demonstrated the ability to control and deliver electrical stimulation synchronized to desired activities and thereby increase synaptic consolidation and learning of regenerated fibers. therefore, a combination of cell transplantation and electrical stimulation is the best way to restore function when neither can do it alone. regenerated axons are not a repaired nervous system but a new one in which new neuron - to - neuron and neuron - to - muscle connections must be learned. initial studies show that transplanting umbilical - cord - blood stem cells in combination with intense physical therapy restores walking in people with spinal - cord injury. but the cost would be prohibitive for large numbers of people to participate in months - long walking programs. however, what if people could receive cell transplants and walk two hours a day in addition to undergoing electrical stimulation that allows them to continue to walk while they sleep ? injected stimulators such as the rice - size bion raise this possibility. the story of stem - cell advocacy is relevant to the balance between hope and realism. celebrating the passage of stem - cell legislation in new jersey in 2003, commissioner of health, j.d., proclaimed that stem - cell medicine was the most significant paradigm shift in the 40 years he had been practicing medicine. newspapers heralded the advance, and community advocates believed that with the exception of restrictions imposed by president george w. bush, the way was clear for miraculous cures for devastating diseases.6 in a movement called quest for the cure, impatient activists worked together to pursue stem - cell legislation at the state level. in december 2003 each of these bills, and others that followed, provided avenues for funding stem - cell research within its respective state. during a subsequent backlash, other states increased restrictions on or entirely prohibited fetal and embryonic stem - cell research. on march 9, 2009, excitement filled the room when, in front of many disabled and ill people and their families, newly elected president barack obama signed an executive order lifting restrictions related to human embryonic stem cells. the president proclaimed, today, with the executive order i am about to sign, we will bring the change that so many scientists and researchers ; doctors and innovators ; patients and loved ones have hoped for, and fought for, these past eight years : we will lift the ban on federal funding for promising embryonic stem cell research. we will vigorously support scientists who pursue this research. later, when the order s official guidelines were released, scientists were disappointed to discover that the new policy was more restrictive and onerous than the previous one. two years earlier, shinya yamanaka s discovery that skin cells can be reprogrammed to become embryonic stem cells called induced pluripotent stem (ips) cells had changed the field and had made it unnecessary to harvest fertilized eggs in order to obtain embryonic stem cells. to date, no ips cell has been tried in humans because of fears that these cells can produce tumors. however, the discovery established the principle that pluripotency is genetically programmed. further recognition of the discovery s significance came when yamanaka received the nobel prize in 2012 for physiology or medicine. the suppression of embryonic - stem - cell research did lead to a renaissance of studies of adult stem cells. this soon resulted in over 4,500 clinical trials involving stem cells in the united states. the field of stem - cell therapies has turned 180 degrees from embryonic stem cells because pluripotency is not as desirable as originally thought. in fact, most scientists and clinicians consider pluripotency to be a dangerous property that must be eliminated before cells can be transplanted. for example, geron corporation obtained permission from the food and drug administration (fda) to transplant embryonic stem cells into people with spinal - cord injury, but only proving that less than one in a billion transplanted cells were pluripotent. the ability of make many kinds of cells is a dangerous property if not controlled. stem cells that find their way into the spinal cord to make a hair or a toenail or to penetrate a tissue but end up causing a tumor are harmful to the point where the human body has evolved to suppress pluripotency. an adult stem cell can behave like a stem cell only if it finds a niche of cells that tell the stem cell exactly what to do, which is why it is so difficult to grow stem cells in culture. nature has developed ways to reduce the dangers of stem cells by forcing them to produce the correct type and number of cells in response to tissue requirements. when embryonic stem cells first were discovered and grown in culture, we did not understand stem cells and the implications of pluripotency. scientists were excited about the possibility of growing any and all sorts of tissues from embryonic stem cells. religious conservatives believed that allowing embryonic stem cell research to proceed would lead to the practice of killing fetuses to treat adults. with more knowledge and greater understanding of the biology of stem cells for example, we know from animal studies and hopefully soon from clinical trials that the spinal cord can regenerate. at the same time, our expectations are tempered by the observations that animals do not recover function after regeneration and that intensive exercise and training are needed to restore function. but lest overhyping hope sow the seeds of its own destruction, hope must be coupled with honest realism.7 in the absence of understanding, scientists would do well to under promise and over deliver. each potential treatment raises the question : when is too soon, and when does an overly conservative approach perpetuate human suffering ? are large animal studies always required before people can be studied, and to what extent are double - blind randomized trials de rigueur ? the present ebola virus disease (evd) epidemic has brought this debate into focus. according to the world health organization (september 2014 fact sheet n103), the average fatality rate for untreated evd is 50 percent, with a range of 25 to 90 percent. now one idea is that the blood of evd survivors might impart immunity to patients, and transfusions are being given to patients without meticulous study. the question of timing raises the important issue of whether there should be different standards for situations like the aids epidemic of the 1980s and the present evd crisis in which death is a highly probable outcome or for conditions like spinal - cord injury, in which people are paralyzed but stable. should victims of the former have fast - track access to untested potential treatments while victims of the latter are made to wait through a full clinical - trial process ? should there be different criteria for children as the enterovirus d68 (ev - d68) respiratory illness spreads across the united states ? one danger arising from delay in committing resources and manpower is the burgeoning industry of false promises. whenever new possibilities arise, such as stem cells and clinical trials, so - called clinics spring up like mushrooms and offer these treatments or claim to offer them without waiting for trial results. for instance, the black market for the blood of evd survivors was flourishing almost before the newsprint was dry. unscrupulous opportunists lie in wait to take advantage of the desperation of the afflicted and their families. under what circumstances should compassion supersede caution ? should the definition of compassionate use be expanded to offer people the option to obtain treatments approved by the fda for phase iii trials but at non - trial sites by companies in exchange for cost of the therapy ? it behooves the scientific community to develop guidelines to balance the urgency of impending death with the dreams of those who would be healed. another principle advanced by the heaths in their book decisive is that of multitracking options that is, keeping all options on the table. politics, fear, and mistrust raise the slippery - slope argument, which too often results in the closure of pathways that may be beneficial. for example, would we have safe nuclear power today if fear had shut down nuclear research ? would adult stem cells have been discovered or well understood if all embryonic - stem - cell research had been terminated, as some people wanted ? there will always be tension between mechanical and biological approaches, between hope and hype, and between caution and risk the struggle surrounding whether to test something new as early as possible despite the inherent danger or to wait too long at the potential expense of human lives. debates about funding short - term immediate therapies or long - term potential breakthroughs will continue to rage. are we open to radically different changes, such as shifting from developing each vaccine from scratch to the chassis approach, used by vaxcelerate, which cut time and money for a lassa fever vaccine from several years and billions of dollars to four months and less than a million ? critics will continue to question practices such as spending money and using manpower on heart transplants from pigs and baboons ; isolating stem cells from urine ; 3-d printing of organs ; darpa s electrx program, which may give humans self - healing powers8 ; and quality of life issues like that raised by ezekiel emanuel in his recent article why i hope to die at 759 : how long is too long to live ? thomas rivers reminded the researchers, nothing is sacred in science ; you give up the old when you find something new that is better. when we fail to follow promising leads, we freeze ourselves to the obsolete, shut - out the critically important, break our foundational commitment that science exists to help people | editor s note : from their roles directing the w.m. keck center for collaborative neuroscience at rutgers university, wise young and patricia morton have been on the front lines of spinal - cord - injury research for most of their careers. in this article they lean on lessons from the past, their own experience, and events still unfolding as they raise questions about the future of all scientific research. |
liver fibrosis is characterized by excessive scarring, caused by chronic inflammatory processes during liver diseases of different origin. in response to chronic liver injuries, various cell types get activated and transdifferentiate into myofibroblastic cells that then participate in synthesis and reorganization of connective tissue (hautekeete and geerts, 1997 ; friedman, 1999, 2008 ; knittel., 1999). a main source of extracellular matrix (ecm) production are hepatic stellate cells (hsc) undergoing myofibroblastic transition (hautekeete and geerts, 1997 ; friedman, 1999, 2008). myofibroblastic differentiation and matrix accumulation of hsc is heavily triggered by profibrogenic mediators such as transforming growth factor (tgf-) and the -isoform of platelet - derived growth factor (pdgf). hence, in response to tgf-, hsc take center stage during fibrosis by the enhanced synthesis of ecm proteins, in particular collagen i and ii. here, we emphasize the role of dysregulated microrna (mirna) during liver fibrosis, their function in ecm expression and in profibrogenic signaling in hsc. the fibrotic remodeling process and the change of gene expression during liver fibrosis are associated with an altered pattern of mirna. mirna are small (1924 nucleotides long) non - coding rna molecules inhibiting posttranscriptionally gene expression. it is suggested that more than one - third of all human genes are regulated by mirna (krek. the primary mirna (pri - mirna) molecules of more than 1000 bases in length are transcribed by rna - polymerase ii. cleavage of the pri - mirna then generates the precursor mirna (pre - mirna). this pre - mirna is exported into the cytoplasm and further processed by rnase iii and dicer resulting in the release of a mature mirna (ruby., 2007). after integration into the rna - induced silencing complex (risc), interaction of mirna sequences with the untranslated region (utr) of transcripts causes translational repression or transcript degradation (bartel, 2009). several algorithms predict that one mirna might bind to a multitude of mrna transcripts and, in turn, that one mrna might be targeted by a widespread panel of mirna species (doench and sharp, 2004 ; lewis., 2005). in liver, mir-122 is the most abundant mirna, accounting for more than 70% of the total mirna in hepatocytes (jopling., 2005). mir-122 is involved in cholesterol synthesis and hepatitis c virus (hcv) replication (jopling. is markedly decreased depending on severity of fibrosis (cheung., 2008 ; other mirna species, that are also highly expressed in the healthy liver, e.g., mir-125b or mir-22, were shown to be additionally reduced in fibrotic liver biopsies of chronic hepatitis c patients. furthermore, the members of the mir-29 family, as well as mir-194 and mir-150 are reported to be downregulated during fibrogenesis (kwiecinski., 2011 ; roderburg., additionally, mir-19b is recently found to be diminished in fibrotic liver of rat and human (table 1) (lakner., 2012). whereas a wide range of mirna are reduced after fibrosis, only some mirna like the members of the mir-199, the mir-200, and the mir-34 family are known to be increased (alisi., 2010 ; pogribny., 2010 ; murakami., 2011). though mir-21 upregulation was only analyzed on fibrotic liver biopsies of a limited number of hcv patients (marquez., 2010), in many other organs mir-21 is one of the most important mirna prevalently expressed after fibrosis induction (thum., 2008 ; liu., 2010 ; zhu and fan, 2011). personal observation ; nafld, non - alcoholic fatty liver disease ; hfd, high fat diet. the mir-122 decrease, observed in primary hsc during culture - induced myofibroblastic activation, might be due to the dilution of contaminating hepatocyte mirna of the primary hsc isolate. recent reports have shown that altered mirna levels are also associated with the phenotypical changes of hsc during the myofibroblastic transition process including the induction of ecm proteins (guo., 2009a ; ji., 2009) (table 1). the members of the mir-29 family are of particular interest because they are shown to inhibit ecm synthesis indicating an antifibrotic function. the mir-29 family consists of mir-29a, mir-29b, and mir-29c, differing only in two or three bases. mir-29a and mir-29b1 as well as mir-29c and mir-29b2, are encoded and transcribed in tandem by two genes located on chromosome 7 or chromosome 1, respectively (mott. the authors proved mir-29 mediated repression of elastin, collagen i and iii synthesis in cardiac fibroblasts and its regulation by tgf-. accordingly, downregulation of mir-29 was suggested to enhance the fibrotic response after myocardial infarction, whereas overexpression of mir-29 in cardiac fibroblasts reduced collagen expression. similarly, ogawa. (2010) demonstrated that mir-29 inhibits the production of fibrillar collagen in hsc, suggesting also a function of mir-29 in liver fibrosis (roderburg., 2011). furthermore, highly conserved binding sites for the mir-29a and mir-29b are found in many 3-utr sequences of the various subunits of ecm proteins like collagen type v and xv subunits, laminin 1, and nidogen. (2011) suggest that mir-29a and mir-29b are also involved in a widespread panel of other fibrosis associated genes including adam metalloproteinases mainly type 12 and 9, ecm formatting components such as fibrillin-1 and follistatin-1, and different integrin chains. (in review) showed that mir-29 not only targets gene expression of ecm associated proteins, but also the expression of profibrogenic growth factors (manuscript submitted). they found putative mir-29a and mir-29b binding sites in mrna of igf - i but most notably also in members of pdgf linked signaling pathways such as pdgf- receptor, pdgf - c, and vegf - a. accordingly, mir-29 mediated inhibition of igf - i and pdgf - c was proven in hsc. (2011) collect evidence that also the pdgf- receptor is targeted by mir-29 regulation. as a consequence, mir-29 acts as antifibrogenic mirna by two pathways (1) by inhibition of ecm formation and (2) interfering with the profibrogenic cell communication pathways via pdgf - b and pdgf - c signaling (figure 1b). interestingly, mir-29 expression is in turn highly regulated by pdgf - bb (ogawa., 2010). thus, the loss of mir-29 in myofibroblastic hsc during liver fibrosis is mainly due to profibrogenic stimulation by tgf- and pdgf - bb (ogawa., 2010 ; kwiecinski., 2011) the members of the mir-29 family are encoded by two genes, located on chromosome 7 or 1, respectively. the pri - mir-29a and b1 as well as the mir-29c and b2 are each transcribed in tandem. the promoter region of the mir-29a / b1 gene contains several putative binding sites for the profibrogenic repression of mir-29 : three ap1 consensus sequences (ap1-re), three tgf- inhibitory elements (tie) and in addition the three putative smad binding elements (sbe). these transcriptional binding sites and their interaction are suggested to mediate profibrogenic stimulation of pdgf - bb (i.p. of the ap1 re sites) and of tgf- by smad and ap1 signaling. (b) mir-29 signaling in the healthy and the fibrotic liver. in the healthy liver, mir-29 is highly expressed in hepatic stellate cells (1) and is responsible for repression of extracellular matrix proteins (ecm) in particular collagens (2), but also of expression of growth factors such as pdgf - c and igf - i. during fibrogenesis, profibrogenic growth factors are increased and stimulate hepatic stellate cells in a paracrine and autocrine manner (3). profibrogenic stimulation of tgf- and pdgf - bb results in mir-29 repression (4). the loss of mir-29 by tgf- and pdgf - bb results in the abolished repression of profibrogenic expression of ecm, pdgf - c or igf - i (5). the enhanced secretion of pdgf - c and igf - i stimulates autocrinely stellate cells, leading to increased proliferation and ecm production (6). the decrease of mir-29 was observed after experimental fibrosis including liver intoxication in mice and cholestasis induced fibrosis after bile duct occlusion in rat. furthermore, in liver biopsies of patients with chronic hepatitis c mir-29 levels are significantly reduced (kwiecinski., 2011 ; roderburg., these in vivo studies suggest that the loss of mir-29 during liver fibrogenesis leads to the abolishment of ecm and profibrogenic mediator repression. the findings on hsc provide additional evidence, that reduced mir-29 levels leading to profibrogenic gene expression are due to tgf- or pdgf - bb exposure. the smad-2/3 proteins act as the main signal transducers of tgf- stimulation, initiating ecm synthesis and myofibroblastic transition (dooley., 2000, 2001a). in renal fibrosis, silencing of the mir-29c / b2 gene is assumed to involve smad-3 signaling (qin., 2011). however, the analysis of promoter regions of both mir-29 genes, shown in figure 1a, has just started by defining the transcriptional nf - kb and yy - nf - kb control, respectively (wang., 2008 ; mott., 2010), and did not yet focus on tgf- signaling. interestingly, the promoter sequence of the mir-29a / b1 gene harbors several caga - boxes. caga - boxes function as smad-3/4 protein binding elements (sbe) and smad-3/4 binding is commonly followed by induction of gene transcription (dennler., 1998). however, suppressive effects of smad proteins are also possible, depending on their interaction with other regulatory factors like histone deacetylases (liberati., 2001) or the activator protein 1 (ap1 ; hall., 2003) thus, tgf- induced smad-3/4 signaling and the regulatory binding of the sbe may contribute to the transcriptional repression of the mir-29a / b1 gene. in addition, three consensus sequences for binding of the transcription factor ap1 are located in the upstream region of the mir-29a / b1 gene. is highly activated by the ras / raf pathway after tgf- and pdgf - bb exposure (angel and karin, 1992 ; zhang., 1998). ap1 interaction with the ap1 responsive elements (ap1 re) drives transcription of a broad spectrum of genes involved in the early gene response and acute inflammatory stimulation. however, ap1 can also function as transcriptional suppressor by binding to tgf- inhibitory elements (tie), that are known to lead to gene silencing in the stromelysin (kerr., 1990), the hgf, and the c - myc gene (matrisian., 1992 ; yagi., 2002). thus, in future experiments it has to be proven if profibrogenic mir-29 repression is mediated by the consensus sequences of the tie, the ap1 re, the sbe, or even by the interplay of different regulatory elements (figure 1a). mir-21 is an ubiquitously expressed mirna, which is highly upregulated in the majority of cancer types. in cancer, mir-21 acts as an oncogenic mirna (oncomir) targeting pten and other tumor suppressor proteins (krichevsky and gabriely, 2009 ; qi., 2009). previous reports have demonstrated that mir-21 is also enhanced after initiation of myocardial, renal, or pulmonary fibrosis (thum., 2008 ; liu., 2010). mir-21 enrichment during fibrosis is assumed to be based on profibrogenic stimulation by tgf-, because zhong. (2011) have demonstrated that smad-3 transducing tgf- signaling, is crucial for mir-21 transcription. furthermore, the signal transducers of tgf-, the receptor - regulated smad-2 and smad-3 (r - smad), are able to interact with the p68 rna helicase of the drosha / pdcd4 microprocessor complex, promoting the restriction of pri - mir-21 into the precursor pre - mir-21 (davis., 2008). thus, the upregulation of mir-21 during fibrotic processes is based on two tgf- stimulated mechanisms, that are mediated by the smad proteins : (1) by transcriptional induction and (2) by enhanced mir-21 maturation (figure 2). fibrosis tgf- binds to the receptors leading to smad-2 or smad-3 phosphorylation, followed by aggregation with smad-4 (1). the smad-3/4 is shown to induce transcriptional induction of synthesis of pri - mir-21 (2). the further cleavage of pri - mirna into hairpin - loop precursor mirna is catalyzed by the pdcd4/drosha complex. the smad proteins can interact with the rna helicase p68, which is integrated in the microprocessing complex. after tgf- exposure, both the smad-2 and smad-3 protein is bound by p68 of the complex resulting in stabilization and high microprocessing efficiency (3). high levels of mir-21 target the smad-7 mrna and repress translation of the inhibitory smad-7 (4). the decrease of the inhibitory smad-7 protein in turn abolishes the negative feed - back mechanisms of tgf- signaling (5) resulting in elevated profibrogenic tgf- stimulation. a potential mechanism for the role of mir-21 in fibrosis is through regulating the protein synthesis of the inhibitory smad-7 (figure 2 ; liu. after tgf- stimulation, smad-7 transcription is driven by smad-2/3 and smad-4 (stopa., 2000 ; dooley., 2001b). enhanced smad-7 levels, in turn, are highly potent to antagonize tgf--mediated pathways (1) by blockade of the tgf- type i receptor for further binding of the receptor smads (massague and chen, 2000), and (2) by smurf2 interaction, to form an e3 ubiquitin ligase that targets the tgf- type i receptor for degradation (kavsak., 2000). therefore, the inhibition of smad-7 in response to mir-21 enhancement during fibrosis has to be considered as an important profibrogenic pathway, which might become an attractive target for future therapeutical approaches. in contrast to mir-21 that promotes tgf- signaling, a recent study of lakner. mir-19b represses fibrotic features after myofibroblastic activation of stellate cells by targeting the tgf- ii receptor and most notably smad-3 (lakner., 2012). hence, upcoming knowledge of mirna species, involved in profibrogenic signaling, will provide novel perspectives in understanding and probably also in treatment of chronic liver diseases. the authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest. | microrna (mirna) are small non - coding rna molecules that posttranscriptionally effect mrna stability and translation by targeting the 3-untranslated region (3-utr) of various transcripts. thus, dysregulation of mirna affects a wide range of cellular processes such as cell proliferation and differentiation involved in organ remodeling processes. divergent mirna patterns were observed during chronic liver diseases of various etiologies. chronic liver diseases result in uncontrolled scar formation ending up in liver fibrosis or even cirrhosis. since it has been shown that mir-29 dysregulation is involved in synthesis of extracellular matrix proteins, mir-29 is of special interest. the importance of mir-29 in hepatic collagen homeostasis is underlined by in vivo data showing that experimental severe fibrosis is associated with a prominent mir-29 decrease. the loss of mir-29 is due to the response of hepatic stellate cells to exposure to the profibrogenic mediators tgf- and pdgf - bb. several putative binding sites for the smad proteins and the ap1 complex are located in the mir-29 promoter, which are suggested to mediate mir-29 decrease in fibrosis. other mirna are highly increased after profibrogenic stimulation, such as mir-21. mir-21 is transcriptionally upregulated in response to smad-3 rather than smad-2 activation after tgf- stimulation. in addition, tgf- promotes mir-21 expression by formation of a microprocessor complex containing smad proteins. elevated mir-21 may then act as a profibrogenic mirna by its repression of the tgf- inhibitory smad-7 protein. |
one of the few well - understood features of intensive care unit (icu) delirium is its association with poor patient outcome. risk factor stratification is essential to the understanding, prevention and treatment of any disorder, and is a cornerstone of scientific endeavor in clinical research. the largest study on icu delirium risk factors to date is published in the previous issue of critical care. delirium in the critical care setting is said to occur in 22% to over 80% of patients. such broad variations in delirium incidence may be partly attributable to differences in predisposing risk factors, which may differ between icus. co - morbidities present prior to icu admission have particularly seldom been considered in icu delirium studies ; several of them are discussed in the paper by van rompaey and colleagues. physicians hold opinions on the risks and benefits of environmental factors (for example, physical restraints) affecting the patient once in the icu ; however, little is known about these factors. human interaction, such as the effect visitors may have on delirium, remains unexplored in the critically ill patient. these environmental features, discussed in van rompaey and colleagues ' paper, are important not only because they are inexpensive but also perhaps because they less likely to harm patients than poorly studied pharmacological interventions. the patients described in the study were no longer intubated and thus were perhaps less ill ; in addition, not all centers collected all risk factor data. van rompaey and colleagues nevertheless provide confirmation that several previously identified risk factors remain significant in this multicenter study, challenge other risk factors, and add several risk factors not previously described. alcohol use is not screened for routinely, validated alcohol withdrawal scales remain under - used, and intervention for withdrawal is seldom incorporated into treatment plans. this knowledge is all the more surprising because the relevant studies identify alcohol abuse as a significant risk factor for developing delirium. whether alternatives to routine care (that is, benzodiazepines titrated to symptoms, rather than antipsychotics) in these high - risk patients are of any benefit is unknown. age has been considered a risk factor for delirium in non - icu populations and by some icu investigators. when van rompaey and colleagues consider pre - existing cognitive dysfunction, tobacco use and alcohol, age does not appear to confer an additional risk for delirium. if dementia is a risk factor but age is not and studies considering pre - icu admission co - morbidities would indicate this is true prevention or prophylaxis of this common and morbid disorder in the icu should consider different interventions than, say, similar initiatives on the wards. several previously described predisposing factors (psychoactive drugs, sedatives and opiates) are revisited and their relative contribution to the risk of icu delirium is tempered by the case mix, and the addition of other variables. the most novel elements in this study, however, are the environmental risks for icu delirium. visible daylight, visitors and not being physically restrained seem to result in a lower incidence of delirium. it is refreshing to know that in the high - tech environment of icus, someone still asks the question ' which inexpensive and nonmorbid approach is useful ? ' combinations of pharmacotherapy and nonpharmacologic interventions such as psychotherapy are used in a broad range of psychiatric disorders. in some situations, mental health is purportedly based on the ' functioning of a high - order nervous system in constant and complex relation with the personal and social environment '. several of the points raised by the authors (such as the benefit of company) offer simple venues for nonpharmacologic intervention. the rise in odd ratios for delirium in physically restrained patients yet make sense when one considers how fearful delirious patients are. other reports have recently corroborated that nonpharmacologic interventions may impact on delirium ; early physiotherapy and ambulation appears to be associated with a decrease in delirium days in a recently conducted randomized, controlled study. all recommended or clinically used antipsychotic drugs have been validated for the treatment of schizophrenia in young populations over short periods of time. the potential for harm with these drugs is all the more worrisome given that their effectiveness and side effect profiles in older or critically ill populations are largely unknown. there is an urgent need for carefully conducted studies differentiating cognitively intact patients from those with subsyndromal delirium or frank delirium, which will integrate stratification based on risk factors such as those described by the authors. only then can we move forward with the disorder, which arguably causes patients, their families and their caregivers the most distress during critical illness. | icu delirium is associated with poor patient outcome. risk factor stratification is essential to the understanding, prevention and treatment of this disorder. alcohol consumption, smoking and prior cognitive impairment appear strongly correlated with delirium risk. several potentially modifiable associations deserve prospective study : these include administration of sedatives and opiates ; multiple catheters ; as well as minimizing physical restraints and enabling visitors. |
a common feature of aged organisms is functional alteration and gradual loss of muscle mass and force. a deficit of muscle innervation due to motor - neuron loss is believed to have a major contribution to age - dependent muscle wasting, also called sarcopenia. this age - acquired deficit in muscles contributes profoundly to reduced quality of life in elderly people and predisposes them to an increased risk of morbidity, disability, and mortality (visser and schaap, 2011). the etiology of sarcopenia is multifaceted and involves several intrinsic and extrinsic factors. despite the clinical, social, and economic relevance of sarcopenia, the precise mechanisms for the age - related loss of muscle mass and function are not yet fully understood. age - related changes in muscle are complex, with key features including myofiber atrophy, profound weakness that is partially independent of muscle mass loss, myofiber degeneration, accumulation of dysfunctional mitochondria, and increased oxidative stress. until recently, it was thought that age - associated atrophy and weakness were secondary to motor - neuron loss in the brain or in the spinal cord. in fact, little neuronal death occurs in most areas of the aging nervous system, and there is no decline of lower motor neurons during aging (chai., 2011 ; morrison and hof, 1997). conversely, it is emerging that neuromuscular junctions (nmjs) and their interactions with myofibers are greatly altered during aging, resulting in a loss of muscle innervation (chai. oxidative stress and decreased release of trophic factors are independent influences on nmj integrity and contribute to denervation (jang. however, to date, it is not known whether myofiber denervation is due to deleterious changes in muscle cells themselves, in neurons, or both. two lifestyle adaptations, caloric restriction and exercise (jang., 2012 ; valdez., 2010), have been consistently demonstrated to extend lifespan and, in parallel, to mitigate age - related alterations of nmj. macroautophagy, hereafter named autophagy, is activated by both of these conditions in skeletal muscles and other tissues (grumati., 2010, 2011a, 2011b ; he., 2012 ; rubinsztein. autophagy is a highly conserved homeostatic mechanism used for the degradation and recycling of bulk cytoplasm, long - lived proteins, and organelles through the lysosomal machinery (mizushima and komatsu, 2011). the autophagy machinery generates double membrane vesicles (autophagosomes) that engulf and sequester target cellular components (mizushima and komatsu, 2011). therefore, autophagy can be defined as a process of cytosolic renovation. in mammals, deficient expression of atg1, atg7, atg8, becn1 (beclin1), and sestrin1 (which is also required for basic autophagy) shortens the lifespan of the fruit fly d. melanogaster and of the nematode c. elegans (lee., 2010b ; rubinsztein., 2011 ; simonsen., 2008). on the other hand, increased autophagy contributes to longevity, and mutation of essential atg genes prevents the gain of longevity (melndez., 2003). a recent report shows that aging can be controlled by a single tissue ; overexpression of foxo transcription factor or its target eif4ebp1 in fly skeletal muscle abolishes the age - associated decline in autophagy and increases longevity (demontis and perrimon, 2010)., 2007, 2008 ; zhao., 2007), and genetic variations in the human foxo3a the role of autophagy in sarcopenia in mammals is still controversial. both impaired and excessive autophagy have been associated with aging sarcopenia (wenz., 2009 ; wohlgemuth., however, loss - of - function experiments that support the involvement of autophagy in aging sarcopenia are still lacking. here, we show that specific inhibition of autophagy in skeletal muscle leads to abnormalities in motor neuron synapses that ultimately lead to denervation whereas accumulation of dysfunctional mitochondria triggers oxidation of contractile elements, causing a decrease in force generation. age - related muscle loss is believed to result from a general decline of protein synthesis or an enhancement of protein breakdown. to study autophagy in aging, we monitored the expression of autophagy markers, such as lc3 (map1lc3a) and the critical e1-like enzyme, atg7, in mice and humans. aged mice showed a decline of atg7 protein and, concurrently, of lc3 lipidation when compared to young animals (figure 1a). an important decrease of atg7 protein and lc3ii was found in muscle biopsies of elderly sedentary (sarcopenic) subjects (figure 1b). because exercise activates autophagy and counteracts most age - related characteristics, including the decline of muscle mass (zampieri., 2014), we tested whether long - life regular exercise in humans was able to prevent the reduction of these autophagy markers. atg7 protein and lc3ii were maintained in muscle biopsies of senior sportsmen that had been previously shown to have better muscle mass and strength than elderly sedentary subjects (zampieri. to mimic the decrease of atg7 in aging, we characterized muscle - specific autophagy - deficient (atg7) mice that we have generated (masiero., 2009). the absence of autophagy caused a significant reduction of animal survival (figure 2a). morphological analyses of aged mice showed higher levels of atrophy, center - nucleated fibers, and inflammation in atg7 muscles compared to age - matched controls (figures 2b and s1a). some fibers atrophied to a level that made them hardly detectable (figure 2c). these small fibers did not express the typical markers of regeneration and, therefore, are adult atrophic myofibers (data not shown). quantification of the cross - sectional area (csa) of atg7 revealed that, although muscle atrophy was present in both oxidative and glycolytic fibers, it was more pronounced in the latter (figures 2d and 2e). the deterioration of atg7 muscles was also confirmed by the increase of center - nucleated fibers (figure 2h). correspondingly, atg7 muscles were weaker than controls both in adult and elderly mice (figures 2f and 2 g). given that the features of atrophic fibers resemble denervated fibers, and a decline in innervation and loss of motor units are known to be important endogenous causes of sarcopenia, we tested whether denervation plays a role in the phenotype of atg7 mice. we first examined the expression pattern of the neural cell adhesion molecule (ncam), a molecule that is enriched in the postsynaptic membrane of the nmj but largely absent in adult myofibers. however, ncam is re - expressed along the entire muscle fiber after the loss of innervation. immunohistochemistry revealed that, during aging, there is a progressive increase of ncam - positive fibers in controls. importantly, atg7 muscles showed 5- to 7-fold more ncam - positive fibers when compared to age - matched controls both in adult and elderly mice (figures 2i2k and s1b). the expression of two other markers of denervation, musk (musk) and the acetylcholine receptor (achr) -subunit (chrng) were significantly more upregulated in atg7 muscles (figure 2l). to confirm these findings, we used a recently described in vivo imaging approach where two distinct achr pools are differently color labeled (rder., 2008, 2010) to monitor nmj morphology and stability. automated image analysis revealed that, in contrast to control muscles, nmjs of adult atg7 knockout mice showed fragmented morphology (figures 3a and 3b) and instability (figures 3a and 3b). whereas in controls, the changes in morphology and instability progressively increased with age, this was not the case in atg7 knockout mice (figure 3b). nmjs of both adult and aged atg7-deficient animals showed significantly more fragmentation and achr turnover than 26-month - old (aged) control animals (figure 3b, right panel). exocytic and endocytic processes mediate delivery of newly formed achr and retrieval of old achr, respectively. inhibition of autophagy led to accumulation of vesicles close to the endplates that contain bungarotoxin (bgt) (figures 3c and 3d), further corroborating an impairment of achr turnover and of endosome trafficking. to determine whether alteration in endosome trafficking might also affect musk, a kinase that affects a plethora of signaling pathways that are important for nmj stability, we monitored musk localization. immunohistochemistry revealed that most musk colocalized with achr at the plasma membrane in control fibers (figure 3e). importantly, atg7 caused a significant loss of musk on the plasma membrane and a concomitant enrichment of internalized musk (figure 3e). these findings confirm an alteration of achr and musk recycling and localization in atg7 mice. to determine whether the changes of nmj are secondary to p62 (p62/sqstm) accumulation into aggregates that clear signaling factors such as nrf2 or secondary to inhibition of the conjugation system, we knocked down p62 in atg7. for in vivo transfection experiments, we used bicistronic vectors that simultaneously encode small hairpin rnas (shrnas) and gfp. in this way, detection of gfp fluorescence allowed us to monitor the efficiency of transfection and the changes that occurred to p62-positive aggregates. after 14 days of transfection, atg7 tibialis anterior (ta) muscle was cleared by p62-positive inclusions (figure s2a). however, despite the absence of p62-positive aggregates, the percentage of denervated ncam - positive fibers was not improved (figure s2b). to understand the role of autophagy in age - related nmj alterations, we used the inducible muscle - specific atg7 knockout mice that we have recently generated (masiero., 2009). the atg7 gene was acutely deleted in 22-month - old mice, and mice were sacrificed 3 months later. western blots for p62 and lc3 revealed that autophagy was successfully blocked in aged mice (figure 4a). the inhibition of autophagy in old mice led to an exacerbation of muscle mass degeneration as revealed by the increase of centronucleated fibers and the decrease of csa (figures 4b and 4c). fiber size distribution analysis revealed that acute atg7 deletion led to an enrichment of small fibers when compared to controls (figure s3), suggesting that denervation occurred in a discrete number of fibers. we then monitored nmj to determine whether autophagy inhibition in old mice was sufficient to destabilize muscle - nerve interaction. atg7 deletion led to a significant increase of denervated ncam - positive fibers (figure 4d). denervation is also supported by the finding that the musk transcript is significantly induced in atg7 (figure 4e). acute inhibition of autophagy in aged mice caused a significant loss of musk on the myofiber plasma membrane and a concomitant enrichment of internalized musk protein (figure 4f). to determine the involvement of autophagy in nmj maintenance during aging, we overexpressed atg7 protein in 26-month - old atg7 mice to restore normal autophagy flux in aged mice. atg7 expression was sufficient to increase lc3-positive vesicles in sarcopenic muscles (figure 5a). when we monitored the effect of atg7 expression on nmj of aged mice, we found a significant improvement in morphology ; nmj was significantly less fragmented than age - matched controls (figures 5b and 5c). correspondingly, restoring autophagy in aged mice led to a decrease of vesicles close to the endplates that contain bgt, further corroborating a reactivation of achr turnover and of endosome trafficking (figure 5d). this was confirmed by the fact that musk localization was improved by the expression of atg7 (figure 5e). rescuing atg7 protein and autophagy led to a reduction of denervated ncam - positive fibers that returned to the values of adult mice (figure 5f). finally, improvement of autophagy flux and nmj morphology resulted in an enhancement in muscle mass (figure 5 g). one potential explanation of age - related loss of muscle mass and innervation is due to accumulation of dysfunctional mitochondria that generate an enhancement of reactive oxygen species (ros) production and oxidative stress. over the past years, several researchers have reported that oxidative stress might be involved in etiology of weakness, nmj degeneration, and sarcopenia (jang., 2010, 2012). in fact, inhibition of autophagy induced an accumulation of mitochondria as revealed by succinate dehydrogenase (sdh) staining (figure 6a). electron microscopy analyses revealed the presence of giant mitochondria containing abnormal cristae (figure 6b). atg7 flexor digitorum brevis (fdb) myofibers showed a significant increase of mitochondria that depolarized when the f1f0-atpase was blocked by oligomycin (grumati. similarly, fdb myofibers isolated from aged atg7 showed a significant increase in depolarized mitochondria, which was corrected by restoring atg7 expression (figure s4a). the alteration of mitochondrial morphology and function is associated with increased oxidative stress as revealed by protein carbonylation (figure 6d). atg7 muscles showed a 2-fold increase of carbonylated proteins when compared to age - matched controls. we performed a proteomic approach on carbonylated proteins and found that mitochondrial and sarcomeric proteins are more oxidized in atg7 than controls (table s1 ; figure s4b). because oxidative stress is believed to affect force generation, its enhancement might contribute to age - dependent weakness. morphological and functional analyses on isolated single - skinned fibers confirmed that atg7 myofibers are more atrophic and generate less force (figures 6e and s4c). when the absolute force was normalized for myofiber size, the resulting specific force was still significantly lower (figure 6f). thus, not only the muscles became smaller, but there was a general impairment in force transmission, which led to profound weakness. the reduction of specific force may be caused by posttranslational modifications of contractile proteins induced by ros. we then purified actin and myosin from atg7 muscles and confirmed that both proteins were more oxidized in atg7 mice (figure 6 g ; table s1). acto - myosin function was investigated using an in vitro motility assay approach (canepari., 2012). actin sliding velocity on both myosin and heavy meromyosin fraction (hmm) of atg7 was slower compared to controls (figure 6h), confirming that an alteration of the functional properties of contractile proteins occurs when autophagy is reduced. to test the role of oxidative stress in sarcopenia, we treated animals with trolox, a potent antioxidant, for 4 weeks. the treatment successfully reduced the amount of total carbonylation on muscle protein extracts (figures 7a and s4b ; table s1). protein carbonylation of trolox - treated atg7 no longer differed from age - matched controls. the proteomic approach confirmed that trolox abolished the oxidation of mitochondrial and sarcomeric proteins (table s1 ; figure s4b). importantly, antioxidant treatment blocked the oligomycin - dependent mitochondrial depolarization of atg7 mice (figure 7b). we then addressed whether atrophy, weakness, and nmj degeneration are affected by blunting oxidative stress. the treatment did not rescue myofiber size (figures 7c and s5) but reduced the drop of specific force in isolated atg7-deficient myofibers (figure 7d). trolox completely prevented carbonylation of purified myosin and actin (figures 7e and s4b) and restored a normal acto - myosin function (figure 7f). looking at nmj, we found that inhibition of ros in adult atg7 mice partially reduced nmj instability whereas it did not give protection from nmj fragmentation (figure 7 g). in conclusion, these findings strongly suggest that ros production directly affects acto - myosin interaction and force generation but shows a limited involvement in the changes occurring at nmj and no effect on atrophy. the present study provides several important insights concerning the role of autophagy in nmj preservation during aging. the most striking conclusion is that autophagy controls two important destabilizing factors that are (1) the removal of dysfunctional mitochondria that produce ros and (2) the endosome recycling of achr that affects musk localization and muscle - nerve interaction. the consequence of aging is the deterioration of tissue function mainly due to accumulation of damaged dna, proteins, and organelles. autophagy is a critical system to maintain the cell clear from dysfunctional organelles and mis- or unfolded proteins that are prone to aggregate and to preserve dna stability (sandri, 2010). due to these actions and that autophagy declines with aging, there is consensus in considering autophagy as an antiaging system. genetic evidence in flies and worms sustain this concept, but these data are still lacking in mammals. in fact, autophagy knockout mice die as newborns due to a general energy failure (kuma., 2004), and most of the tissue - specific knockouts (hara., 2006 ; komatsu., 2006 ; aging is a multisystemic disorder that affects multiple organs, leading to alterations of metabolism and tissue function. the postmitotic tissues such as brain, heart, and skeletal muscle are the most susceptible to age - related disease, and their dysfunction contributes importantly to precocious aging. the important role of muscle in healthy aging has been sustained by recent studies in drosophila. activation of autophagy by overexpression of foxo transcription factor in the muscles of flies increases longevity (demontis and perrimon, 2010). the extension of lifespan is due to reduction of food intake and insulin release from neurosecretory cells, confirming that maintenance of a normal autophagy level in skeletal muscle, but not in adipose tissue, positively affects whole - body metabolism (demontis and perrimon, 2010). however, the role of autophagy in age - related muscle loss in mammals is still unclear, being either beneficial or detrimental (gaugler., 2011 ; wenz., 2009 ; wohlgemuth., our findings support the notion that autophagy is critical to prevent age - related denervation and weakness. indeed, autophagy inhibition is sufficient to trigger a cascade of events that resemble those happening in elderly people. because mitochondria are the main producers of ros, dysfunctional mitochondria are thought to play a key role in muscle function decline. in old age, a significant portion of mitochondria are abnormally enlarged, more rounded in shape, and display vacuolization in the matrix and shorter cristae (peterson. these features are present in autophagy - deficient muscles of adult animals, suggesting that defects in mitochondrial turnover are involved in age - dependent mitochondrial abnormalities. it is established that ros production is increased in aged muscle in both the subsarcolemmal and intermyofibrillar pools of mitochondria (chabi., 2008). this increase in ros has been reported to induce oxidation of complex v, leading to decreased atp production (peterson., 2012). accordingly, adult atg7 muscles showed a significant increase of carbonylated atp synthase (table s1). consistent with the ros - mediated inhibition of atp synthase, the energy - stress sensor of the cell, ampk, is activated in atg7-null muscles (not shown ; masiero., 2009). this finding is consistent with a recent report that showed improvement of age - related deficit, including mitochondrial function, by expressing a mitochondrial - targeted human catalase (lee., 2010a).. in muscle, oxidation of contractile proteins has been described, but the functional meaning of this condition is unclear. we showed by proteomic analyses that contractile proteins are carbonylated and that trolox treatment reverts both protein oxidation and the myosin capacity of moving actin filaments, ultimately improving muscle force. it is well established that changes in muscle mass and strength tend to be dissociated in elderly persons, the decline of muscle strength being three times faster than the decrease of muscle mass (peterson., 2012). this suggests that alteration in the quality of contractile proteins plays a critical role during age - related decrease of muscle force. accordingly, atg7 myofibers show a significant decrease of force compared to age - matched controls, and this decline is corrected by trolox. however, whereas the antioxidant improves acto - myosin function, it does not protect from muscle atrophy, although we can not exclude that extending trolox treatment for longer periods may successfully inhibit the signaling pathways controlling muscle atrophy. previous studies reported that mitochondrial ros production may contribute to nmj instability (dobrowolny., 2008 ; overexpression of uncoupling protein (ucp1), specifically in skeletal muscle, is sufficient to dismantle nmj and to induce distal motor neuron degeneration (dupuis., 2009). in fact, whereas trolox treatment slightly reduced the turnover of old and new achr, it did not prevent nmj fragmentation. in conclusion, our data strongly support the concept that autophagy in a postmitotic tissue is required for the correct interplay between muscle and nerve and for the quality control of mitochondria. our findings also sustain the concept that the beneficial effects of caloric restriction and exercise on aging are a consequence of autophagy reactivation. animals were handled by specialized personnel under the control of inspectors of the veterinary service of the local sanitary service (asl 16padova), the local officers of the ministry of health. all procedures are specified in the projects approved by the italian ministero della salute, ufficio vi (authorization numbers c65). subjects were male volunteers who received detailed information about the study and gave informed consent. approval from the ethics committees of the city of vienna and the comenius university in bratislava for medical ethics was obtained at the outset of the study. muscle - specific atg7-null (atg7) and tamoxifen - inducible muscle - specific atg7 mice have been previously described (masiero., 2009). tamoxifen - induced cre loxp recombination was activated by oral administration of tamoxifen - containing chow (tam400/cre er harlan). in vivo transfection and sequences and plasmids are described in the supplemental experimental procedures. for in vitro validation of shrna constructs, c2c12 cells were maintained in dulbecco s modified eagle s medium (dmem)/10% fetal bovine serum and transfected with shrna constructs using lipofectamine 2000 (life technologies). muscle force was measured in living animals as previously described (blaauw., 2008). the method used for single - muscle - fiber dissection, the solutions, and the experimental setup have been previously described (bottinelli., single - fiber analysis was performed as previously described (bottinelli., 1996). absolute (po) and specific forces (po / csa) of the fibers were determined. at the end of the mechanical experiment, fibers were put in 20 l of laemmli buffer and stored at 20c for subsequent electrophoretic analysis of myosin heavy chain (mhc) isoform content. myosin isoform 2b was extracted from bulk gastrocnemius muscles of mice according to a procedure previously described in detail (canepari., 2000) and used to prepare the hmm. hmm was obtained by a proteolytic digestion with -chimotrypsin of myosin according to a modification of the method of margossian and lowey (1982) previously described in detail (canepari., 2000). g - actin was extracted as described by pardee and spudich (1982) from acetone powder prepared from the residues of mice muscles after myosin extraction. after polymerization, f - actin was labeled by incubation for several hours with rhodamine - phalloidine (molecular probes r415) as described by kron. myosin (or hmm) was diluted to 0.1 mg / ml in a high (or low) ionic strength buffer and infused in a flow cell treated with nitrocellulose and prepared according to anson. the in vitro motility assay (ivma) analysis was performed according to canepari. the composition of the experimental buffer was 3-(n - morpholino)propanesulfonic acid 25 mm (ph = 7.4 at 25c), kcl 25 mm, mgcl2 4 mm, egta 1 mm, dithiothreitol (dtt) 1 mm, glucose oxidase 200 g / ml, catalase 36 g / ml, glucose 5 mg / ml, and atp 2 mm. the velocities of at least 50 filaments were measured and their distribution characterized according to parametric statistics. complementary dna generated with life technologies superscript iii reverse transcriptase was analyzed by quantitative real - time pcr using power sybr green applied biosystem. cryosections of frozen gastrocnemius muscles were lysed in a buffer containing 50 mm tris (ph 7.5), 150 mm nacl, 10 mm mgcl2, 0.5 mm dtt, 1 mm edta, 10% glycerol, 2% sds, 1% triton x-100, roche complete protease inhibitor cocktail, and sigma protease inhibitor cocktail. the samples were immunoblotted as previously described (sandri., 2004) and visualized with supersignal west pico chemiluminescent substrate (pierce). carbonylation of muscle proteins was detected by using the oxyblot protein oxidation detection kit from millipore (masiero., mice were intraperitoneally injected with trolox (6-hydroxy-2,5,7,8-tetramethylchroman-2-carboxylic acid) 30 mg / kg daily for 4 weeks. for a detailed description of the detection of oxidized proteins, see the supplemental experimental procedures. spot detection and quantification was carried out using the image master 2d platinum 7 software (ge healthcare). for a detailed description of the procedure, see the supplemental experimental procedures. for a detailed description of the procedure, see the supplemental experimental procedures. immunofluorescence staining was performed on cryostatic sections as previously described (masiero., 2009) and then monitored with a fluorescence microscope or confocal microscopy. fiber cross - sectional area was performed on ta or gastrocnemius (gcn) as described (mammucari., 2007) and measured using imagej software. for electron microscopy, we used conventional fixation - embedding procedures based on glutaraldehyde - osmium fixation and epon embedding. c2c12 myogenic cell lines were cultured in dmem (gibco - life technologies) supplemented with 10% fetal bovine serum. myoblasts were transfected using lipofectamine 2000 (life technologies) according to the manufacturer s instructions. mitochondrial membrane potential was measured by epifluorescence microscopy based on the accumulation of tetramethylrhodamine, methyl ester (tmrm) fluorescence as previously described (romanello., 2010). the mhc isoform composition of gastrocnemius muscles of mice was assessed by 8% sds polyacrylammide gel electrophoresis as described by pellegrino. (2003). in vivo microscopy of mice was performed under anesthesia using zoletil and xylazine on a leica sp2 confocal microscope equipped with a 63 1.2 numerical aperture water immersion objective, essentially as described previously (rder. automated analysis of achr turnover and nmj fragmentation used algorithms described earlier (rder. the sample size was calculated using size power analysis methods for a priori determination, based on the sd and effect size previously obtained using the experimental methods employed in the study. for animal studies, we estimated sample size from the expected number of knockout mice and littermate controls, which was based on mendelian ratios. considering a likely drop - off effect of 10%, we set the sample size of each group at five mice. to reduce the sd, we minimized physiological variation by using homogenous animals with the same sex and age. the exclusion criteria for animals were pre - established. in case of death, cannibalism, or sickness, the animal was excluded from analysis. tissue samples were excluded in cases such as cryo - artifacts, histological artifacts, or failed rna extraction. we included animals from different breeding cages by random allocation to the different experimental groups. animal experiments were not blinded ; however, when applicable, the experimenters were blinded to the nature of samples by using number codes until final data analysis was performed. statistical tests were used as described in the figure legends and were applied upon verification of the test assumptions (e.g., normality). | summarythe cellular basis of age - related tissue deterioration remains largely obscure. the ability to activate compensatory mechanisms in response to environmental stress is an important factor for survival and maintenance of cellular functions. autophagy is activated both under short and prolonged stress and is required to clear the cell of dysfunctional organelles and altered proteins. we report that specific autophagy inhibition in muscle has a major impact on neuromuscular synaptic function and, consequently, on muscle strength, ultimately affecting the lifespan of animals. inhibition of autophagy also exacerbates aging phenotypes in muscle, such as mitochondrial dysfunction, oxidative stress, and profound weakness. mitochondrial dysfunction and oxidative stress directly affect acto - myosin interaction and force generation but show a limited effect on stability of neuromuscular synapses. these results demonstrate that age - related deterioration of synaptic structure and function is exacerbated by defective autophagy. |
acute heart failure is a condition that is characterised by impaired myocardial function, whereby the heart can not supply sufficient o2 to the body tissues. the common causes of heart failure include hypertension, coronary artery disease (including previous myocardial infarction), atrial fibrillation, valvular heart disease, and cardiomyopathy [1, 2 ]. heart failure can also be triggered by surgical procedures, generally in the more elderly patients with limited cardiopulmonary reserve. all surgical procedures can lead to systemic inflammatory reactions, with the resultant increase in heart rate. stress and inadequate postoperative analgesia can prompt elevated systemic blood pressure, tachycardia and increased afterload, thereby raising myocardial o2 requirements. the strategies commonly used focus not only on improvement of the symptoms, but also on prevention of the transition from asymptomatic to symptomatic heart failure, as well as on mortality reduction through slowing disease progression. however, once haemodynamic support is required, there is a relative scarcity of effective therapies. -adrenergic - receptor - stimulating drugs including dobutamine, dopamine and adrenaline are used in this setting. all of these act via the adrenergic receptors on the myocyte cell membranes, to intensify the production of the second messenger adenosine 3,5-cyclic monophosphate, which leads to increases in ca influx and increased contraction force. in addition, these drugs tend to cause arrhythmia, which can further impair cardiac function. more recently, the phosphodiesterase inhibitors drugs were developed, which reduce the degradation of adenosine 3,5-cyclic monophosphate, thereby leading to increased influx of ca. the inodilator levosimendan is a ca sensitiser that has been approved for short - term treatment of acutely decompensated severe chronic heart failure when conventional therapy is not suffcient, and in cases where inotropic support is considered appropriate. levosimendan has a number of pharmacological effects, which include increased cardiac contractility mediated by ca sensitisation of troponin c, vasodilation based on the opening of k channels in the vasculature, and cardioprotection due to the opening of mitochondrial k channels in the cardiomyocytes. clinical data obtained in patients with heart failure has confirmed that these pharmacological effects translate into improved haemodynamics. contrary to other inotropes, o2 consumption is not increased to a significant extent during treatment with levosimendan [20, 21 ]. symptoms of acute heart failure have been shown to be diminished by levosimendan treatment [17, 18, 22, 23 ]. levosimendan pre - treatment can decrease infarct size in an ischaemia - reperfusion model and improve recovery of cardiac function following global ischaemia. this beneficial effect is not believed to be mediated through inhibition of ventricular hypertrophy, dilation or alterations in late - phase healing of the infarct, but primarily through ca sensitisation of contractile proteins. levosimendan has an active metabolite, known as or-1896, which ensures sustained efficacy for at least 7 days [24, 27 ]. in contrast to dobutamine, the effects of levosimendan are not attenuated by concomitant administration of -blockers. levosimendan also offers a predictable safety profile [17,18,19, 23 ], and no impairment of diastolic function has been demonstrated with levosimendan [29, 30 ]. also, there is no development of tolerance to levosimendan. the most common adverse events of levosimendan treatment include hypotension, headache, atrial fibrillation, hypokalaemia and tachycardia [22, 23, 31 ]. in recent years, the use of levosimendan has broadened to treatment of heart failure in different settings. these include advanced chronic heart failure, and other scenarios where haemodynamic stability is sought, such as pre - operative treatment of patients at risk of low cardiac output syndrome or peri - operative heart failure. the aims of this presentation of four case reports were to compare the use of levosimendan in different settings, and to highlight differences and similarities in the effects obtained, with the purpose of defining common guidance on the use of levosimendan. we retrospectively reviewed the records of patients with heart failure in the registries of our wards, and identified four cases where the patients had received levosimendan in four different settings. we describe here the clinical management of these four cases. according to the local laws and regulations, due to the retrospective nature of data collection case 1. in 2002, a 71-year - old, non - smoker male with a history of lymphoma, hypertension and long - standing diabetes was diagnosed with enlargement of the left ventricle and pronounced impairment of systolic function, with mitral insufficiency and pulmonary hypertension. over the course of the next 18 months, the patient was repeatedly hospitalised due to congestive heart failure, and his medication was adjusted several times. apart from treatments with angiotensin - converting enzyme inhibitors and diuretics, he also received an aldosterone antagonist, an angiotensin receptor blocker, and a -blocker. in april 2003, he had new york heart association (nyha) class iiib heart failure, coronary angiography showed no significant arterial stenosis and the findings suggested biventricular failure. based on the electrocardiogram, the patient did not meet the criteria for cardiac resynchronisation therapy (failure) pacemaker implantation. in the spring of 2004, medical treatment of this patient had effectively reached a dead end, and no further clinical improvement was seen. the decision was then taken to initiate treatment with levosimendan. in late april 2004, the first dose of levosimendan was applied, followed by further levosimendan doses every 4 weeks. since the start of this treatment, the patient has not needed any further emergency admissions. in july 2004, another echocardiograph that was performed in october 2004 showing only mildly impaired lv function with just minor mi and insignificant ti. patient s condition was markedly improved with no symptoms, absence of oedema and improved quality of life. simdax treatment was discontinued. at recheck to the cardiology clinic in march 2005, the patient remained asymptomatic and his quality of life had further improved with increased physical activity, such as dancing and 3-km long daily walks. anticoagulants were replaced with asa and the dosage of diuretics was reduced since there was no longer any fluid retention. at a follow up in september 2005 (three year after the first hospitalization) the patient was still asymptomatic. a 73-year - old male had myocardial infarction in 1994, which was followed by bypass surgery. he was suffering from paroxysmal atrial fibrillation and chronic heart failure. in spring 2005, the patient was hospitalised because of heart failure (nyha class iiib). in august 2005, echocardiography showed impaired left - ventricular systolic function with a left - ventricular ejection fraction (lvef) of 10% to 15%. he also showed mild mitral and moderate tricuspid insufficiency, with a maximum velocity of tricuspid regurgitation flow of 4.2 m / s. the patient was admitted to the internal medicine ward, and treatment with intravenous diuretics initiated. he experienced less dyspnoea, but was still dizzy, with blood pressure of 80/60 mmhg. after transfer to the cardiology - internal medicine ward, levosimendan treatment was started at a loading dose of 12 g / kg over 10 min, followed by continuous infusion with 0.2 g / kg / min for 24 h. the condition of the patient had already dramatically improved on the day after the levosimendan infusion. his blood pressure rose to 95/65 mmhg, his diuresis recovered, and the following day he was able to walk on the ward without dyspnoea. laboratory results showed improved renal function with decreasing creatinine values, and normalised liver function tests. coronary angiography revealed proximal occlusion of the left anterior descending artery, and proximal stenosis of the circumflex artery. he was completely symptom - free during surgery, and experienced no problems when lying flat on the operating table. he showed improved left - ventricular function, with lvef of 20% to 25%. at the latest regular telephone follow up in 2008 (three year after the previous hospitalization) he had had a myocardial infarction approximately 7 years previously, had undergone coronary artery bypass surgery the same year, but had had no cardiac issues since that time. he showed an inflammatory response with vasodilation during the procedure, and required infusion of substantial amounts of both crystalloid and colloid fluids. support with phenylephrine was needed to maintain his mean arterial pressure (map) > 65 mmhg. surgery revealed a perforated diverticulum of the small intestine and an abscess that required small bowel resection. successful cardioversion was performed after 6 h of fibrillation. on the morning of the first postoperative day, the patient showed normal sinus rhythm and heart rate, with map > 65 mmhg. however, he reported shortness of breath, and his o2 saturation was 90% on 8 l / min supplemental o2, using a mask. laboratory results showed mild elevation of troponin t, but there were no electrocardiogram changes. this was interpreted as heart failure, which had perhaps been triggered by a small myocardial infarction. treatment with levosimendan was initiated with a loading dose for 10 min, which was followed by continuous infusion with 0.1 g / kg / min. a couple of hours after the start of levosimendan treatment, the patient began to produce increasing amounts of urine. during the night, his o2 supplementation was reduced. serial analysis of his troponin levels suggested a small myocardial infarction. repeated blood - gas evaluation showed a gradual increase in central venous o2 saturation (scvo2), to 68%. after 24 h, the patient was discharged from the intensive care unit, and 10 days later he left for rehabilitation at another hospital. at one month after the operation the patient was asymptomatic. case 4. a 94-year - old male with known heart failure (lvef, 15%-20% ; mild elevation of pulmonary artery pressure with moderate tricuspid insufficiency ; atrial fibrillation with normal heart rate) presented at the emergency room with a two - day history of abdominal pain. following various radiographic investigations, he was referred for an emergency laparotomy with suspected intestinal perforation. given his advanced age and cardiac status it was believed that the perioperative inflammatory response, the negative inotropic effects of anaesthesia, and the positive - pressure ventilation might tip the balance and trigger manifest heart failure. his cardiac index was 1.7 l / min / m, and scvo2 was 59%. after treatment was begun with colloid administration, his cardiac index increased a little, to approximately 2 l / min / m, and his scvo2 to just over 60%. to further optimise treatment, the patient was started on levosimendan infusion (loading dose 12 g / kg, followed by continuous infusion at 0.1 g / kg / min). after 4 h of levosimendan treatment, the heart function of the patient improved, with a cardiac index of 3 l / min / m, and scvo2 of almost 70%. small bowel resection was performed because of a perforated diverticulum. during the entire procedure, he was completely stable throughout the peri - operative course, and was extubated immediately after surgery. then the patient was transferred to the postoperative ward for 24 h. five days later, the patient was discharged from hospital. at one month after the operation the patient was asymptomatic. in this case series, we have presented four patients who required haemodynamic support in various settings of a failing heart. three patients (cases 1 - 3) experienced acute cardiac decompensation, while one patient (case 4) appeared stable at low lvef, but needed to undergo abdominal surgery, which raised concerns as to probable cardiac failure during the course of the intervention. the first patient developed persistent symptomatic heart failure on the basic of chronic ventricular dysfunction, with frequent emergency admissions to hospital. customary heart - failure medication only temporarily relieved these symptoms. when it was felt that no further progress could be made, levosimendan treatment was administered over a total of four sessions, which produced a pronounced and rapid improvement at both the subjective and objective levels. the second patient showed signs of severe biventricular failure after chronic heart failure had been present for many years. he experienced hypotension, with signs of renal hypo - perfusion. in this patient with ischaemic heart disease and susceptibility to ventricular arrhythmia, levosimendan was the obvious choice. biventricular pacing and levosimendan proved to be a well - chosen combination. for the third patient rhythm regularisation and diuretic therapy were not sufficiently effective, but the condition of the patient improved with levosimendan treatment. dobutamine can be considered as an alternative inotropic in this setting, although it can increase myocardial o2 consumption and the risk of arrhythmia. as both a small myocardial infarction and atrial fibrillation were present in this patient the last case report describes the perioperative management of a 94-year - old man with known impairment of left - ventricular function. levosimendan was deemed more appropriate than treatment with an adrenergic agonist, all the more so because the patient had chronic atrial fibrillation. the administration of levosimendan produced rapid improvements to cardiac function, thus enabling the surgery to go ahead. a large amount of data from many clinical trials has been published describing the effects of levosimendan in different clinical settings. our narrative should be considered as anecdotic as any set of case reports, but our aim was to collect cases in which the same inodilator was used in different settings. the description of the hemodynamic and symptomatic effects of the drug in parallel in such different patients may offer a new view point. one clear limitation is that the patients undergoing surgery were followed up only for one month after operation. in our own clinical experience, the use of a loading dose could be harmful if : the baseline pressure is too low;the diuretic dose is too high;the patient is hypokalemic. the baseline pressure is too low ; the diuretic dose is too high ; the patient is hypokalemic. in this case another point to be discussed is the cost of the drug : since at the moment no large mrct are published to support the beneficial effect of levosimendan over comparator on long term outcome, it appears difficult to justify a premium price over cheap generic such as dobutamine. some pharmaco - economic studies, however, were published which justify the use of this drug in the settings which we described in our manuscript. we have presented a case series that shows that the administration of the ca sensitiser levosimendan can greatly improve heart failure in different settings. the ca - sensitising effects of levosimendan are demonstrated here to remarkably improve cardiac output. levosimendan, however, also has a pronounced vasodilatory effect, which contributes to lowering the pre - load and after - load. on the bases of our own experience, due to its vasodilatory effect, levosimendan should be given cautiously to patients with low blood pressure, especially in the case of hypovolaemia. the use of lower infusion rates without the loading bolus should be considered for such patients. finally, we present here three recommendations for dosing of levosimendan treatment based on our own experiences on the ward : use a loading dose (6 - 12 g / kg over 10 min) only if an immediate effect is needed and if systolic blood pressure is 100 mmhg;use a maintenance infusion rate of < 0.2 g / kg / min, with individualised dosing regimen;avoid hypovolaemia before and during the treatment (fluid as needed ; intravenous diuretics with caution). guidance on the repetitive use of levosimendan in chronic advanced heart failure, and on the perioperative use of levosimendan was provided recently by nieminen. and toller. use a loading dose (6 - 12 g / kg over 10 min) only if an immediate effect is needed and if systolic blood pressure is 100 mmhg ; use a maintenance infusion rate of < 0.2 g / kg / min, with individualised dosing regimen ; avoid hypovolaemia before and during the treatment (fluid as needed ; intravenous diuretics with caution). guidance on the repetitive use of levosimendan in chronic advanced heart failure, and on the perioperative use of levosimendan was provided recently by nieminen. and toller. | introductionthe inodilator levosimendan was developed as a treatment for acutely decompensated severe chronic heart failure. in recent years, its use has broadened to treatment of heart failure in different settings. these include advanced chronic heart failure, and other scenarios where haemodynamic stability is sought, such as pre - operative treatment of patients at risk of low cardiac output syndrome or peri - operative heart failure. the aims of this presentation of four case reports were to compare the use of levosimendan in different settings, and to highlight differences and similarities in the effects obtained, with the purpose of defining common guidance on the use of levosimendan.methodswe retrospectively reviewed the records of patients with heart failure in the registries of our wards, identified and described four cases where levosimendan was received in four different settings. we provide here a systematic report on these four cases.resultsone patient suffered from acutely worsened chronic heart failure, one from advanced chronic heart failure, with repetitive treatment needed, one experienced acute ventricular failure as a result of a perioperative myocardial infarction, and one with left - ventricular function impairment and planned surgery.conclusionsheart failure arising from different aetiologies and occurring in different settings is amenable to successful treatment with levosimendan. |
-n - methylamino - l - alanine (bmaa) is a nonprotein amino acid. its molecular formula is c4h10n2o2 (figure 1), its cas number is 15920 - 93 - 1, and it has a molar mass of 118.13 g / mol. exposure to l - bmaa may cause neuronal death in the brains of humans and animals, and exposure may play a role in the pathogenesis of parkinson 's and alzheimer 's diseases and amyotrophic lateral sclerosis or lou gehrig 's disease. various doses of l - bmaa have been administered intraperitoneally (ip) to mice, rats, and chickens [13 ], orally to monkeys and mice [46 ], and intracerebroventricularly to mice and rats [711 ]. several studies demonstrated that a single dose of l - bmaa causes hyperexcitability, inability to extend the legs, a dragging gait, myoclonus, and convulsions [1, 2, 7 ]. additional studies demonstrated similar findings, and this is likely because l - bmaa crosses the blood - brain barrier and causes irreversible damage [3, 8, 12, 13 ]. in rats, l - bmaa adversely affects monoamine neurons in the substantia nigra, and it decreases noradrenaline levels in the hypothalamus. clinical symptoms caused by l - bmaa neurotoxicity may be due to changes in cholinergic and glutamatergic neurotransmission, primarily due to a decrease in the number of glutamatergic receptors [911 ]. glutamate acts on the ligand - gated receptor channels n - methyl - d - aspartic acid (nmda), 2-amino-3-(5-methyl-3-oxo-1,2-oxazol-4-yl) propionic acid (ampa), and kainate receptors at the postsynaptic membrane. this is an important mechanism in memory function and for the sensing of environmental cues [1418 ]. because l - bmaa has glutamate receptor agonist activity in mammals and plants [19, 20 ], couratier. suggested that neuronal degeneration in als is initiated at the level of glutamate ampa / kainate receptors. the initiation of neurotoxicity may be due to direct action on nmda receptors and activation of metabotropic glutamate receptors 5 (mglur5) and/or by inducing oxidative stress [2226 ]. additional studies demonstrated that l - bmaa inhibits the cysteine / glutamate antiporter (system xc-) that mediates cysteine uptake and increases oxidative stress, and/or it may activate ampa / kainate receptors which causes selective death of motor neurons. l - bmaa concentrations as low as 30 m cause motor neuron death, a concentration of 10 m enhances neuronal death [25, 26 ], and a concentration of 3 mm causes death of entire cortical neuron populations. l - bmaa is actively transferred across the blood - brain barrier where it also increases output of dopamine by affected neurons. fruit bats, a known source of l - bmaa, are used to make a traditional soup by the chamorro people in guam [30, 31 ]. cox and sacks calculated that a human weighing 70 kg body weight (bw) and eating two fruit bats of 500 g each will ingest approximately 28 mg l - bmaa / kg bw., however, did not observe any behavioral, neurochemical, or neuropathological changes in mice orally dosed with 0.5 mg of l - bmaa / g bw / day for 11 weeks, and lesions were not seen histopathologically in the brain. cruz - aguado. also did not observe neuronal damage after orally dosing mice with 1 mg lbmaa (28 mg / kg daily) for 30 days. were the first to demonstrate that administering 100315 mg l - bmaa / kg daily for up to 12 weeks to monkeys caused clinical symptoms very similar to amyotrophic lateral sclerosis / parkinson dementia complex (als / pdc), and, in another study, they suggested a significant role for l - bmaa in the etiology of als - pdc.. reported sex - dependent changes in motor function and spinal cord neurochemistry, and they concluded that these changes were not related to als / pdc. more recently, l - bmaa has been detected in many fish species and aquatic plants, as well as open water samples from reservoirs in nebraska, usa, which suggests that a direct human exposure to l - bmaa may occur through the food chain [33, 34 ]. although earlier studies have investigated the acute neurotoxic effects of l - bmaa in several animal species, buenz and howe demonstrated that direct administration of bmaa to the mouse 's brain causes sporadic death of hippocampal neurons, and they demonstrated this histopathologically using tunel staining after subcutaneous injection of 600 mg / kg of l - bmaa in rat pups. the objectives of the present study were to determine the presumptive ld50 and loael for l - bmaa in mice. five doses of l - bmaa (supplied by the institute for ethnomedicine, jackson hole, wy, usa) were prepared in sterile water and adjusted to ph 6.5 with naoh prior to ip injection. each dose was dissolved in 0.5 ml of sterile h2o and calculated as follows depending on each mouse weight : dose (mg / g bw) mouse weight (1520 g) = y mg / mouse (l - bmaa / mouse), for example, group e dose (3 mg / g bw) 18 g = 54 mg/0.5 ml. dose (mg / g bw) mouse weight (1520 g) = y mg / mouse (l - bmaa / mouse), for example, group e dose (3 mg / g bw) 18 g = 54 mg/0.5 ml. thirty - five male and 35 female nih swiss outbred mice (harlan laboratories, indianapolis, in, usa) weighing 1520 g each were used. males and females were housed separately, and they were fed a standard mouse diet and water ad libitum. the mice were allowed to acclimate for 3 days prior to ip injection, and they were housed and treated according to university of nebraska - lincoln institutional animal care and use committee guidelines. mice were randomly assigned to six groups, and equal numbers of males and females were included in each group (table 1). each mouse was injected with 0.5 ml of the respective l - bmaa preparation depending on individual body weight and observed 4 times daily for 14 days ; control mice received sterile water only. presumptive ld50 was defined as the l - bmaa dose that caused one - half of the mice receiving that dose to display clinical symptoms requiring humane euthanasia. the loael was defined as the lowest dose of l - bmaa that caused adverse clinical symptoms after ip injection. mice displaying adverse clinical symptoms were humanely euthanized, and all remaining mice were euthanized 14 days after injection. specimens of brain, liver, lung, heart, spleen, and kidney from one male and one female in each group were immediately immersed in 10% phosphate - buffered formalin. after 24 hours of fixation, brains were transversely sectioned at five levels in a cranial to caudal fashion, and then all specimens were routinely processed for histopathology. sections of each specimen were cut at 4 - 5 m and stained with hematoxylin and eosin. brain and liver specimens from all remaining mice were frozen for l - bmaa extraction. frozen liver and brain specimens from 20 mice representing control, a, b, and e group (table 2) were thawed, and 50 mg of the frontal brain lobe and 50 mg of the liver from each mouse were weighed separately in 2 ml glass amber tubes. five hundred l of 6 m hcl was added, and the mixture was sonicated for 30 seconds and then vortexed. after heating for 16 hours at 110c, 100 l of the mixture was transferred to a millipore ultrafilter centrifuge tube (emd millipore corporation, billerica, ma, usa) and centrifuged for 3 min at 1300 rpm. the filtered solution was then evaporated to dryness by using n2 gas and heating at 45c. brain and liver samples from the 20 male and female mice (table 2) were dried using established protocol and analyzed using ultra performance liquid chromatography (uplc), and liquid chromatography / mass spectrometry / mass spectrometry (lc / ms / ms) at the institute for ethnomedicine (iem), jackson hole, wy, usa [38, 39 ]. l - bmaa was detected in mouse tissues using waters acquity pressure uplc - uv and in - line single quadrupole mass spectrometry (uplc - ms) following a validated method. eluents were purchased from waters (eluent a : part # 186003838, eluent b : part # 186003839) ; composition is proprietary. separation was achieved by reverse phase chromatography over 9.5 minutes on a waters accq - tag ultra column (part # 186003837, 2.1 100 mm) at temperature of 55c and flow rate of 0.7 ml / min. the elution gradients were 0.0 min = 0.1% b ; 0.54 min = 0.1% b curve 6 ; 6.24 min = 9.1% b curve 7 ; 7.74 min = 21.2% b curve 6 ; 8.04 min = 59.6% b curve 6 ; 8.73 min= 0.1% b curve 6 ; 9.5 min = 0.1% b curve 6. l - bmaa was identified using mass and retention time in comparison with an authenticated l - bmaa standard [38, 4042 ]. l - bmaa analyses were performed using a triple quadrupole instrument (thermo scientific finnegan tsq quantum ultraam, san jose, ca) and separation was performed by using waters acquity - uplc system with a binary solvent manager, sample manager, and a waters accq - tag ultra column (part # 186003837, 2.1 100 mm) at 55c. separation was completed using 0.65 ml / min in aqueous 0.1% (v / v) formic acid (eluent a) and 0.1% (v / v) formic acid in acetonitrile (eluent b) with the following elution gradient : 0.0 min = 99.1% a ; 0.5 min = 99.1% a curve 6 ; 2 min = 95% a curve 6 ; 3 min = 95% a curve 6 ; 5.5 min = 90% a curve 8 ; 6 min = 15% a curve 6 ; 6.5 min = 15% a curve 6 ; 6.6 min = 99.1% a curve 6 ; 8 min = 99.1% a curve 6. the heated electrospray ionization (h - esi) probe was supplied with nitrogen gas at a nebulizing pressure of 40 psi and a vaporizer temperature of 400c. the mass spectrometer operating conditions were as follows : capillary offset of 35, capillary temperature of 270c, auxiliary gas pressure of 35, spray voltage 3500 v, source collision energy of 0 ev, multiplier voltage of 1719 v, and tube lens offset of 110. the second quadrupole was pressurized to 1.0 m torr with argon. in the first quadrupole filter, ion m / z 459 was isolated as the precursor ion and subjected to collision induced dissociation (cid). the second step mass filtering was completed using selective reaction monitoring (srm) of l - bmaa after cid in the collision cell. the m / z transitions monitored were 459119 ce 21 ev ; 459289 ce 17 ev ; 459171 ce 38 ev. the three product ion resultants originating from derivatized l - bmaa (119, 289, and 171 m / z) were scanned and detected by the third quadrupole and their relative abundances quantified. the ratio of the three product ions was compared to the product ion ratios of an authenticated l - bmaa standard [3841 ]. results were presented as mean standard deviation (sd) using three results ' reading. the statistical analysis was used in our study to show the degree of significance of our data. the presumptive ld50, the dose at which 50% of the mice became moribund and required euthanasia, was 3 mg / g l - bmaa bw. four males and three females in the group given this dose developed myoclonus, convulsions, and uncontrolled urination and defecation within 20 minutes of injection. the lowest administered dose that caused the previously described clinical symptoms was 2 mg / g l - bmaa bw ; one female mouse in the group given this dose required euthanasia 45 minutes after injection. there were no histopathologic lesions in the brain, liver, lung, kidney, heart, or spleen from any of the mice, including one male and one female in the 3 mg l - bmaa / g bw group and the one female in the 2 mg l - bmaa / g bw group that had displayed adverse clinical symptoms. table 3 shows l - bmaa concentrations in brains and livers as detected by uplc - uv, with the concentrations of l - bmaa in male subgroups being higher than that in female subgroups. figure 2 will show uplc - uv chromatographic detection figure of l - bmaa in male mouse brain injected with 3 mg / g bw. figures 3 and 4 will show uplc - uv results comparison of l - bmaa concentrations in (g / g) in brains and liver of male and female mice. to confirm the results of l - bmaa concentrations detected in extracted brain and liver samples from treated and control mice using uplc - uv, lc / ms / ms chromatography was performed on these same samples. figure 5 will show lc / ms / ms chromatographic detection figure of l - bmaa in male mouse brain injected with 3 mg / g bw. comparison of l - bmaa concentrations in male and female brains and livers using lc / ms / ms chromatography is shown in figures 6 and 7, respectively. results of this study indicate that the presumptive ld50 of l - bmaa is 3 mg / g bw and the loael of l - bmaa is 2 mg / g bw in male and female nih swiss outbred mice when administered intraperitoneally. clinical symptoms such as myoclonus, convulsions, and uncontrollable urination and defecation seen in some of the mice are symptoms similar to those reported by other investigators [2, 7, 8 ] regardless of animal species used or routes of l - bmaa administration. other symptoms included a dragging gait, weakness, and convulsions ; hyperexcitability and shaking ; ataxia, rolling, unsteady gait, and myoclonia. studies that did not report any clinical symptoms or neuropathological changes presumably used insufficient doses of bmaa or routes of administration, that is, mainly by mouth [5, 6, 43 ]. tissue sections were cut at 4 - 5 m and stained with hematoxylin and eosin. only the front lope of brain and a part of the liver were used to measure the accumulated bmaa from our original doses. this lack of histopathologic lesions in the brain may not be uncommon. however, pablo. failed to detect lesions in brain samples taken from als and ad deceased patients. also, perry. could not detect any neurochemical and neuropathological changes in bmaa orally exposed mice. in addition, no histopathologic changes were seen in the hippocampus of neonatal rats injected subcutaneously with 0.2 mg / g bw bmaa. exposure to bmaa is believed to kill neurons in the brain, leading to neurodegenerative diseases. in one study, neuronal death occurred within 24 hours after 0.6 mg / g bw bmaa was injected subcutaneously in neonatal rats. the results showed a significantly higher concentration of l - bmaa, again demonstrating that the lc / ms / ms was more sensitive than the uplc - uv method. other investigators have reported that ip administration of l - bmaa causes selective degeneration of cerebellar cortical neurons in rat pups and intracerebral administration of l - bmaa causes sporadic death of hippocampal neurons in mice. histopathologic lesions were not seen in brains or in other selected tissues from treated mice, including symptomatic mice, in the present study. this lack of histopathologic lesions might suggest that l - bmaa causes a biochemical lesion as opposed to a histopathologic lesion in brain and other tissues under the conditions of this study. to truly focus on possible histopathologic changes caused by l - bmaa in tissues from mice, however, future studies might examine larger numbers of mice and employ perfusion fixation and advanced staining techniques. buenz and howe demonstrated that direct administration of l - bmaa to the mouse 's brain causes sporadic death of hippocampal neurons, and they demonstrated this histopathologically using tunel staining after subcutaneous injection of 600 mg / kg of l - bmaa in rat pups. the method of administrating l - bmaa was intraperitoneal injection which was found to be accurate to induce acute neurotoxicity in mice brain as was shown in a study in 1990. lc / ms / ms chromatography was shown to be more sensitive (p < 0.01) than uplc - uv when determining l - bmaa concentrations in tissues. the use of both methods consistently detected higher concentrations of l - bmaa in brain and liver samples from males in groups a (0.03 mg / g bw), b (0.3 mg / g bw), and e (3.0 mg / g bw) as compared to females in those groups (p < 0.01) which could be result of lower metabolic rate in female than in male [46, 47 ]. in conclusion, the presumptive ld50 of l - bmaa is 3 mg / gm bw and the loael of l - bmaa is 2 mg / g bw in male and female nih swiss outbred mice when administered intraperitoneally, and this animal model may prove useful for investigating the role of l - bmaa in neurodegenerative diseases. lc / ms / ms chromatography is more sensitive (p < 0.01) than uplc - uv when determining l - bmaa concentrations in mouse tissues. future studies should further examine whether l - bmaa concentrations in brain, liver, and perhaps other tissues are influenced by gender. studies might be designed to examine the long - term, chronic effects of administering l - bmaa at doses lower than the loael for longer than 14 days. perhaps then a relationship between l - bmaa exposure and neurodegenerative diseases in humans can be determined. l - bmaa has been shown clearly to be a neurotoxin in our mouse model and in other laboratory animals. this reinforces the notion that l - bmaa can cause serious neurodegenerative diseases in humans (and animals) as it can pass easily through the blood - brain barrier, and it can also transfer from mother to offspring through their milk. when administered intraperitoneally to mice at doses greater than 2 mg / g bw, the onset of adverse clinical symptoms is rapid. a long - term study of the relation between human neurodegenerative diseases such as als and the presence of bmaa in the same geographic environment can help us to determine the effect of the cyanobacterial neurotoxin (bmaa) on human in usa and worldwide, similar to the one recently done by delzor and his colleagues in france. | the cyanobacterial neurotoxin -n - methylamino - l - alanine (bmaa) is considered to be an excitotoxin, and its suggested mechanism of action is killing neurons. long - term exposure to l - bmaa is believed to lead to neurodegenerative diseases including parkinson 's and alzheimer 's diseases and amyotrophic lateral sclerosis (lou gehrig 's disease). objectives of this study were to determine the presumptive median lethal dose (ld50), the lowest - observed - adverse - effect level (loael), and histopathologic lesions caused by the naturally occurring bmaa isomer, l - bmaa, in mice. seventy nih swiss outbred mice (35 male and 35 female) were used. treatment group mice were injected intraperitoneally with 0.03, 0.3, 1, 2, and 3 mg / g body weight l - bmaa, respectively, and control mice were sham - injected. the presumptive ld50 of l - bmaa was 3 mg / g bw and the loael was 2 mg / g bw. there were no histopathologic lesions in brain, liver, heart, kidney, lung, or spleen in any of the mice during the 14-day study. l - bmaa was detected in brains and livers in all of treated mice but not in control mice. males injected with 0.03 mg / g bw, 0.3 mg / g bw, and 3.0 mg / g bw l - bmaa showed consistently higher concentrations (p < 0.01) in brain and liver samples as compared to females in those respective groups. |
a 75-year - old male patient was emergently admitted to the hospital with gross hematuria, generalized abdominal pain, and oliguria of about 3 days ' duration. he had undergone multimodal treatment for muscle - invasive bladder cancer (stage t2, urothelial cancer with sarcomatous differentiation) with transurethral resection (tur) of the bladder tumor and 6 adjuvant cycles of cisplatin - based cytotoxic chemotherapy (gemcitabine+cisplatin) (fig. 1), because he desired bladder preservation and had a strong fear of urinary diversion. one year after tur, a follow - up ct scan showed bladder tumor recurrence with a focal irregular margin of the bladder wall, suggestive of perivesical invasion. so he underwent tur of the bladder cancer (stage t2, urothelial cancer with squamous differentiation) (fig. 2) with adjuvant chemotherapy (methotrexate, vinblastine, adriamycin, and cisplatin). at 10 months after the operation, he presented with acute illness with vague abdominal pain. he was febrile at 39. he did not have a history of recent pelvic trauma, instrumentation, pelvic radiation, infravesical obstruction due to benign prostatic hyperplasia, or episodes of acute urinary retention. on the physical exam, the abdomen was markedly distended with muscular guarding and rebound tenderness. the serum creatinine (cr) level was elevated to 5.8 mg / dl with biochemical features of acute renal failure [k 5.7 mmol / l, na 126 mmol / l, serum blood urea nitrogen (bun) 53 mg / dl, bun / cr ratio 9:1 ]. the spiral ct showed a large bladder tumor extending into the perivesical space with a focal bladder wall disruption. the bladder tumor was nearly in contact with the anterior rectal wall without clear demarcation. we therefore first suspected an invasive bladder tumor with a rectovesical fistula and performed sigmoidoscopy and plain film cystography with retrograde contrast media injection through an indwelling urethral catheter. sigmoidoscopy showed no signs of fistula opening within the site of 70 cm from the anal verge except for a mild segmental mucosal edema. plain film cystography showed a refractory bowel pattern to paralytic ileus and left lateral wall irregularity with a suggestive sinus tract, but no evidence of intra- or extraperitoneal contrast media extravasation (fig., it was difficult for us to identify the cause of the acute peritonitis and biochemical features of acute renal failure. so we finally performed ct cystography with the patient in the prone position with 50 ml megluatmine iothalamate mixed in 500 ml of normal saline. the ct cystography showed the highly attenuated fluid in the peritoneum via a disrupted left lateral bladder wall and small bowel loop pooling with contrast media (fig. considering the patient 's age, poor general condition, and performance status, we decided to manage him conservatively with broad - spectrum antibiotics and indwelling catheters. a 8.5 fr pigtail drain catheter was inserted into the right pelvic area under the guidance of fluoroscopy in addition to percutaneous nephrostomy catheters for adequate urine drainage. after the insertion of the intraperitoneal drain catheter, 150 ml of turbid, yellowish urine with pus was drained. after intervention, the patient 's serum creatine level and white blood cell count returned to normal values in 4 days. the patient was discharged home with successful peritonitis resolution on hospital day 28th but died 3 months later as the result of acute renal failure. spontaneous intraperitoneal bladder perforation is a very rare clinical event and is associated with high mortality. most spontaneous bladder ruptures occur as the result of long - term indwelling catheters, radiation, chronic cystitis, bladder distention due to infravesical obstruction, or neurogenic bladder dysfunction. however, bladder perforation associated with bladder cancer is an extremely rare cause of spontaneous rupture. such rupture is a surgical emergency that may be rapidly fatal if its diagnosis and treatment is delayed or missed. patients usually present with symptoms such as sudden onset of lower abdominal pain, high spiking fever, hematuria, abdominal distention with signs of peritoneal irritation, and anuria with biochemical features of acute renal failure due to auto - dialysis of urinary ascites across the peritoneum. plain film cystography is accepted as the most accurate radiological technique for diagnosing bladder rupture. but with the widespread use of ct cystography, this imaging technique is increasingly being performed as an alternate method of diagnosing bladder rupture and has been shown to be as accurate as conventional cystography. ct cystography can also distinguish the specific type of bladder rupture between extraperitoneal or intraperitoneal. ct cystography has several advantages over plain film cystography : (1) it is rapid and is easily performed at the same time as other ct studies, (2) it is less affected by overlying bone fragments, and (3) it is more sensitive to the detection of small amounts of intraperitoneal or extraperitoneal fluid. in the present case, even though an abdominal helical ct scan was performed with adequate bladder distention of intravenous contrast media injection, there was no evidence of intraperitoneal perforation even on the 10 minute delay scan. so we checked ct cystography with retrograde contrast media injection in the prone position and finally diagnosed that the intraperitoneal perforation was associated with invasive bladder cancer. urothelial carcinomas are known to demonstrate a wide range of divergent histologic differentiations into the entire spectrum of histologic variants, including squamous, glandular, micropapillary, sarcomatoid, small cell, clear cell, lymphoepithelial, and plasmacytoid components. wasco found that any type or amount of divergent histologic differentiation present with urothelial carcinoma was strongly associated with unfavorable prognostic features. such cancer with mixed histologic features was nearly uniformly high grade and highly invasive and was also an independent predictor of extravesical diseases. in our case, 2 tur specimens showed urothelial carcinoma with sarcomatoid differentiation and squamous differentiation, respectively. highly aggressive characteristics of urothelial cancer with divergent differentiation may explain the spontaneous bladder perforation and following early death. in summary, we encountered a case of spontaneous intraperitoneal bladder perforation associated with highly aggressive urothelial cancer with divergent differentiation. at first, the findings of conventional helical ct and plain film cystography made it difficult for us to diagnose the intraperitoneal perforation properly. although intraperitoneal bladder rupture is a serious condition due to increased urine leakage and subsequent systemic absorption, and prompt surgical repair is key for patient management, we managed the patient conservatively rather than by open surgical repair in consideration of his poor general condition and suboptimal prognosis. we successfully treated the patient conservatively with adequate urinary diversion, intraperitoneal drainage, and broad - spectrum antibiotics. | spontaneous bladder perforation is a very rare event. prompt diagnosis of this injury is very important, particularly with intraperitoneal perforation, because mortality increases if surgical repair is delayed. previous studies have reported that plain cystography is the primary modality of imaging study rather than relatively insensitive computed tomography (ct) when bladder perforation is suspected. we report here a rare case of spontaneous intraperitoneal perforation of the bladder associated with urothelial carcinoma with divergent histologic differentiation, as diagnosed with ct cystography. |
a girl aged 6 years 10 months who had down syndrome had atlantoaxial rotatory fixation with os odontoideum. no neurologic symptoms and signs were present ; however, her neck showed wryneck (the so - called cock robin position), and the range of motion was extremely limited because of severe neck pain. on plain radiographs, plain computed tomography (ct) showed os odontoideum, and 3-dimensional ct clearly depicted not only sagittal but also axial dislocation of the atlantoaxial joint complex (fig. the spinal cord snaked through into the spinal canal, but high - intensity change of the spinal cord on the t2-weighted image was not observed on magnetic resonance imaging (fig. morphologic analysis of the c2 pedicles by ct imaging techniques indicated that insertion of pedicle screws was judged dangerous on both sides (fig. 3). atlantoaxial rotatory fixation could be incompletely reduced by halo traction, but it was not maintained without halo - ring and -vest immobilization. posterior occipito - axial fixation with bilateral c2 laminar screws (vertex max ; medtronic, memphis, tennessee) and a decompressive procedure by resection of the c1 posterior arch were then performed (fig. fixation was achieved with a halo ring and vest for 6 weeks postoperatively, with a subsequent cervical orthosis for 3 months. bone union was obtained at 3 months after surgery, and the patient 's neck pain and wryneck had disappeared. plain ct showed not only sagittal but also axial dislocation of the atlantoaxial joint with os odontoideum. preoperative magnetic resonance image (t1wi : t1-weighted image, t2wi : t2-weighted image) in case 1. the spinal cord snaked through into the spinal canal, but high - intensity change of the spinal cord on the t2wi was not observed. postoperative x - ray (obtained 1 year 3 months after surgery) and ct scan (obtained 4 weeks after surgery) in case 1. alignment of the cervical spine had improved, and the positions of the bilateral c2 laminar screws were correct. a boy aged 10 years 7 months who had down syndrome had atlantoaxial subluxation with os odontoideum after falling. he had incomplete quadriplegia with urorectal disturbance, so he could neither walk nor have a meal by himself. on dynamic radiographs, the spinal canal had a severe stenosis at the atlantoaxial level, and high - intensity change of the spinal cord on the t2-weighted image was clearly observed on magnetic resonance imaging (fig. morphologic analysis of the c2 pedicles by ct imaging techniques indicated that insertion of pedicle screws was judged dangerous on the left side (fig. moreover, repositioning of the atlantoaxial complex could not be obtained by preoperative direct traction. at 1 week after installation of a halo ring and vest, posterior occipitoaxial fixation with right c2 pedicle and left c2 laminar screws (vertex max) and a decompressive procedure by resection of the c1 posterior arch were carried out (fig. 8). halo - ring and -vest fixation was continued for 4 weeks, and a cervical orthosis was subsequently used for 3 months postoperatively. bone union was obtained at 3 months after surgery, and the patient 's paralysis had improved. preoperative x - ray and ct scan in case 2. on dynamic radiographs, marked instability at the atlantoaxial joint was observed. preoperative magnetic resonance image (t1wi : t1-weighted image, t2wi : t2-weighted image) in case 2. severe spinal canal stenosis accompanied by high - intensity change of the spinal cord on the t2wi was clearly observed at the atlantoaxial level. (lt, left ; rt, right.) postoperative x - ray (obtained 1 year 6 months after surgery) and ct scan (obtained 1 week after surgery) in case 2. alignment of the cervical spine had improved, and the accurate insertion of both right c2 pedicle and left c2 laminar screws was confirmed. a girl aged 6 years 10 months who had down syndrome had atlantoaxial rotatory fixation with os odontoideum. no neurologic symptoms and signs were present ; however, her neck showed wryneck (the so - called cock robin position), and the range of motion was extremely limited because of severe neck pain. on plain radiographs, plain computed tomography (ct) showed os odontoideum, and 3-dimensional ct clearly depicted not only sagittal but also axial dislocation of the atlantoaxial joint complex (fig. the spinal cord snaked through into the spinal canal, but high - intensity change of the spinal cord on the t2-weighted image was not observed on magnetic resonance imaging (fig. morphologic analysis of the c2 pedicles by ct imaging techniques indicated that insertion of pedicle screws was judged dangerous on both sides (fig. 3). atlantoaxial rotatory fixation could be incompletely reduced by halo traction, but it was not maintained without halo - ring and -vest immobilization. posterior occipito - axial fixation with bilateral c2 laminar screws (vertex max ; medtronic, memphis, tennessee) and a decompressive procedure by resection of the c1 posterior arch were then performed (fig. fixation was achieved with a halo ring and vest for 6 weeks postoperatively, with a subsequent cervical orthosis for 3 months. bone union was obtained at 3 months after surgery, and the patient 's neck pain and wryneck had disappeared. plain ct showed not only sagittal but also axial dislocation of the atlantoaxial joint with os odontoideum. preoperative magnetic resonance image (t1wi : t1-weighted image, t2wi : t2-weighted image) in case 1. the spinal cord snaked through into the spinal canal, but high - intensity change of the spinal cord on the t2wi was not observed. postoperative x - ray (obtained 1 year 3 months after surgery) and ct scan (obtained 4 weeks after surgery) in case 1. alignment of the cervical spine had improved, and the positions of the bilateral c2 laminar screws were correct. a boy aged 10 years 7 months who had down syndrome had atlantoaxial subluxation with os odontoideum after falling. he had incomplete quadriplegia with urorectal disturbance, so he could neither walk nor have a meal by himself. on dynamic radiographs, the spinal canal had a severe stenosis at the atlantoaxial level, and high - intensity change of the spinal cord on the t2-weighted image was clearly observed on magnetic resonance imaging (fig. morphologic analysis of the c2 pedicles by ct imaging techniques indicated that insertion of pedicle screws was judged dangerous on the left side (fig. moreover, repositioning of the atlantoaxial complex could not be obtained by preoperative direct traction. at 1 week after installation of a halo ring and vest, posterior occipitoaxial fixation with right c2 pedicle and left c2 laminar screws (vertex max) and a decompressive procedure by resection of the c1 posterior arch were carried out (fig. 8). halo - ring and -vest fixation was continued for 4 weeks, and a cervical orthosis was subsequently used for 3 months postoperatively. bone union was obtained at 3 months after surgery, and the patient 's paralysis had improved. (3d, 3-dimensional.) preoperative magnetic resonance image (t1wi : t1-weighted image, t2wi : t2-weighted image) in case 2. severe spinal canal stenosis accompanied by high - intensity change of the spinal cord on the t2wi was clearly observed at the atlantoaxial level. (lt, left ; rt, right.) postoperative x - ray (obtained 1 year 6 months after surgery) and ct scan (obtained 1 week after surgery) in case 2. alignment of the cervical spine had improved, and the accurate insertion of both right c2 pedicle and left c2 laminar screws was confirmed. it occurs in about 1 in 660 live births, and approximately 20% of patients with down syndrome have associated musculoskeletal disorders. among these disorders, symptomatic atlantoaxial instability, which is estimated to occur in 1% to 2% of patients with down syndrome, is one of the most serious issues because it may result in irreversible spinal cord damage. laxity of the transverse atlantal ligament has been thought to be the primary cause of the instability. among patients aged 11 to 39 years, ambulation was shown to be the best predictor of survival ; therefore surgical decompression in combination with fusion and instrumentation may be required from the point of view of not only maintenance of activities of daily living but also life saving. however, the high rate of serious perioperative complications, especially nonunion, deep wound infection, and any problems related to spinal instrumentation, causes hesitation in choosing to perform surgical intervention. some articles recommend nonoperative management for patients who have down syndrome and atlantoaxial instability without neurologic signs or symptoms. however, in addition to precautions regarding daily living, regular (at least annual) follow - up is needed, when an interim history of neuromotor function can be obtained and a neurologic examination can be carried out. if the severity of symptoms necessitates a posterior arthrodesis, a high rate of complications must be anticipated. the main problems of atlantoaxial instability due to down syndrome are as follows : symptomatic patients often present when aged between 5 and 15 years, children with down syndrome have a notably greater number of osseous anomalies of the upper cervical spine than do age- and sex - matched healthy children, mental retardation with restless hyperactivity interferes with postoperative cervical immobilization, and a variety of medical conditions that affect the surgical intervention are found in patients with down syndrome. in other words, safely performing not only transarticular screw fixation but also c1 lateral mass screw and pedicle screw fixation seems impossible because adequate screw insertion may not be feasible by reason of the small size and unusual shape of the c1 and c2 vertebrae. conventional posterior wiring procedures may not be able to achieve sufficient bone union as a result of incomplete postoperative cervical immobilization because of mental retardation even though a halo ring and vest were applied. furthermore, intensive care for general condition during the perioperative period is mandatory because of the accompanying various pathologic conditions of the vital organs. therefore we tried to carry out c2 laminar screw fixation as reported by wright in 2004 for patients with down syndrome in whom pedicle screw insertion was not possible. our literature search found no report in which occipitoaxial fixation with c2 laminar screws was adopted for pediatric atlantoaxial instability due to down syndrome. this technique is technically simpler and does not require fluoroscopy or navigation because screws are placed directly into the visualized laminae. in addition, c2 laminar screws yield no risk of vertebral artery injury and are acceptably inserted in pediatric patients because the laminae of the axis are relatively wide. cortical window at the facet - laminar junction ensures that the screw is bicortical and within the cancellous bone of the lamina and not deep in the spinal canal. ferride - barros reported that screw insertion in the c2 laminae is anatomically safe compared with screw insertion in the c2 pedicles by morphologic analysis using ct images in pediatric patients, with a mean age of 6 years. in biomechanical studies, although the c2 pedicle screw was stiffer than the c2 laminar screw, there were no statistically significant differences between them. that is, the c2 laminar screw must clinically provide enough stability. by this novel technique, favorable immediate intraoperative fixation enough to achieve sufficient bone union was accomplished with rods connected by occipital screws and c2 laminar screws. with respect to the upper foundation, occipital bone was used in both cases because c1 was too hypoplastic for placement of the lateral mass screws and the bone graft bed was lost by resection of the c1 posterior arch. naturally, if complete repositioning of the atlantoaxial complex can be achieved and c1 lateral mass screws can be placed safely, only atlantoaxial fusion should be chosen because this procedure is less invasive and provides preservation of one motion segment. improvements of the patients preoperative symptoms have been excellently maintained at 2 years after surgery. however, the atlantoaxial complex was forced to fuse in a somewhat flexed position because repositioning of the atlantoaxial malalignment could not be thoroughly accomplished. long - term careful observation is necessary because adverse effects to the entire cervical alignment are anticipated in the future. c2 laminar screws with which immediate rigid fixation is guaranteed are easily applied for the pediatric axis. satisfactory clinical results will be expected combined with halo - ring and -vest immobilization even though the patients will not be able to follow the instruction about postoperative treatment because of mental retardation. two cases of pediatric atlantoaxial instability due to down syndrome that were treated by posterior occipitoaxial fixation with c2 laminar screws were reported. bone union was successfully obtained with accompanying postoperative short - term halo - ring and -vest immobilization, and clinical symptoms were mostly relieved. the c2 laminar screw is one of the most useful options to achieve stability of the pediatric atlantoaxial joint complex without severe complications for patients in whom pedicle screw fixation can not be performed safely. | backgroundupper cervical spine instability is one of the most critical orthopedic problems in patients with down syndrome. however, arthrodesis of the upper cervical spine in these patients can be very difficult to achieve and has a high complication rate because of mental retardation and accompanying various medical conditions of the vital organs. even now, surgeries in such patients, especially pediatric cases, are challenging and the optimal operative procedure remains unsettled. the purpose of this study was to report 2 cases of pediatric atlantoaxial instability due to down syndrome in which posterior occipito - axial fixation with c2 laminar screws was performed.methodscase 1 was a girl aged 6 years 10 months who had atlantoaxial rotatory fixation with os odontoideum. atlantoaxial rotatory fixation was incompletely reduced by halo traction, and it was not maintained without halo - ring and -vest fixation. posterior occipito - axial fixation with bilateral c2 laminar screws was then performed. case 2 was a boy aged 10 years 7 months who had atlantoaxial subluxation with os odontoideum. he also had incomplete quadriplegia, so he could neither walk nor have a meal by himself. posterior occipito - axial fixation with right c2 pedicle and left c2 laminar screws was then carried out.resultsin case 1 bone union was obtained at 3 months after surgery and the patient 's symptoms were resolved. in case 2 bone union was obtained at 3 months after surgery and the paralysis was improved.conclusions/level of evidencein cases of atlantoaxial instability due to down syndrome, symptomatic patients often present between ages 5 and 15 years and mental retardation interferes with postoperative cervical immobilization. c2 laminar screws can be safely applied for the pediatric axis and biomechanically accomplished rigid fixation. the c2 laminar screw is one of the most useful options to achieve stability of the pediatric atlantoaxial complex without the risk of vertebral artery injuries (level iv case series). |
we recruited 13 patients (12 men and 1 woman) with type 2 diabetes for this study. the study was conducted at the general clinical research center of the university of texas southwestern medical center at dallas. the protocol for this study was approved by the institutional review board of the medical center, and all patients gave written informed consent. nine of the 13 subjects were non - hispanic whites, and the remaining subjects were african american. their mean sd age was 60 8 years (range 4570 years) and mean bmi (weight in kilograms divided by the square of the height in meters) was 34.9 8.7. ten patients were taking glyburide daily ; one or more patients were using nonsteroidal anti - inflammatory drugs, anticlotting, antihypertensive, antipsychotic, antidepressant, sleep, and gout medications, or pyridoxine daily, and the doses of these medications did not change throughout the study. none of the patients had thyroid, renal, or hepatic disease or were taking any vitamin d or mineral supplements. all of the patients received the two isoenergic study diets, a high - fiber and a moderate - fiber diet, for a period of 6 weeks each, in a randomized crossover design. there was a median interval of 7 days between the two diet periods during which the subjects were instructed to follow an isoenergic diet. the daily energy intake needed for weight maintenance during the two diets was estimated by multiplying the calculated basal energy expenditure by an activity factor (12). all of the patients ate at least one meal per day at the general clinical research center. the remaining food was supplied in packages to be consumed at home. to monitor compliance, the patients were instructed to bring back any unconsumed food, were interviewed by a dietitian, and were weighed during their visits. the patients were hospitalized during the last week of each dietary period (days 3642) for evaluation. the patients were instructed to maintain their usual level of physical activity during the entire study period. a set of three standard menus for each study diet were prepared for a 2,000-kcal intake. for a different energy requirement the moderate - fiber diet provided 8 g / day of soluble fiber and 16 g / day of insoluble fiber, and the high - fiber diet provided 25 g / day each of soluble and insoluble fiber. the fiber goal for the high - fiber diet was achieved by including natural sources of fiber such as fruit, beans, oat bran, oatmeal, sweet potato, winter squash, and vegetables such as okra and zucchini. both of the diets were designed to provide 800 mg calcium, 400 mg magnesium, 1,600 mg inorganic phosphorus, 120 mmol sodium, and 100 mmol potassium per day. homogenates of the diets were prepared, and the mineral content of the diets was determined by ash analysis. thereafter, both diets were matched for calcium, magnesium, phosphorus, sodium, and potassium by adding calcium gluconate, magnesium gluconate, sodium chloride, dibasic sodium phosphate, potassium chloride, or dibasic potassium phosphate to the diets, if needed. sample menus for both of the study diets have been published previously (2). the energy intake was adjusted if needed to maintain a constant body weight during the study. composition of the study diets fractional intestinal calcium absorption was measured by recovery of ca in the feces after oral administration of isotope (13) on day 36. ca was given orally with 250 ml distilled water and 4.3 ml neo - calglucon (sandoz pharmaceuticals, east hanover, nj). food was withheld for 4 h thereafter. stool was collected for 3 days until the disappearance of carmine, which was given 24 h after isotope administration. the patients collected 24-h urine specimens for determination of urine volume and chemistry on days 38 through 42 of each dietary phase. stools were collected for determination of stool weight and mineral content for 3 days at the end of each dietary phase. blood for serum chemistry analyses was drawn, after an overnight fast, daily on days 38 through 42 during each dietary period. urinary, stool, and plasma calcium content and urinary and stool magnesium content were determined by atomic absorption spectrophotometry. urinary, stool, and plasma phosphorus content was measured using the method of fiske and subbarow (14). urinary sodium and potassium were measured by specific ion electrode using a beckman astra analyzer (beckman instruments, fullerton, ca). plasma sodium, potassium, creatinine, and uric acid were measured as a part of the systematic multichannel analysis (sma-20). urinary creatinine was estimated by the rate - jaffe method using beckman astra, oxalate by the method of hodgkinson and williams (15), uric acid by the enzymatic method of liddle. (16), and citrate by an enzymatic method using kits (boehringer - mannheim biochemicals, indianapolis, in). urinary sulfate was determined by the turbidimetric procedure of ma and chan (17). the ca in stool was determined by a well - type nai - crystal gamma - scintillation counter equipped with a single - channel pulse - height analyzer at the ca peak of 1.29 mev. parathyroid hormone (pth) was assessed by a nichols allegro intact pth assay (nichols diagnostics, san juan capistrano, ca). the repeated measures analysis of variance model was used to assess the effect of the study diets and the order in which the diets were given on stool weight and mineral content, percent ca absorption from the gastrointestinal tract, 24-h urinary volume and chemistry, and fasting serum chemistry. the results were not affected by the order in which the diets were given, and so only the effect of the diets will be presented in the article. a set of three standard menus for each study diet were prepared for a 2,000-kcal intake. for a different energy requirement the moderate - fiber diet provided 8 g / day of soluble fiber and 16 g / day of insoluble fiber, and the high - fiber diet provided 25 g / day each of soluble and insoluble fiber. the fiber goal for the high - fiber diet was achieved by including natural sources of fiber such as fruit, beans, oat bran, oatmeal, sweet potato, winter squash, and vegetables such as okra and zucchini. both of the diets were designed to provide 800 mg calcium, 400 mg magnesium, 1,600 mg inorganic phosphorus, 120 mmol sodium, and 100 mmol potassium per day. homogenates of the diets were prepared, and the mineral content of the diets was determined by ash analysis. thereafter, both diets were matched for calcium, magnesium, phosphorus, sodium, and potassium by adding calcium gluconate, magnesium gluconate, sodium chloride, dibasic sodium phosphate, potassium chloride, or dibasic potassium phosphate to the diets, if needed. sample menus for both of the study diets have been published previously (2). the energy intake was adjusted if needed to maintain a constant body weight during the study. fractional intestinal calcium absorption was measured by recovery of ca in the feces after oral administration of isotope (13) on day 36. ca was given orally with 250 ml distilled water and 4.3 ml neo - calglucon (sandoz pharmaceuticals, east hanover, nj). food was withheld for 4 h thereafter. stool was collected for 3 days until the disappearance of carmine, which was given 24 h after isotope administration. the patients collected 24-h urine specimens for determination of urine volume and chemistry on days 38 through 42 of each dietary phase. stools were collected for determination of stool weight and mineral content for 3 days at the end of each dietary phase. blood for serum chemistry analyses was drawn, after an overnight fast, daily on days 38 through 42 during each dietary period. urinary, stool, and plasma calcium content and urinary and stool magnesium content were determined by atomic absorption spectrophotometry. urinary, stool, and plasma phosphorus content was measured using the method of fiske and subbarow (14). urinary sodium and potassium were measured by specific ion electrode using a beckman astra analyzer (beckman instruments, fullerton, ca). plasma sodium, potassium, creatinine, and uric acid were measured as a part of the systematic multichannel analysis (sma-20). urinary creatinine was estimated by the rate - jaffe method using beckman astra, oxalate by the method of hodgkinson and williams (15), uric acid by the enzymatic method of liddle. (16), and citrate by an enzymatic method using kits (boehringer - mannheim biochemicals, indianapolis, in). urinary sulfate was determined by the turbidimetric procedure of ma and chan (17). the ca in stool was determined by a well - type nai - crystal gamma - scintillation counter equipped with a single - channel pulse - height analyzer at the ca peak of 1.29 mev. parathyroid hormone (pth) was assessed by a nichols allegro intact pth assay (nichols diagnostics, san juan capistrano, ca). the repeated measures analysis of variance model was used to assess the effect of the study diets and the order in which the diets were given on stool weight and mineral content, percent ca absorption from the gastrointestinal tract, 24-h urinary volume and chemistry, and fasting serum chemistry. the results were not affected by the order in which the diets were given, and so only the effect of the diets will be presented in the article. the stool weight and mineral content and percent absorption of ca in the gastrointestinal tract are presented in table 2. stool weight was about one - third higher (p = 0.02) during the high - fiber diet than during the moderate - fiber diet. there was no statistically significant difference in stool calcium, magnesium, and phosphorus content between the two diets, although there was a tendency for magnesium and phosphorus stool content to be slightly higher with the high - fiber diet than with the moderate - fiber diet. ca absorption in the gastrointestinal tract was slightly lower with the high - fiber diet than with the moderate - fiber diet, but the difference was not statistically significant. stool mineral content and intestinal ca absorption, 24-h urinary chemistry, and fasting serum chemistry during the study all values are shown as the mean sd or mean difference (95% ci). stool weight was assessed in 11 subjects during the moderate - fiber phase and 12 subjects during the high - fiber phase, and stool ca, mg, and p contents were assessed in 11 subjects during the moderate - fiber phase and 10 subjects during the high - fiber phase. serum values represent mean values for five daily collections of blood for each patient except for pth levels, which were determined on a single sample. ca, calcium ; cr, creatinine ; crcl, creatinine clearance ; k, potassium ; mg, magnesium ; na, sodium, p, phosphorus. the 24-h urinary calcium, phosphorus, magnesium, sodium, sulfate, and oxalate results for each individual are shown in fig. urinary volume was similar for the two diets. compared with the moderate - fiber diet, the high - fiber diet was associated with lower urinary calcium (27% ; p = 0.003), phosphorus (11% ; p = 0.003), and sodium (12% ; p = 0.02) excretion. urinary excretion of oxalate was higher (36% ; p = 0.0006) and that of sulfate was lower (21% ; p < 0.0001) with the high - fiber diet compared with the moderate - fiber diet. no difference was found in urinary excretion of urate, citrate, and creatinine or in creatinine clearance with the two diets. urinary ph was higher with the high - fiber diet than with the moderate - fiber diet (5% ; p = 0.001). the 24-h urinary calcium (ca), phosphorus (p), magnesium (mg), sodium (na), sulfate, and oxalate concentrations for each individual during consumption of the moderate - fiber and high - fiber diets. each value represents mean of five daily collections of urine during the inpatient stay at the general clinical research center. the mean fasting serum calcium level was slightly but significantly lower (1.5% ; p = 0.04) with the high - fiber diet than with the moderate - fiber diet (table 2). there was a tendency for the serum phosphorus level and potassium level to be slightly lower and the pth level to be higher with the high - fiber diet than with the moderate - fiber diet, but the differences were not statistically significant. our data suggest that a high intake of fiber results in reduced urinary calcium excretion and a slight but significant reduction in serum calcium levels. these effects are most likely due to effects of dietary fiber on reducing calcium absorption. however, we did not find a significant reduction in intestinal calcium absorption using the ca isotope method. analysis of minerals in stool also did not reveal increased fecal calcium excretion despite a 31% increase in the wet weight of stool with the high - fiber diet. similarly, spencer. (9) also observed a significant decrease in urinary calcium excretion and no change in the intestinal absorption of ca in ambulatory men after consumption of an additional 21 g fiber / day in the form of oat bran muffins for 32 days. balasubramanian. (7) reported a decrease in apparent calcium absorption (calcium intake fecal calcium excretion and expressed as a percentage of intake) in elderly subjects during the last 10 days after consumption of 30 g of wheat bran supplements for 21days. (8), on the other hand, found no change in urinary or fecal calcium content in healthy subjects after consumption of diets enriched with 15 g barley fiber for 22 days. this study, however, did not closely match the calcium content of the two diets. (10) reported no change in apparent calcium balance (intake fecal and urinary excretion) in subjects with type 2 diabetes after consumption of a diet enriched with 32 g / day of guar for 6 months, whereas coudray. (11) reported a positive calcium balance in healthy men consuming diets enriched with 58 g fiber in the form of inulin or sugar beet for 28 days. 10) did not provide the study diets for the subjects and therefore probably had less control of the overall diet. the lower urinary calcium excretion with the high - fiber diet may also be partly explained by increased alkalization of urine as evidenced by the increased ph with the high - fiber diet. this could be due to the reduced animal protein and higher plant food content of the high - fiber diet. the high - fiber diet contained about 15 g more plant protein than the moderate - fiber diet for an energy intake of 2,000 kcal / day. animal protein is rich in sulfur - containing amino acids that are oxidized to sulfate (18). plant foods, on the other hand, contain alkali that buffers the moderate acidosis caused by sulfate. alkali enhances renal tubular reabsorption of calcium and reduces bone resorption, thereby lowering the urinary calcium excretion (19). the reduced urinary sulfate excretion with the high - fiber diet may have also contributed to the reduced urinary calcium excretion because sulfate binds with calcium ions and prevents renal tubular reabsorption of calcium (20). a reduced sulfate level would lead to greater renal tubular reabsorption and reduced excretion of calcium. the lower urinary calcium excretion with the high - fiber diet may also be partly due to the lower urinary sodium excretion. the role of urinary sodium is likely to be minor, however, because there was only a small difference in urinary sodium excretion with the two diets and because sodium intake, which is highly correlated with urinary sodium excretion, was held constant across the two diets. caffeine intake, which slightly reduces calcium absorption but has no effect on 24- h urinary calcium excretion (21), was kept constant throughout the study and could not have affected urinary calcium excretion. stool and urinary magnesium content were not significantly higher with the high - fiber diet compared with the moderate - fiber diet. these results are similar to a number of studies that reported no change in apparent magnesium balance with diets enriched with oat bran (9), guar (10), inulin, or sugar beet (11) fiber (8) reported a slight negative magnesium balance following consumption of diets rich in barley fiber. the decreased urinary phosphorus excretion with the high - fiber diet was probably due to the effect of dietary fiber on phosphorus absorption. our study, however, did not show a significant increase in the phosphorus content of stools with the high - fiber diet. our results contradict the results from another study (9), in which consumption of a diet rich in oat bran led to a significant increase in urinary phosphorus level ; however, the phosphorus content was about twice as high with the high - fiber diet than with the moderate - fiber diet (9). it is not possible to distinguish the role of soluble from insoluble fiber on mineral absorption in our study because the high - fiber diet, although particularly rich in soluble fiber, also contained insoluble fiber in greater quantity than in the moderate - fiber diet. also not possible to differentiate from our study is the role of dietary fiber from the effect of phytate and oxalate on mineral absorption. the high - fiber diet in our study had nearly 3 times more phytate and 4 times more oxalate than the moderate - fiber diet. both phytate and oxalate form insoluble complexes with minerals such as calcium, thereby reducing their absorbability (22,23). designing diets with the same amount of insoluble fiber, phytate, and oxalate would be challenging because foods rich in soluble fiber tend to be rich in the above components. in addition, the purpose of our study was not to match the insoluble fiber, phytate, and oxalate content of the two diets but to examine the effect of a diet high in fiber derived from natural foods on lipids, glycemic response, and mineral balance. we did not assess the impact of the high - fiber diet on absorption of trace minerals. the small sample size in our study is probably not an issue because we had a crossover design. according to garcia. (24), who evaluated the efficiency of crossover designs, a crossover design needs about 410 times fewer subjects than a similarly powered parallel design. in their article, garcia. also noted that our study (with the primary data) (2) incorporated an efficient crossover design. furthermore, our current analysis did have sufficient power to statistically detect the clinically important differences in the mineral balance data presented in this article. the mineral contents, especially the calcium, phosphorus, and magnesium contents, of the two diets were carefully matched because high - fiber foods, such as legumes and green leafy vegetables, are naturally rich in calcium and other minerals, and excessive calcium intake decreases magnesium absorption and vice versa (25) and increased intakes of calcium and phosphate decrease magnesium absorption due to formation of an insoluble calcium - magnesium - phosphate complex in the intestinal lumen (26). other strengths included providing the diets and thus controlling the overall food intake, hospitalizing the patients during the last week of each phase for data collection, assessing the long - term effect of fiber intake on mineral absorption and metabolism by feeding each diet for 6 weeks, and determining the calcium absorption through fecal recovery of calcium isotope, the gold - standard method for assessing calcium absorption. in summary, a diet high in fiber, especially soluble fiber, lowers urinary calcium and phosphorus levels and slightly reduces serum calcium concentration. these results do not justify modifying the dietary recommendations made by the national cholesterol education program adult treatment panel iii and the american diabetes association. nevertheless, it may be prudent to ensure adequate amounts of calcium and other minerals with long - term consumption of a high - fiber diet. | objectivehigh levels of dietary fiber, especially soluble fiber, are recommended to lower serum cholesterol levels and improve glycemic control in patients with type 2 diabetes. it is not clear, however, how high levels of fiber affect mineral balance.research design and methodsin a randomized crossover study, 13 patients with type 2 diabetes were fed a high - fiber (50 g total and 25 g soluble fiber) and a moderate - fiber (24 g total and 8 g soluble fiber) diet of the same energy, macronutrient, calcium, magnesium, and phosphorus content for 6 weeks each. intestinal calcium absorption was determined by fecal recovery of 47ca. stool weight and mineral content were assessed during 3 days, and 24-h urinary mineral content and serum chemistry were assessed over 5 days at the end of each phase. the results were compared by repeated - measures anova.resultscompared with the moderate - fiber diet, the high - fiber diet increased stool weight (165 53 vs. 216 63 g / day, p = 0.02) and reduced 24-h urinary calcium (3.3 1.7 vs. 2.4 1.2 mmol / day, p = 0.003) and phosphorus (29.2 5.5 vs. 26.0 3.2 mmol / day, p = 0.003) excretion and serum calcium concentration (2.33 0.06 vs. 2.29 0.07 mmol / l, p = 0.04). calcium absorption, stool calcium, magnesium, and phosphorus content and serum phosphorus concentration were not significantly different with the two diets.conclusionsa high - fiber diet rich in soluble fiber has a small impact on calcium and phosphorus balance in subjects with type 2 diabetes. it may be prudent to ensure adequate intake of calcium and other minerals in individuals consuming a high - fiber diet. |
to date, one of the most understudied etiologies of older adults ' survival and longevity has been the role of their cognitive beliefs and worldviews that possibly interact with their functional and mental capacities to endure, challenge, overcome, and survive in the face of the numerous struggles and obstacles in advanced old age. in earlier research on predictors of mortality, the focus has been exclusively on variations in physical health and sociodemographic variables to explain and predict differences in longevity and mortality rates across a wide age range. more recently, studies have explored the relationship between the 5-factor personality traits [14 ] and other stress - inducing traits of perfectionism and dysfunctional dependency traits to predict greater longevity or increased risk of mortality. the present study presents a clear departure from earlier studies that have focused on sociodemographic and personality factors to explain and predict differences in all - cause mortality rates in later life. the goal of the present research is to move outside the personality and traits model to other second - order cognitive - behavioral factors to predict differences in all - cause mortality rates in later life. cognitive - behavioral theorists argue on both theoretical and empirical grounds that individuals ' cognitive beliefs exert a great deal of influence on their health, resilience, and longevity and may logically be assumed to be robust predictors of impending mortality or conversely of longevity. however, the ability of cognitive belief systems to predict important health outcomes of survival and longevity has traditionally been questioned because of the putative effects of individuals ' earlier life experiences such as parental loss and divorce. more recent explorations into individuals ' cognitive beliefs have been drawing attention to a cluster of beliefs systems that may counter the effects of earlier negative experiences and may serve as strengthening factors toward enhancing longevity. recent research using more modern concepts of evaluating dominant cognitive beliefs and cognitive perspectives of individuals (e.g., beliefs about a just world (bjw) for self and others, beliefs about one 's future time, beliefs about one 's self - continuity with the future, and beliefs about social, political, and interpersonal trust) has provided growing evidence that individuals ' cognitive beliefs and perspectives are indeed related to health - related processes [7, 8 ] leading to longer survival and longevity as a final health outcome. also, in recent years, the availability of reliable and valid measures of cognitive beliefs of justice and fairness [9, 10 ], future time perspectives, and future self - continuity perspectives [12, 13 ] has increased our understanding of the predictive value of individuals ' cognitive beliefs as strengthening or debilitating factors in health - related outcomes of resilience and longevity. the present study addresses the relationship between newly emerging sets of important cognitive belief systems and the potential for increased longevity. for example, a number of researchers [10, 14 ] have demonstrated empirically that individuals ' tenacious cognitive beliefs in a just world (bjw) society are not only predictive of their subjective well being and resilience, but more importantly drive them toward investment in long - term goals and a commitment to better self - care of health and a longer life. as a result, life - span scholars are now more keenly exploring the proactive role that individuals ' beliefs about a just world (bjw) may play in their future well being and healthy physical survival (see tomaka and blascovitch, 1994), low levels of depression, and less loneliness. other dominant cognitive beliefs which have been seen to be related to healthy survival processes or which present increased risks of mortality include beliefs about interpersonal trust and trust in key institutions [18, 19 ]. individuals who have strong positive beliefs of trust in the interpersonal and institutional domains are commonly expected to live lives that are more organized and planned, as distinguished from lives of instability, anxiety, and caution. other perspectives and belief systems that are predictive of planned healthy survival include future time perspective (ftp) and self - continuity with the future perspective (fsc). the ftp perspective is a measure of individuals ' perceived belief about how much time participants had left in life. according to carstensen, the subjective sense of remaining time has profound effects on basic human processes, including motivation, cognition, and behaviors. with increasing age, constraints on time left shift individuals ' priorities about how remaining time can be protected. along somewhat similar lines, the future self - continuity perspective (fsc) indicates that participants ' beliefs about their similarity and connection as well as caring and liking for their future self 10-, 15-, or 20-years from now determine and shift their motivation to protect the potential future person. for purposes of the present study, our underlying conceptual assumption in both these futuristic perspectives is that individuals who perceive their time horizons and their self - continuity with the future as more limited would be more likely to discount the future, and thus more unlikely to plan for self - care and self - management of the future, whereas those who feel the future horizons are more open - ended and expansive are more likely to plan and organize for a secure future. implicit in these perspectives is the prediction that individual differences in the experience of self - continuity could have positive pragmatic consequences for future health care and healthy survival. one logical assumption is that people who experience little or no continuity with the future self may not aspire to control future health - related processes whereas people who experience much similarity or self - continuity with the future self are likely more motivated to work toward shaping a better survival. while previous research has demonstrated empirically the predictive value of the preceding sets of cognitive beliefs and perspectives in regard to well - being and physical and mental health - related processes and outcomes, findings have been drawn from the study of a wide range of ages. thus, there is the question of whether the prognostic value of these belief systems continues into advanced old age. to date, the number of longitudinal studies of cognitive beliefs as predictors of longevity or as risk to mortality in old age is limited. to address this issue, accordingly, the purpose of our current research was to examine longitudinally the extent to which specific and select sets of cognitive beliefs are enabling, strengthening, or disabling with respect to long - term health, resilience, and longevity of older adults and have predictive value for all - cause mortality in advanced old age. the question is of increasing interest to health professionals and gerontologists for both practical and conceptual reasons. in the section which follows, we review briefly the research literature that both explains and extends the assumptions underlying the theory and goals of concepts of bjw, ftp, and fsc and their potential for predicting longer survival / or reduced risk for mortality. the just world hypothesis and how it may relate to health and longevity is easily stated. individuals have a strong need to believe that they live in a world where people generally get what they deserve. the belief that the world is just enables the individual to confront his / her physical and social environment as though they were stable and orderly. without such a belief, it would be difficult for the individual to commit himself / herself to the pursuit of long - range goals or even to the socially regulated behavior of day - to - day life. since the belief that the world is just serves such an important adaptive function for the individual, people are very reluctant to give up this belief, and they can be greatly troubled if they encounter evidence that suggests that the world is not really just or orderly after all. according to lerner and miller 's just - world theory, people who believe that the world treats them fairly may plan confidently for their future, expecting their lives to be orderly, meaningful, and controllable, foreseeing a positive future or viewing one 's living situation as justly deserved and hence fair. in turn, this expectation promotes mental health, meaning that the belief in a just world (bjw) can be seen as a positive illusion. indeed research links bjw to many indices of subjective well being including a greater purpose in life and commitment to planned healthy survival. there is empirical evidence showing that individuals who strongly believe in a just world have been seen to experience less stress and more positive affect than individuals with a weaker bjw (e.g., [16, 24 ]). the preceding conceptual underpinnings and the recent theory and research related to cognitive beliefs of a just world (bjw) lend weight to the proposed hypothesis of our present study that strong bjw beliefs about justice for the self portend positive social consequences and health - related benefits for the future. as such, individuals ' strong cognitive beliefs about a just world (bjw) may be early predictors of their continued physical and mental well being at later stages of life and would serve to protect them against the stress associated with the challenges of later life. in the current study, we reason that the predictive power of bjw to enhance longevity derives uniquely from perceived justice and bjw beliefs. in light of the preceding discussion, our leading hypotheses for the current study were (1) that individuals ' beliefs that the world is just to themselves (bjw - self) are particularly predictive of their longer term survival and longevity, and (2) that the associations between cognitive beliefs of a just world would be observed more powerfully among measures of bjw for self only (as distinguished from bjw for others). in essence, we reason that it is the perception of one 's own, more so than other individuals ', outcomes that would most powerfully predict longevity or possible risks of mortality ; (3) that individuals ' stronger levels of interpersonal trust and trust in the major communal institutions (as associated with their perceptions of justice in the bjw beliefs) are early predictors of their longevity, or conversely stronger levels of distrust in the major communal institutions would be associated with increased risk of mortality. a related second goal of our current study was to examine the predictive value of other related cognitive perspectives such as future time perspectives not previously studied as predictors of mortality and longevity. on the basis of postulates derived from carstensen 's theory on the influence of a sense of time on human development (also see [13, 25 ]) theory on individual differences in future self - continuity, we reason that while time eventually runs out for all individuals, individuals who hold more expansive and open - ended future time horizons or who foresee stronger self - continuity with the future self (compared to those who hold more limited future time horizons and less self - continuity with the future self) are less likely to discount the significance of future time and are more invested in self - preservation for the future. accordingly, we hypothesize (4) that individuals ' varying beliefs about future time left (ftp) and their beliefs about their ability to maintain self - continuity with the future (fsc) are critical markers or early predictors of longevity and of the risks of mortality. while we acknowledge that the preceding associations between mortality and cognitive beliefs may not have been apparent in early and middle - age adulthood, our expectation is that the associations will be especially observable and relevant in late life functioning and will emerge as early markers or predictors of mortality or longevity. participants for the study were randomly recruited from the registry listings of four branch offices of community services and community organizations for seniors (ministry of health services and health policy 1992), a governmental organization responsible at the time for social services and health policy in southern alberta. a sampling strategy with proportional stratification in function of geographical zone (metropolitan, urban, or rural) was used to ensure that the sample was representative of the general population of older adults living in three big cities and various rural areas in southern alberta. participants came from three mid - sized cities (populations ranging from 170,000 to 300,000 individuals) and surrounding suburban and rural areas in southern alberta (canada). it should be noted that various levels of community dwellings ranging from upper middle class private houses to low income apartment housing, and assisted living homes were included in the final recruitment. initially 760 brochures briefly describing the research were mailed on a staggered basis to seniors ' households requesting individuals ' participation with a one - time offer of a $ 30 gift certificate to compensate for their time. the purpose of the study was explained as an attempt to understand older individuals ' beliefs, hopes, expectancies, and planned goals for the foreseeable future. by the end of eight weeks the remaining 628 individuals were subsequently recontacted by mail, and of these 137 individuals who wanted additional information about the research were contacted by phone. another 333 individuals agreed to participate in response to further advertising and a to a second and third call for participants, made 3 and 4 months later, bringing the total number of willing participants to 470. eligibility criteria for the selection of participants included (1) being 65 years or older ; (2) being able to understand, speak, and write english ; (3) not having a diagnosis of cognitive dysfunction registered in the medical files ; (4) being available for baseline assessments ; (5) able to specify by name, address, phone number, and other relevant details, one or more family members or care - givers willing to serve as informants to the research team ; (6) willing to sign a consent form. the initial interview with each of the 470 participants and their family members took approximately one - and - a - half hours, with interviews staggered over a period of 16 weeks. the majority of participants were interviewed in their homes in order to obtain baseline information about health status in relation to the chronic condition presented, to obtain participants ' formal consent to participate and to arrange for their family member or primary care giver to contact us periodically concerning the participant 's general progress. we provided informants with postage - paid envelopes to contact us at regular intervals, as stated in the contact form, concerning the participant 's health status (improving, stable, declining somewhat, seriously declining), and in the event of the participant 's death, to provide the exact date of death. within the first four months of the completion of baseline assessments for the study, a total of 30 participants withdrew their participation for a number of reasons, mostly because of the care - givers ' reluctance to cooperate. data are presented for the remaining 440 participants who, following baseline assessments, stayed the entire 6.5 years ' course of the study. we wrote thank you notes and sent gift coupons to care givers at every wave of the study, as a token of appreciation of their continuing participation. there was no further attrition of participants during the course of the next 6.5 years. ascertainment of mortality (date of death) was done solely on the basis of report of the informants. family members preferred that we used this follow - up and contact procedure because it was more personal and private. however, as far as possible, we double checked dates of death against easily accessible local / provincial mortuary listings. the study comprised 11 waves of data collection. following a small pilot study, we conducted in 1995 on study procedures and assessment scales, baseline measures (wave 1) were obtained between september and december 2000 in a staggered way, followed by 10 subsequent waves of contacts with informants and/or participants to obtain summary progress data on participants. contacts were made at approximately eight - month intervals (240 days apart) till early december 2007, approximately 6.5 years after baseline. participants agreed to complete paper - and - pencil tests at their own pace, at home or in their place of study, and approximately 10 percent sought the help of research assistants to record their responses. at baseline, participants completed the following. measure of beliefs of a just world (bjw)bjw were assessed with a scale originally developed by lipkus and siegler but further improved by bgue and bastounis, in order to separate items of bjw pertaining to self from items of bjw pertaining to others. participants rated on a scale of 1 (strongly disagree) to 6 (strongly agree) 8 items of bjw beliefs pertaining to the self. sample items are i feel that the world treats me fairly in life, i feel that i get what i deserve, i feel that when people meet with misfortune, they have brought it upon themselves. scores for bjw (self) and scores for the bjw (others) ranged from 8 to 48. we used the option of scoring the bjw - self and bwj - others as continuous scales. cronbach 's alpha were.84 and.74 for the bjw - self and bwj - others, respectively. bjw were assessed with a scale originally developed by lipkus and siegler but further improved by bgue and bastounis, in order to separate items of bjw pertaining to self from items of bjw pertaining to others. participants rated on a scale of 1 (strongly disagree) to 6 (strongly agree) 8 items of bjw beliefs pertaining to the self. sample items are i feel that the world treats me fairly in life, i feel that i get what i deserve, i feel that when people meet with misfortune, they have brought it upon themselves. scores for bjw (self) and scores for the bjw (others) ranged from 8 to 48. we used the option of scoring the bjw - self and bwj - others as continuous scales. cronbach 's alpha were.84 and.74 for the bjw - self and bwj - others, respectively. measure of future time perspective (ftp)ftp was assessed with the future time perspective scale developed by carstensen. participants rated on a scale from 1 (very untrue for me) to 7 (very true for me) the degree with which they agreed with each of 10 items. i have the sense that time is running out, as i get older, i begin to experience time as limited. we used the option of scoring the ftp as a continuous scale in the first instance. participants rated on a scale from 1 (very untrue for me) to 7 (very true for me) the degree with which they agreed with each of 10 items. sample items are many opportunities await me in the future, most of my life still lies ahead of me, i have the sense that time is running out, as i get older, i begin to experience time as limited. we used the option of scoring the ftp as a continuous scale in the first instance. measure of future self - continuity (fsc)fsc was assessed by means of an adapted psychometric measure of future self - continuity originally devised by frederick that used a single - item measure (i.e., how similar / connected are you to your past and future self for 5-, 10-, 15-, and 20-year intervals on a 1100 scale ?). to facilitate the comprehension of the concept of continuity, the individual 's endorsement of similarity between present and future selves was presented pictorially by a range of five circles with no overlap to circles with complete overlap. the index of future self - continuity featured two questions on 7-point scale marked at each point by two circles that ranged from showing no overlap at one end of the scale to depicting almost complete overlap at the other end (see for circles depicting no overlap to complete overlap), thus, making the measuring devise more concretely comprehensible to older adults. participants first selected the pair of circles that best described how similar / connected they felt to the future self 15 years from now, and how much they cared about the future self. subsequently, their responses were invited to two questions : how connected do you feel to your future self 15 years from now ? (not at all = 0 to very much = 7). how much do you care for your future self ? (not at all = 0 to very much = 7). we used the option of scoring the fsc scale (similarity / caring) as a continuous scale in the first instance. the index score of future self - continuity ranged from 7 to 35, and caring for the future self ranged from 7 to 35, assessed in terms of one continuous total index score ranging from 14 to 70. the high scores represented higher levels of future self - continuity / caring for future self. fsc was assessed by means of an adapted psychometric measure of future self - continuity originally devised by frederick that used a single - item measure (i.e., how similar / connected are you to your past and future self for 5-, 10-, 15-, and 20-year intervals on a 1100 scale ?). to facilitate the comprehension of the concept of continuity, the individual 's endorsement of similarity between present and future selves was presented pictorially by a range of five circles with no overlap to circles with complete overlap. the index of future self - continuity featured two questions on 7-point scale marked at each point by two circles that ranged from showing no overlap at one end of the scale to depicting almost complete overlap at the other end (see for circles depicting no overlap to complete overlap), thus, making the measuring devise more concretely comprehensible to older adults. participants first selected the pair of circles that best described how similar / connected they felt to the future self 15 years from now, and how much they cared about the future self. subsequently, their responses were invited to two questions : how connected do you feel to your future self 15 years from now ? (not at all = 0 to very much = 7). how much do you care for your future self ? (not at all = 0 to very much = 7). we used the option of scoring the fsc scale (similarity / caring) as a continuous scale in the first instance. the index score of future self - continuity ranged from 7 to 35, and caring for the future self ranged from 7 to 35, assessed in terms of one continuous total index score ranging from 14 to 70. the high scores represented higher levels of future self - continuity / caring for future self. interpersonal and society trust measureindividuals ' degree of interpersonal trust and trust in the surrounding public institutions that are perceived to represent justice and fairness were assessed by means of scale items adapted from the the rotter trust scale. as a first step in adapting the scale, a number of items were written using a 5-point likert format, (1) strongly agree to (5) strongly disagree. an attempt was made to sample a wide variety of social objects so that a subject would be called upon to express his / her trust of outside agents, friends, and family members. sample items include in dealing with strangers one is better off to be cautious until they have provided evidence that they are trustworthy, most elected public officials are not really sincere in their campaign promises ; most friends can be trusted to support you for life ; i am able to share my innermost thoughts and feelings with family because of my trust in them ; i do not like to reveal personal information to outside agents even when they claim to be helping me ; i am a private person and find it hard to trust people i do not know well. in the final form of this scale, the 24 items selected were similarly balanced. twelve items indicated trust for agreeing, and 12 items indicated distrust for agreeing (with the range of scores for both the trust items and distrust items being 12 to 60). a few filler items were included to disguise the true purpose of the scale. cronbach 's alpha for the trust scale and distrust scale were.77 and.72, respectively. individuals ' degree of interpersonal trust and trust in the surrounding public institutions that are perceived to represent justice and fairness were assessed by means of scale items adapted from the the rotter trust scale. as a first step in adapting the scale, a number of items were written using a 5-point likert format, (1) strongly agree to (5) strongly disagree. an attempt was made to sample a wide variety of social objects so that a subject would be called upon to express his / her trust of outside agents, friends, and family members. sample items include in dealing with strangers one is better off to be cautious until they have provided evidence that they are trustworthy, most elected public officials are not really sincere in their campaign promises ; most friends can be trusted to support you for life ; i am able to share my innermost thoughts and feelings with family because of my trust in them ; i do not like to reveal personal information to outside agents even when they claim to be helping me ; i am a private person and find it hard to trust people i do not know well. in the final form of this scale, the 24 items selected were similarly balanced. twelve items indicated trust for agreeing, and 12 items indicated distrust for agreeing (with the range of scores for both the trust items and distrust items being 12 to 60). a few filler items were included to disguise the true purpose of the scale. cronbach 's alpha for the trust scale and distrust scale were.77 and.72, respectively. spheres of control the scale has little or no conceptual overlap with the bjw scale and, hence, was selected to provide an independent measure of control. the scale is comprised of 30 items with the three spheres of control (personal efficacy, interpersonal control, and sociopolitical control) each represented by 10 items each rated on a 5-point likert scale ranging from disagree to agree. in the present research, we collapsed the scores across these three spheres of control because the results of our hypothesis tests were not affected by distinguishing between them. specimen items for the personal efficacy scale, interpersonal scale, and sociopolitical scale, respectively, include it 's pointless to keep working on something that is too difficult for me ; i find it easy to play an important part in most group or individual situations. in the long run, we as voters are responsible for bad government on a local or national level ; it is difficult for people to have much control over things politicians do in offices. a total index score for the 30 items was obtained with scores ranging from 30 to 150. the scale has little or no conceptual overlap with the bjw scale and, hence, was selected to provide an independent measure of control. the scale is comprised of 30 items with the three spheres of control (personal efficacy, interpersonal control, and sociopolitical control) each represented by 10 items each rated on a 5-point likert scale ranging from disagree to agree. in the present research, we collapsed the scores across these three spheres of control because the results of our hypothesis tests were not affected by distinguishing between them. specimen items for the personal efficacy scale, interpersonal scale, and sociopolitical scale, respectively, include it 's pointless to keep working on something that is too difficult for me ; i find it easy to play an important part in most group or individual situations. in the long run, we as voters are responsible for bad government on a local or national level ; it is difficult for people to have much control over things politicians do in offices. a total index score for the 30 items was obtained with scores ranging from 30 to 150. measure of self - esteem (sei :) this inventory was used to measure self - esteem as a global and stable disposition. this inventory was used to measure self - esteem as a global and stable disposition. physical functionphysical function was assessed by means of a single item taken from the physical function mobility index inquiring about one 's ability (yes / no) to climb one flight of stairs without help. this one - item question was intended to seek information on physical fitness.it should be noted that all measures administered to the participants were formatted in terms of language and structure appropriate for adults having a ninth - grade education. all paper - and - pencil tests and self - report measures used in the study were previously piloted on a volunteer group of 20 men and women aged 60 to 80 years. subsequent modifications were made in the instructions and illustrations given for responding to the five - point ratings of test items. this procedure was undertaken to ensure that even those participants who were elderly and had relatively limited education could validly complete the measures. physical function was assessed by means of a single item taken from the physical function mobility index inquiring about one 's ability (yes / no) to climb one flight of stairs without help. it should be noted that all measures administered to the participants were formatted in terms of language and structure appropriate for adults having a ninth - grade education. all paper - and - pencil tests and self - report measures used in the study were previously piloted on a volunteer group of 20 men and women aged 60 to 80 years. subsequent modifications were made in the instructions and illustrations given for responding to the five - point ratings of test items. this procedure was undertaken to ensure that even those participants who were elderly and had relatively limited education could validly complete the measures. advanced old age is commonly associated with an increase in disabilities, higher rates of health care use, and higher need for social support. thus, we felt the need to examine further fluctuations in risk of mortality after controlling for health - related covariates, which were assessed as follows : survey of number of visits to health providersas a part of a separate survey, respondents listed the number of visits that they had paid in the previous year to health providers, including visits to family physicians, community health clinics, and emergency health units, including hospital visits. as a part of a separate survey, respondents listed the number of visits that they had paid in the previous year to health providers, including visits to family physicians, community health clinics, and emergency health units, including hospital visits. iadl index of disabilitywe based this index on the self - reported ability for 12 daily living activities included in the iadl. respondents were asked to indicate whether they had experienced limitations in 12 areas of functioning with responses coded (1) for yes and (0) for no, for example, able to use a telephone ; boarding a bus without assistance ; lifting or carrying groceries ; personal grooming and personal hygiene care ; doing light house work ; taking medications ; walking one block. all the items were summed to form one index of iadl, with scores ranging from 0 to 12. we based this index on the self - reported ability for 12 daily living activities included in the iadl. respondents were asked to indicate whether they had experienced limitations in 12 areas of functioning with responses coded (1) for yes and (0) for no, for example, able to use a telephone ; boarding a bus without assistance ; lifting or carrying groceries ; personal grooming and personal hygiene care ; doing light house work ; taking medications ; walking one block. all the items were summed to form one index of iadl, with scores ranging from 0 to 12. measure of satisfaction with family and social supportsocial satisfaction was assessed with 10 items adapted from zimet.. participants rated how satisfied they were with their social partners in general, and how satisfied they were with their family and relatives on a rating scale ranging from 1 (very dissatisfied) to 3 (very satisfied). participants rated how satisfied they were with their social partners in general, and how satisfied they were with their family and relatives on a rating scale ranging from 1 (very dissatisfied) to 3 (very satisfied). we assessed the internal consistency of each trait scale with cronbach 's coefficient alpha and the association of the scales with each other and with other covariates by means of pearson correlation coefficients. for all analyses, differences between survivors and decedents on the date of final censoring were assessed with t - tests and chi - square tests of association. cox proportional hazard models were fitted to estimate the importance of each predictor of mortality. it is important to note that cox regression, or the proportional hazards model, is a well - recognized statistical technique for survival analysis which is concerned with studying the time between entry to a study and a subsequent event such as death, as is the case in the present research. cox regression has the advantage that it allows for the simultaneous exploration of the relationship between survival of persons and several explanatory variables (in our case variables such as cognitive beliefs, future time perspectives, control and trust, etc.). of particular relevance and interest to our research is that the technique allows for age adjustment of the calculated hazard ratios across a wide range of ages, as was the case in our study., by stephen j. walters, a haywood group plc publication, may 2003, accessible online at http://www.whatisseries.co.uk/whatis/pdfs/what_is_cox_model.pdf) ; see also g.d. garson, statnotes, north carolina state university, online at http://faculty.chass.ncsu.edu/garson/pa765/cox.htm) for details of statistical procedures for achieving adjustment for the effect of age as a covariate. the cox regression model assumes that the death rate of the population depends on a continuous time variable, which in the present study was the interval between the wave 1 assessment and date of death, calculated in terms of total number of days. in the present study, predictor variables included beliefs in a just society (bjw : self and others), future time perspective (ftp), future self - continuity (similarity / caring) perspective (fsc), demographic variables, and health and physical functioning variables. the initial risk ratios (irrs) (frequently referred to as hazard ratios) are calculated by exponentiating the beta weight for the predictor, and regressions are expressed in risk ratios and 95 percent confidence intervals. all cox regression hazard ratios (irrs) presented in the present analyses were first adjusted for age. in subsequent analyses, we controlled for three health - related covariates (see [3, 5, 32, 33 ] for significance of studying health variables). results are reported in two sections corresponding to our two main research questions. in the first section, we examine key differences between survivors and decedents in baseline characteristics of participants. in specific, we conducted cox regression analysis of risk rations of mortality to estimate the relative risk of death and the importance of each predictor of mortality for the whole sample. all variables entered in the cox regression analysis were entered as continuous variables for these analyses. in the second section, we present additional analysis of data where we were unable to derive easily interpretable results from using cox regressions of continuous variable data. subsequently, we analyzed the data using categorical variables that we considered were appropriate for the otherwise continuous variables. four hundred and forty participants were followed starting in december 2000 when baseline assessments were completed. as of december 2007, after an average of 6.5 years of observation one hundred and forty (32%) deaths had occurred, and 300 (68%) survived. table 1 provides crude data at baseline on the two subgroups of decedents and survivors. those who died during the study period were somewhat older. among health - related variables, the respondents in the two groups were quite different with respect to physical function scores, but not with respect to number of medical visits reported at time of baseline assessment, or in respect of number of disabilities reported on the iadl index (see table 1). survivors compared to decedents had significantly higher scores on measures of beliefs in just world (bjw - self), on the future time perspective (ftp) and future self - continuity / caring for the future self (fsc) perspective scale. by contrast, decedents compared to survivors had significantly higher scores on the measure of distrust on the interpersonal and society scale and on the control scale. first, we examined the intercorrelations of measures of beliefs in a just world (bjw ; self and others), future time perspective (ftp), future self - continuity perspective (continuity / caring for future self), trust (agreement with trust items and agreement with distrust items) and control with one another, and with demographic variables (age and education), and baseline indicators of number of medical visits, iadl disability, and satisfaction with social support. as expected, the two scales of bjw were positively related to each other, with correlations ranging from.41 to.64 ; p <.001. overall, the bjw - self scale, the ftp scale, and fsc scale were positively correlated with one another, with correlations ranging from.34 to.68 ; p <.001. in general, the bjw, ftp, fsc, and trust measures were not correlated significantly with demographic variables of age and education. the one notable exception, however, was that the distrust measure was significantly correlated with age and education, with correlations ranging from.34 to.39 ; p <.001 (note : the detailed table of correlations is available from the authors on request). table 2 provides psychometric information on the predictor variables for mortality risks selected for the research. examination of the mean scores for the various scales for which baseline data were obtained shows that the mean score of the control scale (80.1) was quite elevated when considered within the context of validity norms outlined in paulhus. however, the mean scores for the bjw, ftp, fsc. trust and distrust the internal consistencies of the various trait measures as reported in table 2 are consistent with and converge appropriately with internal consistencies reported for the various scales elsewhere (see [10, 12, 19, 25 ]). when cox proportional hazard models adjusted for age were fitted to estimate the relative risk of death and the importance of each predictor of mortality for the whole sample of 440 participants, the findings showed that bjw (self), ftp, and fsc were positively and significantly related to reduced risk of mortality. in other words, scores on these measures were inversely related to risk of mortality, and associated with a significantly reduced risk of mortality. as seen in table 3, bjw (others), trust, self - esteem, and social support satisfaction were associated with a rather weak or marginal reduction in risk of mortality. by contrast we conducted a hierarchical regression analysis (n = 440) in order to examine further the relative contribution of the variables to risk of mortality (table 4). this analysis revealed the ability of bjw - self to predict risks of mortality over and above other predictor variables. as seen in table 4 (model 1 model 2), results clearly show that adding the cognitive beliefs of bjw (self) variable separately contributed to the explanation of variance in mortality risks significantly and uniquely, over and above that offered by the three variables of ftp, fsc, and distrust. in other words, the results in table 4 confirm that bjw (self) predicts an association with significant reduction in mortality risks independent of the other predictor variables. this rules out the sceptical view that the ability of bjw - self to predict outcomes is an artifact of correlations with other factors previously associated with outcomes of bjw, for example, control or trust. additionally, we conducted a preliminary examination of how deaths were distributed across low, average, and high trait standard scores. the proportionality assumption is violated when the relative risk of the outcome does not change in the same manner for equivalent changes in the levels of a risk factor or covariate. categorical variables may then be appropriate for an otherwise continuous variable and predictors may be trichotomized based on broad cut - off points. although trichotomization may reduce statistical power, it has the possible advantage that trichotomized domain scores will be more readily interpretable. accordingly, following scores on each of the predictor variables (converted to standard scores), tertiles were computed for each of the predictor variable subscale measures. we plotted survival curves showing specifically and with greater focus on the relationship of predictor variables to mortality, with survival rates plotted for extreme high scorers (at 67th percentile and above) and extreme low scorers (at 33rd percentile and below). four survival curves of particular interest and relevance to our research hypotheses are portrayed in figures 1to 3. figure 1 showing the survival curve for beliefs in a just world (bjw - self) suggests that individuals with extreme high scores (at 67th percentile and above) on this dimension are at significantly reduced risk for mortality compared to individuals with extreme low scores (at 33rd percentile and below). the percentages for those who survived in the two groups are 79.6% and 70.7% percent, respectively, indicating a 9% difference in mortality. the ratio of fractions of decedents to survivors (1 0.707)/(1 0.796) = 1.433 (see figure 1) suggests a 43.3% lower risk of death for extreme high scorers compared to extreme low scorers. the findings from the survival curve presented in figure 1 further confirm the predictive ability of this measure seen earlier in table 3 where bjw - self was used as continuous variable in the cox regression analyses. figure 2(a) showing the survival curve for future time perspectives (ftps) suggests that individuals with extreme high scores on this dimension (at 67th percentile and above) are at a significantly reduced risk for mortality compared to individuals with extreme low scores (at 33rd percentile and below). the percentages for those who survived in the two groups are 81.6% and 74.8% percent, respectively, indicating a 7% difference in mortality. the ratio of fractions of decedents to survivors (1 0.748)/(1 0.816) = 1.370 ; (see figure 2(a)) suggests a 37.0% reduced risk of death for extreme high scorers compared to extreme low scorers. the findings from the survival curve presented in figure 2(a) further confirm the predictive ability of this measure seen earlier in table 3 where future time perspective was used as continuous variable in the cox regression analyses. figure 2(b) showing the survival curve for future self - continuity perspectives (fscs) suggests that individuals with extreme high scores (at 67th percentile and above) on this dimension are at a significantly reduced risk for mortality compared to individuals with extreme low scores (at 33rd percentile and below). the percentages for those who survived in the two groups are 79.6 and 74.1 percent, respectively, indicating a 5.5% difference in mortality. the ratio of fractions of decedents to survivors (1 0.741)/(1 - 0.796) = 1.267 (see figure 2(b)) suggests a 26.7% reduced risk of death for extreme high scorers compared to extreme low scorers. the findings from the survival curve presented in figure 2(b) further confirm the predictive ability of this measure seen earlier in table 3 where the future self - continuity perspective measure was used as continuous variable in the cox regression analyses. conversely, the survival curve for distrust (figure 3) suggests that individuals with extreme high scores (at 67th percentile and above) on this dimension, compared with those with extreme low scores (at 33rd percentile and below), are at a significantly increased risk for mortality. the percentages for those who survived in the two groups are 80.3% and 74.8%, respectively, indicating a 5.5% difference in mortality. the ratio of fractions of decedents to survivors (see figure 3) (1 0.748)/(1 0.803) = 1.276 suggests a 27.6% higher risk of death for extreme high scorers on distrust, compared to extreme low scorers. the findings from the survival curve presented in figure 3 further confirm the predictive ability of this measure seen earlier in table 3 where the distrust measure was used as continuous variable in the cox regression analyses. to sum up the results, when the tertile split analysis was done, bjw (self), future time perspectives (ftps) and future self - continuity perspectives (fscs) were found to be differentially associated with mortality risks. when bjw (self) scores, future time perspective scores, and self - continuity or similarity with the future self scores were extremely low (33rd percentile and below), mortality risk was significantly greater, compared to extremely high scores on these measures (67th percentile and above). however, the variable of distrust revealed a somewhat contrasting pattern in the tertile analysis. when distrust scores were extremely low (33rd percentile and below), mortality risk was significantly lower, compared to extremely high distrust scores (67th percentile and above) which were associated with an increase in mortality risk. in a separate set of regression analyses, we explored the influence of three health - related covariates (table 5). these analyses were intended mainly to see whether differences in cognitive predictors of mortality would be maintained after controlling for three health - related covariates assessed at baseline : (1) number of visits in the previous year to medical practitioners and health providers, (2) total index score for the measure of disability (iadl) in daily life activities, and (3) total score for self - rated satisfaction with family and social support. initially, these health - related covariates were controlled for one at a time, using a cox regression analysis procedure. we then re - ran the analysis using multiple regression, adjusting for the covariates (table 5). as seen in table 5, the negative beta values for beliefs in a just world, future time perspective, future self - continuity, and social support satisfaction, and the significant f values observed in the multiple regression analysis are consistent with the direction of reduced risk ratios shown in the relative risk (rr) and 95% confidence interval (ci) model (table 3). similarly, after adjusting for the covariates, the positive direction of the beta values and the significant f values for distrust in the multiple regression analyses is consistent with the direction of increased risk ratios for this variable in the relative risk (rr) and 95% ci model. thus, overall, the relationship between cognitive beliefs about a just world, future time perspectives, and risks for mortality were maintained after adjusting for the health - related covariates. in other words, the direction of the association we saw in the earlier cox regression analyses (table 3) between scores on cognitive beliefs, future perspectives, distrust, and risks for mortality remained unchanged after adjusting for the health - related covariates. in further analyses, we found no statistically significant interaction effects among the sociodemographic variables and health variables relating to the prediction of mortality. consistent with our hypothesis, our findings from the cox regression analysis of the predictor variable of bjw revealed that bjw is positively related to survival. additionally, our findings based on a hierarchical regression analysis of a two - model design show that the variable of bjw (self) had stronger ability than all other cognitive variables explored in this research to predict mortality risk. these findings lend weight to recent theory and research suggesting that the predictive power of bjw - self seems to derive uniquely from perceived justice and that most persons have a strong need to perceive the world to be just, a belief system that conceivably serves to protect their health and survival [10, 14, 23 ]. our findings that high levels of beliefs about justice and fairness are early predictors of longer survival are consistent with our hypothesis. these findings advance and extend the assumptions of earlier researchers ' work on perceived justice and fairness [9, 10 ] as linked to better health and well being. our findings show that individuals ' concern that the world is just to themselves, as distinguished from others, is particularly predictive of their healthy survival. along with earlier researchers, we speculate that bjw for self contributes to a larger extent to individuals ' psychosocial adjustment, providing them with useful resources in times of stress, and correspondingly becomes linked with reduced risks of mortality. in our study, bjw (others) was not differentially linked with mortality risks. however, we can not conclude that bjw - self alone generates the link with reduced risk of mortality. consequently, the mortality correlates with bjw in the spheres of self and others remain to be determined more fully. overall we predicted that while time is finite and limited for all, an increased or more expansive or open - ended future time perspective would reduce the risk of mortality, based on a logical assumption that a more expansive view on time left may promote valuation of future plans to safeguard the future self and protect it against risks of mortality. consistent with our hypothesis, our findings from the cox regression analysis (adjusted for age) show that an expansive future time perspective is associated with a reduced risk of mortality for our older sample. our findings lend support to earlier postulates that the subjective sense of time plays an essential role in human motivation, and gradually time left becomes a better predictor than a range of other cognitive variables that contribute to behavioral and psychological processes at work in old age. the present direction of findings advances and extends assumptions of future time perspectives proposed by previous researchers (e.g.,) according to whom individuals ' perceptions of remaining time to live determines their potential for evaluating and shaping future time and future prospects concerning identity and health. extrapolating from our findings, we speculate that incorporating an expansive time horizon influences individuals to pay relatively greater attention in the time left to make pragmatic and more practical decisions concerning a healthier future life. additionally, we speculate that individuals in our sample who showed more expansive or open - ended time horizons at the time of baseline assessment would have already maximized attempts to preserve and protect future personal health and survival. however, our findings suggest that older adults ' perception of time left is linked rather nonspecifically with risks of mortality. it remains for future researchers to disentangle the specific psychological processes that link limited horizons of time left with increased risk of mortality. overall, we predicted that increased future self - continuity and caring for future self would reduce the risk of mortality, based on a logical assumption that increased future self - continuity perceptions may promote the valuation of future plans to safeguard the future self and to protect it against risks of mortality. consistent with our hypothesis, our findings from the cox regression analysis (adjusted for age) show that future self - continuity as a variable is associated with reduced risk of mortality. extreme high scorers on future self - continuity and caring for the future (i.e., individuals who perceived greater similarity between their present and future self), compared with extreme low scorers (i.e., individuals who perceived minimum similarity between their present and future self) had a significantly reduced risk of mortality (37%). although the present results can not specify the causal direction of the association between future self - continuity and reduced risk of mortality nor specify the health - related processes at work to explain this association, the research findings provide initial evidence that high similarity and high self - continuity with future self is a significant predictor of longevity. overall, our findings fit well with the philosophical analysis by parfit that individuals who feel similar to their future selves are more likely to make more prudent decisions for the future, including health - related decisions, because of their perceived close connectedness to the future self. alternatively, we speculate that individuals who perceived their current physical and mental health to be stable at the time of baseline assessments were also able to identify better with their future self as being one of healthy survival and, therefore, worth protecting. of particular interest, in the context of a longitudinal study, is the initial evidence that behavioral differences in longevity are driven differentially by perceived future self - continuity. our findings from the cox regression analysis, showing that high distrust predicted a significantly increased risk of mortality, are consistent with our hypothesis. these findings are not at variance with earlier theoretical proposals suggesting that historically older adults have had difficulty in accepting the status quo as defined by younger authorities in the social system and may tend to be more distrusting of those authorities. our findings suggest that extreme high levels of distrust which typified some individuals in our sample, compared with extreme low levels of trust, increased the risk of mortality by 27.6 percent. overall, the cox regression analysis revealed that distrust is empirically predictive of an increased risk of mortality. we speculate that high levels of distrust may be analogous to a form of pathological social isolation or breakdown in communications that leads to increased risk for physical and psychological disease [37, 38 ]. conceivably distrust becomes linked with a shorter life span. despite the novelty of our data, and thus the importance of their contribution to cognitive etiology of health - related processes such as survival, mortality, or longevity, our study was subject to the limitation that the sample was a volunteer one. our cognitive scale measures of beliefs in a just world, and other measures exploring individuals ' perspectives on future self - continuity and future time, trust and distrust were self - report measures and subject to the biases associated with self - report measures. the preceding sources of unreliability of measurement could potentially both reduce or increase the proportion of variance in the outcome variables for which our models were able to account. however, we are confident that we had a sufficiently large and representative sample of urban and rural older adults, and the measures we used showed high internal consistency. our study provided novel indications that cognitive belief systems and future time perspectives of older adults may have much to contribute to increased or reduced mortality risks in late life. thus, we suggest that basic cognitive beliefs and future time perspectives that were examined in the present research for their association with increased or reduced risk for mortality are an important direction for future research. it remains for future researchers to try to integrate these various cognitive factors into some kind of theoretical frameworks to gain a precise appreciation of how these factors may be causally linked with longevity. extrapolating from the findings of the study concerning the association between beliefs in a just world and the potentials for a longer survival, it may be reasonable to postulate that the findings have possible implications for clinical practice with older adults who may be dealing with traumatic life events such as life threatening illness, loss of loved ones, and other natural disasters. it is conceivable that these individuals may, as a result of adverse and stressful experiences, feel an abrupt decline in their beliefs in a just world or a decline in their faith or trust in interpersonal connectedness. it is suggested that clinicians be particularly mindful of clients who score extremely low on measures of bjw and future time perspectives.. similarly, those individuals scoring extremely high on measures of distrust and control may be at greater risk of mortality. by exploring with older clients their beliefs about a just world and their trust or faith in interpersonal connectedness, geriatric service providers and psychologists may be able to assist clients to develop a realistic self - profile of their sources of life strengths in relation to self - growth, resilience, and control over every day life situations. thus, clinicians may be able to assist elderly clients to draw on internal sources of strengths, such as reflecting on their beliefs about a just world and their beliefs about trusting others, as a means to strengthening and enhancing future self - continuity. based on our findings suggesting that individuals ' strong beliefs in a just world and positive perspectives regarding future time may possibly protect them against risk to mortality, geriatric service providers are encouraged to engage in a dialogue with their clients on these themes. such dialogues may not only serve to act as buffers for clients against stress and anxiety about the future, but may also assist clients in building up greater motivation for living. from a pragmatic standpoint, we postulate that interventions aimed at strengthening individuals ' beliefs in a just world at an earlier age, and encouraging future - self continuity in the earlier adulthood years, might motivate people to care more for their potential person in the later years, and conceivably keep people healthier longer and thereby reduce risk of mortality. similarly, communication programs that foster interpersonal and institutional trust or help older adults combat high levels of distrust (which in our research were associated with significantly increased risk of mortality) may be of value to a longer survival. | on the basis of postulates derived from cognitive - behavioral theory, research and therapy, the authors explored the extent to which older adults ' cognitive beliefs of a just world and their perspectives on future time and similarity or self - continuity with the future self are predictors of long - term survival. after baseline assessment of health and cognitive beliefs and future perspectives of time and self - continuity as predictors of mortality, 440 participants (ages 65 to 87) were followed longitudinally for 6.5 years. consistent with our hypotheses, findings demonstrated that a significantly higher percentage of survivors were individuals who showed higher scores on beliefs in a just world and on both the future time perspective and the future self - continuity perspective at the time of baseline assessments. conversely, mortality risk was much higher for individuals who scored low on these predictor variables, and high on distrust. implications for health and longevity are discussed. |
being an invasive procedure, it is associated with complications that can be managed conservatively or require surgical intervention. in our case report, we discuss a patient who developed surgical emphysema following a therapeutic colonoscopy without any associated abdominal or chest symptoms and was managed conservatively. this case report highlights one of the rare presentations of colonoscopic perforations and provides a feasible management option for clinicians. a 60-year - old female presented to our endoscopy suite after being referred by her general practitioner for investigation of bleeding and passage of mucus per rectum. her past medical history included being diagnosed with ulcerative colitis 26 years ago during her first pregnancy for which she was treated with steroids and has been relatively healthy since then. this colonoscopy showed quiescent colitis confirmed by biopsy. during the present colonoscopy, she had biopsies taken from her rectum, sigmoid, descending and ascending colon given the findings of pseudopolyps. this was not accompanied by shortness of breath, chest pain or abdominal pain. on examination, her oxygen saturation was 99% on room air, with normal respiratory and heart rate. she had marked crepitus over her clavicles, supraclavicular fossa and most of her neck. her erect chest x - ray revealed air under both hemidiaphragms and significant pneumomediastinum (fig. 1). a computed tomography (ct) scan of her chest, abdomen and pelvis was requested. this ct - scan revealed very extensive spreading of surgical emphysema in the retroperitoneum, extending into the mediastinum with small volumes of free intraperitoneal gas (figs 24). figure 2.ct scan showing an extensive pneumoretroperitoneum. figure 3.ct scan of abdomen showing free intraperitoneal gas compressing the splenic flexure. this consisted of keeping her nil by mouth for 24 h, intravenous fluids and antibiotics. her cervical emphysema gradually resolved and she was discharged 72 h after presentation without any surgical intervention. the rate of perforation following colonoscopy ranges from 0.03 to 0.12% [1, 2 ]. first, it can result from mechanical perforation with the colonoscope and is usually recognized at the time of endoscopy. reported that advanced age, significant comorbidity, obstruction as an indication for colonoscopy and performance of invasive interventions increased the risk of perforation. also reported that older age, male sex, having a polypectomy and a low volume endoscopic service increased the risk of perforation. our patient presented after a therapeutic colonoscopy with cervical emphysema as the initial complaint without any abdominal or chest complaints even though her imaging revealed both pneumoperitoneum and pneumomediastinum. fortunately, she did not exhibit signs of the fourth pneumothorax and did not require a chest drain. this is in stark contrast to previously published case reports where patients developed pneumothoraces requiring chest tube drainage [6, 7 ]. briefly, air in the retroperitoneum can track upwards entering the mediastinum via the hiatus for the aorta and ivc. the air can then continue along fascial planes into the neck resulting in cervical emphysema. additionally, air within the peritoneum can enter the mediastinum via the oesophageal hiatus or can pass through openings in the diaphragm to enter the pleural cavity resulting in pneumothorax. conservative management of perforation following colonoscopy is a safe and acceptable option in patients not exhibiting signs of peritonitis, adequate bowel preparation or silent perforations. additionally, perforations resulting from therapeutic procedures are usually small and are best managed conservatively. | colonoscopy is an invasive procedure used in the detection of colon cancer, inflammatory bowel disease and investigation of bleeding from the rectum. in addition to diagnostic procedures, colonoscopy also has therapeutic indications such as polypectomy and dilation of strictures. we present a case of a patient who presented with cervical emphysema following a therapeutic colonoscopy. the patient had no abdominal or chest pain, shortness of breath and was managed conservatively. perforation following colonoscopy is a rare complication ; however, it is essential that doctors recognize and are aware of the different presentations and management options for this complication. |
a feature of asthma (especially severe asthma) is airway remodelling, that is, increased smooth muscle mass, fibrosis, and excessive mucus production. the epithelium plays a key role in the development of airway remodelling and inflammation as it represents the primary barrier to environmental exposures and also signals to other cell types within the context of the epithelial mesenchymal trophic unit [3, 4 ]. in vitro models using primary cells and cell lines cells are routinely cultured in submerged monolayers on a plastic substrate. in order to obtain a more physiological model, primary human bronchial epithelial cells (hbecs) may be cultured at air - liquid interface (ali) using defined medium to drive a differentiated phenotype. this model shows a pseudostratified, polarised phenotype, including ciliated and goblet cells and develops high transepithelial electrical resistance (teer) [6, 7 ]. measurement of teer provides an indirect measure of formation of tight junctions and is often used as a marker of disruption of the epithelial layer. cultured primary hbecs from asthma and non - asthma subjects have been compared in a number of studies, to investigate intrinsic differences in the asthmatic epithelium. epithelial cells from asthmatic patients display differential expression of genes associated with inflammation, repair, and remodelling and have been shown to differ from normal cells in culture, including increased proliferation and slower repair of a mechanical wound [10, 11 ]. several groups have cultured asthmatic epithelial cells at ali, showing a less differentiated phenotype, that is, increased numbers of basal cells or decreased tight junction formation, and differing responses to stimulation including viral infection, mechanical wounding, and cigarette smoke [1214 ] report no difference in teer between normal and asthmatic cultures, whilst xiao and colleagues suggest that cells from asthmatic subjects show decreased teer and disrupted tight junctions. these discrepancies may reflect differences in donor profile (donors were significantly older in the xiao study), cell source (post mortem donor lungs versus bronchial brushings), or the much greater number of subjects included in the xiao study. paediatric asthmatic hbecs in monolayer culture show slower repair of a mechanical wound [10, 11 ]. at ali, hbecs from asthma donors show increased cytokine release in response to mechanical wounding, or viral or particulate matter exposure, and are more sensitive to disruption of teer by cigarette smoke extract. another study found that whilst hbecs from normal donors showed an increased rate of wound repair in response to il-1 treatment, asthmatic cells did not show this response. these results may suggest that asthmatic cells at ali have an intrinsically different phenotype and show different signalling responses to normal cells and support the utility of epithelial cell culture in asthma research. direct comparisons of normal and asthmatic cells allow characterisation of the asthmatic phenotype ; however, they are less helpful when trying to dissect the underlying mechanisms behind epithelial changes in asthma. normal primary bronchial epithelial cells and cell lines may be used to model various aspects of asthma. cytokines may be added to cells in monolayer or ali culture [1517 ], whilst asthma triggers such as derp1 or rhinovirus have been applied to the cells to mimic allergen inhalation or viral exacerbation [18, 19 ]. treated ali hbecs with il-13 or il-4, resulting in changes in permeability, suggesting that these asthma - related cytokines may contribute to a more secretory phenotype, whilst wadsworth and colleagues found that addition of il-13 and other th2 cytokines led to increased mmp7 and fasl release, which may lead to epithelial damage and inflammation. in another study, hbec or beas-2b cells at ali were treated with leukotriene d4, resulting in signalling via egfr and release of il-8. overall these data demonstrate that the use of hbec and cell line cultures can provide a unique insight into mechanisms underlying asthma and it is important to understand the strengths and weaknesses of these culture systems. accumulating data suggest that bronchial epithelial cells may be a viable drug target in asthma. cell culture models are used in drug development, both to assess the direct effect of potential drugs on cell function and signalling and to investigate drug uptake and metabolism. although primary cells are the gold standard, there are some disadvantages to their use including cost, limited life span, and variability between donors, passage, or experiments. this has led to the use of cell line systems, in both monolayer culture and at ali. the calu-3 cell line was established from a pleural effusion of a lung adenocarcinoma, derived from submucosal gland serous cells [2224 ]. it is often used at ali as a model system, particularly for investigations of tight junction and barrier formation, for instance, showing that rhinovirus infection leads to decreased teer and increased permeability. the beas-2b cell line, originally developed by immortalization of normal human bronchial epithelial cells using ad12-sv40 virus, has been less frequently used at ali ; however there is some literature using beas-2b in this system [17, 26 ]. although these cells have been separately characterised by techniques such as immunofluorescence and teer, no systematic comparison of primary cell and cell line culture models in this system has been reported. the aim of the current study was to evaluate primary and non - primary bronchial epithelial cell culture systems as (ali-) differentiated models for asthma research. we cultured primary hbecs from two donors, calu-3, beas-2b, and beas-2b r1 (a subclone of beas-2b, cultured in the presence of foetal calf serum (fcs)) in their respective media at ali. development of teer was measured over 28 days, rna was collected at days 7, 14, and 21, and immunofluorescence was performed at day 28. we measured expression of a panel of differentiation (-tubulin iv, a ciliated cell marker, and muc5ac, a goblet cell marker) and tight junction / adhesion (e - cadherin and zo-1) markers by real - time quantitative pcr (qpcr) and confocal imaging to allow direct comparison of the phenotype of these different cell systems. we show that although primary cells develop a differentiated phenotype, their teer is highly variable, confirming the need to use multiple experiments and donors in primary cell systems. calu-3 cells showed high teer and similar expression of markers compared to primary cells, suggesting that these cells may be the most suitable model cell line for ali experiments. our work (1) indicates that all model systems, including primary cells, should be validated to ensure that the most suitable model is being used for a specific research question and (2) highlights the difficulties in utilising primary cells in epithelial cell research. human bronchial epithelial cells (nhbec, lonza, wokingham, uk) were expanded in growth factor - supplemented medium (begm, lonza) and differentiated at (ali) at passage 3 - 4 in differentiation medium (bedm) according to a previously published method [15, 28 ]. bedm was composed of 50 : 50 dulbecco 's modified eagle 's medium (dmem, sigma) : bebm (lonza) with lonza singlequots, excluding triiodo - l - thyronine and retinoic acid, but including ga-1000 (gentamicin and amphotericin - b). all experiments were performed using a single lot of bebm and singlequots to avoid batch variation. calu-3 lung adenocarcinoma cells (obtained from atcc) were cultured in dulbecco 's modified eagle 's medium / nutrient mixture f-12 ham (dmem / f12) (sigma) supplemented with 10% fcs, 1% mem non - essential amino acid solution (sigma), and 1% penicillin / streptomycin (sigma). beas-2b, a transformed bronchial epithelial cell line (gift from dr r. clothier, university of nottingham), was cultured in begm and differentiated at ali in bedm. r. penn, university of maryland, philadelphia, pa) was cultured in dmem supplemented with 10% fcs and 1% penicillin / streptomycin. all cells were cultured on 12 mm polyester transwell inserts with a pore size of 0.4 m (corning ny, usa). medium was replaced and the apical face washed with phosphate - buffered saline (pbs) every 48 hours. rna was extracted after 7, 14, and 21 days at ali and cells were fixed for immunostaining after 28 days at ali. the transepithelial electrical resistance (teer) was measured in differentiating cells using an evom2 epithelial volt - ohm meter (world precision instruments uk, stevenage), over 21 to 28 days at ali to confirm development of tight junctions. briefly, medium was aspirated and replaced with 1 ml in the basolateral and 0.5 ml in the apical compartment. teer of insert and medium alone was subtracted from measured teer and cm calculated by multiplying by the insert area. ali cultured cells were fixed in situ on inserts and transferred to glass slides for visualisation. cells were fixed using 4% formaldehyde and blocked / permeabilised with pbs, 10% goat serum, 1% bsa, and 0.15% triton - x. cells were incubated with appropriate primary antibodies at 4c overnight (table 1), and fitc or rhodamine - tritc labelled secondary for 1 hour at room temperature before mounting in hardset dapi (vector labs). controls were incubated with secondary antibody alone or primary isotype control antibody followed by secondary antibody. cells were visualized using the zeiss spinning disk confocal microscope using volocity software (version 5.5, perkinelmer, cambridge, uk). cultured cells were lysed and rna was extracted using silica columns (rneasy mini kit, qiagen, crawley, uk). cdna was synthesized using superscript ii (invitrogen, paisley, uk) and random hexamer primers as per instructions. qpcr was performed using taqman gene expression master mix (applied biosystems, warrington, uk) and hprt1 (4310890e, applied biosystems) endogenous control on a stratagene mxpro3005 machine using 40 cycles of 95c 15 sec, 60c 60 sec. primary hbecs (2 donors) and cell lines were cultured at ali and teer measured every 2 - 3 days for 2128 days (figure 1, table 3). all primary cell experiments were performed at passage 3 - 4 from different frozen vials. experiments performed at passage three (two in donor 1, one in donor 2) developed teer > 350 cm, whilst experiments performed at passage four developed teer 400 cm in all experiments, reaching a peak between days 9 and 12. thereafter, values dropped slightly before reaching a more variable plateau (figure 1(c)). beas-2b reached a maximum teer of 100150 cm by around day 14 (figure 1(d)), regardless of passage, whilst beas-2b r1 did not develop significant teer (figure 1(e)). phase contrast images give a limited indication of these differences ; however gross morphological differences are present (figure 2). calu-3 cells took longest to become fully confluent, probably due to their tendency to form discrete colonies, unlike the other cells which form a more even monolayer. hbecs showed darker areas of denser (probably more stratified) cells and lighter, less dense areas (figures 2(a) and 2(b)). the calu-3 cell phenotype was more homogenous (figure 2(c)), with increased mucus secretion apparent on washing. beas-2b cells consistently developed an apical layer of material which was not removed by washing (figure 2(d)). beas-2b r1 cells had a very homogenous appearance, with no indication of mucus production or differentiation (figure 2(e)). at 28 days, cells were fixed and immunostained with antibodies specific for -tubulin iv and muc5ac (figure 3, table 3). although -tubulin iv is often expressed as a cytoskeletal protein, apical expression is a commonly used marker of ciliated epithelial cells. single image slices and z - stacks are shown to give an indication of the overall level of expression and location in the cell layer (basal versus apical). as ali culture thickness varied between cell types, the brightest image is shown in each case. these were representative of 2 - 3 experiments per donor or cell type. hbec images shown for both donors are from experiments reaching low teer ; however, -tubulin iv and muc5ac expression did not seem to reflect teer values (data not shown). hbecs presented apical -tubulin iv expression in a subset of cells with a greater proportion of cells from donor 1 than donor 2 showing expression. -tubulin iv expression was observed in calu-3 layers but staining was only apparent below the apical pole of the cells. while both hbec donors and calu-3 cells was stained positive for muc5ac expression in a subset of cells towards the apical side of the cell layer, neither beas-2b subtypes showed significant muc5ac staining. sections were costained for expression of zo-1 (a tight junction protein) and e - cadherin (a cell adhesion molecule and epithelial cell marker). the brightest image from each stack was chosen to allow comparison of maximum expression in each cell culture system (figure 4, table 3). both hbec donors showed strong staining for zo-1 that was localised to cell membranes / cell - cell junctions. this staining may be stronger in donor 1 (where teer reached > 350 cm) than donor 2 (where low teer 300 cm) teer, although similarly localised around cell boundaries. in both beas-2b subtypes, zo-1 expression was generally diffuse ; however, beas-2b cells showed membrane localised expression in the apical cell layer. both beas-2b subtypes also showed high non - specific staining with the rabbit isotype control, suggesting that zo-1 protein levels may be lower than they appeared. e - cadherin expression was seen in all cells except beas-2b r1. in both hbec donors and calu-3, expression was tightly localised to the cell membrane / cell - cell junctions, whilst in beas-2b expression was more diffuse in the basal layer, but membrane was localised in the apical layer. cells were harvested for rna at days 7, 14, and 21 during ali differentiation and qpcr performed for muc5ac, -tubulin iv, e - cadherin, and zo-1 (figure 5, table 3). hbec results were taken from experiments in which teer reached > 350 cm (donor 1) and low teer (donor 2), whilst in replicate experiments, teer > 350 cm was reached in both donors. expression levels of all genes were significantly different between cell types, although not between hbec donors (p calu-3>beas-2b > hbec (figure 5(b)). this is in contrast to the immunofluorescence data where staining was lowest in beas-2b r1. expression of e - cadherin was highest in hbec > calu-3 and beas-2b > beas-2b r1 (not detected) (figure 5(c)), whereas immunofluorescence was similar in hbec and calu-3. zo-1 expression (figure 5(d)) was highest in hbec > beas-2b and beas-2b r1>calu-3. we have evaluated two primary human donors of bronchial epithelial cells and calu-3, beas-2b, and beas-2b r1 cell culture systems as ali models of the airway epithelium for asthma research. for the first time, cell lines were directly compared to primary cells (table 3). using measurement of teer, immunofluorescent staining, and qpcr, we have investigated formation of tight junctions (zo-1 and e - cadherin) as well as expression and localisation of suggested markers of ciliated (-tubulin iv) and goblet (muc5ac) cells. the main outcomes of our study are that (1) primary hbecs demonstrate a variable differentiated phenotype with the development of tight junctions and teer showing experiment, passage, and donor variation, (2) calu-3 cells exhibit many of the features of primary cells but have distinct differences including, for example, zo-1 expression, and -tubulin iv localisation, although data generated were more reproducible, and (3) as anticipated, the beas-2b cell lines have limited differentiation capacity in ali models. these data have implications for the use of both primary cells and cell lines for airway epithelial research in asthma. the use of primary hbecs in vitro has provided insight into the potential mechanisms underlying asthma. this is exemplified by the recent findings of xiao and colleagues, demonstrating that asthmatic epithelial cells at ali show disrupted tight junctions and increased macromolecular permeability, reflecting the ex vivo phenotype. another study by hackett. observed an increased cytokine response to particulate matter, viral exposure, or mechanical wounding, demonstrating that asthmatic cells may show an aberrant inflammatory response to common environmental stimuli. primary and cell line systems also play a role in dissecting the signalling networks involved in asthma. normal hbecs at ali treated with th2 cytokines, for instance, show a potentially more secretory phenotype, whilst in hbec or beas-2b cells, leukotriene d4 signals via egfr to release il-8. it is beyond doubt that these epithelial ali culture systems show utility in asthma research ; therefore in the current study, we aimed to provide a direct comparison of a number of cell culture systems used in asthma research to help in selection of appropriate systems for specific research questions. we measured expression of various proteins at the mrna and protein levels as markers of differentiation. although -tubulin iv is widely expressed in cultured cells, apical expression is often used to identify ciliated epithelial cells at ali [27, 30 ], whilst muc5ac is a mucus protein, expressed by goblet cells in the lung epithelium. zo-1 and e - cadherin were included as markers of tight junction formation and barrier integrity. an alternative method of characterising ali cultures is sectioning and performing histochemical analysis to confirm differentiation which gives a clearer indication of the multilayer structure (e.g.). this study is limited by the use of immunofluorescence only ; however we can obtain an overview of the phenotypes of different systems using this method. in this study, we found that mrna expression was not tightly linked to immunostaining, particularly for -tubulin iv, where hbecs showed very low mrna levels but high protein expression. this suggests that mrna expression may not be a good marker of functional status for these genes. differences between mrna and protein levels may reflect experimental or biological issues [32, 33 ]. in our study, samples were taken for qpcr at days 721 and for immunofluorescence at day 28, a limitation which may partially explain these differences. some variation in immunofluorescence between samples may reflect different protein localisation ; that is, diffuse faint staining may reflect similar amounts of protein to bright, localised staining. at the biological level, differences between mrna and protein may reflect variation in posttranscriptional mechanisms between the cell types, such as mrna stability or protein synthesis and turn - over. when culturing primary cells at ali, the choice of medium is very important, with different media delivering different degrees of stratification and cell phenotypes [5, 34 ]. (bedm), which is reported to allow development of a pseudostratified, polarised phenotype, including ciliated and goblet cells. this was confirmed in our hands, with localised expression of e - cadherin, muc5ac, and -tubulin iv observed in both primary cell donors. teer > 350 cm was obtained in the three experiments performed at passage three, whilst teer 400 cm and some expression of zo-1 and e - cadherin. interestingly, although teer was higher and more robust than in the primary hbecs, zo-1 expression at both the mrna and protein levels was lower, demonstrating that other tight junction proteins have a role to play in maintaining teer. however, staining for -tubulin iv expression was diffuse and not clearly located at the apical side, suggesting that villi or cilia had not formed in the calu-3 model, in accordance with previous studies that have shown that ciliated cells are sparse in the calu-3 cell line. the beas-2b cell line was originally developed by immortalization of normal human bronchial epithelial cells using ad12-sv40 virus. this parental population of cells (as well as subclone s6, not used here) retains the ability to undergo squamous differentiation in response to tgf1 or serum. the beas-2b r1 line was derived from the parental population by subculture in the presence of 5% fcs. unlike the parental cell line, these cells are induced to proliferate by serum or tgf1 and have a more fusiform appearance. beas-2b cells (s6 subclone, similar to the parental population) have previously been shown to attain teer > 100 cm at higher passage, in kgm (keratinocyte growth medium, clonetics) when supplemented with calcium, or when grown in begm or laboratory of human carcinogenesis (lhc) serum - free medium., these cells developed an apical layer which stained strongly for -tubulin iv and showed localised zo-1 and e - cadherin staining. it may be the presence of this apical layer that increases the teer, rather than tight junction formation throughout the culture model. there is no literature regarding the use of the beas-2b r1 cell line at ali ; therefore these cells were included essentially as a negative control, cultured in dmem with 10% fcs. as anticipated, these cells did not develop teer and expressed minimal levels of e - cadherin at the rna and protein level. the cells show apical -tubulin iv expression, but no muc5ac or localised zo-1 expression. the reduced e - cadherin expression of this cell line suggests that they may have developed a more mesenchymal phenotype by culturing in the presence of fcs. normal and asthmatic primary bronchial epithelial cells and cell lines are widely used in asthma research. we have evaluated primary bronchial epithelial cells from two donors and three cell lines in an ali model with respect to various markers of differentiation. although primary cells are regarded as the most physiologically relevant, they exhibit a high degree of variability between donors, experiments, and passage, particularly with respect to development of teer. primary cells are costly and therefore unsuitable for large scale experiments such as drug screening ; they also have a finite lifespan and may be difficult to manipulate. we found that calu-3 cells develop a high teer and have a pattern of expression of epithelial markers similar to primary cells. although frequently used in monolayer culture, the two beas-2b cell lines did not perform well in the ali model, showing poor teer and lacking expression of epithelial differentiation markers. this work underlines the importance of using a well - characterised model, suitably validated for the outcomes of interest in any experiment. importantly, this study highlights some of the challenges ahead characterising primary human airway epithelial cells from asthma and control donors accounting for the inter- and intradonor variability identified in the current study. | the aim of the current study was to evaluate primary (human bronchial epithelial cells, hbec) and non - primary (calu-3, beas-2b, beas-2b r1) bronchial epithelial cell culture systems as air - liquid interface- (ali-) differentiated models for asthma research. ability to differentiate into goblet (muc5ac+) and ciliated (-tubulin iv+) cells was evaluated by confocal imaging and qpcr. expression of tight junction / adhesion proteins (zo-1, e - cadherin) and development of transepithelial electrical resistance (teer) were assessed. primary cells showed localised muc5ac, -tubulin iv, zo-1, and e - cadherin and developed teer with, however, a large degree of inter- and intradonor variation. calu-3 cells developed a more reproducible teer and a phenotype similar to primary cells although with diffuse -tubulin iv staining. beas-2b cells did not differentiate or develop tight junctions. these data highlight the challenges in working with primary cell models and the need for careful characterisation and selection of systems to answer specific research questions. |
while it is remarkable to consider the sheer wealth and architectural diversity of natural products that can be produced from a relatively small set of starting materials, equally striking is the number of structures within that collection that can be envisioned to arise via the union of a secondary metabolite with itself. indeed, by some estimates, between 15 and 20% of all natural products likely include a dimerization process at some point in their biogenesis. this analysis includes materials with obvious symmetry, such as sceptrin (1, scheme 1), compounds with equivalent halves but non - symmetric unions, such as complanadine a (2), and materials whose symmetry has been partially erased through subsequent structural modifications like oxidation or decarboxylation, such as cp-225,917 (3). given the significant energy invested in the creation of any natural product, the ubiquity of such dimers is logical, since dimerization enables rapid access to additional molecular scaffolds without invoking entirely new biosynthetic pathways. indeed, with their distinct three - dimensional shapes and functional group presentations, these new materials may well afford evolutionary advantages to the producing species. dimer linkages are colored in purple. considering only those dimeric natural products that possess obvious monomer symmetry (i.e., those that have not undergone extensive modifications, such as 3), nature appears to deploy two general strategies to access such materials. the first and most typical approach forges the dimer in a final synthetic operation from fully functionalized monomers. such processes can range from the simple and direct construction of a single connecting bond to far more complex bond - forming unions, such as that postulated for the conversion of sorbicillin (4) into trichodimerol (5) through a series of michael reactions and ketalizations. in the second dimerization approach, monomer union occurs at an earlier stage, with subsequent tandem modifications of each half leading to the final structure (as in 6 7 8 and 10 11 12). during the past several decades, synthetic chemists have become particularly skilled at utilizing both of these bio - inspired strategies to access dimeric materials from monomers. the first strategy is the most appealing from a retrosynthetic standpoint, especially if it directly replicates nature s synthesis. in practice, though, it often requires extensive screening of conditions to achieve success and sometimes affords only modest yields of final product. the second approach has provided the opportunity for further creativity, as dimers distinct from those deployed by nature can also be elaborated in tandem sequences to the final target. this concept was, to the best of our knowledge, first demonstrated by stork in the synthesis of -onocerin (8) in four steps from 9, and used more recently to great effect by a number of groups, including boger in his approach to 12. it also arguably constitutes the only general solution for dimer synthesis when direct, final - step dimerization can not be achieved, whether due to challenges in target patterning, monomer reactivity, and/or the absence of suitable enzymes to achieve the needed bond constructions. yet, despite their respective advantages, these two approaches also share a potential limitation : the key step linking the monomeric materials typically possesses a single reactive course. thus, if the needed bond(s) and/or stereocenter(s) are improperly established in this operation, it is exceedingly difficult to overcome such results. such issues arose during our efforts to synthesize the coccinellid family of alkaloids, materials secreted by numerous species of ladybugs as defensive compounds when provoked and viewed by some as potential commercial insecticides, particularly for the control of aphid pest populations. figure 1 provides the structures of eight of the nine monomers within this class (1421), tricyclic architectures differing in ring junction stereochemistry, oxidation state, and olefin placement. structures of the coccinellid class of alkaloids : unique monomeric and dimeric frameworks. in addition to these materials, several larger and more complex compounds are known wherein half of their framework possesses these monomer cores, such as chilocorine a (22), as well as two other species that structurally reflect the dimeric combination of these cores in the form of psylloborine a (23) and isopsylloborine a (24). the sole distinction between these latter two natural products is ring - junction enamine isomerism within their fused, highly congested, and stereochemically rich frameworks. to date, the monomeric members have elicited significant synthetic interest, with several approaches based on both classical and modern bond constructions affording every tricycle drawn in figure 1. intriguingly, however, it is only within the past year that the first asymmetric synthesis of any of these members has been accomplished. equally surprising, no work toward any higher - order structure has been reported, nor has any mechanistic hypothesis been advanced to account for dimer formation in nature. to date, that work has identified a single common synthetic intermediate capable of rapidly affording every monomer drawn in figure 1. it has also led to a biosynthetic proposal for the formation of both psylloborine a (23) and isopsylloborine a (24), one that, when reduced to practice, resulted in a non - natural, regioisomeric dimer. this unexpected result, coupled with observations from other instances where incorrect dimeric unions have occurred in biomimetic constructions, has led to the development of a unique, non - biomimetic strategy for complex dimer synthesis. as will be described in the ensuing sections, this alternate strategy has afforded rapid syntheses of both psylloborine a (23) and isopsylloborine a (24) through sequences involving some of the most complex condensation / michael / mannich cascade chemistry yet reported. significantly, this approach can likely be applied to other challenging dimerizations and may, in certain cases, be as efficient and powerful as an overall synthetic design. given the absence of any proposal for how either psylloborine a (23) or isopsylloborine a (24) might arise in nature, we began by pondering mechanistic pathways that could account for their formation from the known tricyclic coccinellid alkaloids. the idea that ultimately proved the most attractive is shown in scheme 2 and was inspired by a key structural observation among the monomers depicted in figure 1. namely, although three of those monomers (1416) have a stable n - oxide counterpart (1921, drawn below its respective precursor), propyleine and isopropyleine (17 and 18, a 1:3 equilibrating mixture in solution, respectively) do not. thus, perhaps the n - oxides of 17 and/or 18 are unstable and, if generated (25), convert to a reactive electrophilic species such as 26. if this material was formed in the presence of a molecule of propyleine (17), then perhaps it could undergo the sequence of events shown in scheme 2, involving a vinylogous mannich reaction, proton transfer, mannich reaction, and terminating proton loss to generate dimers 23 and/or 24. in total, this proposed direct, final - stage dimerization sequence would form two new c the main assumption of this analysis, at least in terms of a successful laboratory execution, is that pre - existing chirality within the monomers could dictate the facial presentation of the reacting partners (i.e., enzymatic intervention would not be required). equally critical, but unclear, were (1) whether one or both dimeric products would result from such a pathway, and (2) whether only propyleine (17) would be the active nucleophile, or if its equilibrating and more dominant enamine isomer, isopropyleine (18), could participate in addition to, or instead of, 17. despite these concerns, the overall attractiveness of such a dimerization process prompted us to test its viability. thus, we set out to develop synthetic pathways to access 17/18 as well as 26. scheme 3 provides a retrosynthetic approach that we hoped could ultimately address the synthetic challenges posed by the nucleophilic and electrophilic partners needed to test our proposed dimerization sequence. as indicated, our goal was to prepare bicyclic intermediate 30 through an intramolecular condensation between the deprotected amine variant of 31 and its neighboring carbonyl. then, if its thermodynamically favored trisubstituted enamine could be isomerized to its less stable, exocyclic counterpart and intramolecularly displace a suitably disposed leaving group, propyleine (17) would result alongside its equilibrating enamine isomer, isopropyleine (18). although isomerization to the exocyclic enamine isomer is clearly disfavored, we believed the final ring formation would be an energetically downhill and essentially irreversible process that would enable the reaction to be driven to completion. worth noting is that this sequence, while not fully biomimetic, is certainly bio - inspired as a disubstituted piperidine undergoing enamine condensation and subsequent attack on an intramolecular electrophile has been proposed to account for the biosynthetic formation of several monomeric alkaloids in this class. indeed, as shown in the lower half of scheme 3, braekman and co - workers demonstrated that polyketo - myristic acid (formed from stearic acid through enzymatic oxidations) is the biosynthetic precursor to coccinelline (19) via the proposed intermediacy of 33, a compound containing a 10-membered ring ; the intervening steps listed above each arrow are one proposal for how these net transformations might specifically occur. our proposed synthesis of 17/18 is based on a similar, but differently ordered, set of chemical events involving no individual ring size greater than six, in which a disubstituted piperidine (34) becomes the tricyclic system through an enamine condensation and a terminating c c bond formation driven by nucleophilic attack of the enamine moiety. assuming success in our proposed synthetic operations leading to 17/18, attempts to generate electrophile 26 in situ through n - oxide formation would then begin. as an alternative approach to access 26, we also considered a de novo preparation from 32, again proposing enamine equilibration and subsequent c c bond formation to close the final ring of its tricyclic framework. given that this proposed key starting material (31) possesses three reactive domains (highlighted in blue, green, and orange) with sufficiently distinct and tunable electrophilic and nucleophilic properties, we also questioned whether every other monomer configuration (i.e., 1416 and 1921) within the class could be accessed from the same entry point. if so, then a near - universal, family - level solution for the coccinellid alkaloids would exist, with enantioselective syntheses of all monomeric members possessing optical activity being achieved, some for the first time. based on this plan, our first objective was to devise an efficient synthesis of our key, common building block (31). as shown in scheme 4, we ultimately developed two different routes to accomplish that goal, both starting from the commercially available n - boc-(s)-()-piperidine-2-ethanol (36). this material was chosen because it possessed a key chiral center that we anticipated would readily encode the remaining stereochemical information into the final target. our first route began with silylation of the alcohol and was followed by a copper - mediated allylation with branched bromide 37, itself available in two steps from propargyl alcohol (see supporting information for synthesis). these operations led to trans - disposed intermediate 38 in 84% overall yield and with > 19:1 diastereoselectivity based on h nmr analysis. with all of the carbons of the final in place, only functional group manipulations and redox adjustments remained. these events began by conversion of 38 into enone 39 through a modestly yielding and sometimes capricious wacker oxidation (41% yield) promoted by pdcl2(phcn)2 in dmf / h2o at 60 c, followed by a nearly quantitative base - induced (naoh) olefin isomerization ; these transformations afforded the new alkene with 4:1 selectivity which we assume to have the structure shown, though we never explicitly confirmed the process as being e - dominant. next, we hoped to set the methyl stereocenter of the target through a diastereoselective reduction. this step ultimately proved to be the most challenging of the sequence, with repeated attempts at substrate - directed hydrogenation using wilkinson s or crabtree s catalysts affording either no diastereoselection or preference for the undesired methyl epimer on 39 or its deconjugated enone precursor. fortunately, use of yamamoto s bulky lewis acid, aluminum tris(2,6-diphenylphenoxide) (atph), in tandem with l - selectride afforded the desired stereocenter with a 15:1 diastereomeric ratio (dr) and in 75% yield. a final desilylation using tbaf in thf at 25 c then delivered the desired building block (31) in a sequence that was just seven steps overall (including the two - step preparation of 37). reagents and conditions : (a) tbdpscl (1.05 equiv), imidazole (2.0 equiv), ch2cl2, 25 c, 19 h ; (b) s - buli (1.5 equiv), tmeda (1.6 equiv), et2o, 78 to 45 c, 1 h ; cucn2licl (1.5 equiv), 78 c, 1 h ; 37 (3.0 equiv), 78 to 25 c, 4 h, 84% over two steps ; (c) pdcl2(phcn)2 (0.1 equiv), cucl (1.0 equiv), dmf / h2o (10/1), o2, 60 c, 6 h, 41% ; (d) naoh (2.0 equiv), i - proh, 25 c, 1 h, 100% ; (e) atph (1.5 equiv), ch2cl2, 0 c, 20 min ; l - selectride (2.0 equiv), 78 c, 1 h, 75%, 15:1 dr ; (f) tbaf (2.0 equiv), thf, 25 c, 2 h, 91% ; (g) tbscl (1.1 equiv), imidazole (2.0 equiv), ch2cl2, 25 c, 19 h ; (h) same as step b but with 40 (5.0 equiv) instead of 37, 92% ; (i) k2oso42h2o (0.005 equiv), naio4 (4.0 equiv), 2,6-lutidine (2.0 equiv), 1,4-dioxane / h2o (3/1), 25 c, 24 h ; (j) 42 (2.2 equiv), thf, 78 c, 2.5 h ; (k) k2oso42h2o (0.005 equiv), naio4 (4.0 equiv), 2,6-lutidine (2.0 equiv), 1,4-dioxane / h2o (3/1), 25 c, 16 h, 95% ; (l) tfaa (5.0 equiv), pyridine (15 equiv), 4-dmap (0.1 equiv), ch2cl2, 0 c, 1.5 h ; (m) dbu (1.5 equiv), ch2cl2, 0 to 25 c, 1.5 h, 80% (n) atph (1.5 equiv), ch2cl2, 0 c, 30 min ; l - selectride (2.0 equiv), 78 c, 1 h ; 1 m hcl (10 equiv), meoh, 25 c, 1 h, 79%. concurrent with these efforts, especially in light of the low - yielding wacker oxidation step, we developed an additional sequence to 31. though slightly longer at eight steps, it proved to be operationally simpler and higher yielding overall. it began similarly from 36, with a two - step sequence of silyl protection of the alcohol (this time as a tbs ether) and a copper - mediated addition using allylic bromide 40 that proceeded in 92% overall yield. subsequent oxidative cleavage of the new alkene, mediated by k2oso4 and naio4, afforded methyl ketone 41. the remaining carbon atoms of the target were then installed via nucleophilic addition of grignard reagent 42, with a second oxidative cleavage then generating the ketone within 43 in 95% yield over three steps. formation of the desired enone was accomplished via trifluoroacetate formation and dbu - induced elimination in 80% yield over two steps. finally, this transformation was followed by the same facially selective hydride delivery, with a terminating in situ deprotection upon quenching of the -reduction product with hcl, completing the synthesis of 31 in 79% yield and in 8:1 dr. worth noting is that both routes contributed substantively to the delivery of material for subsequent studies, with each being performed on relatively large scales. indeed, the first route was able to deliver 2.68 g of 31 in a single campaign, while the second afforded 3.02 g of this key intermediate. with compound 31 in hand, our efforts to synthesize the monomeric members of the coccinellid class began in earnest. starting with propyleine and isopropyleine (17 and 18, scheme 5), we first converted the alcohol within 31 to a reactive bromide (44) through the intermediacy of its n - deprotected tfa salt (tfa ; pbr3, one - pot operation). we then dissolved this material (44) in i - proh and treated it with et3n in hopes that its enamine could be isomerized to its less stable, exocyclic counterpart (45) as noted earlier, thereby inducing a terminating cyclization. pleasingly, this conjecture proved true, affording ()-propyleine (17) and ()-isopropyleine (18) as an equilibrating 1:3 mixture in 43% yield. this nine - step sequence (using the step count of the shorter route to 31) is the first asymmetric solution for these targets and the shortest route to date. in addition, the levorotatory rotation of the final synthetic materials matched that of the natural isolates, confirming the absolute configuration of these compounds for the first time as based on the initial assignment of 36 (cf. reagents and conditions : (a) tfa / ch2cl2 (1:1), 0 c, 1 h ; solvent removal, pbr3 (5.0 equiv), et2o, 70 c, 5 h ; (b) et3n (1.0 equiv), i - proh (cat.), ch2cl2, 25 c, 13 h, 43% yield over two steps ; (c) nabh(oac)3 (5.0 equiv), ch2cl2, 0 c, 3 h, 80%, 3.7:1 dr ; (d) bzonhmehcl (1.0 equiv), dmso, 25 c, 2 d, 62% ; (e) tfa / ch2cl2 (1:1), 0 c, 1 h ; concentrate, pbr3 (5.0 equiv), et2o, 70 c, 5 h ; (f) et3n (0.77 equiv), i - proh (0.91 equiv), ch2cl2, 40 c, 4 h ; concentrate, aq naoh (10 equiv), meoh, 65 c, 6 h, 46% over two steps, 1:1.2 dr, recyclable. from here, subsequent reduction of a portion of these natural products with nabh(oac)3 led to a 3.7:1 mixture of precoccinelline (14) and hippodamine (15, scheme 5). due to the trans - ring fusions of these materials, it was difficult to predict the outcome of this reaction a priori. however, given the observed facial bias, we presume that if the top ring (as drawn in the two - dimensional depiction of 46) were to adopt a twist - boat orientation, as indicated by the three - dimensional representation of imine 46 in scheme 5, then hydride delivery from the bottom face would appear to be preferred, forming precoccinelline (14). if true, then hippodamine (15) would have resulted from hydride delivery onto the other side of the structure. presumably, delivery from the top face, forming hippodamine, forces the methyl group into an unfavorable 1,3-diaxial relationship with the incoming hydride in the transition state, whereas delivery from the opposite face produces no such interaction. from the standpoint of synthesis, however, as precoccinelline (14) has previously been readily converted into its n - oxide congener coccinelline (19, cf. figure 1), its preparation allowed us to claim a formal synthesis of this oxidized monomer as well. alternatively, -oxidation of common intermediate 31 with bzonhmehcl, followed by the same general steps already described (tfa ; pbr3 in one pot then et3n, i - proh ; naoh) generated oxidized skeleton 48 by way of 47 as a mixture of recyclable diastereomers about the new, highlighted chiral center. this compound (48) has previously been advanced by mueller to hippodamine and hippocasine (15 and 16, respectively) as well as their n - oxides (20 and 21, cf. figure 1), thus completing total and/or formal syntheses of all eight monomers drawn in scheme 1, all starting from a single starting material (i.e., 31). with syntheses of our targeted monomers complete, our attention now turned to dimerization. although our proposed nucleophilic partner was already available from the synthesis of propyleine and isopropyleine (17 and 18), efforts to generate a reactive electrophile directly from these materials through n - oxidation were unsuccessful. as such, we sought an alternate and potentially more controlled path to the needed electrophilic dimerization precursor in the form of cross - conjugated diene 49 (scheme 6). our hope was that, upon exposure to an appropriate proton source, iminium electrophile 26 (schemes 2 and 7) could be generated in situ, and then we could expose that species to the appropriate nucleophilic partners. our initial route to access this compound sought to dehydrate 51, itself readily prepared from 31 in just two steps via oxidation and a one - pot tfa - promoted deprotection / condensation / mannich reaction sequence. unfortunately, no conditions were found that could reliably afford 49 from this intermediate. as such, an alternate, slightly longer four - step pathway was developed as shown in the lower half of scheme 6. the key operation was the final step involving dibal - h - mediated reduction of vinylogous amide 53. this step proceeded in 45% conversion (based on crude h nmr of samples accounting for full mass recovery) to afford 49 along with the -reduced counterpart of 53. as this critical compound proved unstable and difficult to purify, it was carried forward directly into dimerization studies once formed. reagents and conditions : (a) (cocl)2 (1.6 equiv), dmso (3.2 equiv), et3n (6.0 equiv), ch2cl2, 78 to 0 c, 90 min, 94% ; (b) tfa / ch2cl2 (1/1), 0 c, 1 h, carried forward crude ; (c) ruo2xh2o (0.10 equiv), naio4 (4.0 equiv), acetone / h2o (1:1), 0 c, 90 min, 77% ; (d) p - nitrophenol (1.2 equiv), dcc (1.2 equiv), 4-dmap (0.10 equiv), 25 c, 20 h ; filter, solvent removal, tfa / ch2cl2 (1:1), 0 c, 1 h ; (e) i - proh (cat.), ch2cl2, 40 c, 18 h, 31% over two steps ; (f) dibal - h (2.5 equiv), thf/1,4-dioxane (4:1), 25 c, 4 min. following extensive experimentation with acid source and solvent, we found that electrophile 26 (scheme 7) could be obtained when 49 was taken up in cd2cl2 (to enable close monitoring by nmr analysis) and exposed to tfa at 25 c. when propyleine and isopropyleine (17 and 18) were then added as a cd2cl2 solution to this electrophile 2 min later, a new dimeric material was formed over the course of 2 h in 21% overall yield from 53. unfortunately, this material did not match the spectral data for either 23 or 24. extensive nmr analysis (h, c, cosy, tocsy, noesy, hsqc, and hmbc ; see supporting information for full details) ultimately revealed that this dimer was non - natural, resulting from incorrect regiocontrol in the union of the two building blocks, as noted by the highlighted carbons within their frameworks. this result meant that isopropyleine (18), not propyleine (17), served as the nucleophilic partner. we have elected to give this new dimeric material, compound 54, the name psylloborine b, should it ever prove to be a natural isolate. reagents and conditions : (a) tfa (1.0 equiv based on vinylogous amide 53), 25 c, 2 min ; 17 and 18 (1:3, 1.07 equiv combined based on vinylogous amide 53), 25 c, 2 h, 21% over two steps. as indicated in figure 2, extensive molecular modeling employing hand - held model kits has provided a rationale as to why this outcome may have occurred. critically, we believe it is the result of kinetic control based on the stereoelectronic and conformational demands of the lone desymmetrizing methyl group within nucleophiles 17 and 18, not the ratio of these two components in solution. in theory, there are a total of four possible reactive pathways : either propyleine or isopropyleine serving as a nucleophile (with the nucleophilic carbons colored to match that of scheme 7), with approach of the electrophile occurring from either the top or bottom face. these possibilities are drawn in figure 2 as transition states a d, all viewed from the perspective of looking down the c n bond of the enamine, with the nitrogen atom located behind the circle of the newman projection. possible basis for the observed dimerization result based on transition - state models for electrophile addition (i.e., 26) using either the propyleine (17) or isopropyleine (18) enamines as nucleophile. based on the analysis provided earlier in the context of scheme 2, the requisite pathway to psylloborine a (23) or isopsylloborine a (24) would require nucleophilic attack by propyleine (transition states a and/or b). in transition state a, a favorable pseudochair - like transition state can be achieved, but it incurs a significant steric penalty by requiring the incoming electrophile to approach syn to the pendant methyl group. in transition state b, addition from the bottom face is now anti to the pendant methyl group, but it seems to require a pseudoboat - like orientation to proceed, with a number of destabilizing flagpole and eclipsing interactions resulting as indicated. by contrast, when isopropyleine (18) is the enamine nucleophile (transition states c and d), there are no proximal substituents that can destabilize the approach of the electrophile as in pathway a or b. therefore, the lowest energy pathway is likely to proceed through these transition states, and thus 54 results. given this experimental outcome, a new synthetic approach was needed for psylloborine a (23) and/or isopsylloborine a (24). ultimately, it was careful consideration of this, as well as other cases where direct dimerization had also failed, which led to the revised retrosynthesis as drawn in scheme 8. this analysis is based on a conceptually different approach for dimer synthesis from those posited within the confines of scheme 1 and centered on the long - established principle that intramolecular linking can potentially overcome those factors governing intermolecular reactivity. specifically, rather than combine advanced materials in a final step or merge simpler materials earlier and then elaborate in tandem, instead (1) link two simpler precursors at an appropriate site to ensure proper regiocontrol and (2) embed enough chiral information and reactivity within the overall structure to establish the remaining rings and stereocenters as well as forge any remaining bonds between the two halves. intramolecular dimerization, and compound 59 was designed for the coccinellid alkaloids on the basis of its general concepts, outfitted with one of the requisite dimer linkages (highlighted in purple in scheme 8) that could not be forged from direct, advanced monomer coupling. from here, two cascades were envisioned to forge the remaining rings, stereocenters, and final dimeric linkage needed to complete the targets. initiation of the first cascade required the ability to differentiate selectively between the protecting groups on the two piperidine rings in 59 to reach 58 via a condensation and michael closure. the second cascade would utilize an added electron - withdrawing group (ewg, colored in blue) on one of the pendant methyl groups of the final target to dictate the correct order of bond constructions through condensation, enamine - based michael attack to form the tricyclic ring system, and a terminating mannich ring - closure to complete the carbon framework. collectively, these two cascades would forge five new bonds, five new rings, and four stereogenic centers, assuming again that pre - existing chirality within 59 could govern the incorporation of the remaining chiral elements. if successful, then a terminating excision of the ewg in cascade product 57 would complete the synthesis of 23 and/or 24. on initial inspection, this approach appears contrary to the general tenets of retrosynthetic analysis, since an arguably more complex precursor and set of terminating events are required than those needed for the two dimerization strategies presented in scheme 1. however, given the failure of direct dimerization and the likely inapplicability of tandem elaboration to a non - symmetric dimer, we required a distinct strategy. one potential and logical benefit of this new approach is that the final stitching operations appear to take advantage of biosynthetic efficiency through the use of cascades that resemble nature s synthesis of the monomeric frameworks. indeed, apart from the linkage within 59, the portions of this material colored in scheme 8 match very closely the analogous portions of structures 55 and 56, moving only one bond colored in black and changing the positioning and identity of the functional groups colored in blue. moreover, we anticipated that this synthetic sequence would not be much longer than the failed direct dimerization strategy. indeed, key test substrate 59 was expected to readily arise from a horner wadsworth emmons coupling between phosphonate 60, a material we anticipated could be readily synthesized, and aldehyde 50, the oxidized version of our key common intermediate for monomer synthesis which was already available on gram scale (cf., the incorporation of this group would be attempted once most of 59 had been assembled to afford opportunities to probe different variants as needed to successfully induce the designed cascades. as shown in scheme 9, the key elements of this new dimerization precursor were indeed synthesized quite readily, starting once again from piperidine 36, the same material used earlier to commence our monomer syntheses. its core elements closely mirror the synthetic pathways described earlier in the context of scheme 4, differing only in terms of the fragments coupled, and thus will not be discussed in detail (scheme 9). pleasingly, after phosphonate 60 was accessed in just six steps from 36, the masamune roush variant of the horner wadsworth emmons reaction (licl, i - pr2net in ch3cn at 25 c) coupled it with aldehyde 50 to afford 65, with the previously inaccessible intermolecular dimerization linkage now in place (highlighted in purple in scheme 9). reagents and conditions : (a) tbscl (1.1 equiv), imidazole (2.0 equiv), ch2cl2, 25 c, 19 h ; (b) sec - buli (1.5 equiv), tmeda (1.6 equiv), et2o, 78 to 45 c, 1 h ; cucn2licl (1.5 equiv), 78 c, 1 h ; allyl bromide (5.0 equiv), 78 to 25 c, 2 h, 91% over two steps ; (c) k2oso42h2o (0.005 equiv), naio4 (4.0 equiv), 2,6-lutidine (2.0 equiv), 1,4-dioxane / h2o (3/1), 25 c, 2.5 h ; (d) 62 (1.22 equiv), ch2cl2, 25 c, 14 h, 84% over two steps ; (e) pd / c (10%, 0.06 equiv), h2, meoh / etoac (3/1), 78 to 25 c, 20 h, 97% ; (f) 64 (2.0 equiv), thf, 78 to 45 c, 1.5 h, 87% ; (g) licl (4.0 equiv), i - pr2net (2.0 equiv), 25 c, 30 min ; 50 (1.0 equiv), 25 c, 4 h ; hcl (6.0 equiv), meoh, 0 c, 25 min, 79%. from here, treatment of 65 (scheme 10) with tfa at 78 c differentiated the two boc - protected piperidine ring systems by taking advantage of neighboring group participation, selectively transforming the upper ring boc group (as drawn) into a base - labile carbamate through cyclization onto the enone while leaving the lower ring boc group intact. although this operation afforded no stereocontrol at the highlighted center within 66, that outcome was of no consequence, as this chiral center would be subsequently destroyed. the synthesis of the key precursor (in protected form as 66) was then completed by oxidizing the alcohol and performing a horner wadsworth emmons coupling with an aryl sulfone - containing phosphonate [either ph-, 3,5-(cf3)2ph-, or 4-no2ph-, vide infra ]. pleasingly, treatment of all three of these variants of 66 with 1,1,3,3-tetramethylguanidine (tmg) in a 9:1 mixture of toluene / i - proh effected the desired reaction sequence of carbamate cleavage, enone regeneration, condensation, enamine equilibration to the exocyclic isomer, and a terminating michael addition. however, despite the high control in bond construction events, the highlighted chiral center within 68 was generated in a 1:1.2 dr favoring the undesired, undrawn epimer. exploration of various conditions revealed that this outcome could not be improved, with several alternatives affording inferior stereoselection. while not optimal, it was certainly an improvement on the direct dimerization approach where that center could not be forged correctly to any degree. reagents and conditions : (a) 10% v / v tfa in ch2cl2 (10 equiv), ch2cl2, 78 c, 2 h, 89%, 2:1 dr ; (b) oxalyl chloride (1.6 equiv), dmso (3.2 equiv), et3n (6.0 equiv), 78 c, 30 min ; 0 c, 1 h ; (c) phosphonate (ar = 3,5-(cf3)2c6h3, 1.0 equiv), licl (2.0 equiv), i - pr2net (2.0 equiv), ch3cn, 25 c, 30 min ; substrate (1.0 equiv), ch3cn, 25 c, 2 h, 67% over two steps (all ensuing yields are for when ar = 3,5-(cf3)2c6h3) ; (d) tmg (1.0 equiv), toluene / i - proh (9:1), 25 c, 5.5 h, 1:1.2 dr ; (e) tfa / ch2cl2, 0 c, 1 h ; (f) c6d6, 65 c, 3 h, 15% yield over three steps (79% yield per transformation) ; (g) 5 wt % na / hg (276 equiv), i - proh, 25 c, 30 min, 46% ; (h) tfa (2.0 equiv), clch2ch2cl, 75 c, 30 min, 75%. pressing forward with both diastereomers (as they could not be separated at this stage when the ewg was an aryl sulfone), treatment of 68 with tfa in ch2cl2 at 0 c for 1 h removed the remaining boc group to unveil the free amine needed to initiate the second cascade. subsequent dissolution in benzene - d6 (to monitor the reaction) and heating at 65 c then initiated that cascade sequence : condensation to 69, michael closure to 70, and a terminating mannich reaction to complete the synthesis of 72. as long as the aryl sulfone was sufficiently electron - deficient [i.e., ar = 3,5-(cf3)2ph- or 4-no2ph- ], these operations proceeded in the order designed however, when the unsubstituted phenyl sulfone was used, a large portion of the material appeared to undergo mannich reaction prior to michael addition to afford materials believed to have structure 71. despite various attempts, these compounds thus, the more electron - withdrawing aryl sulfones seem to have enabled the sequence to succeed by ensuring that michael reaction preceded mannich closure. taken together, these two cascade events arguably constitute the most complex use of condensation / michael / mannich chemistry yet described, given that they involve a total of seven distinct chemical events that forged three c n bonds, five rings, and four stereocenters ; the overall yield obtained for the 3,5-(cf3)2ph variant, at 15%, reflects a throughput of 79% per chemical transformation. finally, exposure of the 3,5-(cf3)2ph derivative of 72 to na / hg amalgam transformed it into psylloborine a (23), a material identical in all respects to the natural isolate, thereby completing the first total synthesis of this molecule as well as that of any dimeric coccinellid alkaloid. as a final experiment, heating this material with tfa in clch2ch2cl at 75 c afforded isopsylloborine a (24), completing the first total synthesis of this dimer as well as establishing 23 as a viable biosynthetic precursor to 24. in total, the route to 23 required 16 linear steps, only four steps more than the original direct dimerization approach that failed to deliver the target, thus highlighting the efficiency of this alternate dimerization strategy. finally, it is worth noting that while only the 3,5-(cf3)2phso2- group afforded complete success for the entire sequence, ewgs other than sulfones were also probed for the final cascades. as shown in scheme 11, use of the same sequence with a simple methyl ketone (i.e., 73, x = me) proceeded in similar overall yield (79% per transformation for the steps shown ; see supporting information) to generate the full heptacyclic core of the dimeric coccinellid alkaloids (74). however, no approach could be discovered to convert the methyl ketone to the final pendant methyl of the target natural products. by contrast, use of a simple methyl ester (i.e., 73, x = ome), a far easier group to potentially remove, arrested at compound 75 with mannich closure preceding michael addition in the second cascade, just as a simple vinyl phenyl sulfone had putatively done (69 71, ar = ph). reagents and conditions : (a) tfa / ch2cl2, 0 c, 1 h ; (b) tmg (2.0 equiv), i - proh, 25 c, 1 h ; (c) i - proh, 60 c, 2.5 h, 38% yield over three steps ; (d) tfa / ch2cl2, 0 c, 1 h ; (e) i - proh, 80 c, 2 h, 56% yield over two steps. scheme 12 provides a possible graphical explanation for sequence arrest, with steric clashing likely being the basis for the failed terminating ring - closure. collectively, these findings reveal overall that, while there is some flexibility in the groups that can allow the key elements of this cascade chemistry to proceed, careful control of electronics is required to fully orchestrate the designed sequences. in summary, a concise synthesis of ten members of the coccinellid family of alkaloids has been accomplished in both total and formal format, all starting from a single, common intermediate. key components of the developed chemistry include the use of several cascade - based bond constructions involving finely tuned and highly reactive intermediates coupled with a new synthetic logic for the formation of dimeric natural products where biomimetic, direct dimerization approaches have failed to control regio- and stereoselectivity. we anticipate that this unique design for dimerization is applicable to a number of other natural product compound classes, foremost of which may be the myrmicarin alkaloids for which available approaches have failed. work is ongoing to verify that assertion, as are biochemical studies of the synthesized materials and efforts to prepare other molecules in the class. | although dimeric natural products can often be synthesized in the laboratory by directly merging advanced monomers, these approaches sometimes fail, leading instead to non - natural architectures via incorrect unions. such a situation arose during our studies of the coccinellid alkaloids, when attempts to directly dimerize nature s presumed monomeric precursors in a putative biomimetic sequence afforded only a non - natural analogue through improper regiocontrol. herein, we outline a unique strategy for dimer formation that obviates these difficulties, one which rapidly constructs the coccinellid dimers psylloborine a and isopsylloborine a through a terminating sequence of two reaction cascades that generate five bonds, five rings, and four stereocenters. in addition, a common synthetic intermediate is identified which allows for the rapid, asymmetric formal or complete total syntheses of eight monomeric members of the class. |
the first description of a surgical technique for tonsillectomy was performed by aulus cornelius celsus, a roman physician of the time of christ, who extracted the tonsils using just his fingers.1 currently, tonsillectomy is one of the most common surgical procedures in the world and the most common in otolaryngology.1 2 over the past decade, there has been progress in surgical and anesthetic techniques for tonsillectomy, resulting in faster surgeries with fewer complications.3 despite the evolution to what is currently considered a safe procedure, pain and bleeding after tonsillectomy remain important surgical complications.2 3 4 post - tonsillectomy pain is attributed to a combination of nervous irritation, inflammation, and spasm of the pharyngeal muscles. several strategies have been studied to achieve better safety and efficacy in relieving postoperative pain, including pharmacologic alternatives, surgical techniques, and cooling of the operative area.3 evaluate the use of cooling the oropharynx intraoperatively to reduce postoperative pain in tonsillectomy with the use of monopolar electrocautery in children. operative tonsillectomy pain is basically characterized by local tissue injury, which releases histamine and inflammatory mediators that activate receptors of pain, causing the transduction and transmission of pain information to the central nervous system (cns) and the process of neurogenic inflammation and vasodilatation determining extravasation of plasma in the periphery.5 new surgical techniques for tonsillectomy recently have been introduced as options : the harmonic scalpel and the coblation (plasma) and microdebrider. these devices operate at a much lower temperature (60c to 100c) than electrocautery and thus are expected to cause less thermal damage and less postoperative pain.2 in contrast with these new techniques, dissection with electrocautery, commonly used as a method of choice, results in faster surgeries and promotes better hemostasis. however, it generates more heat (400c to 6,000c) and thus produces greater thermal damage in tissues and nerve endings of the tonsillar and peritonsillar areas, resulting in greater pain, despite the high hemostatic power.2 3 bipolar instruments (forceps and scissors) cause less thermal damage and less postoperative pain compared with electrocautery, but reports have demonstrated a higher incidence of postoperative pain and bleeding with these instruments compared with tonsillectomy performed by cold dissection with the scalpel.2 several techniques have been studied for the management of postoperative pain. local infiltration of anesthetic in the peritonsillar tissue to reduce post - tonsillectomy pain has not shown conclusive results. steroids, delivered via either systemic administration or peritonsillar infiltration, was not effective in reducing pain.3 some other agents, such as fibrin glue and sucralfate, have been used for wound healing, but with inconclusive results concerning pain reduction.3 the nerves are extremely sensitive to temperature, a fact that has promoted the implementation of cryoanalgesia in pain control.3 6 cryoanalgesia can be applied percutaneously or directly on nerve endings with substances at low temperatures, such as liquid nitrogen or saline solution at 0.9%. when these endings are cooled to 200c or less, they may be functionally inactive for 7 to 10 days due to production of crystals that degenerate the axon and its myelin structure preserving intraneural collagen, allowing total regeneration in 4 to 5 weeks. in this temperature, the other tissues do not suffer any damage. thus, it was postulated that cooling the oropharynx immediately after tonsillectomy can cause neuropraxia of the exposed nerves, reducing inflammation and pain. this relatively simple technique does not seem to be associated with complications.3 7 horii conducted a study with 189 patients under 16 years of age, aiming to compare the post - tonsillectomy pain with bipolar scissors after cooling the pharyngeal mucosa with traditional cold dissection. indications for surgery were recurrent tonsillitis, sleep apnea, and hypopnea obstructive syndrome and iga nephropathy. the mucosa was cooled by oropharynx irrigation with saline solution at a temperature of 4c for 10 minutes after removal of the tonsils. as a result, they achieved significantly lower levels of blood loss and postoperative pain assessed by visual analog scale (vas) of pain in the control group. the study was conducted after approval by the research ethics committee of the red cross hospital (hcv)branch of paran, from june to november 2012. subjects undergoing surgery for other reasons, as well as patients with mental or physical disorders who were unable to be submitted to the protocols of anesthesia and postoperative analgesia, were excluded from the study. patients or caregivers were given verbal and written information for study participation and also signed the consent form. patients were randomized into a control group and a study group, and only one surgeon performed the surgeries in the study. all the patients in the study immediately after the procedure received a single dose of analgesics (dipyrone and ketorolac) and antiemetic medication (ondansetron and dexamethasone). subcapsular dissection with hemostasis by electrocautery monopolar surgical technique was chosen for all tonsillectomies performed in the study. the randomized patients in the experimental group had the oropharynx cooled after tonsil dissection and hemostasis for 10 minutes. the oral cavity was irrigated with 500 ml of 0.9% saline solution, with a temperature between 5c and 10c, for 5 minutes and then aspirated through the oropharynx. in the control group, no intervention was made after tonsil dissection and hemostasis. immediately after the procedure, both groups received routine care. all patients received postoperative analgesia with paracetamol every 6 hours and ketoprofen in cases of severe pain as assessed by parents or by subjects crying. 1) ranging from no pain (0) to severe pain (10). the patients ' parents began the register on the day of surgery and were instructed to repeat this procedure twice a day, once in the morning and again in the evening, at the same times, before the analgesics use. the follow - up of patients was performed typically at 10 and 30 postoperatively days. visual analog pain scale. in addition to the pain scale, the absolute amount of ketoprofen used for the pain relief, ranging from zero to three capsules due to the dosage, was recorded as complementary data that could influence the evaluation of postoperative pain. the data were evaluated between the groups by analysis of variance with p < 0.05 denoting significance using statistica, med soft inc., the sample consisted of 66 patients age 1 to 12 years, 42 boys and 24 girls. after randomization, 33 patients (age 1 to 10 years) were placed in the experimental group and 33 patients (age 1 to 12 years) in the control group. as shown in fig. 2, the post - tonsillectomy pain assessed by vas was lower in the experimental group, in which the cooling technique was used (an average of 4.35 in the control group and 3.42 in the experimental group), with statistically significant differences on days 0, 5, and 6 (p < 0.05). the values obtained in the experimental group were lower than the control group on all days, except days 4 and 10, but it was not statistically significant. average visual pain scalevalues. in the pain assessment based on the need to use ketoprofen (table 1), there was no statistically significant difference between the groups during the study period. in the control group, the greatest day of ketoprofen use was day 7 (2.76 0.33), and this day also had the highest average in pain scale (6.3 0.33). in the experimental group, day 6 had the highest use of ketoprofen (2.89 0.39), but the biggest pain according to the vas of pain, as well as in the control group, was on day 7 (5.33 0.33). numerous studies in the literature suggest that temperature is the most important factor in preventing tissue damage and postoperative pain.6 horii first demonstrated that surgical techniques for tonsillectomy that use some kind of heat could reduce postoperative pain with some kind of cooling of the pharyngeal mucosa when compared with the cold technique. the advantages of a local cold stimulus, according to sylvester,6 include prevention of edema due to a decrease of the liquid inside the tissues, reduced inflammation, decreased metabolism, and better control of bleeding. in our study, we demonstrated that cooling the oropharynx results in clear and significant reduction of post - tonsillectomy pain during the 10-day follow - up after surgery. the mean values of the pain scale, in both groups, gradually decreased during the first 3 days after surgery, then increased from the fourth day, with a peak of pain on the day 7 and further reduction from day 8. this fact, as quoted by cornejo,1 can be explained by the destruction of nerve endings in the tonsillar cavity promoted by the heat of electrocautery ; these endings regenerate in the following days, increasing the perception of pain. as an explanation for the similar ketoprofen consumption between groups, we hypothesized that the availability of medication and guidance to caregivers to administer the anti - inflammatory for possible cases of severe pain experienced by the patient, together with the existing emotional bond, could promote the administration of medication as a way to prevent pain, consciously or not, to prevent the patient 's suffering. studies show that its use results in clear and significant reduction of post - tonsillectomy pain during the 10 days after surgery (28.3% decrease in the evaluation of the visual scale of pain compared with the control group). these patients also returned to school or work 4 days earlier, on average, than those who received no intervention. it has been suggested that cryoanalgesia promotes a return to usual diet before the control group, as well as less need to use analgesics.3 in our study, cooling after tonsillectomy resulted in a 21.4% reduction in the average values obtained by vas of pain. few information is available in the literature about what degrees of reduction in scale values for pain are necessary to be considered clinically significant, with values ranging from 20 to 50%, depending on the initial intensity of pain. we obtained a clinically important reduction in pain after tonsillectomy with cooling of the oropharynx. concerning the limitations of our study, we can mention the exclusive analysis of postoperative pain, not taking into consideration factors such as surgical time and blood loss, which could be factors that cause increased postoperative pain due to greater use of electrocautery. another limiting factor to be considered is the subjectivity of pain assessment by caregivers, especially in younger children who have not developed adequate verbalization and can not properly express the symptoms. our study demonstrated that the use of cooling in the oropharynx after tonsillectomy with the monopolar electrocautery can promote a clinically important reduction in postoperative pain, without additional complications, according to the assessment made by an objective and validated scale of pain. | objective evaluate intraoperative cooling of the oropharynx to reduce postoperative pain in tonsillectomy using monopolar electrocautery. methods sixty - six patients, age 1 to 12 years, were selected for the study, 33 in the control group and 33 in the experimental group. after randomization, patients underwent subcapsular dissection and hemostasis with monopolar electrocautery. patients in the experimental group had the oropharynx cooled after tonsil dissection and hemostasis for 10 minutes. the procedure was done through the oral cavity by irrigation with 500 ml of 0.9% saline, in temperatures between 5c and 10c, for 5 minutes. the evaluation of postoperative pain was made with the pain visual analog scale (vas) for 10 days. as complementary data on the evaluation of pain, we recorded daily use of ketoprofen for pain relief. results pain after tonsillectomy assessed by vas was significantly lower in the experimental group at days 0, 5, and 6 (p < 0.05). there were no differences in the use of ketoprofen between the groups. conclusion cooling of the oropharynx after tonsillectomy promotes clinically significant reduction in postoperative pain, without additional complications. |
kaposi 's sarcoma (ks) is a spindle - cell malignant low - grade vascular tumor associated with human herpesvirus 8 (hhv-8). it was first published by the dermatologist moritz kaposi in the journal archiv fr dermatologie und syphilis, in 1872. in the current literature, four main types of ks are described : (1) epidemic or aids - related ks, (2) ks in immunocompromised patients, (3) classic ks, and (4) endemic or african ks. chronic lymphocytic leukemia (cll) is presented with an increasing number of functionally incompetent mature lymphocytes which are of monoclonal origin, mainly in the peripheral blood, bone marrow, and all throughout the reticuloendothelial system. herein we report an interesting case of ks which was diagnosed during the course of cll as a secondary malignancy. a 64-year - old female case presented with complaints of bluish and indurate lesions all over both lower extremities (fig. after initial evaluation, biopsy was done from the lesions and ks was diagnosed (fig. the patient has had a history of cll since the year of 1999 but she has not needed any active drug treatment since 1999. she did not have any complication such as bacterial infection or hemolytic anemia throughout the disease course. there was no risk factor in her personal history that disposed the patient to aids. quantitative immunoglobulin m and a levels were decreased, whereas immunoglobulin g level was normal. although all tests were negative for systemic involvement of ks, ks lesions have an allover pattern in both extremities, so we planned to administer systemic chemotherapy which consisted of anthracycline, vincristine, and bleomycine. after three cycles of systemic chemotherapy, the lesions had completely disappeared and there was no toxicity of chemotherapeutics. although in the literature, there is a strong relationship between immunosuppression after solid organ transplantation and ks, there is no strong data that shows a relation between cll and ks. patients with cll are prone to the viral, bacterial, and opportunistic infection even without taking any chemotherapeutics. although immunosuppression in cll can dispose the patient to the infection, can it cause tending to the formation of secondary malignancy ? reported that ks is 5 times more common in the cll population than the normal population. in this surveillance analyzed 16,367 patients with cll, so we can not just say that the increased incidence of ks in cll patients is an incidental finding. median latency time between diagnosis of cll and preceding ks was 75 months in this unique study. it is true for all types of ks including aids - related ks, ks in immunocompromised patients, classic ks and endemic or african ks. control of hhv-8 infection is mediated by an antiviral t - cell response to hhv-8 proteins. latent hhv-8 infection of endothelial cells can cause subsequent conversion of endothelial cells into the spindle cells. then the proliferative phase started, and vegf secretion increased from the infected endothelial cells. this activation plays a pivotal role in the development of the final tumor. is this a mechanism that causes ks in cll patient ? we know that there is an imbalance in circulating t - cell subpopulations in cll. so theoretically, latent hhv-8 infection can be reactivated in cll patients and can trigger ks lesions. in conclusion, cll can dispose to the development of ks but the exact mechanism is not explained as much as ks preceding solid organ transplantation. so physicians should be very careful about the probability of ks in newly and progressively developing skin lesions in cll. | cutaneous manifestations can occur in the wide range of internal malignancy. they can occur by metastases or local spread, direct infiltration, or a site of primary malignancy itself. sometimes these manifestations are related with an underlying malignancy but they do not contain malignant cells as paraneoplastic dermatological syndromes. chronic lymphocytic leukemia (cll) is the most common leukemia all over the world. cutaneous lesions occur in up to 25% of patients. most commonly seen cutaneous lesions in cll are those of infectious or hemorrhagic origin. skin cancer risk was also increased eightfold in cll when compared with normal population, so cutaneous lesions in cll can be the first manifestation of secondary skin malignancy. herein, we report an interesting case of kaposi 's sarcoma which was diagnosed during the course of cll. |
pregnancy - associated gastric cancer is rare, occurring in only 0.025% to 0.1% of all pregnancies.1 gastric cancer diagnosed during pregnancy can be a devastating situation for the mother and the fetus, and patients with gastric cancer diagnosed during pregnancy have a dismal prognosis.2 in many cases pregnancy - associated gastric cancer is diagnosed at an advanced stage and only 45% to 56% of patients undergo surgical resection.3 the diagnosis of this type of cancer is difficult because symptoms such as nausea, vomiting, or abdominal discomfort are generally overlooked during pregnancy.4 we report three cases of gastric cancer during pregnancy with different outcomes. in table 1, we present a summary of the clinical characteristics, treatment, and outcomes of each patient. a 27-year - old woman, gravida 3, para 2, was admitted with a 1-month history of epigastric pain and weight loss (7 kg). at the time of admission esophagogastroduodenoscopy (egd) was performed, revealing a large borrmann type iv gastric tumor. a biopsy was performed, and a diagnosis of poorly differentiated adenocarcinoma with signet - ring cell morphology was made. magnetic resonance imaging revealed thickening of the gastric wall, metastatic celiac axis lymph nodes, and peritoneal dissemination (fig. the patient 's case was discussed during a tumor board meeting with surgical, medical oncology, and obstetrics specialists. it was determined that the patient should be treated with palliative chemotherapy with 5-fluorouracil (5-fu) and cisplatin. the patient underwent four chemotherapy cycles of 5-fu (1,000 mg / m, 24 hours infusion) on days 1, 2, 3, 4 and cisplatin fourteen weeks after diagnosis, at week 26 of the pregnancy, the patient had a spontaneous delivery. the newborn required ventilatory support due to respiratory failure, renal and cardiac insufficiency, and he died 15 days after birth. a 33-year - old woman, gravida 2, para 1, was admitted to the emergency department with a 2-month history of abdominal pain and weight loss (21 kg). an abdominopelvic computed tomography (ct) scan revealed gastric wall thickening and a gravid uterus, with no signs of dissemination (fig. we recommended immediate surgery, but the patient refused due to concerns regarding the risk of perioperative abortion. the medical team, in agreement with the patient, decided on neoadjuvant chemotherapy with four cycles of folfox4. the patient was treated with folfox4 as follows : intravenous (iv) administration of 85 mg / m oxaliplatin, 200 mg / m leucovorin, and iv push administration of 400 mg / m 5-fu on day 1, and 600 mg / m 5-fu iv continuous infusion for 24 hours on days 1 and 2. the patient went into spontaneous delivery, and gave birth to a male infant weighing 3.150 kg, with an apgar score of 9/9. one month after delivery, the patient underwent a radical total gastrectomy with d2 lymph node dissection. histopathological examination of the resected specimen revealed serosal involvement of the gastric wall and lymph node metastasis in 15 out of 31 resected nodes. the pathologic stage was piiic (t4an3m0, union for international cancer control / american joint committee on cancer [uicc / ajcc ] 7th edition). she received adjuvant chemoradiotherapy as described in the study by macdonald and colleagues.5 the regimen consisted of 5-fu (425 mg / m / day) and leucovorin (20 mg / m / day) for 5 days, followed by radiation to a total of 45 gy (1.8 gy per day, 5 days / week for 5 weeks) beginning on day 28, with 5-fu (400 mg / m / day) and leucovorin (20 mg / m / day) for the first 4 days and the last 3 days of radiotherapy. one month after radiotherapy, two additional cycles of 5-fu and leucovorin were administered once every 28 days. however, the patient developed pulmonary metastasis and died of recurrence 41 months after surgery. a 29-year - old woman, gravida 3, para 2, had a 1-year history of epigastric pain. abdominopelvic ct demonstrated prepyloric gastric wall thickening, with no signs of dissemination (fig. the results of a human chorionic gonadotropin blood test and an us confirmed that the patient was 6 weeks pregnant. following the tumor board meeting, surgery during the second trimester the medical team decided to perform surgery at week 14 of the pregnancy, to which the patient agreed. an open radical subtotal gastrectomy was performed with d2 lymph node dissection ; r0 resection was achieved. histopathological examination revealed subserosal involvement of the gastric wall and lymph node metastasis in 9 out of 25 resected nodes. the disease was classified as stage piiib (t3n3m0, ajcc / uicc 7th edition). the patient was discharged 9 days after surgery with no complications. after confirming adequate fetal development, an elective cesarean section was decided upon at week 32 of gestation, mainly to avoid further delays in the start of adjuvant treatment. a male infant weighing 1.750 kg, with an apgar score of 8/9, was delivered. a 27-year - old woman, gravida 3, para 2, was admitted with a 1-month history of epigastric pain and weight loss (7 kg). at the time of admission esophagogastroduodenoscopy (egd) was performed, revealing a large borrmann type iv gastric tumor. a biopsy was performed, and a diagnosis of poorly differentiated adenocarcinoma with signet - ring cell morphology was made. magnetic resonance imaging revealed thickening of the gastric wall, metastatic celiac axis lymph nodes, and peritoneal dissemination (fig. the patient 's case was discussed during a tumor board meeting with surgical, medical oncology, and obstetrics specialists. it was determined that the patient should be treated with palliative chemotherapy with 5-fluorouracil (5-fu) and cisplatin. the patient underwent four chemotherapy cycles of 5-fu (1,000 mg / m, 24 hours infusion) on days 1, 2, 3, 4 and cisplatin (75 mg / m) on day 1. fourteen weeks after diagnosis, at week 26 of the pregnancy, the patient had a spontaneous delivery. the newborn required ventilatory support due to respiratory failure, renal and cardiac insufficiency, and he died 15 days after birth. a 33-year - old woman, gravida 2, para 1, was admitted to the emergency department with a 2-month history of abdominal pain and weight loss (21 kg). an abdominopelvic computed tomography (ct) scan revealed gastric wall thickening and a gravid uterus, with no signs of dissemination (fig. we recommended immediate surgery, but the patient refused due to concerns regarding the risk of perioperative abortion. the medical team, in agreement with the patient, decided on neoadjuvant chemotherapy with four cycles of folfox4. the patient was treated with folfox4 as follows : intravenous (iv) administration of 85 mg / m oxaliplatin, 200 mg / m leucovorin, and iv push administration of 400 mg / m 5-fu on day 1, and 600 mg / m 5-fu iv continuous infusion for 24 hours on days 1 and 2. the patient went into spontaneous delivery, and gave birth to a male infant weighing 3.150 kg, with an apgar score of 9/9. one month after delivery, the patient underwent a radical total gastrectomy with d2 lymph node dissection. histopathological examination of the resected specimen revealed serosal involvement of the gastric wall and lymph node metastasis in 15 out of 31 resected nodes. the pathologic stage was piiic (t4an3m0, union for international cancer control / american joint committee on cancer [uicc / ajcc ] 7th edition). she received adjuvant chemoradiotherapy as described in the study by macdonald and colleagues.5 the regimen consisted of 5-fu (425 mg / m / day) and leucovorin (20 mg / m / day) for 5 days, followed by radiation to a total of 45 gy (1.8 gy per day, 5 days / week for 5 weeks) beginning on day 28, with 5-fu (400 mg / m / day) and leucovorin (20 mg / m / day) for the first 4 days and the last 3 days of radiotherapy. one month after radiotherapy, two additional cycles of 5-fu and leucovorin were administered once every 28 days. however, the patient developed pulmonary metastasis and died of recurrence 41 months after surgery. a 29-year - old woman, gravida 3, para 2, had a 1-year history of epigastric pain. a prepyloric ulcer was diagnosed on egd. abdominopelvic ct demonstrated prepyloric gastric wall thickening, with no signs of dissemination (fig. the results of a human chorionic gonadotropin blood test and an us confirmed that the patient was 6 weeks pregnant. following the tumor board meeting, surgery during the second trimester was recommended. the medical team decided to perform surgery at week 14 of the pregnancy, to which the patient agreed. an open radical subtotal gastrectomy was performed with d2 lymph node dissection ; r0 resection was achieved. histopathological examination revealed subserosal involvement of the gastric wall and lymph node metastasis in 9 out of 25 resected nodes. the disease was classified as stage piiib (t3n3m0, ajcc / uicc 7th edition). the patient was discharged 9 days after surgery with no complications. after confirming adequate fetal development, an elective cesarean section was decided upon at week 32 of gestation, mainly to avoid further delays in the start of adjuvant treatment. a male infant weighing 1.750 kg, with an apgar score of 8/9, was delivered. gastric carcinoma is rare in patients younger than 40 years old,6 and even rarer during pregnancy. gastric carcinoma in young patients tends to be poorly differentiated, with an overall poor prognosis.3 the helicobacter pylori infection rate is significantly higher in pregnant women than in non - pregnant women (26.6% versus 11%).7 furthermore, the secretion of gastric acid decreases during pregnancy, while the production of gastric mucus increases. histaminase produced by the placenta deactivates histamine function ; therefore, the patient exhibits no deterioration of symptoms caused by a cancerous ulcer.8 the pathogenesis of pregnancy - related gastric cancer is a matter of discussion. furukawa.9 suggested that pregnancy and/or delivery in young women accelerates the growth of stomach cancer, whereas jaspers.10 suggested that clinical features and prognosis in gastric cancer during pregnancy did not differ from those in other young patients. a japanese review of 61 patients with gastric cancer diagnosed during pregnancy reported that only 47.5% of patients underwent surgery. the patients who underwent gastrectomy had a high incidence of in - hospital death (22.7%) and a poor prognosis, with a 3-year survival rate of 21.1%.11 the prognosis of gastric cancer during pregnancy is poor because most cases present at an advanced stage ; the diagnosis is delayed because the symptoms are all nonspecific for cancer and are attributed to the pregnancy.12 in accordance with this, our three patients were diagnosed with stage iii~iv disease. chemotherapy for unresectable gastric cancer during pregnancy is complicated because there are two aspects to consider. second is the importance of continuing the pregnancy as long as possible to ensure the safety of the fetus.13 ueo.11 reported that treatment of pregnancy - associated gastric cancer depends on gestational age and the stage of the gastric cancer. prior to 22 weeks of gestation, the mother should be treated after termination of the pregnancy by abortion. in chile, abortion under any circumstances is prohibited by law ; therefore, for this reason, this option could not be considered for our patients. in the first case, palliative chemotherapy was performed because the patient presented with stage iv gastric cancer. in the second and third cases,, neoadjuvant chemotherapy was administered after careful consideration owing to the mother 's refusal to undergo surgery during pregnancy. herein, it is difficult to draw firm conclusions, but both treatment strategies proved to be safe and allowed a r0 resection and a satisfactory fetal outcome. the use of chemotherapy during the first trimester increases the risk of spontaneous abortion, fetal death, and major malformations ; therefore, chemotherapeutic agents are not recommended during this period.14 in the second trimester, there are no major differences in the incidence of malformations between infants from normal pregnancies and those from pregnancies in which chemotherapy was administered.15 there is no standard chemotherapy regimen for treatment during pregnancy. in conclusion, diagnosis is generally at an advanced stage due to symptoms that are frequently observed in a normal pregnancy. a multidisciplinary approach, with medical oncologists, surgeons, and obstetricians is essential for adequate therapeutic decision - making in this difficult and rare scenario. | pregnancy - associated gastric cancer is extremely rare. in many cases, it is diagnosed at an advanced stage because the symptoms during pregnancy are generally overlooked. we report three cases of gastric cancer during pregnancy with various outcomes. the first case included a patient with stage iv gastric cancer who received palliative chemotherapy. this patient had a preterm birth and died 7 months after diagnosis. the second case received neoadjuvant chemotherapy during pregnancy and a total gastrectomy was performed after delivery. she then received adjuvant chemoradiotherapy. this patient developed pulmonary metastasis and died of recurrence 41 months after surgery. in the third case, a distal subtotal gastrectomy was performed at week 14 of pregnancy, with no complications. the patient received adjuvant chemoradiotherapy. she is currently without recurrence 14 months after surgery. in patients with pregnancy - associated gastric cancer, treatment decisions are predominantly influenced by clinical stage and gestational age at diagnosis. |
obstructive sleep apnea (osa) is a common sleep disorder and is characterized by repeated episodes of partial (hypopnea) or complete (apnea) obstruction of the upper airway during sleep due to pharyngeal collapse, resulting in recurrent chronic intermittent hypoxia and fragmentation of sleep.1 population - based epidemiological studies indicate that osa affects at least 3%7% of middle - aged adult men, 2%5% of women, and up to 4% of children.26 osa may cause excessive daytime sleepiness, frequently altered cardiopulmonary function, independently increased risk for hypertension, insulin resistance, cardiovascular disease, and motor vehicle accidents.710 for patients, osa can result in deficits in executive function, memory, coordination of movement,11 and attention.12 although the main contributory factors are presumed to be sleep fragmentation and intermittent nocturnal hypoxemia during sleep apneas,13 the pathological mechanism of the brain deficits is still unclear. to date, limited work has been done to investigate osa within a neuroscientific framework, and only a handful of studies have directly addressed the neural basis for the osa trait in patients. previous neuroimaging studies have documented altered gray matter volume deficits in the hippocampus,1416 temporal lobe, frontal lobe, anterior cingulate cortex, and cerebellar regions17,18 in patients with osa using the voxel - based morphometry method. moreover, diffusion tensor imaging studies show a wide range of white matter integrity changes within the corpus callosum, frontal cortex, temporal cortex, parietal cortices, cingulum bundle, and cerebellum.1921 magnetic resonance spectroscopy is also a useful neuroimaging tool because it provides a measure of changes in cerebral metabolism that may reflect pathological insults to brain integrity. several studies using magnetic resonance spectroscopy have demonstrated significant metabolic changes in osa.2224 although these studies have focused on structural and metabolic changes in the brains of patients with osa, little research has been undertaken to examine how the human brain is affected by osa, leaving the mechanisms unclear. functional magnetic resonance imaging (mri), a noninvasive, high spatial, and temporal resolution technique, can reflect the intrinsic functional organization of the human brain.25 previous functional mri studies of osa have mainly focused on task studies and more employ either respiratory or cognitive challenges, significant changes are found in brain activation levels compared with good sleepers (gss).2628 in recent years, resting - state functional mri has become a hot topic in neuroimaging studies. regional homogeneity (reho), a newly developed resting - state functional mri approach, can analyze the similarities and coherence of intraregional spontaneous low - frequency (30. exclusion criteria for both patients and gss were as follows : other sleep disorders, such as insomnia and a sleep - related eating disorder ; history of cardiovascular disease, hypothyroidism, or diabetes mellitus ; left - handedness ; alcohol or illicit drug abuse, or current intake of psychoactive medications ; a central nervous system disorder (neurodegenerative disease, epilepsy, head injury, psychosis, current depression) ; and contraindications to mri, such as claustrophobia, metallic implants, or devices in the body. all subjects underwent a cognitive assessment using the montreal cognitive assessment administered by two independent neuropsychologists. this study was approved by the human research ethics committee at the first affiliated hospital of nanchang university, and all participants provided their written informed consent. we used standard overnight polysomnography with the le - series physiological monitoring system (alice 5 le, respironics, orlando, fl, usa) in the sleep center of our hospital, along with standard electroencephalogram, electrooculogram, chin electromyogram, and electrocardiogram checks simultaneously. apnea was defined as continuous cessation of airflow for more than 10 seconds and hypopnea was defined as a decrease in airflow by more than 30% with arousal or oxygen desaturation more than 4%.35,36 the ahi was determined by dividing the average of the total number of apnea / hypopnea events by the estimated hours of sleep. mri scanning was performed on a 3-tesla mr scanner (siemens, munich, germany). the scans consisted of a location image, t1-weighted sagittal images, t2wi axial / coronal images, and functional images. for the t1 sagittal images, 176 images were obtained (repetition time 1,900 msec, echo time 2.26 msec, thickness 1.0 mm, gap 0.5 mm, acquisition matrix 256256, field of view 250 mm 250 mm, flip angle 9 degrees). finally, at the same position, 240 functional images were obtained (repetition time 2,000 msec, echo time 30 msec, thickness 4.0 mm, gap 1.2 mm, acquisition matrix 6464, flip angle 90 degrees, field of view 230 mm 230 mm, 30 axial slices with gradient - recalled echo - planar imaging pulse sequence covering the whole brain). the first ten time points for the functional images were discarded due to the possible instability of the initial mri signal and the participants adaptation to the scanning environment. on the basis of matlab2010a software (mathworks, natick, ma, usa), the rest of the data preprocessing was performed using dparsfa software (http://rfmri.org/dparsf), including dicom form transformation, slice timing, head motion correction, and spatial normalization. motion time courses were obtained by estimating the values for translation (mm) and rotation (degrees) for each subject. participants who had more than 1.5 mm maximum displacement in x, y, or z and 1.5 degrees of angular motion during whole functional mri scans were rejected. the six friston head motion parameters was used to correct for the effects of head motion based on recent work showing that higher - order models are more effective in removing head motion effects.37,38 after correction for head motion, the functional mri images were spatially normalized to the montreal neurological institute space using the standard echo - planar imaging template in statistical parametric mapping 8 (http://www.fil.ion.ucl.ac.uk/spm) software and resampling the images at a resolution of 3 mm 3 mm 3 mm. after preprocessing, the time series for each voxel were detrended and filtered (bandpass 0.010.08 hz) to reduce low - frequency drift and high frequency physiological respiratory and cardiac noise and time series linear detrending. reho computation based on protocols from previous studies was performed with rest software (http://www.resting-fmri.sourceforge.net).29 individual reho maps were generated by calculating kendall s coefficient of concordance (kcc) for the time series of a given voxel with those of its nearest neighbors (26 voxels) in a voxel - wise analysis. the computational formula was39 reho=(ri)2n(r)2k2(n3n)/12, where reho is the kcc among the given voxels, ranging from 0 to 1 ; when a given cluster and its adjacent cluster in a time series is more consistent, the kcc value is more close to 1. k is the voxel number of time series within a measured cluster (the smallest unit of measured reho, comprised of more adjacent clusters) ; here, k = 27 (one given voxel which was located in the cubic center plus its adjacent 26 voxels) ; n is the number of ranks ; ri is the sum rank of the ith time point, where r = (n + 1)k/2 is the mean of the ri values ; the standard reho value is the reho value of each cluster / mean of the whole brain reho value ; thus, the individual reho map was generated for each dataset. to reduce the influence of individual variations in kcc value, normalization of the reho maps was done by dividing the kcc for each voxel by the average kcc of the whole brain. the resulting functional mri data were then spatially smoothed with a gaussian kernel of 666 mm full - width at half - maximum. one - sample t - tests were first performed within each group to detect where the standardized kcc values were larger than the global mean kcc. the between - conditions statistical threshold was set at a cluster size of p 30. exclusion criteria for both patients and gss were as follows : other sleep disorders, such as insomnia and a sleep - related eating disorder ; history of cardiovascular disease, hypothyroidism, or diabetes mellitus ; left - handedness ; alcohol or illicit drug abuse, or current intake of psychoactive medications ; a central nervous system disorder (neurodegenerative disease, epilepsy, head injury, psychosis, current depression) ; and contraindications to mri, such as claustrophobia, metallic implants, or devices in the body. all subjects underwent a cognitive assessment using the montreal cognitive assessment administered by two independent neuropsychologists. this study was approved by the human research ethics committee at the first affiliated hospital of nanchang university, and all participants provided their written informed consent. we used standard overnight polysomnography with the le - series physiological monitoring system (alice 5 le, respironics, orlando, fl, usa) in the sleep center of our hospital, along with standard electroencephalogram, electrooculogram, chin electromyogram, and electrocardiogram checks simultaneously. apnea was defined as continuous cessation of airflow for more than 10 seconds and hypopnea was defined as a decrease in airflow by more than 30% with arousal or oxygen desaturation more than 4%.35,36 the ahi was determined by dividing the average of the total number of apnea / hypopnea events by the estimated hours of sleep. mri scanning was performed on a 3-tesla mr scanner (siemens, munich, germany). the scans consisted of a location image, t1-weighted sagittal images, t2wi axial / coronal images, and functional images. for the t1 sagittal images, 176 images were obtained (repetition time 1,900 msec, echo time 2.26 msec, thickness 1.0 mm, gap 0.5 mm, acquisition matrix 256256, field of view 250 mm 250 mm, flip angle 9 degrees). finally, at the same position, 240 functional images were obtained (repetition time 2,000 msec, echo time 30 msec, thickness 4.0 mm, gap 1.2 mm, acquisition matrix 6464, flip angle 90 degrees, field of view 230 mm 230 mm, 30 axial slices with gradient - recalled echo - planar imaging pulse sequence covering the whole brain). the first ten time points for the functional images were discarded due to the possible instability of the initial mri signal and the participants adaptation to the scanning environment. on the basis of matlab2010a software (mathworks, natick, ma, usa), the rest of the data preprocessing was performed using dparsfa software (http://rfmri.org/dparsf), including dicom form transformation, slice timing, head motion correction, and spatial normalization. motion time courses were obtained by estimating the values for translation (mm) and rotation (degrees) for each subject. participants who had more than 1.5 mm maximum displacement in x, y, or z and 1.5 degrees of angular motion during whole functional mri scans were rejected. the six friston head motion parameters was used to correct for the effects of head motion based on recent work showing that higher - order models are more effective in removing head motion effects.37,38 after correction for head motion, the functional mri images were spatially normalized to the montreal neurological institute space using the standard echo - planar imaging template in statistical parametric mapping 8 (http://www.fil.ion.ucl.ac.uk/spm) software and resampling the images at a resolution of 3 mm 3 mm 3 mm. after preprocessing, the time series for each voxel were detrended and filtered (bandpass 0.010.08 hz) to reduce low - frequency drift and high frequency physiological respiratory and cardiac noise and time series linear detrending. reho computation based on protocols from previous studies was performed with rest software (http://www.resting-fmri.sourceforge.net).29 individual reho maps were generated by calculating kendall s coefficient of concordance (kcc) for the time series of a given voxel with those of its nearest neighbors (26 voxels) in a voxel - wise analysis. the computational formula was39 reho=(ri)2n(r)2k2(n3n)/12, where reho is the kcc among the given voxels, ranging from 0 to 1 ; when a given cluster and its adjacent cluster in a time series is more consistent, the kcc value is more close to 1. k is the voxel number of time series within a measured cluster (the smallest unit of measured reho, comprised of more adjacent clusters) ; here, k = 27 (one given voxel which was located in the cubic center plus its adjacent 26 voxels) ; n is the number of ranks ; ri is the sum rank of the ith time point, where r = (n + 1)k/2 is the mean of the ri values ; the standard reho value is the reho value of each cluster / mean of the whole brain reho value ; thus, the individual reho map was generated for each dataset. to reduce the influence of individual variations in kcc value, normalization of the reho maps was done by dividing the kcc for each voxel by the average kcc of the whole brain. the resulting functional mri data were then spatially smoothed with a gaussian kernel of 666 mm full - width at half - maximum. one - sample t - tests were first performed within each group to detect where the standardized kcc values were larger than the global mean kcc. the between - conditions statistical threshold was set at a cluster size of p<0.001, voxels at p<0.001, and a cluster volume 1,080 mm (a minimum continuous cluster volume of 1,080 mm), corrected by the false discovery rate. group differences based on the reho method were investigated using a two - samples t - test in the rest tool kit. the ages were included as nuisance covariates (variables of no interest) to remove the residual effect in the statistical models applied. a corrected significance level of individual voxel p<0.001 and cluster volume 1,080 mm, using a false discovery rate - corrected threshold of p<0.05, was used to determine the between - conditions statistical significance. based on our reho findings, we identified brain regions that demonstrated significant between - group differences. these regions were classified as regions of interest and saved as masks with rest software. for each region of interest, the mean reho value was extracted by averaging reho values over all voxels for each patient with osa. finally, the mean reho values were entered into statistical package for the social sciences version 17.0 software (spss inc, chicago, il, usa) to calculate their correlation with behavioral performance. the patients with osa had significant higher scores for body mass index (t=6.25, p<0.001), ahi (t=15.51, p<0.001), spo2 < 90% (t=6.66, p<0.001), and epworth sleepiness scale (t=7.64, p<0.001) when compared with gss. compared with gss, patients with osa showed a significantly lower reho in the right medial frontal gyrus (ba11), the right superior frontal gyrus (ba10), the right cluster of the precuneus and angular gyrus (ba39), and the left superior parietal lobule (ba7), and a significantly higher reho in the right posterior lobe of the cerebellum, the right cingulate gyrus (ba23), and the bilateral cluster covering the lentiform nucleus, putamen, and insula (ba13). the details are presented in figure 1 and table 2. the mean reho value of these altered areas were extracted (figure 2). in patients with osa, the ahi score showed a significant positive correlation with arousal index (r=0.642, p=0.001) and a negative correlation with percent time in rapid eye movement sleep (r=0.429, p=0.032) and montreal cognitive assessment score (r=0.405, p=0.045). percent time in stage 2 sleep showed a negative correlation with percent time in rapid eye movement sleep (r=0.584, p=0.002) and epworth sleepiness scale score (r=0.531, p=0.006). body mass index showed a significant positive correlation with arousal index (r=0.582, p=0.002). the observed higher mean reho signal values in the right posterior lobe of the cerebellum showed a significant positive correlation with percent time in stage 3 sleep (r=0.458, p=0.021), the right cingulate gyrus showed a significant positive correlation with percent time in rapid eye movement sleep (r=0.405, p=0.045), and a lower mean reho in the right cluster of the precuneus and angular gyrus showed a significant negative correlation with sleep time (r=0.430, p=0.032). the patients with osa had significant higher scores for body mass index (t=6.25, p<0.001), ahi (t=15.51, p<0.001), spo2 < 90% (t=6.66, p<0.001), and epworth sleepiness scale (t=7.64, p<0.001) when compared with gss. compared with gss, patients with osa showed a significantly lower reho in the right medial frontal gyrus (ba11), the right superior frontal gyrus (ba10), the right cluster of the precuneus and angular gyrus (ba39), and the left superior parietal lobule (ba7), and a significantly higher reho in the right posterior lobe of the cerebellum, the right cingulate gyrus (ba23), and the bilateral cluster covering the lentiform nucleus, putamen, and insula (ba13). the details are presented in figure 1 and table 2. in patients with osa, the ahi score showed a significant positive correlation with arousal index (r=0.642, p=0.001) and a negative correlation with percent time in rapid eye movement sleep (r=0.429, p=0.032) and montreal cognitive assessment score (r=0.405, p=0.045). percent time in stage 2 sleep showed a negative correlation with percent time in rapid eye movement sleep (r=0.584, p=0.002) and epworth sleepiness scale score (r=0.531, p=0.006). body mass index showed a significant positive correlation with arousal index (r=0.582, p=0.002). the observed higher mean reho signal values in the right posterior lobe of the cerebellum showed a significant positive correlation with percent time in stage 3 sleep (r=0.458, p=0.021), the right cingulate gyrus showed a significant positive correlation with percent time in rapid eye movement sleep (r=0.405, p=0.045), and a lower mean reho in the right cluster of the precuneus and angular gyrus showed a significant negative correlation with sleep time (r=0.430, p=0.032). our previous study using the reho method demonstrated that many brain areas show obvious sex differences, both during the rested wakeful condition and the sleep deprivation condition.29 to avoid the influence of sex differences, we chose only male patients with osa to participate in this research. to our knowledge, few resting - state functional mri studies have been conducted in patients with osa.34 the present study used reho to investigate the synchrony of regional spontaneous activity in resting - state functional mri among patients with osa. consistent with our hypothesis, patients with osa showed significantly lower reho in the right medial frontal gyrus, right superior frontal gyrus, right cluster of the precuneus and right angular gyrus, and left superior parietal lobule, and higher reho in the right posterior lobe of the cerebellum, right cingulate gyrus, and bilateral cluster covering the lentiform nucleus, putamen, and insula compared with gss. benedetti found that males had more right left brain hemisphere differentiation than females.40 our previous sleep deprivation study found that both male and female subjects majorly represented strong unilateral between the good sleep condition and sleep deprivation condition, characterized by that altered reho areas are mainly represented in the left hemisphere, and few lower reho areas in the right hemisphere.29 from normal sleep status to sleep deprivation status, both male and female groups demonstrated a regular pattern of changes, ie, the unilateral tendency of reho regions in the brain started to disappear and these regions spread to the opposite side or bilaterally.29 in our study, the altered local coherence was mainly located in the right hemisphere, suggesting that male patients with osa had strong right left brain hemisphere differentiation. the most interesting finding of our study was the lower reho signals in the precuneus, angular gyrus, and medial frontal gyrus in patients with osa compared with gss. to our knowledge, these areas have been identified as being part of a default mode network that is highly active during the resting state.41 these brain regions are thought to be involved in a group of high - level cognitive functions, variously described as visuospatial imagery, consciousness, episodic memory, executive cognitive control, and behavioral inhibition.42,43 previous studies showed decreased resting - state functional connectivity and gray matter volume in the medial prefrontal cortex of the anterior default mode network in patients with osa, indicating both structural and functional deficits in the medial prefrontal cortex which may be related to impaired cognitive function in these patients.44 moreover, intermittent hypoxia is found to have a negative correlation with cerebral activation in the bilateral frontal and left parietal regions, and may be a major factor in default mode network dysfunction in patients with osa.45 the precuneus is located in the posteromedial cortex of the parietal lobe and is a widespread network of higher association cortical and subcortical structures, and plays an important role in an array of advanced cognition functions, including visuospatial imagery, episodic memory retrieval, self - processing, and consciousness.42 a previous sleep study has shown abnormal brain function in this region.46 positron emission tomography measurements of glucose utilization indicated that metabolism was decreased in the precuneus and prefrontal cortex.47 the functional impairment of the precuneus may have been caused partly by remote effects originating from morphologically impaired areas with decreased connectivity.48 in support of these findings, we found that patients with osa had decreased reho in the precuneus compared with gss, and the altered reho in the precuneus showed a significant negative correlation with sleep time (r=0.430, p=0.032), suggesting decreased sleep time may be an important factor for dysfunction in the precuneus. therefore, analysis of reho may be useful for indexing the extent of sleep time and may be an early biomarker of brain injury in patients with osa. joo found that patients with osa frequently showed dysregulation of respiratory control, which might be related to morphological differences in the gray matter areas of the brain, such as the superior frontal gyrus, cingulate gyrus, and left precentral gyrus.49 previous morphological mri studies showed significant gray matter loss or volume decrease in the frontal lobe,17,49 which may result in memory impairment, and executive dysfunctions. a previous mrs study demonstrated significant lower n - acetylaspartate to creatine ratios in the frontal cortex and frontal white matter of patients with osa when compared with gss,22 suggesting the presence of cerebral damage, probably caused by chronic repeated intermittent hypoxia.23 previous task functional mri studies in individuals with osa showed decreased activation in the frontal cortex which was associated with both the duration of oxygen desaturation and the arousal index.50,51 in support of these findings, in our study we found that patients with osa showed a significantly altered pattern of local cortical and subcortical activity in the right frontal gyrus (ba10, ba11) when compared with gss. we also found higher reho values in the right posterior lobe of the cerebellum, right cingulate gyrus, and bilateral cluster covering the lentiform nucleus, putamen, and insula in patients with osa compared with gss. osa is characterized by repeated episodes of partial or complete obstruction of the upper airway during sleep.52 evidence has shown that during respiration some cingulate neurons discharged at pace, suggesting that the anterior cingulate cortex has a complex and indirect relationship to respiratory control mechanisms.53 moreover, it is important in the insular cortex for the perception of dyspnea.54 the insular and cingulate areas are activated by dyspnea.55,56 cerebellar structures have been associated with regulation of respiratory patterns.57 the lentiform nucleus is involved in advanced cognitive function, and is sensitive to intermittent hypoxia with abundant blood supply, because of which patients with osa, characterized by chronic intermittent hypoxia, showed higher reho in bilateral lentiform nucleus compared with gss, which may be a compensatory to adapt to exposed to long - term hypoxia condition. interestingly, these areas displayed symmetrical distribution, which may contribute to the about equal degree of hypoxia between two hemispheres. in conclusion, our results showed altered synchrony of regional spontaneous activity in the default mode circuit during the resting - state condition. the reho on resting - state functional mri is a simple and noninvasive method for investigating osa, and is a promising tool for better understanding the neurobiological consequences of this condition. although our results provide novel information with regard to our understanding of osa, several limitations need to be considered. firstly, larger sample sizes and female groups are needed in future studies to explore the mechanisms of osa in the brain. secondly, polysomnographic data were obtained after a single - night recording, so a first - night effect on sleep parameters could not been excluded. thirdly, we only focused on the effect of severe osa ; other types of patients with osa were not examined in this study. | backgroundprevious studies have demonstrated that obstructive sleep apnea (osa) is associated with abnormal brain structural deficits. however, little is known about the changes in local synchronization of spontaneous activity in patients with osa. the primary aim of the present study was to investigate spontaneous brain activity in patients with osa compared with good sleepers (gss) using regional homogeneity (reho) analysis based on resting - state functional magnetic resonance imaging (mri).methodstwenty - five untreated male patients with severe osa and 25 male gss matched for age and years of education were included in this study. the reho method was calculated to assess the strength of local signal synchrony and was compared between the two groups. the observed mean reho values were entered into statistical package for the social sciences software to assess their correlation with behavioral performance.resultscompared with gss, patients with osa showed significantly lower reho in the right medial frontal gyrus (ba11), right superior frontal gyrus (ba10), right cluster of the precuneus and angular gyrus (ba39), and left superior parietal lobule (ba7), and higher reho in the right posterior lobe of the cerebellum, right cingulate gyrus (ba23), and bilateral cluster covering the lentiform nucleus, putamen, and insula (ba13). the lower mean reho value in the right cluster of the precuneus and angular gyrus had a significant negative correlation with sleep time (r=0.430, p=0.032), and higher reho in the right posterior lobe of the cerebellum showed a significant positive correlation with stage 3 sleep (r=0.458, p=0.021) and in the right cingulate gyrus showed a significant positive correlation with percent rapid eye movement sleep (r=0.405, p=0.045).conclusionpatients with osa showed significant regional spontaneous activity deficits in default mode network areas. the reho method is a useful noninvasive imaging tool for detection of early changes in cerebral reho in patients with osa. |
acute diabetic complications such as diabetic ketoacidosis and chronic micro- and macrovascular diabetic complications and their associated adverse outcomes are intimately related to suboptimal glycemic control in clinical practice. each 1% reduction in the mean glycated hemoglobin (hba1c) has been shown to be associated with reduction in risk of 21% for deaths related to diabetes, 14% for myocardial infarction, and 37% for microvascular complications.1 despite this unequivocal clinical evidence that underscores the value of optimal glycemic control among diabetic patients, studies from sub - saharan africa and other regions of the world still document that majority of the patients in clinical care do not attain the recommended glycemic targets.24 this ultimately translates to increased risk of onset and progression of the fatal diabetic complications, hence increasing morbidity and mortality. due to the economic growth and ensuing rapid urbanization, there is a demonstrable growing trend of diabetes mellitus (dm) and other noncommunicable diseases in uganda. several published community - based cross - sectional studies performed in different regions of rural and semi - urban uganda have reported different prevalence of dm ranging from 0.4% to 9%.58 the disparity in the reported prevalence could probably be explained by the differences in the study diagnostic methods. a recently concluded representative national survey on the burden of noncommunicable diseases in uganda using the standardized world health organization s stepwise approach reported a low prevalence of dm of 1.4%, which is also lower than the international diabetes federation 2014 estimate of 4.4%.9,10 despite this growing trend of dm in uganda, studies assessing the levels of glycemic control and related factors among adult diabetic patients are limited. the objective of this study was to determine the frequency of suboptimal glycemic control and its related factors among adult diabetic patients attending outpatients diabetic clinics at three urban hospitals in kampala, the capital city of uganda. this information obtained will be integral in influencing evidence - based policy formulation and implementation in the national and institutional diabetes management programs. this was a cross - sectional study performed between september 2014 and july 2015 in three outpatient diabetic clinics of mulago national referral and teaching hospital, a public hospital where health services are offered at no charge, and at mengo hospital and our lady of consolata hospital kisubi, which are not - for - profit, faith - based hospitals where health services are offered at subsided fees. all these hospitals manage an adult diabetes clinic at least once weekly. at each center, patients aged 18 years with a diagnosis of diabetes confirmed by a general practitioner or physician using fasting blood glucose levels, an oral glucose tolerance test, hba1c, or random blood sugar level in the presence of symptoms of diabetes and having been receiving care for at least a minimum of 6 months were enrolled consecutively until the desired sample size was attained. all eligible patients offered written informed consent prior to being enrolled into the study. using a pretested questionnaire, information about the study participants sociodemographic characteristics, preexisting medical conditions (coexisting hypertension and hiv), type of diabetes, age at diagnosis of dm, duration since diagnosis, and drug history were collected. all participants underwent standard anthropometric measurements to calculate the body mass index (bmi), and blood pressure (bp) was also measured. a fasting venous blood sample was obtained from each study participant after consent for determination of the hba1c levels and to perform a fasting lipid profile. the analysis was done at each center using a full automated cobas integra 400 (roche diagnostics gmbh, indianapolis, in, usa) machine. data were entered into microsoft excel database, and stata software (college station, tx, usa), version 12.1 was used for all statistical analysis. patient characteristics were reported as frequency and percentage for categorical variables, mean and standard deviation for the normally distributed continuous variables, and median and interquartile range (iqr) for continuous variables that were not normally distributed. the 2015 american diabetes association (ada) guidelines of standards of care of diabetes care were used to define suboptimal glycemic control as hba1c levels 7%. other components of optimal diabetes care were also defined as follows : optimal bp 6.5%.2 other similar studies in ethiopia, south africa, and uganda have documented frequencies of suboptimal glycemic control to be between 64.7% and 79.2%.1215 in another large study of 1,179 diabetic patients from eastern europe, asia, latin america, and africa called the international diabetes mellitus practice study (idmps), suboptimal glycemic control defined as hba1c greater than 7% was noted in 75% of the patients.16 the probable reasons to explain these high proportions of patients with suboptimal glycemic control in our developing countries, as demonstrated in some of the studies, include lack of access to hba1c monitoring, inequitable access to diabetes medication, delay, and fear to initiate and optimize insulin therapy among health care workers, low levels of patient education, and, generally, knowledge gaps in diabetes management among the health care workers.2,1416 the two identified independent predictors were metformin monotherapy and insulin therapy. metformin monotherapy was noted to have a protective effect against suboptimal glycemic control in our study. similarly in the idmps, among patients on oral glucose - lowering therapy, the use of fewer oral therapies was associated with attainment of optimal glycemic goals in all the regions studied.16 fewer medications in clinical practice generally tend to improve patient drug adherence and compliance, hence resulting in better treatment outcomes. metformin monotherapy in clinical practice might reflect mild severity or early disease with easy attainment of glycemic goals. this has also been reported in similar studies from ethiopia and brazil.12,17 however, poor glycemic control can not be directly attributed to insulin therapy per se. in diabetes care, there is an observed clinical inertia, which can be defined as the failure to initiate, establish appropriate targets, and optimize treatment so as to achieve treatment goals with regard to insulin therapy.18 this could be due to the physician s lack of knowledge and experience with insulin use and the patient s fear of insulin - induced hypoglycemia and weight gain. there is also hesitancy among patients to accept insulin treatment due to fear of pain of injections, cost, hypoglycemia, and weight gain. insulin use is, thus, reserved for only patients with severe disease or for patients later in the disease course and for those that have failed to reach glycemic goals despite very high doses of oral glucose - lowering drugs. due to the small sample size and cross - sectional nature of the study as well as its performance in an urban hospital setting, we can not establish temporal relationships and also generalize to the entire adult diabetic population seeking care in uganda. metformin monotherapy was noted to have a protective effect against suboptimal glycemic control in our study. similarly in the idmps, among patients on oral glucose - lowering therapy, the use of fewer oral therapies was associated with attainment of optimal glycemic goals in all the regions studied.16 fewer medications in clinical practice generally tend to improve patient drug adherence and compliance, hence resulting in better treatment outcomes. metformin monotherapy in clinical practice might reflect mild severity or early disease with easy attainment of glycemic goals. this has also been reported in similar studies from ethiopia and brazil.12,17 however, poor glycemic control can not be directly attributed to insulin therapy per se. in diabetes care, there is an observed clinical inertia, which can be defined as the failure to initiate, establish appropriate targets, and optimize treatment so as to achieve treatment goals with regard to insulin therapy.18 this could be due to the physician s lack of knowledge and experience with insulin use and the patient s fear of insulin - induced hypoglycemia and weight gain. there is also hesitancy among patients to accept insulin treatment due to fear of pain of injections, cost, hypoglycemia, and weight gain. insulin use is, thus, reserved for only patients with severe disease or for patients later in the disease course and for those that have failed to reach glycemic goals despite very high doses of oral glucose - lowering drugs. due to the small sample size and cross - sectional nature of the study as well as its performance in an urban hospital setting, we can not establish temporal relationships and also generalize to the entire adult diabetic population seeking care in uganda. suboptimal glycemic control is a highly prevalent finding among adult diabetic patients affecting about seven in ten patients. metformin monotherapy and insulin therapy either in monotherapy or in combination with metformin were observed to be independent predictors of suboptimal glycemic control. | backgroundpersistent suboptimal glycemic control is invariably associated with onset and progression of acute and chronic diabetic complications in diabetic patients. in uganda, studies documenting the magnitude and predictors of suboptimal glycemic control in adult ambulatory diabetic patients are limited. this study aimed at determining the frequency and predictors of suboptimal glycemic control in adult diabetic patients attending three urban outpatient diabetic clinics in uganda.methodsin this hospital - based cross - sectional study, eligible ambulatory adult diabetic patients attending outpatient diabetic clinics of three urban hospitals were consecutively enrolled over 11 months. suboptimal glycemic control was defined as glycated hemoglobin (hba1c) level 7%. multivariable analysis was applied to determine the predictors.resultsthe mean age of the study participants was 52.214.4 years, and the majority of them were females (283, 66.9%). the median (interquartile range) hba1c level was 9% (6.8%12.4%). suboptimal glycemic control was noted in 311 study participants, accounting for 73.52% of the participants. hba1c levels of 7%8%, 8.1%9.9%, and 10% were noted in 56 (13.24%), 76 (17.97%), and 179 (42.32%) study participants, respectively. the documented predictors of suboptimal glycemic control were metformin monotherapy (odds ratio : 0.36, 95% confidence interval : 0.210.63, p<0.005) and insulin therapy (odds ratio : 2.41, 95% confidence interval : 1.414.12, p=0.001).conclusionsuboptimal glycemic control was highly prevalent in this study population with an association to metformin monotherapy and insulin therapy. strategies aimed at improving glycemic control in diabetes care in uganda should be enhanced. |
ochrobactrum anthropi, formerly classified as achromobacter species or centers for disease control groups vd, is an aerobic, oxidase - producing, non - fermenting, gram - negative bacillus (1). o. anthropi is a ubiquitous organism, which is widely distributed in the environment and water sources including normal saline, antiseptic solutions, dialysis liquids, and swimming pools (2). the organism may be part of the normal flora of the large intestine and has been isolated from various clinical specimens (3). o. anthropi is currently considered to be an opportunistic pathogen, and most human diseases reported in the literature are consequences of central venous catheter line infections in severely ill or immunocompromised patients (3, 4). the pathogen usually displays resistance to commonly used broad - spectrum antimicrobial agents, including penicillins and cephalosporins (3). we report a case of o. anthropi spontaneous bacterial peritonitis in a patient without evident impairment of immune function other than liver cirrhosis. a review of the literature, found no case of o. anthropi spontaneous bacterial peritonitis up to now. a 62-yr - old man was admitted to our hospital with a 1-day history of abdominal pain and fever. his blood pressure was 105/68 mmhg, pulse rate was 105 beats per min, and body temperature was 38.2. abdominal examination revealed diffuse tenderness on the whole abdomen, diminished bowel sound, and splenomegaly. laboratory tests showed hemoglobin concentration of 12.2 g / dl, leukocyte count of 7,580/l, platelet count of 233,000/l, serum creatinine level of 1.36 mg / dl, serum bilirubin level of 5.0 mg / dl, and serum albumin level of 2.5 g / dl. the analysis of peritoneal fluid demonstrated an albumin level of 284 mg / dl and leukocyte count of 350/l (poly 89%, other 5%). empirical treatment with ceftriaxone (2 g every 24 hr) was started with the presumptive diagnosis of spontaneous bacterial peritonitis. several days later, gram negative bacilli were growing in the cultures of blood and ascites processed by the bactec 9240 unit (becton dickinson, sparks, md, u.s.a.). the patient 's subsequent hospital course was uneventful except for low - grade fever (38). on the 8th day of admission, his blood pressure was 66/40 mmhg, pulse rate was 94 beats per min, and body temperature was 35.2. laboratory tests showed a hemoglobin concentration of 11.0 g / dl, leukocyte count of 13,670/l, platelet count of 232,000/l, creatinine level of 2.26 mg / dl, ascitic albumin level of 470 mg / dl, and ascitic leukocyte count of 1,190/l (poly 46%, other 50%). we tried to perform an esophagogastroduodenoscopy (egd) because of his black and tarry stool, but the patient and his family refused to give his consent to egd. at that time, the gram - negative bacillus was identified as o. anthropi by the gram negative combo 32 kit (microscan workaway-96, dade behring, west sacramento, ca, u.s.a.), and the biochemical profile determined by the api 20 ne system (biomerieus, marcy l'etoile, france) also gave unequivocal identification of o. anthropi. the organism yielded positive results in tests for urea, ornithine, and esculin hydrolysis and failed to produce hydrogen sulfide in triple - sugar - iron agar, which is collectively consistent with o. anthropi. the isolate was in vitro susceptible to amikacin, gentamicin, tobramycin, imipenem, meropenem, ciprofloxacin, levofloxacin, and trimethoprim but resistant to all other tested (-lactam antibiotics including ceftriaxone). the antibiotic was changed to imipenem (250 mg every 6 hr, estimated crcl=40 ml / min). on the 10th day of admission o. anthropi is currently considered as an emerging pathogen in immunocompromised patients, especially in the presence of indwelling medical devices. cytotoxic chemotherapy, recent transplantation, hematologic and non - hematologic malignancies are common underlying conditions (5, 6). the first case of human infection with o. anthropi, a pancreatic abscess, was reported in 1980 (7). since then, most human diseases reported in the literature were a consequence of indwelling medical devices, such as central venous catheter, drainage tubes, and intraperitoneal catheters (3, 4). the ability of the pathogen to adhere to silicone, similar to that of s. aureus and s. epidermidis, has been shown by in vitro experiment and may play a role in catheter - associated infection (6, 8, 9). in addition to central catheter - related infections, o. anthropi may cause localized pyogenic infections (10), meningitis (11), and osteomyelitis of bone flap following the implantation of contaminated allograft tissue (12), endophthalmitis after vitreous and cataract surgery (13, 14), and endocarditis (15, 16). the pathogen has also been identified as a causative agent of peritonitis in patients undergoing continuous ambulatory peritoneal dialysis (17). the organism is not unusual among infants and toddlers without chronic diseases or other known predisposing factors (3). it has also been recovered from bile, urine, wounds, stool, throat, and vagina. non - fermenting, gram - negative bacilli that are uncommonly isolated may be quite difficult to identify to the species level.. further segregation of o. anthropi from other oxidase - positive organisms such as achromobacter, alcaligenes and agrobacterium is based on the production of 3-ketolactose and hydrogen sulfide, growth on cetrimide and hydrolysis of esculin and urea. accurate identification may require comparison of results obtained by using several identification systems and may sometimes also require comparison of those results of conventional tests such as growth on triple - sugar - iron agar (18). our patient in this report, who had underlying disease of liver cirrhosis as the underlying disease, was suffering from spontaneous bacterial peritonitis caused by o. anthropi. the patient had not received intravenous injections for more than 6 months, and we could not find any other predisposing conditions. enteric bacteria could enter the systemic circulation from the portal vein by passage through the liver or by portosystemic shunts in patients with portal hypertension. enteric bacteria also may gain access to the peritoneal cavity by directly traversing the intact intestinal wall. this observation highlights that o. anthropi should also be considered a significant pathogen in liver cirrhosis patients. typically, o. anthropi isolates are susceptible to commonly used aminoglycosides, carbapenems, cotrimoxazole, quinolones, and sulfonamides ; variably susceptible to rifampicin and tetracyclines ; and resistant to beta - lactams (other than carbapenem), chloramphenicol, macrolides, and trimethoprim (1). anthropi infection, there is a poor correlation, however, of in vitro susceptibility data with clinical efficacy of antimicrobial therapy. treatment failure with imipenem has been reported despite in vitro susceptibility of the strains (19). to our knowledge, this case is the first report of spontaneous bacterial peritonitis due to o. anthropi. despite its high level of resistance to antibiotics, considering that the majority of cases have been described in debilitated host, o. anthropi has been thought to have low intrinsic pathogenic power and virulence. however, this case emphasizes that the awareness of the potential role of o. anthropi in causing spontaneous bacterial peritonitis is important, given the serious morbidity associated with disseminated o. anthropi infections. | we report a case of spontaneous bacterial peritonitis from ochrobactrum anthropi. o. anthropi is recognized as an emerging pathogen in immunocompromised patients. in contrast to most previously described cases, the patient reported here had no indwelling catheter. to our knowledge, no case of o. anthropi spontaneous bacterial peritonitis has been reported in the medical literature until now. |
importance of candida species in nursery and intensive care units (icus) is increasingly being recognized. candida species account for 9 - 13% of all blood isolates in neonatal intensive care units (nicus). although c. albicans has historically been the most frequently isolated species, infections caused by the nonalbicans candida have been diagnosed with increasing frequency in recent years, notably c. tropicalis, c. glabrata, and c. parapsilosis. common use of broad - spectrum antibiotics, low birth weight (lbw), prematurity, and intravenous catheter, etc., makes neonates prone to candidemia. the incidence and associated mortality due to candidemia can be influenced by several factors including characteristic of the population at risk, standard of the health care facilities available, distribution of candida species, and prevalence of antifungal resistance. the increased isolation rates of nonalbicans candida species and a gradual shift in the antifungal susceptibility profile have underlined the need to monitor laboratory data for possible emergence of resistance and to select most appropriate antifungal agent for therapy. we have noticed an increased isolation rate of nonalbicans candida from neonatal septicemia cases over last few months. so we are presenting our findings that were observed while investigating the causes of candidemia in a neonatal icu. a total of 825 clinically suspected cases of neonatal septicemia were included in the study from june 2008-december 2008. demographic and clinical data such as age, sex, birth weight, antibiotic prophylaxis, presence of cvc, and clinical outcome of the neonates were noted from clinical records. approximately 1 to 2 ml of blood was collected under aseptic precautions and inoculated in biphasic brain heart infusion medium. colonies were identified up to the species level on the basis of morphology on corn meal agar, growth on hi- chrome candida agar, carbohydrate fermentation, and assimilation patterns. all the isolates were screened for antifungal susceptibility testing by the disk diffusion (dd) method using fluconazole (25 g) (hi- media, mumbai) on mueller - hinton agar (mha) supplemented with 2% glucose and methylene blue (gmb) 5 g / ml. the broth micro dilution - minimum inhibitory concentration (bmd - mic) of the isolates was performed to the fluconazole using rpmi medium and mops buffer. isolates showing mic 8 g / ml were regarded as susceptible, 16 - 32 g/ ml as dose - dependent susceptible and 64 g / ml as resistant. the quality control test was performed by using c. parapsilosis (atcc 22019), c. krusei (atcc 6258), and c. albicans (atcc 90028). all the neonates (100%) were low birth weight (between 1.0 - 1.5 kg), and had received prophylactic antibiotics. other associated findings were presence of central venous line in 71%, prematurity 40%, perinatal asphyxia 31.2%, jaundice 27.8%, and meconium aspiration in 10.8% of neonates ; crude mortality rate was 50.1%. majority of isolates were c. tropicalis (61.19%), followed by c. albicans (19.40%), c. glabrata (11.94%), c. parapsilosis (5.97%), and c. guillermondii (1.49%). the result of in vitro susceptibility testing of candida isolates to fluconazole is shown in table 1. by dd method, 89.55% of candida the results of antifungal susceptibility testing by dd and bmd - mic were compared for fluconazole. the dd testing performed in accordance with nccls m 44-a guidelines was comparable in 95.53% strains. a discrepancy between dd method and bmd - mic test result for susceptibility to fluconazole was noted in 4.47% strains. in our study, isolation rate of candida from neonatal septicemia cases was 8.1%, which was lower than several other reports showing frequency of isolation in 13.6 - 19.6% cases. c. albicans was the predominant organism in the earliest population based study conducted during 1992 - 1993 by cdc usa. but a notable feature of our study was the emergence of nonalbicans candida (80.59%) as a major cause of neonatal candidemia. c. tropicalis (61.19%) was the most common species followed by c. albicans (19.40%), and c. glabrata (11.94%). our findings are supported by other studies from the same geographical area that have documented predominance of nonalbicans candida over the c. albicans in neonatal septicemia. antifungal susceptibility testing in our study revealed that all the candida isolates except c. glabrata were 100% sensitive to fluconazole, though, three isolates of c. tropicalis were found to be in the susceptible dose dependant (sdd) range with mic 16 g / ml, when tested by broth micro - dilution mic method. in contrast to our study, several other indian studies have reported a high (18.75 - 24%) fluconazole resistance against all the candida spp. the results of dd susceptibility testing to fluconazole were compared by bmd - mic method. overall, four strains of c. tropicalis were sdd by dd method that was reduced to three with bmd - mic method. one strain of c. tropicalis that was resistant by dd method was found to be sdd with mic 16 g / ml. this result of our study emphasizes that dd method alone gives false resistance. several risk factors have been cited as predisposing to candidemia in neonates including underlying illness, lbw, broad - spectrum antibiotic, asphyxia neonatorum, hyperalimentation, and total parentral nutrition. in our study, lbw and broad spectrum antibiotic were the most common associated findings present in 100% neonates with candidemia. our study shows that nonalbicans candida has emerged as a major cause of neonatal candidemia. routine susceptibility testing of candida isolates by dd method should be confirmed by bmd - mic method. | aims : to know the distribution and antifungal susceptibility pattern of candida species in neonatal septicemia cases.materials and methods : in a prospective analysis blood samples from 825 clinically suspected cases of neonatal septicemia, collected aseptically, were cultured to look for the role of candida spp. in septicemia. candida isolates were speciated by germ tube test, hi - chrome agar, sugar fermentation, and sugar assimilation tests using standard protocol. all the candida isolates were tested for antifungal susceptibility to fluconazole by the disk diffusion (dd) method and broth micro dilution - minimum inhibitory concentration (bmd - mic) method using nccls guidelines.results:isolation rate of candida from neonatal septicemia cases was 8.1%. most common isolate was c. tropicalis (61.19%), followed by c. albicans (19.40%), c. glabrata (11.94%), c. parapsilosis (5.97%) and c. guillermondii (1.49%). low birth weight and previous antibiotic prophylaxis was found in 100% cases. crude mortality rate was 50.1%. by dd method, 95.53% of the candida isolates were sensitive to fluconazole. a discrepancy between dd method and bmd - mic method was noted in 4.47% strains. one isolates each of c. tropicalis, c. albicans, and c. glabrata showed discrepancy.conclusion:nonalbicans candida has emerged as an important cause of neonatal septicemia. routine susceptibility testing of candida isolates by dd method should be confirmed by bmd - mic method. fluconazole can be used as empirical therapy for neonatal candidemia at our center. |
these mangroves have suffered extensively with urbanization and industrialization in coastal regions, and, over the years, extensive ecosystems have disappeared, ending many of their important functions, such as being buffers against coastal erosion, retaining some pollutants, and being fishery areas. crabs are decapod crustaceans rich in sodium, potassium, and phosphorus with high amounts of iron, zinc, copper, and manganese. they also present high concentrations of vitamins a, c, b6, thiamine, and riboflavin and are considered a delicacy in several parts of the world. along the brazilian coast, crabs are one of the most important natural resources in estuarine regions and can be intensely exploited without reaching an overfishing threshold, mainly because the picking method allows for the identification of the female individuals, which are of a different size compared to the males, and their release back into the environment. among the large and diverse range of mangrove products in the brazilian north and north - eastern estuaries, the mangrove crab, ucides cordatus, is the most harvested, with the highest commercial and subsistence importance to rural households of the coastal population. environment quality, as well as the mode of collection and processing of products, may affect the quantity and diversity of the microorganisms present on the surface of seafood and fishery products, which may cause increases in microbial contamination. beside the concern regarding the fecal contamination of human foods from marine ecosystems, starting in the late 1960s various indigenous bacteria from estuarine and marine waters the main concern is with regard to several species of vibrio, such as vibrio parahaemolyticus. recent studies have also identified shellfish as sources of vibrio cholerae, vibrio vulnificus, and other vibrio species in cases of human infections. some of these human pathogens can survive and grow at the low temperatures that characterize marine ecosystems. vibrios are gram - negative bacteria that are primarily associated with estuarine and coastal marine environments. all vibrios have an absolute requirement of na for growth although some, such as v. cholerae, only require trace amounts. only a small proportion of the vibrios belong to species potentially pathogenic in humans and, of these, only a small proportion may possess the pathogenicity traits that enable them to colonize and cause disease in the human body. marine vibrios naturally contaminating bivalve mollusks have been shown to be harder to remove by depuration than fecal bacterial indicators, such as e. coli. such processing methods may, therefore, not provide the necessary level of public health protection if significant levels of pathogenic vibrios are present in the harvested product. escherichia coli is a commensal microorganism whose niche is the mucous layer of the mammalian colon. furthermore, e. coli is widely distributed in the intestinal tracts of warm - blooded animals. e. coli is often nonpathogenic, although different strains may cause diseases in the gastrointestinal, urinary, or central nervous systems. currently, six categories of diarrheagenic e. coli have been acknowledged : enterotoxigenic e. coli (etec), enteropathogenic e. coli (epec), enteroinvasive e. coli (eiec), enterohemorrhagic e. coli (ehec, shiga toxin - producing e. coli or stec) [17, 18 ], enteroaggregative e. coli (eaec or eaggec), and diffusely adherent e. coli (daec). despite not being very common, (1994) isolated only one strain of stec from shellfish and gave evidence that preventive measures, especially during harvest and postharvest, are of major importance to avoid contamination of any nature. detection of pathogenic bacteria in seafood is essential to ensure safe products for consumers, sustainable fish, and shellfish growing activities. molecular diagnostic methods have evolved significantly in the last few years and are now established as useful and reliable methods to allow the rapid detection and identification of pathogens. molecular detection, identification, and enumeration of vibrio spp. although less sensitive and more time consuming, dna or oligonucleotide probe - based hybridization methods have been proposed for the detection of vibrio spp. in food. herein, the presence of potentially pathogenic isolates (vibrio and escherichia coli strains) from ucides cordatus crabs from the guanabara bay, rio de janeiro, brazil, is reported, using both conventional (biochemical identification) and molecular (pcr) methods. the mangroves selected for this study are located in itaca (so gonalo), piedade (mage), and suru (mage), in guanabara bay, rio de janeiro, brazil, where the gathering of this crustacean for marketing is more intense. thirty live crabs (ucides cordatus) were collected between march 2012 and june 2014 in each mangrove studied. these samples were analyzed at the laboratory of environmental microbiology at the university of the state of rio de janeiro (uerj). the crabs were washed to remove any excess sediment and other impurities present on their bodies. the viscera and meat were removed with a sterile forceps and a scalpel and placed into sterile petri dishes. twenty - five grams of each sample were mixed with 225 ml of buffered peptone water, and the suspensions were transferred to homogenizer bags (interscience, saint nom, france) and coupled to a stomacher 400 circulator (seward, worthing, west sussex, uk) at 260 rpm for 1 min. the suspensions were serial - diluted from 10 to 10 and 100 l of each dilution was transferred onto specific broths. the tests used for the determination of e. coli and vibrio spp. are established in the methods for the microbiological examination of foods. the reference strains used as controls were provided by the oswaldo cruz foundation, rio de janeiro, brazil. twenty - five grams of tissue were immersed in 225 ml of lactose broth (himedia, mumbai, india) for 48 hours at 35c. subsequently, 10 to 10 dilutions were carried out with 9 ml of saline solution for posterior inoculation in lauryl sulfate broth (himedia, mumbai, india) at 35c for 24 h. an 100 l aliquot of each positive tube lauryl sulfate broth (himedia, mumbai, india) was transferred to a corresponding tube containing 3 ml of ec broth (himedia, mumbai, india) with 5 durham tubes for 24 hours with a series of dilutions and replicates in a water bath at 44.5c to determine the mpn (most probable number) coliform bacteria by counting. an 100 l aliquot was removed from the tube containing 3 ml of positive ec broth (merck, darmstadt, germany) and transferred to agar plates containing emb (merck, darmstadt, germany). the plates were incubated for 24 hours at 37c. the presumptive e. coli spp. colonies were submitted to biochemical tests : sim (sulfide - indole - motility) (biobrs, minas gerais, brazil), citrate (citrate of simmons) (difco, sparks, maryland, usa), and mr / vp broth (methyl red / voges - proskauer) (merck, darmstadt, germany). twenty - five grams of crab meat and viscera were immersed in 225 ml of lactose broth (himedia, mumbai, india) for 48 hours at 35c and transferred to 1 ml tubes containing bhi (heart brain infusion) (himedia, mumbai, india) with 1% and 3% of nacl and incubated for 24 h at 37c. a 100 l aliquot was transferred to plates containing tcbs agar (himedia, mumbai, india) and were incubated for 24 h at 37c. colonies were submitted to biochemical characterization tests : oxidase test, oxidation - fermentation (of) (difco, sparks, maryland, usa), inositol (difco, sparks, maryland, usa), and o129 (celon - lab, madhapur, hyderabad, india). dna preparation was carried out by the thermal shock method from all the harvested colonies. the colonies were grown in 3 ml of bhi broth harvested after 24 h at 37c. one ml of the medium was transferred to sterile eppendorf tubes and centrifuged for 10 min at 12,000 g. the supernatant was discarded and the pellet was resuspended in 400 l of pure sterile water. after homogenization, the supernatant was boiled for 10 min, cooled on ice for 5 min, and then collected and used for the pcr analyses. pcr was performed using multiplex jms1, lt, vira, and eae oligos and pcr - uniplex for aggrks and east1 oligos (table 1). the reactions contained a final volume of 25 l containing 5 l of template dna, buffer (10x), 10 mm dntp, 25 mm mgcl2, 2 u taq polymerase (invitrogen technologies, so paulo, brazil), and 10 mm of each primer (invitrogen technologies, so paulo, brazil). the conditions of reaction were 94c for 5 min, 30 cycles of 1 min at 94c, 1 min at 58c, 2 min at 72c, and a final cycle of 72c for 10 min, for all reactions. pcr amplicons were visualized on 2% agarose gels stained with 3 l of ethidium bromide (0.5 mg ml), visualized on a uv light transilluminator (uvitec, cambridge, uk), and photodocumented by polaroid the reaction was performed using multiplex oligos in a final volume of 20 l. the mixture contained 2 u taq polymerase (invitrogen technologies, so paulo, brazil), 10 mm dntps, buffer (10x), 25 mm mgcl2, 3 l of template dna, and 10 mm primers (sodb, sodb flae, hsp, and 16s) (table 2). the conditions of reaction were 5 min at 93c followed by 35 cycles of 92c for 40 s, 57c for 1 min, and 72c for 1.5 min and a final cycle at 72c for 7 min, for all reactions. pcr amplicons were visualized on 2% agarose gels stained with 3 l of ethidium bromide (0.5 mg ml), visualized on a uv light transilluminator (uvitec, cambridge, uk), and photodocumented by polaroid the microorganisms were inoculated at a concentration equivalent to 0.5 mcfarland units (probac, durban, south africa) onto a muller hinton agar plate (difco, sparks, maryland, usa). the inhibition zone was interpreted according to the clinical laboratory standards m100-s22 guidelines, formerly known as the national committee for clinical laboratory standards. the tested antibiotics were chloramphenicol (30 g), tetracycline (30 g), gentamicin (10 g), amikacin (30 g), tobramycin (10 g), trimethoprim - sulfamethoxazole (1.25/23.75 g), cephalothin (30 g), ampicillin (10 g), ceftazidime (30 g), cefotaxime (30 g), cefepime (30 g), aztreonam (30 g), cefoxitin (30 g), imipenem (10 g), ampicillin - sulbactam (10 g-10 g), and ciprofloxacin (5 g). for quality control, e. coli atcc 25922 and e. coli atcc 35218, the test was performed according to the standard document m45-a2, with the same antibiotic disks used for e. coli (oxoid, hampshire, uk), with the exception of tobramycin (10 g) and aztreonam (30 g) and with the addition of levofloxacin (5 g) and ofloxacin (5 g). high concentrations of fecal coliforms (6.2 10 and 7.2 10 nmp g) were found in the meat and hepatopancreas samples from the itaoca mangrove, respectively. the samples from piedade and suru mangroves showed concentrations of 2.4 10 and 3.2 10 nmp g in meat samples, respectively, and 2.5 10 and 3.5 10 nmp g in hepatopancreas samples, respectively. no significant difference was observed among the thermotolerant coliform values found in the meat and hepatopancreas samples between the mangroves (p < 0.05). multiplex pcr enabled the identification of 4 virulence genes (eaea, stx1, lt, and vira) in single reaction (figure 1). forty - six e. coli colonies isolated from the crab samples of the different mangroves (21 from meat and 25 colonies from hepatopancreas) were confirmed by biochemical tests. after biochemical characterization, the molecular test (pcr) revealed that 25 (54.3%) were positive for the researched virulence genes, 9 presenting easta (36%), 13 presenting lt (52%), and 3 presenting stx (12%). no colonies presenting vira, eaea, st, and agg genes were detected (table 3). fourteen e. coli strains were isolated from itaca, with the presence of virulence genes, 2 presenting stx1 (hepatopancreas), 7 presenting lt (4 in meat and 3 in hepatopancreas), and 5 presenting easta (4 in meat and 1 in hepatopancreas). eight strains were detected in samples from the suru mangrove, where 4 strains showed the lt virulence gene (2 in meat and 2 in hepatopancreas) and 4 strains showed the east virulence gene (2 in meat and 2 in hepatopancreas). thirteen strains were detected in the samples from the piedade mangrove by means of the biochemical test, but only one showed the presence of the stx1 virulence gene (meat), while 2 showed the presence of the lt virulence gene (hepatopancreas). suru mangrove samples showed the highest incidence of isolated vibrio (46), followed by piedade (40) and itaca (33). one hundred and nineteen vibrio strains were confirmed by pcr in 90 samples (meat : 68, and hepatopancreas : 51). (2010) using multiplex pcr (identifying the gyrb and pnta genes) to differentiate v. parahaemolyticus, v. cholerae, v. vulnificus, and other vibrio spp. from fish. among the researched vibrio genus, 61.3% (73/119) of the samples pathogenic strains v. cholerae and v. parahaemolyticus were found with a frequency of 1.7% (02/119) and 37% (44/119), respectively (table 4). the highest incidence of v. parahaemolyticus was observed in samples from the suru mangrove (21), followed by itaca (12) and piedade (11). no v. mimicus and v. vulnificus were detected in the present study (table 4). twenty - six e. coli strains showed some resistance to the tested antimicrobials, with a high index of resistance. e. coli strains isolated from the itaca samples showed high resistance (63%) against gentamicin (cn) and tobramycin (tob). e. coli strains found at piedade, itaca, and suru showed resistance to gentamicin (66%, 63%, and 22%, resp.). the e. coli isolates from the piedade samples showed 33% resistance to chloramphenicol (c). only strains found in crabs from the piedade mangrove showed resistance (16%) to ampicillin (amp). no resistance to amoxicillin + clavulanic acid (amc), levofloxacin (lev), cefoxitin (ctx), ofloxacin (ofx), and ciprofloxacin (cip) was observed. among the 26 resistant e. coli strains, 12 were resistant to two or more antibiotics (table 6). this pattern is mainly due to the indiscriminate use of antimicrobials and may cause serious impacts on human health [31, 32 ]. the e. coli strains showed multiresistance to several antimicrobial agents, with mar indices ranging from 0.12 to 0.31, whereas 3 strains showed mar indexes from 0.12 to 0.25 and 3 strains presented mar indexes of 0.18 (table 6). the resistance of the 26 e. coli strains was distributed as follows : 12 strains were resistant to gentamicin and tobramycin, 4 were resistant to amikacin and cephalothin, 3 were resistant to ciprofloxacin, tetracycline, ceftazidime, and cefoxitin, and one strain was resistant to ampicillin. when 119 vibrio strains were analyzed only 72 isolates (60.5%) showed resistance to some of the tested antimicrobials, with higher rates in those isolated from crabs samples from piedade (29), followed by itaca (23) and surui (20) (table 5). the vibrio strains from piedade, itaca, and suru showed resistance to ampicillin (86%, 78%, and 85%, resp.). the strains from surui showed 5% resistance to amoxicillin + clavulanic acid (amc), ampicillin / sulbactam (sam), and chloramphenicol (c). the piedade strains showed resistance to levofloxacin (lev) and ciprofloxacin (cip). no resistance to cefoxitin (ctx), ceftazidime (caz), tobramycin (tob), and tetracycline (te) was observed. vibrio strains isolated from crabs showed multiresistance to several antimicrobial agents, presenting a mar index ranging from 0.12 to 0.25 ; 24 strains presented mar indices of 0.12 (table 6) ; 5 strains showed mar indices of 0.18 ; and two strains showed mar indices of 0.25 mar indexes. the resistance of the 72 strains was distributed as follows : 60 strains were resistant to ampicillin, 14 were resistant to amikacin (ak), 10 were resistant to cephalothin (kf), 8 were resistant to cefoxitin (ctx), 5 were resistant to gentamicin (cn), 3 were resistant to ciprofloxacin (cip), and 1 strain was resistant to amoxicillin + clavulanic (amc), ampicillin + sulbactam (sam), levofloxacin (lev), ofloxacin (ofx), and chloramphenicol (c). the thermotolerant coliforms found in the present study are above the maximum permissible limit (maximum tolerance of 5 10 nmp g for coliforms at 45c) in bivalve mollusks, crab meat, and similar samples, according to laws from the brazilian sanitary vigilance agency (agncia nacional de vigilncia sanitria (anvisa)). similar results were found with regard to the microbiological quality of a crab meat in 3 different points at praia do futuro, located in fortaleza, ce, brazil, where thermotolerant coliforms were detected ranging from 3.0 to 1,100 nmp g in 90 analyzed crabs. according to de lima grisi and gorlach - lira (2010), the presence of this group of bacteria is associated to the dumping of fecal material in the environment. guanabara bay receives effluents without treatment daily and has become bacteria reservoir, which in turn has caused the contamination of fish and other biota in this region. the expression of e. coli virulence genes is a public health risk, since these genes characterize the presence of toxins able to cause disease. e. coli cells are the main pathogens associated to gastroenteritis of food origin in humans, provoking diarrhea, hemorrhagic colitis, and hemolytic - uremic syndrome. however, some studies reporting human infection by e. coli due to crab consumption are available. despite the absence of the vira, eae, st, and agg genes in the present study, the confirmation of e. coli strains indicates recent fecal contamination in crabs, and this indicates that major care in the preparation of this type of food is required. the results regarding the presence of vibrio can be explained by the salinity and temperature of the studied mangroves. many studies show the presence of vibrio in aquatic animals such as fish, shrimp, and mussels, but, despite the importance of crabs, only some studies have been conducted on crab contamination by vibrio. however, its occurrence in marine food is pointed as a major cause of gastroenteritis in the united states and europe and associated with cases in brazil and chile. these results suggest a probable health risk for people that consume raw and undercooked seafood. according to alam. (2012), v. vulnificus and v. mimicus are most commonly found in coccoid viable but not culturable form, while another study confirmed the presence of vibrio in crabs marketed in fortaleza, brazil, where only 10 strains were identified up to the species level : 2 v. alginolyticus and 8 v. parahaemolyticus but not any v. vulnificus and v. mimicus. abd - elghany and sallam (2013) detected 10 v. parahaemolyticus isolates in crab by molecular identification in egypt and highlighted that reliable molecular detection methods should be included in routine seafood examinations, in addition to the conventional bacteriological methods. these findings of antimicrobial susceptibility are in agreement with data from previous studies, which found that resistance to aminoglycosides, -lactamase, and penicillin is common among e. coli isolates from food of animal origin [4749 ]. however, the resistance frequency in e. coli isolated in the present study was low when compared to other studies, where a resistance of 58% and 42% in raw fish samples from kenya and vietnam, respectively, was observed [48, 50 ]. mussel samples from niteri (brazilian southeastern oceanic region) showed 29% resistance to at least one antimicrobial, and strains isolated from mussels from the guanabara bay, rio de janeiro, showed 40% to 85% resistance to tested antimicrobials, indicating the intense presence of domestic and industrial effluents. the percentage of high sensitivity to these antibiotics was also observed by rebouas. (2011) in strains isolated from shellfish and is associated with various resistance mechanisms found in gram - negative organisms. over time, vibrio strains exposed to antibiotics through the environment can acquire antimicrobial resistance transferable by mobile genetic elements and horizontal gene transfer. thus, due to the presence of r - factors in the population, resistance developed through gene regulation of plasmids and chromosomes may be transferred vertically (by heredity) or horizontally. in the present study, this data was confirmed in another study, where, from 169 vibrio strains isolated from shrimp, only 3 were sensitive to ampicillin. the high percentage of pathogenic vibrio with reduced susceptibility to ampicillin suggests a potential for the low efficiency of ampicillin in the treatment of vibrio infections. many cases of multiple antimicrobial resistance have been reported from shellfish farms in countries where the activity is well developed, such as china, korea, and chile. according to the world health organization, changes in the microbiota can induce the evolution of new pathogenic microorganisms and the development of new virulence factors in ancient pathogens, such as the development of resistance to antimicrobials or changes in their survival ability in adverse environmental conditions. several e. coli and vibrio isolates were found in crabs (ucides cordatus) from different mangroves in the state of rio de janeiro, brazil. considering the current legislation, the presence of these pathogens in crab indicates contamination influenced by mangrove pollution, by using newer molecular methods and thus contributing to seafood safety. the analyzed samples presented unsuitable hygienic - sanitary conditions, which can be considered a warning to the municipal health surveillance agency, since seafood is many times consumed without any subsequent thermal treatment or even sufficient thermal treatment able to eliminate pathogenic microorganisms, causing disorders to consumer health. | the bacteriological quality of crabs from three different mangroves (itaca, suru, and piedade) from rio de janeiro state, brazil, was investigated using conventional and molecular methods. the results revealed high counts for total coliforms in meat and hepatopancreas samples. pcr analyses identified 25 escherichia coli colonies in the itaca, piedade, and suru samples, detecting 13 enterotoxigenic colonies and 9 enteroaggregative colonies. respectively, 12, 11, and 21 vibrio parahaemolyticus strains were detected in the itaca, piedade, and suru samples. two v. cholerae strains were detected in the piedade samples. the e. coli strains isolated in the present study showed resistance to gentamicin. e. coli strains from the piedade samples showed 33% resistance to chloramphenicol and the strains also showed multiresistance to several antimicrobial agents with a mar index ranging from 0.12 to 0.31. vibrio strains from piedade, itaca, and suru showed 86%, 78%, and 85% resistance, respectively, to ampicillin. the isolated vibrio strains showed multiresistance to several antimicrobial agents, with a mar index ranging from 0.12 to 0.25. the presence of these organisms in crab meat is an indication of microbial contamination, which may pose health risks to consumers when improperly cooked. |
the cerebellum has long been known to be a key structure in the integration of descending motor command and ascending sensory feedback which account for the fluency and coordination of movements. in cerebellar degenerative diseases such as spinal cerebral ataxia (sca), the interlinked neural network is interrupted causing abnormalities in the excitation of targeted neurons which further worsen motor performance. an increasing number of associated genetic mutations have been identified in the past decade, of which sca3 is the most prevalent, comprising about 1/3 of the general population. at present, no known medical treatment can cure sca. the clinical symptoms of sca include progressive ataxia, dysmetria, visual nystagmus, parkinsonism, muscular atrophy, spasticity, dysarthria, and hypotone. among these symptoms, hypermetria in patients with dysmetria therefore, fast goal - directed movements such as in the finger - nose - finger test are used to examine limb coordination movements in these patients. in hypermetria, motor sequences are usually characterized by abnormal timing with delayed muscle activation and sudden interruptions of movements followed by exaggerated corrections [7, 8 ]. these aberrations in both timing and coordination are often due to inadequate control of agonist and antagonist muscles [7, 8 ]. healthy adults present with a specific triphasic electromyography (emg) pattern when executing a fast goal - directed movement. in the first phase, an agonist burst (ag1) initiates and accelerates the movement toward the target. in the second phase, antagonist activation (ant) a second agonist burst (ag2) in the third phase then reduces the effect of ant to accurately place the limb at the predetermined endpoint of movement. in sca patients, the triphasic emg pattern is abnormal and shows a delayed onset of ant [4, 1013 ]. several studies have suggested that the triphasic emg pattern is centrally programmed [14, 15 ] in a feedforward mode independent of any sensory feedback [14, 16 ], with the cerebellum involved in the regulation of cortical premovement activity. transcranial magnetic stimulation (tms) has shown that motor evoked potentials (meps) of agonist muscles are facilitated around 70100 ms before the onset of movement, which is also known as premovement facilitation [15, 18, 19 ]. our recent study on the preactivation of slow and fast goal - directed wrist movements showed a delay between the peaks of premovement facilitated meps in the agonist and antagonist muscles and that the delay was well correlated with the time course of triphasic emg activation. fast goal - directed movement training has been shown to enhance cortical excitability [21, 22 ]. in addition, es (electrical stimulation) of the afferent nerve has been shown to enhance cortical excitability through plasticity - like mechanisms in healthy subjects and in sca patients [2326 ]. these findings raised the possibility that combining temporal electrical afferent nerve stimulation and voluntary movement training may enhance premovement facilitation and improve the triphasic emg pattern of movement. we therefore designed a temporal es - assisted fast goal - directed movement training program for patients with sca, under the hypothesis that such a training program could improve the temporal pattern of antagonist premovement facilitation, triphasic emg pattern, and hypermetria in individuals with sca. to the best of our knowledge, no clinical studies have focused on the temporal control of cortical excitability, especially in the premovement phase. the study subjects were recruited from the taiwan spinocerebellar ataxia association after responding to advertisements. the inclusion criteria were showing hypermetria during the finger - to - nose test, being able to sit independently to complete the experiment, no previous history of neuromusculoskeletal diseases other than sca, and no severe tremors that would influence the recording of meps. twenty - two subjects were screened, of whom 20 (age : 49 8.43 years, 7 males, 13 females) met the inclusion criteria (figure 1). the minimal sample size, which was estimated according to the data published in a previous study (alpha = 0.05, power = 0.95), was 18. all of the study subjects provided informed consent, and the testing protocols were approved by our internal review board in accordance with the helsinki declaration. all clinical tests were performed by a licensed physical therapist who was blinded to group allocation. the right hand of each subject was used for the test, during which it was strapped to a custom - designed wrist goal - directed movement test and training system. the system included a laser pointer to show the wrist extension angle and a target line for 30 wrist extension. as the subjects performed the wrist movement, the laser pointer showed the movement angle in real time and provided visual feedback for the subjects. the forearm was kept neutral (0 supination) with the elbow at 80 flexion and the shoulder at 10 flexion. the surface electromyography (emg) of the flexor carpi radialis muscle (fcr) and the extensor carpi radialis muscle (ecr) was recorded by bipolar surface electrodes with a fixed interelectrode distance of 2 cm (b&l engineering, canada). the recording electrodes were located on the muscle belly of the fcr and ecr, with the direction parallel to the muscle fibers. the emg activity was preamplified by a factor of 350 and further amplified at the mainframe amplifier (gould inc. the raw emg data were fed through a 60 hz notch filter and a band - pass (101000 hz) filter to eliminate environmental interference and motion artifacts. emg activity was monitored on an oscilloscope and digitized by a 12-bit resolution analog - to - digital converter (instrunet model 100, input / output a / d system, usa) at 4000 hz. the meps of the fcr were elicited by the tms (magstim 200, magstim co., dyfed, uk) using a round coil with a 9 cm outside diameter with an anticlockwise - oriented current in the coil (side a facing up) to stimulate the left motor cortex. the optimal scalp location that consistently produced the largest meps in the target muscle (fcr) at the lower intensity was marked, and this location was used throughout the experiment. the coil was manually maintained by a custom - designed fixation frame, and the position and orientation of the coil were kept constant throughout the experiment. the resting motor threshold was defined as the minimum tms intensity required to elicit at least five of 10 meps greater than or equal to 50 v in consecutive trials in the relaxed fcr [27, 28 ]. the stimulation intensity for the experiment was set at 20% above the resting motor threshold. after practicing several times, the subject 's right arm was trapped in a custom - designed wrist goal - directed movement test and training system to perform five fast goal - directed wrist extensions. an electrogoniometer (sg75, biometrics ltd., uk) was mounted on these two segments to record the angle during movement. a laser light beam corresponding to the movement of the hand segment was projected onto a screen to provide the subjects with real - time visual feedback. the starting and target angles (30 of wrist extension) were measured and marked and constantly displayed on the screen. the subjects were instructed to perform the wrist extension as quickly as possible and to stop the movement when the laser pointer reached the targeted line indicating 30 of wrist extension. the emg of the ecr (the agonist muscle) and fcr (the antagonist muscle) and joint angle were recorded for further analysis. an audio warning signal followed by an audio go - signal after 610 seconds was given through an earphone. the subjects were asked to perform the goal - directed movement test as mentioned above as soon as the go - signal was heard. the meps were elicited by a single pulse tms at different time intervals in 10 ms steps after the go - signal. we wrote four sets of controlling programs, the most suitable of which were selected to assess the meps according to the subject 's reaction time to ensure that the premovement meps were obtained at least 120 ms before the onset of movement (table 2). after the assessment, the meps were grouped according to the onset of the agonist muscle (ecr) emg into bins of 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, and 120 ms before onset for analysis. control meps were evoked by tms without any audio signal (figure 2). after the pretest, the subjects in the training group received 4 weeks of temporal es - assisted training at home at a training frequency of three sessions per week. during training, paired electrical stimuli were delivered every 15 seconds for 30 minutes through surface electrodes placed on the muscle bellies of the fcr and ecr. the intensity of the stimulus was set to the minimal intensity that would elicit a visible contraction of the stimulated muscle, and the pulse duration was set to 500 s. each stimulation pair included ecr stimulation followed by fcr stimulation with an interstimulus interval of 40 ms. the 40 ms interval was chosen because our previous study on healthy subjects showed an average of a 40 ms delay between ag1 and ant (ag1-ant latency) in goal - directed fast movements. the subjects were asked to perform the 30 fast goal - directed wrist extension movement immediately after perceiving stimulation of the ecr. goal - directed movement and premovement meps were assessed again after 4 weeks of training (training group) or in case of no training (control group), with these assessments being performed 3 days after the last training session. the raw emg data during the fast movement were transformed to the root - mean - square emg (rmsemg), and the onsets of ecr (ag1) and fcr (ant) activation were calculated through rmsemg - time curves. the onsets of ecr and fcr activation were detected when the curve passed through the threshold which was at the mean plus twice the standard deviation of the baseline. ag1-ant latency was calculated by subtracting the ecr onset time relative to the fcr onset time and analyzed only in the trials with goal - directed movement tests without tms or es. the peak - to - peak amplitude of the premovement meps at various time points before the onset of movement was normalized to the control meps. the normalized premovement meps were then averaged by predetermined time bins of 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, and 120 ms, before the agonist muscle (ecr) emg onset. the emg onset of the ecr was determined for each subject in the trials without tms in order to avoid the potential influence of tms. the premovement meps elicited 130 ms before agonist muscle emg onset were not analyzed. linear interpolation was used to adjust the mep amplitude if the meps were elicited between the aforementioned predetermined time bins. the quality of performance was analyzed in the trials of the goal - directed movement test without tms or es. the final angles used to calculate the constant errors (ces) and variable errors (ves) were those at the end of the ballistic movement, measured before any corrective movements were made by the participant. ces, which measured the errors of goal setting, were calculated by the mean difference between the goal - directed angle and each actually performed angle (1) [29, 30 ]. ves, which measured the inconsistency of repetitive measures, were calculated by the standard deviation of the difference between the goal - directed angle and each actually performed angle (2) [29, 30 ]. consider (1)ce=xitn, where xi is the angle at which the subject stopped, t is the target angle, and n is the number of movements;(2)ve=xim2n, where xi is the angle at which the subject stopped, m is the averaged angle, and n is the number of movements. two - way repeated - measures analysis of variance (anova) with factors of group (training and control) and time (before and 4 weeks after) followed by the post hoc tukey test (when needed) was used to determine and compare the effect of training on premovement meps, ves, and ces. if a significant group and time interaction was found, the model was further reduced by group. the significance level was set at p 0.05). before training, there was no difference in ces between the training and control group (f = 1.123, p = 0.303). two - way anova showed a significant group and time interaction (f = 5.99, p = 0.0249), with the ce decreased to 10.16 3.53 degrees in the training group (f = 6.43, p = 0.0319) but unchanged in the control group (f = 1.48, p = 0.2554) (figure 5(a)). before training, the ves were 3.91 1.37 degrees and 4.49 2.05 degrees in the training and control groups, respectively (f = 0.565, p = 0.462), compared to 2.52 0.73 and 4.76 1.56 degrees after 4 weeks. two - way anova showed no significant group and time interaction (f = 3.27, p = 0.0874) (figure 5(b)). spearman correlation coefficient analysis showed a median but significantly negative correlation between ag1-ant latency and antagonist mep amplitude at 50 ms before the onset of movement (r = 0.4066, p = 0.011). this suggests that the increase in antagonist premovement facilitation was correlated with the decrease in ag1-ant latency. in the present study, 4 weeks of temporal es - assisted movement training decreased ces, indicating an alleviation of hypermetria in the patients with sca. in addition, the prolonged ag1-ant latency was shortened toward the normal range, suggesting that the training corrected the aberrant triphasic emg pattern in these patients. furthermore, the premovement facilitation of the antagonist muscle, which was previously absent in the patients, was reestablished after the 4-week temporal es - assisted training program. applied goal - directed movement only training for 200 repetitions per day for 7 days and showed only marginal improvement in accuracy in healthy subjects. in the present study, we showed for the first time that a combination of temporal es and movement training reduced ces, which evaluate a subject 's tendency to be directionally biased when performing a skill relating to the goal setting [29, 30 ], indicating that the coarseness of the movements in dysmetria was improved. we suggest that the effect of the temporal es - assisted training program was through the synergistic effect of the es and motor training. repeatedly pairing stimulation with es to the peripheral nerve and tms to the motor cortex pairing es and motor training may also induce a change in plasticity in the brain to enhance the training effect. in the present study, activation of the antagonist muscle has been reported to change fast goal - directed movements [11, 33, 34 ]. the delayed onset of antagonist muscle activation can explain the hypermetria symptoms in patients with sca. after 4 weeks of training, the ag1-ant latency had significantly decreased, which may, at least in part, explain why the ces improved, thereby resulting in better movement control by alleviating dysmetria. in healthy subjects, only an earlier peak of antagonist muscle emg but no similar reduction in ag1-ant latency has been shown after movement training [31, 35 ]. instead, improvements in movement errors after pure movement training have been explained by increased recruitment rates of the antagonist muscle. we also found that the temporal es - assisted training program partially restored premovement facilitation towards a normal pattern, although the significance of the facilitation at 50 ms before activation was marginal. it is known that movement training can enhance excitability of the movement mapping cortical area [21, 22, 36 ], and it is generally considered to function through a long - term potentiation - like mechanism in which the horizontal synaptic connections in the brain cortex are enhanced through motor learning [22, 3639 ]. moreover, mcdonnell and ridding reported that subjects who received 1 hour of peripheral es to the muscle responsible for movement prior to movement training had significant improvements in motor performance, suggesting that the peripheral es enhanced motor performance and motor learning ability. peripheral es has also been reported to facilitate the meps of the corresponding innervation muscles through plasticity - like mechanisms in various patients, including those with sca [2326 ]. previous studies have indicated that the triphasic emg pattern is centrally programmed [15, 4143 ] and stored in the motor cortex [14, 17, 44 ]. the correlated enhancement of premovement facilitation and the reduction of ag1-ant latency after temporal es - assisted training in our study may support the centrally programmed theory of triphasic emg pattern in ballistic movements. however, we failed to show other significant correlations between measurements, and it is possible that the relationship between the physiological improvements and functional improvements is complex and nonlinear. although ves were slightly decreased after training, they did not reach a statistically significant difference, in contrast to the ces. ve measures the inconsistency of performance [29, 30 ], and no significant improvement in ve suggests that the temporal es - assisted fast goal - directed movement training did not improve the variability between each trial. the potential mechanism of the training effect in the present study is that the temporal es - assisted training helped to rebuild the central program of the triphasic emg pattern through changes in plasticity in the neural network. the fixed temporal pattern of es that triggered the movement improved the accuracy of the muscle contraction pattern during the requested task resulting in better ces. in contrast, the extension range of the training movement was not strictly controlled or trained, and it is therefore not surprising to see no improvements in ves. in the present study, we concentrated on the modulation effect of the temporal es - assisted fast goal - directed movement training that improved the movement in the upper limbs functionally and physiologically in patients with sca. however, it is unclear whether es or movement training alone can achieve a similar or different effect. therefore, further studies are warranted to explore the effect of es or movement training alone and in combination. another concern may be the relatively small subjects number (10 in each group) as compared to other physiological studies [45, 46 ]. this limitation is due to the difficulty of recruiting patients for a long - term training study. hence, we can not fully exclude the possibility of the error and the accuracy problem caused by the small sample size. moreover, only single joint movement with fixed angle, stimulus intensity, and interval was tested in the present study. although the protocol was effective, it is not warranted to be the best. in conclusion, 4 weeks of movement training guided by alternating temporal es on the agonist and antagonist muscles shortened the latency between agonist and antagonist muscle activities, restored premovement facilitation, and improved movement accuracy in patients with sca. therefore, temporal es - assisted fast goal - directed movement training can be considered to be a convenient and helpful therapeutic modality to improve hypermetria and may potentially be useful for patients with dysmetria caused by diseases including stroke, multiple sclerosis, multiple system atrophy type c, and other brain lesions. | disrupted triphasic electromyography (emg) patterns of agonist and antagonist muscle pairs during fast goal - directed movements have been found in patients with hypermetria. since peripheral electrical stimulation (es) and motor training may modulate motor cortical excitability through plasticity mechanisms, we aimed to investigate whether temporal es - assisted movement training could influence premovement cortical excitability and alleviate hypermetria in patients with spinal cerebellar ataxia (sca). the emg of the agonist extensor carpi radialis muscle and antagonist flexor carpi radialis muscle, premovement motor evoked potentials (meps) of the flexor carpi radialis muscle, and the constant and variable errors of movements were assessed before and after 4 weeks of es - assisted fast goal - directed wrist extension training in the training group and of general health education in the control group. after training, the premovement meps of the antagonist muscle were facilitated at 50 ms before the onset of movement. in addition, the emg onset latency of the antagonist muscle shifted earlier and the constant error decreased significantly. in summary, temporal es - assisted training alleviated hypermetria by restoring antagonist premovement and temporal triphasic emg patterns in sca patients. this technique may be applied to treat hypermetria in cerebellar disorders. (this trial is registered with nct01983670.) |
this report is of a bilobed testicle in a 12-year - old boy, which presented as an atypical testicular mass. it is thought to be a variant of polyorchidism, which is associated with an increased risk of malignancy and testicular torsion. due to the extremely rare nature of bilobed testes, it is important to report our findings and start to gather information on the long - term outcome of this condition. a 12-year - old boy was referred by his gp to the paediatric surgery clinic in a district general hospital with a 6-week history of a lump near the inferior pole of his left testicle. it was non - tender, non - erythematous and had not changed in size or consistency. he was otherwise fit and well, with no family history of urological disorders. on examination, his abdomen was soft and non - tender, with a normal right testis and right spermatic cord. a smooth well - defined lump was palpated on the inferior pole of the left testis. ultrasound demonstrated that both testicles were of a similar size, with normal vascularity and normal epididymi. the palpable lump corresponded to a well - defined 1-cm mass attached to the lower pole of the left testicle (fig. 1). it had a similar echo pattern to the testicle with normal vascularity (fig. a mass is seen attached to the left testicle with the same echo pattern as the normal testicular tissue. a mass is seen attached to the left testicle with the same vascularity as surrounding testicular tissue. a mass is seen attached to the left testicle with the same echo pattern as the normal testicular tissue. a mass is seen attached to the left testicle with the same vascularity as surrounding testicular tissue. the size of the lump was unchanged, although he now reported intermittent pain and swelling of the lump. he was referred to a consultant paediatric urologist and his testicle rescanned 6 months after his initial presentation. he will be reviewed again in 12 months, with a view to discharging him if no further changes are seen. of the five previously reported cases of a bilobed testicle, four are in children aged from 3 to 13 [14 ] with the other occurring in a 30-year - old man who had been symptomatic for 10 years. a bilobed testicle is thought to represent an incomplete division of the genital ridge by peritoneal bands during the development of the testis from 6 weeks of embryological life. ultrasound and mri imaging of polyorchidism have demonstrated that the combined length of a supernumerary and ipsilateral testicle are the same as the contralateral testicle, supporting this theory. due to the larger number of case reports in comparison with a bilobed testicle and the presumed similar aetiology, we are reliant on the literature on polyorchidism when considering the management of a bilobed testicle. the risk of malignancy in a supernumerary testicle is reported between 5.7 and 7%, in comparison with 6 in 100 000 in the general population and 24 in 100 000 in cryptorchidism. there are no published cases to date of malignancy associated with a bilobed testicle and the reported cases of malignancy have occurred when the supernumerary testicle was found in a non - scrotal position. consequently, whilst an increased risk of malignancy is possible, the evidence is insufficient to advocate surgical management. a testicular tumour should be considered as a differential diagnosis of any scrotal mass. in view of the normal testicular architecture and vascularity on ultrasound, we excluded a tumour in our patient due to the high sensitivity of ultrasound. consequently, tumour markers such as alpha - fetoprotein and beta - human chorionic gonadotropin were not measured. spermatogenesis is normal in 50% of supernumerary testicles and it is likely that this figure is higher for bilobed testicles. a growing number of case reports suggest that conservative management with regular follow - up and imaging is appropriate for polyorchidism with normal echotexture on ultrasound and uncomplicated cases of bilobed testis [1, 2, 57 ]. a review published in 2004 found the risk of testicular torsion of a supernumerary testicle to be 15%, in comparison with 0.025% of the general population and 0.25% in cryptorchidism. of the five reported cases of bilobed testis, one case presented with torsion resulting in orchidectomy. they must know the signs and symptoms of torsion and be encouraged to present early if it is suspected. unlike cryptorchidism, surgery is not otherwise required for a bilobed testicle and therefore orchidopexy is not appropriate for uncomplicated cases. in our case, however, he was asymptomatic when examined with no ultrasound changes and so it was not felt that orchidopexy was indicated. regular hospital appointments can produce unnecessary distress and concern for the patient and their family. if no changes are seen in a further 12 months, our patient will be discharged to primary care. self - examination of the testicle may be challenging due to the distorted anatomy but should be advocated to detect early changes. ultrasound must be undertaken promptly if there is any concern about changes to the testicle. monitoring tumour markers may be appropriate in non - scrotal polyorchidism due to the significantly increased risk of malignancy. as the current literature does not provide strong evidence of malignancy associated with bilobed testis, it should not be advocated for this condition. conservative management appears to be appropriate in uncomplicated cases such as the one we present. it is unclear how the risk of torsion and malignancy in polyorchidism is applicable to a bilobed testicle. the risk of unnecessary surgery needs to be balanced against the risk of these serious complications. it is important that any long - term complications are reported to further our knowledge of this extremely rare condition. | a bilobed testicle is an extremely rare congenital malformation, with only five cases published to date. we present the case of a 12-year - old boy with a bilobed testicle. with so few cases available, much of what is known about the management of this condition is based on cases of polyorchidism and the complications associated with this, including malignancy and torsion. whilst surgery may play a role in some patients, uncomplicated cases can be managed conservatively. there is no long - term data on the outcome of conservative management but we propose this patient can be discharged if no further changes are identified after 18 months. |
in february october 2002, as part of a broader study, we captured, banded, and marked 156 american crows (c. brachyrhynchos) in champaign and urbana, illinois (yaremych sa. many of the study crows died in the summer ; all recovered crows were tested for wnv. dead crows were retrieved by tracking the radio signal to the carcasses, by chance encounter, or by notification from the public. dead study crows with transmitters were typically recovered < 36 hours after death, as this period was the maximum amount of time elapsed between the last live observation of a crow during radio tracking and recovery of the carcass upon death. we estimated that other marked study crows without transmitters were retrieved up to 72 hours after death. the abundance of dead crows allowed for a simple comparative study involving the use of vectest, rt - pcr, and ihc tests to detect wnv in crow fecal, saliva, and tissue samples. for each dead crow, we diluted fecal scrapings from the cloaca and salivary scrapings from the mouth in vectest buffer solution in the vials provided in the kit. a metal spatula was used to obtain samples, and instruments were sanitized with a wash of soap and water and 70% ethanol before and after use. in some cases, maggots were in such abundance in the mouth and cloaca that they could not be removed from the sample ; they were added to the vials with the feces and saliva. for carcasses with no moist fecal or saliva sample, small metal scissors were used to clip any available dried internal tissues around the mouth and cloaca. samples were shaken by hand for approximately 60 seconds for homogenization. from this point, we followed manufacturer s directions, having replaced mosquitoes with fecal, saliva, and tissue samples. indicator strips were inserted into the solution and interpreted in the field after 15 minutes. samples were stored at 80c after we performed the test. to confirm the results, we used rt - pcr taqman to detect the presence or absence of wnv - rna in these samples by a method similar to that used by lanciotti. alternatively, vectest results were confirmed by ihc testing of the brain, heart, kidney, and spleen of the crow carcass from which the samples were derived. the ihc testing was conducted by the university of illinois veterinary diagnostic laboratory, according to the method outlined by heinz - taheny (7). we used vectest to test all 20 crow samples ; all indicator strips developed control lines, which indicated that the test had performed according to instructions. nineteen samples were positive for wnv with a faint - to - bold wnv line ; one sample was negative for wnv. ihc testing was performed on the crow carcasses from which five of these positive samples were derived, and ihc labeling for wnv antigen was present in all five of these samples, indicating 100% confirmation of the vectest results. the remaining 15 vials containing the vectest crow sample, composed of 14 positives and 1 negative, were assayed by rt - pcr taqman. results from taqman showed 11 positives and 4 negatives (table). in total, 17 (85%) of 20 of the vectest results were confirmed with either ihc or rt - pcr taqman, and 3 (15%) of 20 involved conflicting results between the two testing methods for the samples. no significant difference existed between the positive and negative rates of vectest and rt - pcr in a chi - square analysis of a 2x2 contingency table (chi square = 2.16, df=1, p=0.14). using rt - pcr as the standard criterion, we found that vectest results included three false positives, yielding a false - positive rate of 75%. vectest west nile virus / saint louis encephalitis virus antigen panel assay (medical analysis systems inc. reverse transcriptase polymerase chain reaction ; taqman (applied biosystems, foster city, ca). although the rates of positives and negatives did not differ between vectest and rt - pcr in this study, this result may be an artifact of small sample size. the false - positive vectest results on american crow fecal, saliva, and tissue samples suggest a low specificity ; therefore, we recommend that vectest be considered experimental in its application to dead american crows until more extensive investigations are conducted. vectest may be useful in early season screening, when rates of positives are typically low, or in nonpeak areas. we conducted this study in mid- to late summer in east - central illinois, during a time when death rates of free - ranging american crows were high. rt - pcr detects genomic sequences of wnv, whereas vectest detects the viral capsid. because of the abundance of environmental rnaase and the possibility of the wnv capsid s persisting longer than the rna, the three false positives detected by vectest may indeed contain wnv capsid. alternately, the conjugate in vectest may react with a nonspecific protein in the fecal, saliva, or tissue samples of the dead crows to create a false positive. this preliminary investigation establishes the basis for more comprehensive research on the full capabilities of this test for wnv detection in birds, including the sensitivity of the test, the postmortem period for which the test is viable, and the effectiveness across a range of species. we suggest that vectest may be a cost - effective, rapid field technique for wnv detection in dead american crows in the early transmission season or in areas with low transmission rates, although confirmation of positives is suggested at this time. this assay may be a useful tool for epidemiologic studies of wnv transmission cycles involving american crows and will help to provide an epidemiologic basis for vector control efforts, although further study is warranted. | a dipstick immunochromatographic assay used for west nile virus (wnv) detection in mosquitoes was investigated for application to testing of fecal, saliva, and tissue samples from dead american crows (corvus brachyrhynchos). results suggest that vectest may be an efficient method for wnv detection in field - collected, dead american crows, although confirmation of results and further investigation are warranted. |
this review shows the equal or greater importance of leaded gasoline - contaminated dust compared to lead - based paint to the child lead problem, and that soil lead, resulting from leaded gasoline and pulverized lead - based paint, is at least or more important than lead - based paint (intact and not pulverized) as a pathway of human lead exposure. because lead - based paint is a high - dose source, the biologically relevant dosage is similar to lead in soil. both lead - based paint and soil lead are associated with severe lead poisoning. leaded gasoline and lead in food, but not lead - based paint, are strongly associated with population blood lead levels in both young children and adults. soil lead and house dust, but not lead - based paint, are associated with population blood lead levels in children. most soil lead and house dust are associated with leaded gasoline. lead - based paint dust is associated with cases of renovation of either exterior or interior environments in which the paint was pulverized. based upon the limited data to date, abatement of soil lead is more effective than abatement of lead - based paint in reducing blood lead levels of young children. about equal numbers of children under 7 years of age are exposed to soil lead and lead - based paint. seasonality studies point to soil lead as the main source of population blood lead levels. soil lead is a greater risk factor than lead - based paint to children engaged in hand - to - mouth and pica behavior. in summary, soil lead is important for addressing the population of children at risk of lead poisoning. when soil lead is acknowledged by regulators and the public health community as an important pathway of human lead exposure, then more effective opportunities for improving primary lead prevention can become a reality.imagesfigure 1 |
|
the incidence of diabetes mellitus has reached epidemic proportions and is one of the great biomedical challenges of the 21st century. diabetes is classified as a group of chronic metabolic disorders that are characterized by elevated blood glucose levels due to the insufficient production of insulin and/or peripheral insulin resistance. the strict division into type 1 and type 2 diabetes based on an autoimmune etiology versus a primarily metabolic pathology, respectively, has been challenged over the last few years and it has recently been suggested that a continuous spectrum of diabetic disorders exist. classical type 2 diabetes is a heterogeneous cluster of disorders, whereby both lifestyle and genetic factors play a role in its pathogenesis. an abnormal expression pattern in a number of genes and various proteins has been described to occur in type 2 diabetes [57 ]. besides impaired pancreatic functioning, peripheral insulin resistance in adipose tissue, the liver, and muscle tissues are the pathophysiological hallmarks of this type of diabetes. serious medical problems manifest themselves such as diabetic retinopathy, diabetic uropathy, diabetic foot infection, and diabetic nephropathy. glucotoxic and lipotoxic side effects due to chronic hyperglycemia and hyperlipidemia, respectively, may result in abnormal cellular functions. the impaired uptake of glucose and deleterious accumulation of lipids triggers the principle feature of type 2 diabetes, that is, the progressive dysregulation of carbohydrate homeostasis. with respect to muscle tissues, diabetes affects primarily cardiac cells and the classification of diabetic cardiomyopathy as a distinct clinical entity is currently under intense discussion [1517 ]. heart failure in diabetic patients, independent of coronary artery disease, appears to represent a discrete primary etiology. however, the skeletal musculature is also significantly involved in diabetic complications, that is, contractile weakness, fibre - type changes, decreased oxidative activity and peripheral insulin resistance. muscle is the most important insulin - dependent glucose sink in the body, therefore, impaired hormonal signaling has a deleterious effect on glucose uptake. the detailed biochemical characterization and proteomic establishment of distinct shifts in metabolic and signaling pathways in diabetic fibres might provide mechanistic insights into the underlying causes of (i) abnormal glucose metabolism and peripheral insulin resistance [22, 23 ], (ii) diabetes - associated loss of skeletal muscle mass and contractile strength [24, 25 ], which is especially prevalent in aged patients [26, 27 ], (iii) muscle mitochondrial dysfunction and the role of mitochondrial deficits in overall disease progression [2830 ], and (iv) slow - to - fast muscle transitions and reduced oxidative enzyme activity in muscle of type 2 diabetic subjects. the fact that drastic lifestyle modifications, such as an altered diet and increased physical activity, have a profound influence on insulin resistance and the onset of diabetic complications [33, 34 ] clearly demonstrates the crucial role of skeletal muscle metabolism in diabetes mellitus. since a single bout of exercise triggers a substantial increase in whole - body glucose disposal, mediated by the translocation of the crucial glucose transporter glut4 to the surface membrane system in contracting skeletal muscles, exercise training should play a key role in the prevention and treatment of diabetes [3638 ]. to better understand these beneficial effects of physical activity, it will be essential to increase our molecular understanding of how exercise utilizes different signaling mechanisms as compared to hormonal regulation of glucose uptake. genomic, proteomic and metabolomic approaches are highly suited to the conduction of such investigations and might determine the best way to counteract diabetic complications in the skeletal musculature. modern proteomics attempts to identify, catalogue, and characterize the entire protein constellation of specific cell types, tissues, or biological fluids using large - scale separation methods, such as two - dimensional gel electrophoresis or liquid chromatography, and high - throughput identification approaches focusing mostly on mass spectrometric techniques. proteomic studies of plasma and cells with mostly soluble components have revealed excellent coverage of protein complements. however, the dynamic range of protein expression in complex tissues and the large number of hydrophobic protein species that are present in membranous systems are major challenges for routine proteomic surveys. immuno - depletion of abundant components, equalization methods, or subcellular prefractionation can be used to overcome some of the problems associated with wide concentration ranges of proteins by reducing sample complexity [4143 ]. the analysis of the membrane proteome can be achieved by employing detergent phase extraction methods, on - membrane digestion protocols, or filter - aided sample preparation in order to include hydrophobic elements in proteomic surveys. however, aside from these technical problems, several physiological, cell biological, and biochemical parameters make the proteomic analysis of skeletal muscle an especially difficult task. in order to cover as many proteins as possible in proteomic studies, since muscle fibres are rigid structures that are embedded in a complex system of connective tissue, these biological properties make it an extremely tough tissue to homogenize. approximately half of the muscle protein content consists of the contractile apparatus with its various isoforms of myosin light chains, myosin heavy chains, troponins, tropomyosins, and associated proteins. due to the high density of these proteins, a certain degree of cross - contamination of protein spots in addition, a large number of very high - molecular - mass proteins exist in skeletal muscle fibres, with some of them being susceptible to proteolytic degradation. the occurrence of protein fragments has therefore to be taken into account in proteomic analyses. with respect to the under - representation of integral proteins in most proteomic investigations of crude tissue extracts, it is important to stress that skeletal muscles exhibit a highly elaborate membrane system, consisting of the sarcolemma, transverse tubules, triad junctions, the sarcoplasmic reticulum, and abundant organelles such as mitochondria. since mature skeletal muscle tissues are heterogeneous in composition, it has to be taken into account that total extracts contain muscle fibre proteins and components derived from nerves, capillaries, basal lamina, and satellite cells. the musculature is physiologically a highly adaptable system with the activity of the critical nerve - muscle connection at the neuromuscular junction dictating gene expression levels based on dynamic changes in neuromuscular activity. thus, ideally proteomic studies have to take the protein complement of motor neuron populations into account for comprehensive investigations of the muscle proteome. predominantly fast - twitching and slow - twitching fibres, as well as its many subtypes and hybrid forms, differ considerably in their proteomic constellation and adaptive capacity [5052 ]. an enormous variety of myosin chain combinations can be found in developing, maturing, and aging skeletal muscles. in this respect, mass - spectrometry - based proteomics is an ideal tool to differentiate subtypes of muscle fibres within a crude extract based on the unequivocal identification of myosin light and heavy chain combinations. the cellular and functional integrity of muscles depends heavily on constant loading and proper activity levels. on the one hand, chronic electrostimulation or physical training triggers profound changes in the protein expression pattern of muscles [5457 ], and on the other hand, disuse leads inevitably to muscular atrophy [5860 ]. proteomics can be employed to catalogue and characterize subtle changes in the abundance and/or isoform expression during muscle alterations. recent scientific achievements and technical challenges for future proteomic studies have been critically examined in several reviews [47, 48, 6163 ]. see figure 1 for the proteomic workflow of analyzing diabetic muscle tissues using a gel electrophoresis - based approach. over the last few years, mass - spectrometry - based proteomics has been established as a crucial analytical tool for biomarker discovery in the heterogeneous pathology of diabetes [6467 ]. proteomic studies have focused on diabetic nephropathy [6870 ], diabetic peripheral neuropathy and diabetic retinopathy [72, 73 ], as well as glucotoxicity and abnormal islet function [7476 ]. although skeletal muscle fibres also play a major role in type 2 diabetes, only a few proteomic surveys have addressed the issue of diabetes - related changes in muscle protein expression levels, as listed in table 1. the sections below critically examine the impact of recently published proteomic studies of type 2 diabetic skeletal muscle tissues [7785 ]. the occurrence of diabetes and cardiovascular disease has reached epidemic rates and there is a clear association of these disorders with obesity - related complications. impaired insulin - mediated glucose uptake in skeletal muscle fibres is related to high levels of circulating free fatty acids, an increased intramyocellular lipid content, diminished mitochondrial functioning and an overall weakened metabolic flexibility. pathobiochemical pathways that mediate chronic low - grade inflammation represent the most likely molecular link between obesity, diabetes, and cardiac disease. to properly study the role of obesity and diabetes in disturbing skeletal muscle metabolism and to evaluate the association between these two pathologies, a comparative proteomic survey would ideally determine global protein expression differences between age- and gender - matched, lean, nondiabetic subjects, and individuals that are classified as obese and diabetic, obese and nondiabetic, and nonobese and diabetic. since the availability of large numbers of clinical human tissue samples for comparative biochemical surveys is a challenge, so far only a few proteomic studies have addressed this fundamental question using human muscle specimens [7781 ]. two - dimensional gel electrophoresis in combination with maldi - tof ms analysis identified a small number of potential muscle - associated biomarkers for type 2 diabetes [77, 78 ]. the proteomic comparison of muscle samples from 10 diabetic patients versus 10 healthy gender- and age - matched controls revealed 8 potential markers of type 2 diabetes in the fasting state. this included the -subunit of atp synthase, isoforms of myosin light chain mlc2, creatine kinase, the 1(iv)-chain of collagen, glucose - regulated protein grp78, the molecular chaperone hsp90, and the glycolytic enzyme phosphoglucomutase. increased levels of the heat shock proteins hsp90 and grp78 indicated increased cellular stress in diabetic muscle tissue. elevated concentrations of phosphoglucomutase suggested an increased glycolytic - to - oxidative ratio in diabetic skeletal muscle during the fasting state. altered levels of the enzymatic interconversion of glucose-1-phosphate and glucose-6-phosphate possibly play a role in altered glycogen and glucose metabolism in diabetes. importantly, the catalytic -subunit of atp synthase was shown to exhibit abnormal phosphorylation in insulin - resistant muscle [77, 79 ]. the biochemical comparison of muscle samples from cohorts of healthy lean controls versus obese individuals versus patients afflicted with diabetes showed that the -subunit of atp synthase is phosphorylated at multiple sites and that abnormal phosphorylation patterns are present in diabetic muscle. the human atpsyn- molecule exhibits phosphorylation sites at thr213, tyr230, tyr269, thr312, tyr361, tyr395, and thr475, whereby thr213 is located in the nucleotide - binding region of this enzyme. in muscle samples from obese and diabetic individuals, thr213 and tyr361 in the -subunit of atp thus, dysregulation of atp synthesis probably triggers perturbations in mitochondrial functions and may be a contributing factor in type 2 diabetes. recently, a more comprehensive proteomic study of diabetic muscle was carried out by one - dimensional gel electrophoresis and hplc - esi - ms / ms analysis. hwang. compared the protein constellation of small percutaneous vastus lateralis muscle biopsies from lean, obese and type 2 diabetic subjects. this proteomic approach had previously been successfully applied to catalogue the human skeletal muscle protein complement and lead to the identification of 954 proteins in normal human vastus lateralis. in the diabetic muscle study, of 1,218 proteins assigned by mass spectrometric identification, a significant increase or decrease was established in 15 muscle proteins. while the expression of mitochondrial elements was shown to be lower in diabetic muscle, several molecular chaperones appear to be higher in insulin - resistant fibres. increased levels of the molecular chaperones hsp90, t - complex protein, and chaperonin, as well as the enzyme protein disulfide isomerase, agree with the idea of increased cellular stress in diabetic fibres. an altered concentration of -actinin and its binding - protein myozenin and a specific isoform of myosin indicate changes in skeletal muscle structure. drastically decreased mitochondrial proteins were identified as ubiquinol - cytochrome c reductase and cytochrome c oxidase, confirming a perturbed mitochondrial functioning in type 2 diabetes. reduced expression levels of genes encoding mitochondrial enzymes have previously been demonstrated by microarray studies. interestingly, the proteomic survey of rectus abdominus muscle from obese and morbidly obese women strongly suggests a compensatory glycolytic shift. increased glycolytic activity might represent a metabolic rescue to counteract mitochondrial dysfunction during progressive obesity- or diabetes - related impairments in oxidative muscle metabolism. the comparative proteomic analysis of mitochondria from insulin - sensitive versus insulin - resistant vastus lateralis muscle suggests an altered density of key enzymes involved in fat oxidation which might be an important contributory aspect of lipid accumulation in diabetes. since abnormal skeletal muscle functioning is a major feature of type 2 diabetes, it can be expected that distinct changes occur in the muscle proteome during the development of insulin resistance and diabetes. established animal models with key symptoms of diabetes are, therefore, an ideal experimental tool to study global alterations in the abundance, isoform expression pattern, and/or posttranslational modifications of muscle proteins. it is clearly evident from the large number of publications on animal model research covering diabetes mellitus that studying laboratory animals had a significant impact on understanding diabetic pathogenesis, testing novel drugs, and evaluating toxic side effects [9599 ]. hence, a lower number of experimental repeats is capable of producing meaningful sets of analytical data. since diabetes is a disease of both genetics and lifestyle that shows a complex pattern of symptoms affecting various tissue and organ systems, no one diabetes - related animal model is sufficient to study all of the clinical aspects of the metabolic symptoms seen in patients. therefore, a major research drive is to generate new diabetes models focusing on the various aspects of this complex metabolic disorder, such as neuropathy, retinopathy, uropathy, cardiovascular problems, and insulin resistance in skeletal muscle, as well as the overall impact of glucotoxicity on body homeostasis. enormous progress has been made by studying models of type 1 diabetes, such as streptozotocin - induced diabetes in rats, as well as type 2 diabetes including the nonobese goto - kakizaki rat and the obese zucker rat. with the emergence of genomics and proteomics, the search for novel genes and protein factors involved in the pathophysiology of diabetes has been decisively improved. the proteomic profiling of animal disease models is highly suitable for the identification of new biomarker signatures, for the development of superior diagnostics, and for the evaluation of novel treatment options to counteract diabetes - related side effects in skeletal muscle tissues. as reviewed by resj., studying animal models of diabetes using proteomics has provided unparalleled mechanistic insights into the development of insulin resistance and has revealed new biomedical opportunities for diabetes prevention strategies. however, it is crucial to keep in mind that related animal species may differ markedly with regard to drug effects, toxic side effects, dietary exposures, and diabetes development, strongly suggesting that studying a single animal system is not sufficient to properly predict human responses. although laboratory animals differ from humans in many physiological and biochemical responses which may affect the degree of cellular pathogenesis, studies of diabetic animals can be helpful to human diabetes predictions and prevention. as discussed in general by doran., a good animal model of diabetes should (i) closely resemble the etiology of human diabetes in onset, progression, complexity, and severity, (ii) develop all or most of the multifactorial aspects usually observed in advanced stages of human diabetes, (iii) mimic the basic mechanisms of human physiology and metabolism that are important for insulin resistance, (iv) be suitable for genetic manipulations and cell - based treatment strategies, and (vii) be large enough to yield sufficient amounts of biological samples for extended biochemical analyses or to facilitate physiological procedures. the initial findings from comparative animal proteomics can be extremely useful for making an informed decision on the design of large - scale clinical proteomics investigation. in the future, genetically engineered animal models promise to be extremely helpful for determining the pharmacological efficacy of novel diabetic drugs. thus, animal model research will be an important prerequisite for proper drug selection prior to the establishment of large - scale clinical trials for the treatment of diabetes. since mass - spectrometry - based proteomic studies of potential changes in the skeletal muscle proteome have mostly focused on the goto - kakizaki rat [8284 ], the suitability of this animal model of type 2 diabetes is briefly described. the general diabetic status of mature goto - kakizaki rats is exemplified by the fact that their blood glucose levels are significantly elevated, but that the concentration of nonfasting plasma insulin is not affected [101, 105, 106 ]. with respect to skeletal muscle tissues of the goto - kakizaki rat, numerous studies have clearly shown diabetes - related abnormalities, including (i) an inhibition of insulin receptor autophosphorylation, (ii) abnormal functioning of insulin signaling intermediates [108, 109 ], (iii) an altered subcellular localization and diminished recruitment of the main glucose transporter glut4, (iv) cytoskeletal defects in the sarcolemmal dystrophin - dystroglycan complex, (v) a significantly reduced percentage of oxidative fibres, and (vi) abnormal mitochondrial functioning. hence, chronically impaired insulin signaling and associated downstream alterations in skeletal muscle tissues make adult goto - kakizaki rats a suitable animal model of type 2 diabetes. the proteomic profiling of crude muscle extracts and subcelluar fractions from the goto - kakizaki rat has employed different protein staining methods for the visualization of protein spots in two - dimensional gels, that is, colloidal coomassie blue, fluorescent rubps [82, 83 ], and fluorescent cydyes for difference in - gel electrophoretic analysis [83, 84 ]. the different labeling techniques clearly showed variations in their dynamic visualization range, so proteomic findings from the 3 dyes used for densitometric scanning could be combined for a more complete coverage of changes within the diabetic muscle proteome. colloidal coomassie staining, routinely used for reliable protein detection following gel electrophoresis [114, 115 ], and fluorescence difference in - gel electrophoresis, which represents one of the most powerful biochemical tools for the comparative analysis of protein complements [116118 ], resulted in the detection of 929 and 1734 protein spots, respectively. the silver staining technique and protein labeling with the fluorescent rubps dye (ruthenium bathophenanthroline disulfonate) were employed as independent visualization methods for the verification of key findings in altered protein expression patterns [82, 83 ]. the mass spectrometric identification of distinct changes in proteins revealed that the nonobese diabetic phenotype exhibits a generally perturbed protein expression pattern. affected protein species were shown to be associated with the contractile apparatus, the antioxidant defense system, detoxification mechanisms, the cellular stress response, glucose metabolism, fatty acid utilization, nucleotide metabolism, and amino acid metabolism [8284 ]. the gel electrophoresis - based proteomic survey of normal versus nonobese diabetic rats showed an altered expression profile for muscle - associated proteins that are involved in lipolytic catabolism, the citric acid cycle, oxidative phosphorylation, glycolysis, nucleotide metabolism, carbon dioxide removal, oxygen transportation, amino acid catabolism, and cellular detoxification mechanisms. mass spectrometry identified the enzymes with the highest decrease as carbonic anhydrase ca3 and 3-hydroxy - isobutyrate dehydrogenase. the ca3 isoform of carbonic anhydrase mediates the vital conversion of co2 into carbonic acid in skeletal muscle tissues. the degradation of leucine, valine, and isoleucine involves the activity of hydroxy - isobutyrate, whereby the resulting carbon skeleton is utilized as a metabolic substrate for the generation of energy. the reduction of this rate - limiting enzyme suggests that the degradation pathway of amino acids is diminished in diabetic fibres. the concentration of enolase appears to be decreased, while aldolase and phosphoglucomutase showed elevated levels in muscle preparations from the goto - kakizaki rat. increased expression of phosphoglucomutase in diabetic rat muscle agrees with the above - discussed findings of an elevated density of this key glycolytic enzyme in human diabetic skeletal muscle. altered levels of glycolytic enzymes will have a profound effect on the metabolic flux in diabetic muscle. however, numerous glycolytic enzymes were shown to be multifunctional, making it difficult to conclude that peripheral insulin resistance in muscle directly affects the expression of select members of the 10-enzyme system of muscle glycolysis. interestingly, increased levels of adenylate kinase isoform ak1 and monoglyceride lipase were shown to exist in diabetic gastrocnemius muscle from the goto - kakizaki rat. changes in adenylate kinase could be interpreted as diabetes - related alterations in nucleotide metabolism and agrees with findings from the proteomic analysis of obese skeletal muscle. the metabolic enzyme monoglyceride lipase catalyses a key step in the hydrolysis of stored triglycerides and its increased abundance in diabetes may represent compensatory energy utilization by the lipolytic pathway in glucose - starved, nonobese muscle fibres. in the absence of alternative signaling mechanisms, such as exercise - induced glucose transport, insulin resistance clearly generates a lack of glucose removal from the circulatory system. decreased glucose uptake by skeletal muscle tissues then triggers a metabolic knock - on effect on other biochemical pathways such as gluconeogenesis, triacylglycerol hydrolysis, fatty acid oxidation, and ketone body formation. thus, the dysregulation of metabolism in diabetic muscle fibres is a highly complex pathology and proteomics has provided additional information of hitherto undetected changes in protein factors that may play a contributory role in type 2 diabetes. in the long term, a more complete comprehension of these complex metabolic alterations will improve our understanding of the overall pathobiochemical processes that lead to peripheral insulin resistance and diabetes - related muscle weakness. in addition to newly detected changes in metabolic enzymes, the fluorescence difference in - gel electrophoretic analysis of diabetic muscle revealed significantly increased levels of the small stress proteins b - crystallin and hsp27. the apparent upregulation of molecular chaperones indicates an enhanced cellular stress response in the diabetic phenotype. in general, stress proteins protect muscle cells during unfavorable conditions, such as extreme hyperthermia, ischemic damage, hypoxic insult, exercise - induced fibre damage, traumatic injury, and in disease - associated muscle degeneration. the family of small heat shock proteins is characterized by a conserved carboxy - terminal sequence, the alpha - crystallin domain. muscle - specific molecular chaperones counteract deleterious protein aggregation and specifically modulate intermediate filament assembly. the elements of the diabetes - associated increase in the cellular stress response might be useful candidates for the establishment of a comprehensive biomarker signature of type 2 diabetes. since mitochondrial dysfunction in skeletal muscle has been implicated in the progression of diabetic pathology [2830 ], it is of considerable interest to determine how the mitochondrial proteome is altered in diabetic fibres. mitochondria play a key role in cell cycle progression, calcium signaling, intermediary metabolism, protein transport, regulation of apoptosis, and energy generation via oxidative phosphorylation. altered protein expression levels or functional modifications of mitochondrial proteins are intrinsically involved in numerous development processes, the natural decline in body systems during aging, and the progression of many different pathologies. as reviewed by distler., the mitochondrial proteome contains approximately 1,500 individual protein species. this relatively manageable number of proteins can be routinely analysed by proteomic technologies, establishing subcellular proteomics as a suitable analytical method to evaluate global alterations in the mitochondrial protein complement. the fluorescence difference in - gel electrophoretic analysis of isolated mitochondria from diabetic gastrocnemius muscle showed changed concentration levels of a variety of metabolic enzymes. an altered expression of nadh dehydrogenase, cytochrome b - c1 complex, isocitrate dehydrogenase, pyruvate dehydrogenase, and atp synthase might trigger a diabetes - dependent impairment of mitochondrial oxidative phosphorylation in goto - kakizaki rat muscle. thus, mitochondrial abnormalities appear to play a contributory role in the molecular pathogenesis of type 2 diabetes and may be associated with the progressive development of insulin resistance. with respect to human diabetes, has demonstrated that it will be possible to study functional mitochondria from human muscle by proteomics in the future. such mass - spectrometry - based studies promise to determine the potential role of altered mitochondrial protein expression levels and/or posttranslational modifications in human type 2 diabetes. besides proteomic surveys of skeletal muscles from nonobese type 2 diabetic animal models, mass spectrometric methodology was also applied to the evaluation of fenofibrate - fed type 2 diabetic oletf rats, type 1 diabetic bb - dp rats, streptozotocin - induced type 1 diabetic mice, and animal models of obesity with a potential for prediabetic complications, such as c57bl/6 mice on a high - fat diet, interleukin receptor - knockout mice on a high - fat diet, capsaicin - treated obese rats, and obesity - prone op rats on a high - fat diet. the pharmacological substance fenofibrate is an agonist of the peroxisome proliferator - activated class of receptors, which are involved in the regulation of carbohydrate and lipid metabolism. a functionally unknown muscle protein named c11orf59 was shown to be markedly increased in a fenofibrate - dependent manner in diabetic oletf rats. obesity appears to have a profound influence on the skeletal muscle proteome, triggering a disturbed expression pattern in various metabolic enzymes [8991 ]. thus, the loss of metabolic homeostasis probably underlies obesity - associated disorders, such as the prediabetic syndrome and type 2 diabetes. the main findings of proteomic surveys of diabetic muscle preparations are summarized in figure 2. although only a limited number of studies have been published that used high - resolution two - dimensional gel electrophoresis or liquid chromatography in combination with mass spectrometry for the analysis of type 2 diabetes, a large number of changed muscle proteins involved in various cellular functions have already been identified. the future application of detailed biochemical, physiological, and cell biological analyses will be crucial to determine the general suitability of these new potential biomarkers as reliable indicators of downstream effects of insulin resistance and disease progression. this will not only be important for improving our biomedical understanding of the molecular pathogenesis that leads to diabetes mellitus but also be helpful for the improved design of diagnostics and the identification of novel therapeutic targets. as recently outlined by herder., the establishment of novel biomarkers for the prediction of type 2 diabetes is crucial to the identification of high - risk individuals who could benefit from targeted preventive measures. in this respect the, albeit limited, application of mass - spectrometry - based proteomics has shown that this highly specialized biochemical technology can make a valuable contribution to the general field of diabetes research. cardiovascular diseases, obesity - related disorders affecting multiple organ systems, the metabolic syndrome, and diabetes mellitus affect hundreds of millions of patients worldwide. these epidemiological facts warrant detailed biomedical studies into the molecular and cellular mechanisms of these crippling diseases. it is hoped that a better understanding of the molecular pathogenesis of common human disorders will help in the identification of novel therapeutic targets. in the long term, this should translate into the development of superior pharmacological approaches and better clinical treatment options. the etiology of type 2 diabetes appears to be influenced by both genetic and environmental factors, making it a great challenge to determine the causative interplay of genetic susceptibilities, pathophysiological aspects, and external features. a change in lifestyle, such as increased physical activity and improved nutritional regimes, can reverse some of the diabetic symptoms such as insulin resistance. diabetes is clearly a heterogeneous group of disorders and can cause extremely serious side effects, such as cardiomyopathy, stroke, lower limb amputation, kidney failure, blindness, and skeletal muscular weakness. in the older population, type 2 diabetes can result in significantly decreased muscle strength and may thus contribute to the development of physical disability in the elderly. sarcopenia of old age, the natural age - related decline in skeletal muscle mass and strength, can be exacerbated by the negative influence of the diabetic phenotype on muscle metabolism. it is, therefore, of the uttermost urgency to devise novel approaches to counteract diabetes - related muscle weakness and abnormal hormone signaling in of the most crucial insulin - dependent organs for glucose disposal. over the last few years, mass - spectrometry - based proteomics has been applied to diabetes research as an unbiased analytical tool for the global determination of abnormal protein expression patterns in diabetic muscle tissues. the proteomic profiling of both biopsy samples from diabetic subjects and muscle extracts from established animal models has resulted in the identification of a variety of new potential markers of diabetes. the biomarker signature of muscle - related changes due to diabetes includes components that are associated with the actomyosin apparatus, the cellular stress response, glucose utilization, fatty acid oxidation, and other metabolic pathways. interestingly, a very recent proteomic study of human diabetic muscle clearly supports the idea of oxidative - to - glycolytic shifts in energy metabolism of the diabetic phenotype. in addition, thingholm. have recently examined human myotubes from type 2 diabetic subjects and identified adenosine deaminase as a contributing factor in diabetes. the identification and characterization of disease stage - specific indicators is especially crucial for the evaluation of the prediabetic phase. insulin resistance in skeletal muscle represents one of the main features of diabetes - related dysregulation and probably develops during a relatively early phase of the prediabetic state. although low levels of insulin resistance can probably be partially compensated by increased hormonal secretion via enhanced pancreatic beta - cell activity in early type 2 diabetes, at more advanced stages of the disease, beta - cell failure occurs resulting in an insufficient concentration of circulating insulin to prevail over signaling defects in muscle tissue sensitivity. building on the findings of the initial proteomic surveys conducted, as outlined in this review, future mass - spectrometry - based investigations promise to identify new protein factors that will be indispensable for the improvement of diagnostic techniques that could monitor diabetic progression, and the discovery of superior therapeutic targets to eliminate peripheral insulin resistance and diabetes - associated contractile weakness. | insulin resistance in skeletal muscle tissues and diabetes - related muscle weakness are serious pathophysiological problems of increasing medical importance. in order to determine global changes in the protein complement of contractile tissues due to diabetes mellitus, mass - spectrometry - based proteomics has been applied to the investigation of diabetic muscle. this review summarizes the findings from recent proteomic surveys of muscle preparations from patients and established animal models of type 2 diabetes. the potential impact of novel biomarkers of diabetes, such as metabolic enzymes and molecular chaperones, is critically examined. disease - specific signature molecules may be useful for increasing our understanding of the molecular and cellular mechanisms of insulin resistance and possibly identify new therapeutic options that counteract diabetic abnormalities in peripheral organ systems. importantly, the biomedical establishment of biomarkers promises to accelerate the development of improved diagnostic procedures for characterizing individual stages of diabetic disease progression, including the early detection of prediabetic complications. |
cystic fibrosis (cf) is a genetic disease characterized by increased viscosity of the bronchial mucus and impaired mucocilliary clearance which predisposes to microbial colonization and infections of the respiratory tract. adult patients with cf have a high incidence of fungal colonization (42%) and invasive disease (11%). a variety of yeasts and filamentous fungi have been recovered from their respiratory samples, before and after lung transplantation. are the most common fungal species isolated, responsible of invasive infection after lung transplantation in patients with cf. recently, invasive pulmonary infections with emerging molds like scedosporium spp., rasamsonia argillacea or exophiala dermatitidis have been described, associated with fungemia for some of them : scedosporium apiospermum and fusarium solani. arthrographis kalrae, an emerging mold is an environmental saprophytic fungus, mainly found in soil and compost. in recent years, cases of opportunistic infections attributed to this pathogen were described : pulmonary infection, endocarditis, sinusitis, meningitis, keratitis, onychomycosis and mycetoma, affecting both immunocompromised and immunocompetent patients. our patient, a 19-year - old woman, was diagnosed with cystic fibrosis at the age of 4 months. she developed an exocrine pancreatic insufficiency, an insulin - dependent diabetes, a moderate chronic renal failure and a severe malnutrition (bmi 14). she also presented a permanent bacterial pulmonary colonization with staphylococcus aureus and pseudomonas aeruginosa, treated by aerosols of colistin. from 1998 to 2005 the lung colonization by a. fumigatus became permanent (positive sputa culture, presence of anti - aspergillus antibodies) for which a treatment with itraconazole 200 mg / day was initiated, increased up to 500 mg / day due to low serum levels. in march 2012, a. kalrae and various aspergillus species (a. fumigatus, a. flavus and a. nidulans) were regularly isolated in sputa cultures. itraconazole was then stopped and replaced by voriconazole 2200 mg / day, later increased to 2250 mg / day. the pre - transplant sputum culture found bacteria colonies (p. aeruginosa, s. aureus), one colony of a. terreus, three of a. fumigatus and ten of a. kalrae. on day 1 post - transplant, blood cultures, broncho - alveolar lavage (bal) and two tracheal aspirations were made. the patient received a probabilistic antibiotic treatment associating ceftazidime, ciprofloxacin, teicoplanin, aerosols of colistin and voriconazole 2200 mg twice a day. on day 3, mold colonies were isolated in blood cultures, bal, tracheal aspirations and in a bronchial smear of the explanted lung cultures. on day 4, molds were identified as a. kalrae, associated with one colony of a. terreus in the bal. given these results, antifungal therapy was modified on day 4 for caspofungin 50 mg / day in combination with liposomal amphotericin b i.v. 3 three colonies of a. kalrae and three colonies of a. fumigatus were found in another bal performed on day 5 post - transplant. the ct - scans and the chest radiographies performed during this acute episode (day 0, 3 and 21) were not contributory. only the first ct - scan showed signs of pulmonary infection of the lingula and lower lobe on day 21. on day 33, the liposomal amphotericin b i.v. was replaced by aerosols of liposomal amphotericin b 3/week, maintained until day 110 post - transplant. despite the negativation of pulmonary samples and the resolution of this acute fungal infection in the following months, the patient died 8 months after her transplantation because of a bacterial septic shock in a context of humoral rejection and a state of severe malnutrition. after two days of incubation at 35 c on chromogenic medium chromid candida (biomerieux, france) for the respiratory samples and on bactec plus aerobic f (beckton dickinson, france) at 37 c, there was growth of small yeast - like colonies. identification was performed based on three methods : a morphological examination, the biochemical characteristics and a mass spectrometry study. macroscopically, we observed small creamy, beige yeast - like colonies after two days of growth on chromogenic medium chromid candida (fig. 1). after 7 days of incubation, the colonies became dry and grainy. the same aspects were observed on sabouraud chloramphenicol (biorad, france) and sabouraud chloramphenicol actidione (biorad, france) at 37 c and 27 c (fig. 3). however, growth on sabouraud chloramphenicol medium with actidione was slower (5 days for yeast - like colonies) than without. a slide culture incubated for 48 h at 27 c on pcb medium (biorad, france) showed characteristic hyaline, septate hyphae with one - celled, smooth - walled arthroconidia and irregularly branched hyphae, with dendritic conidiophores (fig. the isolate was also inoculated into wells of an i d 32 plate (biomerieux, france). after 72 h of incubation, the profile code obtained did not correspond to any taxon scored in the manufacturer 's database. in parallel, mass spectrometry was performed using the microflex lt mass spectrometer (bruker daltonics, france), and analyzed using the maldi biotyper software (version 3.1 with enlarged database version 3.3.1.0 containing 4613 entries). mass spectrometry technique allowed to identify a. kalrae with logscore values > 2.0 (2.28, 2.24), according to the manufacturer 's recommendations. the identification was confirmed by a dna sequencing (using the internal transcribed spacer, its1 and its4) and comparison of obtained sequences to genbank (http://www.ncbi.nlm.nih.gov/genbank, accession number for closest hit km588309.1) and cbs (http://www.cbs.knaw.nl, accession number for closest hit cbs 10896_ex24366_12125_its) databases. a. kalrae was identified with an e - value of 0 (genbank), an overlap of 100% (cbs) and 100% identification concordance. the blood culture strain mics measured by etest gave the following results : amphotericin b 0.75 mg / ml, flucytosine > 32 mg / ml, voriconazole 0.125 mg / ml, posaconazole 0.50 mg / ml, fluconazole > 32 mg / ml, micafungin 0.012 mg / ml, caspofungin 0.047 mg / ml. the strain was sent to the national reference center, at pasteur institute. there, the mics values were determined according to the eucast method and gave the following results : amphotericin b 0.125 mg / ml, flucytosin>64 mg / ml, voriconazole 0.125 mg / ml, posaconazole 0.125 mg / ml, fluconazole 64 mg / ml, micafungin 4 mg / ml and caspofungin>4 mg / ml. arthrographis is a genus containing 5 species : a. kalrae, a. cuboidea, a. lignicola, a. pinicola and a. alba. a. kalrae is a saprophytic fungus with a worldwide distribution, found in soil and compost. in recent years, clinical cases of invasive infections attributed to this pathogen currently, one case of infection with arthrographis sp. and 14 cases of infection with a. kalrae have been reported (table 1) : two onychomycosis,, one mycetoma, five keratitis,,,, one of which associated with sinusitis, two knee joint infection,, one endocarditis, two pulmonary infections,, one meningitis and one fungal stroke. these cases have a worldwide distribution : seven cases in europe, one in china, one in japan, three in usa, one in mexico, one in malaysia and one in australia. three of the five patients with keratitis were soft contact lens wearers ; the other two and the two patients with the knee joint infections have had an injury contaminated with soil. the rest of the patients had predisposing infection factors like malnutrition, systemic corticosteroids, radiotherapy, aids, allogeneic hematopoietic stem cell transplant. diagnoses were always based on phenotypic characteristics and microscopic morphology using de hoog and sigler, and carmichael descriptions. in most cases, identification of the species was confirmed by molecular biology techniques (its, d1/d2 sequencing). no data were available about the most appropriate treatment for this kind of infection. in the previous described cases, when tested the strains were sensitive to azoles, amphotericin b and terbinafin and resistant to flucytosin, but no sensibility results were showed for echinocandins. the azoles showed high activity (mean mic 0.46 g / ml), amphotericin b very little activity (mean mic : 2 g / ml) and echinocandins showed no in vitro activity (mean mec at 24 h>8 g / ml). these results are different from ours but concordant with those of the national reference center for invasive mycoses and antifungals, which is using the eucast method. all patients described except the one with onychomycosis were treated with azoles associated or not with amphotericin b. some reported patients also required surgery (keratitis and knee joint infection). three patients died during their a. kalrae infection, one of them because of the fungus (patient with fungal stroke). given the fact that our patient developed a septic shock with a fungemia despite a prophylaxis with voriconazole, the choice was made to treat her with caspofungin in combination with liposomal amphotericin b. the clinical response was favorable with this treatment, regardless the resistance to the caspofungin detected by the national reference center. in the case of our patient, the evolution of the fungal infection was favorable with a rapid negativity of blood cultures and respiratory samples. the combination of caspofungin and liposomal amphotericin b was effective in our patient whose colonization by the fungus could not be eliminated by a long - term treatment with voriconazole. we therefore describe here the first case, to our knowledge, of an a. kalrae fungemia in a cystic fibrosis patient with an assumed pulmonary portal of entry. please note that this journal requires full disclosure of all sources of funding and potential conflicts of interest. the journal also requires a declaration that the author(s) have obtained written and signed consent to publish the case report from the patient or legal guardian(s). the statements on funding, conflict of interest and consent need to be submitted via our ethical form that can be downloaded from the submission site www.ees.elsevier.com/mmcr. please note that your manuscript will not be considered for publication until the signed ethical form has been received. | arthrographis kalrae is a hyalin fungus. it is a saprophyte of the environment, mainly found in soil and compost. in recent years, cases of opportunistic infections attributed to this pathogen have been described. our patient was a 19-year - old woman with cystic fibrosis. she presented a bacterial and fungal pulmonary colonization with aspergillus fumigatus and arthrographis. kalrae. after her lung transplantation, she developed an a. kalrae fungemia, treated with caspofungin 50 mg / day associated to liposomal amphotericin b i.v. 3 mg / kg / day. the patient died 8 months after her transplantation as the result of a bacterial septic shock. |
drug hypersensitivity syndrome (dhs) refers to a severe, potentially life - threatening, drug reaction. to better individualize this drug reaction, the term, drug rash with eosinophilia and systemic symptoms (dress) syndrome has recently been used. the most frequently involved organ is the liver, followed by the kidney and lungs. the pathophysiology of dress syndrome remains unclear, but a defect in detoxification of causative drug, immunologic imbalance, and viral infections have been suggested. the overall mortality in dress is about 10% and occurs in patients with severe multiorgan involvement. here, we present a case of a 10-year - old girl who developed dress syndrome after taking phenobarbital and ultimately died of multiorgan involvement with, acute respiratory distress syndrome (ards), pneumomediastinum and acinetobacter sepsis. a 10-year - old girl presented with high - grade intermittent fever with cough for 20 days and a generalized rash for 15 days following ingestion of phenobarbital for 6 weeks. there was h / o seizures with fever from the age of 18 months, but the severity and frequency of seizures started increasing, occurring even without fever for which she was put on oral phenobarbital. on admission, we found that the girl was toxic, febrile, icteric, with tachypnea, tachycardia, conjunctival congestion, stomatitis, and cervical, axillary and inguinal lymph node enlargement. there was a diffuse erythematous, maculopapular rash without vesiculation or blistering [figure 1 ]. diffuse rash with oral involvement initial investigations showed leukocytosis, eosinophilia (absolute eosinophil count : 1586/dl), high bilirubin, elevated liver enzymes, microscopic hematuria and minimal pyuria. imaging studies revealed hepatomegaly with features of hepatitis, mild pericardial effusion on echocardiography, and features of diffuse pneumonitis. dexamethasone) was added on persistence of fever and dyspnea, following which there was a short period of improvement. but after a few days, the girl again complained of sudden onset exacerbation of respiratory distress and we found that she had developed subcutaneous emphysema and pneumomediastinum [figure 2 ]. a repeat blood culture showed growth of acinetobacter baumanii and we switched over to sensitive antibiotics. but the general condition deteriorated and the patient developed ards for which she was ventilated. a systemic allergic reaction to anticonvulsant therapy was first described in 1950 and was named it has since been known as drug hypersensitivity syndrome and is now more often referred to as dress syndrome which is a specific, severe, idiosyncratic drug reaction characterized by skin rash with fever, facial edema, lymphadenopathy, and visceral involvement (hepatitis, pneumonitis, myocarditis, nephritis, and colitis). the diagnosis can be difficult because many of the clinical features can be nonspecific, and the syndrome often mimics infectious, neoplastic, or rheumatologic conditions. the diagnosis of dress syndrome involves three criterias : drug - induced skin eruptioneosinophillia, absolute eosinophil count > 1500/dl, or atypical lymphocytesat least one of the following systemic abnormalities : enlarged lymph nodes at least 2 cm in diameter, hepatitis, interstitial nephropathy, interstitial lung disease, or myocardial involvement. drug - induced skin eruption eosinophillia, absolute eosinophil count > 1500/dl, or atypical lymphocytes at least one of the following systemic abnormalities : enlarged lymph nodes at least 2 cm in diameter, hepatitis, interstitial nephropathy, interstitial lung disease, or myocardial involvement. anticonvulsants such as phenytoin, phenobarbital sodium, or carbamazepine, are the most common causes of dress syndrome. other drugs like lamotrigine, valproic acid, allopurinol, sulfasalazine, nonsteroidal anti - inflammatory drugs, nevirapine and vancomycin have also been associated with this syndrome. an association between human herpesvirus 6 infection and the development of dress syndrome has been suggested in susceptible patients. life - threatening multiorgan failure has been documented in dress syndrome ; it carries a mortality rate of about 10%, especially in patients who have liver involvement. but the pathogenesis is believed to be a drug - induced hypersensitivity caused by abnormalities in the production and detoxification of its active metabolites. a genetic predisposition may also exist, as evidenced by an increased risk in patients with a family history of dress syndrome. the syndrome may be related to epoxide hydrolase deficiency, which leads to accumulation of toxic metabolites, known as arene oxides, which may trigger an immunologic response. phenobarbital - induced fulminant hepatic failure in the setting of dress syndrome has been described. to our knowledge, this is the first instance wherein pneumomediastinum, ards and sepsis together have been reported to develop in phenobarbital associated dress syndrome. the recovery from this condition has been reported to be slow, lasting several weeks to months ; recurrences have also been reported. glucocorticoids remain the most widely used agents for treatment of dress syndrome and can result in clinical improvement, although well - controlled clinical trials are lacking. immuneglobulin in nevirapine - induced dress syndrome has been reported, as well as n - acetylcysteine in a patient with sulfasalazine - induced dress syndrome. | drug rash with eosinophilia and systemic symptoms (dress) syndrome reflects a serious hypersensitivity reaction to drugs, and is characterized by skin rash, fever, lymph node enlargement, and internal organ involvement. so far, numerous drugs such as sulfonamides, phenobarbital, sulfasalazine, carbamazepine, and phenytoin have been reported to cause dress syndrome. we report a case of a 10-year - old girl who developed clinical manifestations of fever, rash, lymphadenopathy, hypereosinophilia, and visceral involvement (hepatitis and pneumonitis) after taking phenobarbital for seizures, with subsequent development of sepsis, acute respiratory distress syndrome (ards) and spontaneous air leak syndrome (pnemothorax and pneumomediastinum). she was put on steroids and various antibiotics and was ventilated, but ultimately succumbed to sepsis and pulmonary complications. |
bacterial artificial chromosome (bac) libraries have been used extensively for constructing physical maps of the human genome as well as for whole - genome sequencing projects. these applications require the bac clones to be arrayed into the wells of microtiter plates for archiving single unique clones. the location in the array of each bac clone is used as clone name to connect the library with genome sequence data. such arrayed libraries have been frequently used as reference libraries for fingerprinting, bac - end sequencing, large - scale marker screening, cytogenetic mapping, and bac shotgun sequencing. however, the high costs of arrayed bac libraries can not be easily justified for applications that have a short lifespan or focus on small genomic regions or single gene. for instance, bacs are useful to recover a specific haplotype for a small genomic region in order to identify a disease - causing mutation. bac libraries made for such applications do not necessarily require a format where each clone is identifiable by a name. nonarrayed bac libraries can be conceivably screened by radioactive probe colony hybridization after plating it on petri dishes and screening a filter replicate. this process is laborious requiring multiple cycles of colony streaking and screening to generate pure colonies. alternately, libraries can be amplified and aliquots of the library screened through recombination selection, although feasibility of this approach has not yet been demonstrated for bac libraries. the latter approach is based on phenotypic modification of targeted clones through homologous recombination (hr) and the subsequent selective growth of these clones. this approach has mostly been followed using bacteriophage lambda libraries amplified on a host containing a probe plasmid and then tested in a restrictive e. coli strain for selective growth of recombinant lambda clones with an integrated plasmid [25 ]. newly developed technologies for site - specific engineering of bac clones have been collectively labeled recombineering because they rely on inducible hr to engineer modified bac clones. several systems make use of the reca - recbcd pathway, the rece, t proteins [8, 9 ], or the bacteriophage lambda hr genes : exo, bet, and gam [912 ]. described a new e. coli strain with inducible recombination derived from a defective lambda prophage harboring the lambda exo, bet, and gam genes. this strain (dy380) expresses the exo, bet, and gam genes under control of a temperature - sensitive ci-857 repressor. for our studies we chose to use the dy380 strain with the lambda prophage because the recombination proteins are tightly repressed at low temperature, hence likely reducing the toxicity and presumably ensuring optimal stability of bacs. furthermore, the high recombination efficiency is essential to increase the sensitivity of recombination selection from complex bac libraries. finally, transformation with high - molecular weight dna requires a specific genetic background and, so far, only dh10b and its derivatives have been found to be compatible with artificial chromosome generation. zhang. have shown that small - insert high - copy number plasmid libraries can be screened by hr. in particular, their plasmid library was transformed with a dna construct containing an antibiotic - resistance marker and terminal sequences homologous to the target region. we postulated that a somewhat similar approach could also work for screening bacs, which are high - molecular weight low copy number plasmids, provided that representative libraries can be prepared and the recombination process is adequately efficient. in this study we tested the feasibility of screening by hr lb and soc medium containing 20 g / ml chloramphenicol (cm), and 25 g / ml kanamycin (kan) were used to grow bac clones. all bacterial cultures in this study were maintained (unless specified) at 32c because of the temperature - inducible prophage in dy380 bacterial strain. n.g. copeland and contains a defective prophage to supply the expression of exo, bet, and gam necessary to execute hr. ecori digests were analyzed on a 1% agarose gel in 0.5xtbe at room temperature, 4 v / cm for 8 h. the gels were stained with ethidium bromide for visualization. ptarbac2.1 digested with ecori and dephosphorylated with ciap was used as a cloning vector to construct the library and pcypac1 as a template for kanamycin pcr amplification. we used a human bac (rp11 - 622d14) containing the complete human -globin locus the preparation of recombination proficient orangutan genomic library followed was performed following the cloning approach developed in our laboratory. dna was isolated from a blood sample from a male sumatran orangutan (segundo) by embedding dna in agarose. after pre - electrophoresis, high - molecular weight genomic dna was partially digested with a combination of ecori restriction enzyme and ecori methylase and the resultant fragments were subjected to double - size fractionation by pulsed field gel electrophoresis. dna fragments from the appropriate size fraction were cloned into the ecori digested and dephosphorylated ptarbac2.1 vector. the ligation products were then transformed into dy380 electrocompetent cells ; glycerol stocks of nonarrayed library were made before library amplification on agar plates. to perform control experiments 16,000 colonies (0.7x redundant library) were picked and arrayed into 42 384-well microtiter dishes. same 42 384-well microtiter dishes (16,000 clones) were gridded onto one 22 22 cm nylon high - density filter stamped in duplicate for screening by probe hybridization. to create a supply of nonarrayed library and ensure that each clone is equally represented before amplification, 10 l aliquots were collected from 16,000 wells into one flask and snap frozen in a dry ice ethanol bath. after the titer was determined (3 10 cfu / ml) a 1.6 10 cfu aliquot was taken for genomic library amplification experiment. to amplify the genomic library 16,000 clones were plated at a density of 3,000 cfu on 5 petri dishes (15 mm diameter) containing cm - agar. plates were incubated at 32c for 1824 hours to assess amplification rates and representation of the primary library. to harvest the small (0,20,5 mm) colony growth, 7 ml of lb media was poured on the agar 's surface and incubated at room temperature for 10 min on a rocking platform and 30 ml of lb containing lifted colonies were collected. glycerol was added up to 10%, 30 1 ml aliquots were snap frozen and stored at 80c with titer of 3 10 cfu / ml or 9 10 cfu in total. for 10 electroporations approximately 0.6 ml (3 10 cells) of an overnight culture of dy380 cells (or 3 10 cells from the amplified library) was inoculated into 60 ml of sob and were grown in 1 l baffled conical flasks shaking at 320 rpm until an od600 = 0.6 was reached. cells were collected by centrifugation at 5500 g for 5 min, washed with ice - cold water 3 times and finally resuspended in 200 l of ice - cold sterile water. electroporations were performed with a mix of 2 l of dna and 20 l of cells (1.5 10 cells/l or 3 10 cells per electroporation) using a gibco brl cell - porator set at 315 volts, 350 f, 2 k with resulting pulse more than 1.88 kv. after electroporation cells were resuspended in 500 l soc and incubated at 32c for 1.5 hour with shaking and spread on selective agar media. the achieved efficiency of transformation for large (180-kb) bac molecules was 10 cfu/g of dna. induction of -recombination of the culture for a total of 15 min at 42c was performed following a protocol reported by yu.. about 1 ml (3 10 cells) of glycerol stock from amplified library was inoculated into 60 ml of sob media with chloramphenicol and grown at 32c with shaking in a baffled flask for approximately 4 - 5 hours until an o.d.600 = 0.6 was reached. the flask containing the culture was then placed in a water bath shaker at 42c for 15 min (300 revs / min). immediately after, the flask was swirled in ice - water slurry for 10 minutes to cool down. cells were collected and washed following procedure for preparation and transformation of electrocompetent cells hereinabove. the 1.4-kb kanamycin cassette was pcr amplified from noti / ecori linearized pcypac2n vector using page - purified chimeric oligos. their structure is shown in table 3 in supplementary material available online at doi:10.1155/2011/560124. each chimeric primer is 69 - 70 bases long and contains a portion (shown in upper case characters, 49 - 50 nt long) homologous to the sequence of the targeted region and a portion homologous to the kanamycin gene (shown in lower case characters, 20 nt long). the pcr products were dpni digested and purified by washing with water using centricon spin columns (millipore). pcr colony screening was performed with 1921 nt - long screening primers (table 3). these primers yield pcr products in the range of 300700 bp from unmodified gene, while insertion of the kanr cassette should yield a pcr product over 1.7-kb (figure 6). the same flanking primers were used for verification of library representation after amplification and to generate the probes for library screening by hybridization. an aliquot from the amplified library (13.5 10 cells) was used to prepare 900 l of electrocompetent cells induced for recombination as described above. nine kan targeting constructs were electroporated 5 times each with 0.1 g of purified pcr product and incubated in sob at 32c for 1.5 hours before plating on kan lb plates in order to asses and optimize the efficiency of homologous recombination, we used rp11 - 622d14 bac clone (insert size 187 kb) which contains the complete human globin locus. a kan recombination cassette containing 50 bp terminal sequences homologous to nearby locations in the -globin gene was amplified by pcr as previously described in. the bac clone was electrotransformed using various amounts of pcr product over a 50-fold range. the number of kanamycin - resistant colonies increased proportionally with the amount of pcr product : 250500 clones for 10 ng ; 5,00010,000 clones for 100 ng ; 20,00025,000 clones for 500 ng of linear dna. the 100 ng linear dna was selected for further transformation experiments as an arbitrary compromise between recombination efficiency and total number of recombinant colonies. to assess the selectivity of the recombination process, mixtures of the globin bac with unrelated bacs from the rpci-11 library (http://bacpac.chori.org/hmale11.htm) were created and propagated in dy380 cells at various levels of complexity. following the induction of hr at 42c, the results of the transformation of these pools with the recombination cassette are shown in table 1. the most complex mixture of bacs still resulting in 1 - 2 kanamycin positive clones had 10,000 unrelated bac clones with an average 180 kb insert size. this bac mixture (1/10) corresponds to a complexity of 1.8 giga base pairs(gbp), representing about 60% of the haploid human genome. this 10 efficiency of homologous recombination makes our method compatible with hr screening of full size mammalian genome bac libraries. we took 40 random kanamycin positive clones obtained in the recombination selection experiment as a representative sample from different complexities listed in table 1. all clones tested positive by southern blot (data not shown) for globin figure 1(a) shows results from pcr screening of various kanamycin resistant clones using primers flanking expected -globin integration site. recombinant clones displayed complex recombination events as a result of a partial homology of recombination cassette with duplicated sequences within the globin locus (figure 1(b)) ; all clones recovered after recombination selection originated from rp11 - 622d14 bac indicating high selectivity for hr. to test the feasibility of hr screening of bac libraries using multiple probes, we prepared a bac library from genomic dna of sumatran orangutan (pongo abelii) in the conditional - recombination e. coli strain dy380. we then transferred 16,000 clones with an average size of 130 kb (2 gb total or equivalent to 0.7-fold genomic redundancy) (figure 2) into 384-well plates for size distribution analysis and preparation of high - density filters. to analyze genomic marker representation in the library genomic probes were designed in correspondence of genomic regions highly conserved between human and mouse. such probes were radioactively labeled and used to screen the high - density filters made from the orangutan test library. the hybridization results reveal 16 positives each from a different probe, indicating that the library is ~0.6-fold redundant. the consistency of hybridization results with the 0.7-fold estimate based on clone numbers and insert sizes argues for the absence of a major cloning bias in the dy380 strain. because the dy380 is a conditional temperature inducible recombination e. coli strain, it is conceivable that some leaky expression of the lambda recombination genes occurs at 32c and that this may destabilize the bac clones. to test for genetic instability, 8 isolates for 96 bac clones fingerprinting data was used for an automated contig assembly in fpc to bin the clones. we anticipated that for each clone, the 8 isolates fingerprinted would bind together into a contig, so we would expect 96 different contigs (1 per clone) with 8 clones per contig. for 90/96 contigs that was true, but there were a number of exceptions : for 3 clones all 8 isolates contained only a single band, 2 clones were identical, 2 clones failed to grow and in one isolate of clone#2 single band was missing (figure 3). high - resolution fingerprinting showed that there were no significant differences between the clones in the ecori fragments. therefore, we saw no evidence of major rearrangements of bac clones during their propagation in dy380 strain in the liquid culture demonstrating genetic stability of the bacs in this strain. the goal of library amplification is to have enough starting bacteria for preparing competent cells for transformations. for the screening with multiple hr probes (30300), the nonarrayed library has to be amplified about 1010-fold without loss of genomic representation. we amplified the library on solid agar making sure that colonies have similar growth conditions, thus maintaining the representation of the nonarrayed bac library. by plating the library on solid agar (see section 2 for the details), we achieved 5.6 10 amplification rate and collected a total of 9 10 cfu. it is noteworthy that with this amount of bacteria one could prepare up to 6 ml of competent cells the genomic representation of the amplified library was evaluated by pcr analysis of various titers of amplified and nonamplified library for 10 probes. table 2 illustrates that there was no differential growth during library amplification for any of 10 probes analyzed. hence, we achieved 5.6 10-fold of nonarrayed bac library amplification without a loss of genomic representation. to screen the library by homologous integration of a kan recombination cassette into the genes of interest, nine target cassettes were created by pcr amplification of the kan gene with 70 nt chimeric oligos. the nine target sequences were a subset of the sixteen conserved regions already confirmed to be present in the library by probe hybridization. previous reports have demonstrated higher efficiencies of recombinational deletions versus insertions. to make use of this effect while minimizing the size of the deletions, both ends of targeting cassette hence, homologous integration of the cassette was anticipated to result in a small deletion of genomic target dna with a concomitant insertion of the 1.3-kb kan selection marker. a stock of amplified nonarrayed library was produced by pooling together 10 l aliquots from each well of arrayed library (16,000 clones160 ml, ~5 10 cfu / ml) and one of the aliquots was used to produce electrocompetent cells. for each of the nine hr probes five 20 l aliquots of electrocompetent cells were transformed with 100 ng of targeting cassettes (45 electroporations total) and plated on selective media. the kan colonies were confirmed to contain the correct insertion of kan gene by pcr using screening primers flanking the site of integration (figures 4(a) and 4(b)). because all recombineering oligos were of the same length and similar gc content, differences in hr efficiency can be attributed to specific characteristics of the targeting site such as dna secondary structure or replication asymmetry. the integrity of targeted bacs after recombination was verified by ecori fingerprinting (figure 5). the fingerprints of the recombinant kan bac clones were compared with the original bac clones after ecori digestion. the ecori bands containing the 1.3-kb kan insert have not been identified for every clone although subtle upward band shifts can be seen in some of the target products (i.e., lanes 1, 2 k, and 3 in figure 5). thus, there were no large rearrangements detected confirming the integrity of bac clones after screening via hr. even with advances in new generation sequencing large insert libraries remain indispensable for genome assembly and characterization of structural variations. furthermore, bacs are a useful tool for cloning and stably maintaining large dna fragments, including genes and their intact regulatory elements. this is a great advantage, given the growing need for functional evaluation of various genes. some of the restrictions on manipulation of large insert bacs using conventional cloning techniques have been overcome by hr in e. coli, or recombineering. while recombineering simplifies bac modification and generation of gene targeting constructs, bac library construction, screening, and maintenance are time consuming and require special facilities. to simplify the process of bac library operation we took advantage of a method based on homologous recombination. although, the hr technique has previously been used for small - insert library screening, we developed its application further to screening of large - size genomic bac libraries. first, we demonstrated the genetic stability of bac clones during their propagation in dy380 strain. the genomic library created in this strain benefits from the tight regulation of recombination function by a combination of pl promoter with temperature sensitive ci-857 repressor. the library is stably propagated without rearrangements and leaking expression of recombinant proteins. second, we achieved high efficiency and selectivity of hr compatible with hr screening of bac libraries. we improved our hr techniques by selecting the clone of interest out of the mixed bacs, created a nonarrayed test library, and obtained seven out of nine positive clones from the library of 16,000 clones through hr screening. third, the high rate (5.6 10) bac library amplification on solid agar was accomplished without any loss of genomic representation thereby providing enough starting material for screening the library with multiple pcr probes through hr. the main advantages of isolation of specific clones through hr compared to traditional hybridization screening are its speed and low cost. the process of library construction consists of two main steps : creation of nonarrayed bac library through a ligation - transformation protocol and then picking, arraying, replicating, and gridding of the library to produce the filters for screening. about 75%80% of the total cost of the library is associated with the second step. by screening the library through hr we addressed this problem and omitted the second step. after creating the clones, library can be amplified using clones directly from ligation - transformation experiment (figure 6). to make it more practical and minimize the number of plates used we routinely use such plates to amplify full size genomic libraries without a loss of representation (not published data). another advantage of the nonarrayed bac genomic library method is that bac clones recovered by screening are ready for further modifications without the need of changing the host or incorporation of additional shuttle vectors to supply recombination function. in addition, hr library screening can be combined with precise targeted bac modifications to produce reporter constructs for functional studies and creation of animal models. provided that hr oligos are free of repeats, they can be placed within single intron or into different introns flanking critical exon(s) creating insertion or deletion, respectively. the targeting cassette is also simple to modify making it suitable for any specific experiment. for instance, the cassette may include short site - specific recombination sequences such as loxp, frt, and gateway and counter selection markers (phes, rpsl, tet, sacb) allowing removal of undesired kanr cassette or replacement with mammalian - specific markers and reporters. cre expressing plasmid transformed into bac - containing cells will efficiently delete the recombineering cassette even without counter selection. the low cost of nonarrayed bac library has the potential of promoting a widespread use of this approach in genomic applications such as identification of genomic regions for comparative analysis, creation of bac libraries from large number of animals, patients or tumors, cloning of specific haplotypes associated with predisposition to various disorders, and high - throughput engineering of knockout mice using bacs. the drawback of this approach is that it requires large volumes of dy380 electrocompetent cells for library construction. even though we have seen some large bacs successfully propagated in dy380, home grown cells could never achieve transformation efficiency of commercial cells for bacs over 130 kb. this limitation could be easily overcome by making the dy380 e. coli cell line commercially available. we pursue alternative approach to construct a bac vector with inducible recombination function on the backbone. | we have developed a new approach to screen bacterial artificial chromosome (bac) libraries by recombination selection. to test this method, we constructed an orangutan bac library using an e. coli strain (dy380) with temperature inducible homologous recombination (hr) capability. we amplified one library segment, induced hr at 42c to make it recombination proficient, and prepared electrocompetent cells for transformation with a kanamycin cassette to target sequences in the orangutan genome through terminal recombineering homologies. kanamycin - resistant colonies were tested for the presence of bacs containing the targeted genes by the use of a pcr - assay to confirm the presence of the kanamycin insertion. the results indicate that this is an effective approach for screening clones. the advantage of recombination screening is that it avoids the high costs associated with the preparation, screening, and archival storage of arrayed bac libraries. in addition, the screening can be conceivably combined with genetic engineering to create knockout and reporter constructs for functional studies. |
occupational science, a discipline concerned with human occupation and its situatedness in context (whiteford, townsend, & hocking, 2000) and role and function in society (clark., 1991 ; yerxa, 1990), can not underplay its central role in theorizing about occupation (ramugondo & kronenberg, 2015). the term occupation has different meanings in professional and general public discourses, with various configurations of occupation illuminating the complex nature of the construct and emphasizing different aspects of what it refers to. additionally, a number of constructs or concepts emerging from occupational science have different meanings in the everyday english language. outlining, unpacking and critiquing these constructs has great potential for a generative scholarship or theorizing, which is required to build and sustain occupational science as a discipline. theorizing has only recently come to be regarded as a recognizable scientific practice and a critical aspect of growing and deepening scholarship in the social sciences (swedberg, 2012). theorizing refers to the process of developing a system of interconnected ideas that condense and organize knowledge about the social world, explaining how some aspect of the social world works and why (neuman, 2011, p. 57). the process of developing a system of interconnected ideas about how human occupation is shaped, embedded and negotiated within, as well as how it contributes to the shaping of, social systems and structures (laliberte rudman, 2010, p. 55) is an important exercise for occupational scientists. how else could we advance occupational science as a recognizable body of knowledge, or develop, deepen and extend understandings of human occupation in order to communicate effectively with one another, and develop or critique empirical evidence ? central to theory are constructs or concepts. while these abstractions are often used interchangeably some authors draw a clear distinction, suggesting that concepts are phenomena with specific definitions that are broadly agreed upon while constructs are more complex phenomena, with multiple dimensions and thus possibly contested. for instance, neuman (2011) suggested that concepts differ in terms of level of abstraction and whether they operate singularly or in clusters, are simple or complex, and narrow or broad in scope. thus neuman s definition of abstract concepts corresponds with the definition of a construct, referring to aspects of the world that are not directly observable but can help people organize their thoughts and expand understandings. in this paper, some originate from classical theory, while others come out of deep contemplation and reflection, or after examining and synthesizing research findings (neuman, 2011 ; swedberg, 2012). the power available to the theorist in shaping knowledge by proposing new constructs, however, needs careful examination and interrogation. theorizing in occupational science, as in many social science disciplines or humanities, many authors have pointed to the skewed ontological positions of theorists in occupational therapy and occupational science in terms of gender, socio - cultural and socio - economic factors, whereby western, caucasian, female, middle - class, heterosexual and ableist constructions of meaningful occupation are favoured (hammell, 2009 ; hocking, 2012 ; iwama, 2003 ; kantartzis & molineux, 2011 ; kronenberg, algado, & pollard, 2005). for this reason, hammell (2011) warned of the potential danger of universalism and theoretical imperialism, arguing that theories from a diversity of cultural perspectives are likely to promote inclusivity and a richer understanding of occupation. in writing about a construct emerging from research on people who may be viewed as vulnerable, by virtue of their relative distance from the intellectual exercise of theorizing that does not involve them directly yet pertains to their everyday lives, it is imperative that i disclose some aspects of my socio - cultural positioning in relation to them. occupational consciousness is a construct with potential and particular relevance in occupational science that emerged from my doctoral work. the study explored intergenerational shifts and continuities in children s play within family, and investigated associated factors (ramugondo, 2012). the family i researched is black south african, representing a statistically dominant group in the country in terms of race and political affiliation to the ruling elite, but largely marginalized in terms of economic participation and growth (van der westhuizen, 2007). i share both racial and ethnic identities with this family, to whom i will refer as the gudani family. having grown up during apartheid south africa, i am a first generation university graduate in my family, only coming into contact with occupational therapy as a profession during my undergraduate studies. although both parents within the gudani family held post - matric qualifications, the family had never been exposed to occupational therapy. my presence within their community as a researcher of play sparked considerable interest, prompting a request for inclusion in the study from one family. the other two families that participated were approached in accordance with inclusion criteria for purposive sampling. recruitment followed ethical processes as approved by the human research ethics committee of the university of cape town. data were collected from all three families, although my doctoral thesis was based on analysis and synthesis of the extensive data gathered from the gudani family, who were given a copy of the thesis and audio recordings of narratives from the grandmother that captured previously unknown details about her childhood. the study was partly prompted by anxieties about the apparent decline of play in relation to what adults knew of their own childhood play, that were noted in the post - apartheid era. these anxieties were shared with me by various community leaders during my visits across south africa covering six provinces (limpopo, eastern cape, kwazulu - natal, northern cape, free state and gauteng). observations in my personal and professional life as an occupational therapist echoed these sentiments. similar anxieties are reflected in literature about british childhood play at the turn of the 20 century (barnes & kehily, 2003 ; bishop & curtis, 2001). the study sought to explore whether such anxieties in post - apartheid south africa could be settled in the same manner as they were in britain, where researchers concluded that rather than total decline, contemporary british childhood play was in many respects embedded in historical practices (barnes & kehily, 2003 ; boyes, 1995). given south africa s colonial and apartheid past, as well as large - scale, on - going, and rapid politico - ideological and macro - economic changes, and an accelerated pace of modernization (boehnke & bergs - winkels, 2002 ; haste, 2001), a study of change in children s play within family during early 20 to 21 centuries promised to yield interesting lessons about how play evolves as an occupation, and how individuals across generations within family assert agency in constructing a shared play narrative. the gudani family was studied as a case (flyvbjerg, 2006 ; stake, 2008), situated in post - apartheid south africa and reflective of its historical make - up as well as ongoing transitions. the three generations (grandmother, parents and children) were approached as embedded cases, allowing for historically situated play portraits to emerge for each generation. a focus on play as cultural practice necessitated an ethnographic lens to inform how i interrogated events and narratives about play, especially with regards to third generation. participant observation became the main data collection method during the 24 days that i visited the family, arriving in the morning and departing after the last child had gone to bed. during this time, audio footage was collected mainly via a listening device which i wore around my neck, capturing all conversations, including television audio output whenever i was in the lounge area. consistent with a critical paradigm that purports power to be discursive, circulated through dominant ideologies and practices (frisby, 1972 ; habermas, 1984 ; marcuse, 1968), i held on very lightly to notions of play as presented in academic text, opting to fore - front what emerged as the family s own constructions of what counts as play. useful in this approach was sutton - smith s view of play as elusive, and often framed in literature through theoretical lenses that are already contaminated by what professions and disciplines wish to see in it and use to assert power within the academy (sutton - smith, 1997). what emerged from the study was that while in this particular family play had retained elements found in its institutionalized forms, such as games albeit less prominent in the third generation unstructured play had become complicated, reflecting the complexification of the play narrative (ramugondo, 2012). this complication came as a result of western - led social change characterized by modernization, global awareness and consumerism, and accelerated by technology in the form of television and cell - phones. interestingly, even as adults in the family bemoaned the seemingly lost third generation, signaling the fading away of real play as a form of cultural loss, their role in this process was missing in the narratives. even as the television set went on when the first person got up in the morning and got switched off only when the last person went to bed, no mention was made of how this could compete with formalized or structured games, or influenced unstructured play. television, particularly local and american soap operas such as days of our lives and the young and the restless, not only determined time use and the patterning of occupations in and outside of family life, but also inserted itself into unstructured play and everyday conversation. the apparent lack of awareness about the role of television in what became of play within the third generation, and the accompanying anxiety about the loss of collectively shared notions of real play, led to the emergence of occupational consciousness as a construct with potential relevance in occupational science. this is especially so since it shares both converging and diverging points in how it has been used, or with other related concepts in other disciplines. potential convergence exists between occupational consciousness and other sociological concepts associated with social inequity and systems of stratification, particularly those grounded on marxian and weberian thought, such as class and status consciousness ; the subjective awareness of class or status location and the implications of such awareness for social action (laumann & senter, 1976, p. 1307). it is not so much in the notion of class or status location the conception of which has been problematized in sociology (marshall, 1997 ; wright, 1979) that potential synergy lies, but the formulation of consciousness as an emotional and psychic response to social stratification ; always in interaction with the makings and consequences of such stratification (reay, 2005). this sociological perspective on consciousness has permeated much of post - colonial theory, and provides a central theoretical grounding for how i continue to conceptualize occupational consciousness. social scientists have long concerned themselves with how social stratification positions unequal groups in characteristic patterns of social relationships, but without much theoretical development to explain the link and the nature of such relationships (laumann & senter, 1976 ; nash, 2008 ; reay, 2005). in dealing with oppression and casting a critical theoretical lens to intervene in those ideological discourses of modernity that attempt to give a hegemonic normality to the uneven development and the differential (bhabha, 1994, p. 171), post - colonial theorists have provided important insights in the quest to understand these dynamics. fanon and biko in particular, emerging from a liberation thought on colonialism and black domination, have been able to illustrate how often times both the oppressed and the oppressors reinforce oppressive systems. this perspective echoes a view expressed by paulo freire with reference to the social and political landscape in latin america during the 1960s and 1970s where he observed that : both the metropolitan society and the dependent society, totalities in themselves, are part of a greater whole, the economic, historical, cultural, and political context in which their mutual relationships evolve the dependent society is by definition a silent society. its voice is not an authentic voice, but merely an echo of the voice of the metropolis in every way, the metropolis speaks, the dependent listens. 503 - 504) fanon (1952/1967), through his treatment of the notion of internalization, contended that the success of colonialism throughout the african continent could not depend solely on the might of colonial states, but also implicit consent of the oppressed. it is in this tacit but unwitting consent that i saw parallels between how oppression can be enacted and sustained, and how the gudani family could be displaced from the central role of orchestrating its own play narrative across generations. like colonialism, this shift in control for the occupational trajectory of children s play for the family did not happen overnight. occupational consciousness is thus concerned with how the things people do every day, individually and collectively, sustain systems and structures that support and promote certain occupations or certain ways of doing, to the exclusion of others. it is also about uncovering the trappings of human occupation that perpetuate these systems and structures. occupational consciousness, however, is not about framing the oppressed as cultural dopes (garfinkel, 1967) or as perpetually unaware and incapable of resisting dominance. to the contrary, the term unearths and gives language to acts of resistance that may already be in existence in certain communities that have and continue to face marginalisation and oppression, but have not yet been theoretically explored in occupational science. both the metropolitan society and the dependent society, totalities in themselves, are part of a greater whole, the economic, historical, cultural, and political context in which their mutual relationships evolve the dependent society is by definition a silent society. its voice is not an authentic voice, but merely an echo of the voice of the metropolis in every way, the metropolis speaks, the dependent listens. 503 - 504) both fanon and biko centered their philosophy of liberation on the notion of consciousness. freire (1998) also wrote extensively about the necessity for conscientization in order to break the culture of silence in the dependent society. he noted, however, that even as there may be similarities in how the path to liberation may be advanced in both latin america and other areas of the third world, each context will present particular nuances. consistent with sociological formulations that view it as a response to social stratification (reay, 2005), consciousness is also referred to as a mental attitude in continuous interaction with oppressive systems (biko, 1978 ; fanon, 1961/1963) and a commitment to fight all forces that seek to use identity as a stamp that marks out subservience (biko, 1978). it is a response that requires that one acknowledges that one is indeed oppressed because it is from the other and her exteriority that the new truth - claims spring forth and demand explanation (dussel, 2011, p. 21). freire (1998) also stressed the need for the oppressed to acknowledge this reality, as a first critical step to self - liberation. this stance begins to deal with what social scientists had long evaded a theoretical analysis of the patterns of social relationships between unequal groups albeit from the position of those that admit to suffer the consequences of such social stratification. while biko and fanon s analyses came from liberation thought regarding colonialism and black domination, there are interesting parallels between what can be understood of this analysis and relational patterns between groups with unequal access to meaningful and dignified occupation, and the manner in which systems and structures that sustain such stratification are maintained. biko and fanon consistently argued that the instrumental mode of division is central to the colonial project, with regions within colonies differently marked for privilege across history (fanon, 1961/1963). biko (1978) observed how in apartheid south africa, racial difference was used to stratify people with regards to privilege and resources. lighter skinned black people could climb the social strata and earn more privileges by successfully proving to the authorities that they were of a different race. biko (1978) saw this as a deliberate design by the system to not only stratify people socially, but also in terms of their aspirations. stratified this way, it becomes not only logical but legitimate for people in different social strata to view their positions as deserved. those with sustained privileges and accumulated resources would then fight hard to retain access, while those with less may resign themselves to the limits prescribed for them. the consequences of division within a colonial project for those at the lower end of privilege is that they not only end with feeling separate from the privileged other, but also reduced. for those that benefit from oppressive systems, the oppressed other and his or her ways would need to change substantially, in order to enjoy the same entitlements. consciousness, for biko, therefore begins with a realization that regardless of our positions across social strata, we are all oppressed, and the fact that people are oppressed to varying degrees is a deliberate design of the system. this deliberateness renders individuals and groups within an unequal system able to participate in their own and each other s oppression. it was for this reason that biko saw a strong interrelationship between a consciousness of the self and the emancipatory project. the most potent weapon in the hands of the oppressor is the mind of the oppressed it serves to disrupt the cycle through which subjectivities developed through oppressive systems and othering are sustained. while biko wrote about oppression with a focus on race, blackness and whiteness, fanon signaled very clearly that a central issue of liberation philosophy is not so much the color of one s skin, but how power is used by those with means within an unequal society and the reasons that underlie their continuous hold on power. fanon s analysis of these issues, however, aligns very closely with biko s central arguments about what sustains oppressive systems ; the legitimization of ongoing access to privilege for those with relative power, and the reduction of the other to a lesser being who can graduate to a place of significance only through the denial of self and concomitant emulation of the elite. with reference to the pitfalls of national consciousness amongst the middle - class and political elite at the end of colonial regimes across african and latin - american states, often failed to govern with attention to new social relations that needed to be understood and developed in the interest of the whole nation. in their haste to replace the foreigner and to fit the cosmopolitan mold, they paid little attention to the problems faced by peoples of the new nation from the perspectives of all who make up that nation. this, fanon termed intellectual laziness, which serves to engraft social relations between unequal groups along the lines already laid down by colonialism. nationalization, in this narrow sense, has nothing to do with transforming the nation ; it consists, prosaically, of being the transmission line between the nation and a capitalism, rampant though camouflaged, which today puts on the masque of neo - colonialism (fanon, 1961/1963, p. 122). this, for those who have suggested that post - colonial africa is a myth (aidoo, 1991 ; grosfoguel, 2011), is referred to as coloniality, and defined by maldonado - torres (2007) thus : long - standing patterns of power that emerged as a result of colonialism, but that define culture, labour, intersubjective relations, and knowledge production well beyond the strict limits of colonial administrations. it is maintained alive in books, in the criteria for academic performance, in cultural patterns, in common sense, in the self - image of peoples, in aspirations of self, and so many other aspects of our modern experience. in a way, as modern subjects we breathe coloniality all the time and every day. (p. 243) consciousness, as understood by biko (1978) and fanon (1961/1963), can thus be seen as a mental attitude and commitment to resist coloniality ; patterns of power that define and sustain dominant cultural practices and patterns and in so doing reproduce unequal intersubjective relations. it requires particular attention to mechanisms that serve to divide people, denying those in the periphery their voice, or the ability to tell stories that matter to them. it is recognition that to accede to these mechanisms is to deny humanity a chance at collective self - understanding. long - standing patterns of power that emerged as a result of colonialism, but that define culture, labour, intersubjective relations, and knowledge production well beyond the strict limits of colonial administrations. it is maintained alive in books, in the criteria for academic performance, in cultural patterns, in common sense, in the self - image of peoples, in aspirations of self, and so many other aspects of our modern experience. in a way, as modern subjects we breathe coloniality all the time and every day. intersections between consciousness and occupation hold potential for theorizing about human occupation within occupational science as a discipline, perhaps even introducing the philosophy of liberation (dussel, 1995, 2000, 2011 ; fanon, 1961/1963) into the discipline. the philosophy of liberation has been best articulated by dussel renowned as its co - founder amongst a group of argentinian philosophers who emerged in the 1960s during military dictatorship (burton & osorio, 2011 ; dussel, 2011 ; mahvish, 2013) to refer to an explanation of oppression and a critique of dominant accepted truths about the status quo, from the viewpoint of alterity ; the perspective of the oppressed other (dussel, 2011). human occupation may very well be central to oppression and coloniality, in that doing is the most visible enactment of unequal intersubjective relations. consistent with a transactional view of occupation (dickie, cutchin, & humphry, 2006), what people do every day sustains discourses that produce and maintain truths about self or selves and others. similarly, ramugondo and kronenberg (2015) have argued that human beings in fact are occupied, not only in terms of using their time, energy and personal resources, but also in that they are jointly culpable for what becomes of themselves and others, through their action in and on the world. in drawing links between human occupation and consciousness as understood from fanon and biko, and grounded within the philosophy of liberation, i highlight the need for a wakefulness or alertness about how the things that human beings do every day intersect with inequality and oppression. the generation of constructs within occupational science in recent years has been celebrated by many, viewed as critical to advancing theory related to occupation and its situatedness. some of these constructs can form interconnected groups, which i refer to here as construct clusters, borrowing from neuman s (2011) description of concept clusters ; a collection of associated concepts that are consistent and mutually reinforcing (p. 65). occupational consciousness, as a construct, enjoys synergy with a number of constructs introduced to occupational science during the past decade, as well as occupational therapy discourse. this paper serves to highlight some of the conceptual links between occupational consciousness and these other constructs as an introduction to what i hope will be an ongoing occupational terminology interactive dialogue there may also be other constructs or concepts i have not identified, that fall within the same cluster of construct for theorizing purposes. in outlining some of the conceptual links between occupational consciousness and the four constructs i identify here, i am hoping to illuminate some potential for occupational science terminology to interact in ways that advance theorizing about human occupation. the four constructs i begin to draw from in this occupational terminology interactive dialogue are occupational possibilities, occupational choice, occupational apartheid, and collective occupation. laliberte rudman (2010), having analyzed discourses pertaining to aging and occupations that become constructed as ideal or non - ideal, introduced occupational possibilities as a construct in occupational science. drawing from a foucauldian concept, governmentality, she was able to demonstrate how transactions between socially contextualized structure and agency shape occupation at individual and collective levels, arguing that this is the mechanism through which occupational possibilities are differently shaped for different categories of persons or social groups. laliberte rudman (2010) further proposed that a generative way to advance understanding of the interplay between structure and agency in the negotiation and enactment of occupation was not only understanding how occupational possibilities come about within context, but also how they are taken up and at times resisted by individuals and collectives. occupational consciousness links very strongly with the latter part of this proposition, highlighting that it is through everyday doing at individual and collective levels that systems and structures that support and promote certain occupations to the exclusion of others, are sustained. this point was also made by angell (2014), who argued that human occupation could be a site of both resistance to and reproduction of the social order (p. 104). occupational consciousness, as an occupational science construct, underscores this resistance, suggesting that some level of alertness to how everyday doing intersects with oppression is necessary at individual and collective levels in order to disrupt the cycle through which subjectivities developed through governmentality are sustained. where occupational possibilities frame occupation as an essential object and target of contemporary technologies of government (laliberte rudman, 2010, p. 58), occupational consciousness frames human occupation as a possible response. this response is essential for dignified living, especially for those who are oppressed by circulating dominant discourses. as laliberte rudman (2010) argued, the circulation of discourses appears to be based on a true understanding of what is to be governed with some authorities and agents having more power to influence how discourses are shaped and what discourses come to be most pervasive occupational consciousness is concerned with how human occupation sustains discourses that produce and sustain these truths in relation to self as the oppressed other. advancing the notion that dominant discourses may be sustained by individual and collective action in the world, galvaan (2012, 2015) introduced the construct of occupational choice. she argued that rather than just a conscious act to assert individual agency onto the world, making choices about what to do or not to do was a transactional act between person and context ; a mechanism through which agents and structures define and reproduce each other (2012, p. 160). drawing from bourdieu s critique of rational choice theory and insight about the relationship between structure and agency in shaping social action, galvaan (2012) noted that the occupational choices of adolescents in a western cape community of south africa were contingent upon, and consistent with, those historic socioeconomic and politically asserted patterns of occupational engagement that have developed and been perpetuated in lavender hill since apartheid this patterning occurred even as both the adolescents and adults at times explicitly disapproved of some of these occupations that were historically predicated and a form of occupational injustice, for example dropping out of school or abusing alcohol (galvaan, 2012). this restricted mindset in relation to making occupational choices intersects well with the notion of occupational consciousness. both constructs point to a form of individual and collective culpability to the circulation of dominant discourses, borne by those who are oppressed but cultivated and maintained by oppressive systems that privilege certain subjectivities over others. however, culpability for ongoing oppression and dominance is not only reserved for those that are forced to bear it by virtue of having limited access to structural power. drawing from aristotellian and orwellian perspectives, kronenbeg and pollard (2005) introduced the notion of occupational apartheid, arguing that unequal power relations and consequent access or lack thereof to meaningful and dignified occupation results from a reluctance on the part of privileged sectors of society to confront injustice, because the world s economies have been benefitting from it [emphasis added ] materially and in terms of local political and social stability (p. 66). the authors use of a contentious term apartheid is deliberate, aiming to excavate the systematic segregation of occupational opportunity (kronenberg & pollard, 2005, p. 59), which advances access to power for some but not all people. unlike occupational choice and occupational consciousness, which are constructs that illuminate individual and collective culpability for perpetuating dominant practices and discourses on the part of the oppressed, occupational apartheid exposes individual and collective culpability and complacency on the side of those who benefit from oppressive systems. while both occupational apartheid and occupational consciousness focus on the fact that some agents have more power than others to influence which discourses become pervasive through human occupation, both constructs also bring to light the relational mechanisms and dynamics between unequal agents. occupational apartheid exposes the illusion held by those privileged by dominant structures that the oppressed other has no capacity to realize power, while occupational consciousness points to the response always available to the oppressed to disrupt occupational apartheid, through everyday doing. individual - collective culpability and complacency regarding occupations that perpetuate oppressive systems or disrupt dominant practices that marginalize, is articulated in ramugondo and kronenberg s (2015) definition of collective occupations, a construct introduced to occupational science by fogelberg and frauwirth (2010). in their definition, ramugondo and kronenberg suggested collective occupations to be those that are engaged in by individuals, groups, communities and/or societies in everyday contexts that may reflect an intention towards social cohesion or dysfunction, and/or advancement of or aversion to a common good (p. 10). they grounded this teleological or explanatory approach to collective occupation on the notion of ubuntu ; an african interactive ethic defined by cornell and van marle (2005) as referring to human interconnectedness, or how peoples humanity is constantly shaped in interaction with each other, assigning responsibility to both the individual and the community for the other s existence. through this perspective, ramugondo and kronenberg (2015) argued that peoples shared humanity is constantly being shaped by what we are able or unable to do within groups, communities, and society (p. 12). in a similar vein, laliberte rudman (2010) suggested that occupational possibilities could provide a lens to critically appraise the ways and ends to which occupation is being promoted. ramugondo and kronenberg proposed that in paying attention to the intentional stance of individual and collective occupation, humans as agents within society may be persuaded to ask of themselves : whom do my or our occupations serve ? it is the intentionality within collective occupation (ramugondo & kronenberg, 2015) that intersects with occupational consciousness. in raising consciousness about collective occupations, individuals, families, groups and whole communities begin to elevate the work required to build just societies from mere rhetoric, to paying attention to the ways in which human occupation contributes to or detracts from building such societies. occupational consciousness, however, focusses on those who exist on the margins of unjust societies and calls attention to how, in their respective spaces of occupational influence, individuals can disrupt societal dynamics that perpetuate unjust worlds. in paying attention to only four constructs that share conceptual synergies with occupational consciousness, my intention is not to exclude other constructs or concepts that may also share links with these constructs individually, or as another separate construct cluster. the four constructs, along with occupational consciousness, are outlined here because they begin to illuminate the politics of human occupation (frank, 1996 ; kronenberg & pollard, 2005 ; laliberte rudman, 2013). attention to the politics of human occupation can not be separate from the philosophy of liberation, and without regard to how coloniality (aidoo, 1991 ; grosfoguel, 2011 ; maldonado - torres, 2007 ; ndlovu - gatsheni, 2013) impacts those on the margins of the globalized world. as dussel (2013) argued, it is on the basis of a philosophy of liberation as logic, politics, ethics and interrogating the status quo, that those on the periphery of the dominant world can have a dialogue with modernity and begin to rethink their problems. rather than grand ideals for a global revolution, a simple attempt by those on the periphery towards dignified living is central to this undertaking ; the possibility of authoring the production, reproduction and development of lives in the material, social and cultural sense (burton & osorio, 2011 ; dussel, 2011). in occupational science terms, this refers to those excluded from driving global occupational possibilities (laliberte rudman, 2010), being able, at times, to resist dominant discourses in order to orchestrate their own occupational narratives (goldstein, kielhofner, & paul - ward, 2004) in accordance with what informs meaningful and dignified living. this resistance requires alertness to how human occupation intersects with dominance and perpetuates inequality and oppression, what i refer to as occupational consciousness. in this sense, occupational consciousness illuminates the critical perspective of the oppressed other. occupational consciousness is thus about adopting transgressive acts to disrupt the cycle of oppression through human occupation. in introducing this construct in occupational science as part of a philosophy of liberation, i contend that everyday doing while the most difficult thing to change at individual or collective levels this point was made explicit at the two most recent congresses hosted by the occupational therapy africa regional group (otarg) in zambia, and zimbabwe. having introduced occupational consciousness as an emerging occupational science construct at the zambian otarg congress in 2011, i was approached by one of the zambian delegates. i asked her to explain, and she replied that it is because she knew many families in zambia, including her own, where the television set was on during all hours of the day, without much interrogation about why this is so, and with little reflection about what unrestricted television viewing might lead to in the future with regards to local cultural practices, as well as health and well - being. at the otarg congress in zimbabwe in 2013, i had the privilege of co - facilitating a workshop with my colleague, roshan galvaan, titled occupational choice and occupational consciousness : an african dialogue. during discussions, one of the participants remarked that she was not too sure whether she liked the construct occupational consciousness or not, indicating that it is somewhat burdensome. she added however, that she could see how once communities have had their consciousness raised about their everyday occupations, they would conduct their own advocacy on any issue of injustice. i found that these insights, from delegates at two separate congresses on the african continent, illuminated occupational consciousness as a critical notion and a potentially liberating response to oppressive social structures. just like the dominant discourses within which they are socio - culturally embedded, patterned occupational engagements are difficult to break owing to their normalizing effect. unrestricted television watching, for example, regardless of its adverse long - term consequences within families and potentially whole communities, becomes pervasive within particular contexts because this is what everyone does. it also fits in very well within an ongoing colonial project posing as modernity, where the oppressed other, having been sufficiently reduced, must change himself or herself substantially by emulating the dominant other in order to rise to a place of significance. occupational consciousness, as a critical tool for self - advocacy, calls for individuals within families and communities on the margins of dominant worlds to pay attention to their occupational influence ; the term also alerts occupational scientists to pay attention to acts of resistance in everyday occupations as lived by communities on the margins of society. in this paper, building on a previous article which introduced the construct (ramugondo, 2012), i have argued that occupational consciousness is a response that is always available to individuals and collectives on the periphery of dominant worlds to disrupt the cycle of oppression and inequality through everyday doing ; a form of resistance, and thus a potentially liberating transgressive act. i have made my argument by bringing together human occupation and consciousness, as understood by fanon (1961/1963) and biko (1978) to mean a mental attitude and commitment to resist coloniality. in doing this, i have introduced the philosophy of liberation (dussel, 1995, 2000, 2011) into theorizing about human occupation, illuminating the critical perspective of the oppressed. the philosophy of liberation may enable the political and economic analysis frank (1996) called for as part of defining occupations, and understanding meaningful everyday activity (as) political (p. 56). unwitting consent on the part of the oppressed is central to the ways global dominant cultural practices assert and embed themselves within local contexts, evident in how intergenerational play within a south african context was marked by one family assuming a marginal role in orchestrating its own play narrative. such mechanisms, which rely on continuing unequal intersubjective relations and thus perpetuate coloniality, could be at play across various forms of human occupation. i hope this paper will serve as an invitation to scholars to take up post - colonial theory, coloniality and liberation philosophy to further explore ways in which human occupation is implicated. this could expand inter or transdisciplinary work within occupational science for critical conceptualizations of human occupation. by beginning to draw conceptual links between occupational consciousness and other related constructs that also focus on the politics of human occupation, this paper promotes an ongoing occupational terminology interactive dialogue, and advances theorizing as a scholarly practice within occupational science. it is hoped that further work will outline the complex nature of relationships between the cluster of concepts identified in this paper and relevant others, to offer possible fuller explanations of why people engage in occupations that promote oppression and inequality across contexts. in addition, further reflection on occupational consciousness may be advanced by addressing research questions such as : (a) are there specific indicators for or expressions of occupational consciousness within individuals and collectives ? (b) in what ways do individuals and communities articulate acts of resistance in everyday occupation as expressed in different languages and lived within local contexts ? (c) is occupational consciousness a transferrable disposition across occupations and contexts, and how does it relate to different subjectivities ? (e) what mechanisms and practices are available and effective in raising occupational consciousness ? (f) what intersections lie between social justice and occupational consciousness in individuals within communities, and across institutional levels within corporates and the state ? these questions, especially when those on the margins are involved as co - researchers, would further illuminate everyday doing as a powerful liberating and transgressive act, to resist dominant discourses and practices that deny dignified living for all. the last question, in particular, underscores the fact that raising consciousness in the oppressed is not enough in and of itself and may in fact bear the neo - liberal danger of responsibilizing the oppressed to overcome their oppression. the question highlights instead intersections between occupational consciousness and institutional power as worthy of further exploration. | occupational consciousness refers to ongoing awareness of the dynamics of hegemony and recognition that dominant practices are sustained through what people do every day, with implications for personal and collective health. the emergence of the construct in post - apartheid south africa signifies the country s ongoing struggle with negotiating long - standing dynamics of power that were laid down during colonialism, and maintained under black majority rule. consciousness, a key component of the new terminology, is framed from post - colonial perspectives notably work by biko and fanon and grounded in the philosophy of liberation, in order to draw attention to continuing unequal intersubjective relations that play out through human occupation. the paper also draws important links between occupational consciousness and other related constructs, namely occupational possibilities, occupational choice, occupational apartheid, and collective occupation. the use of the term consciousness in sociology, with related or different meanings, is also explored. occupational consciousness is then advanced as a critical notion that frames everyday doing as a potentially liberating response to oppressive social structures. this paper advances theorizing as a scholarly practice in occupational science, and could potentially expand inter or transdisciplinary work for critical conceptualizations of human occupation. |
uterine serous carcinoma (usc) is an uncommon but aggressive form of endometrial adenocarcinoma. its pattern of spread favors the peritoneum and upper abdomen, and thus adjuvant management is typically more aggressive than for the endometrioid subtypes, even when it presents in early stages. in the united states, surgical staging of usc includes total hysterectomy, bilateral salpingo - oophorectomy, peritoneal washings, omentectomy, and pelvic and para - aortic lymph node dissections. historically, whole abdominal radiotherapy was the mainstay of adjuvant therapy, even in optimally resected stage i disease [3, 4 ]. recently, studies have demonstrated a benefit with the use of adjuvant chemotherapy [57 ]. contemporary adjuvant treatment of early stage (stage i - ii) disease following comprehensive staging involves a combination of chemotherapy and smaller - field radiation therapy (rt) [5, 6 ], and an increasingly popular adjuvant treatment paradigm combines chemotherapy with intra - vaginal brachytherapy (ivb) [5, 813 ]. there have been few studies to date, which have addressed adjuvant ivb technique in early stage usc, and thus questions concerning ivb dose and sequencing with chemotherapy persist. this topic was not covered in the guidelines for adjuvant vaginal cuff brachytherapy released by the american brachytherapy society in 2012. several recent institutional reports describe excellent 5-year vaginal recurrence rates of 0 - 3% using chemotherapy in combination with a common high - dose - rate (hdr) ivb regimen, 7 gy x 3 fractions prescribed to a depth of 5 mm from applicator surface [912 ]. a recent phase ii evaluation of endometrial patients with high - intermediate risk factors, of which 35% of the population was usc, employed this same hdr regimen followed by three cycles of adjuvant chemotherapy. there is modest support for an alternate ivb dose schedule for usc patients receiving chemotherapy based on a single retrospective report, in which hdr ivb was delivered twice per week in 6 fractions of 4 gy prescribed to the mucosal surface. this fractionation schedule delivered an equivalent dose in 2 gy / fraction (eqd2) of approximately 28 gy to the vaginal surface, which is approximately half of the mucosal dose used in the other series. at our institution, usc patients with localized disease who have undergone comprehensive surgical staging are recommended chemotherapy with ivb. when our hdr program was first introduced in the 1990s, in the era of adriamycin - based chemotherapy, several cases of vaginal mucositis were noted by the treating physicians, and thus the hdr prescription for all usc patients receiving chemotherapy was modified from 7 gy x 3 to 7 gy x 2 prescribed to 0.5 cm from the cylinder surface. this lower dose prescription translates into a total equivalent dose (eqd2) of approximately 36 gy to the vaginal mucosal surface. previously published results from our institution have demonstrated that this regimen appeared safe and effective, and resulted in significantly improved vaginal control when compared to outcomes of patients with localized usc who received chemotherapy alone. chemotherapy for usc has since evolved, and for the past 15 years, six cycles of adjuvant carboplatin - paclitaxel (c / t) chemotherapy has become standard. the ivb prescription dose at our institution for patients treated with this chemotherapy regimen has remained 2 fractions of 7 gy prescribed at 0.5 cm depth. in this report, we present the 5-year clinical outcomes of patients with early stage (figo 2009 stage i - ii) usc treated at our institution from 2000 - 2010 with contemporary c / t chemotherapy and this unique brachytherapy regimen. institutional review board approval was granted to perform a retrospective chart review of all patients with stage i - ii usc treated at our institution in the years 2000 - 2010. patients with advanced - stage disease, or those with early stage disease who had received single modality therapy, external beam rt, other brachytherapy fractionation, or chemotherapy regimen other than c / t were excluded. additionally, patients with biopsy - proven cancer but without residual cancer in their hysterectomy specimens were excluded. analysis was limited to patients who received all aspects of their multi - modal treatment at our academic medical center. all patients had biopsy - proven endometrial cancer and underwent total hysterectomy with surgical staging. chemotherapy consisted of carboplatin (auc = 5 - 6) and paclitaxel (175 mg / m) in all patients, given every 3 weeks for 6 cycles. intra - vaginal brachytherapy was delivered via a high - dose - rate ir-192 source. patients were fit with a vaginal cylinder (size ranging from 2.6 - 3.0 cm) at the time of radiation consultation. a dose of 14 gy in 2 fractions (7 gy each) was prescribed to a depth of 0.5 cm from the vaginal cylinder surface. active source length was standardized for all patients to six dwell positions, separated by 1 cm spacing, for an active length of 5 cm. all plans were created on a phantom with a 10 ci nominal source, and dwell times were optimized to ensure a dose of roughly 10.5 - 11 gy at the cylinder surface. ct - simulation was not performed, and normal tissue point doses were not recorded. intra - vaginal brachytherapy was started early in the course of adjuvant treatment, typically with the first fraction delivered one week prior to and the second fraction one week following the second cycle of chemotherapy. administering chemotherapy the same week as brachytherapy was avoided to decrease likelihood of overlapping toxicities. patients were followed by routine clinical examination, pap smears, and tumor markers every three months. based on review of physician - recorded toxicities listed in routine follow - up documentation, toxicity scores were assigned retrospectively with the common terminology criteria for adverse events (ctcae) v4.0. kaplan - meier methods were used to estimate 5-year recurrence - free survival (rfs) and overall survival (os). time to recurrence, last follow - up, and/or death was calculated from the date of hysterectomy. log - rank test was employed to identify patient, tumor, and treatment characteristics associated with rfs and os. given the small sample size and paucity of events, a multivariate analysis was not performed. fifty - six patients were identified with figo 2009 stage i - ii usc treated from 2000 - 2010 with adjuvant c / t chemotherapy along with 2 fractions of ivb (7 gy each). the majority had undergone comprehensive surgical staging including pelvic dissection (96%, median nodes removed = 18, range : 6 - 47), para - aortic dissection (80%, median nodes removed = 3, range : 1 - 37), omentectomy, and peritoneal cytology (93%). the median age was 66 (range : 47 - 81). according to figo 2009 staging, 42 patients (73%) were stage ia, 18% were stage ib, and 9% were stage ii. of the ia patients, 14 (33%) had disease confined to the endometrium, and 28 (67%) had ia invasive disease. among the entire cohort, 21% had myometrial invasion 50%, and 29% had lymph - vascular space involvement. forty percent of tumors consisted of usc mixed (more than 10% usc) with other endometrioid or high grade histologies. patient and tumor characteristics (n = 56) all 56 patients completed 2 ivb fractions, and 53 patients (95%) completed all 6 cycles of chemotherapy. the median time from surgery to first ivb fraction was 49 days (range : 30 - 113). the median follow - up time, calculated from the date of hysterectomy, was 49 months (range : 9 - 145). late toxicities (recorded > 90 days post - treatment) were as follows : forty - seven patients (84%) had no toxicities recorded. one patient who was disease - free with a history of ulcerative colitis had grade 2 diarrhea and tenesmus. two patients (3.6%) had grade 2 vaginal toxicities ; one developed grade 2 vaginal stricture with banding, one was noted to have grade 2 vaginal atrophy. smoking history was associated with poorer os (p = 0.008) and lvi (lymph - vascular space invasion) was associated with poorer rfs (p = 0.003). age > 70 had a borderline significant effect on os (p = 0.062) and smoking had a borderline effect on rfs (p = 0.076). depth of myometrial invasion 50% was significantly associated with both poorer rfs (p 50% depth myometrial invasion and lymph - vascular space involvement, as well as simultaneous lung metastases, as shown in table 3. whether the vaginal relapse may have been prevented had a higher dose of brachytherapy and/or pelvic radiotherapy been utilized is not known. overall, the 2-year vaginal failure rate of 2% in this series appears comparable to that of similar cohorts of early stage usc and/or high - risk endometrial patients, which have used a median dose of 21-gy in 3 fractions, and reported 2 - 5 year vaginal failure rates of 2 - 4% [1012, 15, 26 ]. direct comparison, however, is not possible given the heterogeneity of stages (percentage stage ia versus ib) and histologies (pure usc versus mixed). in addition, the cohort of patients studied is small, although comparable to other publications reporting on this rare disease. it is important to note that all patients in this series were treated with comprehensive aggressive staging by experienced gynecologic oncologists, and therefore this regimen may not be satisfactory for women who have had less aggressive surgery. furthermore, the population described had all received c / t chemotherapy, and hence the use of 2 fractions of 7 gy as described in this report may not be appropriate for women with other chemotherapy regimens, fewer than 6 cycles of chemotherapy, or non - serous histology. moreover, given that, a majority of patients in this series (79%) had < 50% myometrial invasion, our findings may not be generalizable to patients with stage ib or higher disease. also, caution should be used in applying this regimen when using cylinder sizes smaller than 2.6 cm, due to the relatively high fractional surface dose to the mucosa with this regimen. lastly, given the retrospective nature of the study, information on vaginal toxicity was not recorded consistently. an ongoing prospective investigation at our institution examines whether this reduced - dose ivb regimen is associated with improved toxicity compared to more standard ivb schema. debate continues concerning the preferred radiotherapy approach for early stage usc. in our series, when combined with contemporary chemotherapy, adjuvant hdr ivb delivered as 2 fractions of 7 gy prescribed at a depth of 0.5 cm resulted in excellent vaginal / pelvic control rates for localized usc. further study of brachytherapy technique in usc investigating the optimal dose, number of fractions, time interval between fractions, and when to schedule with chemotherapy is warranted. | purposeto evaluate our institutional experience combining carboplatin - paclitaxel (c / t) chemotherapy with high - dose - rate (hdr) intra - vaginal brachytherapy (ivb) following comprehensive surgical staging in localized uterine serous carcinoma (usc).material and methodsinstitutional chart review identified 56 patients with figo 2009 stage i - ii usc treated between 2000 - 2010. patients underwent total hysterectomy, bilateral salpingo - oopherectomy, and comprehensive surgical staging including pelvic and para - aortic lymph node dissection, omentectomy, and peritoneal cytology. chemotherapy was 6 cycles of c / t, and the ivb dose was 14 gy in 2 fractions, prescribed to 0.5 cm from the cylinder surface. kaplan - meier methods were used to estimate recurrence - free survival (rfs) and overall survival (os).resultsthe median follow - up time was 49 months (range : 9 - 145). the 5-yr rfs and os were 85% and 93%, respectively. in all cases of recurrence (n = 8), the first site of failure was extra - pelvic. there were no isolated vaginal recurrences, however, there was one vaginal apex recurrence recorded at 19 months in a patient with simultaneous lung metastases. thus, the 2-year vaginal rfs was 98%.conclusionsexcellent vaginal / pelvic control rates were observed. further study of hdr brachytherapy dose and fractionation in combination with chemotherapy is worthwhile. |
radical cystectomy is a definitive treatment for high - grade muscle - invasive bladder cancer. however, it associates with significant serious medical (e.g., renal insufficiency, cardiovascular complications, pulmonary complications, and sepsis), surgical (e.g., uretero - intestinal anastomotic stricture and reservoir rupture / perforation), metabolic (e.g., metabolic acidosis), and functional (e.g., urinary incontinence and chronic retention) complications.1, 2 these postoperative complications could be reduced by improving the perioperative management of the patient, thereby promoting good patient outcomes after radical cystectomy. one of the complications after surgery, including radical cystectomy, is acute kidney injury (aki). aki is characterized by an abrupt and sustained reduction in renal function, and increases the costs, morbidity, and mortality of hospitalized patients.3, 4 when defined according to acute kidney injury network (akin) criteria (mainly increased serum creatinine levels and decreased urine output), the incidence of aki after cardiac surgery is 27.9% and the 5 year mortality rate is 26.5%.5 since the definitive treatment for postoperative aki has not been established, it is essential to prevent it or detect it early. to improve the preventive management for aki, a better understanding of the risk factors for postoperative aki therefore, the present study was performed to evaluate the incidence and independent risk factors of aki after radical cystectomy. for this purpose, a retrospective review of the computerized patient record system of our hospital was performed to identify all consecutive patients who underwent radical cystectomy at our tertiary - care institution in seoul, korea between january 1, 2001 and december 31, 2013. patients who met the following criteria were excluded : age below 20 years and incomplete preoperative and postoperative laboratory data missing either one of following, c - reactive protein, estimated glomerular filtration rate (egfr), uric acid, and serum creatinine. the demographic, clinical, and intraoperative and postoperative data were collected from the computerized databases. general anesthesia was induced by using a bolus intravenous (iv) injection of pentotal sodium (5 mg / kg) or propofol (2 mg / kg). in all but 7 patients, the general anesthesia was maintained with volatile anesthetics (isoflurane, sevoflurane, or desflurane). the remaining 7 patients were maintained with a continuous infusion of propofol and remifentanil that was delivered by a target control infusion pump (orchestra base prima ; fresenius kabi, brezins, france). to facilitate orotracheal intubation, all patients received a bolus iv injection of 0.5 - 0.8 mg / kg of rocuronium. crystalloid (lactated ringer 's solution or plasmalyte) and colloid solution (voluven, 6% hydroxyethyl starch 130/0.4) were administered during surgery. arterial blood pressure during anesthesia was maintained at above 65 mmhg of mean arterial pressure or above 90 mmhg of systolic arterial pressure. packed red blood cell transfusion was performed during the perioperative period if the hemoglobin concentration reached 140 mmhg, diastolic blood pressure > 90 mmhg, or medication with an anti - hypertensive drug. heart failure was defined as a history of any type of heart failure that was diagnosed by a cardiologist with / without medication or decreased ejection fraction (300% relative to baseline values, an increase to 4.0 mg / dl with an acute increase of at least 0.5 mg / dl, or the need for renal replacement therapy.8 the urine output criteria of akin were not used in the present study. patients who underwent radical cystectomy with neobladder reconstruction were received massive and frequent bladder irrigation (normal saline 3 - 4 l / day), at least, until postoperative 2 weeks. and, hourly urine output was not checked for patients transferred to general ward postoperatively. moreover, intraoperative use of diuretics also can make it inconsistent to detect aki by urine output criteria.9 thus, the application of urine output criteria is incoherent and inaccurate to evaluate postoperative aki in these patients. postoperative outcomes included length of hospital stay and the clavien - dindo classification system.10 all continuous variables were expressed as mean standard deviation or median with interquartile range. categorical variables were expressed as number and percentage. to compare the patients with and without aki in terms of demographics and intraoperative characteristics, student 's t - test or the mann - whitney u test were used for continuous variables, while the chi - square test or fisher 's exact test were used for categorical variables. to identify independent risk factors for aki after radical cystectomy all factors that had a p value 140 mmhg, diastolic blood pressure > 90 mmhg, or medication with an anti - hypertensive drug. heart failure was defined as a history of any type of heart failure that was diagnosed by a cardiologist with / without medication or decreased ejection fraction (300% relative to baseline values, an increase to 4.0 mg / dl with an acute increase of at least 0.5 mg / dl, or the need for renal replacement therapy.8 the urine output criteria of akin were not used in the present study. patients who underwent radical cystectomy with neobladder reconstruction were received massive and frequent bladder irrigation (normal saline 3 - 4 l / day), at least, until postoperative 2 weeks. and, hourly urine output was not checked for patients transferred to general ward postoperatively. moreover, intraoperative use of diuretics also can make it inconsistent to detect aki by urine output criteria.9 thus, the application of urine output criteria is incoherent and inaccurate to evaluate postoperative aki in these patients. all continuous variables were expressed as mean standard deviation or median with interquartile range. categorical variables were expressed as number and percentage. to compare the patients with and without aki in terms of demographics and intraoperative characteristics, student 's t - test or the mann - whitney u test were used for continuous variables, while the chi - square test or fisher 's exact test were used for categorical variables. to identify independent risk factors for aki after radical cystectomy all factors that had a p value < 0.05 on univariate logistic regression analysis were included in a stepwise multivariate logistic regression analysis. to summarize the strength of the association of each variable with postoperative aki, odds ratios (ors) with 95% confidence interval (ci) were calculated. to evaluate model calibration, the medical chart review identified 698 patients who underwent radical cystectomy during the study period. of these, 460 were excluded because their age was below 20 years (n = 20) and they did not performed some laboratory examination such as c - reactive protein, egfr, uric acid, and serum creatinine (n = 399). the baseline and intraoperative characteristics of the remaining 238 patients are summarized in tables 1 and 2, respectively. they were more likely to have higher baseline serum uric acid levels than the patients who did not develop postoperative aki (table 1). in addition, there were no significant differences in hematological and biochemical variables such as hematocrit, platelet count, albumin, aspartate aminotransferase, alanine transaminase, sodium, potassium, and chloride levels between no - aki and aki groups until postoperative day 2 (data not shown). there was no significant difference in median length of hospital stay between two groups (p = 0.152). postoperative complications according to the clavien - dindo classifications were not significantly different between two groups (p = 0.424). univariate logistic regression analysis revealed that male gender, high baseline serum uric acid level, and a long operation time associated with the development of aki (table 3). multivariate logistic regression analysis revealed that independent risk factors for postoperative aki were high baseline serum uric acid concentration (or = 1.251 ; 95% ci 1.048 - 1.493 ; p = 0.013) and a long operation time (or = 1.005 ; 95% ci = 1.002 - 1.008 ; p = 0.003) (table 3). the present study showed that 38.2% of the patients who underwent radical cystectomy developed postoperative aki and that this complication associated independently with high baseline serum uric acid concentration and long operation time. it develops more frequently in men than in women,11 and its most common histological type is transitional cell carcinoma. approximately 30% of bladder cancers have invaded the muscle at the time of diagnosis.12, 13 while non - muscle - invasive bladder cancer is not life threatening, muscle - invasive bladder cancer associates with a high risk of distant metastasis and death. the standard treatment of muscle - invasive bladder cancer is radical cystectomy and urinary diversion. the complication rate after radical cystectomy ranges between 20% and 58%.14 - 17 these complications include ileus, wound dehiscence, urinary tract infection, and renal insufficiency.18 with regard to the latter complication, a previous study showed that between 4% and 7% of patients who undergo radical cystectomy develop acute renal failure (arf).19 similarly, a recent observational study reported that 6.7% of patients who underwent urological surgery developed postoperative aki.20 by contrast, the present study found an incidence of aki after radical cystectomy of 38.2%. this disparity may relate to the criteria that were used to detect the kidney injury and the nature of the patient population. arf is defined as severe kidney injury that requires renal replacement therapy. on the other hand, aki is defined on the basis of relatively small changes in creatinine levels relative to baseline. thus, the use of aki criteria would lead to a considerably higher incidence of kidney injury than if the classical arf criteria were used.21 the relatively high incidence of aki that was detected by the present study is important because it is well - known that postoperative aki increases costs, morbidity, and mortality.3, 4 thus, physicians should be aware of the strong possibility that aki may develop after radical cystectomy. since definitive treatments for postoperative aki have not been established, it is important to identify risk factors that will facilitate the early detection of aki and aid risk management strategies. the present study showed that a higher preoperative serum uric acid level was an independent risk factor for aki after radical cystectomy. it was shown previously that patients with a large tumor burden and those receiving chemotherapy can develop uric acid - induced aki. in such patients, aki is caused by hyperuricemia and the intratubular deposition of uric acid crystals after the rapid release of nucleotides after tumor cell death.22, 23 however, several recent studies showed that preoperative hyperuricemia may also associate with an increased risk of postoperative aki even if intratubular uric acid crystal deposition does not occur. one of these studies was by ejaz.,24 who reported that elevated preoperative serum uric acid may be a risk factor for aki in patients undergoing high - risk cardiovascular surgery. the other study was an observational study by our center that also suggested that preoperative hyperuricemia is an independent risk factor for aki after cardiovascular surgery.25 the possible mechanisms by which uric acid induces aki are renal vasoconstriction, endothelial dysfunction, impairment of renal auto - regulation, and tubular obstruction by uric acid crystals.23, 26 with regard to endothelial dysfunction, uric acid activates intracellular protein kinases (p38 and extracellular - signal - regulated kinases 1/2) and nuclear transcription factors (nuclear factor-b and activator protein-1), thereby stimulating vascular smooth muscle cell proliferation and local inflammation.27, 28 hyperuricemia also seems to stimulate the production of proinflammatory substances, such as c - reactive protein, interleukin-1, interleukin-6, and tumor necrosis factor -2, which may further promote endothelial dysfunction. uric acid also appears to activate the renin - angiotensin system by up - regulating the expression of angiotensinogen, angiotensin - converting enzyme, and angiotensin ii receptor expression. this suppresses nitric oxide synthesis and increases vascular tone.29, 30 the present study also showed that a longer operation time associated independently with the development of aki after radical cystectomy. similarly, tomas.31 reported that a longer operation time associated independently with a higher overall incidence of complications after radical cystectomy. prolonged operation time also associates with a greater risk of aki after surgical procedures for lung cancer.32 a long surgical time may reflect the need for complex surgical procedures that may directly and/or indirectly damage the kidney. although we considered many variables and performed multivariate analysis to obtain reliable results, we can not exclude the possibility that factors that were not evaluated may have influenced the outcomes. second, large numbers of patients were excluded in the present study. although it might act as a selection bias, although these levels associated significantly with aki in this study, we can not exclude the possibility that uric acid levels at other time points may also associate with the risk of aki. indeed, ejaz.33 reported that postoperative serum uric acid levels associate with a higher risk of aki after cardiac surgery. further studies investigating the association of uric acid levels with aki risk after radical cystectomy should include serial measurements of serum uric acid in the preoperative and postoperative periods. in conclusion, the present study showed that aki was a common complication after radical cystectomy and that it associated with a higher preoperative serum uric acid level and a longer operation time. the identification of these risk factors can be useful for preventing the development of aki after radical cystectomy. | background : acute kidney injury (aki) is a common complication after surgery and increases costs, morbidity, and mortality of hospitalized patients. while radical cystectomy associates significantly with an increased risk of serious complications, including aki, risk factors of aki after radical cystectomy has not been reported. this study was performed to determine the incidence and independent predictors of aki after radical cystectomy.methods : all consecutive patients who underwent radical cystectomy in 2001 - 2013 in a single tertiary - care center were identified. their demographics, laboratory values, and intraoperative data were recorded. postoperative aki was defined and staged according to the acute kidney injury network criteria on the basis of postoperative changes in creatinine levels. independent predictors of aki were identified by univariate and multivariate logistic regression analyses.results : of the 238 patients who met the eligibility criteria, 91 (38.2%) developed aki. univariate logistic regression analyses showed that male gender, high serum uric acid level, and long operation time associated with the development of aki. on multivariate logistic regression analysis, preoperative serum uric acid concentration (odds ratio [or ] = 1.251 ; 95% confidence interval [ci ] = 1.048 - 1.493 ; p = 0.013) and operation time (or = 1.005 ; 95% ci = 1.002 - 1.008 ; p = 0.003) remained as independent predictors of aki after radical cystectomy.conclusions : aki after radical cystectomy was a relatively common complication. its independent risk factors were high preoperative serum uric acid concentration and long operation time. these observations can help to prevent aki after radical cystectomy. |
hypersensitivity syndrome is an idiosyncratic, serious drug reaction that consists of a rash, fever, involvement of multiple visceral organs, and hematological abnormalities such as eosinophilia. to better individualize drug hypersensitivity reaction and to distinguish the hypersensitivity reaction from drug - induced pseudolymphoma, bocquet. have recently introduced the term drug rash with eosinophilia and systemic symptoms (dress) syndrome (1). anticonvulsants are the principal drugs responsible for this malady. among them, arene oxide producing aromatic anticonvulsants such as phenytoin and carbamazepine are the particular drugs most frequently implicated for dress syndrome or the anticonvulsant hypersensitivity syndrome (ahs) (2 - 10). cross - reactivity among the aromatic anticonvulsants frequently occurs when a previous history of dress syndrome exists (10 - 12). many studies have described cross sensitivity as a worsening of the initial features of dress syndrome when switching from a sensitive anticonvulsant to a cross - reactive anticonvulsant (8,13 - 15). however limited data have described the development of dress syndrome after switching medication from a previously well - tolerated anticonvulsant to another (5 - 7). we present here a case of dress syndrome in which hypersensitivity reaction to a previously well - tolerated phenytoin was induced by hypersensitivity to carbamazepine, and we show that the patch test may be a useful method for detecting possible cross - reactive drugs in such situations. a 40-yr - old man suffering from epilepsia presented with a generalized skin rash, facial edema, sore throat and high - grade fever of 3-day duration. he had been taken phenytoin and sodium valproate for 4 yr without having any adverse reaction. because of several attacks of seizure while taking these anticonvulsants, the medications were switched to carbamazepine and sodium valproate 16 weeks before the onset of skin rash and fever. at admission his temperature was 38.9, blood pressure 90/50 mmhg, pulse 140 beats / min, and respiratory rate 17 breaths / min. on physical examination, generalized, diffuse, maculopapular, erythematous, pruritic rash was noted over the face, trunk and extremities with marked facial edema (fig. 1). he had moderately enlarged tonsils, injected oropharynx, and bilateral cervical lymphadenopathy. the laboratory studies showed a leukocytosis of 16.110/l with an eosinophilia of 2.710/l (table 1). the creactive protein was high at 11.3 mg / dl (normal < 0.3 mg / dl), and the erythrocyte sedimentation rate was 2 mm in the first hour. iu / l), alanine aminotransferase 122 iu / l (normal 10 - 72 iu / l), alkaline phosphatase 232 iu / l (normal 30 - 140 serology for antinuclear factor, ra factor, hbs ag, anti - hiv antibodies, anti - mycoplasma antibodies, igm anti - eb virus antibodies, anti - hantan virus antibodies, anti - leptospiral antibodies, anti - rickettsial antibodies, p - anca and c - anca antibodies was all negative. skin biopsy showed moderate perivascular and interstitial infiltration of lymphocytes, eosinophils with exocytosis, basal cell vacuolization and marked upper dermal edema. the diagnosis of dress syndrome due to carbamazepine was proposed on the basis of his clinical and biological findings. carbamazepine was discontinued, phenytoin was restarted at the dose of 300 mg / day, and he was also treated with prednisolone (40 mg / day). however, during the next 7 days his skin rashes and facial edema progressively worsened, and mucosal lesions developed with the persistence of fever (fig. rapid progression of the leukocytosis with an eosinophilia was also noted (table 1). on the seventh day of hospitalization, phenytoin was stopped while continuing prednisolone based on a presumed diagnosis of hypersensitivity reaction to phenytoin. there was marked improvement in his general condition over the next several days with subsidence of the fever. following the resolution of his skin eruption and laboratory abnormalities, the prednisolone was tapered over the next 3 weeks. after obtaining informed consent, patch test several anticonvulsants including carbamazepine and phenytoin were tested at concentrations of 1% and 10% in petrolatum with / without 1% and 10% in water. using finn chambers on scanopor tape, 2-day closed patch testing was performed on the backs of the patient. the reactions were scored at 30 min after removal and 4 days after application, according to the international contact dermatitis research group recommendations (16,17). carbamazepine and phenytoin patch tests were positive at day 2 and day 4, however, phenobarbital, sodium valproate, topiramate, gabapentin, and vigabatrin showed no significant response on the patch tests (fig., he was completely asymptomatic and was tolerating sodium valproate (1,200 mg / day) and topiramate (250 mg / day). dress syndrome can manifest 1 - 8 weeks after starting the anticonvulsant therapy with a mean of 3 weeks (11 - 13,18). in previously sensitized individuals the patient had no known exposure to other medications that have been implicated in development of the dress syndrome. various factors may have contributed to this long induction period ; interindividual variations, individual susceptibility, and induction of the carbamazepine metabolism via the hepatic cytochrome p-450 system by the previously administered phenytoin, which might have reduced the tendency to develop dress syndrome. cross sensitivity among the aromatic anticonvulsants occurs at a rate as high as 80% (11,12). however, development of dress syndrome to one anticonvulsant after switching medication, and the subsequent development of hypersensitivity to a previously well - tolerated anticonvulsant upon second exposure rarely occurs (5 - 7). for most of these cases, there was no objective evidence about secondary induction of hypersensitivity to a previously tolerated drug, and only a presumptive diagnosis was made based on the clinical manifestations (5,7). some patients with dress syndrome may have flare - up of symptoms 3 to 4 weeks after the initiation of the reaction despite the discontinuation of the offending drug. in addition, once the offending drug is discontinued, those organs initially involved may show progressive changes or organs that were previously uninvolved may manifest involvement (11). therefore, we can not exclude the possibility that the worsening of the clinical features was not due to cross - reactivity but due to the natural course of the dress syndrome in some reports (5,7). klassen and sadler (6) only showed induction of hypersensitivity to the previously tolerated phenytoin by carbamazepine with the reintroduction of phenytoin to the patient. the initial lack of adverse reaction to phenytoin, followed by immediate adverse response on later rechallenge several months after development of hypersensitivity to carbamazepine indirectly suggest induction of hypersensitivity to phenytoin in that report. besides the clinical features, we showed induction of hypersensitivity to phenytoin with the results of the patch tests. the diagnosis of dress syndrome is made based on the history of drug exposure and clinical examination. the differential diagnosis includes other cutaneous drug reactions, acute infections, neoplastic, and other immunologic disorders. withdrawal of the suspicious drug and subsequent improvement of clinical manifestations makes the diagnosis more reliable. when anticonvulsant therapy is invaluable, however, additional diagnostic methods can be sought to select safe drugs for seizure control. although no gold standard exists, in vitro lymphocyte toxicity assay or lymphocyte transformation tests (ltt), and in vivo patch tests may be helpful in such situations. many studies have showed the usefulness of ltt and patch testing for the diagnosis of hypersensitivity to anticonvulsants (11,12,17 - 23). but false negative reaction of ltt was also noted in patients with simultaneous positive patch test (20). as patch testing is less cumbersome and seems more reliable, it is more frequently used in the case of diagnostic uncertainty (17,19 - 24). positive rate of patch tests to carbamazepine were relatively high from 70% to 100% (20 - 24). however, positive patch test results in phenytoin - induced ahs were much lower (30 - 60%) than in carbamazepine - induced ahs (25,26). moreover, it is not yet known accurately how many patients who are on anticonvulsants have a positive patch test. thus the diagnostic accuracy of patch test in dress syndrome is currently unknown. in general, positive predictive value of patch test is relatively good, but negative results of patch test can not exclude the possibility of hypersensitivity. if patch testing is to be performed, 1% and 10% carbamazepine or phenytoin in petrolatum, in water or in alcohol is recommended (11,19). it is also recommended that at least 2 months should elapse from the time of the skin eruption to the testing date since either false positive reactions due to increased reactivity or false negative reactions due to a refractory state may exist. we performed patch tests 3 months after the total resolution of symptoms with several anticonvulsants at 1% and 10% concentrations, and both carbamazepine and phenytoin showed positive results. although we did not perform an oral rechallenge testing with phenytoin, the imputability of these two drugs was possible because of the clinical features and the in vivo patch test results. aromatic anticonvulsants are metabolized by the cytochrome p-450 enzyme to a common arene oxide metabolite that is normally detoxified by enzyme systems such as epoxide hydrolase. genetically determined abnormalities in enzyme systems leading to inability to detoxify toxic metabolites may be involved in the pathogenesis of ahs (11,12,25). reactive toxic metabolites irreversibly modify cellular proteins, and then initiate or serve as targets for an immune attack on modified proteins in target organs (27,28). thus both pharmacogenetic and immunologic mechanism may play an important role in anticonvulsant - induced dress syndrome, and this immune response can explain the late induction of hypersensitivity to the previously tolerated phenytoin after sensitization to carbamazepine. recent studies have strongly suggested that viral infections, especially reac - tivation of human herpesvirus 6, contribute to the pathogen - esis of drug hypersensitivity to anticonvulsants (4,9,10). however further study will be required to establish the relationship between human herpesvirus 6 infection and drug hypersensitivity. in conclusion, we present a case of carbamazepine - induced dress syndrome that also showed induction of hypersensitivity to the previously well - tolerated phenytoin. our case suggests that physician should be aware that hypersensitivity to previously tolerated anticonvulsants can be induced by hypersensitivity to another anticonvulsant, and patch test may be a worthwhile method for detecting other possible cross - reactive drugs in such situations. | drug rash with eosinophilia and systemic symptoms (dress) syndrome associated with anticonvulsant drugs is a rare but potentially life - threatening disease that occurs in response to arene oxide producing anticonvulsant such as phenytoin and carbamazepine. there have been many reports of cross reactivity among the anticonvulsants upon first exposure to the offending drugs. however, there has been few data describing the development of dress syndrome after switching medication from previously well - tolerated phenytoin to carbamazepine, and the induction of hypersensitivity to phenytoin by dress to carbamazepine. we experienced a case of a 40-yr - old man who had uncontrolled seizure that led to the change of medication from the long - term used phenytoin to carbamazepine. he developed dress syndrome after changing the drugs. we stopped carbamazepine and restored phenytoin for seizure control, but his clinical manifestations progressively worsened and he recovered only when both drugs were discontinued. patch tests with several anticonvulsants showed positive reactions to both carbamazepine and phenytoin. our case suggests that hypersensitivity to a previously tolerated anticonvulsant can be induced by dress to another anticonvulsant, and that the patch test may be a useful method for detecting cross - reactive drugs in anticonvulsant - associated dress syndrome. |
during stage 9 of oogenesis, oskar mrna localizes to the posterior of the drosophila oocyte, where it nucleates the pole plasm, which contains the determinants that specify the germ cells and abdomen at the posterior of the embryo [13 ]. this localization depends on the rna - binding proteins staufen and hrp48 and on the exon - junction - complex components mago nashi, y14, eif4aiii, and barentsz [814 ]. in addition, the posterior accumulation of oskar mrna requires microtubules and the plus - end - directed microtubule motor protein, kinesin, suggesting that it is transported by kinesin toward microtubule plus ends at the posterior pole [4, 15 ]. as part of a project to visualize the transport of oskar mrna, we used the uas - gal4 expression system to overexpress oskar mrna in the female germline. although increased amounts of oskar mrna are localized to the oocyte posterior in these uas - osk females, a significant proportion of the mrna is found in an ectopic dot in the middle of the oocyte in all stage 9 egg chambers (62/62) and more than half of those at stage 10a (80/150) (figures 1a1d). the mislocalization of oskar mrna to the center of the oocyte is reminiscent of the localization of oskar mrna at stage 8, suggesting that excess oskar mrna saturates the transport pathway, causing a delay in its translocation to the posterior pole. we therefore examined the localization of other components of the oskar mrna localization complex that are required for its transport to the posterior. barentsz, mago nashi, staufen, and the kinesin heavy chain all localize to the ectopic dot in the middle of the oskar - overexpressing oocytes, as well as to the posterior pole (figures 1g1n). thus, none of these components appears to be limiting for transport to the posterior. oskar mrna is normally translationally repressed until it reaches the posterior pole, but overexpression of the oskar 3 untranslated region (utr) causes its premature translation. we therefore examined whether this was also the case in the egg chambers overexpressing full - length oskar rna. oskar protein starts to accumulate at the posterior pole of wild - type egg chambers at stage 9 (figures 1o and 1p). in uas - osk egg chambers, robust oskar expression is already visible in the ectopic dot at stage 8 (figure 1q). thus, overexpressed oskar mrna is not translationally repressed, even though it has not reached the posterior. furthermore, the ectopic oskar protein recruits vasa, indicating that the premature translation of oskar initiates the formation of the pole plasm in the middle of the oocyte (figures 1r1 t). to test whether oskar protein is required for the mislocalization of oskar mrna, we generated a second construct, uas - oskar - stop, in which we introduced a stop codon at position k178, which is equivalent to the mutation in the oskar protein - null allele oskar (figures 1e and 1f). when oskar - stop mrna is overexpressed, it rarely localizes to the middle of the oocyte (13/79 at stage 9 ; 11/96 at stage 10a), although it is overexpressed at similar levels to the wild - type uas - oskar mrna (figure s1e in the supplemental data online). thus, the formation of the ectopic dot seems to be mainly caused by oskar protein, rather than saturation of the localization pathway. the expression of the uas - oskar - stop construct induces the premature translation of endogenous oskar mrna (see below), and this may account for the low penetrance of oskar mrna mislocalization to the middle of these oocytes. whereas oskar mutants block abdomen formation, extra copies of oskar cause the opposite bicaudal phenotype, in which the head and thorax are replaced by a mirror - image copy of the abdomen. although uas - osk females produce some bicaudal embryos, the vast majority show a more extreme phenotype, in which the gut and terminal structures are expanded at the expense of the cuticle (figures s1a s1d, table s1). this is most probably because oskar mrna is very highly expressed in uas - osk ovaries (equivalent to at least ten copies of oskar ; see figure s1e), leading to oskar and nanos overexpression, which causes an expansion of the expression domains of the terminal - gap genes, tailless and huckebein (data not shown). surprisingly, uas - oskar - stop gives rise to embryonic phenotypes similar to those of uas - oskar, even though it can not produce functional oskar protein (figure s1d and table s1). a weaker bicaudal phenotype has been observed when the oskar-3utr is overexpressed, leading to the proposal that this rna activates the translation of endogenous oskar mrna by titrating out translational repressors. to test whether this is also the case for uas - oskar - stop, we expressed the transgene in females that were transheterozygous for two oskar protein - null mutations (oskar / oskar). the resulting embryos showed a typical posterior - group phenotype that was indistinguishable from oskar / oskar alone (table s1). thus, uas - oskar - stop produces a bicaudal phenotype by activating the translation of endogenous wild - type oskar mrna. at stage 7 of oogenesis, a signal from the posterior follicle cells induces a reorganization of the oocyte microtubule cytoskeleton, so that microtubules are then nucleated from the anterior and lateral cortex [2125 ]. the microtubule plus ends appear to localize to the middle of the oocyte during stages 7 and 8, as revealed by the localization of oskar mrna, staufen, and kin:-gal (a marker for the plus ends of the microtubules) [4, 17, 26 ]. this organization is only temporary, however, and plus - end markers start to accumulate at the posterior cortex at the beginning of stage 9, coincident with the onset of oskar mrna localization to the posterior. the mislocalization of oskar mrna to the center of uas - oskar oocytes resembles the polarity phenotype produced by par-1 hypomorphic mutant combinations, in which some of the microtubule plus ends localize to the middle of the oocyte, rather than the posterior pole [5, 6 ]. we therefore examined the localization of the plus - end marker kinesin--gal in uas - osk oocytes. kinesin--gal always localizes to an ectopic site in the center of these oocytes (18/18), as well as to the posterior, and colocalizes with staufen, a marker for oskar mrna (figures 2a2f). the dynein / dynactin motor complex provides another marker for the polarity of the microtubules because it is localized by kinesin to the posterior of the oocyte independently of oskar mrna [17, 27, 28 ]. this can be visualized with gfp - dynamitin, a subunit of the dynactin complex (figures 2g2i). gfp - dynamitin is mislocalized with staufen to the ectopic dot in the middle of almost all oskar - overexpressing oocytes (16/18) (figures 2j and 2k). thus, two markers for microtubule plus ends colocalize with ectopic oskar in the middle of the oocyte. the ectopic oskar does not appear to interfere with the organization of the microtubule minus ends, or with minus - end - directed processes. the overall morphology of the microtubules is not affected when visualized with tubulin antibodies (not shown) or with a gfp - tagged version of the microtubule - binding protein tau (figures s2c and s2d). in addition, the oocyte nucleus always migrates normally to the dorsal - anterior corner of the oocyte, and bcd mrna shows a wild - type localization to the anterior cortex (figures s2a and s2b). surprisingly, some gurken mrna is often mislocalized to the posterior of uas - oskar oocytes. it is not translated there, however, because gurken protein is only found at the correct location adjacent to the oocyte nucleus (figures s2e s2i). this phenotype requires high levels of oskar protein because gurken mrna is not mislocalized in uas - oskar - stop oocytes. these results suggest that prematurely translated oskar protein and/or downstream components of the pole plasm somehow sequester gurken mrna and take it with them to the posterior pole. the results above indicate that oskar protein recruits microtubule plus ends when overexpressed, raising the possibility that oskar normally plays a role in the recruitment of plus ends to the posterior in wild - type oocytes. to test this hypothesis, we re - examined the organization of the microtubule cytoskeleton in the absence of oskar protein and in mutants that affect oskar mrna localization and translation. the plus - end marker kin:-gal localizes to a tight posterior crescent in most wild - type stage 9 oocytes (88%, n = 58), with 12% displaying a weaker enrichment at the posterior pole (figure 3a, table s2). in an oskar protein null, however, only 16% of the oocytes show a robust posterior localization of kin:-gal, whereas 72% show a weak posterior enrichment, and 12% show no localization to the posterior at all (figure 3d). we also examined germline clones of btz and khc, which completely disrupt oskar mrna localization [12, 15 ]. in these cases, the distribution of kin:-gal in the mutant egg chambers can be directly compared with its localization in the heterozygous egg chambers from the same ovaries, which are stained under identical conditions. in each case, the mutant egg chambers show a highly penetrant reduction or loss of the posterior localization of kin:-gal compared to the nonmutant controls (figures 3g3o, table s2). these results are in good agreement with those of brendza, who noted that kin:-gal is not detectably localized in a significant fraction of khc mutant oocytes. thus, the posterior recruitment of plus ends is strongly impaired when oskar protein is absent from the posterior pole. the mechanism that recruits microtubule plus ends to the posterior pole at stage 9 is not well understood, but depends on the function of the conserved polarity kinase par-1 [5, 6 ]. in contrast to the wild - type, microtubules are nucleated all around the oocyte cortex of par-1 mutants, and the plus ends are focused at the center instead of the posterior pole. as a consequence, oskar mrna is mislocalized to the middle of the oocyte, and the resulting embryos lack an abdomen and germline. par-1 plays a similar role in organizing the microtubule cytoskeleton in both drosophila and mammalian epithelial cells, indicating that one of its major functions is in the establishment of polarized microtubule arrays [3032 ]. the par-1n1 short and long isoforms appear to play the major role in the polarization of the oocyte cytoskeleton because only these fully rescue the polarity defects of par-1 hypomorphs, and gfp - tagged par-1n1s and l are recruited to the posterior cortex of the oocyte at stage 7, making them the earliest markers for polarization of the anterior - posterior axis. this localization is more cortical than that of the pole plasm and is not disrupted in staufen, mago nashi, and kinesin heavy chain mutants, indicating that it is independent of oskar mrna localization. antibody stainings fail to detect the cortical par-1, perhaps because it is of too low abundance, but recognize a second population of par-1, which colocalizes to the posterior with the pole plasm [5, 6 ]. this localization is disrupted in oskar and staufen mutants, but not vasa mutants, suggesting that par-1 is recruited by oskar protein. these results suggest that oskar overexpression may interfere with polarity by recruiting par-1 to the center of the oocyte. in support of this view, antibody stainings revealed a strong localization of par-1 to the dot in the middle of the oocyte in uas - osk - overexpressing flies (100%, n = 16 ; figures 4a4f). gfp - par-1n1s does not colocalize with ectopic oskar in the center of the oocyte, however, consistent with the previous observation that this isoform is recruited to the posterior cortex, but not the pole plasm. we also tested whether uas - oskar enhances the phenotype of a weak par-1 mutant combination. flies transheterozygous for the two hypomorphic par-1 alleles, par-1 and par-1, have mild polarity defects, in which oskar mrna and staufen protein are mislocalized to the center of the oocyte in 56% (n = 136) of egg chambers (figures 4g4j, table s3). despite this mislocalization, stau is also visibly enriched at the posterior pole of the oocyte in the majority of cases (88%). in contrast, par-1/par-1 oocytes that also overexpress oskar mrna show a much stronger phenotype : stau protein is visibly enriched at the posterior pole of the oocyte in only 27% (n = 37) of these egg chambers and is mislocalized all around the oocyte cortex in most cases (figure 4j ; table s3). in addition, these flies do not lay any eggs because of these severe defects in oogenesis. thus, oskar overexpression strongly enhances the phenotype of a weak par-1 mutant combination, most probably because ectopic oskar protein recruits some of the limited amount of par-1 away from the posterior to the oocyte center. although oskar mrna localization has always been presumed to be downstream of the polarization of the oocyte microtubule cytoskeleton, here we show through both gain- and loss - of - function experiments that it also plays an active role in this process, through the recruitment of microtubule plus ends by oskar protein. par-1 is a good candidate to be the effector of oskar function in plus - end recruitment because it is required for the polarization of the microtubule cytoskeleton and is recruited by oskar protein to the posterior of the oocyte. furthermore, the polarity phenotype of par-1 hypomorphs is strongly enhanced by oskar mrna overexpression, suggesting that par-1 and oskar function in the same pathway to regulate the microtubules. on the basis of our results, we would like to suggest a revised model for how the polarity of the oocyte is established (figure s3). the polarization of the oocyte is initiated by the posterior - follicle - cell signal, which induces the localization of the par-1n1 isoforms to the posterior cortex. this localized par-1 then recruits or stabilizes some microtubule plus ends at the posterior cortex, leading to the kinesin - dependent transport of a small amount of oskar mrna from the center of the oocyte to the posterior pole. once oskar mrna reaches the posterior, its translational repression is relieved, and the resulting oskar protein recruits another population of par-1 to the posterior. this par-1 can then recruit further microtubule plus ends, which in turn direct the posterior localization of more oskar mrna. thus, oskar protein initiates a positive feedback loop that amplifies the polarization of the microtubule cytoskeleton, leading to an increase in the localization of its own mrna. the microtubule polarity is not reinforced in oskar protein - null mutants or in mutants that disrupt the localization of translation of oskar mrna, and this results in only a partial polarization of the microtubule cytoskeleton. on the other hand, oskar mrna overexpression and premature translation in the middle of the oocyte initiates the positive feedback loop in the wrong place. as a consequence, par-1 recruits some of the microtubule plus ends to the center of the oocyte and away from the posterior pole. this therefore generates a second positive feedback loop that further reinforces the posterior localization of par-1, oskar protein, and microtubule plus ends. for example, the polarization of migrating neutrophils depends on the local enrichment of phosphatidylinositol 3,4,5 triphosphate (ptdinsp3) at the leading edge of the cell, and this is amplified by a rho - dependent positive feedback loop, in which ptdinsp3 recruits ptdins-3-oh kinase to the leading edge, which in turn generates more ptdinsp3. the bud site is defined by the localization of activated cdc42-gtp, and this localization induces the assembly of actin cables that extend into the cytoplasm. this signal is then reinforced by the transport of more cdc42-gtp along the actin cables to the bud site, where it can induce the assembly of further actin cables. this mechanism is enhanced by a second feedback loop, in which cdc42-gtp recruits the adaptor protein, bem1, which binds cdc24, which activates cdc42 [36, 37 ]. our results add a third example of the use of multiple feedback loops to reinforce an initially weak cell polarity, and they provide the first case where this amplification involves the microtubule cytoskeleton rather than actin. | summarythe localization of oskar mrna to the posterior of the drosophila oocyte defines the site of assembly of the pole plasm, which contains the abdominal and germline determinants [13 ]. oskar mrna localization requires the polarization of the microtubule cytoskeleton, which depends on the recruitment of par-1 to the posterior cortex in response to a signal from the follicle cells, where it induces an enrichment of microtubule plus ends [47 ]. here, we show that overexpressed oskar mrna localizes to the middle of the oocyte, as well as the posterior. this ectopic localization depends on the premature translation of oskar protein, which recruits par-1 and microtubule - plus - end markers to the oocyte center instead of the posterior pole, indicating that oskar regulates the polarity of the cytoskeleton. oskar also plays a role in the normal polarization of the oocyte ; mutants that disrupt oskar mrna localization or translation strongly reduce the posterior recruitment of microtubule plus ends. thus, oskar mrna localization is required to stabilize and amplify microtubule polarity, generating a positive feedback loop in which oskar recruits par-1 to the posterior to increase the microtubule cytoskeleton 's polarization, which in turn directs the localization of more oskar mrna. |
sixty - eight percent of the us adult population is overweight or obese and thus at increased risk of developing debilitating and costly illnesses, including, diabetes, cardiovascular disease, and depression. while modest weight loss improves health, the vast majority of individuals who lose weight eventually gain it back [3, 4 ]. understanding how to best promote weight loss and weight control that can be sustained is a top public health priority. in addition, regular physical activity reduces the risk of developing cardiovascular disease, diabetes, osteoporosis, and some cancers and improves quality of life [611 ]. despite these numerous benefits and over thirty years of behavioral research and messages in the media educating people about physical activity benefits, most individuals do not sustain physically active lives. while most individuals are aware of the many benefits physical activity brings, this knowledge is not sufficient to motivate active lifestyles. for both women and men, the typical messages and communications emphasize physical activity primarily for health and/or weight control benefits [1416 ]. furthermore, exercise is typically prescribed to patients for its weight and health value rather than as a good way to enhance mood or quality of life. when physicians recommend exercise to their patients it is usually within the specific context of the need to diet and lose weight. thus, the dominant messages in society have framed and branded physical activity primarily as a way to lose weight, prevent disease, and age with good health. how physical activity benefits are framed in health communications and prescribed by clinicians they teach people about the goals they should strive to achieve from being physically active (e.g., the reasons why they should participate) they direct and energize behavior, with some goals energizing behavior better than others [2427 ]. behavioral goals and motives influence the quality of motivation that develops and are central to long - term sustainability [2831 ]. thus, to optimally promote sustainable physical activity, it is crucial to identify which frames foster optimal motivational responses toward physical activity and result in goals that are energizing and motivationally potent [19, 29 ]. self - determination theory (sdt) has not been previously studied as an explanatory motivation / behavior framework in the exercise / physical activity framing literature as far as we know. yet, we believe it holds great potential to identify optimal frames for physical activity marketing and promotions. sdt proposes that socialization to a behavior like physical activity occurs within social contexts that either support or undermine autonomy, one of three innate human needs. feeling autonomous, or self - determined, toward physical activity is important because it helps individuals internalize the value of being physically active so they can integrate it into their selves and lives. thus, the real objective is for individuals to integrate physical activity regulations within their sense of self and values rather than behavior change, per se. sdt pays attention to the motives behind a behavioral goal the reasons underlying the decision to become more physically active (or adopt any behavior). controlled regulations refer to initiating a behavior to fulfill an external demand or a socially constructed contingency (external regulation) and/or also reflect an individual partially internalizing the value of being active but not in a deeper sense where it is truly accepted as one 's own (introjected regulation). introjection - based behaviors are done to avoid guilt and shame and to attain feelings of worth. in contrast, autonomous regulations reflect acting with a full sense of volition and choice when initiating an activity. when individuals experience autonomy toward being physically active they value it (identified regulation) and may enjoy and/or receive positive feelings and satisfaction from the act of being physically active (intrinsic regulation). sdt offers a helpful framework to understand the counterintuitive notion that initiating physical activity with goals related to losing weight may, ironically, undermine the ultimate aim to motivate sustainable participation and weight control. weight loss goals for physical activity embed pressures based on sociocultural norms that encourage women to internalize a sexualized, third - person view of themselves [16, 3538 ]. we argue that losing weight as a physical activity goal, in general, is inextricably connected to appearance norms and thinness pressures in our culture, especially for women. because of that it is difficult to separate out attractiveness and thinness pressures and goals from a weight loss goal for women. for example, one study validating an exercise motive scale reported that separate appearance and weight loss items were highly correlated. in addition, we conducted a cross - sectional mixed - method study with 59 midlife women, most of whom were well - educated european americans (mean age = 45.6 years). they were asked to imagine being physically active for two minutes and then write down the first associations, words, and phrases that came to mind. participants who noted ideas like calories, losing weight, and so forth were categorized as having body - shape motives (44%). those who did not note those types of concepts were placed into the non - body - shape motive category (56%). those who exercised with body - shape motives self - objectified more (e.g., perceiving oneself from a third - person perspective : how do i look ? instead of how do i feel ?) compared to participants who exercised for non - body - shape goals. higher self - objectification among participants with weight - related goals indicates that they had more greatly internalized cultural beauty norms and pressures compared to the other participants. the participants with body - shape motives were also 37% less physically active than those with non - body - shape motives (p 0.001). it reflects individuals believing that physical activity is valuable and participating because it feels good or is inherently satisfying. autonomous sdt regulations were measured by adapting items from the trsq related to diabetes [70, 71 ] and the behavioral regulation in exercise questionnaire (breq). the following statements list reasons people often give when asked why they are or would become physically active. whether you currently are physically active or not, please read each statement carefully and indicate whether or not each statement is or would be true for you personally if you decided to be physically active. participants responded to two items with a 7-point scale, from 0 (not at all true) to 6 (very true). intrinsic regulation refers to being physically active as a way to achieve positive emotional experiences and/or satisfaction derived from participating in the behavior per se. it was assessed by the statement : it feels good to be physically active. the mean score indicates that, on average, participants felt somewhat autonomous toward being physically active. the autonomous regulation and controlled regulation indexes were positively correlated = 0.64 (p > 0.001). we chose the body image state scale (biss) because of its sensitivity to changes in state body image. the biss has acceptable internal consistency and is sensitive to reactions in positive and negative situational contexts. the biss is phrased for each of the questions below, select the one statement that best describes how you feel right now, at this very moment. participants responded to two items from the biss that reflected body satisfaction, using a 9-point scale from 0 (extremely dissatisfied) to 8 (extremely satisfied) about (1) my body size and shape and (2) my weight. bmi was calculated as the ratio of study participants ' self - reported weight (kg) to self - reported height squared (m). we fit three - way anovas to the continuous outcome variables of interest, checked assumptions of linear models, and found no patterns that required remediation. the predictor variables for these models included the experimental condition (frame), gender, and bmi (obese and overweight). the initial model for each dependent variable included all possible interactions with frame, gender, and bmi. the bonferroni correction was used for group comparisons as a conservative method to control for type ii errors. data are displayed in graphs with error bars showing the 95th percentile confidence intervals of the mean. appendix ii in supplementary material available online at doi:10.1155/2012/354721 shows the adjusted means and standard errors for all variables. we also conducted post hoc analyses on the individual components of controlled and autonomous regulation to understand how the advertisements impacted these individual regulations. a total of 3470 participants accessed the survey, with a 67% completion rate (n = 2313). this research question aimed to understand how overweight and obese individuals respond to the typical exercise frames seen in society and health care, with a specific interest in the effects from a weight loss frame. because of that, we only included individuals in the analyses who had bmis categorizing them as overweight or obese. bmi categories in this study were distributed as follows : 44.9% were overweight (bmi 2529.9 kg / m) and 55.1% were obese (bmi 30 kg / m). our final model for controlled regulation toward being physically active indicates one significant two - way interaction between frame and bmi, f(2,1667) = 3.4, p < 0.05, p = 0.004. see figure 1 for the mean scores of controlled regulation. the framing effects on controlled regulation depend on bmi. for those individuals who were overweight, reading the daily well - being advertisement decreased controlled regulation compared to reading the weight loss and health advertisement. in contrast, for obese individuals, those reading the daily well - being advertisement reported higher controlled regulation, compared to those reading the health and weight loss advertisement. post hoc analyseswe conducted post hoc analyses separately on the two components of controlled regulation, external regulation and introjected regulation toward being physically active. we conducted post hoc analyses separately on the two components of controlled regulation, external regulation and introjected regulation toward being physically active. introjected regulationthe introjected regulation model showed a significant two - way interaction between frame and bmi, f(2,1675) = 6.2, p < 0.01, p = 0.007, in the same direction as seen in controlled regulation. see figure 2 for the mean scores of introjected regulation. the introjected regulation model showed a significant two - way interaction between frame and bmi, f(2,1675) = 6.2, p < 0.01, p = 0.007, in the same direction as seen in controlled regulation. see figure 2 for the mean scores of introjected regulation. our model for autonomous regulation toward being physically active indicates one significant three - way interaction between frame, gender, and bmi, f(2,1665) = 4.5, p < 0.05, p = 0.005. see figure 3 for the mean scores of autonomous regulation. the framing effects on autonomous regulation differed depending on bmi and gender. among overweight individuals, men and women responded differently to the daily well - being frame. overweight women who read the daily well - being advertisement reported greater autonomous regulation than those reading the weight loss, but not health, advertisement. in contrast, overweight men who read the daily well - being advertisement reported lower autonomous regulation compared to those who read the weight loss and health advertisements. post hoc analyseswe conducted post hoc analyses separately on the two components of the autonomous regulation variable, identified regulation and intrinsic regulation. we conducted post hoc analyses separately on the two components of the autonomous regulation variable, identified regulation and intrinsic regulation. identified regulationour final model for identified regulation toward being physically active indicates a significant frame - gender interaction, f(2,1666) = 3.1, p < 0.05, p = 0.004, and a significant frame - bmi interaction, f(2,1666) = 3.1, p < 0.05, p = 0.004. see figure 4 for mean scores of identified regulation. overweight women reading the daily well - being advertisement reported marginally higher identified regulation than those reading the weight loss advertisement. in contrast, overweight men reading the daily well - being advertisement reported lower identified regulation compared to those reading the weight loss advertisement. our final model for identified regulation toward being physically active indicates a significant frame - gender interaction, f(2,1666) = 3.1, p < 0.05, p = 0.004, and a significant frame - bmi interaction, f(2,1666) = 3.1, p < 0.05, p = 0.004. see figure 4 for mean scores of identified regulation. overweight women reading the daily well - being advertisement reported marginally higher identified regulation than those reading the weight loss advertisement. in contrast, overweight men reading the daily well - being advertisement reported lower identified regulation compared to those reading the weight loss advertisement. intrinsic regulationour final model for intrinsic regulation toward being physically active indicated a significant three - way interaction between frame, gender, and bmi, f(2,1665) = 6.7, p < 0.01, p = 0.008. see figure 5 for mean scores of intrinsic regulation overweight women reading the daily well - being advertisement reported higher intrinsic regulation toward being physically active than those reading the weight loss advertisement. overweight men, however, had the opposite response. those who read the daily well - being advertisement reported lower intrinsic regulation than those reading the weight loss and health advertisements. our final model for intrinsic regulation toward being physically active indicated a significant three - way interaction between frame, gender, and bmi, f(2,1665) = 6.7, p < 0.01, p = 0.008. see figure 5 for mean scores of intrinsic regulation. among overweight individuals, women and men overweight women reading the daily well - being advertisement reported higher intrinsic regulation toward being physically active than those reading the weight loss advertisement. those who read the daily well - being advertisement reported lower intrinsic regulation than those reading the weight loss and health advertisements. our final model for body image showed a trend toward a three - way interaction between frame, gender, and bmi, f(2,1236) = 2.8, p < 0.10, p = 0.005. overweight women who read the daily well - being advertisement reported more favorable body image compared to those reading the weight loss advertisement. this study showed that there are immediate framing effects on behavioral regulation and body image from simply reading a one - page advertisement about physical activity and that gender and bmi moderate these effects. this was seen most convincingly in body image and autonomous regulation, with the strongest effect in the intrinsic regulation component of autonomy. overweight men tended to respond unfavorably toward the daily well - being frame, with generally equal effects on both the identified and intrinsic components of autonomy. this study expands the framing literature by being the first to evaluate which gain - frame messages most optimally influence sdt constructs and body image among overweight and obese men and women in midlife. our hypothesis that daily well - being would predict greater autonomy toward being physically active compared to health or weight loss was only partially supported. a trend among overweight (but not obese) women suggested that reading the daily well - being frame predicted higher autonomous regulation toward being physically active compared to reading the weight loss frame. autonomy refers to feeling as the causal agent of one 's life and acting in harmony with one 's fully integrated self. these data suggest that just the idea of striving toward well - being through physical activity may foster autonomous feelings, something that may help women better internalize the value of being physically active and promote ongoing participation. this idea is supported by previous behavioral research showing that overweight women exercising in order to enhance their well - being feel more autonomous and participate in more exercise over time than women exercising to lose weight [24, 41 ]. moreover, two other studies investigated differences between active and inactive women related to their reasons for participating. they found that women who are regularly physically active report exercising in order to increase their well - being and quality of life. in contrast, those who are not active report weight loss as their main motive for participating [62, 78 ]. while it can not be known whether individuals with weight loss motives aim to improve appearance or benefit health without also investigating this question specifically, the interconnections between losing weight, health, and socialized pressures to be thin and attractive are powerful, often implicit, and might be hard for individuals to untangle [66, 80, 81 ]. interestingly, the post hoc analyses showed that the experiment affected intrinsic regulation toward being physically active (feeling good from or enjoying the process of being active) more than identified regulation (cognitively valuing physical activity). this experiment showed that framing physical activity as a way to achieve daily well - being (compared to weight loss) positively influenced overweight women 's perceptions about the experience of being physically active. thus, frames featuring enhanced well - being may implicitly give women permission to create physical activity experiences that are congruent with their unique preferences and intrinsically feel good to them. if so, this would help women experience physical activity as an autonomous activity. intrinsic experiences with physical activity, however, may not just influence participation and adherence [8385 ]. intervention research showed that increased intrinsic motivation for exercise was the strongest predictor of long - term weight loss among women who participated in a weight reduction program. furthermore, physical activity messages that emphasize well - being experiences instead of women 's bodies may positively impact women 's body image. women 's socialization to physical activity and exercise embeds sociocultural appearance and weight - related pressures [37, 47, 81 ]. thus, reframing physical activity as a positive experience producing behavior instead of a body shaping behavior might improve women 's body image. in partial support of this hypothesis, overweight (but not obese) women who read the daily well - being advertisement reported better body image compared to those who read the weight - loss advertisement. another study, on college - aged women, conducted a framing experiment with similar goals as ours. they found that participants showed an immediate and positive framing effect on body image from reading magazine articles featuring feel good this research advances the literature by showing that there are immediate and beneficial framing effects on body image from simply reading an advertisement featuring daily well - being as the primary reason to become physically active, among overweight women in midlife. new research emphasizes the importance of a positive body image for maintaining health behaviors. a 12-month weight management intervention that included a body - image educational component resulted in improvements in body image among participants. the authors further reported that having a more positive body image improved eating self - regulation and behavior. this finding with eating behavior is similar to two separate physical activity interventions that also had program curriculum that addressed the thin ideals and weight - related pressures that women experience. these interventions, conducted with convenience samples, explicitly reframed exercise away from weight loss and body shaping goals to self - care and self - worth as key benefits of and new reasons to become more physically active. both interventions showed increased physical activity from baseline to after the program that was sustained at the long - term study follow - ups [88, 89 ]. having positive feelings about the self, such as from positive body image and self - worth, may be very important to produce sustainable self - regulation and behavior. thus, our physical activity frames and messages / promotion might improve outcomes if they were crafted to help women feel good instead of bad about themselves and their bodies. contrary to our hypothesis and the findings among overweight women, overweight men who read the daily well - being advertisement reported less autonomy toward physical activity compared to those who read the weight loss advertisement. based on sdt and behavioral economics research, we thought that the daily well - being frame would be experienced as the most autonomous by both women and men. despite this, overweight men in our sample experienced the weight loss frame as more autonomous than the well - being frame. these data might reflect a true gender difference and may indicate that well - being is not relevant or is a nonoptimal physical activity frame for men. the notion that proximal and noticeable well - being benefits from physical activity are not compelling to men, however, conflicts with research across genders suggesting that immediately experienced benefits are more motivating than abstract and distant benefits. in fact, to improve behavioral pursuit, behavioral economists recommend reward substitution, a strategy to reframe a behavior away from distant benefits (e.g., disease prevention) to rewards that can be experienced immediately (e.g., increased energy) [60, 61 ]. an alternative explanation for this unexpected finding, based on research focused on men 's unique experience with health behavior, may help explain why the daily well - being frame did not foster autonomy among men. the daily well - being advertisement text mentioned benefits like improved mood and stress reduction. men may be less comfortable with mental health issues and thus may not feel self - determined when confronted with messages about them. in addition, many men define stress as something that is driven by factors that are outside of their control, such as job strain and family responsibilities. thus, men reading the daily well - being advertisement might have been primed to think about these larger and overwhelming stressors and, as a result, felt less autonomous toward being physically active compared to those reading the weight loss or health advertisements. moreover, feeling good was the central goal (e.g., motive for change) in women 's goal hierarchy, it was not central for men. this study suggests that men may not value well - being experiences as much as women do [95, 96 ]. however, more in - depth and gender - specific framing research is needed on men in midlife to better understand which frames and messages are most acceptable and motivating to them [9799 ]. contrary to our hypothesis, women reading the daily well - being and health advertisements reported the same level of autonomy toward being physically active. given that our past research showed that health goals for exercise resulted in non - optimal behavioral regulation among overweight women in midlife, this unexpected we conjecture that this current study finding highlights the conundrum related to promoting physical activity for health (to women). individuals have clearly been socialized to value behaviors like exercise because they improve health and prevent disease [101, 102 ]. moreover, other exercise studies show that exercising to pursue good health reflects an intrinsic drive and goal [26, 50 ]. valuing exercise for its health benefits is also logical given the frequently communicated link between exercise and health by health organizations and the media [15, 53 ]. in fact, campaigns even brand exercise explicitly as medicine. placing a high value on health is generally thought to motivate individuals to practice health behaviors. yet, while the societal branding of exercise for health benefits has been successfully internalized by most, we remain skeptical that health as the primary reason for exercising will optimally promote sustainable participation among women. what an individual espouses as important does not necessarily translate into behavior that is sustained over time. it is easy for individuals to report exercising for health as an important value and autonomous aim because, in theory, it is. what individuals find important enough to consistently prioritize within their busy lives, however, may be different than abstract values. for example, in previous mixed - method longitudinal research, midlife women who were overweight evaluated how much they valued their superordinate - level goal for exercising, compared to their other important life goals. the participants in the three largest categories, current health, healthy aging, and quality of life, reported equally valuing their goals. current health or healthy aging exercised significantly less than those having exercise goals related to enhancing their quality of life. research on values and behavior shows that situational forces (e.g., barriers to the behavior) can dramatically reduce behaviors that affirm cherished values. it is easy to see how exercising in order to benefit health would be highly valued by women. yet, because women constantly juggle multiple roles and responsibilities [95, 105 ], it is also easy to see how exercise aiming to improve health could be trumped by the other daily priorities against which it constantly competes [19, 31, 106 ]. doing behaviors to benefit health, while considered important, may not rank as a top or urgent priority on women 's daily to do lists. taking medication offers another example to support the notion that despite being valued, health may not be the optimal frame to promote sustainable behavior. the purpose of taking medication is to improve health and prevent disease, not unlike physical activity. taking pills, however, while not a simple behavior, does not include the same level of logistics and negotiating time that remaining physically active does. despite this, there are well - documented low adherence rates to prescription medication around the world [107, 108 ]. overweight men who read the daily well - being advertisement reported less autonomy toward physical activity compared to those who read the health advertisements, contrary to our hypotheses and different than the null effects seen among women. this current study comes out of our program of research that, until now, has been focused on the gender - specific issues faced by midlife, overweight women and is our first time studying these questions among men. we had assumed that daily well - being frames would positively impact men 's behavioral regulations, based on previous investigations on women, sdt, and behavioral economics studies [24, 33, 62, 91, 109 ]. however, these study data suggest that well - being might not be an optimal exercise frame for men, contrary to our hypothesis. these data suggest that men may feel more autonomous toward a health frame compared to a well - being frame for being physically active. we believe that to learn how to optimally promote physical activity, it is essential to develop marketing messages that target gender and other specific demographic characteristics, as industry does [19, 110 ]. for example, a popular commercial weight loss program website (medifast) shows that they market differently to men than to women. the page promoting medifast to men started with the following text when you want to lose weight and get healthy, medifast makes sense. if you 're unhappy or unhealthy because of your weight, medifast can help you get fast results. it is interesting to note that some marketing strategies in industry support the general gender differences identified in this study and our research on women and physical activity [62, 96, 113 ], such that losing weight and health are often featured motivators for men, while well - being outcomes such as joy, however, without more inductive research with men on physical activity per se, it is premature to make conclusions about which frames will be most motivating. it is important to contextualize this study within a parallel program of research on exercise goals in europe. there is a growing specialized area within sdt research that investigates the differential contribution of goals and behavioral regulations to physical activity participation that is referred to as the what of goal pursuits includes participation motives or goal contents (the reason why an individual decides to participate) while behavioral regulations are referred to as the why of goal pursuits. in support of the current finding that men experience health as a more autonomous goal and frame, much of this other research also finds a positive relationship between health goals for exercise, autonomous regulation [26, 29, 115 ], and physical activity participation [26, 30 ]. while this european - based research is in line with these unanticipated findings among overweight men, they do not support our previous research showing that women experience health goals for exercising as controlling and predictive of decreased exercise participation over time [24, 41 ]. we should also consider whether distinct findings among different programs of research might be due to differences in study populations (gender - specific versus mixed gender investigations and analyses, ethnicity, etc.), methodological issues (variable - centered versus person - centered measurement), and life stage (targeting specific life stages versus including individuals in samples across the adult lifespan, etc.). in addition, health might have distinct meanings within different cultures that may influence findings in the realms of physical activity motivation, behavior, and weight control. while some research suggests that health goals and frames for exercising benefit motivation and participation, research perspectives outside of the physical activity literature suggest that promoting the value of health as the primary reason for exercise might present challenges to individuals sustaining participation over time [91, 104, 109 ]. given our previous research, and the extreme cultural pressures to be thin, we were surprised that the weight loss frame was not more greatly associated with controlled regulation, especially among women. both the lack of hypothesized effects related to controlled regulation, and the low internal consistency reliability coefficient seen with the controlled regulation index were reported elsewhere. this high mean controlled regulation score suggests that individuals may have been socialized in ways, through the media and within health care, that generally promote controlled regulations toward being physically active. thus, reading a one - page advertisement may not be sufficient to change this pressuring regulation toward being physically active. it is interesting, however, to note that the controlled regulation and autonomous regulation indexes were strongly positively correlated. as others have reported, individuals can feel both controlled and autonomous toward being physically active at the same time. this is not surprising given that our general socialization to being physically active includes a strong external focus on body and weight and that individuals do value being healthy and well. despite this, having concurrent autonomous and controlled regulations toward physical activity may promote ambivalence. when individuals feel ambivalent toward physical activity they are less likely to prioritize it among the other goals and responsibilities against which it constantly competes. the framing experiment, in general, had fewer effects among the obese participants. while not hypothesized, most effects occurred among the overweight participants. the only effect seen among the obese individuals occurred in controlled regulation (specifically in introjected regulation) compared to overweight participants. the overweight individuals reading the daily well - being advertisement compared to those who read the weight loss or health advertisements reported decreased controlled regulation. this suggests that, across genders, overweight individuals may experience a daily well - being frame for physical activity as less controlling than health- or weight - related frames. obese men and women who read the daily well - being advertisement reported higher controlled regulation compared to those who read the weight loss or health advertisement. obese individuals experience extreme pressure in society, especially in areas related to their health and weight. we wonder whether their higher controlled response (compared to the overweight participants) to the daily well - being advertisement reflects that the obese participants felt pressured to add one more thing to strive toward on a list that probably already includes losing weight and improving health. to understand the lack of effects among obese individuals it is important to consider that they experience extreme pressures and prejudices related to their larger size. obesity is considered one of the most enduring stigmas in society because of the common perception that extra weight is due to controllable personality flaws like laziness, gluttony, or lack of self - discipline. weight discrimination leads to unfair treatment in employment and health care, among other areas. in addition, the consequences of being overweight and obese worsen as individuals reach heavier weights [118, 119 ]. moreover, the health care context uniquely challenges individuals who are obese. even professionals whose careers emphasize research or the clinical management of obesity show a very strong weight bias. schwartz and colleagues found that health professionals (n = 389) endorsed both implicit and explicit stereotypes that overweight and obese people are lazy, stupid, and worthless. thus, it is not surprising that obese participants reported lower body image compared to those who were overweight in this study. despite frequent dieting, one qualitative study among obese individuals reported that they have many barriers to being physically active, including being embarrassed to exercise in front of people and experiencing exercise as difficult because of their weight and physical health. another study examined self - reported physical activity barriers and the effects of these barriers on physical activity behavior among 280 previously inactive women enrolled in a physical activity intervention. the authors reported that the obese participants reported significantly greater physical activity barriers compared with those who were overweight (p < 0.05). obesity is also frequently accompanied by depression, and depressed individuals might be even less likely to respond to reading a one - page advertisement about physical activity. it can not be overstated that obese individuals face daunting barriers to being physically active. we believe that the lack of effects among the obese participants in this experiment suggest that reading a one - page advertisement is simply not a strong enough intervention for obese individuals, given their negative experiences with and their extreme barriers to exercising. thus, it may take a much more intense intervention, one with ongoing support, to foster autonomy among obese individuals, as occurred in an intervention study previously conducted with obese women. much more research is needed to identify how to help obese individuals address their unique barriers so that they can become more physically active in ways they can sustain. increasing participation among women in sustainable ways might be a question of improving how we sell physical activity and exercise through intensive market research and principles such as branding [19, 110, 125127 ]. instead of promoting the end points that clinicians, business, and governments endeavor to achieve from promoting exercise to individuals (e.g., improved health in service of health care savings), health communications might become more meaningful and persuasive to women if they were based on the exercise benefits that are most compelling to them [41, 62, 94, 96 ]. individuals who strive toward achieving well - being goals have to turn inward in order to determine how to achieve well - being experiences for themselves. thus, striving toward well - being is inherently autonomous and, as such, may foster a key aspect of the basic psychological needs that promote flourishing and optimal motivation, as posited by sdt. in fact, other research found that intrinsic (relative to extrinsic) exercise goals positively predicted psychological needs satisfaction. thus, to promote physical activity as a key means to daily well - being capitalizes on its potentially inherent autonomous nature and, because of that, may be ideal to facilitate ongoing physical activity motivation and participation among overweight women. there is significant research showing the connection between physical activity and well - being [8, 85, 128130 ]. but women may not make that connection when deciding whether or not to be physically active because the vast majority of physical activity promotions feature health- and weight - related benefits [14, 68 ]. in support of this contention, our previous research showed that only a minority of women reported being physically active to enhance well - being (12%) or quality of life (22%) [19, 41 ]. this is concerning because it suggests that women in midlife have not been socialized to consider physical activity for experiential positive mood enhancing and well - being purposes. this could be reducing the effectiveness of our social marketing and promotion of physical activity to overweight women. reframing physical activity as a primary way women can feel better every day (like the american heart association has started doing : you 'll feel better and your life depends on it) and the downstream effects from feeling better on meaningful areas of life (more patient parenting, enjoyment and productivity at work, etc.) may better promote sustainable physical activity and, hence, may result in better weight control among overweight women. the effects from this experiment are very small, but that was to be expected from this weak intervention. the purpose of this experiment was a proof of concept study to see whether this line of research, investigating whether distinct gain - frame messages can immediately impact individuals ' regulations and body image, was worth pursuing. we believe the findings suggest this line of questioning merits further research, with an emphasized need for more inductive work to illuminate what physical activity frames will be most motivating and compelling to overweight men as well as obese individuals in general. while we proposed that there might be long - term behavioral implications from promoting physical activity with these different frames, these experimental data do not address nor support a causal connection. participants who sign up with companies to regularly take surveys for payment represent a specific population that are likely very different from the general population and may affect how they responded to the questions. while this may impact the generalizability of the findings, the randomized design supports the internal validity of this study. finally, while this sample was selected by the survey research firm to approximate the us population, it still contained a vast majority of european americans and thus potentially different framing effects by ethnicity are not known. we used a randomized design to evaluate the immediate framing effects on physical activity behavioral regulations and body image among a large sample of midlife adults who were overweight and obese. having research that focuses on a specific life stage and population is an important strength because individuals in different life stages have different responsibilities, priorities, and values [43, 44 ]. thus, to understand how to optimally promote physical activity to a particular group at risk, it is important to investigate that specific population based on their demographics. in addition, while we kept our focus on investigating adults in midlife, we expanded our targeted program of research on overweight women to include men in order to better understand how gender influences motivational responses to distinct frames for promoting physical activity. this study advanced the framing literature by investigating and identifying differences in effects by gender, and between participants who are overweight and obese, with a less frequently studied frame (daily well - being) using variables related to sdt and body image. these and other data suggest that how we market and frame physical activity may need to change depending on the demographics : life stage, gender, and bmi status, among other variables [94, 132 ]. the framing of benefits brands physical activity and influences the specific goals individuals strive to achieve through becoming physically active [41, 43 ]. because not all goals are equally motivating [30, 60, 133, 134 ], the framing of physical activity has important implications for promoting sustainable physical activity and weight control. this study showed that there are immediate framing effects on behavioral regulation and body image from simply reading a one - page advertisement about physical activity and that gender and bmi moderate these effects. overweight women tended to respond positively to the daily well - being frame, especially the intrinsic regulation component of autonomy, while overweight men tended to respond unfavorably toward the daily well - being frame. research shows that women want their leisure time experiences to reflect freedom of choice and intrinsic experiences. thus, framing physical activity in ways that are congruent with and reflect women 's valued experiences might help them internalize the value of being active, making it more compelling to fit regular physical activity into their busy days [19, 24, 106 ]. these findings support a growing body of research that suggests that framing physical activity for daily well - being, compared to framing it for weight loss, might enhance autonomy toward physical activity, making it a better gain - frame message for overweight women in midlife [19, 24, 62 ]. more gender - specific research is needed about how to optimally frame physical activity for overweight men and for obese individuals more generally. | the reasons for exercising that are featured in health communications brand exercise and socialize individuals about why they should be physically active. discovering which reasons for exercising are associated with high - quality motivation and behavioral regulation is essential to promoting physical activity and weight control that can be sustained over time. this study investigates whether framing physical activity in advertisements featuring distinct types of goals differentially influences body image and behavioral regulations based on self - determination theory among overweight and obese individuals. using a three - arm randomized trial, overweight and obese women and men (aged 4060 yr, n = 1690) read one of three ads framing physical activity as a way to achieve (1) better health, (2) weight loss, or (3) daily well - being. framing effects were estimated in an anova model with pairwise comparisons using the bonferroni correction. this study showed that there are immediate framing effects on physical activity behavioral regulations and body image from reading a one - page advertisement about physical activity and that gender and bmi moderate these effects. framing physical activity as a way to enhance daily well - being positively influenced participants ' perceptions about the experience of being physically active and enhanced body image among overweight women, but not men. the experiment had less impact among the obese study participants compared to those who were overweight. these findings support a growing body of research suggesting that, compared to weight loss, framing physical activity for daily well - being is a better gain - frame message for overweight women in midlife. |
as one of the most common malignant tumors derived from the gastrointestinal tract, esophagus carcinoma has a high incidence and mortality, and more than 300 000 people died from this cancer, making it the sixth leading cause of cancer death worldwide. due to various factors, including environment, diet, and modern life - styles, china has one of the world s highest incidence rates of esophagus cancer. esophagus carcinoma has been reported as one of top 10 cancers in chinese [35 ]. the etiology of esophagus carcinoma has revealed the involvement of multiple factors, including genetics, diet, and environmental influences. in its early stage, esophagus cancer normally manifests as only minor discomfort when chewing solid food and lacks typical features, causing a high rate of misdiagnosis. it is thus usually diagnosed in late stage, when opportunity for optimal treatment has passed, leading to difficulty of treatment and unfavorable prognosis, and severely compromising patient life quality and survival rate. current studies agree on the genetic component underlying risk of malignant tumors, which are the results of accumulation of minor genetic mutations across different genes in a cascade manner. micro rna, which is a type of small molecule, also named as mirna or small molecule rna, is widely expressed in animal and plant cells for gene expression regulation. via its base paring with a target gene or to inhibit its downstream protein expression, mirna mediates mrna degradation and protein expression. a close relationship between mirnas and tumor pathogenesis has been suggested, as certain mirnas facilitate tumor proliferation and metastasis, while the silencing of certain mirna may cause it to lose its tumor - suppressor activity. recent finding indicated the role of mir-503 in various tumor cells, including tumor cell growth, differentiation, and invasion, as well as prognosis. the detailed function of mir-503 and its effects on the immune system, however, remain unclear. this study thus investigated the role and effects of mir-503 in cell growth, proliferation, and invasion of esophagus cells and measured its influences on immune cytokine secretion, in an attempt to study the related mechanism and to develop novel drug targets against esophagus cancer. resuscitated ec9706 and heec cells (atcc cell bank, usa) were thawed at 37c, followed by 1 000 rpm centrifugation for 3 min and re - suspension in 1 ml dmem medium (hyclone, us). cells were incubated in a humidified 37c chamber with 5% co2 perfusion for 24~48 h. both cell lines were then inoculated into a culture dish at 110/cm using high - glucose dmem medium containing 10% fetal bovine serum (fbs, evergreen, china), 100 u / ml penicillin, and 100 g / ml streptomycin. log - phased heec cells were used as the control group, while ec9706 cells were randomly divided into a tumor cell control group and a mir503 inhibitor group. mir-503 inhibitor oligonucleotide (5-gagcauuucggu cuggaa-3, gimma, shanghai) was mixed with 0.2 ml serum - free dmem medium and lipo2000 transfection reagent (invitrogen, usa), and was added into cultured ec9706 cells (confluence : 70~80%) for 30-min incubation. after the removal of serum and rinsing by pbs, 1.6 ml of serum - free medium was added for further 6-h incubation. trizol reagent (invitrogen, usa) was used to extract mrna from all groups. after measuring concentration and purity by ultraviolet spectrometer, total rna was used as the template for in vitro reverse - transcription using a test kit (invitrogen, us) to synthesize cdna. real - time pcr was then used to amplify the target gene using specific primers (table 1, sangon, china) under the following condition : 55c for 1 min, followed by 35 cycles each with 92c denaturing for 30 s, 58c annealing for 45 s, and 72c elongation for 35 s. using gapdh as the internal reference, fluorescent signals were quantified to determine ct values of all samples and standards. log - phased ec9706 cells were seeded into 96-well plates at 5 x 10 density in dmem medium containing 10% fbs. after 24-h incubation, 20 l of sterile mtt reagents was added into each well. four hours later, supernatants were removed, followed by the addition of 150 l dmso. the plate was shaken until complete resolving of the crystal violet. a microplate reader (bio - rad, usa) was used to measure the absorbance value at 570 nm. a transwell chamber (hyclone, usa) after 48-h transfection, cells were incubated using serum - free medium for 24 h. the transwell chamber was put into a 24-well plate which containing 0.5 ml dmem medium (with 10% fbs). we added a 100-l suspension of tumor cells inside the chamber with serum - free medium. after 48-h incubation, the chamber was rinsed in pbs and fixed in cold ethanol. the number of cells translocated to the lower side of the membrane was counted using an inverted microscope. cytokine levels including il-2, ifn-, il-4 and il-10 were quantified by elisa using test kits (ebioscience, usa) following the manual instructions. in brief, serially diluted standard samples were added into 96-well plates, along with tested samples in triplicates. after washing and rinsing 5 times, enzyme - linked reagent was applied to each well, followed by 37c incubation for 30 min. chromogenic substrate a and b were sequentially added into each well for development in the dark (10 min). the reaction was stopped by adding quenching buffer to each well. optical density (od) the spss16.0 software package was used to analyze all collected data, of which measurement data are presented as mean standard deviation (sd). resuscitated ec9706 and heec cells (atcc cell bank, usa) were thawed at 37c, followed by 1 000 rpm centrifugation for 3 min and re - suspension in 1 ml dmem medium (hyclone, us). cells were incubated in a humidified 37c chamber with 5% co2 perfusion for 24~48 h. both cell lines were then inoculated into a culture dish at 110/cm using high - glucose dmem medium containing 10% fetal bovine serum (fbs, evergreen, china), 100 u / ml penicillin, and 100 g / ml streptomycin. log - phased heec cells were used as the control group, while ec9706 cells were randomly divided into a tumor cell control group and a mir503 inhibitor group. mir-503 inhibitor oligonucleotide (5-gagcauuucggu cuggaa-3, gimma, shanghai) was mixed with 0.2 ml serum - free dmem medium and lipo2000 transfection reagent (invitrogen, usa), and was added into cultured ec9706 cells (confluence : 70~80%) for 30-min incubation. after the removal of serum and rinsing by pbs, 1.6 ml of serum - free medium was added for further 6-h incubation. trizol reagent (invitrogen, usa) was used to extract mrna from all groups. after measuring concentration and purity by ultraviolet spectrometer, total rna was used as the template for in vitro reverse - transcription using a test kit (invitrogen, us) to synthesize cdna. real - time pcr was then used to amplify the target gene using specific primers (table 1, sangon, china) under the following condition : 55c for 1 min, followed by 35 cycles each with 92c denaturing for 30 s, 58c annealing for 45 s, and 72c elongation for 35 s. using gapdh as the internal reference, fluorescent signals were quantified to determine ct values of all samples and standards. log - phased ec9706 cells were seeded into 96-well plates at 5 x 10 density in dmem medium containing 10% fbs. after 24-h incubation, 20 l of sterile mtt reagents was added into each well. four hours later, supernatants were removed, followed by the addition of 150 l dmso. the plate was shaken until complete resolving of the crystal violet. a microplate reader (bio - rad, usa) a transwell chamber (hyclone, usa) was coated with 50 mg / l matrigel dilution. after 48-h transfection, cells were incubated using serum - free medium for 24 h. the transwell chamber was put into a 24-well plate which containing 0.5 ml dmem medium (with 10% fbs). we added a 100-l suspension of tumor cells inside the chamber with serum - free medium. after 48-h incubation, the chamber was rinsed in pbs and fixed in cold ethanol. the number of cells translocated to the lower side of the membrane was counted using an inverted microscope. cytokine levels including il-2, ifn-, il-4 and il-10 were quantified by elisa using test kits (ebioscience, usa) following the manual instructions. in brief, serially diluted standard samples were added into 96-well plates, along with tested samples in triplicates. after washing and rinsing 5 times, enzyme - linked reagent was applied to each well, followed by 37c incubation for 30 min. chromogenic substrate a and b were sequentially added into each well for development in the dark (10 min). optical density (od) value at 450 nm was measured by the microplate reader within 15 min. the spss16.0 software package was used to analyze all collected data, of which measurement data are presented as mean standard deviation (sd). using real - time pcr, we found significant elevation of mir-503 expression in ec9706 esophagus carcinoma cells compared to normal heec cells (p<0.05, figure 1). mtt assay was used to describe the effect of mir-503 on the proliferation of esophagus carcinoma cells. results showed significantly depressed proliferation rate after the transfection of mir-503 inhibitor compared to the control group (p<0.05, figure 2), suggesting the participation of mir-503 in cell proliferation of ec9706. after the transfection of mir-503, the percentage of invasive cells was significantly decreased compared to controlled ec9706 cells (p<0.05, figures 3, 4). the transfection of mir-503 inhibitor significantly decreased the secretion of th1 cytokines il-2 and inf- as compared to control group (p<0.05, figure 5a, 5b), suggesting the potentiation of mir-503 in th1 cytokine secretion from esophagus carcinoma cells. opposite effects occurred when checking the level of th2 cytokines including il-4 and il-10, both of which had elevated secretion after mir-503-specific silencing (p<0.05, figure 5c, 5d). using real - time pcr, we found significant elevation of mir-503 expression in ec9706 esophagus carcinoma cells compared to normal heec cells (p<0.05, figure 1). mtt assay was used to describe the effect of mir-503 on the proliferation of esophagus carcinoma cells. results showed significantly depressed proliferation rate after the transfection of mir-503 inhibitor compared to the control group (p<0.05, figure 2), suggesting the participation of mir-503 in cell proliferation of ec9706. after the transfection of mir-503, the percentage of invasive cells was significantly decreased compared to controlled ec9706 cells (p<0.05, figures 3, 4). the transfection of mir-503 inhibitor significantly decreased the secretion of th1 cytokines il-2 and inf- as compared to control group (p<0.05, figure 5a, 5b), suggesting the potentiation of mir-503 in th1 cytokine secretion from esophagus carcinoma cells. opposite effects occurred when checking the level of th2 cytokines including il-4 and il-10, both of which had elevated secretion after mir-503-specific silencing (p<0.05, figure 5c, 5d). as one of the most common malignant tumors in china, esophagus carcinoma has relatively high invasion and recurrence rates, both of which cause unfavorable prognosis. currently available treatment against esophagus cancer, including surgical resection and chemo- and radio - therapy, can not significantly improve its 5-year recurrence rate. such difficulty, plus the insidious onset of esophagus cancer, make it an important focus in cancer research. therefore, the illustration of the biological mechanism underlying occurrence and progression of esophagus cancer may help early diagnosis and treatment of cancer, thus improving the prognosis and patient life quality. mirna is a kind of pluripotent small molecule involved in multiple cellular processes, including cell proliferation, apoptosis, signal transduction, differentiation, hormone secretion, lipid metabolism, and maintaining potency of embryonic stem cells, all of which can regulate body growth and environmental acclimation. recent studies have revealed the participation of mirna in tumor occurrence, progression, invasion, and metastasis, as well as other biological features. as a newly discovered mirna, mir-503 has been suggested to be abnormally expressed in various tumors and can be the target for regulating tumor biology. its expressional profiles, however, vary across different tumors. in hepatocellular carcinoma, mir-503 can inhibit tumor growth and proliferation via inducing g1 phase arrest. in other tumors, such as osteosarcoma and brain glioma, therefore, it is generally believed that mir-503 acts like a tumor - suppressor gene. however, in a study of esophagus carcinoma tissue, mir-503 expression was found to facilitate tumor progression, although its detailed role and mechanism in esophagus cancer has not been defined. this study demonstrated the elevation of mir-503 in esophagus carcinoma, in agreement with a previous observation. further in vivo gene silencing assay by transfecting mir-503 inhibitor into esophagus cancer cell revealed significantly inhibited cell proliferation and lowed invasion ability, suggesting the participation of mir-503 in facilitating tumor proliferation and metastasis. we also analyzed the effect of mir-503 on cytokine release from cancer cells and found decreased th1 cytokines (il-2 and ifn-) but elevated th2 cytokines (il-4 and il-10) in mir-503 inhibitor transfected cells. it has been shown that th1 sub - population of t cells mainly induce pathogenic immune response via secreting il-2 and tumor necrotic factor- (tnf-) to facilitate cell apoptosis, increased expression of adhesion molecules, and degrading normal tissues. th2 sub - type of lymphocytes, however, can inhibit th1-induced immune damage and stimulate the differentiation of b cells into plasma cells for secreting antibody and production of memory b cells, thus potentiating humoral immunity. the inhibition of mir-503 can depress proliferation and invasion ability of tumors, in addition to improving body immune function. this study suggests the potency of mir-503 as a novel molecular target for diagnosis and treatment of esophagus cancer. | backgroundmicrorna (mir) has been proved to be an important biomarker for tumors because it can regulate occurrence, progression, invasion, and metastasis of cancer. a previous study has shown the involvement of mir-503 in multiple gastrointestinal tumors. its detailed role and immune regulatory function in esophagus carcinoma, however, remains unknown. this study thus investigated the effect of mir-503 in regulating growth, proliferation, and invasion of esophagus cancer and its influence on cytokine secretion.material/methodsesophagus carcinoma cell line ec9706 and normal esophageal epithelial cell line heec were transfected with mir-503 inhibitor. mtt assay was used to quantify the cell proliferation, and a transwell chamber was used to evaluate cell invasion. release of cytokines, including interleukin-2 (il-2), il-4, il-10, and interferon- (ifn-), was measured by enzyme - linked immunosorbent assay (elisa).resultsmir-503 expression was significantly elevated in esophagus carcinoma cells (p<0.05). the specific inhibition of mir-503 expression remarkably suppressed proliferation and invasion of tumor cells. it can also down - regulated il-2 and ifn- expression and facilitate secretion of il-4 and il-10 when compared to the control group (p<0.05 in all ceases).conclusionsthe inhibition of mir-503 can effectively inhibit tumor progression and improve immune function, suggesting its potency as a novel drug target for esophagus cancer treatment. |
calculating nonsynonymous (ka) and synonymous (ks) substitution rates is of great significance in reconstructing phylogeny and understanding evolutionary dynamics of protein - coding sequences across closely related and yet diverged species 1., 2., 3.. it is known that ka and ks, or often their ratio (ka / ks), indicate neutral mutation when ka equals to ks, negative (purifying) selection when ka is less than ks, and positive (diversifying) selection when ka exceeds ks. therefore, statistics of the two variables in genes from different evolutionary lineages provides a powerful tool for quantifying molecular evolution. over the past two decades, several methods have been developed for this purpose, which can generally be classified into two classes : approximate method and maximum likelihood method. the approximate method involves three basic steps : (1) counting the numbers of synonymous and nonsynonymous sites, (2) calculating the numbers of synonymous and nonsynonymous substitutions, and (3) correcting for multiple substitutions. on the other hand, the maximum likelihood method integrates evolutionary features (reflected in nucleotide models) into codon - based models and uses the probability theory to finish all the three steps in one go (4). however, these methods adopt different substitution or mutation models based on different assumptions that take account of various sequence features, giving rise to varied estimates of evolutionary distance (5). in other words, ka and in addition, since the amount and the degree of sequence substitutions vary among datasets from diverse taxa, a single model or method may not be adequate for accurate ka and ks calculations. therefore, a model selection step, that is, to choose a best - fit model when estimating ka and ks, becomes critical for capturing appropriate evolutionary information 6., 7.. toward this end, we have applied model selection and model averaging techniques for ka and ks estimations. we use a maximum likelihood method based on a set of candidate substitution models and adopt the akaike information criterion (aic) to measure fitness between models and data. after choosing the best - fit model for calculating ka and ks, we average the parameters across the candidate models to include as many features as needed since the true model is seldom one of the candidate models in practice (8). finally, these considerations are incorporated into a software package, namely kaks_calculator. substitution models play a significant role in phylogenetic and evolutionary analyses of protein - coding sequences by integrating diverse processes of sequence evolution through various assumptions and providing approximations to datasets., 14., 15., 16. as shown in table 1 17., 18., ranging from the jukes - cantor (jc) model, which assumes that all substitutions have equal rates and equal nucleotide frequencies, to the general time - reversible (gtr) model that considers six different substitution rates and unequal nucleotide frequencies. subsequently, we incorporated the parameters in each nucleotide model into a codon - based model 19., 20.. as a result, a general formula of the substitution rate qij from any sense codon i to j (i j) is given for all candidate models (19):qij={0ifiandjdifferbymorethanonedifferencekxyjifiandjdifferbyasynonymoussubstitutionofxforykxyjifiandjdifferbyanonsynonymoussubstitutionofxforywhere j is the frequency of codon j, is the ka / ks ratio, and kxy is the ratio of rxy to rca, x, y {a, c, g, t } (table 1). for example, in the jc model, kxy and j are equal to 1 owing to equal substitution rates and equal nucleotide frequencies assumed. in the hasegawa - kishino - yano (hky) model, ktc and kag become equivalent to the transition / transversion rate ratio and j can be estimated from sequences, similar to the method reported by goldman and yang (19). therefore, we could acquire maximum likelihood scores in various values generated from individual candidate model by implementing the codon - based models in a maximum likelihood framework 19., 20.. aic (21) has been widely used in model selection aside from other methods such as the likelihood ratio test (lrt) and the bayesian information criterion (bic) (8). aic characterizes the kullback - leibler distance between a true model and an examined model, and this distance can be regarded as quantifying the information lost by approximating the true model. kaks_calculator uses a modification of aic (aicc), which takes account of sampling size (n), maximum likelihood score (lnli), and the number of parameters (ki) in model i as follows : aicci = aici+2ki(ki+1)nki1=2lnli+2ki+2ki(ki+1)nki1 aicc is proposed to correct for small sampling size, and it approaches to aic when sampling size comes to infinity. consequently, we could use this equation to compute aicc for each candidate model and then identify a model that possesses the smallest aicc, which is a sign for appropriateness between models and data. model selection is merely an approximate fit to a dataset, whereas a true evolutionary model is seldom one of the candidate models (8). therefore, an alternative way is model averaging, which assigns each candidate model a weight value and engages more than one model to estimate average parameters across models. accordingly, we first need to compute the akaike weight (wi, where i = 1, 2,, m) for each model in a set of candidate models : wi = exp[12(aicciminaicc)]j=1mexp[12(aiccjminaicc)]where min aicc is the smallest aicc value among candidate models. we can then estimate model - averaged parameters. taking ktc as an example, a model - averaged estimate can be calculated by : ktc=i=1m[wii(ktc, i)ktc, i]i=1m[wii(ktc, i)]where ktc, i is ktc in model i andi(ktc, i)={1ifrtcrcainmodeli0otherwise substitution models play a significant role in phylogenetic and evolutionary analyses of protein - coding sequences by integrating diverse processes of sequence evolution through various assumptions and providing approximations to datasets., 14., 15., 16. as shown in table 1 17., 18., ranging from the jukes - cantor (jc) model, which assumes that all substitutions have equal rates and equal nucleotide frequencies, to the general time - reversible (gtr) model that considers six different substitution rates and unequal nucleotide frequencies. subsequently, we incorporated the parameters in each nucleotide model into a codon - based model 19., 20.. as a result, a general formula of the substitution rate qij from any sense codon i to j (i j) is given for all candidate models (19):qij={0ifiandjdifferbymorethanonedifferencekxyjifiandjdifferbyasynonymoussubstitutionofxforykxyjifiandjdifferbyanonsynonymoussubstitutionofxforywhere j is the frequency of codon j, is the ka / ks ratio, and kxy is the ratio of rxy to rca, x, y {a, c, g, t } (table 1). for example, in the jc model, kxy and j are equal to 1 owing to equal substitution rates and equal nucleotide frequencies assumed. in the hasegawa - kishino - yano (hky) model, ktc and kag become equivalent to the transition / transversion rate ratio and j can be estimated from sequences, similar to the method reported by goldman and yang (19). therefore, we could acquire maximum likelihood scores in various values generated from individual candidate model by implementing the codon - based models in a maximum likelihood framework 19. aic (21) has been widely used in model selection aside from other methods such as the likelihood ratio test (lrt) and the bayesian information criterion (bic) (8). aic characterizes the kullback - leibler distance between a true model and an examined model, and this distance can be regarded as quantifying the information lost by approximating the true model. kaks_calculator uses a modification of aic (aicc), which takes account of sampling size (n), maximum likelihood score (lnli), and the number of parameters (ki) in model i as follows : aicci = aici+2ki(ki+1)nki1=2lnli+2ki+2ki(ki+1)nki1 aicc is proposed to correct for small sampling size, and it approaches to aic when sampling size comes to infinity. consequently, we could use this equation to compute aicc for each candidate model and then identify a model that possesses the smallest aicc, which is a sign for appropriateness between models and data. model selection is merely an approximate fit to a dataset, whereas a true evolutionary model is seldom one of the candidate models (8). therefore, an alternative way is model averaging, which assigns each candidate model a weight value and engages more than one model to estimate average parameters across models. accordingly, we first need to compute the akaike weight (wi, where i = 1, 2,, m) for each model in a set of candidate models : wi = exp[12(aicciminaicc)]j=1mexp[12(aiccjminaicc)]where min aicc is the smallest aicc value among candidate models. we can then estimate model - averaged parameters. taking ktc as an example, a model - averaged estimate can be calculated by : ktc=i=1m[wii(ktc, i)ktc, i]i=1m[wii(ktc, i)]where ktc, i is ktc in model i andi(ktc, i)={1ifrtcrcainmodeli0otherwise kaks_calculator is written in standard c++ language. it is readily compiled and run on unix / linux or workstation (tested on aix / irix / solaris). in addition, we use visual c++ 6.0 for graphic user interface and provide its windows version that can run on any ibm compatible computer under windows operating system (tested on windows 2000/xp). compiled executables on aix / irix / solaris and setup application on windows, as well as source codes, example data, instructions for installation and documentation for kaks_calculator is available at http://evolution.genomics.org.cn/software.htm., kaks_calculator employs model - selected and model - averaged methods based on a set of candidate models to estimate ka and ks. it integrates as many features as needed from sequence data and in most cases gives rise to more reliable evolutionary information (see the comparative results on simulated sequences at http://evolution.genomics.org.cn/doc/simulatedresults.xls) (24). kaks_calculator also provides comprehensive information estimated from compared sequences, including the numbers of synonymous and nonsynonymous sites and substitutions, gc contents, maximum likelihood scores, and aicc., 25., 26., 27., 28., 29., 30., 31. and allows users to choose one or more methods at one running time (table 2). although there exist 203 time - reversible models of nucleotide substitution (8), model selection in practice is often limited to a subset of them (32), and thus model averaging can reduce biases arising from model selection. therefore, model - averaged methods should be preferred for general calculations of ka and ks. some planned improvements include application of model selection and model averaging to detect positive selection at single amino acid sites, which requires high - speed computing for maximum likelihood estimation, especially when an adopted model becomes complex. in conclusion, kaks_calculator incorporates as many features as needed for accurately extracting evolutionary information through model selection and model averaging, therefore it may be useful for in - depth studies on phylogeny and molecular evolution. zz designed and programmed this software, and drafted the manuscript. jl carried out computer simulations to generate sequences. | kaks_calculator is a software package that calculates nonsynonymous (ka) and synonymous (ks) substitution rates through model selection and model averaging. since existing methods for this estimation adopt their specific mutation (substitution) models that consider different evolutionary features, leading to diverse estimates, kaks_calculator implements a set of candidate models in a maximum likelihood framework and adopts the akaike information criterion to measure fitness between models and data, aiming to include as many features as needed for accurately capturing evolutionary information in protein - coding sequences. in addition, several existing methods for calculating ka and ks are also incorporated into this software. kaks_calculator, including source codes, compiled executables, and documentation, is freely available for academic use at http://evolution.genomics.org.cn/software.htm. |
cancer remains a major problem worldwide with 12.7 million new cases diagnosed in 2008. in the uk alone, 331,000 people were diagnosed with cancer in 2011. despite major advances in detection and treatment of cancer as well as the introduction of several cancer screening programmes, outcomes following cancer remain poor with only half of people diagnosed with cancer surviving at 5 years. allocation of patients to the correct form of treatment, be that surgical, oncological, or palliative, remains a difficult decision. however, if patients were allocated to the most appropriate treatment, then outcomes for all patients would improve, irrespective of new, more effective treatments. traditionally, in those with early stage operable disease the treatment decision has been made largely based on staging of the cancer itself for example the tumour, node, metastasis (tnm) staging system whereas in advanced stage inoperable disease the treatment decision has been made largely based on the general health and fitness and whether the patient had lost weight (cachexia). in the last decade or so it has become apparent that a host inflammatory response, in particular the systemic inflammatory response, plays a key role in determining cachexia and the survival of patients with cancer [2, 3 ]. with this new knowledge, a number of prognostic scoring systems that provide an objective measurement of the systemic inflammatory response have been developed and have been shown to have prognostic value in patients with cancer. these include the glasgow prognostic score / modified glasgow prognostic score (gps / mgps), neutrophil - lymphocyte ratio (nlr), platelet - lymphocyte ratio (plr), white cell - lymphocyte ratio (wlr), and others [4, 5 ]. the mgps (combination of the values of preoperative serum albumin and c - reactive protein) and the nlr (ratio of neutrophil and lymphocyte counts) are the most widely reported prognostic scores worldwide and both have been shown to have prognostic value in a variety of common solid tumours [68 ]. for example, by the end of 2012, the gps / mgps had been shown to have independent prognostic value in cancer patients in 51 studies involving 28,500 patients. furthermore, the nlr has been shown to have independent prognostic value in 100 studies involving greater than 40 000 patients, with greater than 50% of these studies published since the start of 2012. despite the plethora of reported studies for these prognostic scores, their value in routine clinical practice either as tools to stratify patients in terms of outcomes or for consideration for therapies such as adjuvant chemotherapy or in clinical trials is not clear. with this in mind, the aim of the present survey, in an international cohort, was to examine the range of opinions on the routine use of systemic inflammation based prognostic scoring systems and their potential incorporation into clinical guidelines. a worldwide survey designed to establish opinions on the use of systemic inflammation based prognostic scoring systems was created. this was a web - based survey that included 10 questions on systemic inflammation based prognostic scores in cancer as follows. survey questions what is your discipline (surgeon / oncologist / pathologist, etc.) and in which country are you based?do you or your colleagues routinely assess the systemic inflammatory response as part of the clinical assessment of patients with cancer ? since 2008, could you estimate how many patients have been assessed (a) in total and (b) per year ? if you answered yes to question (2), for what purpose ? audit prognostication treatment allocation research if you answered yes to question (2), what measure of the systemic inflammatory response do you use ? gps nlr other would you use a measure of the systemic inflammatory response to stratify patients entering into clinical trials?if you answered yes to question (5), which would you prefer to use ? gps nlr other in which clinical scenario do you think a measure of the systemic inflammatory response offers most benefit to patients ? in making decisions about allocation of surgical treatment for primary operable disease in making decisions on allocation of neoadjuvant treatment in making decisions on allocation of adjuvant treatment in making decisions on palliative chemotherapy do you think that a measure of the systemic inflammatory response should be adopted into clinical guidelines?if yes, which would you prefer to use ? gps nlr other if you do not think that a measure of the systemic inflammatory response is useful in the routine clinical assessment of cancer patients, please comment.the survey was generated through the surveymonkey website (http://www.surveymonkey.com/, surveymonkey, paulo alto, usa) and the access link emailed to the target group. the target group was selected primarily from two recent reviews [6, 7 ] and by performing a more recent literature search for articles using the keywords cancer, inflammation, recurrence, survival, mgps, and nlr. once a comprehensive list of articles was obtained, the email addresses of corresponding authors from each article formed the basis of a mailing list for distribution. the email sent out clearly stated that the aim of the survey was to establish whether there was a role for the application of systemic inflammation based prognostic scores in routine clinical practice and research and that participation was voluntary. software on the website ensured duplication of responses from the same individual was not recorded. what is your discipline (surgeon / oncologist / pathologist, etc.) and in which country are you based ? do you or your colleagues routinely assess the systemic inflammatory response as part of the clinical assessment of patients with cancer ? since 2008, could you estimate how many patients have been assessed (a) in total and (b) per year ? since 2008, could you estimate how many patients have been assessed (a) in total and (b) per year ? if you answered yes to question (2), for what purpose ? audit prognostication treatment allocation research if you answered yes to question (2), what measure of the systemic inflammatory response do you use ? would you use a measure of the systemic inflammatory response to stratify patients entering into clinical trials ? if you answered yes to question (5), which would you prefer to use ? in which clinical scenario do you think a measure of the systemic inflammatory response offers most benefit to patients ? in making decisions about allocation of surgical treatment for primary operable disease in making decisions on allocation of neoadjuvant treatment in making decisions on allocation of adjuvant treatment in making decisions on palliative chemotherapy in making decisions about allocation of surgical treatment for primary operable disease in making decisions on allocation of neoadjuvant treatment in making decisions on allocation of adjuvant treatment in making decisions on palliative chemotherapy do you think that a measure of the systemic inflammatory response should be adopted into clinical guidelines ? if yes, which would you prefer to use ? if you do not think that a measure of the systemic inflammatory response is useful in the routine clinical assessment of cancer patients, please comment. the survey was first sent out on 26th february 2014 with a reminder sent out one week later. the survey remained open for 4 weeks and was closed on the 26th march 2014. data was analysed and graphs of results were compiled using microsoft excel 2007 (redmond, wa, usa). in february 2014, the survey was emailed to 238 individuals worldwide who had published articles related to systemic inflammation in patients with cancer. 43% were from asia, 42% from europe, 12% from america, and 3% from australia. the response to survey question (1) is shown in figures 1(a) and 1(b). in total 26 respondents (43%) were surgeons, 15 (25%) oncologists, and 19 (32%) from other medical specialties. the proportion of respondents is shown in figure 1(b) with 55% of respondents being from europe, 29% from asia, 13% from americas, and 3% from australia. in response to question (2), 39 (65%) of the respondents answered yes that they routinely measured the systemic inflammatory response in patients with cancer. the median number of patients each participant assessed per year was 100 and the median number of patients each participant assessed in total was 330. of the respondents, 11 (27%) reported its use for the purpose of prognostication and research, 11 (27%) reported its use for research purposes alone, 5 (12%) reported its use for the purpose of prognostication alone, 4 (10%) reported its use for audit purposes, and 3 (8%) reported its use for the purpose of treatment allocation. the response to question (4) is shown in figure 3. of those who responded, 16 (40%) answered that the measure of the systemic inflammatory response they used was the gps, 8 (20%) the gps / nlr, and 6 (15%) the nlr alone. the response to question (5) of the respondents, 31 (56%) answered yes they would use a measure of the systemic inflammatory response to stratify patients entering clinical trials. of the respondents, 20 (57%) answered that they would use the gps, 4 (11%) the nlr, and 4 (11%) the gps / nlr for stratifying patients entering clinical trials. of the respondents, 12 (25%) reported that the clinical scenarios where a measure of the systemic inflammatory response offers most benefit were making decisions on palliative chemotherapy, 10 (21%) making decisions on allocation of adjuvant therapy, 6 (12%) making decisions about either adjuvant therapy or palliative chemotherapy, and 5 (10%) all 4 categories. only 2 (4%) reported on making decisions on allocation of surgical treatment. the response to question (8) is shown in figure 6(a). of the respondents, 46 (81%) answered yes to whether a measure of the systemic inflammatory response should be adopted into clinical guidelines. the response to question (9) is shown in figure 6(b). of those who responded, 30 (60%) answered that the measure of the systemic inflammatory response they would prefer to use in clinical guidelines was the gps, 7 (14%) gps / nlr, and 5 (10%) nlr. the results of the present study showed that the majority of respondents routinely measured the systemic inflammatory response and used the gps / mgps, mainly for research and prognostication purposes and that the majority of respondents reported that a measure of the systemic inflammatory response should be adopted into clinical guidelines. a small number of people responded to our survey (25%) although this rate falls within the average response rate of between 20 and 30%. factors that are known to improve the survey response rate include incentives, reduced survey length, reduced complexity of questions, and reminder emails. in the present study the questions were intentionally simple and limited to 10 in total and a reminder email was sent to encourage respondents but did not employ any incentive for completing the survey. the survey was sent to potential participants worldwide with the majority to asia and europe. the majority of respondents of this survey were surgeons (43%) with oncologists making up a quarter of respondents. the location of the respondents did not closely match the locations of the potential survey participants. those invited to participate were mainly from asia and europe ; however, only 29% of respondents were from asia while 55% were from europe. perhaps this lack of response from asia is due to cultural differences which were not present in those from europe or due to greater language barriers. whatever the reason, the poor response rate from asia was disappointing given that the majority of work using these prognostic scores has been carried out in europe and asia. in the present study, respondents were asked to estimate how many patients with cancer they had assessed using these systemic inflammation based scores in each year. the response was approximately 100 per year. with this volume of work it could be considered that those who responded were specialists and had an interest in systemic inflammation based scores. it has been widely reported that markers of the systemic inflammatory response are good prognostic markers in patients with cancer. the majority of survey respondents reported that they routinely assessed the systemic inflammatory response in patients with cancer and the majority used this assessment for research or prognostication purposes. this is not unexpected since the majority of studies examining these scoring systems were performed for research purposes or were performed retrospectively to aid prognostication of patients into high and low risk groups. whilst crp has been shown to have prognostic value in a number of tumours, the mgps, which utilises a combination of crp and albumin at standard thresholds, has been shown to have superior prognostic value and obviates the problem of different crp threshold values being used within and across different tumour types. in the present study, the majority of respondents reported that they would use gps / mgps as their method of assessing the systemic inflammatory response. this would appear to be consistent with the literature and whilst the participants of this survey have an interest in this field, it was not clear, prior to this survey, what views they had on the clinical application of systemic inflammation based prognostic scores, in particular which, if any, score that they would prefer to use clinically. interestingly, only a small number of respondents reported that they used assessment of the systemic inflammatory response to determine treatment allocation and this is an area where proponents of these scoring systems would hope to expand their use in order to better stratify patients to appropriate treatment modalities. of the survey respondents, 56% reported that they would use a measure of the systemic inflammatory response to stratify patients entering into clinical trials and 57% said they would choose mgps / gps for this. moreover, of the survey respondents, 25% reported that these scores were used in making decisions about palliative chemotherapy, 21% in making decisions about allocation of adjuvant therapy, and 12% in making decisions either about adjuvant therapy or palliative chemotherapy. only 4% reported that a measure of the systemic inflammatory response would be of benefit in making decisions about allocation of surgical treatment. this is of interest as the majority of respondents were surgeons, with the majority of research in these scoring systems having been undertaken by surgeons, yet the consensus was that it would not be of benefit to allocate surgical treatment based on these scoring systems.. however it may be that surgeons wish to operate on all patients with potentially curable disease. it remains to be seen whether this approach will be maintained in the long term, particularly in aggressive cancers such as pancreatic cancer where neoadjuvant therapy is increasingly used as first line therapy. furthermore, recent work has suggested that markers of the systemic inflammatory response may be useful as a therapeutic target. the recent addition of an antiangiogenic monoclonal antibody to vegf therapy, such as bevacizumab to standard chemotherapy regimens, has resulted in improved efficacy of these regimens. however, recent studies have reported that patients with a raised neutrophil count, high nlr or mgps 1 or 2, received no significant survival benefit from these regimens [1214 ]. in addition, botta and colleagues reported in their study that preoperative systemic inflammatory status was a marker of resistance to bevacizumab therapy. also, recent hurwitz. recently reported that ruxolitinib (a janus kinase 1 (jak1)/janus kinase 2 (jak2) inhibitor) along with capecitabine improved overall survival and progression free survival in patients with metastatic pancreatic cancer with inflammation characterised by mgps 1 or 2. of the survey respondents, 80% reported that they felt that a measure of the systemic inflammatory response should be adopted into clinical guidelines and 60% reported that gps / mgps would be their preference. for example, cancer cachexia affects greater than 50% of patients with advanced disease and its clinical definition and symptoms have been intensively discussed in recent years [16, 17 ]. recently, the european school of oncology task force conducted a review of the literature on cancer cachexia. they concluded that cachexia is a complex process but that, along with anorexia, the presence of a systemic inflammatory response results in the features of the disease. furthermore, douglas and mcmillan (2014) recently proposed that the mgps be used as the basis for formation of an objective and clinically relevant definition of cachexia. the findings of the present study would appear to confirm that the mgps is the most commonly used systemic inflammation based score and therefore appropriate for forming the basis of an objective definition of cancer cachexia. firstly, respondents did not have to enter their location in order to complete the questionnaire, meaning the location for all the respondents was not obtained. in all surveys there is a tension between making the sample size as large as possible in order to eliminate bias and asking questions appropriate to those surveyed. in the present survey, we targeted those with a known interest in systemic inflammation based prognostic scores (those who had already published in this field) in order to maximise the number of appropriate and meaningful responses. the mgps and nlr are the most popular scores as they have the largest evidence base. although other systemic inflammation based prognostic scores such as the derived nlr (dnlr), lymphocyte monocyte ratio (lmr), and platelet - lymphocyte ratio (plr) have been reported, they have not established a sufficient body of evidence in the literature. moreover, where they have been directly compared, the mgps had the greatest prognostic value in patients with cancer, independent of age, sex, deprivation, and tumour stage [4, 18 ]. therefore, it is likely that the results of this survey reflect the reality of attitudes towards the application of these scores in those individuals with an interest in the field. indeed, it is recognised that surgeons are key members of the multidisciplinary team (mdt) that decides treatment allocation. irrespectively, this would confirm that the survey was directed at clinicians in routine clinical practice. in summary, the present study has shown that, in those who responded, the majority routinely measured the systemic inflammatory response in patients with cancer, with the majority using the gps / mgps, mainly for research and prognostication purposes. the majority reported that these scoring systems were of most clinical benefit in making decisions on adjuvant therapy and palliative chemotherapy and that the systemic inflammatory response, as evidenced by the gps / mgps, should be adopted into clinical guidelines, such as a new, objective and clinically relevant definition of cancer cachexia. | introduction. the systemic inflammatory response (sir) plays a key role in determining nutritional status and survival of patients with cancer. a number of objective scoring systems have been shown to have prognostic value ; however, their application in routine clinical practice is not clear. the aim of the present survey was to examine the range of opinions internationally on the routine use of these scoring systems. methods. an online survey was distributed to a target group consisting of individuals worldwide who have reported an interest in systemic inflammation in patients with cancer. results. of those invited by the survey (n = 238), 65% routinely measured the sir, mainly for research and prognostication purposes and clinically for allocation of adjuvant therapy or palliative chemotherapy. 40% reported that they currently used the glasgow prognostic score / modified glasgow prognostic score (gps / mgps) and 81% reported that a measure of systemic inflammation should be incorporated into clinical guidelines, such as the definition of cachexia. conclusions. the majority of respondents routinely measured the sir in patients with cancer, mainly using the gps / mgps for research and prognostication purposes. the majority reported that a measure of the sir should be adopted into clinical guidelines. |
glucose transport protein type 1 (glut1) delivers glucose to the brain from bloodstream and is therefore crucial for an adequate energy provision. glut1 deficiency syndrome, inducing a chronic brain energy failure, is caused by mutations of the solute carrier family 2 (facilitated glucose transporter) member 1 (slc2a1) gene, located on the chromosome 1p34.2. the classic phenotype of glut1 deficiency syndrome is characterized by : mild to severe motor delay and mental retardation ; infantile - onset epilepsy ; head growth deceleration, possibly resulting in acquired microcephaly ; movement disorders (ataxia, dystonia, spasticity) ; and non - epileptic paroxysmal events (intermittent ataxia, periodic confusion, recurrent headaches). reported features of epilepsy in this condition are heterogeneous ; generalized tonic - clonic and absence seizures prevail. lumbar puncture shows hypoglycorrhachia, with a reduced cerebrospinal fluid / blood glucose ratio in most patients. the ketogenic diet has proved to markedly improve epilepsy, movement disorders and head growth, while the cognitive effects are less pronounced. the patient 's family history was positive for : a not better specified psychiatric disorder and somnambulism in the mother ; epilepsy and mental retardation, in a paternal uncle and a paternal cousin, respectively. he was an only child, born at the 36 week of gestation by caesarean section due to hypertensive gestosis, after a two - placenta twin pregnancy, with the intrauterine death of the other fetus. apgar index was 7 (1) and 8 (5) ; birth weight was 3040 grams. cyanosis and jaundice at the birth were reported ; jaundice was treated by phototherapy and exsanguinotransfusion. at the age of 4 years 1 month, eeg tracing during wakefulness, performed due to the psychomotor retardation, was normal. from the age of about 4 years he has suffered from headache several times monthly, sometimes associated with nausea and vomiting, treated with paracetamol. at the age of about 6 years, he started to present, especially in the morning, short but frequent (even several times a day) episodes of loss of consciousness, eye closure, inconstant eyelid myoclonia. the events could occur isolated or close together resulting in falling asleep but showing amelioration on awakening. the drowsiness associated with the long clusters of these events was a major problem in his everyday life, especially at school. neurological examination showed only a mild, aspecific incoordination ; head circumference corresponded to the fiftieth percentile. neuropsychological evaluation showed a mild mental retardation (wechsler scale), stable during the follow - up, with a significant prevalence of verbal intelligence quotient (iq) versus performance iq ; an aspecific learning disorder was evident. eeg revealed diffuse paroxysmal abnormalities and several brief absence seizures have been recorded [figures 1 and 2 ]. high - resolution kariotype and search for fragile x syndrome were normal, as well as a metabolic screening including creatine kinase, lactic acid at baseline and after exercise, thyroid hormones, tests for celiac disease, ammonia, serum and urinary aminoacids, and urinary oligosaccharides. absence seizures were drug resistant to ethosuximide, levetiracetam, lamotrigine, and valproate, with only transient improvements after beginning a drug. after antiepileptic therapy start, we found episodic, mild postural and tremor - like action dyskinesias in the arms. at the age of 15 years, mainly due to the drug - resistant absence seizures, we performed the molecular analysis of the slc2a1 gene. the polymerase chain reaction sequencing of all exons revealed a nucleotide deletion in heterozygosity, c.1336_1338del, causing the loss of one amino acid (isoleucine : p.ile446del). we chose not to give the lumbar puncture to avoid causing the patient excessive discomfort. a ketogenic diet was started and we noted a fast, marked clinical improvement. the boy became more responsive and active, while absence seizures and headache frequency decreased. however, patient 's compliance with the prescribed dietary regimen was so poor that after 1 year we decided to stop the diet. only a few days after the discontinuation, the boy showed clinical worsening, which made him willing to resume the diet. eeg recording, at the age of 14 years, showing diffuse bilateral and frontal dominant spike and wave discharges during wakefulness : open eyes on the left, closed eyes on the right eeg recording, at the age of 14 years, showing diffuse bilateral spikes and waves during hyperpnea, once associated (see arrows) with a brief absence seizure a constant supply of glucose is the most important source of energy for the brain. therefore, glut1 deficiency syndrome could be considered as a brain energy failure prototype. during last years also the three following clinical pictures have been described : (a) carbohydrate - responsive phenotype, characterized by clinical worsening (motor and mental performance, seizures) with fasting and improvement with carbohydrate intake ; (b) movement disorder without epilepsy, characterized by ataxia, dystonia, spasticity, mild delay of motor and mental development, normal or decelerated head growth ; (c) paroxysmal exertion - induced dyskinesias (dystonia, choreoathetosis, ballism) and epilepsy. the case we have described shows an atypical phenotype of glut1 deficiency syndrome. no movement disorders were present (except for slight tremor after antiepileptic therapy start, probably a side effect of antiepileptic drugs), nor decrease of head circumference has been detected. the phenotype of our patient does not fully fit in any of the clinical pictures described so far in association with glut1 deficiency. in 2010, leen. reported 10 cases with the so - called late - onset classical phenotype, but only in one of them movement disorders were absent and the reported features of seizures were different compared to those of our patient. it is true that epilepsy with the absence seizures is among those most frequently described in glut1 deficiency syndrome, but more often it has an early onset (before the age of 4), while in the forms with later onset, as in our patient, the combination of drug - resistant absence seizures (without other types of seizures) and mental retardation, present in the case we have reported, has not been described. considering the findings of our patient 's eeg (initially normal, then clearly pathological), our data confirm what pong. stated, namely that in the same individual, affected by this disorder, eeg picture could change over time. our case report suggests that, in the lack of a better definition of the possible phenotypes associated with glut1 deficiency, there is a risk of underestimating the actual occurrence of the disease. especially because of the atypical phenotypes, this fact has important implications also for the treatment, because a ketogenic diet, that should begin as soon as possible, could significantly improve the quality of life of these patients, while classic antiepileptic drugs usually fail. in fact, a high - fat diet leads to the production of ketone bodies bypassing the glut1 deficiency and providing an alternative source of energy to the brain. incidentally, we emphasize that the exact pathogenetic mechanism of the formation of cataracts, also present in our patient, is currently unknown. in conclusion, it is recommended to consider this diagnostic hypothesis in any case with an unexplained neurological disorder, also when, as in our case, a main clinical feature consists of drug - resistant seizures associated with a global developmental delay, even in the lack of a movement disorder, according to klepper suggestions. | the glucose transport protein type 1 (glut1) deficit causes a chronic brain energy failure. the classic phenotype of glut1 deficiency syndrome is characterized by : mild to severe motor delay and mental retardation ; infantile - onset epilepsy ; head growth deceleration ; movement disorders (ataxia, dystonia, spasticity) ; and non - epileptic paroxysmal events (intermittent ataxia, periodic confusion, recurrent headaches). during last years the classic phenotype of this syndrome, as originally reported, has expanded. we report the atypical phenotype of a boy with glut1 deficiency syndrome, characterized by mild mental retardation and drug - resistant absence seizures with onset at the age of 6 years, without movement disorders nor decrease of head circumference. a prompt diagnosis of this disorder is mandatory since the ketogenic diet might represent an effective treatment. |
a maxillary sinus lift procedure is an established method used to provide a sufficient bone volume for implant placement in patients with a severely atrophied posterior maxilla [1 - 3 ]. the use of autogenous bone in sinus augmentation is believed to be a superior method because of the reproducible healing mechanism of osteogenesis, osteoinduction, and osteoconduction. however, some important disadvantages, such as the need for additional surgical sites, the associated morbidity, and the rapid resorption rate when autogenous bone is used as a sinus grafting material [4 - 6 ], have led many surgeons to use other materials including derived bovine bone. graft materials consisting of deproteinized, sterilized, bovine bone, are reported by several studies to be osteoconductive and well integrated in the host site with very low resorbability [9 - 18 ]. recently, a highly purified, bovine bone derived graft (laddec) has been introduced to clinicians for its innovative features. it is a xenograft consisting of deproteinized, sterilized bovine bone, characterized by the preservation of a collagen type i matrix, associated with spindle - shaped hydroxyapatite crystals. unlike other commercially available bovine derived biomaterials in which all the organic phase is chemically removed using ethylene diamine treatment and heating, followed by extensive washing and heating below 600 c (u.s. patent 5,167,961), laddec is obtained from bovine bone after extensive washing with distilled water and a phosphate buffer (0.4 m, ph 7.4), followed by defatting at a temperature < 50 c with ethanol / dichloromethane and proteoglycan removal by urea and mercaptoethanol (international patent : pct / wo/91/07194). this process has previously been shown to preserve the collagen type i fibres in the matrix of the xenograft, which seem to play a crucial role in cell attachment, as well as the spreading and orientation of osteoblasts, as collagen type i can bind osteoblasts via specific cell surface receptors, the integrins. in addition to the maintenance of the collagen fibres, laddec presents physical characteristics very similar to human cancellous bone, with an average thickness of trabecules of 164.8 (35.1) m, an intertrabecular separation (porosity) of 342.9 (105.6) m, and 2 (0.4) trabecules per mm. preclinical studies have already shown the capacity of laddec to stimulate osteoblastic activity, facilitating the formation of multiple cell layers, and to increase the expression of alkaline phosphatase in mesenchymal cell cultures [20 - 22 ]. furthermore, subsequent clinical and histological studies in humans indicated that the processing methodology of laddec is safe, as the biomaterial does not induce laddec immunologic response, and it represents a reliable option in oral and maxillofacial surgery procedures. the aim of this study was to evaluate the clinical, radiographic and histologic results when highly purified xenogenic bone (laddec) was used as a grafting material in maxillary sinuses. fifteen patients (8 males and 7 females, aged from 48 to 66 years, with a mean of 58 [5.2 ] years), with a severely atrophied posterior maxilla, participated in this study. this study used a retrospective clinical database of information about patients who were previously treated as part of an approved research protocol (university ethical committee approbation # 7413). all patients signed a written informed consensus, and the study was conducted according to the principles of the declaration of helsinki on experimentation involving human subjects. inclusion criteria were : 1) presence of maxillary partial edentulism involving the premolar / molar areas ; 2) the presence of a residual alveolar ridge height less than 5 mm ; 3) patients in which primary implant stability could not be established. exclusion criteria were : 1) smoking more than 10 cigarettes / day ; 2) systemic diseases or maxillary sinus pathology ; 3) recent extractions in the involved area. a thorough preoperative evaluation, including the studying the mounted diagnostic cast and diagnostic wax - up, was performed. preoperative medications included amoxicillin, and 1 g twice a day of clavulanic acid (neoduplamox, procter & gamble), starting 1 day prior to surgery and continuing until 8 days post - surgery. patients were asked to rinse with 0.2% chlorhexidine gluconate at the surgery and twice a day for 14 days after the procedure. under local anaesthesia, a crestal incision was made slightly toward the palatal aspect and throughout the entire length of the edentulous segment, supplemented by buccal releasing incisions mesially and distally. full thickness flaps were elevated to expose the alveolar crest and the lateral wall of the maxillary sinus (figure 1). using a round burr under cold (4 - 5 c) sterile saline irrigation, the door was rotated inward and upward with a top hinge to a horizontal position (figure 3). the sinus membrane was lifted with elevator instruments of different shapes until it became completely detached from the lateral and inferior walls of the sinus. small tears in the membrane were covered with a cross - linked collagen membrane (mem - lok, biohorizons, birmingam, alabama, usa), before graft placement to avoid the possible complication of sinusitis from the migration of granules towards the middle meatus with its obstruction. full thickness flap elevated to expose the alveolar crest and the lateral wall of the maxillary sinus. a trap door made in the lateral sinus wall. the door was rotated inward and upward with a top hinge to a horizontal position. the laddec (biohorizons, birmingam, alabama, usa) particles were mixed with sterile saline solution and carefully packed in the sinus cavity using a plugger (figure 4). the quantity of laddec needed for each augmentation varied from 3 to 5 g. a membrane (mem - lok, biohorizons, birmingam, alabama, usa) was positioned against the packed sinus window and was folded over (figure 5). the mucoperiosteal flap was then replaced and sutured with multiple horizontal mattress sutures (figure 6). the laddec particles mixed with sterile saline solution and carefully packed in the sinus cavity. a cross - linked collagen membrane positioned against the packed sinus window and folded over. the mucoperiosteal flap replaced and sutured with multiple sutures. the sinus was allowed to heal for 6 months, and then laser - lok biohorizons implants (biohorizons, birmingam, alabama, usa) were placed. radiographic analysis radiographic analysis was performed using intraoral radiographs and computerized tomography (figures 8 and 9). at least 3 computerized topographies were taken, one immediately before and one after the sinus augmentation, and another one up to 3 years after the surgery. the linear measurements taken from radiographs were described below. preoperative computerized tomography. the original alveolar bone heights prior to the surgery, from the alveolar crest to the base of the sinus, were measured. the augmented sinus heights (ash) were measured from the 1 bone to implant contact points to the base of the maxillary sinus, which had been elevated with laddec at the mesial and distal aspects of the implants. the marginal bone loss (mbl) was determined by comparing the intraoral radiographs immediately taken after the surgery and up to 3 years after implant loading. the reduced height of laddec (rdl) was calculated based on the changes in the ash and mbl. at time of the implant surgery, bone cores were harvested using a 3.5 x 10 mm diameter trephine under cold (4 - 5 c) sterile saline solution irrigation. the bone specimens were immediately fixed in 10% buffered formalin and embedded in a glycolmethacrylate resin. after polymerization, specimens were sectioned along their longitudinal axis to a thickness of 70 microns (laddec plastic microtome, rm 2265). slides were stained with trichrome, methilyne blue, and von kossa (figure 10). the histomorphometry was performed using bioquant image analysis software (r&m biometrics, nashville, tn, usa) and images were captured with a q - imaging camera, 32 - 0013b-157, retiga, colour 12-bit (figures 11 and 12). bone core specimens. a = trichrome stain ; b = von kossa stain ; c = methylene blue and basic fuschin stain.. trichrome stain of the osteoid rim and graft material. a = original magnification x20 ; b = original magnification x100. red osteoid rim (yellow arrows) green viable bone (blue arrows) and graft material (red arrows). red osteoid rim (yellow arrows) green viable bone (blue arrows) and graft material (red arrows). differences in rdl according to the timing of implantation were analysed using an independent t - test. a one - way analysis of variance was used to evaluate the differences in rdl according to the implant sites. correlation between the rdl and follow - up period were determined by spearman s test. one of the 42 implants was removed between implantation and the follow - up period. the 0 to 6 month cumulative implant survival rate was 97.6 %, and this value continued to 36 months. the mean follow - up period for implants after the sinus augmentation was 28.4 (3.2) months (range 24 to 36 months). the original sinus height was a mean of 3.65 (0.7) mm (range 1.4 to 4.6 mm) and the augmented sinus height was a mean of 13.8 (2.4) mm (range 9.5 to 16.7 mm) after the surgery. the mean implant marginal bone loss up to 30 months after loading was 0.38 (0.24) mm. the rdl 1 year postoperatively was 0.83 (0.38) mm, and at 3 years postoperatively was 0.91 (0.25) mm. no significant correlation was noted between the rdl and follow - up periods by spearman s test (p = 0.118). in addition, no significant difference in the rdl was observed according to the site of implantation (p = 0.682). histologic and histomorphometric results microscopic examination of all the processed bone core specimens showed newly formed bone, in close contact with the xenogenic graft particles. most of the graft particles were surrounded by newly formed bone, and in some areas, the graft particles were in contact with marrow spaces. the presence of non - mineralized matrix (osteoid seam) was also observed at the interface with the xenograft, which was strongly stained by von kossa ; the osteoid was surfaced by a rim of osteoblasts (figures 11 and 12). the newly formed bone abutting the graft particles showed well - organized lamellae, and numerous lacunae with osteocytes. histomorphometric analysis showed the bone cores were composed of 64.72 (3.44)% newly formed bone, 17.41 (2.02)% connective tissue, 16.93 (2.83)% residual graft particles, and 0.94 (0.11)% inflammatory cells. histomorphometric mean data are reported in table l. histomorphometric mean data of bone core specimens sd = standard deviation ; tt. technological evolution and better understanding of bone - healing biology have helped to clarify the optimum makeup of xenogenic bone substitute, including the source, preparation methods, and particle size, in order to improve their osteoconductive potential. when associated with the refinement of the sinus lift surgical technique occurred in recent years, this allows for predictable placement of implants in atrophic maxillae bone regenerated with xenografts. in the present study, the survival rate of implants placed after a sinus augmentation procedure was 97.6 %, which is comparable with the pre - existing literature data [25,27 - 29 ] despite the small sample size. in addition, radiographic evaluation showed the graft material, was well maintained in the sinus and only decreased slightly over a 3 year period, demonstrating that laddec is a clinically suitable material for sinus augmentation. despite the clinical success of xenogenic graft materials, the purpose of our histologic and histomorphometric evaluation is to understand the interactions that occur between the bone and the graft. in all the histological sections examined in the present study, this indicates that the processing methodology of laddec is safe, as the biomaterial does not induce adverse immunologic response. in addition, the regenerated bone has shown that laddec, is mostly reabsorbed after 6 months, replaced by vital bone, and the residual xenograft particles are integrated to vital bone. histological analysis showed the bone cores were composed of 64.72 (3.44)% newly formed bone, 17.41 (2.02)% connective tissue, 16.93 (2.83)% residual graft particles, and 0.94 (0.11)% inflammatory cells. the 16.93% residual graft particles indicate that, after 6 months, the graft material is almost all reabsorbed and replaced by newly regenerated bone. these data are particularly significant because it is known that to maintain the osseointegration of the implant over the time, a presence of reactive tissue able to undergo a sustained state of remodelling is needed. several studies have suggested that differing methods of xenograft preparation can cause differences in efficacy and in reabsorption time. orsini. reported that bovine bone derived graft material in which all the organic phase is chemically removed (bio - oss) after 6 months does not show signs of resorption. same authors reported identical histological results also for porcine derived bone substitute with no evidence at 6 months of biomaterial resorption. in our opinion, the differences between the histologic results of the present study and those reported by these other studies might be related to the specific chemical / physical features of the graft materials, and the events occurring after biomaterial implantation. when a graft material is implanted in bone, the healing process is characterized by two phases : 1) the response of the host to the biomaterial ; and 2) the behaviour of the material in the host. a non - specific action occurs in the first phase : a blood clot is formed in the injured area where the outer area of the local bone becomes necrotic, the capillaries start to develop, and migration of inflammatory cells e.g. lymphocytes, granulocytes and monocytes occurs. these actions restore blood flow, activate an inflammatory response after 1 - 3 days, and start to form granulation tissue. the granulation tissue will mature to a collagen matrix and mesenchymal stem cells begin to differentiate into osteoblasts cells. a more specific action occurs during the second phase depending on the ability of osteoblastic cells to migrate into the biomaterial and on the relationships they establish between their membrane and the biomaterial surface. adhesion, proliferation, migration, and differentiation of mesenchymal stem cells at the surface of grafted materials are related to the ability of membrane receptors to bind molecules of the extracellular matrix. among the membrane receptors, integrins are transmembrane heterodimer proteins known to play a key role in the cellular adhesion [39 - 41 ]. in bone, the b1-integrin subunit specifically, the b1-subunit is involved in adhesion of osteoblasts to collagen type i and is supposed to play a role in osteoblast morphology. previous in vitro studies highlighted the importance of preserving the collagen matrix in the xenograft material. comparing two different types of bovine derived bone graft materials, with similar architectural organization, morphological surface topography and roughness index, but with different chemical composition of their matrices, (laddec characterized by preservation of the mineralized collagen matrix, and bio - oss, characterized by complete deproteinization which only preserves the mineral phase), bals. reported that osteoblast - like cells cultured at the surface of the two bone xenogenic biomaterials have their orientation mainly influenced by the chemical nature of the underlying surface. at the surface of the collagen - containing matrix (laddec), cells exhibited an elongated shape and oriented axis parallel to the underlying collagen bundles. in contrast, at the surface of the single mineral matrix (bio - oss), cells were round shaped with random disposition. the b1-integrin subunit, detected with an immunogold method at the transmission electron microscopic level, was found localized at the outer surface of cells, in close association with mineralized collagen matrix, and at the contact points between cells and biomaterials. in contrast, at the surface of the single mineral matrix (bio - oss), cells were round - shaped with random disposition and without association with deproteinized matrix. the importance of preserving the collagen matrix in the xenograft material, has also been reported by another in vitro study, in which authors reported that mesenchymal stem cells, growing on the highly purified bovine xenograft granules, exhibit a high seeding efficiency, a good proliferation, and an early expression of membrane (vesicles) specializations, presumably due to the process of mineralisation since x - ray microanalysis showed the presence of calcium. although in vitro studies must be interpreted with caution since they can not recreate the complex interactions of cells in vivo, those studies indicated the presence of collagen fibres in the matrix of a bone xenogenic biomaterial appears to be the major element in determining early cell disposition, and perhaps further cell functions such as orientation of new matrix deposition. histomorphometric analysis in the present study add further information for understanding the laddec xenograft integration process in the bone site, and interactions that occured seem to sustain the validity of previously reported data. however, further study and additional long - term histologic analyses are needed to confirm our results. within the limitation of the present study, it can be suggested that the highly purified xenogenic bone substitute laddec may have predictable results when used as a grafting material for maxillary sinus lift procedures due to its excellent osteoconductive properties. | abstractobjectivesthe aim of this study was to evaluate the clinical, radiographic and histologic results when a highly purified xenogenic bone (laddec) was used as grafting material in maxillary sinuses.material and methodsin fifteen patients requiring unilateral maxillary sinus augmentation, the grafting procedure was performed with laddec. forty - two implants were installed after a 6 month healing period. the height of the augmented sinus was measured radiographically immediately after augmentation and postoperatively up to 36 months. at the time of implant placement, a bone core was harvested in each patient for histological examination.resultsthe cumulative implant survival rate was 97.6%. the original height was 3.65 (sd 0.7) mm and the augmented sinus height was 13.8 (sd 1.4) mm after the surgery. the reduced height of grafted xenogenic material (rdl) at the implant insertion was 0.83 (sd 0.38) mm, and at the final postoperative visit was 0.91 (sd 0.25) mm, showing no significant correlation with the follow - up periods by spearman s test (p = 0.118). in addition, no significant difference in the rdl was observed according to the site of implantation (p = 0.682). the mean implant marginal bone loss was 0.38 (sd 0.24) mm. histological analysis showed the bone cores were composed of 64.72 (sd 3.44)% newly formed bone, 17.41 (sd 2.02)% connective tissue, 16.93 (sd 2.83)% residual graft particles, and 0.94 (sd 0.11)% inflammatory cells.conclusionsaccording to our data, the highly purified xenogenic bone (laddec), used as graft material in the sinus lift procedure, may create adequate bone volume, and appropriate osseointegration of dental implants. |
trichoadenoma is a rare benign tumor, with multiple cystic structures closely resembling the infundibular structures of the hair follicle. it presents as a non - specific nodule over the face or buttocks, however, unusual sites such as the neck, upper arm, thigh shoulder, and shaft of the penis may also be affected. ours is a case of a 60-year - old female with a trichoadenoma over the left labia majora, which presented as a slow growing nodular plaque. a 60-year - old married female patient presented to us with asymptomatic gradually increasing skin lesion on vulva since 2 years. examination revealed a firm, nontender, nodular plaque of 3.5 cm 2.5 cm along with a few shiny papules along the right labia majora [figure 1a ]. the left labia majora, labia mijora, clitoris, and perianal areas were not involved. differential diagnoses considered were fibrosis lymphangioma circumscriptum, giant trichoepithelioma, sarcoidosis, lupus vulgaris, and deep fungal infection. (c) post - treatment - 2 months, healing with post - inflammatory hyperpigmentation histopathology from the lesion showed numerous horn cysts present throughout the dermis surrounded by eosinophilic cells [figure 2a ]. few of the cyst walls were lined by eosinophilic epidermal cells and contained keratin [figure 2b ] ; thereby leading to a diagnosis of a less known adnexal tumor trichoadenoma. (a) 10 view : showing numerous horn cysts present throughout the dermis. (b) 40 view : showing cyst walls lined by eosinophilic epidermal cells, containing keratin trichoadenoma of nikolowski is a rare, follicular tumor considered as a neoplastic process by some authors and benign malformation by some others. clinically it presents as a solitary slow growing grayish nodule measuring up to 1.5 cm in diameter, seen over the face (57.5%) and buttocks (24.2%). other uncommon sites of involvement are the neck, upper arm, thigh, shoulder and shaft of penis. it may also present as a chronic discharging nodule or as an ulcerated growth. rare case reports of trichoadenoma in association with intradermal melanocytic nevus, sebaceous carcinoma, basal cell carcinoma, syringocystadenoma papilliferum have also been recorded. verrucous variants of trichoadenoma have also been reported. though it is a tumor of adulthood, infants as old as 20 months numerous horn cysts are present surrounded by eosinophilic cells. in some instances, a single layer of flattened granular cells is interpolated between the horn cysts and surrounding eosinophilic cells. moreover, the histological similarity of trichoadenoma with trichoepithelioma suggests the development of immature hair structures. however, because the cyst wall consists of epidermoid cells and keratinization may take place with the formation of keratohyalin, it has been suggested that the tumor differentiates largely toward the infundibular portion of the pilosebaceous unit. the keratin profile expression of this tumor supports the theory that it differentiates towards the follicular infundibulum and the follicular bulge region., we used co2 laser at 9.0 watts with 100 mm hand piece (1.0 mm spot size) in superpulse mode to ablate the growth under local anesthesia [figure 1b ]. there has been no recurrence so far and the normal vulvar anatomy has been maintained. the trichoadenoma is a mystifying follicular tumor. though it is known to occur on the face and buttocks, newer cases with unusual manifestations are being reported. to the best of our knowledge, a histopathologically proven large trichoadenoma over the vulva has not been reported. | trichoadenoma of nikolowski is a rare, benign, well differentiated, slowly growing tumor of the hair follicle which was first described in 1958 by nikolowski. it usually occurs as a solitary nodular lesion between 3 and 15 mm in diameter. it commonly occurs on the face or the buttocks. herein we report a case of a slowly growing nodular plaque over the vulva of a 60-year - old female, histopathologically proven to be a trichoadenoma. the lesion was completely removed by ablative carbon dioxide laser (co2). |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.