article
stringlengths 0
682k
| abstract
stringlengths 146
3.69k
|
|---|---|
flow cytometry is a laser - based technology developed for the analysis of multiple physical and fluorescent parameters in cell populations. this technology works as suspended cells in a stream of fluid encounter a laser, exciting fluorescent markers on or within the cells. while flow cytometry has traditionally been used to identify populations of cells, it has proven to be a useful technology when studying an array of cell properties including cell membrane integrity, protein - protein interactions and protein trafficking. we have developed a protocol that allows this technology to be used to detect the state of chromatin in t cells as they are activated in vitro. we have also used this protocol to investigate the mechanism of activation - induced chromatin decondensation of t cells. t cells, a specific subset of lymphocytes within the immune system, are required for proper immune responses and the development of immunological memory. activation is initiated when an antigen is presented in the context of the major compatibility complex to the t cell receptor (tcr) located on the extracellular surface of quiescent t cells (reviewed in). this triggers a series of dynamic and highly ordered molecular events within t cells that culminate in an increase in intracellular ca2 + concentration and the nuclear translocation of transcription factors required for activation (reviewed in). once activated, t cells gain the ability to respond to interleukin-2 (il-2), a potent growth factor that utilizes the jak (janus kinase)/stat (signal transducer and activator of transcription) pathway to drive clonal proliferation of activated t cells. briefly, il-2 stimulation results in the phosphorylation of stat proteins, a family of latent cytosolic transcription factors. once phosphorylated, stat proteins dimerize, translocate to the nucleus and drive expression of genes including those involved in cell cycle progression. in t cells, il-2 signals via stat5, which is required for t cell proliferation. in order to achieve clonal expansion of activated t cells, those cells that have not experienced antigen - tcr engagement (nave t cells), must have a mechanism to ignore the potent effects of il-2. nave t cells possess a condensed chromatin that prohibits stat5-dna engagement in response to il-2 stimulation. upon activation, chromatin decondenses and stat5 can access the promoters of target genes, permitting clonal proliferation. interestingly, this change in chromatin status is not dependent on epigenetic modification of histone proteins (for review, see) as we observed no global change in histone modification during t cell activation. while performing these studies, we discovered that antibodies raised against histone proteins also had difficulty accessing their epitopes in nave cells, but that upon activation could more readily bind their epitopes. here we present the method to use flow cytometry to detect fluorescently conjugated histone h3 antibodies in order to assess chromatin status in t cells. chromatin condensation in a population of cells is measured as the mean florescence intensity (mfi) of histone h3 staining. in the context of t cell activation, the mfi of histone h3 staining increases, signifying the decondensation of chromatin. in addition to measuring chromatin status via intracellular histone h3 staining, this protocol also incorporates surface staining and a fixable stain for live cells, permitting analysis of subpopulations of cells. this study was carried out in strict accordance with the recommendations in the guide for the care and use of laboratory animals of the national institutes of health. the animal protocol was approved by the furman university institutional animal care and use committee (permit number : a3242 - 01). all materials and equipment used in this protocol can be found in the table of materials and equipment, while buffers used can be found in the table of buffers and solutions. note : use spleens from two 6 - 8 week old isogenic mice (e.g., c57b/6) of the same gender. typically, two spleens are processed. spray the animals profusely with 70% ethanol solution and orient such that the head is facing left. using forceps, lift the skin of the animal upwards and away from the body. using scissors, cut a small notch through the skin near the abdomen of the animal. using fingers, pull each side of the notch to expose the peritoneum from the neck to the beginning of the hind legs. the spleen should be visible directly underneath the peritoneum. using forceps, lift the peritoneum and make a small incision to expose the spleen. remove the spleen with forceps and use scissors to tease away any adipose and connective tissue. place the spleen into a 50 ml conical tube containing 10 ml pbs supplemented with 2% fetal bovine serum (hereafter referred to as pbs+2%). note : typical recovery is between 60 - 90 million cells per spleen, and typically, 2 million cells are needed per sample. obtain two frosted microscope slides and hold the slides so that the two rough frosted surfaces face inwards towards one another. hold the spleen between the frosted surfaces of the slides, with the edges still submerged, and grind the spleen gently by moving the slides back and forth against one another (figure 1a). continue grinding until all cells have been released and the remains of the spleen appear white (figure 1b). draw up the cell suspension in a pipet and filter it slowly through a 70 m filter into a new sterile 50 ml conical tube. note that small pieces of red pulp will be present on the filter (figure 2a). if the filter rises up, gently lift it up slightly to allow the fluid to drain through and place the filter back into the 50 ml conical tube and continue, repeating this process as necessary. if processing more than 5 spleens, it may be necessary to divide into two batches and use a new filter for each. if the filter rises up, gently lift it up slightly to allow the fluid to drain through and place the filter back into the 50 ml conical tube and continue, repeating this process as necessary. if processing more than 5 spleens, it may be necessary to divide into two batches and use a new filter for each. using the stopper portion of a 3 ml syringe gently press the red pulp containing the remaining cells through the strainer (figure 2b). make sure to press both the filter bottom and sides to ensure that all red pulp has passed through the filter (figure 2c). add 10 mlof pbs + 2% to the tissue culture dish and use this to wash the slides, syringe stopper, and dish to recover any remaining cells. pass this through the same 70 m cell strainer into the 50 ml conical tube. centrifuge the filtered cell suspension at 300 x g for 5 min at 4 c. lyse red blood cells by adding 2 ml of ack lysis buffer (0.15 m nh4cl, 1 mm khco3, 0.1 mm edta, ph to 7.2, store at 4 c) per spleen to the conical tube and rotate and invert the tube to ensure that all cells come into contact with the ack buffer. gently swirl the tube for 1 min at rt. bring the volume of the cell suspension to 50 ml by adding pbs + 2% the tube to neutralize the ack buffer. invert the tube 10 times and centrifuge for 5 min at 300 x g at 4 c. after gently decant and discard the supernatant, careful not to disturb the pellet. leave a trace amount of pbs + 2% in the tube, cap the tube, and flick the pellet to resuspend it. add 10 ml of t cell media [10% fbs, 10 mm hepes (ph 7.0), 2 mm glutamax, 1 mm sodium pyruvate, 1x non - essential amino acids, 1x penicillin / streptomycin and 50 mm -mercaptoethanol ], and further resuspend the pellet by gently pipetting up and down. then filter the suspension through a new 70 m filter into a new 50 ml conical tube. use another 5 - 10 ml of t cell media to rinse the original tube and pass this through the 70 m filter into the tube containing the rest of the filtered cells. if processing more than two spleens, the volume of t cell media can be increased to maximize recovery. cells should be counted and viability accessed. to count cells, combine 3 ml of cells with 24 ml of pbs + 2% and 3 ml of 0.4% trypan blue. viability, as assessed by trypan blue exclusion, is typically between 85 - 95%. to count cells, combine 3 ml of cells with 24 ml of pbs + 2% and 3 ml of 0.4% trypan blue. viability, as assessed by trypan blue exclusion, is typically between 85 - 95%. resuspend cells in t cell media to a concentration of 1 x 10 cells / ml. transfer 2 million cells (100 ml) into a well of a u remove the supernatant from each well by flicking liquid within the well plate into the sink (the cell pellet will remain in the well) and dabbing the plate on a clean paper towel. wash the cells by resuspending them in 200 l pbs followed by centrifugation at 300 x g for 10 min at 4 c. perform all washes this way unless otherwise noted. note : do not use pbs + 2% as it will interfere with the fixable pi stain. remove the supernatant by flicking the plate and add 100 ml of freshly prepared commercial stain (e.g., fixable red dead cell stain) to each well. make the stain by diluting the reactive dye stock solution 1:10 in dmso followed by a 1:10 dilution in pbs. make the stain by diluting the reactive dye stock solution 1:10 in dmso followed by a 1:10 dilution in pbs. centrifuge the plate for 10 min at 300 x g at 4 c. at this point forward, remove the supernatant by flicking the plate and then add 100 ml of fc block solution. dilute antibodies to be used for surface staining (e.g., anti - cd4 or anti - cd8) in pbs and add 100 ml to each well. note : surface stain antibodies should be titered for optimal performance. typically use a 1:200 or 1:400 dilution, per the manufacturer s protocol. following incubation of the surface stain, wash the cells twice in pbs. after the last wash, add 100 l of 4% paraformaldehyde to each well. make perm / block solution (stock perm solution is pbs + 2% + 0.02% triton x-100, store at 4 c) by combining 2 ml of normal rabbit serum per 100 ml stock perm solution. add 40 ml perm / block to each sample well and mix well by gently pipetting up and down, taking care not to make bubbles. dilute fluorescently conjugated histone h3k4me1 antibody in perm / block solution reserved in step 3.5 and add 10 l of this dilution to each well. note : use an h3k4me1 antibody conjugated using the r - phycoerythrin conjugation kit following the manufacturer s instructions. resuspend the cells in 200 l pbs+2% and transfer the samples to facs tubes for flow cytometry analysis. confirm euthanasia by cervical dislocation. note : use spleens from two 6 - 8 week old isogenic mice (e.g., c57b/6) of the same gender. spray the animals profusely with 70% ethanol solution and orient such that the head is facing left. using forceps, lift the skin of the animal upwards and away from the body. using scissors, cut a small notch through the skin near the abdomen of the animal. using fingers, pull each side of the notch to expose the peritoneum from the neck to the beginning of the hind legs. the spleen should be visible directly underneath the peritoneum. using forceps, lift the peritoneum and make a small incision to expose the spleen. remove the spleen with forceps and use scissors to tease away any adipose and connective tissue. place the spleen into a 50 ml conical tube containing 10 ml pbs supplemented with 2% fetal bovine serum (hereafter referred to as pbs+2%). note : typical recovery is between 60 - 90 million cells per spleen, and typically, 2 million cells are needed per sample. obtain two frosted microscope slides and hold the slides so that the two rough frosted surfaces face inwards towards one another. hold the spleen between the frosted surfaces of the slides, with the edges still submerged, and grind the spleen gently by moving the slides back and forth against one another (figure 1a). continue grinding until all cells have been released and the remains of the spleen appear white (figure 1b). draw up the cell suspension in a pipet and filter it slowly through a 70 m filter into a new sterile 50 ml conical tube. note that small pieces of red pulp will be present on the filter (figure 2a). if the filter rises up, gently lift it up slightly to allow the fluid to drain through and place the filter back into the 50 ml conical tube and continue, repeating this process as necessary. if processing more than 5 spleens, it may be necessary to divide into two batches and use a new filter for each. if the filter rises up, gently lift it up slightly to allow the fluid to drain through and place the filter back into the 50 ml conical tube and continue, repeating this process as necessary. if processing more than 5 spleens, it may be necessary to divide into two batches and use a new filter for each. using the stopper portion of a 3 ml syringe gently press the red pulp containing the remaining cells through the strainer (figure 2b) make sure to press both the filter bottom and sides to ensure that all red pulp has passed through the filter (figure 2c). add 10 mlof pbs + 2% to the tissue culture dish and use this to wash the slides, syringe stopper, and dish to recover any remaining cells. pass this through the same 70 m cell strainer into the 50 ml conical tube. centrifuge the filtered cell suspension at 300 x g for 5 min at 4 c. lyse red blood cells by adding 2 ml of ack lysis buffer (0.15 m nh4cl, 1 mm khco3, 0.1 mm edta, ph to 7.2, store at 4 c) per spleen to the conical tube and rotate and invert the tube to ensure that all cells come into contact with the ack buffer. gently swirl the tube for 1 min at rt. bring the volume of the cell suspension to 50 ml by adding pbs + 2% the tube to neutralize the ack buffer. invert the tube 10 times and centrifuge for 5 min at 300 x g at 4 c. after gently decant and discard the supernatant, careful not to disturb the pellet. leave a trace amount of pbs + 2% in the tube, cap the tube, and flick the pellet to resuspend it. add 10 ml of t cell media [10% fbs, 10 mm hepes (ph 7.0), 2 mm glutamax, 1 mm sodium pyruvate, 1x non - essential amino acids, 1x penicillin / streptomycin and 50 mm -mercaptoethanol ], and further resuspend the pellet by gently pipetting up and down. then filter the suspension through a new 70 m filter into a new 50 ml conical tube. use another 5 - 10 ml of t cell media to rinse the original tube and pass this through the 70 m filter into the tube containing the rest of the filtered cells. if processing more than two spleens, the volume of t cell media can be increased to maximize recovery. cells should be counted and viability accessed. to count cells, combine 3 ml of cells with 24 ml of pbs + 2% and 3 ml of 0.4% trypan blue. viability, as assessed by trypan blue exclusion, is typically between 85 - 95%. to count cells, combine 3 ml of cells with 24 ml of pbs + 2% and 3 ml of 0.4% trypan blue. viability, as assessed by trypan blue exclusion, is typically between 85 - 95%. resuspend cells in t cell media to a concentration of 1 x 10 cells / ml. transfer 2 million cells (100 ml) into a well of a u remove the supernatant from each well by flicking liquid within the well plate into the sink (the cell pellet will remain in the well) and dabbing the plate on a clean paper towel. wash the cells by resuspending them in 200 l pbs followed by centrifugation at 300 x g for 10 min at 4 c. perform all washes this way unless otherwise noted. note : do not use pbs + 2% as it will interfere with the fixable pi stain. remove the supernatant by flicking the plate and add 100 ml of freshly prepared commercial stain (e.g., fixable red dead cell stain) to each well. make the stain by diluting the reactive dye stock solution 1:10 in dmso followed by a 1:10 dilution in pbs. make the stain by diluting the reactive dye stock solution 1:10 in dmso followed by a 1:10 dilution in pbs. centrifuge the plate for 10 min at 300 x g at 4 c. at this point forward, perform all work with the plate with the tissue culture hood light off. remove the supernatant by flicking the plate and then add 100 ml of fc block solution. dilute antibodies to be used for surface staining (e.g., anti - cd4 or anti - cd8) in pbs and add 100 ml to each well. note : surface stain antibodies should be titered for optimal performance. typically use a 1:200 or 1:400 dilution, per the manufacturer s protocol. following incubation of the surface stain, wash the cells twice in pbs. after the last wash, add 100 l of 4% paraformaldehyde to each well. make perm / block solution (stock perm solution is pbs + 2% + 0.02% triton x-100, store at 4 c) by combining 2 ml of normal rabbit serum per 100 ml stock perm solution. add 40 ml perm / block to each sample well and mix well by gently pipetting up and down, taking care not to make bubbles. dilute fluorescently conjugated histone h3k4me1 antibody in perm / block solution reserved in step 3.5 and add 10 l of this dilution to each well. note : use an h3k4me1 antibody conjugated using the r - phycoerythrin conjugation kit following the manufacturer s instructions. resuspend the cells in 200 l pbs+2% and transfer the samples to facs tubes for flow cytometry analysis. lymphocytes from a c57b/6 mouse were processed into a single cell suspension according to the protocol and counted using a standard hemocytometer. cells were seeded in triplicate at 2 x 10/ml in t - cell media in 15 ml conical tubes and left untreated, or stimulated with 1 mg / ml soluble anti - cd3 antibodies (clone 4c11) for 3 hr at 37 c in a standard tissue culture incubator. dead cells were stained and then cells were then surface stained using fitc - cd8 and apc - cd4 antibodies according to the protocol. histone accessibility was analyzed via flow cytometry (figure 4). in both nave cd4 and cd8 t cells, the mean fluorescent intensity (mfi) is low, signifying a condensed chromatin state. as cells are activated with anti - cd3 antibodies the mfi increases significantly (p < 0.001, student t - test) indicating that chromatin has decondensed. (a) the spleen is pressed against the frosted surfaces of two microscope slides. (b) the slides are moved back and forth against each other releasing lymphocytes into a 100 mm petri dish until the remains of the spleen are white. figure 2.using a syringe stopper to press remaining red pulp through a 70 mm cell strainer. (a) red pulp remaining after a spleen is processed into a single cell suspension and passed through the 70 mm cell strainer. (b) the stopper portion of a 3 ml syringe is used to gently press remaining red pulp through the cell strainer. (c) after using the syringe, there should be virtually no red pulp left in the cell strainer. (a) centrifugation of a single cell suspension generated from a single mouse spleen prior to ack lysis. (b) after ack lysis of red blood cells, the cell pellet should be white. (b and c) t cells were left untreated or activated with 1 mg / ml soluble anti - cd3 antibodies for 3 hr (in triplicate). cells were then analyzed by flow cytometry to determine chromatin condensation in cd4 cells (b) and cd8 cells (c). data are the means standard deviation of the mean fluorescence intensity of h3k4me1 staining. p < 0.001 (student s t - test) please click here to view a larger version of this figure. table 1 : troubleshooting guide. a quick reference to common issues and possible solutions. we developed a protocol that allows for the assessment of chromatin condensation in t cells. it relies on the simple observation that histone h3 antibodies can not access their epitopes readily in nave cells, but upon t cell activation, these same antibodies are able to bind to their epitopes. by comparing the mfi of histone h3 staining between treatment groups, the relative degree of condensation or decondensation can be determined. we have used this protocol to determine relative condensation status during thymocyte development and during t cell activation. we have also used this protocol to investigate the mechanisms that control the decondensation process. this protocol relies on the use of a histone h3 antibody to detect chromatin condensation status. since there is no global change in histone modification during t cell activation, we are able to use an h3k4me1 antibody to assess chromatin status in this protocol. we have used antibodies raised against unmodified histone h3 ; however, the signal produced was much weaker overall. in our experience, antibodies raised against modified histone h3 work better in immunofluorescence and flow cytometry assays, while antibodies against unmodified histone h3 work better in western blot. it must be noted that it is also possible to use antibodies raised against other histone proteins, although we have not attempted it. the perm / block and histone h3 antibody steps are the most critical steps in the protocol. the amount of perm / block solution used needs to be optimized each time the stock perm solution is made. a typical experiment involves comparing chromatin status in nave t cells to those activated for 3 hr (figure 4). one should choose the dilution that produces the greatest change in mfi over the time period analyzed. the stock solution can be diluted in pbs + 2% to decrease perm / block strength by first resuspending the cells in as much as 100 ml pbs + 2% after step 3.4 and then adding the perm / block in step 3.5. a similar pilot experiment should be used to test different dilutions of the fluorescently conjugated histone h3 antibody each time a new batch of antibody is labelled. these steps are especially critical to successful detection of condensation differences early in t cell activation (e.g., within 3 hr of activation). occasionally, there are cells that do not get permeabilized and thus will not stain with the histone h3 antibody. this may happen if the cells are not resuspended well when adding the perm / block or if the perm / block is not strong enough. these cells will appear as events pressed against the axis when visualizing a histogram of histone h3 staining. since these events will skew the overall mfi, these events can be omitted from analysis by gating the normal distribution of histone h3 positive cells. the inclusion of a fixable dead cell stain allows for the assessment of cell viability in the assay. this is absolutely critical when manipulating t cell activation because certain stimuli can induce cell death. in such a case, the histone h3 antibody can bind histones in dead cells differently than live cells, leading to misinterpretation of the results. this protocol is designed for use in 96-well plate format, permitting a high throughput analysis of chromatin status. a spleen from a 6 - 8 week old female mouse since the staining protocol requires 2 million cells per sample, one can easily assay multiple treatment groups and time points in triplicate with a single spleen on a single 96-well plate. it is possible to perform the protocol with less cells per sample ; however, due to the number of centrifugation steps and the inherent loss of cells at each of these steps, it is not advisable to lower the number of cells by much. we used this protocol to examine chromatin status in cd4 t helper cells and cd8 cytotoxic t cells. the protocol could easily be adapted for the examination of chromatin in other lymphocyte subpopulations by using antibodies against population - specific surface markers. this protocol could also easily be adapted to other cell types so long as antibodies recognizing relevant surface markers are available and proper fixation / permeabilization conditions are known. | during a proper immune response, quiescent t cells become activated upon antigen presentation to their antigen - specific t cell receptor. this leads to clonal proliferation of only those t cells that bear a receptor that recognizes the antigen. chromatin decondensation is a hallmark of t cell activation and is required for t cells to acquire the ability to proliferate after antigen engagement. this change in chromatin condensation can be detected using antibodies raised against histone proteins. these antibodies can not bind to their epitopes in nave t cells as well as they can in activated t cells. we describe how to simultaneously stain t cell - specific surface markers, track viability with a fixable dead cell stain, and measure chromatin status via intracellular staining of histone h3 proteins. stained cells are analyzed by flow cytometry and chromatin condensation status is measured as the mean fluorescence intensity (mfi) of the histone h3 stain. chromatin decondensation during t cell activation is demonstrated as an increase in the mfi |
edible bivalve molluscs may constitute a risk to food safety because, as filtering organisms, they are potential receptacles of pathogens, toxins and contaminants (huss., 2000), so that classifying and monitoring fishery waters (latini, 2010) and the molluscs themselves is fundamental to ensure food safety in shellfish production. the fishing and marketing of molluscs should therefore comply with the chemical, biotoxicological and microbiological parameters established by the relevant european standards. 854 of 29 april 2004 (european commission, 2004b) states that member countries must classify fishery waters and set up monitoring systems for fishery waters that are already classified, based on the regular monitoring of both water and shellfish. classification and monitoring are implemented differently from region to region, partly because of the different types of coasts, and partly due to differences in the shellfish collected, in terms of species and quantity, in the various parts of italy. in the marche region 1300 of 3 august 2009 (regione marche, 2009), while monitoring is regulated by the decreto del dirigente p.f. november 2005 (european commission, 2004b, 2005), which classify fishery waters in three categories according to the e. coli concentrations in molluscs (expressed as mpn/100 g) : a zone (230), b zone (4600), c zone (46,000), respectively. another fundamental aspect for the proper classification of fishery waters is the preliminary assessment of pollutants, their local circulation and their actual impact. this must be carried out by the competent authorities, while food business operators, in accordance with ec regulation no. 853 of 29 april 2004 (european commission, 2004a), must take into account all the relevant information, including environmental and weather conditions. 190/2009 (regione marche, 2010a) sets out the monitoring frequency and criteria and establishes partnerships between the competent authorities and food business operators through operational protocols. the area vasta di fermo (the competent health authority of the marche region), in collaboration with the producers association consorzio per la gestione della pesca dei molluschi bivalvi nel compartimento marittimo di san benedetto del tronto (co.vo.pi.), conducted a series of studies on the presence of e. coli as an indicator of faecal contamination in the environment, in shellfish and in fishery waters, and on the factors that can affect their presence. these studies included an assessment of sea currents and tides, a census of the sources of human and animal pollution and the evaluation of data on organic pollutants released in the environment in various times of the year, as connected to seasonal variations, resident and animal populations in the catchment area, rainfall, wastewater treatment and orographic features of the area involved. this information was in part acquired from documentation made available by the various competent agencies (competent health authority, official laboratories, marche region, province of fermo, integrated provincial water consortium) and in part derived from direct measurements made along the 26 km of shoreline under study. in order to identify potential sources of pollution, the documentation consulted included : technical reports of the wastewater treatment plants, biological monitoring, ecological and environmental classification of the water courses that empty into the sea along the coast under study, reports on the vulnerability to nitrate pollution of surface waters, data on livestock, maps with the locations of breeding farms in the area, data on wildlife and data on the monitoring of coastal seawaters. the purpose of this study is to report on the data regarding the samples taken along the coast of the province of fermo during the period 2008 - 2011 and the number of samplings resulting in e. coli values greater than 230 mpn/100 g, and to illustrate the possible relations between the increased concentrations of e. coli in the harvested shellfish and the levels of precipitation immediately prior to sampling. the survey was conducted in accordance with the provisions of the delibera della giunta regionale no. 1665 of 22 november 2010 (regione marche, 2010b) and in application of the guide to good practice of the european union reference laboratory on monitoring bacteriological contamination of bivalve molluscs, issued on 4 august 2010 (cefas, 2010). e. coli monitoring was performed by the competent health authority from 2008 to 2011 in the production areas of natural beds of venus gallina along the coast within the area vasta di fermo. during the period from 2008 to 2010 seven zones were classified ; according to the classification made in 2011 ten zones were classified (figure 1), divided into subzones based on bathymetry (3 - 6 m and 6 - 9 m) ; the difference is due to the fact that three new zones were added which were previously under the competent health authority area vasta di san benedetto del tronto. in these subzones, the natural beds of v. gallina were sampled from aboard a fishing boat equipped with a special rake, and the samples were taken by travelling backwards along designated stretches of water. in each stretch, two strips parallel to the coastline were examined, at depths of 3 - 6 m and 6 - 9 m, respectively ; the catch was selected by size using rotating screens mounted on the deck, and under - measure shellfish were returned to the sea. in each zone / subzone the frequency of microbiological testing was at least every two months. the mollusc samples to be analysed, consisting of a single batch of at least 4 kg of commercial - size shellfish, were sent to the official laboratory responsible for the area accompanied by the sampling report. e. coli determinations were made using the official methods prescribed by the relevant standards (iso ts1649 - 3). historical data on daily precipitations during the period 2008 - 2011 was acquired from the centro di ecologia e climatologia, osservatorio geofisico sperimentale di macerata. the data regarding the official sampling for the detection of e. coli in molluscs, carried out from january 2008 to december 2011, were compared with the historical data on total daily rainfall during the three days prior to each sampling, as measured in two monitoring stations located at civitanova marche (for production zones between bm.1 and b17.2) and san benedetto del tronto (for zones a - b18 and aq). table 1 shows the number of samplings and of e. coli determinations in mollusc tissues exceeding the limit of 230 mpn/100 g (non conformities). in 2008, the prescribed e. coli limits were exceeded 3 times, 2 of which in a zones and 1 in a b zone. the non - conformities were detected in samples taken during the months of october, november and december. in 2009, the limits were exceeded 29 times, 4 of which in a zones and 25 in b zones, in samplings made in march (12), april (2), september (1) and december (14). in 2010, 61 cases of exceeded limits were detected, 12 of which in a zones and 49 in b zones, observed in january (14), february (8), march (14), april (2), june (4), august (3), november (12) and december (4). in 2011, 33 cases were detected, 9 of which in a zones and 24 in b zones, recorded in february (1), march (4), june (18), august (7) and december (3). a comparison between the microbiological data and the analytical data on precipitations showed that in most cases small concentrations of e. coli in shellfish corresponded to small or no levels of precipitation, while an increase in the levels of e. coli was preceded by more or less abundant precipitations. an example of the comparison between e. coli concentrations and precipitations in a17.2/6 - 9 zone is shown in figure 1. in some cases heavy rainfall was not followed by an increase in e. coli concentrations. in one case only (17.8.11) increased concentrations were found even in the absence of precipitations during the three preceding days. the concurrence between heavy rainfall during the three days prior to collection and increases in e. coli levels was more evident in the following zones, shown in figure 2 : bm.1/3 - 6 m (immediately south of the river chienti, which receives the outflows of a purification plant, a few natural drainage ditches and spillways from the municipal sewage network), b15/3 - 6 m (on the southern edge of the town of porto santelpidio, where the river tenna empties along with the porto santelpidio purification plant and spillways from the municipal sewage network), b16.2/3 - 6 and 6 - 9 m (on the southern edge of the town of porto san giorgio, where the river ete vivo empties along with a few ditches and discharges from the purification plant of the town of fermo), b17.1 and b17.2 (where a few ditches empty), b18 and a18 (facing the mouth of the river aso, where a few purification plants empty), aq/3 - 6 and 6 - 9 m (where a few ditches and discharges from a purification plant empty). finding positive measurements in absence of precipitations during the three days prior to sampling may be due to the fact that the sampling period coincided with the peak of the tourist season (17.8.11), when the amount of wastewater treated by purification plants can be generally very large, exceed plant capacity and cause the spillage of above - normal pollution loads into the receiving waters. a further consideration is related to the location of the areas where the concurrence between abundant rainfalls and increased levels of e. coli was more evident : in all likelihood, once drained into the sea, the rainwater and fluvial run - off are transported south by the local prevailing current which flows from north to south, according to available data on currents and tides (cushman - rosin., 2001) ; in addition, since the regions upstream of these areas are densely inhabited, industrialized and highly touristic, the waters closer to the coast would be at greater risk of faecal contamination linked to municipal wastewater. a further aspect to highlight is the relation between river regime and the seasons : the torrential nature of the rivers of the marche region greatly affects the amount of sediment carried to the sea, with large variations in flow rates between high - water and low - water periods. when a particularly abundant precipitation occurs after a prolonged drought, the river beds fill quickly and consistently and the waters carry away the pollutants that have accumulated along the course of the river. the socio - economic data of the three hydrographic areas in the province of fermo (chienti, tenna / ete vivo, aso / tesino) show that, over the years, there has been a gradual abandonment of mountain areas and an increase in the population living in seaside towns, resulting in the development and expansion of industrial activities. because of this, anthropogenic pollution is greater near the coast, especially in the areas of the chienti and tenna rivers. together with these factors it must be taken into account the considerable pressure exerted on the territory of the coastal communities by tourism during the summer months, especially in the southernmost part of the province. other important factors in evaluating the extent of pollution are the characteristics of the sewage and wastewater purification plants (design organic load, type of treatments applied, etc.). in the coastal towns the percentage of coverage of sewerage networks is about 80 - 90%. on the whole, the ten treatment plants, located in the area have capacities suitable for the amount of wastewater to be treated. in addition, expansion works are already planned for some of them, and a new sewage plant is scheduled to be built in the lower tenna area. in case of excessive rainfall, spillway discharges may occur that completely bypass the purifier and discharge wastewater directly into the receiving bodies. the survey of water supplies, discharges, ditches and all other potential sources of pollution along the coast of the province of fermo provided an overview of the general situation regarding coastal pollution loads. the possible sources of pollution directly involved are represented by the four rivers that are the coast (chienti, tenna, ete vivo and aso), which are intercepted with dams or sluices to generate hydroelectric power or for agricultural and industrial purposes. the large water withdrawals make the river courses more prone to flash floods, with frequent increases in the amounts of pollutants and sediment that reach the sea. although the waters of these rivers are in critical conditions, considering the data on the whole it can be noted that the number of samples with values of e. coli above 230 mpn/100 g detected in shellfish production zones located in front of river mouths was similar to the number detected in other zones (table 1). this can also be attributed to the fact that the sediments (and any pollutants) carried to the sea are widely distributed by the sea currents. the main surface current in this part of the adriatic sea runs from north to south, but other minor, deeper currents have been identified whose directions are still not well known. the interplay between surface and deep currents, together with the action of the waves and the tides, produces considerable mixing of marine sediments, which represent the most important vehicle for all sorts of pollutants that, once carried to the sea, can reach considerable distances. in conclusion, while routine tests on batches received at dispatch centres do provide additional control on microbiological quality, they do not make up for a fully adequate monitoring and classification system that includes measurements that take into account additional risk factors, such as precipitations. to better assess the correlations between precipitations and increased values of e. coli in shellfish, it would be interesting to examine samples taken three days after the start of heavy rainfalls, since, as observed above, it should be possible to find an increase in bacterium levels in the shellfish. in that regard, food business operators themselves could include the following activities among good manufacturing practices : shellfish taken from a zones three days after the start of a rainfall, especially if heavy, should be sent to purification centres, while shellfish taken from b zones three days after the start of a rainfall should undergo additional testing to check whether the microbiological parameters are within the prescribed limits. however, monitoring alone, based on the determination of indicator organisms, allows a less than satisfactory risk assessment of contamination by any pathogenic bacteria and viruses that may be present ; a single analysis, or a small number of determinations regarding e. coli, does not provide a fully reliable indication of healthiness. in order to ensure the safety of bivalve molluscs it is essential that the regional surveillance plans be applied timely and rigorously, but equally important is the continuity of onsite investigations looking to identify urban or environmental changes that can affect the presence of e. coli in shellfish (latini, 2010). | the area vasta di fermo (the competent health authority of the marche region), in collaboration with the local producers association conducted a series of studies on the presence of e. coli as an indicator of faecal contamination in the environment, in shellfish and in fishery waters, and on the factors that can affect their presence. these studies, carried out from 2008 to 2011, included an assessment of the currents along the coast, of the precipitations, and data from the monitoring of e. coli on shellfish harvested in the collection areas were examined. the results showed that in most cases, small concentrations of microorganisms in shellfish corresponded to little or no precipitations, while an increase in the levels of e. coli was preceded by more or less abundant rainfalls. the conclusions suggest that it is advisable to carry out a more detailed risk analysis which should take into account the above - mentioned factors. furthermore, monitoring alone based on the determination of indicator organisms, especially when carried out as a single analysis or with a small number of e. coli determinations, does not provide a satisfactory indication of safety. the regional surveillance plans should be applied timely and rigorously, together with onsite investigations aimed at identifying changes that can affect the presence of e. coli in shellfish. food business operators themselves could implement good manufacturing practices to verify whether the microbiological parameters are within the prescribed limits after rainfalls, especially if heavy. |
a major challenge in the successful replantation / revascularization of an avulsed scalp is positioning of the patient 's head during and after the operation, because : possibility of shearing between scalp and skull when the head is moved / rotated intra - operatively, leading to tearing of anastomosed vessels ; andpost - operatively, the possibility of necrosis of scalp over pressure - bearing areas. possibility of shearing between scalp and skull when the head is moved / rotated intra - operatively, leading to tearing of anastomosed vessels ; and post - operatively, the possibility of necrosis of scalp over pressure - bearing areas. an 18-year - girl presented to us with near total scalp avulsion due to machine belt injury [figure 1a ]. halo frame to stabilize the scalp during and after operation [figures 1c, d and 2a ]. (a) pre - operative view of avulsed scalp (b) pre - operative view of avulsed scalp after shaving (c) immediate post - operative cranial view of scalp with halo device in situ, and (d) frontal view showing halo device in situ (a) picture showing assembled halo device (b) computed tomography scan axial view showing halo device 's screw engaging outer cortex of cranium (c) 2-month post - operative : lateral view showing marking for screw entry point and (d) 4-month postoperative : frontal view the device we used is a 10 mm thick aluminum bar bent into a u - shape. it has multiple - threaded holes in the axial plane, through which stainless steel screws are passed. the superficial temporal vessels were identified and tagged in the avulsed scalp and in both the pre - auricular regions.the scalp was put in place and stapled at multiple points maintaining access to the vessels through oblique incisions.the halo was attached to the skull, with the open end of the u facing anteriorly, using 4 screws [figure 1c and d ]. the marking for the placement of screws was done as follows [figure 2c ] : all the 4 screws were placed in the same axial plane about 3 cm above the upper margin of the helix. the anterior screws were placed about 4 cm in front of a vertical line passing through the root of helix, and the posterior screws about 3 cm behind this line. these points were chosen to avoid the (i) thin squamous temporal bone, (ii) the previously marked anterior and posterior branches of the superficial temporal vessels, and (iii) the major venous sinuses.the screws were passed through small stab incisions in the scalp and gradually tightened by hand till the tip of the screw touched the outer table. care was taken to rotate the screws in small increments, one after the other, so that all the 4 screws went to the same depth and the gap between the halo and the scalp was equal all around. once the screw tip had touched the outer table, each screw was tightened further by one full turn (1 mm depth). at this point the halo had a firm grip on the skull without the screws having penetrated the outer table fully [figure 2b ]. the vascular anastomoses were carried out, and the skin edges closed.only a small dressing was applied along the suture lines and around the 4 screw entry points, leaving the entire replanted scalp exposed for easy monitoring [figure 1c and d ]. the avulsed scalp was cleaned and shaved [figure 1b ]. the superficial temporal vessels were identified and tagged in the avulsed scalp and in both the pre - auricular regions. the scalp was put in place and stapled at multiple points maintaining access to the vessels through oblique incisions. the halo was attached to the skull, with the open end of the u facing anteriorly, using 4 screws [figure 1c and d ]. the marking for the placement of screws was done as follows [figure 2c ] : all the 4 screws were placed in the same axial plane about 3 cm above the upper margin of the helix. the anterior screws were placed about 4 cm in front of a vertical line passing through the root of helix, and the posterior screws about 3 cm behind this line. these points were chosen to avoid the (i) thin squamous temporal bone, (ii) the previously marked anterior and posterior branches of the superficial temporal vessels, and (iii) the major venous sinuses. the screws were passed through small stab incisions in the scalp and gradually tightened by hand till the tip of the screw touched the outer table. care was taken to rotate the screws in small increments, one after the other, so that all the 4 screws went to the same depth and the gap between the halo and the scalp was equal all around. once the screw tip had touched the outer table, each screw was tightened further by one full turn (1 mm depth). at this point the halo had a firm grip on the skull without the screws having penetrated the outer table fully [figure 2b ]. the vascular anastomoses were carried out, and the skin edges closed. only a small dressing was applied along the suture lines and around the 4 screw entry points, leaving the entire replanted scalp exposed for easy monitoring [figure 1c and d ]. post - operatively the patient 's head was allowed to rest on the halo, and the head end of the bed was kept elevated [figure 1c ]. from the first post - operative day the whole of the scalp survived except for the partial thickness loss of two small patches where there had been direct deep grazing injury. the halo was removed at bedside, without any anesthesia, on the 14 post - operative day. the superficial temporal vessels were identified and tagged in the avulsed scalp and in both the pre - auricular regions.the scalp was put in place and stapled at multiple points maintaining access to the vessels through oblique incisions.the halo was attached to the skull, with the open end of the u facing anteriorly, using 4 screws [figure 1c and d ]. the marking for the placement of screws was done as follows [figure 2c ] : all the 4 screws were placed in the same axial plane about 3 cm above the upper margin of the helix. the anterior screws were placed about 4 cm in front of a vertical line passing through the root of helix, and the posterior screws about 3 cm behind this line. these points were chosen to avoid the (i) thin squamous temporal bone, (ii) the previously marked anterior and posterior branches of the superficial temporal vessels, and (iii) the major venous sinuses.the screws were passed through small stab incisions in the scalp and gradually tightened by hand till the tip of the screw touched the outer table. care was taken to rotate the screws in small increments, one after the other, so that all the 4 screws went to the same depth and the gap between the halo and the scalp was equal all around. once the screw tip had touched the outer table, each screw was tightened further by one full turn (1 mm depth). at this point the halo had a firm grip on the skull without the screws having penetrated the outer table fully [figure 2b ]. the vascular anastomoses were carried out, and the skin edges closed.only a small dressing was applied along the suture lines and around the 4 screw entry points, leaving the entire replanted scalp exposed for easy monitoring [figure 1c and d ]. the avulsed scalp was cleaned and shaved [figure 1b ]. the superficial temporal vessels were identified and tagged in the avulsed scalp and in both the pre - auricular regions. the scalp was put in place and stapled at multiple points maintaining access to the vessels through oblique incisions. the halo was attached to the skull, with the open end of the u facing anteriorly, using 4 screws [figure 1c and d ]. the marking for the placement of screws was done as follows [figure 2c ] : all the 4 screws were placed in the same axial plane about 3 cm above the upper margin of the helix. the anterior screws were placed about 4 cm in front of a vertical line passing through the root of helix, and the posterior screws about 3 cm behind this line. these points were chosen to avoid the (i) thin squamous temporal bone, (ii) the previously marked anterior and posterior branches of the superficial temporal vessels, and (iii) the major venous sinuses. the screws were passed through small stab incisions in the scalp and gradually tightened by hand till the tip of the screw touched the outer table. care was taken to rotate the screws in small increments, one after the other, so that all the 4 screws went to the same depth and the gap between the halo and the scalp was equal all around. once the screw tip had touched the outer table, each screw was tightened further by one full turn (1 mm depth). at this point the halo had a firm grip on the skull without the screws having penetrated the outer table fully [figure 2b ]. the vascular anastomoses were carried out, and the skin edges closed. only a small dressing was applied along the suture lines and around the 4 screw entry points, leaving the entire replanted scalp exposed for easy monitoring [figure 1c and d ]. post - operatively the patient 's head was allowed to rest on the halo, and the head end of the bed was kept elevated [figure 1c ]. from the first post - operative day onwards, the whole of the scalp survived except for the partial thickness loss of two small patches where there had been direct deep grazing injury. the halo was removed at bedside, without any anesthesia, on the 14 post - operative day. from our experience of scalp replantation in the past, and as reported by others, replanted scalps are susceptible to shearing and avulsion, as well as pressure necrosis at occipital region. one of the ways of avoiding these problems is to keep the patient in a sitting posture at all times. once a scalp replant fails, it not only results in multiple stages of surgery, but also causes great financial loss and emotional trauma to the patient. use of this halo device can make the intra- and post - operative management of scalp replantations easier and ensure more complete survivals [figure 2c and d ]. we present a new technique for stabilization of a replanted scalp and avoiding pressure on the scalp post - operatively. this technique is safe, simple and has the additional advantage of avoiding a bulky dressing and allowing continuous easy monitoring of vascularity. | we present a new technique for stabilizing an avulsed scalp during and after replantation / revascularization. we used an aluminium halo frame with 4 screws. this technique can rigidly stabilize an avulsed scalp and eliminate the possibility of shearing / pressure necrosis. this device can make perioperative management easier and more comfortable for the patient and caregivers. |
the technique described provides extracorporeal control of one limb of the suture and has the advantage of continuous tension application on both ends of the thread during knot formation. it is easy to learn, fast to perform, and no new equipment is used. the needle end is advanced through the trocar, and the free end is firmly grasped extracorporeally by the assistant. the needle is passed through the tissues to be sutured and held with the right needle holder. the left - hand instrument holds the filament about 5 cm proximal to the needle, thus resulting in a triangle formation, the apex of it being presented by the tissues to be sutured and the base by the segment of the filament between the left instrument and the needle holder (figure 1). the needle is rotated around the free end of the filament, which is aligned and held in place by external traction (figures 2 and 3). as many turns as desired are thrown choosing the appropriate direction : for clockwise throws, the needle is grasped proximally and for opposite throws distally. the surgeon prepares to rotate the needle around the limb of the suture for a first time. accurate and safe tissue suturing is essential for advanced laparoscopic surgery. during the last decade, suturing devices such as clip applicators, staplers, and endo - loops have been developed. extracorporeal knots are easy to perform and are usually created by multiple throws that are advanced intracorporeally with a knot pusher. most important, tension can not be maintained while throwing turns, and the tying instruments before the next throw release the ends of the filament. on the other hand, sequential throw formation in opposite directions is technically demanding, resulting in an unsecured sliding sequence instead of a square knot. another problem is tissue exposure to unnecessary manipulation and traction from pulling long lengths of suture through the needle track and pushing the knot into position. intracorporeal knots seem to deal better with the last issue, and they have the advantage of focusing on the operative field during creation. however, a considerable degree of virtuosity is required, and these knots are not available as an option to occasional laparoscopists. on the other hand, the main problem of preserving ligature tension while forming the knot remains to be settled. even though the technique is an intracorporeal one, continuous tension is guaranteed by providing extracorporeal control of one limb of the suture, thus allowing the manipulation of the needle end with both instruments. winding sequential throws in both directions the procedure necessitates the presence of a curved needle and can be used for ligating tissues that must be securely approximated, as in gastric banding and nissen fundoplication. the greek term for intracorporeal knot is easy to learn and is secure and therefore presents an option not only to the laparoscopic surgeons but to other surgeons as well. | accurate placing of securely tied knots in laparoscopic surgery is technically demanding and time consuming. surgeons must face difficulties arising from 2-dimensional vision, spatial limitations, and restricted movement. issues to be taken into account include security, virtuosity, and cost effectiveness. the authors believe that in spite of advances in instrumentation and optics, training should aim at manual skill development and application of the basic principles of general surgery. |
they are formed as earlier indicated as a result of aggregation of three or more molecules of surfactant existing in a particular liquid medium in thermodynamically stable equilibrium that create highly anisotropic interfacial region lining the boundary formed by polar aqueous and nonpolar hydrocarbon regions, impacting new chemical and physical properties to the system [27 ]. determination of reaction rates in micellar is usually based on the pseudophase mode, which treats aqueous, organic, and/or surfactant components of the solvent medium as constituting distinct phases in which reaction occurs and between which reagent and product are distributed in accordance with conventional laws of kinetic and mass transfer. it has the greatest application in the field of alcohol and carbohydrate chemistry. under controlled conditions, periodate will selectively oxidize 1,2-diol, 1,2-amino alcohols, 1,2-hydroxyl aldehyde, and ketones and various other groupings. periodate oxidation has a lot of advantages which are responsible for its being widely studied. for example, it can be applied in aqueous solution over a wide range of ph. ethylene glycol is an organic compound primarily used as a raw material in the manufacture of polyester fibers and fabric industry. a small percent is used in industrial application like antifreeze formulation and other industrial products. the kinetic oxidation of ethylene glycol by various oxidizing agents has been investigated and was found to involve two electron transfers through the formation of a negatively charged cyclic intermediate. kinetics and mechanism of the reaction between ethylene glycol and periodate in micellar system remain unexplored. in this work, i have explored the effect of cationic (cetyltrimethylammonium bromide, ctabr) and nonionic (dodecyl amine, da) surfactant micelles on the kinetics and mechanism of the reaction between ethylene glycol and periodate. cetyltrimethylammonium bromide (ctabr) from fluka, dodecyl amine (da) from sigma, and sodium periodate from bdh (99% pure) were used without further purification. reaction kinetics were studied on the perkin - elmer uv / vis spectrophotometer, lambola e 2150, using a cell of path length 1 cm by recording the change in absorbance due to disappearance of periodate (at 225.4 mn) in a thermostated reaction cell. the concentration of ethylene glycol was kept in large excess over the concentration of periodate. the integrated first order equation is as follows : (1)lnata=lna0ak0 t, where a0, at, and a are the absorbance time zero, t, and infinity was fitted to the kinetic data by using algorithm to give the first order pseudoconstant k0 (k0 = observed rate constant). the value of the observed rate constant was reproducible within the experimental error (3%). the conductivity measurement was performed with jenway 4510 digital conductometer using a dip - type cell of constant 0.88 cm. all measurements were done in a jacketed vessel, maintained at desired temperature, with circulating water thermostat bath. the conductometric method was used to determine the cmc value of ctabr and da solution at different experimental conditions : ctabr, and da only, ctabr + io4, ctabr + eg, da + io4, and da + eg. the cmc value was determined from the specific conductivity versus [ctabr ] and [da ] in the presence and absence of io4 and eg. the cmc was found to be 9.1 10, 1.54 10, 9.7 10, 1.01 10, 2.06 10, and 1.50 10 mol / dm for water + ctabr, water + da, ctabr + io4 (1.051 10 mol / dm), ctabr + eg (3.580 10 mol / dm), da + io4 (4.20 10 mol / dm), and da + eg (2.87 10 mol / dm), respectively, at 25c as shown in tables 1(a) and 1(b). the reaction was carried out in the presence of ctabr (0.0002.743) 10 mol dm and fixed concentration of eg and io4. addition of ctabr results in partial increase in rate up to the concentration of 1.83 10 mol / dm after which inhibition predominate as shown in figure 1. the initial catalytic role of ctabr below 1.83 10 mol / dm can be explained on the fact that small aggregate of the ctabr exists below the cmc which interacts physically with the reactants forming active entities. therefore, the catalytic role is due to the presence of premicelle and preponement of micellization by reactant ; the two reactants are assumed to have penetrated the stern layer electrostatically. below 1.83 10 mol / dm of ctabr, inhibition occurs. these could be interpreted using the kinetic model of the pseudophase proposed by menger and portnoy, which, taking the micelles as a pseudophase uniformly distributed in the aqueous phase, put forward a reaction scheme with a micelle - substrate equilibrium governed by an equilibrium constant ks (scheme 1). this scheme represents the micellized surfactant as dn where [dn ] = [d ] cmc and [d ] is the concentration of surfactant where m and w refer to the micellar and aqueous pseudophases, respectively. the scheme predicts a value for kob given by (2) which is the overall reaction rate. this value is equal to the rates at the micellar and aqueous pseudophases (scheme 1) (2)kob = kw+kskm[dn]1+ks[dn ]. the inhibition observed occurs because of the low concentration of io4 near the cationic surface causing the reactivity of the associated substrate to be much less than that of the substrate in the aqueous phase preventing the formation of [eg. if km = 0, io4 is completely excluded from the stern layer of the micelle and (2) becomes (3)kob = kw1+ks[dn ], where kh2o represents the observed rate constant in the absence of surfactant. the reaction was also studied in the presence of da and the result (figure 2) can be interpreted in the same way. added surfactant increases the relative concentration of eg and io4 in the stern layer which increases the reaction rate as shown by the ascending branch of the curve. as the concentration of ctabr and da increases, the concentration of the reagent in the micellar pseudophase decreases and furthers the excess of unreactive io4 in the stern layer so that the reaction rate decreases. finally, it can be concluded that, within the experimental range of studies, the pseudophase ion - exchange model has been found to be successful in explaining the result obtained in the kinetics and mechanism of the reaction between ethylene glycol and periodate in micellar system. | the oxidation of ethylene glycol by periodate (io4) was studied in different micellar aggregates of cetyltrimethylammonium bromide (ctabr) and dodecylamine (da) by means of uv / vis spectroscopy. the observed constant ko was obtained by monitoring the disappearing of ethylene glycol with time at a suitable wavelength under pseudofirst condition. addition of ctabr and da inhibits the reaction rate while the kinetic behavior was explained on the association of one of the reactants with the micelles leaving the other reactant in the bulk solution (pseudophase model). |
united states committee on quality of health published a report in 1999 by the title of to err is human in which medical errors were mentioned as an epidemic problem leading to almost 44,000 - 98,000 deaths annually. this report was remarkable for who eventually leading to an announcement prioritizing patient safety as an imperative for health care policy makers around the world. increasing number of reports on medication errors and relevant subsequent damages, especially in medical centers has become a growing concern for patient safety in recent decades. on the other hand, because of drug overuse and self - treatment within the society, especially among elderly, appropriate use of medications as well as their safety has become the superior concern of public health policy makers all around the world. a number of studies have been performed in the area of medication errors. an earlier study was performed by harvard university on 3000 hospitalized patients showing 3.7% of patients affected by the health system errors leading to mortality or severe damage. similar studies in canada, england, france, australia, spain, and some other states of the united states indicate that 5 - 10% of patients experience variable degrees of adverse effects of treatment - preventable errors - during the time they reside in the hospital. only a fraction of medication errors are reported, but each report can raise awareness and voluntary reporting to prevent repetition of unwanted outcomes in similar situations. complex drug dispensing systems in hospitals highlights the importance of monitoring medication errors and incidence reporting by the staff to improve the quality of medication errors. discovering error rates is not an easy process, but it should be taken into consideration that most of these errors which threat patients health and safety are repetitive and preventable. because of the large diversity of reported medication errors with different definitions and methodologies, defining the exact and consistent rate of such errors is a difficult task in general. a number of methods are used for medication error measurements each one of which has its pros and cons : anonymous self - reports or questionnaires, incident voluntary reporting, critical incident technique, chart review, computer - assisted monitoring, disguised direct observation (ddo). while plenty of biases have been identified for the majority of these methods, the ddo has been cited as most suitable for research. prescribing error of 10.5% and transcribing error of 29.9% have been reported as part of these published articles. to the best of our knowledge, none of the published studies conducted in iran to date has exclusively and completely evaluated medication errors in four stages of prescribing, transcribing, dispensing and administering and most of them were affected by limitations and small sample size. because of the importance of medication safety and lack of a comprehensive survey, we aimed to evaluate the incidence of medication errors in four stages (administration, transcribing, prescribing and dispensing) for the first time in isfahan province in two of its largest hospitals with two different medication distribution systems. the design utilized is a descriptive cross - sectional study conducted on a total of 565 hospitalized patients in all 40 wards of medical, surgical and intensive care units of the two largest hospitals of isfahan during september 2012 to february 2013. the two teaching hospitals, one affiliated to isfahan university of medical sciences (al - zahra hospital [azh ]) and another affiliated to the social security organization (dr. shariati hospital [dsh ]), the former using unit - dose (distributing 24 h needs of each medication per patient) and the latter using floor stock system (distributing medication needs based on nursing request to distribute medications. the hospitals were selected because they are the two largest in the city and can provide a good representation of governmental hospitals in the province. twenty resembling wards in azh and dsh (including all the medical, surgical and intensive care units) were selected and their names were drawn randomly to determine, which ward to be visited first by the researcher. a random number generator was used for the randomization process. upon arrival on each ward, the first nurse seen by the researcher would be approached and asked whether she or he would agree to be accompanied by the researcher to be observed for drug distribution purposes. the head nurse was approached occasionally to facilitate this process. according to the definition of the national coordinating council for medication error and prevention, medication error is any preventable incidence, which leads to misuse of the drug or damage to patient whilst taking drugs is under health team or patient 's control. ddo, a previously validated method, was used as our method to detect and describe medication errors. the number of doses (medication items) observed by the researcher which in fact represents the opportunities for error occurrence was used as the basis for sample size calculation. since, no data was available on the rate of medication errors in isfahan hospitals ; the total sample size of 1000 doses was calculated to be studied for each hospital. we evaluated types and incidence of medication errors utilizing ddo method in four stages including prescribing, transcribing, dispensing and administering. to avoid or reduce bias due to the presence of researcher on performance of target individuals, hospital nurses, nurse aids, ward secretaries, pharmacists, and pharmacy technicians were told that the observer was assessing the process of drug distribution instead without giving further details. diagrams for each drug distribution system in each hospital were drawn by the help of pharmacy directors in each hospital to clarify the steps involved in medication handling in each of the two institutions the outcome of the study was to measure the incidence rate of medication errors in the four stages. once oral consent of the nurse was obtained, the researcher would follow and observe the nurse. the researcher recorded the doses dispensed and continued observing until the 50 doses in that ward finished. the researcher occasionally had to observe more than one nurse or had to be present in a ward in am, pm or graveyard shifts to complete the 50 administered dose since in some wards medication administration was not as prevalent as in some other wards. after recording the details of administration, the observer checked patients documents to compare his / her records with what the physician had prescribed and what the hospital pharmacy had delivered in addition to the nursing reports for further verification. detected inconsistencies were discussed in a team including the researcher, clinical pharmacist and head of the pharmaceutical care department of the hospital. the definition of administration error used by the team is any inconsistency, whether in dosage form, dose, administration route, dosing interval, between what has been ordered by a physician and what the patient receives by nurse. probable errors of administration that our observer focused on in this stage were unauthorized dose, extra dose, under - dose, omission dose, wrong dose, wrong route and wrong time and frequency. wrong time error occurred when a drug was administered > 1 h before or after the scheduled time. the above - mentioned process went on until the records of 1000 doses were collected in each of the two hospitals. in both hospitals, physician orders are not delivered or presented to the hospital pharmacy directly contrary to what is typically seen in a community pharmacy. once the order is written, the head nurse records the medications ordered onto a medication list (medication sheet) (t1). in azh, one of the nurses transcribes the medication orders from the medication sheet onto a request list, which is sent to the pharmacy department whereas in dsh, the secretary sends the request through the computer system to the pharmacy department (t2). in azh, a third step is involved and that is the information from the paper medication request list sent by the ward is entered by computer operators situated in the pharmacy department into the computer system (t3). in order to evaluate transcribing errors, the researcher categorized these errors into three types based on which stage of transcribing they occurred (t1, t2 or t3). any inconsistency detected between the physician order, and the medication sheet the researcher then checked the written (azh) or computerized (dsh) list of requested drugs sent to the pharmacy against the medication sheet for probable inconsistencies in name, dose, dosage form, quantity, etc. type 3 error was measured only in azh on any inconsistencies between the paper request list of the ward and the computer list generated by the operators located in the pharmacy department (t3). after observing the nurse and evaluating the administration stage, the researcher recorded the exact written order of the administered drug extracted from the chart. the researcher defined prescribing error if one of the following criteria were met : the dose of the drug was not written based on the current available doses in the iranian market. that is, md wrote ranitidine tablet 100 mg instead of 150 mg or 300 mg.the medication order lacked one of the following and therefore considered as not complete : name, dosage form, dose and measuring unit such as mg or that is, administration route, intervals of administration. the dose of the drug was not written based on the current available doses in the iranian market. that is, md wrote ranitidine tablet 100 mg instead of 150 mg or 300 mg. the medication order lacked one of the following and therefore considered as not complete : name, dosage form, dose and measuring unit such as mg or that is, administration route, intervals of administration. the observer was present at the checking point in the pharmacy and the receiving point at the ward. she finished recording as soon as she reached the 1000 mark as the goal for dispensed medications and followed the medication courier to the ward. given the fact that the checker at the checking point did not check all the medications specifically oral medications, the second stage (d2) seemed inevitable. in order to detect the dispensing errors (d1 and d2), the observer checked the inaccuracies of what was dispensed against the computer generated list either by the computer operator in azh or by the ward secretary in dsh at the checking point in the pharmacy department (d1). to detect the d2 errors, the researcher accompanied the medication courier and checked the medications sent to ward against the requested list. recorded errors and inconsistencies of the above four stages were discussed and confirmed by the 3 member team. data were input into and analyzed by statistical package for social sciences (spss) version 20 (ibm corporation, ny, usa). chi - square test was used to compare different medication errors between the two hospitals. twenty resembling wards in azh and dsh (including all the medical, surgical and intensive care units) were selected and their names were drawn randomly to determine, which ward to be visited first by the researcher. a random number generator was used for the randomization process. upon arrival on each ward, the first nurse seen by the researcher would be approached and asked whether she or he would agree to be accompanied by the researcher to be observed for drug distribution purposes. the head nurse was approached occasionally to facilitate this process. according to the definition of the national coordinating council for medication error and prevention, medication error is any preventable incidence, which leads to misuse of the drug or damage to patient whilst taking drugs is under health team or patient 's control. ddo, a previously validated method, was used as our method to detect and describe medication errors. the number of doses (medication items) observed by the researcher which in fact represents the opportunities for error occurrence was used as the basis for sample size calculation. since, no data was available on the rate of medication errors in isfahan hospitals ; the total sample size of 1000 doses was calculated to be studied for each hospital. we evaluated types and incidence of medication errors utilizing ddo method in four stages including prescribing, transcribing, dispensing and administering. to avoid or reduce bias due to the presence of researcher on performance of target individuals, hospital nurses, nurse aids, ward secretaries, pharmacists, and pharmacy technicians were told that the observer was assessing the process of drug distribution instead without giving further details. diagrams for each drug distribution system in each hospital were drawn by the help of pharmacy directors in each hospital to clarify the steps involved in medication handling in each of the two institutions the outcome of the study was to measure the incidence rate of medication errors in the four stages. once oral consent of the nurse was obtained, the researcher would follow and observe the nurse. the researcher recorded the doses dispensed and continued observing until the 50 doses in that ward finished. the researcher occasionally had to observe more than one nurse or had to be present in a ward in am, pm or graveyard shifts to complete the 50 administered dose since in some wards medication administration was not as prevalent as in some other wards. after recording the details of administration, the observer checked patients documents to compare his / her records with what the physician had prescribed and what the hospital pharmacy had delivered in addition to the nursing reports for further verification. detected inconsistencies were discussed in a team including the researcher, clinical pharmacist and head of the pharmaceutical care department of the hospital. the definition of administration error used by the team is any inconsistency, whether in dosage form, dose, administration route, dosing interval, between what has been ordered by a physician and what the patient receives by nurse. probable errors of administration that our observer focused on in this stage were unauthorized dose, extra dose, under - dose, omission dose, wrong dose, wrong route and wrong time and frequency. wrong time error occurred when a drug was administered > 1 h before or after the scheduled time. the above - mentioned process went on until the records of 1000 doses were collected in each of the two hospitals. in both hospitals, physician orders are not delivered or presented to the hospital pharmacy directly contrary to what is typically seen in a community pharmacy. once the order is written, the head nurse records the medications ordered onto a medication list (medication sheet) (t1). in azh, one of the nurses transcribes the medication orders from the medication sheet onto a request list, which is sent to the pharmacy department whereas in dsh, the secretary sends the request through the computer system to the pharmacy department (t2). in azh, a third step is involved and that is the information from the paper medication request list sent by the ward is entered by computer operators situated in the pharmacy department into the computer system (t3). in order to evaluate transcribing errors, the researcher categorized these errors into three types based on which stage of transcribing they occurred (t1, t2 or t3). any inconsistency detected between the physician order, and the medication sheet the researcher then checked the written (azh) or computerized (dsh) list of requested drugs sent to the pharmacy against the medication sheet for probable inconsistencies in name, dose, dosage form, quantity, etc. type 3 error was measured only in azh on any inconsistencies between the paper request list of the ward and the computer list generated by the operators located in the pharmacy department (t3). after observing the nurse and evaluating the administration stage, the researcher recorded the exact written order of the administered drug extracted from the chart. the researcher defined prescribing error if one of the following criteria were met : the dose of the drug was not written based on the current available doses in the iranian market. that is, md wrote ranitidine tablet 100 mg instead of 150 mg or 300 mg.the medication order lacked one of the following and therefore considered as not complete : name, dosage form, dose and measuring unit such as mg or that is, administration route, intervals of administration. the dose of the drug was not written based on the current available doses in the iranian market. that is, md wrote ranitidine tablet 100 mg instead of 150 mg or 300 mg. the medication order lacked one of the following and therefore considered as not complete : name, dosage form, dose and measuring unit such as mg or that is, administration route, intervals of administration. the observer was present at the checking point in the pharmacy and the receiving point at the ward. she finished recording as soon as she reached the 1000 mark as the goal for dispensed medications and followed the medication courier to the ward. given the fact that the checker at the checking point did not check all the medications specifically oral medications, the second stage (d2) seemed inevitable. in order to detect the dispensing errors (d1 and d2), the observer checked the inaccuracies of what was dispensed against the computer generated list either by the computer operator in azh or by the ward secretary in dsh at the checking point in the pharmacy department (d1). to detect the d2 errors, the researcher accompanied the medication courier and checked the medications sent to ward against the requested list. recorded errors and inconsistencies of the above four stages were discussed and confirmed by the 3 member team. data were input into and analyzed by statistical package for social sciences (spss) version 20 (ibm corporation, ny, usa). chi - square test was used to compare different medication errors between the two hospitals. a total number of recorded data were 8162, from which 8000 were complete and used for analysis. the number of records in each stage was 1000 in each hospital or 2000 records for each of the four stages. all three shifts were included in the evaluation process : morning (1094), afternoon (851) and graveyard (55) shifts comprised of 54.7%, 42.6% and 2.8% of the 2000 records, respectively in both hospitals in administering, transcribing, and prescribing stages. more than half (50.8%) of patients were males and the rest (49.2%) were females. ages ranged from newborn to 89 years old (8.8% up to 2 years, 3.6% from 2 to 17 years, 66.1% from 18 to 65 years, and 22.2% above 65 years). results of data analysis of each stage are described below : as explained before, 2000 md orders were assessed for 6 parameters including p1) drug route, p2) dosage form, p3) dose unit (mg, g, ml, etc.), p4) frequency interval, p5) drug name, p6) drug dose. as seen in the table 1, one - third (34%) of orders had five parameters, whereas 39% of orders had four or less parameters. from all the six parameters of prescribing p5 (drug name) was not missed in any of orders and p6, p4, p3, p2, and p1 were the parameter with most frequent- omissions, respectively. another error we detected while reviewing orders, which was not part of our early objectives was ordering doses of medications, which were not available in iranian market (0.75%). more details and p values overall prescribing error frequencies incidence of medication errors in two hospitals three kinds of errors were defined for this stage, which was described earlier as t1, t2, and t3 in the methods section. the errors related to the additional stage (t3) in azh consisted of 1.8% of transcribing errors. fortunately, omitting this additional stage (t3) occurred at the end of our study and a computerized list of required drugs is now directly sent to the pharmacy in azh like dsh. as described in the methods section evaluation of dispensing stage was performed at two distinct levels and times (d1 and d2). as shown in table 2, there is not a significant difference between errors of d1 between the two hospitals. our findings showed that administration errors were frequent in both hospitals occurring at an average rate of 1 in every three doses. administration error was 41.5% in azh and 34% in dsh, which are significantly different (p = 0.04). on an average, the most frequent error was the wrong time (15.6%) and omission, unauthorized dose, under - dose, extra dose, wrong route, and wrong frequency occurred in 4.7, 4.6, 4.5, 3.2, 2.9, and 0.5% of cases, respectively. a great portion of errors were wrong time errors, none of the cases proved fatal. we found more than a single administration error for almost 1% of all 2000 doses. as explained before, 2000 md orders were assessed for 6 parameters including p1) drug route, p2) dosage form, p3) dose unit (mg, g, ml, etc.), p4) frequency interval, p5) drug name, p6) drug dose. as seen in the table 1, one - third (34%) of orders had five parameters, whereas 39% of orders had four or less parameters. from all the six parameters of prescribing p5 (drug name) was not missed in any of orders and p6, p4, p3, p2, and p1 were the parameter with most frequent- omissions, respectively. another error we detected while reviewing orders, which was not part of our early objectives was ordering doses of medications, which were not available in iranian market (0.75%). more details and p values three kinds of errors were defined for this stage, which was described earlier as t1, t2, and t3 in the methods section. reported incidences of errors were 6.3%, 37.7%, and 1.8%, respectively. the errors related to the additional stage (t3) in azh consisted of 1.8% of transcribing errors. fortunately, omitting this additional stage (t3) occurred at the end of our study and a computerized list of required drugs is now directly sent to the pharmacy in azh like dsh. as described in the methods section evaluation of dispensing stage was performed at two distinct levels and times (d1 and d2). as shown in table 2, there is not a significant difference between errors of d1 between the two hospitals. our findings showed that administration errors were frequent in both hospitals occurring at an average rate of 1 in every three doses. administration error was 41.5% in azh and 34% in dsh, which are significantly different (p = 0.04). on an average, the most frequent error was the wrong time (15.6%) and omission, unauthorized dose, under - dose, extra dose, wrong route, and wrong frequency occurred in 4.7, 4.6, 4.5, 3.2, 2.9, and 0.5% of cases, respectively. a great portion of errors were wrong time errors, none of the cases proved fatal. we found more than a single administration error for almost 1% of all 2000 doses. one of the problems in these types of studies is differences in definitions, terminology, methods and indices used making comparisons of results difficult. a review article published in 2013 in iran reported administration error as the most frequent medication error with a prevalence range of 14.3 - 70%. furthermore, they showed that 83.3% of reviewed studies measured administration errors solely or in combination with other medication error types. other types of errors reported according to this review were 29.8 - 47% for prescribing, 11.2 - 33.6% for dispensing, and 10 - 51.8% for transcribing errors. to the best of our knowledge, none of the available studies conducted in iran has exclusively and completely evaluated medication errors in all levels to date and most of them were affected by limitations and small sample size as the largest one belonged to fahimi,. 8000 data belonging to 565 patients were evaluated in two large teaching hospitals. although the severity of errors was not part of this study, but our observations showed that there was no known life - threatening risk error in our study, but there were several near miss errors like mistaken selection of heparin instead of tramadol or amikacin instead of ranitidine because of their similarities in appearance that were fortunately caught by the nurse prior to administration. since the majority of works in the central pharmacy of the hospital are performed in the morning shift, the observer collected her data on dispensing errors in the hospital pharmacy solely in the morning. when evaluating prescribing errors, we found that few md orders (27%) the 6 parameters as explained before. incomplete orders may lead to more medication errors because of assumptions (sometimes wrong), which have to be made by the nursing or pharmacy personnel. for example, if a physician does not clarify the quantity of the medication ordered, this could be interpreted as 1 or 2 or any other quantity, which inherently could lead to error. this shows that physicians may not be aware of or obey laws or regulations governing prescribing and re - educating them may be necessary. as considered before, total prescribing error in iran was reported to a range from 29.8% to 47.8%, but this may depend on the definitions and methods used. for example, vesal considered mostly clinical parameters in her 4-month evaluation of prescribing errors in 2010, which yielded a 39% prevalence : wrong frequency, wrong drug selection, overdose, failure to discontinue, failure to order, under - dose, wrong time, therapeutic monitoring, wrong route, and drug interactions. also, lewis., in his systematic review article addresses the wide variations in prescribing errors, 2 - 14%, mainly due to differences in settings, definitions, research methods making any comparison quite difficult. we reported mean prevalence of 15.26% for transcribing errors, which is in the range reported by mansouri. as seen in table 2, most of the transcribing errors (37.7%) occur in the t2 stage, showing the problem in the request lists, either paper or electronic, sent to the pharmacy by the wards. specifically, most of these errors in the t2 stage were due to no requests (21.4%), which might have been due to the presence of medications in the floor stocks of the wards, and requests of extra doses (9.9%) of medications by the wards. also, most errors occurred in the medication dosage in the t1 stage in the two hospitals. the additional stage of transcribing (t3) in azh was omitted beginning farvardin 1392 because of computerization of transcribing process. in a study by lisby., transcribing errors were 56% quite higher than our study and outside the range of mansouri 's article showing that settings of the study and definitions used could impact the numbers reported. dispensing error was reported to be 4% by lisby,. and 11.2 - 33.6% by mansouri,. again, differences reported among different numbers shows that different settings and definitions can impact on the prevalence of medication errors in the dispensing stage. as shown in the results section of this article, the error rate (d1) in azh is almost twice that of dsh. from these dispensing errors, higher workload relative to the number of technicians dispensing or checking medications could perhaps be one of the explanations for higher rate of dispensing errors in one institution. look - a - likes and sound - a - likes could easily be missed in higher workload situations especially in the morning shifts. in addition, in azh the pharmacy is responsible to render intravenous solutions as well as solid dosage forms at the same time whilst dsh has a separate dispensing system for intravenous solutions reducing the workload for the final checker. other causative factors such as work experience may play a role in the difference observed, which are out of scope for this research. comparison of two hospitals in dispensing stage higher demands from the pharmacy especially during 10:30 am to 12:30 pm could be alleviated by designating time slots to each ward for their medication requests. this may spread the traffic of requests over a 4 - 5 h period reducing potential for dispensing errors in turn. administration errors varied among different working shifts in both hospitals : in the mornings, the rate was 472/1094 (43.1%), evenings 334/851 (39.2%), and graveyard shifts 9/55 (16.3%). he reported that most of the unintended events including different medical errors such as medication errors occurred in the morning shifts as opposed to the afternoon and night shifts. these findings may be explained by nurses heavier workload in the morning shifts as well as the presence of medical, nursing and pharmacy students in morning shifts who due to lack of experience may ask unnecessary questions from the nurse or commit errors in administering by the nursing students. barker and kenneth also used direct observation method and reported administration errors to be 19%, most of which (43.1%) was related to the wrong time of administration while omission, wrong dose and unauthorized drug errors were reported to be 30%, 17%, and 4%, respectively. we also have shown that wrong time administration errors are the most, whereas, wrong dose (combination of under and over dose) of 7.7% was next, followed by omission and unauthorized errors as next most frequent ones. tisset., have reported lower rates for administration errors (14.9%) of which wrong dose and wrong time were 41%, and 26%, respectively accounting for most frequent administration errors. fahimi., have reported rate of administration error to be 9.4% quite lower than ours. the main reason for wrong time error as the most frequent administration error in dsh may be the fact that nurses usually do not pay much attention to the exact time of orders and they tend to administer all medications in that shift at the same time to improve efficiency. but in azh, the most important cause for the wrong time error was perhaps due to the delay, which occurred in receiving the drugs from the pharmacy department due to lack of an extensive floor stock. the researcher poses the theory that perhaps due to the nature of dsh as being a social security organization facility in which patients receives free care, might be a reason for less motivation among the nurses and therefore committing more errors. in none of above studies including ours, administration of expired medications one of the reasons for this was that the expiration date on some of the medications was not clear or easily readable. although there are similarities among our results with other research, the differences might be as the result of different methods and settings that these studies have been performed in. the advantage of this study was that all four stages of administering, transcribing, prescribing, and dispensing were observed in two different large hospitals. this contributes to the generalizability of the study in a large city such as isfahan. the limitations were that we did not investigate the clinical aspects of prescribing errors and simply limited to only the parameters comprising a physician order. although prescribing and administrating compromise most of the medication errors, improvements are needed in all four stages with regard to medication errors. clear guidelines must be written and executed in both hospitals to reduce incidence of medication errors. ahz and fs contributed to the conception and design of the work, analysis, and interpretation of data ; prepared the manuscript ; did final approval of the version to be published ; and agreed to be accountable for all aspects of the work. | background : increasing number of reports on medication errors and relevant subsequent damages, especially in medical centers has become a growing concern for patient safety in recent decades. patient safety and in particular, medication safety is a major concern and challenge for health care professionals around the world. our prospective study was designed to detect prescribing, transcribing, dispensing, and administering medication errors in two major university hospitals.materials and methods : after choosing 20 similar hospital wards in two large teaching hospitals in the city of isfahan, iran, the sequence was randomly selected. diagrams for drug distribution were drawn by the help of pharmacy directors. direct observation technique was chosen as the method for detecting the errors. a total of 50 doses were studied in each ward to detect prescribing, transcribing and administering errors in each ward. the dispensing error was studied on 1000 doses dispensed in each hospital pharmacy.results:a total of 8162 number of doses of medications were studied during the four stages, of which 8000 were complete data to be analyzed. 73% of prescribing orders were incomplete and did not have all six parameters (name, dosage form, dose and measuring unit, administration route, and intervals of administration). we found 15% transcribing errors. one - third of administration of medications on average was erroneous in both hospitals. dispensing errors ranged between 1.4% and 2.2%.conclusion : although prescribing and administrating compromise most of the medication errors, improvements are needed in all four stages with regard to medication errors. clear guidelines must be written and executed in both hospitals to reduce the incidence of medication errors. |
the children prospectively observed in this study participate in the norwegian cohort entitled environmental triggers of type 1 diabetes : the midia study. the cohort was identified at birth from the general population based on genetic testing for the hla genotype conferring the highest genetic risk of type 1 diabetes, drb1 0401-dqa1 03-dqb1 0302/drb1 03-dqa1 05-dqb1 02. between 2001 and 2006 all subjects were followed up with stool samples, blood samples for autoantibody screening, and structured questionnaires. the study was approved by the regional committee for medical research ethics and the norwegian data inspectorate. blood samples taken at ages 3, 6, 9, and 12 months and every 12 months thereafter were processed, and the plasma was tested for autoantibodies against gad 65, protein tyrosine phosphatase ia-2, and insulin, using radiobinding assays as described in detail earlier (9). mailed questionnaires were administered at the same intervals. if a plasma sample was found to be positive for one autoantibody, the child was retested every 6 months ; if a sample was positive for two or three antibodies, the child was retested every 3 months. the end point for this study, islet autoimmunity, was defined as positivity for two or more islet autoantibodies in two or more consecutive samples. type 1 diabetes was diagnosed according to the world health organization criteria. by december 2008, 27 of the 911 children in the cohort the median age at onset of islet autoimmunity was 12.0 months (range 5.437.4 months). of the 27 case children, diabetes was diagnosed in 10 by 1 september 2009, at a median age of 23.1 months (8.754.2 months). the timing of autoantibody seroconversion and age at diagnosis for each of the case subjects is shown in supplementary table 1 (available in an online appendix at http://care.diabetesjournals.org/cgi/content/full/dc10-1413/dc1). two control subjects were randomly assigned per case subject, matched for the length of follow - up (at least as long as the time when the corresponding case subject developed multiple islet autoantibodies), date of birth within 1 month (tolerating up to 3 months if necessary), and county of residence (tolerating closest neighboring county if necessary). children were ineligible as control subjects if they were repeatedly positive for one or more islet autoantibodies during follow - up. one control subject was transiently positive for a single autoantibody before the end point in the respective case subject ; otherwise no control subjects developed positive autoantibodies (even after their case subject reached the end point). data from one control child (matching group 27) are missing because the parents later withdrew the child from the study and refused any use of the collected data. to test for enterovirus infections, we used stool samples obtained by the parents ; they collected stool samples from their children every month from 3 to 35 months of age. these were sent by mail to our central laboratory, with a median transit time of 3 days. of 704 planned blood samples, 637 were taken (91%) ; 2,173 of 2,482 scheduled stool samples (88%) and 492 of 547 questionnaires were received (90%). the median duration of follow - up with stool samples was 28 months (range 735 months). characteristics of the case subjects and control subjects in this study data are median (range), n (%), and n. for matched control subjects : before the age at which the corresponding case subject seroconverted for islet autoantibodies. the processing and testing of stool samples in this study were described earlier (10). in brief, the samples were received by postal service, diluted, and centrifuged. the extraction protocol used the 96-well qiaamp plates vacuum - processed under the qiaamp viral rna mini protocol (qiagen, hilden, germany). west nile virus armored rna (asuragen, austin, tx) was added in a constant quantity to the lysis buffer, which was used in the first step of the protocol. this exogenous internal control was used to monitor the success of rna extraction and detection. testing for human enterovirus rna was performed in duplicate in 20-l - volume one - step real - time rt - pcr with a primer - probe combination specific for the conserved 5-untranslated region of human enteroviruses. serial dilutions of enterovirus armored rna (asuragen) were used to construct a seven - point standard curve from 24 to 10 copies/l. the threshold of positivity used in this study was set to 100 copies/l rna, a quantity that could be consistently and reliably detected. to optimize the use of information in repeated samples collected from each individual, we compared the percentage of enterovirus rna positive samples collected from case subjects with those collected from control subjects, and tested this result using a mixed - effect logistic regression model with random intercept for each individual to account for potential intraindividual correlation (clustering) in risk of enterovirus positivity (xtmelogit in stata 11). the primary analysis involved only samples collected up to seroconversion for the case subjects and the corresponding age in the matched control subjects. in case subjects who first tested positive for a single autoantibody, this first occurrence of autoantibody positivity was regarded as the onset of autoimmunity. the estimated odds ratio (or) (with 95% ci) from this model is interpreted as the odds that a fecal sample is positive for enteroviral rna given that it came from a child who later developed islet autoimmunity, relative to the odds that a sample is enterovirus - positive given that it came from a control child. planned (secondary) subgroup analyses involved time windows of 6 and 12 months before seroconversion in case subjects (and corresponding ages in matched control subjects), samples collected before 1 year of age, and samples collected after seroconversion. we also adjusted for other variables by including them in the regression model, as reported in results. in separate analyses only the first enterovirus rna - positive samples among series of two or more consecutively positive samples was counted, assuming that they were part of the same infectious episode. we also analyzed the data according to a formal nested case - control study design using conditional logistic regression (accounting for the matched design with a fixed intercept for each matching group), modeling the cumulative number of enterovirus rna positive fecal samples before seroconversion (grouped as 0, 1, 2, or 3) as the exposure variable. with the given study design, the measure of association from this analysis is interpreted as the relative risk of islet autoimmunity per increase in cumulative number of enterovirus rna positive samples, with a corresponding 95% ci. the processing and testing of stool samples in this study were described earlier (10). in brief, the samples were received by postal service, diluted, and centrifuged. the extraction protocol used the 96-well qiaamp plates vacuum - processed under the qiaamp viral rna mini protocol (qiagen, hilden, germany). west nile virus armored rna (asuragen, austin, tx) was added in a constant quantity to the lysis buffer, which was used in the first step of the protocol. this exogenous internal control was used to monitor the success of rna extraction and detection. testing for human enterovirus rna was performed in duplicate in 20-l - volume one - step real - time rt - pcr with a primer - probe combination specific for the conserved 5-untranslated region of human enteroviruses. serial dilutions of enterovirus armored rna (asuragen) were used to construct a seven - point standard curve from 24 to 10 copies/l. the threshold of positivity used in this study was set to 100 copies/l rna, a quantity that could be consistently and reliably detected. to optimize the use of information in repeated samples collected from each individual, we compared the percentage of enterovirus rna positive samples collected from case subjects with those collected from control subjects, and tested this result using a mixed - effect logistic regression model with random intercept for each individual to account for potential intraindividual correlation (clustering) in risk of enterovirus positivity (xtmelogit in stata 11). the primary analysis involved only samples collected up to seroconversion for the case subjects and the corresponding age in the matched control subjects. in case subjects who first tested positive for a single autoantibody, this first occurrence of autoantibody positivity was regarded as the onset of autoimmunity. the estimated odds ratio (or) (with 95% ci) from this model is interpreted as the odds that a fecal sample is positive for enteroviral rna given that it came from a child who later developed islet autoimmunity, relative to the odds that a sample is enterovirus - positive given that it came from a control child. planned (secondary) subgroup analyses involved time windows of 6 and 12 months before seroconversion in case subjects (and corresponding ages in matched control subjects), samples collected before 1 year of age, and samples collected after seroconversion. we also adjusted for other variables by including them in the regression model, as reported in results. in separate analyses only the first enterovirus rna - positive samples among series of two or more consecutively positive samples we also analyzed the data according to a formal nested case - control study design using conditional logistic regression (accounting for the matched design with a fixed intercept for each matching group), modeling the cumulative number of enterovirus rna positive fecal samples before seroconversion (grouped as 0, 1, 2, or 3) as the exposure variable. with the given study design, the measure of association from this analysis is interpreted as the relative risk of islet autoimmunity per increase in cumulative number of enterovirus rna the frequency of human enterovirus rna in stool samples before the development of islet autoimmunity did not differ between case subjects (12.7%) and control subjects (13.6%). results were similar even after adjustment for age, sex, month of sampling, year of sample, number of siblings, breastfeeding, and first - degree relatives with type 1 diabetes (table 2). likewise, no association was seen when only infections before 12 months of age (or 1.02 [95% ci 0.512.04 ]) or various time windows before seroconversion in case subjects were analyzed : with a 6-month window, the frequency was 20 of 142 (14.1%) in case subjects vs. 42 of 308 (13.6%) in control subjects (1.05 [0.542.04 ]) and with a 12-month window the frequency was 31 of 214 (14.5%) in case subjects vs. 62 of 454 (13.7%) in control subjects (1.09 [0.621.92 ]). the use of infectious episodes rather than number of positive stool samples (i.e., consecutive positive samples were deemed as a single episode) did not appreciably alter the above figures. the results were similar when a conditional logistic regression model estimating the or per increase in infections before development of islet autoimmunity was used (or 1.12 [0.661.91 ]). frequency of human enterovirus fecal samples collected before islet autoimmunity data are n, n (%), and ors (95% ci). estimated from logistic mixed - effects logistic regression models with random intercept for each subject to control for intraindividual correlation (no significant random intercept in model for enterovirus episodes, but highly significant in model for enterovirus positivity). the unadjusted or in ordinary logistic regression ignoring intraindividual correlation in infections was 0.92 ; adjusted for sex, calendar month of sample collection, year of sample collection (20012003, 20042006, or 20072008), age (continuous), number of siblings (0 vs. 1), breast - feeding, and first - degree family history of type 1 diabetes (yes / no) ; excluding consecutively positive samples that may have been part of the same infectious episode as in the previous positive sample. the effect of viral load was assessed by dividing the positivity into two categories : low to moderate (quantity of 1009,999 enterovirus copies/l rna) and high (10,000 enterovirus copies/l rna). no association with islet autoimmunity was found in this type of analysis (table 3). in the 43 enterovirus - positive samples from the preautoimmunity period among case subjects, the median estimated human enterovirus quantity was 18,000 copies/l rna compared with a median of 12,000 copies/l rna among 94 enterovirus - positive samples from matched control subjects from the corresponding periods (mann - whitney nonparametric test p = 0.37). similar results were seen in the samples collected after the onset of autoimmunity. among the 30 new enterovirus episodes during the preautoimmune period of case subjects, 13 (43.3%) were followed by at least one additional consecutive enterovirus - positive sample, compared with 29 of 65 (44.6%) among the control subjects (test p = 0.73). semiquantitative testing of the stool samples : frequency of enterovirus infections with high and low viral load in the children who subsequently developed repeated positivity of multiple autoantibodies vs. matched control subjects who did not develop autoimmunity negative, 2,000 monthly fecal samples from children who developed repeated positivity for multiple islet autoantibodies and their matched control subjects, all with a single hla - dq, -dr genotype, conferring the highest risk of type 1 diabetes. we found no evidence to support a higher frequency of enterovirus in case subjects than in control subjects either before or after seroconversion for islet autoantibodies. it must be kept in mind that the study population consisted only of very young children ; thus, the conclusions might not apply to older individuals. this study is the first to use a quantitative assay for testing the viral load, enabling us to distinguish between low- and high - quantity infections and follow the dynamics of the viral load. our cohort includes only the highest risk hla - dq, -dr genotype and is thus more genetically restricted than previously reported studies. the generalizability of our results might be questioned if the hla genotype influenced the risk of enterovirus infection and/or immune response. however, preliminary results from our pilot study, which also included a group without the high - risk hla genotype, indicated only a moderate difference in frequency of fecal enterovirus shedding (11). to our knowledge, none of the previous cohort studies of enterovirus and islet autoimmunity has found any significant difference in association depending on hla genotype. we have also used a strict definition of islet autoimmunity, requiring repeated positivity for two or three islet autoantibodies, which is known to be strongly predictive of type 1 diabetes in genetically susceptible children. the number of case subjects and sample size could indeed be increased with a less strict definition of autoimmunity. however, the power of the study might actually decrease by including subjects with milder autoimmunity who are less likely to eventually develop type 1 diabetes. regular monthly sampling from all participants and high completeness are important strengths, because shedding duration is thought to be 34 weeks (12) ; the necessity of frequent stool sampling is further supported by our earlier study showing that excretion usually lasted 2) are unlikely. however, we can not exclude a possible role of a subgroup of enterovirus infections (particular strains) perhaps influencing viremia and ability to spread from the gut (the primary site of replication) to the target organ. this ability was seemingly unlinked to the viral load or duration of gut infections, as judged from our results. other relevant factors may potentially influence the level and duration of viremia and the ability to invade the islets and their -cells. in summary, there was no evidence to support a major role of frequency, timing, or quantity of fecal enterovirus shedding in prediction of advanced islet autoimmunity and no evidence that islet autoimmunity predicted increased susceptibility to fecal enterovirus shedding. further research should be focused on the character of viremia and the ability of enterovirus to invade the target pancreatic tissue in much larger sample sets. | objectiveto test whether the frequency of human enterovirus rna in fecal samples collected monthly from early infancy was associated with development of multiple islet autoantibodies in children with the highest risk hla genotype.research design and methodsindividuals carrying the hla drb1 0401-dqa1 03-dqb1 0302/drb1 03-dqa1 05-dqb1 02 genotype were identified at birth and followed with monthly stool samples from age 3 to 35 months. blood samples taken at age 3, 6, 9, and 12 months and then annually were tested for autoantibodies to insulin, gad 65 and ia-2. among 911 children, 27 developed positivity for two or more islet autoantibodies in two or more consecutive samples (case subjects). two control subjects per case subject were matched by follow - up time, date of birth, and county of residence. stool samples were analyzed for enterovirus with a semiquantitative real - time rt-pcr.resultsthe frequency of human enterovirus rna in stool samples from case subjects before seroconversion (43 of 339, 12.7%) did not differ from the frequency in control subjects (94 of 692, 13.6%) (p = 0.97). results remained essentially unchanged after adjustment for potential confounders, restriction to various time windows before seroconversion, or infections in the 1st year of life or after inclusion of samples collected after seroconversion. there was no difference in the average quantity of enterovirus rna or in the frequency of repeatedly positive samples. the estimated relative risk for islet autoimmunity per enterovirus rna positive sample during follow - up (nested case - control analysis) was 1.12 (95% ci 0.661.91).conclusionsthere was no support for the hypothesis that fecal shedding of enteroviral rna is a major predictor of advanced islet autoimmunity. |
let g be a graph with vertex set v(g) and edge set e(g). the number of vertices of a graph g is the order of g and is denoted by n. on the other hand, the number of edges of g is the size of g and is denoted by e. we denote the degree of vertex v in g by dg(v). for two subsets s, tv(g), let eg(s, t) denote the number of edges of g joining s to t. let c(g) and co(g) denote the number of components and the number of odd components of g, respectively. a k - factor of a graph g is a spanning subgraph h of g such that dh(x)=k for every xv(g). let d and s be disjoint subsets of v(g) and c be a component of g(ds). c is a k - odd component of g(ds) if k|c|+eg(s, v(c)) is odd. petersen obtained the following theorem, which is chronologically the first result on k - factors in regular graphs. theorem 1.1petersen every 3-regular, 2-connected graph has a 1-factor. every 3-regular, 2-connected graph has a 1-factor. for the existence of 1-factors in arbitrary graphs, theorem 1.2tutte a graph g has a 1-factor if and only if co(gs)|s| for all sv(g). a graph g has a 1-factor if and only if co(gs)|s| for all sv(g). a graph g has a k - factor if and only if, for all d, sv(g) with ds=0,g(d, s)=k|d|+xsdg(x)k|s|eg(d, s)qg(d, s;k)0,where qg(d, s;k) is the number of k - odd components c of g(ds). a graph g has a k - factor if and only if, for all d, sv(g) with ds=0,g(d, s)=k|d|+xsdg(x)k|s|eg(d, s)qg(d, s;k)0,where qg(d, s;k) is the number of k - odd components c of g(ds). the following theorem examines the existence of a 1-factor in vertex - deleted subgraphs of a regular graph. let g be a 2r - regular, 2r - edge - connected graph of odd order. for any vertex u in g, then graph gu has a 1-factor. let g be a 2r - regular, 2r - edge - connected graph of odd order. for any vertex u in g, then graph gu has a 1-factor. theorem 1.5katerinis let g be a 2r - regular, 2r - edge - connected graph of odd order. if m is an integer such that 1mr, then gu has an m - factor for any vertex uv(g). let g be a 2r - regular, 2r - edge - connected graph of odd order. if m is an integer such that 1mr, then gu has an m - factor for any vertex uv(g). in this paper, we set independent values to the degree and the edge - connectivity. theorem 1.6let m and r be two integers such that 2mr. let g be a 2r - regular, 2m - edge - connected graph with odd order. if one of the following conditions holds, then gv has a k - factor for all vv(g).(i)k is even and 2km ; (ii)k is odd, 3km and 2m > r. let m and r be two integers such that 2mr. let g be a 2r - regular, 2m - edge - connected graph with odd order. if one of the following conditions holds, then gv has a k - factor for all vv(g).(i)k is even and 2km ; (ii)k is odd, 3km and 2m > k is even and 2km ; k is odd, 3km and 2m > our results reveal an interesting behavior of a k - factor with respect to the parity of k and a difference between the case k=1 and k>1. in this section, we give the proof of theorem 1.6 and show that each hypothesis can not be weakened. let h = gu. by theorem 1.3, there exist disjoint subsets d and s of v(g)u such that (1)qh(d, s;k)+xs(kdhd(x))k|d|+2 so k|s|k|d|+2 and hence |s|>|d|. since v(h)=ds and |v(h)| is even, therefore (3)|s||d|+2. now since g is 2r - regular, by tutte s theorem we have xs(2rdgd(x))2r|d|, which implies 2r|s|xsdgd(x)2r|d|. therefore, 2r(|s|+1)xsdgd(x)2r|d|, and hence, (4)(2rk)|s|+k|s|+2rxsdgd(x)k|d|+(2rk)|d|. also xsdgd(x)=xsdgd(x)+dgd(u)=xsdhd(x)+eg(u, s)+dgd(u). therefore (4) becomes (5)k|d|+(2rk)|d|(2rk)|s|+k|s|+2rxsdhd(x)eg(u, s)dgd(u). now using (2) and eg(u, s)dgd(u)2r, (5) implies (6)(2rk)(|s||d|)2r2. moreover, since |s||d|+2 by (3), we can conclude from (6) that kr+1. that is a contradiction, we conclude k|s|k|d|+1, and hence |s|>|d|.since g is a 2m - edge - connected, 2r - regular graph, we have 2r|d|eg(d, v(gd))=eg(d, v(w))+eg(d, s)=eg(ds,v(w))eg(s,v(w))+eg(d, s)=eg(ds,v(w))(xsdgd(x)2eg(s,s))+(2r|s|xsdgd(x))=eg(ds,v(w))2xsdgd(x)+2eg(s,s)+2r|s|2m2(xsdhd(x)+eg(u, s)+dgd(u))+2eg(s,s)+2r|s|=2m2xsdhd(x)2dgd(u)+2eg(s, s)+2r|s|2m2xsdhd(x)+2r|s|2r. now we have 2r|d|eg(ds,v(w))2xsdgd(x)+2eg(s,s)+2r|s|=eg(ds,v(w))2(xsdhd(x)+eg(u, s)+dgd(u))+2eg(s,s)+2r|s|=eg(ds,v(w))2xsdhd(x)2dgd(u)+2eg(s, s)+2r|s|2mc(w)2xsdhd(x)2r+2r|s|(since g is 2m - connected)(2m2)c(w)+(2r2k)|s|2r+2k|d|+4(by inequality (1))4m2r+(2r2k)|s|+2k|d|. thus we have (2r2k)(|d||s|+1)2 m, from which it follows |d||s|. for every odd component c of w, the integer k|v(c)|+eh(v(c),s) is odd. since k is an even integer, eh(v(c),s) must be odd. thus eh(v(c),s)1 and xsdhd(x)qh(d, s;k). hence (1) implies k|s|k|d|+2, from which it follows that |s||d|+1, a contradiction.next assume condition (ii) of the hypothesis ; that is, k3 is odd and 2m > r., we have (9)|d||s|1k(qxsdhd(x)2), and qk+2 since |d|>|s|. by (8) and (9), there exist disjoint subsets d and s of v(g)u such that (1)qh(d, s;k)+xs(kdhd(x))k|d|+2. define s=s{u } and w=(gd)s. claim 1c(w)2. so k|s|k|d|+2 and hence |s|>|d|. since v(h)=ds and |v(h)| is even, therefore (3)|s||d|+2. now since g is 2r - regular, by tutte s theorem we have xs(2rdgd(x))2r|d|, which implies 2r|s|xsdgd(x)2r|d|. therefore, 2r(|s|+1)xsdgd(x)2r|d|, and hence, (4)(2rk)|s|+k|s|+2rxsdgd(x)k|d|+(2rk)|d|. therefore (4) becomes (5)k|d|+(2rk)|d|(2rk)|s|+k|s|+2rxsdhd(x)eg(u, s)dgd(u). now using (2) and eg(u, s)dgd(u)2r, (5) implies (6)(2rk)(|s||d|)2r2. moreover, since |s||d|+2 by (3), we can conclude from (6) that kr+1. that is a contradiction, so case 1 can not occur. now qh(d, s;k)1, and this implies (7)xs(kdhd(x))k|d|+1. we conclude k|s|k|d|+1, and hence |s|>|d|. since g is a 2m - edge - connected, 2r - regular graph, we have 2r|d|eg(d, v(gd))=eg(d, v(w))+eg(d, s)=eg(ds,v(w))eg(s,v(w))+eg(d, s)=eg(ds,v(w))(xsdgd(x)2eg(s,s))+(2r|s|xsdgd(x))=eg(ds,v(w))2xsdgd(x)+2eg(s,s)+2r|s|2m2(xsdhd(x)+eg(u, s)+dgd(u))+2eg(s,s)+2r|s|=2m2xsdhd(x)2dgd(u)+2eg(s, s)+2r|s|2m2xsdhd(x)+2r|s|2r. now (7) implies 2r|d|2m2xsdhd(x)2r+2r|s|2m2(k|s|k|d|1)2r+2r|s|. thus (2r2k)(|d||s|)2m2r+22k2r+2, from which it follows that |d||s|, a contradiction. hence case 2 also we have 2r|d|eg(ds,v(w))2xsdgd(x)+2eg(s,s)+2r|s|=eg(ds,v(w))2(xsdhd(x)+eg(u, s)+dgd(u))+2eg(s,s)+2r|s|=eg(ds,v(w))2xsdhd(x)2dgd(u)+2eg(s, s)+2r|s|2mc(w)2xsdhd(x)2r+2r|s|(since g is 2m - connected)(2m2)c(w)+(2r2k)|s|2r+2k|d|+4(by inequality (1))4m2r+(2r2k)|s|+2k|d|. thus we have (2r2k)(|d||s|+1)2 m, from which it follows |d||s|. for every odd component c of w, the integer k|v(c)|+eh(v(c),s) since k is an even integer, eh(v(c),s) must be odd. thus eh(v(c),s)1 and xsdhd(x)qh(d, s;k). hence (1) implies k|s|k|d|+2, from which it follows that |s||d|+1, a contradiction. next assume condition (ii) of the hypothesis ; that is, k3 is odd and 2m > r. now we obtain (8)|d||s|mrq11rxsdhd(x). by (1), we have (9)|d||s|1k(qxsdhd(x)2), and qk+2 since |d|>|s|. by (8) and (9) in the following discussion, let be the graph obtained from the complete graph k2r+1 by deleting a matching of size m. the bounds are sharp. let g1 be the bipartite graph with bipartition (u, w) obtained by deleting a matching of size m from k2r,2r. let g be the 2r - regular graph obtained by matching the 2 m vertices of degree 2r1 in to 2 m vertices of degree 2r1 in g1. clearly, g is 2m - edge - connected. now we show that gu contains no m-factor for all uuw. without loss of generality, suppose that uu note that qg(d, s;m)=1 if mm (mod 2) and qg(d, s;m)=0 if mm (mod 2). let h be the 2r - regular graph obtained by matching the 2r2 vertices of degree 2r1 in each of 2r1 disjoint copies of to the vertex set s of mr1. since co(hv(mr1))=2r1>|v(mr1)v|=2r3 for all vv(mr1), by theorem 1.2, gv contains no 1-factor for all vv(mr1). let r1 denote the complete bipartite graph k2r,2r1 with bipartition (u, w), where |u|=2r and |w|=2r1. take two copies of. match 4 m vertices of degree 2r1 of two copies of to 4 m vertices of degree 2r1 of k2r,2r1, and then add a matching of size r2 m to the rest vertices of degree 2r1 of k2r,2r1. this produces a 2r - regular, 2m - edge - connected graph r. let uu and r=ru. since k is odd, qr(d, s;k)=2 and hence we have k|d|k|s|+xsdrd(x)qg(d, s;k)=2<0. by theorem 1.3 | let k, m, and r be three integers such that 2kmr. let g be a 2r - regular, 2m - edge - connected graph of odd order. we obtain some sufficient conditions for gv to contain a k - factor for all vv(g). |
because of an increased detection rate of small renal masses (4 cm or less), partial nephrectomy (pn) as a nephron - sparing surgery (nss) has been conducted in a number of centers as the gold standard of care. in cautiously selected patients with tumor sizes of < 7 cm, pn can be considered feasible with superior renal functional preservation and comparable oncologic and survival outcomes to radical nephrectomy. currently, the application of pure laparoscopic or robotic approaches for minimally invasive nephron - sparing surgery (minss) has emerged as an alternative modality to the existing open approach because minss can provide several additional advantages, such as better cosmetic results, shorter periods of convalescence, and decreased blood loss, as well as comparable oncologic and functional outcomes. despite advantages with laparoscopic partial nephrectomy (lpn) and robot - assisted laparoscopic partial nephrectomy (ralpn), previously, we had devised the sliding loop technique (slt) by modifying the conventional sliding clip technique introduced by benway., and established that slt was feasible for renorrhaphy in a porcine model. the comparative analysis between the two techniques showed that slt is superior to the sliding clip technique in terms of lowered risks of renal parenchymal dehiscence, as it allows more tension following renorrhaphy. in this paper, based on our feasibility experiments in animal models, we attempted to verify the clinical feasibility and safety of slt renorrhaphy in patients undergoing ralpn. this study design and the use of patients ' information stored in the hospital database were approved by the institutional review board (irb) at the seoul national university hospital (snuh) (irb no. we were given exemption from obtaining informed consent by the irb because the present study is a retrospective study and personal identifiers were completely removed and the data were analyzed anonymously. our study was conducted according to the ethical standards laid down in the 1964 declaration of helsinki and its later amendments. we collected and reviewed the electronic medical records and surgical videos of 31 patients who had undergone ralpn for small renal masses by two surgeons (cwj and ck) at snuh between january 2014 and october 2014. the decision to perform ralpn was mainly determined according to tumor characteristics and patient 's individual preferences, so patients were not randomized based on distinct institutionalized standards or guidelines. under general anesthesia, then, the patients were turned to the flank position at approximately 60 degrees. in all cases, four robotic arm approaches, consisting of a 12-mm camera (30 degree downward lens) port and three robotic working ports (8 mm) were commonly used with two additional trocars for assistance, consisting of a 12-mm trocar located at the periumbilical area and a 5-mm trocar located at a point about 8 cm toward the caudal side from where camera port was used. the placement of trocars and their locations in ralpn is presented in fig. 1. gerota 's fascia was incised and the surrounding perirenal fat was removed to expose the renal mass. after the exact margin and depth of the tumor was confirmed with an intraoperative flexible ultrasound, the resection margin was outlined with electrocautery, with consideration for a sufficient margin of normal parenchymal tissue around the tumor. mannitol (0.5 mg / kg) was intravenously administered before hilar vessel clamping to prevent ischemic renal injury. after clamping of the renal artery with laparoscopic bulldog clamps, tumor excision was performed with cold scissors. the excised tumor was located above the liver or spleen for later retrieval using endobag at the end of surgery. after replacing the equipment of the 1st and 2nd robotic arms with robotic needle drivers, in order to ensure hemostasis and to repair any collecting system openings, bed suturing of the tumor resection site was conducted with continuous running suture using about 15 cm of 3 - 0 v - loc 90 (covidien, dublin, ireland) barbed suture material (fig. following bed suturing, biologic hemostatic tissue sealant (i.e., fibrilla) was applied to the parenchymal defect site. the slt used for renorrhaphy in our study was a modification of the conventional sliding clip technique. however, the setting up of suture material and the method of creating tension are slightly different between slt and the sliding clip technique. we designed a suture material of approximately 13 cm in length with a loop, which had a length of about 1 cm after being tied three times at the end of each 1 - 0 vicryl (ethicon inc., somerville, nj, usa) thread, and placed a tfe polymer pledget (7.0 mm3.0 mm) (ethicon inc.) and a 10-mm weck hem - o - lok (teleflex, research triangle, nc, usa) clip below the knot (fig. each prepared suture material was inserted through the renal capsule at intervals of approximately 1 cm, and the needle was passed through the premade loop (fig. 2b). by pulling the thread toward the direction of needle passage with a robotic needle driver, then, the surgeon pushed the hem - o - lok clip perpendicularly toward the renal parenchyma using another robotic needle driver to tighten the renorrhaphy (fig. 2c) clips were placed at each thread just above the second hem - o - lok clip to maintain the tension of sutures (fig. 2 ; video clip, supplementary material), secure tightness of renal parenchymal suturing can be obtained. following renorrhaphy, the renal artery was unclamped by a laparoscopic bulldog remover and the tumor resection bed was examined to check for additional bleeding. the excised tumor and perirenal fat were placed in an endobag and extracted via the 12-mm assistance port, which may be extended in cases of larger tumors. all trocars were removed under direct laparoscopic vision, and the fascia at the 12-mm camera and 12-mm port sites was closed with a thick nonabsorbable suture material to prevent the risk of herniation. this study design and the use of patients ' information stored in the hospital database were approved by the institutional review board (irb) at the seoul national university hospital (snuh) (irb no. we were given exemption from obtaining informed consent by the irb because the present study is a retrospective study and personal identifiers were completely removed and the data were analyzed anonymously. our study was conducted according to the ethical standards laid down in the 1964 declaration of helsinki and its later amendments. we collected and reviewed the electronic medical records and surgical videos of 31 patients who had undergone ralpn for small renal masses by two surgeons (cwj and ck) at snuh between january 2014 and october 2014. the decision to perform ralpn was mainly determined according to tumor characteristics and patient 's individual preferences, so patients were not randomized based on distinct institutionalized standards or guidelines. under general anesthesia, a nasogastric tube and foley catheter were inserted in the supine position. then, the patients were turned to the flank position at approximately 60 degrees. in all cases, basically, four robotic arm approaches, consisting of a 12-mm camera (30 degree downward lens) port and three robotic working ports (8 mm) were commonly used with two additional trocars for assistance, consisting of a 12-mm trocar located at the periumbilical area and a 5-mm trocar located at a point about 8 cm toward the caudal side from where camera port was used. gerota 's fascia was incised and the surrounding perirenal fat was removed to expose the renal mass. after the exact margin and depth of the tumor was confirmed with an intraoperative flexible ultrasound, the resection margin was outlined with electrocautery, with consideration for a sufficient margin of normal parenchymal tissue around the tumor. mannitol (0.5 mg / kg) was intravenously administered before hilar vessel clamping to prevent ischemic renal injury. after clamping of the renal artery with laparoscopic bulldog clamps, tumor excision was performed with cold scissors. the excised tumor was located above the liver or spleen for later retrieval using endobag at the end of surgery. after replacing the equipment of the 1st and 2nd robotic arms with robotic needle drivers, in order to ensure hemostasis and to repair any collecting system openings, bed suturing of the tumor resection site was conducted with continuous running suture using about 15 cm of 3 - 0 v - loc 90 (covidien, dublin, ireland) barbed suture material (fig. 2a). following bed suturing, biologic hemostatic tissue sealant (i.e., fibrilla) the slt used for renorrhaphy in our study was a modification of the conventional sliding clip technique. however, the setting up of suture material and the method of creating tension are slightly different between slt and the sliding clip technique. we designed a suture material of approximately 13 cm in length with a loop, which had a length of about 1 cm after being tied three times at the end of each 1 - 0 vicryl (ethicon inc., somerville, nj, usa) thread, and placed a tfe polymer pledget (7.0 mm3.0 mm) (ethicon inc.) and a 10-mm weck hem - o - lok (teleflex, research triangle, nc, usa) clip below the knot (fig. each prepared suture material was inserted through the renal capsule at intervals of approximately 1 cm, and the needle was passed through the premade loop (fig. by pulling the thread toward the direction of needle passage with a robotic needle driver, a second hem - o - lok clip was placed on the thread. then, the surgeon pushed the hem - o - lok clip perpendicularly toward the renal parenchyma using another robotic needle driver to tighten the renorrhaphy (fig. 2c) clips were placed at each thread just above the second hem - o - lok clip to maintain the tension of sutures (fig. 2 ; video clip, supplementary material), secure tightness of renal parenchymal suturing can be obtained. following renorrhaphy, the renal artery was unclamped by a laparoscopic bulldog remover and the tumor resection bed was examined to check for additional bleeding. the needle was cut and extracted. the excised tumor and perirenal fat were placed in an endobag and extracted via the 12-mm assistance port, which may be extended in cases of larger tumors. all trocars were removed under direct laparoscopic vision, and the fascia at the 12-mm camera and 12-mm port sites was closed with a thick nonabsorbable suture material to prevent the risk of herniation. under general anesthesia, a nasogastric tube and foley catheter were inserted in the supine position. then, the patients were turned to the flank position at approximately 60 degrees. in all cases, basically, four robotic arm approaches, consisting of a 12-mm camera (30 degree downward lens) port and three robotic working ports (8 mm) were commonly used with two additional trocars for assistance, consisting of a 12-mm trocar located at the periumbilical area and a 5-mm trocar located at a point about 8 cm toward the caudal side from where camera port was used. gerota 's fascia was incised and the surrounding perirenal fat was removed to expose the renal mass. after the exact margin and depth of the tumor was confirmed with an intraoperative flexible ultrasound, the resection margin was outlined with electrocautery, with consideration for a sufficient margin of normal parenchymal tissue around the tumor. mannitol (0.5 mg / kg) was intravenously administered before hilar vessel clamping to prevent ischemic renal injury. after clamping of the renal artery with laparoscopic bulldog clamps, tumor excision was performed with cold scissors. the excised tumor was located above the liver or spleen for later retrieval using endobag at the end of surgery. after replacing the equipment of the 1st and 2nd robotic arms with robotic needle drivers, in order to ensure hemostasis and to repair any collecting system openings, bed suturing of the tumor resection site was conducted with continuous running suture using about 15 cm of 3 - 0 v - loc 90 (covidien, dublin, ireland) barbed suture material (fig. 2a). following bed suturing, biologic hemostatic tissue sealant (i.e., fibrilla) was applied to the parenchymal defect site. the slt used for renorrhaphy in our study was a modification of the conventional sliding clip technique. however, the setting up of suture material and the method of creating tension are slightly different between slt and the sliding clip technique. we designed a suture material of approximately 13 cm in length with a loop, which had a length of about 1 cm after being tied three times at the end of each 1 - 0 vicryl (ethicon inc., somerville, nj, usa) thread, and placed a tfe polymer pledget (7.0 mm3.0 mm) (ethicon inc.) and a 10-mm weck hem - o - lok (teleflex, research triangle, nc, usa) clip below the knot (fig. each prepared suture material was inserted through the renal capsule at intervals of approximately 1 cm, and the needle was passed through the premade loop (fig. 2b). by pulling the thread toward the direction of needle passage with a robotic needle driver, then, the surgeon pushed the hem - o - lok clip perpendicularly toward the renal parenchyma using another robotic needle driver to tighten the renorrhaphy (fig. 2c) clips were placed at each thread just above the second hem - o - lok clip to maintain the tension of sutures (fig. 2 ; video clip, supplementary material), secure tightness of renal parenchymal suturing can be obtained. following renorrhaphy, the renal artery was unclamped by a laparoscopic bulldog remover and the tumor resection bed was examined to check for additional bleeding. the excised tumor and perirenal fat were placed in an endobag and extracted via the 12-mm assistance port, which may be extended in cases of larger tumors. all trocars were removed under direct laparoscopic vision, and the fascia at the 12-mm camera and 12-mm port sites was closed with a thick nonabsorbable suture material to prevent the risk of herniation. the characteristics and perioperative outcomes of the study cohort are listed in table 1. mean age and body mass index (bmi) were 48.5 years (range, 31 - 74 years) and 25.3 kg / m (range, 19.9 - 39.2 kg / m), respectively. a total of 16 and 15 tumors were located on right and left side, respectively. mean operative time and console time were 163.3 minutes (range, 90 - 240 minutes) and 114.8 minutes (range, 55 - 180 minutes), respectively. mean renorrhaphy time (rt), which was defined as the interval from the completion of bed suturing to renal artery declamping, was 9.0 minutes (range, 5 - 24 minutes). warm ischemic time (wit) showed a mean value of 22.6 minutes, ranging from 13 to 51 minutes. mean estimated blood loss was 330.7 ml (range, 50 - 1,100 ml). slt renorrhaphy was successfully conducted in all patients without conversion to robotic radical nephrectomy or open surgery. af ter renorrhaphy, there were no adverse events, such as dehiscence of approximated renal parenchyma, renal parenchymal tearing, and significant bleeding in any patients. mean preoperative serum creatinine (cr) level and estimated glomerular filtration rate (egfr) were 0.91 mg / dl and 87.5 ml / min/1.73 m, respectively, while their values at 1 month postsurgery were 0.93 mg / dl and 83.9 ml / min/1.73 m. however, there was no statistically significant perioperative change in either serum cr (p=0.184) and egfr (p=0.173). there were 3 cases (9.7%) of intraoperative transfusions (clavien - dindo grade ii) with a mean of two packed red cell blood units. however, there were no severe postoperative complications, such as delayed hemorrhage and urine leakage, as of the latest follow - up in all patients. for the past several years, open partial nephrectomy (opn) has been established as the preferred therapeutic modality for the management of small localized renal masses, providing comparable oncologic and survival outcomes, and superior benefit for the preservation of renal function to radical nephrectomy. since the introduction of minss using pure laparoscopic or robotic approaches in the urologic field, pn applying these minimally invasive techniques has been conducted by experienced surgeons in several centers and shown to have comparable outcomes to opn with relatively better cosmetic benefits and improved convalescence. in particular, ralpn is an emerging procedure that can provide many potential advantages, such as three - dimensional images, magnified vision, prevention of hand tremor, and fully articulating instruments. therefore, ralpn has become regarded as a viable means of surmounting the technical limitations related to lpn. even though minss has its advantages renorrhaphy should be performed in a time - sensitive manner due to its impact on wit. in any case, the shortening of wit is generally considered as a crucial factor for the preservation of renal function in the context of pn. renal reconstruction after tumor excision in opn has usually been performed with traditional tied - suture renorrhaphy. under direct vision through the open approach, knot tied - suturing for renorrhaphy can be easily performed while maintaining the suture line tension with direct hand control under acceptable wit. under the limitation of wit, intracoporeal knot tied - suture renorrhaphy in minss may be technically difficult and time - consuming even for skillful laparoscopic surgeons because it is necessary to control the needle and proceed with renorrhaphy with the dominant hand while maintaining the suture tension with the nondominant hand. therefore, to simplify renorrhaphy and reduce wit in minss, many knotless suturing techniques for renorrhaphy have been developed and applied in clinical practice. in particular, because knotless suturing with tight tension can be accomplished using several surgical clips including lapraty and hem - o - lok clips, renorrhaphy techniques using these tools have been studied by a number of investigators. orvieto. used simplified surgical techniques, including closure of the renal defect using lapraty clips, for 41 patients who received lpn and reported a wit of 29.7 minutes, but there were three cases of open conversion and a complication rate of 13.2%. v - hilar suture renorrhaphy, which is a form of knotless suturing using hem - o - lok clips, has been applied for renal hilar tumors in ralpn and shown to provide feasible results. recently, unidirectional barbed suture material (v - loc) has been applied to renorrhaphy in lpn and ralpn, and shown promising results in terms of reducing wit by approximately 20% in comparison with conventional polyglactin (vicryl) running sutures. furthermore, as demonstrated by our study, barbed suture materials can be used for intracorporeal repair of renal parenchymal defects in minss. reported the comparative results between two renorrhaphy methods, which are conventional one layer, interrupted, figure - of - eight (olif) suture and two layer, continuous, unknotted (tlcu) suture using hem - o - lok clip, in retroperitoneal lpn. it was revealed that tlcu renorrhaphy could provide better several advantages than olif renorrhaphy in terms of wit, hospital stay, and preservation of renal function measured by egfr. contrary to the renorrhaphy approaches mentioned above, " off - clamp, non - renorrhaphy " technique was more recently introduced in lpn. in this technique, biologic hemostatic agents such as floseal and tisseel are used in the bed of the excised mass as a hemostatic method following renal mass excision without renal artery clamping, and the perirenal fat and gerota 's fascia reapproximation are performed using 3 - 0 vicryl continuous sutures without renorrhaphy. although zero ischemia time was achieved, a high postoperative complication rate (25%), including delayed bleeding requiring blood transfusion, urine leak, and perirenal abscess, may be a concern. the slt applied to renorrhaphy in our study was a modification of the existing sliding clip technique, which is at present the most commonly used renorrhaphy method, especially in ralpn. in the case of sliding clip renorrhaphy, suture tension is created by sliding nonabsorbable weck clips (i.e., hem - o - lok clips) along the thread and adding lapraty clips to prevent the weck clips from sliding back. surgical clips used for renorrhaphy may slip or migrate and loosen the compression, causing approximated parenchymal dehiscence or rebleeding. to counter these drawbacks, we designed the suture material with a loop at the end of the thread, and identified the feasibility of slt through preclinical animal experiments using a porcine model. first, in our slt, the application of greater tension would be possible outside the renal parenchyma as well as at the site of the thread passed through the loop, while sliding clip technique provides tension only at the renal parenchyma through which the thread is passed. consequently, our slt can apply superior tension without injury, and allow tighter renal parenchymal suturing without dehiscence. in fact, it was confirmed in our previous porcine model experiment that mean distance between renal surfaces after slt renorrhaphy was significantly narrower than that of the conventional sliding clip technique (1.80 mm vs. 5.28 mm, p<0.001). second, in the current study, no postoperative complications have been observed as of the last follow - up for any patient. although there were 3 cases of intraoperative transfusions, these resulted from causes irrelevant to slt, including small vein bleeding during hilar dissection and low preoperative hemoglobin level. in contrast, it was reported that there were postoperative perirenal hematoma and anemia as complications related to sliding clip renorrhaphy. third, our mean wit was 22.6 minutes, which is comparable to that (22.8 minutes) of sliding clip technique and superior to other studies. there was no significant decrease in renal function as measured by serum cr level and egfr in this study. furthermore, sliding loop renorrhaphy could be rapidly conducted, as evidenced by the fact that mean rt was 9.0 minutes, accounting for less than half (about 40%) of the acceptable mean wit. therefore, slt in ralpn may be a feasible renorrhaphy method in the light of renal function preservation and time - saving advantages. the results of our study should be carefully interpreted in the light of several limitations. first, the study design was a case - series with a small volume, and was retrospective in nature, meaning some degree of bias was unavoidable. second, because the study included patients who underwent surgery performed by multiple surgeons (cwj and ck), there may be technical variations between surgeons that may have an influence on surgical outcomes. in fact, there were statistically significant differences among surgery - related parameters, including rt, wit, operative time, and console time. however, our study might be meaningful as an initial preliminary report demonstrating the potential feasibility of slt in real clinical practice. further large - scale, prospective, long - term follow - up, and direct comparative studies including other techniques will be required to confirm the clinical applicability of slt. in ralpn, slt was identified as a potentially feasible and safe method for renorrhaphy in terms of tightened renal parenchymal closure, rapid performance, renal function preservation, and low risk of complications in real clinical practice. further large scale, prospective, longterm follow - up, and direct comparative studies with other techniques are required to confirm the clinical applicability of slt. an accompanying video can be found in the ' urology in motion ' section of the journal homepage (www.kjurology.org). the supplementary data can also be accessed by scanning a qr code located on the fig. 2 of this article, or be available on youtube (http://youtu.be/ucxubkqxqza). | purposeto report the initial clinical outcomes of the newly devised sliding loop technique (slt) used for renorrhaphy in patients who underwent robot - assisted laparoscopic partial nephrectomy (ralpn) for small renal mass.materials and methodswe reviewed the surgical videos and medical charts of 31 patients who had undergone ralpn with the slt renorrhaphy performed by two surgeons (cwj and ck) between january 2014 and october 2014. slt renorrhaphy was performed after tumor excision and renal parenchymal defect repair. assessed outcomes included renorrhaphy time (rt), warm ischemic time, perioperative complications, and perioperative renal function change. rt was defined as interval from the end of bed suture to the renal artery declamping.resultsin all patients, sliding loop renorrhaphy was successfully conducted without conversions to radical nephrectomy or open approaches. mean renorrhaphy and warm ischemic time were 9.0 and 22.6 minutes, respectively. after completing renorrhaphy, there were no adverse events such as dehiscence of approximated renal parenchyma, renal parenchymal tearing, or significant bleeding. furthermore, no postoperative complications or significant renal function decline were observed as of the last follow - up for all patients. the limitations of this study include the small volume case series, the retrospective nature of the study, and the heterogeneity of surgeons.conclusionsfrom our initial clinical experience, slt may be an efficient and safe renorrhaphy method in real clinical practice. further large scale, prospective, long - term follow - up, and direct comparative studies with other techniques are required to confirm the clinical applicability of slt. |
ridi was set up in 1997 to coordinate registries for the incidence of type 1 diabetes in italy (17). all registries reported newly diagnosed cases of childhood type 1 diabetes using a special form, which includes each patient 's personal identification number, date of birth, sex, date of diagnosis (defined as the date when the first insulin injection was given), and municipality of residence. a diagnosis of type 1 diabetes was based on permanent insulin treatment within 6 months of diagnosis, fasting c - peptide levels 0.20 nmol / l, or positivity for insulinoma - associated protein 2, islet cell antibody, or gad antibody. each registry used at least two independent data sources for case ascertainment (17), and the completeness of ascertainment was estimated by the capture - recapture method. in a previous report (17), we presented incidence rates based on 3,602 incident case subjects aged 014 years, who had been registered during 19901999 by nine registries. to date, 12 registries regularly update incidence rates as part of ridi : seven regional registries (liguria, marche, umbria, lazio, abruzzo, campania, and sardinia) and five province registries (trento, torino, pavia, modena, and firenze - prato), covering an at - risk population of 3,321,459 children (39.7% of the whole italian population aged 014 years (a geographical distrubution map is available in an online appendix at http://diabetes.diabetesjournals.org/cgi/content/full/db10-0151/dc1). the registries of modena and trento contributed cases in periods 19962003 and 19982003, respectively, whereas registries of abruzzo, lazio, and umbria contributed data in periods 19901995, 19901999, and 19902001, respectively. data on at - risk residents in the geographical area covered by each registry for each year of the study period were obtained from the national institute for statistics. the presence of extra - poisson variability has been evaluated assuming a distribution of the true incidence rates through the likelihood ratio test. multilevel random intercept poisson regression models have been used to estimate the effects of sex, age (five 3-year age - groups : 02, 35, 68, 911, and 1214 years), calendar time (four 3-year periods : 19901992, 19931995, 19961998, 19992001 ; and one 2-year period : 20022003), and birth cohorts (nine 6-year birth cohorts : 1978, 1981, 1984, 1987, 1990, 1993, 1996, 1999, 2001 mid - years), taking into account the registry - level variance component. the models assume a distribution of the registry - level random intercept, accounting also for within - registry dependence. six models were fitted to data : sex ; sex, age ; sex, age, linear time trend (drift) ; sex, age, cohort ; sex, age, period ; and sex, age, period, cohort. the term drift denotes a temporal variation of rates that does not distinguish between the influences of two of the three temporal variables involved in the analysis. the test for trend in incidence rates used is the mantel extension of the armitage - cochran trend test (19). age - period - cohort models were fitted using apc.fit in r (http://www.r-project.org) (16). the presence of extra - poisson variability has been evaluated assuming a distribution of the true incidence rates through the likelihood ratio test. multilevel random intercept poisson regression models have been used to estimate the effects of sex, age (five 3-year age - groups : 02, 35, 68, 911, and 1214 years), calendar time (four 3-year periods : 19901992, 19931995, 19961998, 19992001 ; and one 2-year period : 20022003), and birth cohorts (nine 6-year birth cohorts : 1978, 1981, 1984, 1987, 1990, 1993, 1996, 1999, 2001 mid - years), taking into account the registry - level variance component. the models assume a distribution of the registry - level random intercept, accounting also for within - registry dependence. six models were fitted to data : sex ; sex, age ; sex, age, linear time trend (drift) ; sex, age, cohort ; sex, age, period ; and sex, age, period, cohort. the term drift denotes a temporal variation of rates that does not distinguish between the influences of two of the three temporal variables involved in the analysis. the test for trend in incidence rates used is the mantel extension of the armitage - cochran trend test (19). age - period - cohort models were fitted using apc.fit in r (http://www.r-project.org) (16). in the 19902003 period, 5,180 incident cases of type 1 diabetes were identified among children aged 014 years. all registries provided high estimated completeness of ascertainment (table 1). incidence rates by sex, age - group, calendar period, birth cohort, italian macro - area (north, center - south, island [sardinia ]), and registry are shown in table 1. the incidence rate was 12.26 per 100,000 person - years (95% ci 11.9312.60), with significantly lower risk in girls (11.35 [95% ci 10.9011.82 ]) than in boys (13.13 [12.6613.62 ]). in peninsular italy, the incidence rates were 9.53 (95% ci 9.229.84) overall, 9.97 (9.5410.42) in boys, and 9.06 (8.649.50) in girls. incidence rates of type 1 diabetes among italian children 014 years old in the years 19902003 by sex, age - group, calendar period, and geographical area of residence the likelihood ratio test showed substantial and statistically significant presence of overdispersion (p < 0.001). to account for this heterogeneity, multilevel random - intercept poisson regression models were fitted to data accounting for the registry - level variance component. in the regression analysis, after controlling for age, the rate ratio (rr) for girls with respect to boys was 0.87 (95% ci 0.820.92) ; corresponding values in peninsular italy and in sardinia were 0.91 (0.850.97) and 0.77 (0.700.85), respectively. the incidence steeply increased from the age - group 02 to the age - group 35 years (table 1), was quite similar in age - groups 68 and 1214, and peaked at 911 years. large geographical variations in type 1 diabetes incidence were evident (table 1), with the highest rate in sardinia, an intermediate rate in central - southern italy, and a high rate in northern italy, particularly in the trento province (18.67 per 100,000 person - years [95% ci 14.9723.27 ]). the lowest incidence rate was recorded in the campania region (8.10 [7.678.55 ]). an increasing temporal trend was evident both examining the whole italian area and the three italian macro - areas separately ; in sardinia we found a tendency toward lower risk in more recent years (fig. overall, the rates increased from 10.22 per 100,000 person - years in 19901992 to 14.78 per 100,000 in 20022003 (table 1). controlling for age and sex, the annual increase was 2.94% (95% ci 2.223.67). incidence rates of type 1 diabetes among italian children 014 years old in the years 19902003 in the three italian macro - areas (center - south, island [sardinia ], and north). table 2 shows age - specific incidence rates by calendar period (diagonals) and birth cohorts. an increasing temporal trend across calendar period was evident (p < 0.0001) : with respect to the calendar period 19901992, the rr was 1.15 (95% ci 1.061.25) in the period 19931995, 1.27 (1.171.39) in the period 19961998, 1.35 (1.241.47) in the period 19992001, and 1.40 (1.271.55) in the period 20022003. in all periods (diagonals), the highest incidence rates were found in the age - group 911 years ; in the last period (20022003) only, after a rapid increase from the first to the second age - group, rates remained similarly high from 6 years old onwards. age - specific incidence rates (per 100,000 person - years) of type 1 diabetes among italian children 014 years old in the years 19902003, by birth cohorts 19782001, and by calendar periods (diagonals) 19901992,, 20022003 number of cases are in parentheses. percent yearly increases, test for age - specific trends adjusted by sex over calendar periods, and estimated variance of the registry - level random intercept () are shown in the last column. likelihood ratio test of = 0 rr, rate ratio for each birth cohort taking as reference those born in 19871993 (1990 mid - year). with respect to birth cohort 19871993 (1990 mid - year), the incidence rates increased approximately linearly. as shown in table 2, the rr increased from 0.63 (95% ci 0.540.73) in birth cohort 19751981 (1978 mid - year) to 1.38 (1.061.80) in birth cohort 19992003 (2001 mid - year). multilevel poisson regression analysis was also used to assess whether the observed temporal increase in incidence rates could be due to period or cohort effects. the best model (model 3) included sex, age, and a linear time trend (drift). therefore, the variation over time has a linear component that can not be ascribed to either the calendar period or the cohort. indeed, the sex, age, and cohort model (model 4) and the sex, age, and period model (model 6) were not significantly better than the sex, age, and drift model (model 3). the estimated variance of the registry - level random intercept showed statistically significant heterogeneity between registries (p value of the likelihood ratio test < 0.001 in all models, table 3). comparison of different age - period - cohort models fitted to incidence rates of type 1 diabetes among italian children 014 years old in the years 19902003 each model is compared with the one above through the likelihood ratio test. likelihood - ratio test of = 0 ; p < 0.001 in all models. figure 2 shows incidence rates (on a logarithmic scale) over age - groups by birth cohorts, over calendar period by age - groups, and over birth cohorts by age - groups. results were similar when data were analyzed by geographical macro - areas (data not shown). incidence rates of type 1 diabetes among italian children 014 years old in the years 19902003 over age - groups by birth cohorts (mid - year of birth cohorts) (a), over calendar period by age - groups (b), and over birth cohorts by age - groups (c). results of the present analyses of the ridi study provide evidence of 1) large geographical variations in risk of childhood type 1 diabetes within italy, with high - risk areas in both sardinia and trento, in the north - east of italy ; 2) a significantly lower risk in girls than in boys, which is more pronounced in sardinia (23%) than in peninsular italy (9%) ; and 3) a linear increasing temporal trend, with an annual increment of 2.94%, affecting all age - groups and both sexes. in our dataset, however, it was impossible to ascribe this increase definitively to either a birth cohort or a calendar period effect. our findings are based on a national registry using standardized methods of ascertainment of incident cases, covering 40% of the italian population at risk ; moreover, the long time period on which this report is based allows us to add to current knowledge on epidemiology of type 1 diabetes. heterogeneity of type 1 diabetes risk has been reported worldwide, but italy is one of the countries with greater variation within it. indeed, incidence in peninsular italy is fourfold lower than in sardinia. in the latter, rates appeared to decline in more recent years, suggesting the possibility that an upper limit has been reached. the novel finding of the updated report of the ridi study is that a new high - risk area has been identified in the north - east of italy, in trento. the lower boundary of the ci of the incidence rate for trento is higher than the upper value of the ci of all other peninsular areas (with the exception of modena), and is similar to risk of children living in neighboring european areas, germany, and austria (45). whether this heterogeneity is due to either genetic or environmental factors is difficult to establish on the basis of available data and advocates further studies. moreover, the extension of the ridi project to other italian areas not covered by registries would provide a more accurate estimate of risk at national level. sex differences in risk of both type 1 and type 2 diabetes, with an almost two - fold higher risk in males than in females, have been previously reported in young italian adults (2021). the large number of cases on which this report is based allows us to provide evidence that the male excess in risk of type 1 diabetes is evident even in italian children, consistent with studies performed in high - risk areas (22). this finding could suggest a role for sex - linked differences in -cell function or in insulin sensitivity, with a higher rate of -cell exhaustion in male than in female subjects. this finding is consistent with a recent report from the registry of turin, showing a similar increase in incidence of childhood and adulthood diabetes since 1984, suggesting that widespread environmental determinants are involved in this phenomenon (18). this finding, however, is in contrast with studies suggesting that the incidence increase could be explained by a shift to a younger age at onset (7,1112,14,2324). in our study, we carried out an age - period - cohort analysis that included evaluation of both the drift (the linear variation of the incidence in time due to either a calendar period or a cohort effect) and the nonlinear components of the effects of the two temporal variables. we did not find evidence of nonlinear effects because there were no improvements in the models when the nonlinear components of calendar period or birth cohort were introduced. because the incidence increase was linear, it was not possible to distinguish between the effects of calendar period and birth cohort, and our data do not support the hypothesis of a shift to a younger age at onset. previously published age - period - cohort models in childhood diabetes temporal trend have shown inconclusive results. county in the years 19701985 (25). in 19781987 in sweden (13), in 19651984 in finland (14), and in 19732000 in norway (9) linear and nonlinear effects of the calendar period were evident, but no statistically significant cohort effect was found ; the finnish study (14) found only some evidence of younger age at diabetes onset. a later swedish study (24) found no evidence of an increase in incidence rates, whereas it strongly supported a cohort effect because of a steeper increase in younger age - groups. in 19702000 in denmark, a modest drift effect and a significant cohort effect were found, with increased risk for children born after 1985 (12). similarly, in 19782000 in yorkshire, u.k., increased incidence rates were associated with late birth cohorts (in particular 1985 and 1995) and with calendar periods (12). finally, the most recent eurodiab study (7) showed a statistically significant yearly increase in all age - groups (+ 5.4% in 04, + 4.3% in 59, and + 2.9% in 1014 years old) and a statistically significant interaction between calendar year and age - group, with the highest increase in the youngest age - groups. an analysis of the registry of turin in the period 19842003 for the age - group 029 years found a linear effect that could not be ascribed to either the calendar period or the birth cohort (18). the ridi study does not support the interpretation of the observed steady increase as a cohort or a calendar period effect, and reasoning on causal and biological plausibility of different hypotheses becomes crucial. because prevalence of childhood obesity is increasing over time, the accelerated hypothesis has been suggested as a possible explanation of the increasing temporal trend of type 1 diabetes (26). other studies have proposed that the decreasing early life exposure to infectious diseases, which typically occurred over the past three decades in developed countries, could be involved in this trend (27). such an increase can not be ascribed to either the calendar period or the birth cohort. | objectiveto investigate age - period - cohort effects on the temporal trend of type 1 diabetes in children age 014 years in italian registries.research design and methodsthis report is based on 5,180 incident cases in the period 19902003 from the registry for type 1 diabetes mellitus in italy (ridi). multilevel (random intercept) poisson regression models were used to model the effects of sex, age, calendar time, and birth cohorts on temporal trends, taking into account the registry - level variance component.resultsthe incidence rate was 12.26 per 100,000 person - years and significantly higher in boys (13.13 [95% ci 12.6613.62 ]) than in girls (11.35 [10.9011.82 ]). large geographical variations in incidence within italy were evident ; incidence was highest in sardinia, intermediate in central - southern italy, and high in northern italy, particularly in the trento province, where the incidence rate was 18.67 per 100,000 person - years. an increasing temporal trend was evident (2.94% per year [95% ci 2.223.67 ]). with respect to the calendar period 19901992, the incidence rates increased linearly by 15, 27, 35, and 40% in the following time periods (p for trend < 0.001). with respect to the 19871993 birth cohort, the incidence rate ratio increased approximately linearly from 0.63 (95% ci 0.540.73) in the 19751981 cohort to 1.38 (1.061.80) in the 19992003 cohort. the best model, however, included sex, age, and a linear time trend (drift).conclusionslarge geographical variations and an increasing temporal trend in diabetes incidence are evident among type 1 diabetic children in italy. age - period - cohort analysis shows that the variation over time has a linear component that can not be ascribed to either the calendar period or the birth cohort. |
clostridium difficile, a gram - positive, spore forming, and toxin - producing anaerobic rod bacterium, is the leading cause of hospital- and community - acquired antibiotic - associated diarrhea (aad) in the western world.1,2 c. difficile infection (cdi) is a growing worldwide health problem associated with substantial health care costs and significant morbidity and mortality.2 the incidence of cdi in the united states is rapidly increasing, and is estimated to affect approximately 1% of all hospitalized patients, increasing length of stay by 55%, and us health care system costs by usd13 billion annually.1,3,4 c. difficile - associated diarrhea (cdad) occurs most often in elderly and hospitalized patients receiving broad - spectrum antibiotics.2,58 antibiotic exposure is considered the most significant risk factor for cdi, and several drugs have been implicated in high cdad rates including cephalosporins, fluoroquinolones, penicillins, and clindamycin.1,911 other cdad risk factors include the use of proton - pump inhibitors, h2 antagonists, methotrexate, and the presence of existing gastrointestinal pathologies, such as inflammatory bowel disease.1,9 most approaches for the prevention of cdi to date have focused on limiting the spread of cdi. the most common methods are early detection and isolation, contact precautions, and appropriate hand hygiene. a number of studies have focused on the role of environmental cleaning to eradicate cdi in the health care environment, including the use of environment disinfectants as well as chlorhexidine patient baths, but have shown limited success.12,13 more recently, probiotics have been proposed for the prevention and treatment of a variety of gastrointestinal conditions, including diarrhea. normal intestinal flora is an important barrier against pathogenic bacteria, and disruption of this normal flora with antibiotic use can lead to diarrhea.14,15 probiotics are live microbial food supplements and have been hypothesized to counteract disturbances in intestinal flora and reduce colonization by pathogenic bacteria.14,15 various species of probiotics have been studied, with the most common being within the lactobacillus and bifidobacterium genus. more recently, saccharomyces boulardii, a yeast, has also been considered a probiotic.15 hempel reported a 42% reduction in the risk of developing aad with the use of probiotics (relative risk [rr ] = 0.58 ; 95% confidence interval [ci ], 0.500.68 ; p 65 years (1,470 patients receiving probiotics and 1,471 patients in the control group) across five hospitals in the united kingdom, and reported no significant reduction in cdad incidence with the use of a multistrain preparation of lactobacillus and bifidobacterium (rr = 0.71 ; 95% ci, 0.341.47 ; p=0.35). given the high morbidity and mortality associated with cdi, and conflicting results among published rcts, this meta - analysis provides an updated analysis on the efficacy of probiotics in the prevention of cdad, for both adults and children, in the hospital and outpatient settings. a comprehensive search of all published rcts evaluating probiotics to prevent cdad was conducted using pubmed, cochrane central registry of controlled trials, and google scholar (19662015). additional citations were searched, using the references of the articles retrieved from prior publications. the last search was conducted on october 10, 2015, and only articles written in english were considered., lactobacillus, bifidobacterium, saccharomyces, clostridium difficile, clostridium difficile - associated diarrhea, antibiotic associated diarrhea, and diarrhea. the following inclusion criteria were used : rcts comparing the use of any strain or dose of a specified probiotic with a placebo or no intervention control group, probiotics initiated within 3 days of starting antibiotics and continued for at least the entire duration of antibiotic treatment. in case of duplicate publications, only the most recent and updated report of the clinical trial was included. articles retrieved from the searches were assessed for eligibility, and data pertaining to patients, intervention, control groups, outcomes, and methodology were abstracted (figure 1). the clinical outcome of interest was incidence of cdad (diarrhea and positive stool cytotoxin assay or culture), among children and adults, in both the hospital and outpatient setting. for each trial, rr with a 95% ci for cdad was calculated. meta - analysis of the pooled data was performed using the comprehensive meta - analysis software version 3 (biostat, englewood, nj, usa). for studies reporting zero events in any group, a continuity correction factor of 0.5 if there was a zero event in both groups, the rr was not calculable and the study was excluded from the meta - analysis. both the fixed - effects model and random - effects model were considered, depending on the heterogeneity of the included studies. to assess the heterogeneity between studies, both cochrane s q statistic and i statistic were used. conversely, in the absence of heterogeneity, a fixed - effects model was assumed. the publication bias regarding the rr of cdad in patients receiving probiotics was first visually evaluated by a funnel plot, and further evaluated using egger s and begg s tests. a two - tailed p - value of < 0.05 was considered statistically significant. subgroup analysis was performed based on the genus of probiotics (lactobacillus, bifidobacterium, saccharomyces, and a mixture of probiotics), the age of the patient (pediatric patients < 18 years and adults), and the health care setting (hospitalized inpatient or outpatient). a comprehensive search of all published rcts evaluating probiotics to prevent cdad was conducted using pubmed, cochrane central registry of controlled trials, and google scholar (19662015). additional citations were searched, using the references of the articles retrieved from prior publications. the last search was conducted on october 10, 2015, and only articles written in english were considered., lactobacillus, bifidobacterium, saccharomyces, clostridium difficile, clostridium difficile - associated diarrhea, antibiotic associated diarrhea, and diarrhea. the following inclusion criteria were used : rcts comparing the use of any strain or dose of a specified probiotic with a placebo or no intervention control group, probiotics initiated within 3 days of starting antibiotics and continued for at least the entire duration of antibiotic treatment. in case of duplicate publications, only the most recent and updated report of the clinical trial was included. articles retrieved from the searches were assessed for eligibility, and data pertaining to patients, intervention, control groups, outcomes, and methodology were abstracted (figure 1). the clinical outcome of interest was incidence of cdad (diarrhea and positive stool cytotoxin assay or culture), among children and adults, in both the hospital and outpatient setting. meta - analysis of the pooled data was performed using the comprehensive meta - analysis software version 3 (biostat, englewood, nj, usa). for studies reporting zero events in any group, a continuity correction factor of 0.5 if there was a zero event in both groups, the rr was not calculable and the study was excluded from the meta - analysis. both the fixed - effects model and random - effects model were considered, depending on the heterogeneity of the included studies. to assess the heterogeneity between studies, both cochrane s q statistic and i statistic were used. conversely, in the absence of heterogeneity, a fixed - effects model was assumed. the publication bias regarding the rr of cdad in patients receiving probiotics was first visually evaluated by a funnel plot, and further evaluated using egger s and begg s tests. subgroup analysis was performed based on the genus of probiotics (lactobacillus, bifidobacterium, saccharomyces, and a mixture of probiotics), the age of the patient (pediatric patients < 18 years and adults), and the health care setting (hospitalized inpatient or outpatient). a total of 26 rcts evaluating the use of probiotics in the prevention of cdad were identified, involving a total of 7,957 patients (table 1). approximately 4,124 patients received probiotic supplementation, and 3,833 patients received either placebo or no treatment. among patients who received probiotics, 2,273 received lactobacillus, data on the incidence of cdad (defined as diarrhea and positive stool cytotoxin assay or culture) in both the probiotic group and the placebo group were reported in all trials. fewer patients in the probiotics group developed cdad, compared to the control group who received placebo or no supplement (62/4,124 [1.5% ] versus 145/3,833 [3.8% ]). there was no significant heterogeneity between trials (p=0.751, i=0.000), and a fixed - effects model was assumed. meta - analysis showed a significantly lower risk of developing cdad in the probiotics group compared to the control group (rr = 0.395 ; 95% ci, 0.2940.531 ; p<0.001 ; figure 2). subgroup analysis identified that lactobacillus, saccharomyces, or a mixture of probiotics were beneficial in reducing the risk of developing cdad (rr = 0.363 ; 95% ci, 0.2250.585 ; p<0.001 for lactobacillus ; rr = 0.415 ; 95% ci, 0.2170.796 ; p=0.008 for saccharomyces ; and rr = 0.418 ; 95% ci, 0.2630.664 ; p<0.001 for mixture of probiotics ; figure 3). probiotics were beneficial for both adults (rr = 0.405 ; 95% ci, 0.2940.556 ; p<0.001) and children (rr = 0.341 ; 95% ci, 0.1530.759 ; p=0.008 ; figure 4). hospitalized patients were more likely to benefit from probiotic use compared to outpatients (rr = 0.390 ; 95% ci, 0.2830.538 ; p<0.001 versus rr = 0.306 ; 95% ci, 0.0137.470 ; p=0.468 ; figure 5). most studies utilized stool culture and cytotoxin testing, or enzyme immunoassay (eia) in diagnosing c. difficile. a few studies were nonspecific and either did not state the technique utilized or simply stated that c. difficile was diagnosed according to hospital protocol. subgroup analysis based on the testing method (stool culture and cytotoxin versus eia) identified that probiotics were beneficial in reducing the risk of cdad with both the stool cytotoxin (rr = 0.271 ; 95% ci, 0.1310.561 ; p<0.001) and eia testing methods (rr = 0.431 ; 95% ci, 0.2880.647 ; p<0.001). there was no significant difference between the benefit derived from either testing method (p=0.536). a funnel plot was used to qualitatively assess for publication bias, and egger s and begg s tests were conducted to calculate publication bias. there was no obvious evidence of asymmetry on the funnel plot (figure 6). furthermore, there was no evidence of publication bias for the primary end point of this study (rr of cdad in patients receiving probiotics) by either the egger s (p=0.748) or begg s test (p=0.747). a total of 26 rcts evaluating the use of probiotics in the prevention of cdad were identified, involving a total of 7,957 patients (table 1). approximately 4,124 patients received probiotic supplementation, and 3,833 patients received either placebo or no treatment. among patients who received probiotics, 2,273 received lactobacillus, data on the incidence of cdad (defined as diarrhea and positive stool cytotoxin assay or culture) in both the probiotic group and the placebo group were reported in all trials. fewer patients in the probiotics group developed cdad, compared to the control group who received placebo or no supplement (62/4,124 [1.5% ] versus 145/3,833 [3.8% ]). there was no significant heterogeneity between trials (p=0.751, i=0.000), and a fixed - effects model was assumed. meta - analysis showed a significantly lower risk of developing cdad in the probiotics group compared to the control group (rr = 0.395 ; 95% ci, 0.2940.531 ; p<0.001 ; figure 2). subgroup analysis identified that lactobacillus, saccharomyces, or a mixture of probiotics were beneficial in reducing the risk of developing cdad (rr = 0.363 ; 95% ci, 0.2250.585 ; p<0.001 for lactobacillus ; rr = 0.415 ; 95% ci, 0.2170.796 ; p=0.008 for saccharomyces ; and rr = 0.418 ; 95% ci, 0.2630.664 ; p<0.001 for mixture of probiotics ; figure 3). probiotics were beneficial for both adults (rr = 0.405 ; 95% ci, 0.2940.556 ; p<0.001) and children (rr = 0.341 ; 95% ci, 0.1530.759 ; p=0.008 ; figure 4). hospitalized patients were more likely to benefit from probiotic use compared to outpatients (rr = 0.390 ; 95% ci, 0.2830.538 ; p<0.001 versus rr = 0.306 ; 95% ci, 0.0137.470 ; p=0.468 ; figure 5). most studies utilized stool culture and cytotoxin testing, or enzyme immunoassay (eia) in diagnosing c. difficile. a few studies were nonspecific and either did not state the technique utilized or simply stated that c. difficile was diagnosed according to hospital protocol. subgroup analysis based on the testing method (stool culture and cytotoxin versus eia) identified that probiotics were beneficial in reducing the risk of cdad with both the stool cytotoxin (rr = 0.271 ; 95% ci, 0.1310.561 ; p<0.001) and eia testing methods (rr = 0.431 ; 95% ci, 0.2880.647 ; p<0.001). there was no significant difference between the benefit derived from either testing method (p=0.536). a funnel plot was used to qualitatively assess for publication bias, and egger s and begg s tests were conducted to calculate publication bias. there was no obvious evidence of asymmetry on the funnel plot (figure 6). furthermore, there was no evidence of publication bias for the primary end point of this study (rr of cdad in patients receiving probiotics) by either the egger s (p=0.748) or begg s test (p=0.747). c. difficile was first described by hall and otoole23 as part of the intestinal microflora in neonates, and represents the leading cause of aad.24,25 prior to the year 2000, the rate of cdi in the usa did not vary greatly from year to year and has been relatively stable at 3040 cases per 100,000 population.26 in 2001, a sudden spike in cdad rates occurred, rising to approximately 50 cases per 100,000 population, and this incidence has continued to rise by approximately 25% each year.26 in a retrospective analysis of the us national hospital discharge survey between 2001 and 2010, reveles reported that the incidence of cdi among hospitalized patients nearly doubled from 4.5 cdi discharges per 1,000 total adult discharges in 2001 to 8.2 cdi discharges per 1,000 adult discharges in 2010. overall mortality also increased from 6.6% in 2001 to 7.2% in 2010.27 the rise in cdi has been attributed to various factors, including antibiotic resistance and the emergence of new c. difficile strains. the toxogenic c. difficile nap1/bi/027 strain was discovered in 2002, and found to be associated with more severe presentations, including toxic megacolon, leukemoid reaction, severe hypoalbuminemia, septic shock, and death.26,2830 several epidemic outbreaks occurred throughout north america during the mid-1900s and mid-2000s, which were attributable to this hypervirulent c. diffile strain.31,32 according to the society for healthcare epidemiology of america and the infectious diseases society of america, metronidazole remains the initial drug of choice for mild - to - moderate cdi, and oral vancomycin for severe cdi.26,28 however, recurrence and relapse of cdi, even after repeated cycles of antibiotic therapy, has emerged as a major public health problem.33 fecal microbiota transplantation has been increasingly studied.3436 cammarota conducted an rct involving 39 patients with recurrent cdi (20 patients receiving fecal transplantation and 19 patients receiving vancomycin) and reported significantly higher rates of resolution with the use of fecal transplantation (90% versus 26%, p<0.0001). given the high morbidity and mortality of the cdi, and the rising incidence despite adequate antibiotic therapy, efforts to prevent rather than treat cdi are paramount. several approaches have been suggested to prevent the transmission of c. difficile ; however, the mainstay remains early detection and isolation, contact precautions, and appropriate hand hygiene. the use of environmental cleaning disinfectants and chlorhexidine patient baths has also been studied, but has shown only limited success.12,13 probiotics, which are living commensal microorganisms and part of the normal host intestinal flora, has been shown to exert a protective effect on the gastrointestinal tract. the mechanism by which probiotics work has not been fully elucidated, but various mechanisms have been proposed. commensal bacteria inhibit enteric pathogens and may help suppress the growth and invasion of pathogenic bacteria, thereby improving intestinal barrier function.37 probiotics also modulate proinflammatory cytokines, which help regulate immune responses and maintain homeostasis.37,38 probiotic supplementation may also allow the acquisition and subsequent population of the gastrointestinal tract with normal commensal bacterial flora, modulating the inflammatory balance, and as a result, decrease the development of cdad in patients receiving antibiotics.37,38 probiotics have been extensively studied and shown to have a therapeutic role in various gastrointestinal conditions, including diarrhea. ford published a meta - analysis, which included 23 rcts involving 2,575 patients with irritable bowel syndrome, and reported that 21% of patients experienced improved symptoms with probiotics (rr = 0.79 ; 95% ci, 0.700.89 ; p<0.01). shen published a meta - analysis including 12 rcts involving 723 patients with inflammatory bowel disorder (649 had ulcerative colitis, 74 had crohn s disease). probiotics were effective in inducing remission in patients with ulcerative colitis (rr = 1.80 ; 95% ci, 1.362.39 ; p=0.01) ; however, it was less effective in patients with crohn s disease (rr = 0.89 ; 95% ci, 0.701.13 ; p=0.35).40 salari published a meta - analysis that included 19 rcts including 3,867 children with acute diarrhea, and reported a significant reduction in the duration of diarrhea (weighted mean difference [wmd ] 0.67 ; 95% ci, 0.95 to 0.38 ; p<0.0001) and the duration of fever (wmd = 0.18 ; 95% ci, 0.34 to 0.02 ; p=0.0246). although cdi is closely linked to the use of broad - spectrum antibiotics that disrupt the normal intestinal flora, probiotics as adjunct therapy along with antibiotics has been considered in the prevention of cdi and its complications. the current meta - analysis found that probiotics are associated with a 60.5% reduction in the incidence of cdad.17,18 the use of lactobacillus, saccharomyces, and a mixture of different probiotics all significantly reduced the risk of cdad (63.7%, 58.5%, and 58.2% risk reduction, respectively). there was a 59.5% risk reduction among adults and a 65.9% risk reduction among children. a 61% risk reduction was observed in hospitalized inpatients. in the lone study addressing outpatient treatment with probiotics, a 69.4% reduction was observed but was not statistically significant.42 the efficacy of probiotics has been widely studied in a variety of rcts ; however, the adverse events for probiotic therapy are not well documented. in a comprehensive systematic review conducted by the agency for healthcare research and quality, a third of the 622 published studies provided only nonspecific statements indicating that probiotics were well - tolerated, while most other articles indicated only the presence or absence of one or more specific adverse events, but failed to provide specific details.43 although some case studies have reported fungemia, bacteremia, and sepsis associated with probiotic use, the incidences of these adverse events are inconsistent and not statistically significant across studies.43 most studies included in this meta - analysis provided minimal nonspecific statements about adverse events, although some studies did report no statistical significance between patients receiving probiotics and the control group with respect to nausea, abdominal cramping, constipation, and urticaria.4447 several studies even noted that probiotics were associated with decrease in length of stay, fever, and nausea / vomiting.44,48 although the results of this meta - analysis are significant, there are limitations to these results, given the variation and heterogeneity of the rcts analyzed. the enrollment criteria used in each study differed with regard to patient age, comorbidities, and health care setting. the specific strain, dosage, and duration of probiotic also differed between studies, as well as the concurrent antibiotic regimen of the patients. the test used for diagnosing cdi and the follow - up period also varied between studies. additional studies to determine the optimal dose and particular strain of probiotic as well as the long - term effects of probiotics are required. most existing studies have included individuals of all age groups, and very few trials have specifically studied elderly patients who are at highest risk of developing cdi and cdad. furthermore, almost all studies explicitly stated that immunocompromised patients and patients with a history of major gastrointestinal surgery were excluded from the study, and the remainder were nonspecific as to whether or not these patients were included. additional randomized placebo - controlled trials more clearly assessing the safety and efficacy of probiotics in this particular population are needed. despite the aforementioned limitations, this study found that probiotic supplementation is a valuable adjunct in the routine care of patients receiving antibiotic therapy. given the high morbidity and mortality associated with cdi and cdad, the significant reduction in the incidence of cdad achieved with probiotic supplementation and the apparent lack of significant negative side effects should prompt physicians to consider these readily available, low - cost supplements as an effective and potentially routine therapy for patients receiving antibiotic therapy. | introductionclostridium difficile infection (cdi) is the leading cause of antibiotic - associated diarrhea. cdi has increased in incidence and severity over the past decade, and is a growing worldwide health problem associated with substantial health care costs and significant morbidity and mortality. this meta - analysis examines the impact of probiotics on the incidence of clostridium difficile - associated diarrhea (cdad) among children and adults, in both hospital and outpatient settings.methodsa comprehensive literature search of all published randomized control trials (rcts) assessing the use of probiotics in the prevention of cdad in patients receiving antibiotic therapy was conducted, and the incidence of cdad was analyzed.resultstwenty-six rcts involving 7,957 patients were analyzed. probiotic use significantly reduced the risk of developing cdad by 60.5% (relative risk [rr ] = 0.395 ; 95% confidence interval [ci ], 0.2940.531 ; p<0.001). probiotics proved beneficial in both adults and children (59.5% and 65.9% reduction), especially among hospitalized patients. lactobacillus, saccharomyces, and a mixture of probiotics were all beneficial in reducing the risk of developing cdad (63.7%, 58.5%, and 58.2% reduction).conclusionprobiotic supplementation is associated with a significant reduction in the risk of developing cdad in patients receiving antibiotics. additional studies are required to determine the optimal dose and strain of probiotic. |
this retrospective study included 112 eyes of 83 consecutive patients with mature cataracts who all had extracapsular cataract extraction with scoli between may and december 2008. all surgeries were performed using topical anesthesia (proparacaine hydrochloride, 4 times in 15 min before surgery) by a single experienced surgeon (jun yang). a 1.0-mm paracentesis is made at 2 oclock in the limbus with a 15 blade while the eye is stabilized and pushed downward by grasping in the limbus with a 0.12 toothed forceps. the eye is stabilized by grasping in the paracentesis. a composite photograph of making a subconjunctival limbus oblique incision, (a) a paracentesis is made with a 15 blade, (b) the 3.0 mm keratome is placed parallel to the posterior sclera, 0.5 mm behind the conjunctival - limbal insertion, 90 to the right side of the paracentesis, (c) a 3.0 mm transconjunctival sclerocorneal tunnel is fashioned with a keratome, (d) the dissected pocket is extended temporally, (e) the pocket is extended nasally up to the limbus, (f) an inverted is created a uniplanar transconjunctival tunnel (oblique plane incision) is fashioned with a 3.0 mm keratome (sharpoint, usa), 90 to the right side of the side port (oblique location). the knife is placed parallel to the posterior sclera, 0.5 mm behind the limbal vascular arcades, and pressure is slightly applied to indent the limbus with the knife, pushing forward to begin the transconjunctival tunnel incision [fig. 1b ]. when the knife tip approach 1 mm into clear cornea, the eyeball is rotated slightly backward to enable the knife tip penetrate the descemet 's membrane. the knife is then inserted until the shoulders are at the internal corneal incision [fig. a subconjunctival limbal tunnel is subsequently created with an angled bevel - up crescent blade (sharpoint, usa) beneath the conjunctival / tenon 's tissue. the dissected pocket should extend temporally and nasally up to, but should not cut the limbal vascular arcades on either side. its transverse extent is greater in the cornea (9.0 mm) than in the limbal opening (7.0 mm) [fig. the crescent blade is then used to cut remaining adherent tenon 's tissue in a way perpendicular to corneal limbus to create an inverted l conjunctival pocket. with two straight edges being 3 mm and 4 mm in length thus, a limbal tunnel covered partially by conjunctiva - limbal attachment is created. as only little bleeding occurs, cautery is typically not necessary. a 7.0 mm capsulorhexis is performed using a pair of capsulorhexis forceps [fig. a sinskey hook is used to extract one pole of the nucleus and rotate in a clockwise direction, until a half of the nucleus is in the anterior chamber [fig. 2b ]. using toothed forceps to grasp the side incision and rotate the eye downward a little, a vectis may be passed into the anterior chamber and under the half - dislocated nucleus [fig. the external foramen of the tunnel can be opened a little using downward pressure of the heel of the vectis [fig. 2d ]. the bulk of the nucleus can then be lifted and drawn into the tunnel [fig. when the nucleus is passing through the incision, epinucleus may strip off, or the nucleus may fragment. however, in most cases, the nucleus should be delivered in whole [fig. 2f ]. a composite photograph of extracting the nucleus outside the capsular bag and subconjunctival limbus incision, (a) 6.0 mm capsulorhexis is performed using a pair of capsulorhexis forceps, (b) a sinskey hook is used to extract one pole of the nucleus outside the capsular bag, (c) a vectis is passed into the anterior chamber and under the half - dislocated nucleus, (d) the external foramen of the tunnel is opened a little using downward pressure of the heel of the vectis, (e) the bulk of the nucleus is passing through the conjunctival pocket, (f) the whole nucleus is delivered from the eye, (g) a 5.5 mm 3-piece pmma lens is implanted into the bag, (h) final redeepening of the anterior chamber is done, (i) a limbal incision partly covered by conjunctiva - limbal attachment is created. 1 = corneal lip ; 2 = limbal cut ; 3 = inverted l conjunctival opening after cortex is removed, a 5.5 mm 3-piece pmma lens is implanted in the bag [fig. final deepening of the anterior chamber (with 500 mg/100 ml vancomycin in ringer lactate solution) (about 1.0 mg) is done to reach an intraocular pressure slightly higher than normal (t + 1) [fig. the uncorrected and best - corrected visual acuity (bcva) was measured 3 months after surgery. the central corneal endothelium was examined with a specular microscope (sp 8000 konan medical inc). surgically induced astigmatism was calculated using the vector analysis method based on the keratometry results of corneal topography examinations (orbscan iii, bausch and lomb inc). postoperative topographic changes were determined by subtracting the preoperative readings from the postoperative numerical map readings. a 1.0-mm paracentesis is made at 2 oclock in the limbus with a 15 blade while the eye is stabilized and pushed downward by grasping in the limbus with a 0.12 toothed forceps. the eye is stabilized by grasping in the paracentesis. a composite photograph of making a subconjunctival limbus oblique incision, (a) a paracentesis is made with a 15 blade, (b) the 3.0 mm keratome is placed parallel to the posterior sclera, 0.5 mm behind the conjunctival - limbal insertion, 90 to the right side of the paracentesis, (c) a 3.0 mm transconjunctival sclerocorneal tunnel is fashioned with a keratome, (d) the dissected pocket is extended temporally, (e) the pocket is extended nasally up to the limbus, (f) an inverted conjunctival pocket with an opening of 5 mm is created a uniplanar transconjunctival tunnel (oblique plane incision) is fashioned with a 3.0 mm keratome (sharpoint, usa), 90 to the right side of the side port (oblique location). the knife is placed parallel to the posterior sclera, 0.5 mm behind the limbal vascular arcades, and pressure is slightly applied to indent the limbus with the knife, pushing forward to begin the transconjunctival tunnel incision [fig. 1b ]. when the knife tip approach 1 mm into clear cornea, the eyeball is rotated slightly backward to enable the knife tip penetrate the descemet 's membrane. the knife is then inserted until the shoulders are at the internal corneal incision [fig. a subconjunctival limbal tunnel is subsequently created with an angled bevel - up crescent blade (sharpoint, usa) beneath the conjunctival / tenon 's tissue. the dissected pocket should extend temporally and nasally up to, but should not cut the limbal vascular arcades on either side. its transverse extent is greater in the cornea (9.0 mm) than in the limbal opening (7.0 mm) [fig. the crescent blade is then used to cut remaining adherent tenon 's tissue in a way perpendicular to corneal limbus to create an inverted l conjunctival pocket. with two straight edges being 3 mm and 4 mm in length thus, a limbal tunnel covered partially by conjunctiva - limbal attachment is created. as only little bleeding occurs, cautery is typically not necessary. a 7.0 mm capsulorhexis is performed using a pair of capsulorhexis forceps [fig. a sinskey hook is used to extract one pole of the nucleus and rotate in a clockwise direction, until a half of the nucleus is in the anterior chamber [fig. 2b ]. using toothed forceps to grasp the side incision and rotate the eye downward a little, a vectis may be passed into the anterior chamber and under the half - dislocated nucleus [fig. the external foramen of the tunnel can be opened a little using downward pressure of the heel of the vectis [fig. 2d ]. the bulk of the nucleus can then be lifted and drawn into the tunnel [fig. when the nucleus is passing through the incision, epinucleus may strip off, or the nucleus may fragment. however, in most cases 2f ]. a composite photograph of extracting the nucleus outside the capsular bag and subconjunctival limbus incision, (a) 6.0 mm capsulorhexis is performed using a pair of capsulorhexis forceps, (b) a sinskey hook is used to extract one pole of the nucleus outside the capsular bag, (c) a vectis is passed into the anterior chamber and under the half - dislocated nucleus, (d) the external foramen of the tunnel is opened a little using downward pressure of the heel of the vectis, (e) the bulk of the nucleus is passing through the conjunctival pocket, (f) the whole nucleus is delivered from the eye, (g) a 5.5 mm 3-piece pmma lens is implanted into the bag, (h) final redeepening of the anterior chamber is done, (i) a limbal incision partly covered by conjunctiva - limbal attachment is created. 1 = corneal lip ; 2 = limbal cut ; 3 = inverted l conjunctival opening after cortex is removed, a 5.5 mm 3-piece pmma lens is implanted in the bag [fig. final deepening of the anterior chamber (with 500 mg/100 ml vancomycin in ringer lactate solution) (about 1.0 mg) is done to reach an intraocular pressure slightly higher than normal (t + 1) [fig. patients were examined preoperatively and on 1-day, and after 3 months postoperatively. the uncorrected and best - corrected visual acuity (bcva) was measured 3 months after surgery. the central corneal endothelium was examined with a specular microscope (sp 8000 konan medical inc). surgically induced astigmatism was calculated using the vector analysis method based on the keratometry results of corneal topography examinations (orbscan iii, bausch and lomb inc). postoperative topographic changes were determined by subtracting the preoperative readings from the postoperative numerical map readings. the mean age of the 83 patients was 67.2 years 9.3 (sd) (range 68 to 86 years). there were 41 male patients (40.2%) and 42 female patients (59.8%). preoperative uncorrected visual acuity in all 112 eyes ranged from light perception to 20/200. in 73 eyes (65.2%), the mean surgical time was 3.75 1.1 min (range 1.5 to 4.5 min). sutureless wounds were achieved in all but 2 patients, who required 2 sutures to close the main wound. the intraoperative complications included hyphema in 3 eyes (2.7%), irregular conjunctiva tear in 10 eyes (8.9%), iridodialysis in 2 eyes (1.8%), descemet 's membrane detachment in 5 eyes (4.5%), posterior capsular rupture and zonular dialysis in 2 eyes (1.8%). on the 1 day postoperatively, folds in descemet 's membrane were observed in 13 eyes (11.6%) ; 9 were moderate corneal edema limited to the incision area (8.0%). a transient increase in intraocular pressure (> 25 mm hg) was observed in 11 eyes (9.8%). fifteen patients (13.4%) reported a minor superior foreign - body sensation, which resolved within the first 48 h of surgery. no other significant intraocular complications such as endophthalmitis, retinal detachment or epithelial ingrowth occurred in the study. there are 67% patients at 1-day and 81% at the 3 months post - operative visit achieved a ucva of 20/40 or better, 91% patients at the 3 months post - operative visit achieved a bcva of 20/20 or better [figs. 3 and 4 ]. two eyes with a post - operative corrected visual acuity of 20/200 or worse had chorioretinal atrophic changes in the macula [figs. 3 and 4 ]. frequency histogram of ucva 1-day and 3-mon postoperatively frequency histogram of bcva 3-mon postoperatively the mean preoperative and postoperative 3 months astigmatism was 0.71 d 0.55 d, 1.5 d 0.73 d, respectively. the mean (sd) sia in 25 patients preoperative astigmatism within 0.5d was -0.62d 0.41d at a mean axis of 135.0 15 calculated using the vector analysis method [fig. 5 ]. the frequency distribution of sia by vector analysis at three months postoperatively the mean preoperative endothelial cell density per millimeter squared were 2300 313, 3 months after surgery were 2200 475 (p < 0.05). the average number of cells lost per patient was 114 21 per millimeter squared. the present study reports a novel incision technique (scoli) and its outcomes in manual cataract extraction for mature cataracts. in this study, 98% eyes (110/112) of the wounds were self - sealing, 81% eyes (68/84) achieved ucva of 20/40 or better at the 3-month follow - up. there was a low rate (4.2%) of endothelial cell loss, which was compared favorably with endothelial cell loss reported for manual sics, especially for large and dense cataracts. despite an average surgical time of 3.75 min per case, the surgical complication rate was low, with less than a 2% rate of vitreous loss. clinical outcomes of this study demonstrated that the scoli technique is a safe and effective alternative to msics for mature cataracts. for standard extracapsular cataract extraction (ecce), the surgical limbus is the primary choice for incision site. however, this entrance approach ca nt yield a long enough tunnel for a self - closed wound. in msics, the external incision is moved to a more posterior location to promote better self - sealing of the wound. while this incision may be sufficient for cataracts of mild to moderate density, it is sometimes difficult to deliver a large, hard nucleus without fragmentation. in scoli, the location of the external entry has been shifted back toward the limbus approach. the shorter tunnel length (1.5 mm) permits easy delivery of a large nucleus. in this series, the nucleus was delivered in whole in 108 eyes (96.4%). in 3 eyes, if it is a small fragment, it can be removed by hydroexpression ; if it is large, it should be pushed back into the anterior chamber with viscoelastic before reattempting. only 1 eye may need nucleus fragmentation with the second instrument through the side - port incision. it has been found that the shorter tunnel in scoli allows easy delivery of large nucleus safely and effectively using a vectis. this subconjunctival limbal incision is essentially composed of 3 staggered incisions in alignment as follows : the innermost corneal lip being 9 mm in width ; the intermediate scleral - corneal cut being 7 mm in width and the outermost inverted 2i ]. with a smaller conjunctival pocket (5 mm in width), the limbus - corneal tunnel is covered by conjunctive / tenon 's tissue [fig., the natural elasticity of conjunctival - limbal attachments enhances the wound stability by decreasing sliding between the two lamina of the tunnel. besides, conjunctival tissue heals quickly, is usually subject to fibrosis / coagulation, and forms rather strong adhesive bonds making the incisions more secure. thanks to the elasticity of the conjunctival tissue, the smaller size conjunctival opening (5.0 mm in width) does not constitute a barrier to nucleus expression and lens implantation [fig. 2e and g ]. the key step in this technique involves making a tunnel length proportional to the nuclear sclerosis and widening of the limbus tunnel beneath the conjunctival pocket. in msics, here we created the scoli from inside to out and this needed a great deal of surgical expertise. though difficult, it gives increased wound integrity and is quick in the hands of experienced surgeon. in a high volume setting, the scoli, because of its location and its architecture, induces less iatrogenic astigmatism. the super - oblique incision contributes to less surgically induced astigmatism (sia) than with a superior incision. the scoli technique is free of cautery, minimizing the damage to sclera and its associated astigmatism. importantly, as mentioned above, the scoli gives increased wound integrity. where we keep the integrity of tunnel intact, without stretching or tearing of the internal incision, we can minimize sia. in our series, vector analysis demonstrated a mean sia of -0.62d 0. 41d post - operative 3 months, which is similar to others reports. local anesthesia is routinely used in msics, primarily because of intraoperative pain resulting from trauma / cautery as well as placing a bridle suture for akinesia. in scoli, less surgical trauma to conjunctive / sclera decrease the peroperative requirements for analgesia. meanwhile, the side paracentesis enables the surgeon to control the movement of the eyeball using a forceps, decreasing the necessity for a rectus bridle suture. these merits contribute to the less - invasive characteristics and bring the trend toward topical anesthesia. in fact, this limbal incision can be easily extended if conversion to conventional ecce is necessary. conversely, by enlarging the incision, we can easily convert phacoemulsification into sclol with this technique, especially in eyes with large and hard nuclei. in conclusion, we present here a novel cataract incision technique that allows removal of a large, hard nucleus via a shorter sutureless incision. this scoli is free of performing a peritomy and can be performed under topical anesthesia, decreasing operative time and minimizing the damage to limbal architecture. therefore, this technique has the potential to serve as safe and effective technique for mature cataracts. | aims : to report the technique and outcomes of sutureless manual cataract extraction via a subconjunctival limbus oblique incision for mature cataracts.materials and methods : this retrospective study comprised of 112 eyes of 83 patients with mature cataract who all had manual cataract extraction via a subconjunctival limbus oblique incision. a transconjunctival tunnel is fashioned with a 3.0 mm keratome, 0.5 mm behind the limbal vascular arcades. a limbal tunnel, with a transverse extent of 9 mm in the cornea and 7.0 mm in the limbus, is created beneath the conjunctival / tenon 's tissue using an angled bevel - up crescent blade. outcome measures included visual acuity, intraoperative complications, surgically induced astigmatism, endothelial cell loss rate and surgery time.results:self-sealing wound was achieved in 112 eyes (98.2%). the nucleus was delivered in whole in 108 eyes (96.4%). intraoperative complications included hyphema in 3 eyes (2.7%), iridodialysis in 2 eyes 1.8%), posterior capsular rupture and zonular dialysis in 2 eyes (1.8%). at the 3-month follow - up, 91% patients achieved a best - corrected visual acuity of 20/20 or better, the mean of surgically induced astigmatism was -0.62 0.41 diopters and endothelial cell loss was 4.2%. average surgical time was 3.75 min per case.conclusion:this subconjunctival limbus oblique incision has the potential to serve as safe and effective technique for mature cataracts. |
micrornas (mirnas) are small (2123 nt) non - coding rnas that are important regulators of gene expression. they act by base pairing with partially complementary sites in the mrna of their targets, and either inhibit translation into protein or decrease the stability of the transcript (1,2). the number of currently known mirnas in mammalian systems has risen dramatically in the last year, and predictions about their total number in humans amount up to 1000 (3). mirnas are transcribed as long primary transcripts (pri - mirnas), some of them being polycistronic, which are processed in the cell nucleus by an enzyme called drosha, yielding precursor mirnas (pre - mirnas) that exhibit a characteristic stem loop sequence. these are exported into the cytosol where mature mirnas are generated by the rnase iii - type enzyme dicer, producing a small double - stranded rna from which one strand (called mirna) is quickly degraded, releasing the small single - stranded mirna (4). translational inhibition, which seems to be the major mode of action in animals, is performed by a riboprotein complex called rna - induced silencing complex (risc) consisting of the mirna and proteins of the argonaute family (5,6). mirnas are involved in several cellular processes, including cellular differentiation (7,8), organism development (9,10) and apoptosis (11,12). while all of these are conserved in metazoans, the number of conserved mirnas between mammals suggests that there are additional functions only found in vertebrates (13), e.g. controlling hematopoietic differentiation (14). recent studies provide growing evidence for the involvement of mirnas in cancerogenesis (1518). the advantages of argonaute over current databases on mirnas are as follows : it has information on (i) origin of a mirna, i.e. in which host gene it is encoded, (ii) its expression in different tissues and its known or proposed function, (iii) its potential target genes including gene ontology annotation as well as (iv) on mirna families and proteins known to be involved in mirna processing. the first release of argonaute contains 839 mirnas from human, mouse and rat. in summary, argonaute is a comprehensive database for mammalian mirnas collecting all available latest information about mirna expression, pre - mirna sequence and length of the stem loop region, function and potential target genes, and is thus providing a valuable platform for quick and efficient access to all important information on the fast growing field of mirna research. through a user - friendly web interface at, as main sources for mirnas and corresponding annotation, we used the mirbase sequence database (19). we further checked noncode (20) and rnadb (21) for mirnas that were not contained in mirbase::sequences like hsa - mir-350 and hsa - mir-196 - 4. these have been reported in literature (22), but the only information given there is that they are contained within intron 6 of ensg00000143702. owing to the lack of other information, we also decided not to include them in argonaute. for individual mirnas with direct support in the literature, the details (sequence, accession number, chromosomal location, etc.) additional annotation, especially on confirmed or predicted targets of mirnas and on tissue specificity of expression, was entered manually based on primary literature. literature scanning is done on a regular basis using my ncbi (cubby) in order to keep the contents of the database up - to - date. a list of studies used for the current version of argonaute is reported in supplementary data (supplementary table 1). information on mirnas and their targets is contained in different objects in order to be able to map the many - to - many relationships correctly. for each mirna target relation, individual reference to the literature is reported which is kept in a separate table to minimize redundancy. possible queries include exact or wildcard search for an mirna name, batch retrieval based on a text file with mirna names and browsing the entire contents of the database. a selection panel allows to tailor information retrieval by selecting or deselecting fields to be displayed in the output. results of queries are presented in two different tables (figure 1), one on the mirnas and one on the targets (provided that target information has been selected for display). if the box annotation for targets is unchecked, all predicted targets for a given mirna are presented in one row of the result table, together with all references. if it is checked, there is one row per target gene, including the reference that reported the mirna target relationship, so it can be tracked where the evidence on the relationship has come from. target gene identifiers are linked to ensembl to get information on the transcript assumed to be regulated by a certain mirna. the result field origin is linked to a third table (figure 1, inset) providing comprehensive results on the gene the mirna is contained in (many mirnas are hosted in introns of protein - coding genes). additionally, a detailed list of proteins involved in mirna processing can also be obtained from the homepage. in order to facilitate the characterization of target genes we developed an information retrieval system mainly based on several ncbi sources as well as unigene, swiss - prot and ensembl. this allows us to perform a comprehensive search for each target gene by clicking on the gene name (figure 2). the major advantage of our interface is that it generates an automated pubmed search using all synonyms of the individual gene (figure 2, inset). this search can be tailored to an organ - specific search or a search for transgenes / knock - outs. furthermore, information on the availability of the target gene on affymetrix chips is given. the system is implemented as a php - based web interface to an mysql database. it is capable of generating automatic search strings for the target gene in pubmed using several criteria. it is possible to save the results of the search as an excel table for later use. furthermore, the system is able to process a list of genes, which is very convenient when analyzing results of microarray experiments or any experiments yielding a group of related genes. currently, argonaute hosts information on 839 mammalian mirnas from human, mouse and rat, and reports 312 mirna target relationships. we continue to add further information as reported in primary literature and synchronize with mirbase::sequence db (microrna registry) every 4 months. we are currently developing an interface for sequence - based search that allows to find potential target sites for mirnas in the query sequence based on established mirna target - prediction algorithms. the upper table provides comprehensive information on the mature mirna and its precursor, the middle table has information on predicted targets of hsa - mir-328. the inset shows additional information on the origin of this mirna, i.e. the gene it is encoded in. the table provides comprehensive information on the gene, including affymetrix probe set ids, cross - references to other databases, synonyms and textual summary information. the links to pubmed search by all synonyms of the gene, either alone (inset) or in combination with (transgen or knockout or knock - out) and (animals[mh ] or animal [mh]) to find reports on genetically modified organisms where this gene is altered or deleted. | micrornas (mirnas) constitute a recently discovered class of small non - coding rnas that regulate expression of target genes either by decreasing the stability of the target mrna or by translational inhibition. they are involved in diverse processes, including cellular differentiation, proliferation and apoptosis. recent evidence also suggests their importance for cancerogenesis. by far the most important model systems in cancer research are mammalian organisms. thus, we decided to compile comprehensive information on mammalian mirnas, their origin and regulated target genes in an exhaustive, curated database called argonaute (). argonaute collects latest information from both literature and other databases. in contrast to current databases on mirnas like mirbase::sequences, noncode or rnadb, argonaute hosts additional information on the origin of an mirna, i.e. in which host gene it is encoded, its expression in different tissues and its known or proposed function, its potential target genes including gene ontology annotation, as well as mirna families and proteins known to be involved in mirna processing. additionally, target genes are linked to an information retrieval system that provides comprehensive information from sequence databases and a simultaneous search of medline with all synonyms of a given gene. the web interface allows the user to get information for a single or multiple mirnas, either selected or uploaded through a text file. argonaute currently has information on 839 mirnas from human, mouse and rat. |
after obtaining approval from the ethical committees of the forsyth institute and harvard school of dental medicine (hsdm, boston, ma, usa), both healthy and inflamed gingival tissue samples were collected in the periodontology department laboratories at hsdm. healthy gingival tissue was characterized by the lack of bleeding on probing (gingival pocket depth3 mm ; n=5, 2 males and 3 females, aged 2943 years) and collected from the healthy volunteer who signed informed consent prior to enrollment. periodontal disease was divided into three categories by the degree of swelling of the site collected from the patients. since there was a limitation among the small number of samples to discuss the correlation between the production of il-32 and three different categories, these were all grouped as one category inflamed. the periodontally diseased sites of patients who donated the gingival tissue samples were also characterized by radiological bone resorption and bleeding on probing (gingival pocket depth5 mm ; n=7, 4 males and 3 females, aged 2055 years) (table 1). human gingival fibroblasts (hgf) were obtained from healthy volunteers as described previously (14). hgf were cultured to confluence in a 35 mm diameter dish with dulbecco 's modified eagle 's medium supplemented with 10% fetal bovine serum (gibco, grand island, ny, usa), 100 units / ml penicillin, 100 g / ml streptomycin and 1 g / ml amphotericin b. when hgf cells formed a confluent monolayer, cells were harvested with 0.05% trypsin and 0.02% edta and transferred to a 100 mm diameter plastic culture dish. fourth passage hgf cultures were used in the following experiments. in order to examine the production of il-32 in the gingival tissue, gingival tissues were homogenized in lysis buffer (15). il-32 from the gingival tissue homogenate or the supernatant of hgf was detected by elisa, as previously described (16). briefly, anti - il-32 mouse monoclonal antibody (2 g / ml, # 513501 ; biolegend, san diego, ca, usa ; sodium bicarbonate buffer, ph 9.7) was coated onto a 96-well elisa plate (bd falcon, franklin lakes, nj, usa). after blocking each well with 0.5% bsa in pbs supplemented with 0.05% tween 20 (pbst), either a homogenate of gingival tissue samples or a cultured medium supernatant was applied into each well, followed by purified anti - il-32 rabbit igg (2 g / ml, # imx-5871 ; imgenex, san diego, ca, usa). the il-8 elisa development kit (# 900-k18 ; peprotech, rocky hill, nj, usa) was used to detect il-8, following the manufacturer 's protocol. each well was then reacted with anti - rabbit igg - conjugated horseradish peroxidase (roche, indianapolis, in, usa). colorimetric reactions were developed with o - phenylenediamine (sigma, tokyo, japan) in the presence of 0.02% h2o2. color development was paused with h2so4 (2 n) and measured by an elisa reader (od 490 nm). the actual concentration of il-32 was calibrated by referring to a standard curve prepared by serial dilution of recombinant human il-32 (biovision, mountain view, ca, usa) or (r and d systems, inc., frozen sections of each tissue (two healthy and three inflamed tissues) were fixed with acetone - alcohol at 4c for 1 min. after blocking with 0.5% bsa in pbst, each section was incubated with anti - il-32 mouse monoclonal antibody (2 g / ml, # 513501 ; biolegend) or anti - il-8 mouse monoclonal antibody (2 g / ml, # 500-m8 ; peprotech) in pbs at 4c for 12 hours. then, alexa594-labeled anti - mouse igg (invitrogen, carlsbad, ca, usa) was applied for 30 min at room temperature. the alexa594 signals in the sections were observed using fluorescent microscopy (model bz-9000 ; keyence, osaka, japan). the confluent culture of hgf was stimulated with formalin fixed p. gingivalis w83 (10 cfu / ml) for 12 hours to examine the expression of mrna and for 24 hours to detect the production of il-32 or il-8 by elisa. after the stimulation of hgf, total rna was purified and analyzed by the two - step lightcycler 480 real - time pcr system (17). briefly, one microgram of total rna was used for reverse transcription by the first strand cdna synthesis kit for rt - pcr (roche diagnostics, tokyo, japan). after obtaining approval from the ethical committees of the forsyth institute and harvard school of dental medicine (hsdm, boston, ma, usa), both healthy and inflamed gingival tissue samples were collected in the periodontology department laboratories at hsdm. healthy gingival tissue was characterized by the lack of bleeding on probing (gingival pocket depth3 mm ; n=5, 2 males and 3 females, aged 2943 years) and collected from the healthy volunteer who signed informed consent prior to enrollment. periodontal disease was divided into three categories by the degree of swelling of the site collected from the patients. since there was a limitation among the small number of samples to discuss the correlation between the production of il-32 and three different categories, these were all grouped as one category inflamed. the periodontally diseased sites of patients who donated the gingival tissue samples were also characterized by radiological bone resorption and bleeding on probing (gingival pocket depth5 mm ; n=7, 4 males and 3 females, aged 2055 years) (table 1). human gingival fibroblasts (hgf) were obtained from healthy volunteers as described previously (14). hgf were cultured to confluence in a 35 mm diameter dish with dulbecco 's modified eagle 's medium supplemented with 10% fetal bovine serum (gibco, grand island, ny, usa), 100 units / ml penicillin, 100 g / ml streptomycin and 1 g / ml amphotericin b. when hgf cells formed a confluent monolayer, cells were harvested with 0.05% trypsin and 0.02% edta and transferred to a 100 mm diameter plastic culture dish. in order to examine the production of il-32 in the gingival tissue, gingival tissues were homogenized in lysis buffer (15). il-32 from the gingival tissue homogenate or the supernatant of hgf was detected by elisa, as previously described (16). briefly, anti - il-32 mouse monoclonal antibody (2 g / ml, # 513501 ; biolegend, san diego, ca, usa ; sodium bicarbonate buffer, ph 9.7) was coated onto a 96-well elisa plate (bd falcon, franklin lakes, nj, usa). after blocking each well with 0.5% bsa in pbs supplemented with 0.05% tween 20 (pbst), either a homogenate of gingival tissue samples or a cultured medium supernatant was applied into each well, followed by purified anti - il-32 rabbit igg (2 g / ml, # imx-5871 ; imgenex, san diego, ca, usa). the il-8 elisa development kit (# 900-k18 ; peprotech, rocky hill, nj, usa) was used to detect il-8, following the manufacturer 's protocol. each well was then reacted with anti - rabbit igg - conjugated horseradish peroxidase (roche, indianapolis, in, usa). colorimetric reactions were developed with o - phenylenediamine (sigma, tokyo, japan) in the presence of 0.02% h2o2. color development was paused with h2so4 (2 n) and measured by an elisa reader (od 490 nm). the actual concentration of il-32 was calibrated by referring to a standard curve prepared by serial dilution of recombinant human il-32 (biovision, mountain view, ca, usa) or (r and d systems, inc., frozen sections of each tissue (two healthy and three inflamed tissues) were fixed with acetone - alcohol at 4c for 1 min. after blocking with 0.5% bsa in pbst, each section was incubated with anti - il-32 mouse monoclonal antibody (2 g / ml, # 513501 ; biolegend) or anti - il-8 mouse monoclonal antibody (2 g / ml, # 500-m8 ; peprotech) in pbs at 4c for 12 hours. then, alexa594-labeled anti - mouse igg (invitrogen, carlsbad, ca, usa) was applied for 30 min at room temperature. the alexa594 signals in the sections were observed using fluorescent microscopy (model bz-9000 ; keyence, osaka, japan). the confluent culture of hgf was stimulated with formalin fixed p. gingivalis w83 (10 cfu / ml) for 12 hours to examine the expression of mrna and for 24 hours to detect the production of il-32 or il-8 by elisa. after the stimulation of hgf, total rna was purified and analyzed by the two - step lightcycler 480 real - time pcr system (17). briefly, one microgram of total rna was used for reverse transcription by the first strand cdna synthesis kit for rt - pcr (roche diagnostics, tokyo, japan). the production of total il-32 in human healthy or inflamed gingival tissues was examined by elisa (fig. although il-32 was detected in both healthy and inflamed tissues, the amount of il-32 in the inflamed gingival tissue was lower than that observed in the healthy tissue (average healthy tissue : 471.6108.7 pg / mg tissue ; inflamed tissue : 106.169.7 pg / mg tissue). proinflammatory cytokine il-8 production in the gingival tissues was also measured by elisa (fig. the amount of il-8 in periodontally diseased tissue was higher than in healthy gingival tissue (average healthy tissue : 38.611.4 pg / mg tissue ; inflamed tissue : 840.5513.6 pg / mg tissue), suggesting that the gingival tissues sampled from patients with periodontal disease were inflamed. immunohistostaining of il-32 showed the presence of many positively stained cells in the healthy gingival tissue section (fig. 1c). in particular, prickle and basal cell layers in the epithelium and fibroblastic cells in connective tissue were heavily stained. on the other hand neither healthy nor diseased gingival tissue was stained in the control non - immunized mouse igg (fig. the production of il-8 in healthy tissue was weak, whereas positive staining of il-8 expression was found in the inflamed gingival tissues, especially epithelium and connective tissue (fig. 1 g, h). analyses of il-32 and il-8 expressed in healthy and inflamed human gingival tissue. (a) in order to determine the production of il-32 by elisa, both healthy gingival tissue (gingival pocket depth 3 mm ; n=5, two males and three females, aged 2943 years) and inflamed gingival tissue (gingival pocket depth>4 mm ; n=5, four males and two females, aged 2055 years) were collected from volunteer patients. (b) il-8 production was measured by elisa development kit in accordance with the manufacturer 's instructions. significantly higher than healthy gingival tissue, by student 's t - test (p4 mm ; n=5, four males and two females, aged 2055 years) were collected from volunteer patients. (b) il-8 production was measured by elisa development kit in accordance with the manufacturer 's instructions. significantly higher than healthy gingival tissue, by student 's t - test (p<0.01). (c h) immunohistochemical analysis of human il-32 and il-8 production in the gingival tissue : il-32 production in human healthy (c, e) and inflamed (d, f) gingival tissues was determined using immunohistochemical staining, following the previously published protocol. for il-32-positive staining, mouse monoclonal anti - il-32 was utilized to detect the production of il-32 (c, d). as a negative control, non - immune mouse igg was used (e, f). in order to show the inflammation of the tissue four isoforms of il-32 mrna are well known : il-32,, and (10). to determine the mrna expression of il-32,, and in hgf stimulated by p. gingivalis w83, real - time pcr was performed by using specific primer and the lightcycler system. each il-32 mrna isoform was detected in unstimulated hgf. however, stimulation of hgf with p. gingivalis downregulated the mrna expression of each il-32 isoform, respectively (fig. a similar result was obtained in the total il-32 production at the protein level in the hgf culture supernatant (66% reduction) (fig. (a) effects of porphyromonas gingivalis stimulation on the production of il-32 mrna in human gingival fibroblasts : primary culture of human gingival fibroblasts was stimulated with formalin fixed p. gingivalis (10 cells / ml) for 12 hours, and total rna was extracted to perform the quantitative rt - pcr for the four different isoforms of il-32. the mrna expression of il-32 was standardized by the ratio against glyceraldehyde 3 phosphate dehydrogenase (gapdh). significantly higher than medium control alone without bacteria by student 's t - test (p < 0.01). (b) effect of porphyromonas gingivalis on il-32 protein production from hgf : the production of il-32 in contact with p. gingivalis for 24 hours was monitored using an il-32 elisa. significantly higher than control without bacteria (the far left bar with #) by student 's t - test (p<0.01). (c) the effects of il-32 on expression of il-8 mrna in hgf : in order to determine the effect of il-32 in hgf, recombinant human il-32 (10 ng / ml) was applied to the culture medium with and without p. gingivalis stimulation. anti - il-32 polyclonal antibody (2 g / ml) or normal goat igg (2 g / ml) was also added into the medium for neutralization of il-32. total rna was extracted for quantitative rt - pcr to analyze the il-8 mrna expression after 12 hours of stimulation by p. gingivalis. significantly higher than control without bacteria (the far left bar with #) by student 's t - test (p<0.01). in an attempt to examine the anti - inflammatory effect of il-32, recombinant il-32 was added into the hgf culture with or without fixed p. gingivalis. however, the addition of il-32 resulted in the suppression of il-8 mrna expression (66% reduction). furthermore, anti - il-32 goat igg partially reversed the suppression of il-8 mrna caused by p. gingivalis. interestingly, recombinant il-32 alone without p. gingivalis also showed inhibitory effect on il-8 mrna expression in hgf (35% reduction). finally, anti - il-32 neutralizing antibody upregulated il-8 mrna expression in the non - stimulated hgf, indicating that constitutively expressed il-32 appeared to suppress il-8 mrna expression. these results suggested that il-32 may play a role in the downregulation of il-8 mrna expression in hgf and that the periodontal pathogen p. gingivalis can suppress il-32 production from hgf. in this study, we investigated the production pattern of il-32 in periodontal tissue with or without periodontal disease. the production of il-32 was lower in the tissue from periodontitis patients compared with the tissue of healthy volunteers (fig. 1). an in vitro study showed that il-32 was constitutively expressed in hgf, but suppressed by p. gingivalis stimulation. recombinant il-32 exhibited an anti - inflammatory effect by suppressing the il-8 expression in hgf stimulated with p. gingivalis. furthermore, antibody - mediated neutralization of il-32 in non - stimulated hgf increased il-8 production. taken together, these results suggested that il-32 appeared to play an anti - inflammatory role in healthy gingival tissue, while suppression of il-32 by the periodontal pathogen p. gingivalis may lead to the upregulation of inflammatory response, which promotes the progression of periodontal disease. previous reports show that il-32 was originally cloned as a transcript (nk4) that is produced in nk- or t - cells (11). in addition, il-32 is produced by mononuclear, endothelial and epithelial cells after stimulation by il-1, il-2, il-18, tnf- or ifn- (9, 1820). dna microarray analysis shows that p. gingivalis - derived lps induced the expression of il-32 in monocytes (thp-1 cells) (3). however, very little is known about the expression of il-32 in the gingival fibroblasts which constitute majority of tissue supporting cells in lamina propria of periodontal tissue. immunohistochemistry showed strong staining patterns in subgingival fibroblastic cells as well as gingival epithelial cells (fig. 1c, d), and such expression of il-32 in the gingival tissue was lower in the diseased gingival tissue compared with the healthy ones (fig. although some cytokines are known to be influenced by genetic background or single - nucleotide polymorphism (snp), the small number of subjects used in this study is not suitable to compare the correlation between healthy and periodontitis tissue (21). furthermore, the production of ifn - g and il-13 in whole blood cell from smokers is reported to be higher than non - smoker (22). therefore, it is very significant to analyze the production of il-32 in many subjects including multiple genetic background. our in vitro experiment showed that the addition of p. gingivalis suppressed the otherwise constitutively expressed il-32 mrna and protein in hgf (fig. these results indicated that down - regulatory effects of il-32 on inflammatory response can be interrupted by periodontal pathogen, p. gingivalis, in the context of periodontal disease. it has been reported that the production of il-32 is increased in rheumatoid arthritis (ra), an inflammatory bone resorptive disease, which shares several pathogenic characteristics in common with periodontal disease (23). however, one of the major differences between ra and periodontal disease is the phenomenon of polymicrobial infection. a number of virulent factors are reported to be produced from periodontal pathogens such as p. gingivalis (2426). therefore, it is plausible that some bacterial factors, including lps, outer membrane protein, and protease, might have acted on hgf and suppressed il-32 production by generating a negative signal to reduce il-32 mrna expression. on the other hand, il-32 has been reported to induce the production of anti - inflammatory cytokine il-10 (27). more specifically, il-32 was found to promote the expression of il-10 in monocyte linage cells upon stimulation with phorbol 12-myristate 13-acetate (pma) or lipopolysaccharide (lps) (27). while immune cells are accepted as the major cellular source of il-10 in the context of inflammation (28, 29), it is also true that hgf produce il-10 in response to bacterial challenge (30). therefore, it is conceivable that il-10 may intervene in the bacteria - mediated suppression of il-32 production from hgf. our in vivo and in vitro results showed that il-32 is produced constitutively in healthy conditions. hence, it was hypothesized that il-32 might have an anti - inflammatory effect in periodontal tissue. il-8 is a chemokine produced by gingival epithelial cells and upregulated in the presence of periodontopathogenic bacterial stimulation (31). il-8 induces the chemoattraction of neutrophils through cxcr1 receptors in the affected lesion, which, in turn, promote inflammatory response by such tissue destructive factors as reactive oxygen species (ros) from migrating neutrophils (32). recombinant il-32 suppressed the induction of il-8 mrna in hgf, while anti - il-32 antibody neutralized the effect of il-32. furthermore, the addition of anti - il-32 antibody into hgf culture without p. gingivalis increased il-8 mrna. thus, il-32 may function as an autocrine factor to downregulate the expression of il-8. it is curious that a putative receptor for il-32 remains unknown. to date, the only identified il-32 binding protein is proteinase 3 (pr3) whose catalytic activity partially cleaves il-32, increasing bioactivity of il-32 (33). the difficulty of identifying an il-32 receptor was speculated to result from its possibly high molecular weight which is not feasibly separated in sds - page. alternatively, the binding affinity of il-32 could be lower than pr3 (33) which is not suitable for affinity - dependent isolation. however, based on the contrary results between present study and the report of ra (3, 13), two different types of il-32 receptors can be assumed to induce cell signaling ; one type of receptor induces a proinflammatory signal, while another induces an anti - inflammatory signal. based on the results of this study, it can be hypothesized that hgf express il-32 that has a receptor of the second type. this theory, however, requires further study to identify the hgf - specific il-32 receptor and to characterize the properties of the cell signaling elicited by the il-32 receptor expressed on hgf. in conclusion, since constitutive production of il-32 can inhibit il-8 production, il-32 might play an important role in regulating inflammation in healthy gingival tissue. on the other hand, it was found that periodontopathogenic bacterial challenge can suppress il-32 production, leading to the increase of inflammatory response by loss of anti - inflammatory il-32. taken together, these findings could help to further define the etiology of periodontal disease, as well as form a basis for novel therapeutic regimens against periodontitis. further study will be needed to determine the target molecule of il-32 in periodontitis and the structural component of p. gingivalis that suppresses il-32 expression. there is no conflict of interest in the present study for any of the authors. | backgroundil-32 was recently found to be elevated in the tissue of rheumatoid arthritis and inflammatory bowel disease. periodontitis is a chronic inflammatory disease caused by polymicrobial infections that result in soft tissue destruction and alveolar bone loss. although il-32 is also thought to be associated with periodontal disease, its expression and possible role in periodontal tissue remain unclear. therefore, this study investigated the expression patterns of il-32 in healthy and periodontally diseased gingival tissue. the expression of il-32 in cultured human gingival fibroblasts (hgf) as well as effects of autocrine il-32 on il-8 production from hgf were also examined.methodsperiodontal tissue was collected from both healthy volunteers and periodontitis patients, and immunofluorescent staining was performed in order to determine the production of il-32. using real - time pcr and elisa, mrna expression and protein production of il-32 in hgf, stimulated by porphyromonas gingivalis (pg), were also investigated.resultscontrary to our expectation, the production of il-32 in the periodontitis patients was significantly lower than in the healthy volunteers. according to immunofluorescent microscopy, positive staining for il-32 was detected in prickle and basal cell layers in the epithelium as well as fibroblastic cells in connective tissue. addition of fixed pg in vitro was found to suppress the otherwise constitutive expression of il-32 mrna and protein in hgf. however, recombinant il-32 in vitro inhibited the expression of il-8 mrna by hgf stimulated with pg. interestingly, anti - il-32 neutralizing antibody upregulated the il-8 mrna expression in non - stimulated hgf, indicating that constitutive expression of il-32 in hgf suppressed il-8 mrna expression in the absence of bacterial stimulation.conclusionthese results indicate that il-32 is constitutively produced by hgf which can be suppressed by pg and may play a role in the downregulation of inflammatory responses, such as il-8 production, in periodontal tissue. |
joint contracture causes functional disturbances in patients activities of daily living, decreased movement ability, and impairs the joint function, with high incidence1, 2. therefore, preventing the development of joint contracture is a key goal of physical therapists and rehabilitation specialists. unfortunately, medical professionals are still struggling to find definitive therapies for the prevention and management of joint contracture. although a number of factors can lead to the development of contractures3, differentiating between them in a clinical setting can be difficult. orthopedic surgeons generally classify contractures on the basis of changes causing restriction of the normal range of motion of a joint, a rigidity resulting from some extracapsular cause3,4,5. in physical therapy, classifying cases in terms of the area causing the condition has little practical purpose. therefore, joint immobility causing restricted range of motion can be treated as a case of contracture2. changes in the cartilage and the synovial membrane have been reported as intracapsular joint sequelae resulting from contracture6,7,8,9. to date, significant discrepancies exist among reports, and thus, the current state of research is inadequate for drawing meaningful conclusions. we previously clarified organic changes in the joint composition and structure resulting from contracture10, 11 : fibrosis of the cartilage surface, atrophy of adipose tissue in the synovial membrane, fibrosis in the lower layers of the synovial membrane, microvasculature expansion, and blood congestion. furthermore, evans.6 and yaoita7 investigated the effects of natural healing processes on these organic changes and reported that restrictions of range of motion and structural changes both recovered within a comparatively short time period. this study aimed to investigate histopathological changes to clarify temporal effects on restrictions to range of motion and joint components after joint immobilization in a rat knee - contracture model. fifty - four 8-week - old male wistar rats (body weight 234269 g) were used in this study. the rats were randomly divided into two groups : a fixation group (n = 36) and a control group (n = 18). in the fixation group, right hindlimb knee joints were immobilized in full flexion by plaster casts, which were removed after four weeks. the research protocol followed kanazawa university animal experiment regulations and kinjo university experimental animal handling regulations. all animal handling and experimentation were undertaken with the approval of the ethics committees of both universities (kanazawa university : ap-091379 and kinjo university : approval no. rats from each group were raised in cages (similar to fixation group rats) up to ages corresponding to the subdivisions used for the fixation group. they were labeled as 0wc, 4wfc, 8wfc, 16wfc, 24wfc, and 32wfc, corresponding to the times of examination after cast removal : 0, 4, 8, 16, 24, and 32 weeks, respectively. fixation group rats were immobilized with plaster casts according to a modified version of previously described methods10, 12, 13. pentobarbital sodium (5 mg/100 g body weight) anesthesia was administered through the abdominal cavity. manchester, nh, usa) were fitted to the animals backs. to prevent scratches and abrasions to the right hind limb resulting from the plaster casts, the right hindlimb was covered with a layer of gauze that centered on the knee. the casts extended from the pelvic girdle to the ankle joint, with the hip joint at maximal extension, the knee joint at maximal flexion, and the ankle joint at maximal plantar flexion. the cast area was exposed from the distal ankle to the foot to confirm the absence of swelling and congestion. considering the bone growth during the cast period, the kneecap was exposed as well. rats were able to freely move in their cages using their left hind limb and both forelimbs. if swelling was observed in the fixed limb, the fixation procedure was repeated, and casts were immediately replaced to prevent continuance. if casts were observed to slip out of place or become loose, they were also replaced as soon as possible. the cast period was set at four weeks on the basis of the findings of previous studies, which confirmed that histological changes were evident in the joint structure and content at this point. following the cast period, fixation group rats were randomly divided into six subgroups, with six rats in each group : these were labeled 0wf, 4wf, 8wf, 16wf, 24wf, and 32wf, corresponding to the examination times after cast removal : 0, 4, 8, 16, 24, and 32 weeks, respectively. the 0wf and 0wc groups underwent immediate assessments (described below) to measure the extension angle of their knee joints, to assess restrictions to range of motion, and to create histological specimens for analysis of the joints. the restriction of knee joint extension angle was measured and recorded on the basis of a preliminary experiment. an intra - abdominal pentobarbital sodium anesthetic was administered (5 mg/100 g body weight), and the rats were laid on their sides. using one hand to hold the femur in place, researchers used the other hand to hold the leg at 35 mm from the knee joint and guide the knee into maximal extension, the feeling experienced at the end of the range of motion. using a digital camera, images of the principal axis of extension of the knee joint (the line running from the greater trochanter to the lateral condyle of the femur) and the movement axis (the line running from the head of the fibula to the lateral malleolus) were captured in the sagittal plane. the images were loaded onto a computer, and the angles of the principal and movement axes were measured using three - point measuring instrument software (version 1.1.2). this protocol was used for all assessments. in addition, a digital force gauge (imada dps-5) was attached at 35 mm from the knee joint, which was then extended to the angle measured. three technicians, each with more than five years of clinical experience, performed each procedure five times. the average value was 0.33 0.05 n. on the basis of these preliminary findings, all measurements of the restriction of knee joint extension angle were recorded by first attaching a digital force gauge at 35 mm from the knee joint, followed by application of 0.3 n of extension force and recording of the resulting angle. for the fixation group, these measurements were conducted before the experiment, immediately after cast removal and then weekly until the experiment was concluded. individual differences in the development of contractures were assessed using retention rate calculations, which were as follows : retention rate = [(the measured angle at each time - period) (the angle at development of contracture) ] 100. at the end of each experimental period, a group of six animals was euthanized with a pentobarbital sodium overdose, and their hindlimbs were severed at the hip joint. tissues were fixed over a 72-h soaking period in a 10% buffered neutral formalin solution, and then decalcified using the planck - rychlo solution for 72 h at 4 c. thereafter, an area approximately 10 mm above and below the knee joint was removed. tissues from the center of the kneecap, moving toward its inner regions in the sagittal plane, were removed. to preserve this removed region, a 5-mm margin was cut and stored in an embedding cassette. it was subsequently neutralized in a 5% anhydrous sodium sulfate solution for 72 h, rinsed under running water for 30 min, and soaked for approximately 3 h in 100% alcohol to remove any remaining fat. thereafter, samples were processed in an automatic dehydrating - and - paraffin - wax - embedding device into paraffin blocks and sliced into 3-m thick sections using a sliding microtome (leica sm2000r). after these organizational segments had been attached to a slide glass and dehydrated, they were stained with hematoxylin - eosin (he) stain and enclosed in a hydrophobic mounting agent, to complete the histological specimen preparation. the specimens were observed using a microscopic digital camera (olympus dp50) connected to an optical microscope (olympus bx-51) to examine the entire knee joint structure. although it is possible to classify cartilage on the basis of the degeneration it has undergone in cases of osteoarthritis14,15,16, histological classification of cartilage degeneration resulting from immobilization is a relatively new area of study. therefore, to quantify histological changes in the cartilage, we classified samples into one of the following four groups : group i, fibrosis and degeneration could not be identified in outer layers ; group ii, irregularities and fibrosis could be identified on the cartilage surface ; group iii, thinning and transformation into fibrous pseudocartilage could be identified ; and group iv, destruction and damage could be identified in the cartilage. for each group fitted with plaster casts, a comparative examination was conducted with the control group using fisher s exact test using the statistical software, r (version 2.15.1). following the cast period, knee joint extension angles revealed following restrictions : 73.2 9.9 in the 0wf group, 71.4 8.3 in the 4wf group, 71.2 8.1 in the 8wf group, 68.8 7.4 in the 16wf group, 73.6 7.9 in the 24wf group, and 70.2 11.2 in the 32wf group. using retention rate calculations, each group showed improvement over time, and the retention rate in the 4wf group was 7.1 3.8% at the end of the study. excluding the 4wf group, retention rates by the fifth week after cast removal were as follows : 8wf, 1.4 1.1% ; 16wf, 1.7 0.6% ; 24wf, 0.5 1.1% ; and 32wf, 1.2 1.2%. furthermore, retention rates of all groups were 0% by the sixth week. knee extension angles were measured over the subsequent weeks, but none of the individual subjects in any group revealed any recurrence of their restrictions (table 1table 1. changes in knee extension angle restrictionsimmediateremovalweek following fixation removal1th2nd3rd4th5th6thgroup 4wf100%69.414.6%42.510.4%19.65.9%7.13.8%group 8wf100%74.45.9%50.54.8%20.38.5%7.85.3%1.41.1%0%group 16wf100%71.16.0%46.09.6%16.26.9%6.71.7%1.70.6%0%group 24wf100%76.68.8%41.48.4%16.04.5%7.53.2%0.51.1%0%group 32wf100%75.67.5%44.63.7%22.04.3%10.53.0%1.21.2%0%). considering the relationship between age and histological changes, case control comparisons matched by age produced the following data (table 2table 2. abnormal findings in joint cartilage and the frontal synovial membranefibrosis ofcartilagedegenerationof cartilagethinning ofcartilageadhesion offrontal tibiaatrophy ofadipocytefibroblasthyperplasiagroup 0wf600566group 4wf600366group 8wf600366group 16wf620366group 24wf631166group 32wf652066numbers within the table indicate the number of specimens presenting the conditions out of a total of 6., fig. (he stain, scale bar left : 1 mm, center and right : 100 m). the 0wf group : adhesions of fibrous hyperplasia tissue between the frontal tibial area and the frontal synovial membrane were noted (, left). adipocyte atrophy and fibroblast hyperplasia appeared, as well as expansion and blood congestion in the microvasculature (right). there were no clear differences in the extent of any of the conditions between the 4wf and 0wf groups. the space between adhesions was more expanded than in the 4wf group (, left). the 16wf group : adhesions covered an even larger area than in the 8wf group (left). some hyaline cartilage had been replaced with fibrous cartilage tissue (center). findings related to conditions in the frontal synovial membrane were identical to those of the 0wf group (right). the 24wf group : spaces between adhesions were bigger than in the 16wf group (, left). cartilage degeneration and thinning were identified (center). findings related to conditions in the frontal synovial membrane were identical to those of the 0wf group (right). the 32wf group : no adhesions were evident (left). cartilage degeneration and thinning were identified (center). findings related to conditions in the frontal synovial membrane were identical to those of the 0wf group (right)). in the articular cartilage of the 0wf group, fibrosis was identified on the surface of all cartilage specimens, and in five of six specimens, adhesion of the forward synovial membrane and fibrous structure of the hyperplasia was observed in the frontal tibial area. all specimens revealed adipocyte tissue atrophy in the frontal synovial membrane, fibroblast hyperplasia in the lower layers, and expansion and blood congestion in the microvasculature. no significant changes were observed between 0wf, 4wf, 8wf, 16wf, 24wf and 32wf groups in terms of adipocyte tissue atrophy and size, fibroblast hyperplasia, and microvasculature changes. numbers within the table indicate the number of specimens presenting the conditions out of a total of 6. histological findings (he stain, scale bar left : 1 mm, center and right : 100 m). the 0wf group : adhesions of fibrous hyperplasia tissue between the frontal tibial area and the frontal synovial membrane were noted (, left). adipocyte atrophy and fibroblast hyperplasia appeared, as well as expansion and blood congestion in the microvasculature (right). there were no clear differences in the extent of any of the conditions between the 4wf and 0wf groups. the space between adhesions was more expanded than in the 4wf group (, left). the 16wf group : adhesions covered an even larger area than in the 8wf group (left). some hyaline cartilage had been replaced with fibrous cartilage tissue (center). findings related to conditions in the frontal synovial membrane were identical to those of the 0wf group (right). the 24wf group : spaces between adhesions were bigger than in the 16wf group (, left) findings related to conditions in the frontal synovial membrane were identical to those of the 0wf group (right). the 32wf group : no adhesions were evident (left). cartilage degeneration and thinning were identified (center). findings related to conditions in the frontal synovial membrane were identical to those of the 0wf group (right) although findings in the 4wf group were largely identical to those of the 0wf group, adhesions were only found in three out of six samples. the same numbers of adhesions were observed in the 8wf group and the 4wf group, but the gap between fibers tended to become larger. in addition, the results of articular cartilage examination in the 16 wf were the same as for the 4wf and 8wf groups, but two of six specimens revealed replacement of the original hyaline cartilage with of a fibrous - type cartilage. although adhesions of the frontal tibial area were identified in three of six specimens, gaps between fibers greater than those in the 8wf group, and fibrous structures were sparser. however, only a partial adhesion was observed in the frontal tibial area of just one of six specimens. the gap between fibers was even greater than those observed in the 16wf group. in three of six samples, original cartilage was replaced with fibrous - type structures, and one of these revealed additional thinning in the cartilage. fibrosis of the articular cartilage but no adhesion was observed in the frontal tibial area in the articular cartilage samples of the 32wf group. however, the original cartilage was replaced with fibrous - type structures in five of six cases, and the degeneration was quite severe ; two of these revealed additional thinning the cartilage. all adhesions had disappeared in this group. finally, inflammatory cell infiltration was observed in all groups. on the basis of histological classification of the cartilage in the cast group compared with the control group, a significant difference was observed between both groups (table 3table 3. in this study, six weeks after cast removal, all rats showed complete recovery in their range of knee joint extension. however, although the degree of contracture - associated adhesions decreased over time, a replacement of existing cartilage with fibrous - type structures along with thinning of the cartilage was observed. moreover, at all stages, there were persistent changes in the frontal synovial membrane, atrophy and differences in the size of adipocyte tissues, fibroblast hyperplasia in lower layers, and expansion and blood congestion in the microvasculature. therefore, although the range of knee joint extension improved, the articular cartilage and frontal synovial membrane remained damaged. evans.6 evaluated the restoration of mobility in immobilized joints following the onset of contracture using an internal - fixation knee - arthrodesis contracture model in rats. their study reported that provided, the fixation lasted no longer than 30 days, changes in the range of motion were reversible. yaoita7 and maoka17 also reported that range of motion and organizational structures were restored comparatively quickly following short - term fixation of 30 days or less in a rat knee contracture model. although we found some differences in the time required to restore mobility and used a different fixation method, the complete restoration of mobility we observed agrees with prior research. the hyaline cartilage forms a structure around joints and functions as a load - bearing buffer, reducing friction between bones in the course of normal joint movement, and playing a role in maintaining mobility. hyaline cartilage does not contain blood cells, lymph ducts, or nerves, and does not directly experience inflammation18. in a broader evaluation of joint changes resulting from contracture, evans.6 examined histological changes in rats with internal fixation knee arthrodeses. they reported that after 30 days of fixation, there was a proliferation of intra - articular connective tissue as well as fibrosis and blood congestion under the kneecap and in the intercondylar fossa. they also observed cartilage compression at contact points of the femur and tibial condyles, and miniaturization of chondrocytes, and they concluded that intra - articular connective tissue hyperplasia and adhesions within the cartilage were the cause of the restricted range of motion. these adhesions did not completely cover the cruciate ligament of the knee and its surroundings, rather they originated from fibrosis of the synovial membrane. similar to results of the study conducted by evans.6, yaoita.7, using internal fixation for the knee joint in rats, revealed thinning of cartilage tissue, disordered cell arrangement, and necrobiosis after 30 days of fixation. because of these structural changes, fibrous connective tissues and adipocytes filled the intra - articular area from the rear of the joint, extending the joint surface forward, parallel to the femur, narrowing the articular space. both the studies cited here discussed the process used to induce contracture in detail and highlighted resulting histological changes. however, their descriptions of the recovery process after the removal of fixation was limited to general statements about the range of motion being restored to its pre - experimental levels, and the joint being otherwise normal. we could find no other study in the literature which described the progress of contracture and histological joint changes over time. moreover, the hyperplasia we observed in the membrane tissue of the outer layer of articular cartilage is consistent with our previously published reports10,11,12,13 and could have resulted from joint immobilization. in addition, adhesions within the frontal synovial membrane and the frontal tibial area were consistent with the findings of watanabe.10 during long - term cast fixation. although these adhesions may be consistent with the work of evans. and this could be explained by differences in the fixation methods and observation areas among the studies, but the true reasons remain unclear and require further investigation. in the present study, as the time interval progressed, adhesions diminished ; moreover, by 32 weeks after cast removal, they had completely disappeared. yaoita, who noted that free movement after removal of fixation resulted in mechanical stress, though it is equally possible that the adhesions may have simply detached. in contrast with the resolution of adhesions, the number of cases, wherein normal cartilage was replaced with fibrous structures and thinning, increased as time progressed. ely.8 evaluated changes in joint components resulting from cast fixation in adult dogs, and reported a narrowing of the space between opposite cartilage structures along with thinning of the cartilage in load - bearing areas. in addition, hagiwara.19 evaluated knee articular cartilage thickness in rats after internal fixation at 150, and reported that the thickness increased in movement areas, although it remained unchanged in contact and non - contact areas. the timing of the appearance of cartilage thinning in the study of hagiwara. clearly differs from that reported by ely. and yaoita. furthermore, the cartilage thickening observed by hagiwara. was not observed in any sample in the present study. first, because adhesions connect viscera and tissue that should be separated20, the detachment of these adhesions through mechanical stress may have caused bleeding and inflammation21. as a result, the normal repair process may have caused the replacement of normal cartilage with fibrous tissue structures. second, the articular cartilage derives nutrition from synovial fluid, and if this nutritional supply were obstructed by surface tissue hyperplasia, it might cause degeneration. this could then result in a decline in cartilage regeneration, necrobiosis, and decreasing thickness, resulting in the replacement of cartilage with fibrous tissues through the recovery process21. these qualitative changes to the articular cartilage did not occur immediately after the onset of the contracture but after an amount of time had passed. this cartilage degeneration is a new finding, and future biochemical analyses will be required to clarify its causes. takemura.12 analyzed changes in the frontal synovial membrane resulting from contracture with regard to contractures induced by cast fixation. joint immobilization resulted in adipocyte tissue atrophy and size differences in the frontal synovial membrane, fibroblast hyperplasia in the lower layers, and expansion and blood congestion in the microvasculature. watanabe.10 and matsuzaki.11 reported identical findings, and these were unsurprisingly confirmed by our study. these changes may have occurred because of a decrease in the mechanical stress resulting from the contracture. to date, very few articles have prospectively considered the recovery process of the frontal synovial membrane following immobilization. and yaoita provided detailed descriptions of the recovery process, they only made general statements about histological improvement. conversely, takemura. and matsuzaki. failed to observe any improvement in frontal synovial membrane atrophy. in this study, we observed adipocyte tissue atrophy and size differences in the frontal synovial membrane, fibroblast hyperplasia in the lower layers, and expansion and blood congestion in the microvasculature. moreover, this occurred at all the examination periods (up to and including 32 weeks after removal of cast fixation). even after the passage of a long time interval, no trends toward improvement were identified in the findings. to the best of our knowledge, although articles have reported the posterior synovial membrane changes that result from joint immobilization, our report is the first to observe atrophy of adipose tissue in the frontal synovial membrane. in addition, atrophy of structural fat such as the corpus adiposum infrapatellar as well as bone marrow is not thought to easily occur in such cases11. therefore, future histological and biochemical investigations may be necessary to clarify how this occurs. the results of our present study are in agreement with previous research that joint mobility may completely recover after contracture. we further add that this may occur through time alone, and that damage to the articular cartilage and frontal synovial membrane did not improve within 32 weeks after fixation, the end of our observation period. briefly, free motion merely improves mobility and does not result in any organic improvements in the joint itself. when physical therapists passively mobilize joints to improve range of motion following contractures, they often experience a different sensation toward the end of the range of motion. this may result from an increased coefficient of friction because of the fibrosis and degeneration in the cartilage surface. the inadequate consideration of these issues in reports to date means future research focusing more closely on appropriate medical interventions to limit organic changes is required. furthermore, future research must respond to advances in our understanding of the fundamental scientific basis of physical therapy. | [purpose ] the purpose of our study was to clarify temporal effects on restrictions to range of motion and the histopathological changes of joint components after joint immobilization in a rat knee - contracture model. [subjects ] fifty - four male wistar rats were randomly divided into two groups : a fixation group, and a control group. [methods ] in the fixation group, unilateral knee joints were immobilized at full flexion using a plaster cast for 4 weeks. at four weeks the animals were randomly divided into six subgroups, corresponding to the time of examination after cast removal : 0, 4, 8, 16, 24, and 32 weeks. for comparison, control group animals of corresponding age were also examined. [results ] although movement restrictions of the knee joint had completely recovered 6 weeks after the cast removal, cartilage and synovial membrane structures did not completely recover. [conclusion ] these findings have not previously been reported, and as they form an addition to the fundamental scientific foundations of physical therapy, further research must examine these findings from a variety of perspectives. |
the study used data from the cross - sectional population - based 1998 singapore national health survey (nhs98 ; n = 4,723). genotype data were available for 3,734 subjects comprising 2,520 chinese, 693 malay, and 521 asian indians. a total of 1,881 chinese subjects with normal glucose tolerance (ngt) had previously served as the control subjects for the singapore replication arm in our original report (6), whereas type 2 diabetes case subjects were from a separate study (the singapore diabetes cohort study). in this present study, all subjects (including subjects with ngt, impaired fasting glucose, impaired glucose tolerance [igt ], and type 2 diabetes) were derived from the nhs98 study. details of the nhs98 survey have been previously described in greater detail (9). briefly, this was a population - based, cross - sectional survey conducted between september and november in 1998. the reference population was 2.16 million chinese, malay, and asian indian singapore residents aged between 18 and 69 years. the survey was based on the world health organization (who)-recommended model for field surveys of diabetes and other noncommunicable diseases and the who monica protocol for population surveys. the research protocol for nhs98 was approved by the singapore general hospital institutional review board (# 54/2001). fasting blood samples were collected for glucose and insulin after an overnight fast of 10 h. all subjects underwent a 75-g oral glucose tolerance test except those taking oral hypoglycemic agents or insulin. subjects were classified as having diabetes if they gave a history of diabetes or if their fasting glucose was > 7 mmol / l or 2-h post - challenge glucose > 11.1 mmol / l. mmol / l and impaired glucose tolerance as 2-h post - challenge glucose of 7.811.1 mmol / l. insulin resistance was estimated using the homeostasis model assessment method (homa - ir) (10). -cell function was assessed using the corrected insulin response at 120 min (cir120) (11). genotyping of four snps in intron 15 of kcnq1 rs2237897 (c > t), rs2237895 (a > c), rs2237892 (c > t), and rs2283228 (a > c) was performed using the taqman snp genotyping assay (applied biosystems, foster city, ca). genotyping success rate for rs2237897, rs2237895, rs2237892, and rs2283228 was 92, 99, 92, and 87%, respectively. to assess reproducibility, 1% of samples were analyzed in duplicate ; genotyping was 100% concordant for these samples. minor allele frequency, hardy - weinberg equilibrium, and linkage disequilibrium (ld ; reported using r) were estimated using haploview (12). the distribution of glucose and insulin measures were skewed and therefore normalized by natural logarithmic transformation. linear regression analyses were performed to study the associations between diabetes - related traits with genotypic groups. individuals were as assigned as 0/1/2 according to their number of minor alleles under an additive model of inheritance. there was no significant heterogeneity between the sexes (p > 0.05), and subsequent analyses were performed with the sexes combined and adjusted for sex. linear regression with adjustment for ethnicity was used to estimate the summary effect size of the snps in the combined sample from the three ethnic groups. logistic regression was used to estimate the association between kcnq1 snps and type 2 diabetes. all analyses were stratified by ethnic group and adjusted for age, sex, and bmi (where appropriate). analysis of association with -cell function was further adjusted for insulin resistance (13). fasting blood samples were collected for glucose and insulin after an overnight fast of 10 h. all subjects underwent a 75-g oral glucose tolerance test except those taking oral hypoglycemic agents or insulin. subjects were classified as having diabetes if they gave a history of diabetes or if their fasting glucose was > 7 mmol / l and impaired glucose tolerance as 2-h post - challenge glucose of 7.811.1 mmol / l. insulin resistance was estimated using the homeostasis model assessment method (homa - ir) (10). -cell function was assessed using the corrected insulin response at 120 min (cir120) (11). genotyping of four snps in intron 15 of kcnq1 rs2237897 (c > t), rs2237895 (a > c), rs2237892 (c > t), and rs2283228 (a > c) was performed using the taqman snp genotyping assay (applied biosystems, foster city, ca). genotyping success rate for rs2237897, rs2237895, rs2237892, and rs2283228 was 92, 99, 92, and 87%, respectively. to assess reproducibility, 1% of samples were analyzed in duplicate ; genotyping was 100% concordant for these samples. minor allele frequency, hardy - weinberg equilibrium, and linkage disequilibrium (ld ; reported using r) were estimated using haploview (12). the distribution of glucose and insulin measures were skewed and therefore normalized by natural logarithmic transformation. linear regression analyses were performed to study the associations between diabetes - related traits with genotypic groups. individuals were as assigned as 0/1/2 according to their number of minor alleles under an additive model of inheritance. there was no significant heterogeneity between the sexes (p > 0.05), and subsequent analyses were performed with the sexes combined and adjusted for sex. linear regression with adjustment for ethnicity was used to estimate the summary effect size of the snps in the combined sample from the three ethnic groups. logistic regression was used to estimate the association between kcnq1 snps and type 2 diabetes. all analyses were stratified by ethnic group and adjusted for age, sex, and bmi (where appropriate). analysis of association with -cell function was further adjusted for insulin resistance (13). the anthropometric and biochemical characteristics of the participants are detailed in table 1. among these individuals, there was a higher prevalence of type 2 diabetes among the malay and asian indian populations and a lower mean bmi and fasting glucose level among the chinese population. clinical characteristics of the nhs98 study population by ethnicity data are means sd unless otherwise stated. units for insulin120(i) are given in mmol / l and for glucose120(g120) in mg / dl. subjects taking diabetes medication were excluded (59 chinese, 35 malays, and 44 asian indians). allele frequency for rs2237897, rs2237895, rs2237892, and rs2283228 were similar between the chinese and malays but different in asian indians (table 2). rs2237895 was in weak ld with rs2237897, rs2237892, and rs2283228 (r 0.05). in the asian indians, three of the snps that had low minor allele frequency (rs2237897, rs2237892, and rs2283228) were not in the hardy - weinberg equilibrium. association of kcnq1 genetic variants with type 2 diabetes in the chinese, malay, and asian indian population in singapore risk allele denoted in bold. p values adjusted for age, sex, bmi, and ethnicity (for combined analysis). table 2 shows the association between kcnq1 snps with type 2 diabetes in the chinese, malay, and asian indian population in singapore. significant associations were observed in the chinese, with rs2237897 showing the strongest effect : odds ratio (or) 1.50 (1.151.96), p = 0.003. in the combined sample of the three ethnic groups, the risk alleles of rs2237897 (c), rs2237892 (c), and rs2283228 (a) were also associated with type 2 diabetes in our study, consistent with previous reports (6,7). of these, rs2237897 showed the strongest association (or 1.48 [1.201.83 ], p = 0.0003). in the combined sample of only chinese and malays subjects, the association with rs2237897 remained significant (or 1.45 [1.161.81 ], p = 0.001). the risk alleles for rs2237897, rs2237892, and rs2283228 showed statistically significant association with higher fasting glucose levels (p = 0.014, 0.011, and 0.034, respectively) and reduced cir120(p = 0.007, 0.013, and 0.014, respectively) in the chinese population. after restricting to subjects without diabetes, the association remained significant with cir120(p = 0.011, 0.020, and 0.015, respectively ; online appendix table 1). a similar trend was observed among the malays and asian indians, although the associations did not reach statistical significance, possibly because of the limited sample sizes for these minority ethnic groups. in the combined analysis, rs2237897 and rs2237892 were significantly associated with fasting glucose levels (p = 0.029 and p = 0.021, respectively), whereas rs2237897, rs2237892, and rs2283228 were significantly associated with lower -cell function (cir120) (p = 0.013, 0.021, and 0.020, respectively). these snps also showed associations with bmi in the malay population and waist - to - hip ratio in asian indians. however, these associations were no longer statistically significant in the combined analysis. based on a risk allele frequency of between 0.3 and 0.6, power calculations estimate that the combined sample provided 90% power to detect a 10% change in the examined traits. combined estimates were obtained using linear regression with adjustment for ethnicity. additionally adjusted for bmi and excluding subjects taking diabetic medication (59 chinese, 35 malays, and 44 asian indians). values were log - transformed to improve normality in regression analysis, and adjusted means were subsequently back - transformed. polymorphisms within kcnq1 have recently been shown to be strongly associated with an increased risk of type 2 diabetes in the east asian and european populations (6,7). of the three polymorphisms within kcnq1 previously described, rs2237897 appeared to have the strongest association with type 2 diabetes (6), whereas another study reported the strongest association with rs2237892 (7). consistent with these findings, we found that both these snps were significantly associated with type 2 diabetes in the combined analysis of three ethnic groups. in addition, the presence of the risk allele for kcnq1 variants rs2237897, rs2237892, and rs2283228 were associated with increased fasting glucose level and decreased -cell function in the chinese population and combined sample. (7), which reported an association of these kcnq1 variants with -cell function. together, these findings corroborate the hypothesis that the role of this protein in the pathogenesis of type 2 diabetes is likely mediated through its effects on the pancreatic -cell, although there is still a possibility that these polymorphisms may increase the risk of type 2 diabetes through regulation of nearby genes. in contrast, there was no association between rs2237895 with any diabetes - related traits, specifically highlighting the importance of the polymorphisms rs2237897, rs2237892, and rs2283228 (which are in moderate ld) in increasing the risk of developing type 2 diabetes. further fine mapping of snps in kcnq1, especially within the ld block containing rs2237897 and rs2237892, may allow the identification of the causal variant. kcnq1 is located on 11p15.5, which encodes the pore - forming -subunit of the iks kchannel, which is expressed mainly in the heart and, to a lesser extent, the inner ear, stomach, small and large intestine, liver, and kidney. kcnq1 is also expressed in the pancreas, where it is coexpressed with products of other regulators such as kcne1, which may alter its biophysical characteristics and role (15). as such, it is plausible that polymorphisms within the kcnq1 gene alter the properties and role of the iks kchannel, causing decreased pancreatic -cellfunction and insulin production, leading eventually to hyperglycemia. whereas we do appreciate that the associations observed in the chinese do not represent an independent replication, since the controls used are largely the same as those in the study by unoki. (6), we have provided data on malays and indians and, in our opinion, it was reassuring that similar trends for an effect of these three polymorphisms on association with type 2 diabetes, fasting glucose, and -cell function were also observed in the malay and asian indian subjects, even though their limited numbers certainly resulted in a reduction of study power. although associations with bmi in malays and waist - to - hip ratio in asian indians were found, the smaller sample sizes for these ethnic groups, together with the fact that these observations were not found in other ethnic groups, inevitably led us to be cautious in interpreting these findings. one caveat of this study is that we only examined the snps, which showed the strongest association, identified by unoki. although the chinese show strong and consistent associations with these snps, the association among malays and asian indians is less clear. further fine mapping of the kcnq1 locus, for instance, through deep dna resequencing may allow the identification of population - specific causative variants. the use of cir120represented a limitation of our study, since it only served as an approximate measure of -cell function, which may be better assessed using the cir30. thus, if cir30measurements were available, the positive associations that had been observed in our study may be further strengthened. it has also been suggested that cir120could inadvertently capture information on additional aspects of glucose intolerance instead of insulin secretion alone. the previous finding of the association between cir30with kcnq1 snps, in nondiabetic european subjects of the botnia prospective study during their follow - up visit (p = 0.024) (7), however, appeared to corroborate our hypothesis that these snps may exert their effect on type 2 diabetes through an effect on insulin secretion. in conclusion, the risk alleles of rs2237897, rs2237892, and rs2283228 within the kcnq1 gene are associated with decreased pancreatic -cell function and fasting glucose levels, suggesting that the impact of these polymorphisms on the risk of type 2 diabetes may be mediated through an impact on -cell function rather than insulin resistance. further studies will be useful to replicate these promising findings and to fully delineate the role of kcnq1 and its related pathways in the pathogenesis of type 2 diabetes. | objectivethe potassium voltage - gated channel, kqt - like subfamily, member 1 (kcnq1) has been found through a genome - wide association study to be a strong candidate for conferring susceptibility to type 2 diabetes in east asian and european populations. our objective was to describe the association between polymorphisms at the kcnq1 locus with insulin resistance, -cell function, and other type 2 diabetes related traits in a sample of chinese, malays, and asian indians living in singapore.research design and methodswe examined the associations between four previously reported kcnq1 single - nucleotide polymorphisms (snps) with type 2 diabetes related traits in 3,734 participants from the population - based 1998 singapore national health survey cohort (2,520 chinese, 693 malay, and 521 asian indians). insulin resistance was calculated from fasting insulin and glucose using the homeostasis model assessment method, whereas pancreatic -cell function was assessed using the corrected insulin response at 120 min (cir120).resultssnps rs2237897, rs2237892, and rs2283228 were significantly associated with type 2 diabetes (odds ratio [or ] 1.48, p = 3 104 ; or 1.38, p = 0.002 ; or 1.31, p = 0.012, respectively). within the chinese population, the risk alleles for rs2237897, rs2237892, and rs2283228 were significantly associated with higher fasting glucose levels (p = 0.014, 0.011, and 0.034, respectively) and reduced cir120(p = 0.007, 0.013, and 0.014, respectively). a similar trend was observed among the malay and asian indian minority groups, although this did not reach statistical significance because of limited sample sizes.conclusionsthe increased risk for type 2 diabetes associated with kcnq1 is likely to be caused by a reduction in insulin secretion. further studies will be useful to replicate these findings and to fully delineate the role of kcnq1 and its related pathways in disease pathogenesis. |
iran is home to one of the world s oldest civilizations in southern and western asia. the 18th - largest country in the world in terms of area at 1,648,195 km, iran has a population of around 79 million. while the publication of scientific results is the main aim of research activity, scientometric methods (the study of research output in the form of scientific articles) and the resulting citations universal databases, which are being used in such studies include the thomson - reuter institute of scientific information / web of science database (isi), pubmed, scopus and google scholar. pubmed, as a trouble - free, fast and open database, has indexed 5,650 journals since 1950 and has become one of the most reliable web based resources for clinicians as well as researchers in biomedical / dental sciences. biomedical / dental research as the leading science has had great impact on researchers, health professionals and policy makers ; these sciences weigh heavily on the measurements of national competitiveness. over the past 30 years, iran has invested profoundly on its research infrastructure in many fields of science and technology i.e. medicine / dentistry / pharmacology, space sciences, nanotechnology, biotechnology and nuclear technology ; in the new millennium, iran has experienced a remarkable growth in the field of biomedical / dental research. while less than 1% of iran s gross domestic product (gdp) was allocated to research until 2011, the objective of the present study was to investigate the quantity as well as the quality of pubmed - indexed published dental articles originnated from iran. the number of articles and contributors, patterns of research designs, most selected scientific journals for each subspecialty, research output of various scientific groups / universities, characteristics of frequently cited papers and scopus / google scholar citation for each subspecialty were evaluated. in order to access published articles by the iranian authors in pubmed - indexed journals, a limited search of affiliations was conducted using the following keywords : dental or endodont or orthodont or periodont or pedodont or prosthodont or oral or dentistry. finally, using advanced search, the above results were combined and the articles that had been published by june 31, 2015 were extracted. the abstracts (and full texts where necessary) were reviewed, and articles in which at least one iranian author from an iranian university or institute had contributed were selected and then analyzed. the following data were extracted from each article and transferred to microsoft excel : year of publication, field of study, name of journal, affiliation of the first / corresponding author, number of authors, scopus / google scholar citation and study design. the field of study of each article was determined twice, i.e. according to i) affiliated department of the first author and ii) that of corresponding author. in case any of these were not available or were not relevant to the fields of dentistry, title and content of the article were used. from a total of 1,257,305 dental publications, 3,835 publications were included according to the selection criteria. overall, the most frequent fields of study were endodontics and orthodontics, whilst the least frequent fields of study were dental materials, community oral health (coh) and oral radiology (fig. unknown considering the affiliation of the first author and corresponding author for grouping, respectively. this group consisted of studies that could not be categorized into one specific field (of study) based on the previously mentioned criteria. (a) distribution of articles according to related scientific group (based on the affiliation of the first author) ; (b) trend of publications of four scientific groups as well as the average of all scientific groups (based on the affiliation of the first author) ; (c) distribution of iranian dental articles according to research design ; (d) the number and trend of articles with zero citation in google scholar and scopus the number of publications in each field was categorized according to the year of publication in the past 10 years (table 1). the average growth in the number of dental publications indicated a positive trend ; the results in relation to the number of dental publications in the field of endodontics indicated a decline from 2010 to 2011 (fig. the publications in each field were presented according to the title of journal, and table 2 shows the three journals with the highest number of publications in each field. the impact factor (if) of the journals in 2014 is also presented ; iranian endodontic journal and journal of endodontics had the highest number of articles and if, respectively (table 2). overall, the most frequent study design belonged to the others group, which included letter to editor, epidemiological studies, descriptive studies, diagnostic accuracy studies, the introduction of a new method, health education, hypothesis and cross sectional studies ; meta - analysis and systematic review studies were the least frequent study designs (fig. number of articles according to related scientific group in the recent 10 years c= corresponding author, f= first author ; r = rank ; n = total number of articles three most selected journals by scientific groups c= corresponding author, f= first author ; r = rank ; no= number of published articles ; if= journal s impact factor (2014) table 3 presents the three articles with the highest number of citations according to google scholar in each subspecialty. table 4 shows the top 10 universities with the highest number of dental publications and their three most active scientific groups. the universities of tehran, shahid beheshti and mashhad had produced the highest number of dental publications amongst all medical universities in iran. three most cited articles in google scholar (gs) according to related scientific group c= corresponding author, f= first author ; r = rank ; s = scopus ; = not indexed in scopus top ten dental schools and top three disciplines that had the highest scientific paper production. c= corresponding author, f= first author ; r = rank ; n= total number of articles the number of authors varied from one to 16 ; the majority of articles were written by four authors (table 5). the number and percentage of citations of iranian dental articles in google scholar and scopus are presented in table 6 ; figure 1d shows a sharply increasing trend for articles with no previous citations in google scholar and scopus. number and percentage of authors per article number and percentage of citations of iranian dental papers in google scholar and scopus = number of citation in google scholar ; = number of citation in scopus scientometric markers are progressively used to assess the patterns of research performed by scientists / researchers, universities / institutes and countries. objective scientometric indices have been specified for such assessments during the previous six to seven decades. the application of scientometric techniques / rankings based on various indices has led to more inter - regional competition among the europe and the united states, west and east and the forthcoming asian countries. our results demonstrated that the number of pubmed - indexed dental publications originating from iran had an increasing trend in the recent years. the past three decades have been marked by near constant tensions in the middle east, including the imposed iraq - iran war, after which iraq s scientific system progressively collapsed and not until recently has it displayed any signs of recovery. in contrast, iran has displayed one of the fastest growth rates in scientific production that the world has witnessed. iran has progressed successfully in its agenda to improve its (inter) national profile in biomedical research by continuously increasing the quantity / quality of publications in peer reviewed scientific pubmed - indexed journals. a recent study reported that iran performed higher than the expected level in six out of the 62 subfields of life sciences ; these include andrology, dentistry, oral surgery and medicine, ecology, entomology, mycology and orthopedics. in addition, andrology is the sole subfield in life sciences in which iran has performed above the global average. the growth rates in the subfields of dentistry, oral surgery and medicine are in the second place and may pass the global trend in the near future. the positive trend in dental research output from iran can be attributed to the focus on research by policy - makers, a national commitment by research policy change and a drastic rise in research resources. the research to the health sector doubled from 1997 to 2005, and there was a significant growth in the number of health / medical / dental researchers. the number of dental research centers in the country increased from one in 1995 to 20 in 2012. such achievements were a result of a national movement in iran to develop research in a broad - spectrum. research productivity is the amount of research performed by scientists within a certain time span. research productivity evaluation is a critical issue because it serves to verify the existing knowledge in an institution, determine the efficiency in addition to the quality of their research and discover less frequently researched subjects ; this evaluation provides a basis for promotion decisions, funding allocations and educational reform ; it lately serves as an indicator of university quality as well. our results revealed that endodontic researchers had the highest number of publications, particularly in the iranian endodontic journal. furthermore, endodontic groups were the most frequently rated active research groups in the top ten dental schools. it has been demonstrated that endodontic research productivity in iran is positive and is favorable in comparison to other regional countries [9,15, 16 ], which is in accord with the current results. our results demonstrated that 3.73% of the articles were written by one author, while the majority of them (46%) were written by three or four authors. iranian researchers in the fields of dentistry, oral surgery and medicine have collaborated well with each other domestically. this may be due to several factors, including the nature of their research, availability of the internet and e - mail correspondence as well as communication between graduate students and their advisers. in relation to this randomized clinical trials, systematic reviews and meta - analyses provide the highest level of evidence. they have a remarkable role in scientific grading thus being useful for decision making, treatment planning, practical guidelines and health policy decisions. our results similar to previously reported results showed that systematic reviews and clinical trials constituted 9% of all dental publications from iran. higher number of articles with high level of evidence indicates higher quality of publications, and such a low proportion of high quality publications is not a phenomenon limited to dentistry ; it may be related to the challenges / difficulties in designing / conducting such trials / studies. moreover, 51% of all dental articles from iran had zero citation in scopus, which may be interpreted as an inferior quality of such publications ; however, as demonstrated in fig. 1d, these articles were mainly published in the recent years and because of the increasing trend of publications, they may be cited in the near future. the authors of the articles were categorized based on the department of first author and corresponding author. reporting the department of the author is not a gold standard method for reporting this variable since an author may have some articles in the fields other than his department field especially in dental materials and dental education. considering the results of iranian pubmed - indexed publication analysis in the field of dentistry, iranian dental research output was promising and showed an increasing trend in the recent years. | objectives : scientometric methods and the resulting citations have been applied to investigate the scientific performance of a nation. the present study was designed to collect the statistical information of dental articles by iranian authors published in pubmed.materials and methods : we searched the pubmed database for dental articles of iranian authors until june 31, 2015. all abstracts were manually reviewed in order to exclude false retrievals. the number of articles per dental subspecialties, distribution of research designs, scopus / google scholar citation of each article, number of authors and affiliation of the first / corresponding author were extracted and transferred to microsoft excel. the data were further analyzed to illustrate the related scientometric indicators.results:a total of 3,835 articles were retrieved according to the selection criteria. the number of pubmed - indexed publications between 2008 and 2015 showed a seven - fold increase. the majority of articles were written by four authors (24.56%). systematic reviews and clinical trials constituted 9.20% of all publications. the number and percentage of articles with 4 citations from google scholar (n=2024 ; 52.78%) were higher than those from scopus (n=1015 ; 26.47%). according to affiliated departments of the first authors, the top three dental subspecialties with the highest number of publications belonged to endodontics (19.82%), orthodontics (11.13%) and oral and maxillofacial surgery (10.33%). moreover, the majority of articles originated from shahid beheshti- (14.47%), tehran- (13.72%) and mashhad- (12.28%) university of medical sciences.conclusions:analysis of pubmed - indexed dental publications originating from iran revealed a growing trend in the recent years. |
pharmacopuncture is a new acupuncture therapy based on a combination of meridian theory and herbal pharmacology. in pharmacopuncture, by injecting the extracts of herbs at acupuncture points, doctors gain a synergism of positive effects, i.e., a physical stimulation due acupuncture and a chemical effect due to the herbal medicine. recently, in korean medicine, pharmacopuncture has been widely used to treat patients with such diverse diseases as herniated intervertebral discs, arthropathia, skin diseases, and especially obesity. for obesity care, many reports have been published concerning related acupuncture points, such as jusanli (st36) and zhongwan (cv12), and pharmacopuncture extracts, such as atractylodes lancea, panax ginseng, sweet bee venom, etc. in addition, mahwang (ephedra sinica)- cheonoh (aconitum carmichaeli) extract is known to be able to inhibit the generation of fat cells, as well as the activation of collateral obese metabolic diseases. as a perennial plant belonging to the family ephedraceae, mahwang, in korean medicine, can perspire, drive out cold, generate diuresis, and reduce edema. mahwang also contains many alkaloids, such as ephedrine, pseudo - ephedrine, tannin and flavonoids, which can pharmacologically activate sympathetic nerves to reduce appetite, inhibit cholesterol absorption, and accelerate the disintegration of body fat [5, 6 ]. because of these effects, it has frequently been used as a herb prescription to treat obese patients and as an ingredient in food for short - term weight loss or for elevating exercise performance. as a perennial plant belonging to the ranunculaceae family, cheonoh is expected to be able to promote the blood - circulation system and the meridian system on the surface of the body and to stimulate metabolism just as mahwang can ; thus, cheonoh has frequently been used with mahwang as a herb prescription for the treatment of obese patients. reports have been published indicating that mahwangcheonoh pharmacopuncture is effective in promoting the disintegration of fat cells [4, 9 ]. however, to the best of the authors knowledge, no reports on its toxicity have yet to be published. accordingly, the authors performed such toxicity tests and obtained significant results demonstrating that mahwangcheonoh pharmacopuncture is a safe, credible pharmacopuncture therapy for treating obese patients. mahwangcheonoh pharmacopuncture extracts were prepared at the korean pharmacopuncture institute (seoul, korea) in a clean room, were stored in a refrigerator at 2.1 - 5.3c, and remained stable for 6 months following production (lot no. kpi-2013 - 03). the animals used in this study were 6-week - old specific - pathogen - free (spf) sprague - dawley (sd) male (184.7 - 204.0 g) and female (156.1 - 179.5 g) rats purchased from orientbio inc. this study was approved by the institutional animal care and use committees of biotoxtech (no. 130364). when the animals were received, a visual inspection was done, and weights were recorded using electronic scales (cp3202s, sartorius, gttingen, germany). the general symptoms and changes were checked once daily during the seven days of acclimatization, after which all animals were checked and found to be normal. all animals were bred in stainless - steel wire breeding boxes (260 mm (w) 350 mm (d) 210 mm (h)) kept at a temperature from 22.1 to 24.1c, a humidity from 47.7% to 70.8%, and an illuminance from 150 to 300 lux, with a 12-hour light (7:00 am to 7:00 pm)/dark cycle. each breeding group was divided by three animals during acclimatization periods and was divided by one animal during observation periods. feed (teklad certified irradiated global 18% protein rodent diet 2918c, harlan laboratories inc., usa) and ultraviolet (uv) sterilizer running water were provided freely. twenty male and twenty female rats with weights closest to the mean weight were selected. the selected animals were distributed into four groups (five rats of each sex per group). the mahwangcheonoh pharmacopuncture extracts were injected into the animals via a muscular route, and the high dose was set at 1.0 ml per animal because no mortalities had occurred in a preliminary test (biotoxtech study no. : b13474p) in which a single dose of 1.0 ml of mahwangcheonoh pharmacopuncture extract had been injected into the muscles of male and female rats. based on this high dose, we set 0.5 ml per animal as the medium dose and 0.25 ml per animal as the low dose. for the control group, 1.0 ml of normal saline was injected. in the low - dose group (g2) and the medium - dose group (g3), the mahwangcheonoh pharmacopuncture extracts were injected into the left femoral muscle. for the control group (g1) and the high - dose group (g4), 0.5 ml of normal saline and 0.5 ml of mahwangcheonoh pharmacopuncture extract, respectively, were injected into the left and the right femoral muscles, for a total of 1.0 ml per animal. on the day of injection (day 0), general symptoms (types of toxic indications, times of toxic expression, recovery times) and any deaths were recorded at 30 minutes and at 1, 2, 4 and 6 hours after injection. from day 1 until day 14 after injection, body weights were measured on the day of injection (before injection) and on days 3, 7 and 14 after injection. all animals were denied access to food and water (fasted) for at least 18 hours prior to necropsy. on the day of necropsy (15 days after injection), the animals were anesthetized with isoflurane, and blood was collected from the abdominal aorta. one ml of the collected blood was put into a tube containing ethylene diamine tetraacetic - acid (edta), and the hematology parameters, the prothrombin time (pt) and the activated partial thromboplastin time (aptt) were measured using a hematology analyzer (advia 2120i, siemens, germany). two ml of the collected blood were put into a tube containing 3.2% sodium citrate ; then, the plasma was collected after centrifugation at 3,000 rpm for 10 minutes. a coagulation examination was performed using coagulation time analyzers (coapresta 2000, sekisui, japan) to measure the pt and the aptt. the blood biochemistry was determined by using serum taken from blood that had been collected from the abdominal aorta and had been centrifuged at 3,000 rpm for 10 minutes. a blood chemistry analyzer (7180, hitachi, japan) and an electrolyte analyzer (avl 9181, roche, germany) were used for the measurements. for the histopathology, the organs and the tissues collected from all animals after necropsy were inspected. after necropsy, tissues surrounding the injection regions were excised and fixed in 10% neutral buffered formalin solution, after which local resistance tests were performed on those tissues. fixed organs and tissues sections the weights, as well as the hematological and the blood biochemical results, were analyzed by using sas (version 9.2, 9.3, sas institute inc. a bartlett test was conducted to evaluate equal variance between the test and the control groups (p < 0.05). the one - way analysis of variation (anova) test was conducted when equal variance was recognized on the bartlett test (p < 0.05), and the dunnett s t - test was conducted when equal variance was recognized on the anova test (both p < 0.05, p < 0.01). also, the kruskal - wallis test was conducted when equal variance was not recognized on the bartlett test (p < 0.05), and the steel - test was conducted when equal variance was recognized on the kruskal - wallis test (both p < 0.05, p < 0.01). during the observation period, no abnormal symptoms or deaths were observed in either the male or the female rats in the test and the control groups (table 1) during that period, the weights of the male rats in the control and the test groups changed from 192.6 8.7 g (g1), 195.6 5.6 g (g2), 195.3 4.3 g (g3), and 193.2 7.4 g (g4) to 314.1 11.9 g (g1), 315.0 18.0 g (g2), 314.2 16.3 g (g3), and 318.5 16.2 g (g4), respectively. those of the female rats changed from 166.3 6.0 g (g1), 168.3 6.9 g (g2), 169.2 9.1 g (g3), and 167.4 7.4 g (g4) to 227.5 10.1 g (g1), 235.4 9.9 g (g2), 230.5 15.3 g (g3), and 223.4 9.2 g (g4), respectively. however, no statistically significant changes in weights associated with injection were recognized (figs. no significant differences were observed in the hematology between the test groups and the control group for either the male or the female rats (tables 2,3). the change observed in the lowdose female group (g2) was a minor variation because it was observed sporadically and exhibited no a dose dependency. that change was determined to be an accidental change with no statistical significance (tables 4,5). the results on the local resistance tests were not affected by the injections. however, a weak inflammation was observed in the region of injection in a rat in the control group. because the inflammation occurred in the control group, it was determined to have no toxicological significance, but rather to be a spontaneous or accidental change without injection relevance. according to national health statistics, the obesity rate in korean adults, based on the body mass index (bmi), has reached 31.5%, being 37.7% in males and 25.3% in females. also, the teenage obesity rate in korea has reached 11.5%. because of this, the people s interest in obesity has also increased. according to a survey, 85.4% of the people were aware of being overweight, and 60% indicated that they were actively trying to lose weight. moreover, during 2008, the social and economic cost associated with the treatment of obese patients in the country was estimated to be approximately 1.6 billion us dollars. because of this, many medical workers can not but be interested in research on treatments for obesity. in korean medicine, much research has been done on the treatment of obese patients by using acupuncture, electro- acupuncture, moxibustion, herbs, subcutaneous acupuncture, and exercise therapy. among these possible treatments, pharmacopuncture injection of one - tenth the volume of a medicine dose directly into fatty areas or acupuncture points moreover, many pharmacopuncture solutions for obesity treatment have already undergone many safety and reliability tests in both experimental and clinical studies. pharmacopuncture extracts known to be effective in the treatment of obese patients are ephedra, atractylodes lancea, coix lacryma - jobi, astragalus propinquus, angelica, ginseng [14, 15 ], and the like. all of these have been found through laboratory research to be able to reduce effectively blood lipids or fat cells, and body weight, to have no toxicity, and to result in no abnormalities in the blood levels. mahwangcheonoh pharmacopuncture has also been proven to be effective in the treatment of obese patients [4, 9 ], but its toxicity and safety have not been adequately addressed. thus, this research was conducted to establish the toxicity, safety, and stability of this pharmacopuncture so that it could be added as another reliable pharmacopuncture for the treatment of obese patients. this study observed the general symptoms, weight changes, and hematological and biochemical blood changes caused by single - dose intramuscular injection of mahwangcheonoh pharmacopuncture in sd 6-week - old male and female rats. the rats were also subjected to necropsy to identify any changes in tissues or organs due to the injections. no deaths or abnormalities occurred any of the rats, and no significant differences in body weights were observed during the 14-day observational period following injection of the pharmacopuncture. finally, no abnormal changes due to the pharmacopuncture were observed on the histopathological examinations after the necropsy. based on the above results, the lethal single dose of mahwangcheonoh pharmacopuncture for rats is over 1.0 ml / animal. in addition, the mahwangcheonoh pharmacopuncture at that dose is stable and safe to use and has no toxic effects on viscera, muscles or functions. although this study has shown that mahwangcheonoh pharmacopuncture is safe to use at doses of 1.0 ml or less, no research on its side effects has yet been officially reported. in addition, because this research involved investigating the effect of a single - dose injection over a 14-day observation period, research on its long - term effects and on the effects of multi - dose injections is needed if mahwangcheonoh pharmacopuncture is to be firmly established as an effective treatment for obese patients. the objective of this study was to analyze the safety and the toxicity of mahwangcheonoh pharmacopuncture. the results after a single intramuscular dose and observations of the general symptoms over a 14-day period showed no abnormal symptoms or mortalities in either the test groups or the control group. in addition, no significant changes in weight, hematology, blood biochemistry, and histopathology between the test groups and the control group were found. based on these results, we consider the lethal dose of mahwangcheonoh pharmacopuncture to be far beyond 1.0 ml / animal ; thus, mahwangcheonoh pharmacopuncture may be considered a safe therapeutic agent for the treatment of patients with obesity. s.d., standard deviation ; rbc, red blood cell ; hgb, hemoglobin ; hct, hematocrit ; mch, mean corpuscular hemoglobin ; mcv, mean corpuscular cell volume ; mchc, mean corpuscular cell hemoglobin concentration ; plt, platelet ; reti, reticulocytes ; wbc, white blood cell ; neu, neutrophils ; lym, lymphocytes ; mono, monocytes ; eos, eosinophils ; baso, basophils ; pt, prothrombin time ; aptt, active partial thromboplastin time. s.d., standard deviation ; rbc, red blood cell ; hgb, hemoglobin ; hct, hematocrit ; mch, mean corpuscular hemoglobin ; mcv, mean corpuscular cell volume ; mchc, mean corpuscular cell hemoglobin concentration ; plt, platelet ; reti, reticulocytes ; wbc, white blood cell ; neu, neutrophils ; lym, lymphocytes ; mono, monocytes ; eos, eosinophils ; baso, basophils ; pt, prothrombin time ; aptt, active partial thromboplastin time. s.d., standard deviation ; alt, alanine aminotransferase ; ast, aspartate aminotransferase ; alp, alkaline phosphatase ; ggt, gamma glutamyltranspeptidase ; glu, glucose ; bun, blood urea nitrogen ; crea, creatinine ; t - bili, total bilirubin ; t - chol, total cholesterol ; tg, triglycerides ; tp, total protein ; alb, albumin ; a / g ratio, albumin / globulin ratio ; p, phosphorus ; ca, calcium ; na, sodium ; k, potassium ; cl, chlorine. s.d., standard deviation ; alt, alanine aminotransferase ; ast, aspartate aminotransferase ; alp, alkaline phosphatase ; ggt, gamma glutamyltranspeptidase ; glu, glucose ; bun, blood urea nitrogen ; crea, creatinine ; t - bili, total bilirubin ; t - chol, total cholesterol ; tg, triglycerides ; tp, total protein ; alb, albumin ; a / g ratio, albumin / globulin ratio ; p, phosphorus ; ca, calcium ; na, sodium ; k, potassium ; cl, chlorine. p < 0.05, which implies the existence of a statistically significant difference from the control group based on the steel test | objectives : this study was conducted to analyze the single - dose toxicity and the safety of mahwangcheonoh pharmacopuncture extracts.methods:six-week-old sprague - dawley rats were used for this study. doses of mahwangcheonoh pharmacopuncture extracts were set at 0.25 ml (low - dose), 0.5 ml (medium - dose) and 1.0 ml (high - dose) for the test groups. a dose of 1.0 ml of normal saline solution was set for the control group. during 14 days, general symptoms, mortalities, and changes in hematology, blood biochemistry and histopathology of all rats were observed.results:no death was observed in all test groups. any abnormal symptom was not observed in all of the groups. no significant changes in weight between the control group and the test groups were observed. in addition, no significant differences in the hematology signs, the blood biochemistry levels and the histopathological signs related to the mahwangcheonoh pharmacopuncture extracts injection were observed.conclusion:the findings of this study indicate that mahwangcheonoh pharmacopuncture at doses of 1.0 ml or less may be consider safe and non - toxic. so, it can be used for therapy of obesity sufficiently. but further studies on this subject must be performed to confirm and verify this conclusion. |
congenital pericardial defects (cpds) are uncommon anomalies that are usually discovered unexpectedly by a cardiologist, radiologist, or surgeon. occasionally, these defects may cause symptoms such as chest pain, dyspnea, arrhythmias, syncope, and even sudden death. arrhythmias, including atrial fibrillation (af), are uncommonly found in cases of cpd. herein, we report the case of a patient with persistent af associated with a cpd and herniation of an enlarged left atrial (la) appendage. the patient was treated successfully with a hybrid procedure, in which total thoracoscopic ablation (tta) was followed by an electrophysiological (ep) study. his medical history was otherwise unremarkable, except for a history of hypothyroidism diagnosed eight years previously. a hybrid procedure involving tta followed by an ep study preoperative computed tomography (ct) and echocardiography showed no evidence of thrombi or vegetation with la enlargement. the size and volume index of the la were 55 mm and 69.4 ml / m, respectively. tta was performed under general anesthesia with double - lumen intubation. on the right side, a larger than normal atrium a large pericardial defect was found, through which an enlarged la appendage was herniated (fig. 1b). although handling the lighted dissector (atricure lumitip dissector ; atricure inc., cincinnati, oh, usa) was difficult due to the large mobile la appendage, pulmonary vein isolation and additional superior and inferior line ablation were successfully completed, and the la appendage was resected with an endoscopic stapler. an episode of af occurred on the fourth postoperative day, and the patient was converted to sinus conversion through cardioversion. a follow - up ep study on the eleventh postoperative day revealed successful pulmonary vein isolation, and cavotricuspid isthmus ablation was performed. left - side defects are most common, accounting for approximately 70% of cases, followed by right - side defects (17%) and complete defects (9%). although patients are usually asymptomatic and most cpds are discovered incidentally, patients with partial defects may present with acute symptoms such as chest pain, dyspnea, arrhythmia, syncope, and even sudden death due to strangulation of the herniated cardiac chamber. echocardiography and ct are the most common methods used to evaluate cardiac and thoracic abnormalities ; however, pericardial defects may go unrecognized for years, as in this case. magnetic resonance imaging (mri) has been reported to be superior to echocardiography, but cardiac mri is still only applicable to a limited set of lesions. furthermore, enlargement of the la and la appendages due to herniation, as in our patient, may contribute to the development of persistent af, and may even be its cause. several methods have been proposed for the treatment of cpd, including la appendectomy, extension of the pericardium to reduce incarceration, primary closure, and patch closure using synthetic materials. however, no consensus currently exists regarding therapeutic options for cpd due to the small number of cases. although a previous case of paroxysmal af was resolved via resection of the la appendage instead of antiarrhythmic interventions, in cases of persistent af with an enlarged chamber, as in our patient, antiarrhythmic management techniques such as tta are probably necessary. however, it involves complex techniques and invasive procedures, requiring median sternotomy and cardiopulmonary bypass [1012 ]. accordingly, some researchers have recently suggested that minimally invasive thoracoscopic ablation be used, and hybrid tta has shown excellent results with low morbidity rates [1315 ]. in our patient, the hybrid tta procedure was initially planned for his persistent af, and the cpd was an incidental finding. although the visual field was disturbed by the enlarged la appendage, the entire ablation procedure was successfully performed and the la appendage was resected safely. in conclusion, cpd is a possible incidental finding when performing cardiac operations, including tta. enlarged la and la appendages due to herniation through the defect may cause persistent af, and antiarrhythmic treatment may be necessary for such patients. tta can be successfully performed in patients with persistent af associated with a cpd and herniation of the enlarged la and/or an la appendage. | congenital pericardial defects (cpds) are infrequent anomalies that are usually asymptomatic and are discovered incidentally during unrelated interventions. here we report the case of a cpd with herniation of an enlarged left atrial appendage identified during total thoracoscopic ablation (tta) for persistent atrial fibrillation (af). the persistent af was successfully treated with a hybrid procedure, in which tta was followed by an electrophysiological study. |
hypertension (ht) is not an adult disease anymore ; it is a silent disease that is generally asymptomatic in childhood and adolescent period. it plays the important pathophysiological role in the development of the reduction in baroreflex sensitivity and retinal alteration. hypertension studies in children and adolescents are of great importance since control at this stage is likely to prevent adverse sequelae in later life. hypertension is a major cause of morbidity, which unless controlled in early life, may tend to introduce a high risk in adulthood. a previous worldwide report records the prevalence of hypertension in children as ranging from 3% to 16.2%. the diversity of the results in hypertension studies stems from the different criteria used, selection of the age group and study population (ethnic), study area (urban and rural), culture, as well as dietary habits (socioeconomic). this study was to detect the prevalence and risk factors of hypertension in children / adolescents aged 10 to 17 years. the objectives and the importance of the study were first explained to the teachers and parents. the children / adolescents aged 1017 years in each selected school in chennai were examined. two field survey teams, each comprising a medical officer and a social scientist were formed. the physician elicited medical history and carried out clinical examination including measurement of blood pressure (bp). the social scientist recorded the background information such as the food frequency questionnaire (ffq) and anthropometric measurements. after getting the child to sit for five minutes, with the back supported and both feet on the floor, systolic and diastolic blood pressures (sbp) were measured on the right arm extended over a table at the level of heart with a calibrated standard sphygmomanometer. a set of different sized cuffs was used to circle the arm completely up to two - thirds of the upper arm without overlapping. systolic pressure was recorded when the initial sound was heard (phase i of the korotkoff sound) ; diastolic pressure was recorded at the disappearance of the sound (phase v of the korotkoff sound). the arithmetic mean of these three sitting bp measurements was used as the mean sitting office bp (mssbp). a cross check of 57% of the hypertension subjects at different times by different teams was done for both accuracy and consistency. every effort was made to avoid staff - child interaction, such as talking, in order to maximize reproducibility. every effort was made to have the same staff member take the bp measurements of the same child, at the same time of day, using the same equipment. hypertension was defined as mssbp above the 95 percentile for age, gender, and height as per recommendation of the national high blood pressure education program working group on high bp in children / adolescents (nhbpep fourth report 2004). the height and weight were measured with the child standing without shoes ; body mass index (bmi) was calculated for all children / adolescents. information on risk factors for hypertension like family history of hypertension and diabetes mellitus were asked for their socioeconomic status was also assessed. their reduced physical activities (arbitrarily children who engaged in a physical activity < 30 min for 4 days per week) posed a high risk. hours of watching television and their monthly consumption of oil were also noted as high risk factors. the fourth report on the diagnosis, evaluation and treatment of high bp in children and adolescents is an authentic source of childhood and adolescent hypertension (2004). in this report, definition and classification of hypertension in children / adolescents we followed the same ffq - pure study from the south india described earlier for the study monthly per capital income was assessed by the children with a score of 1629, and above ; modified kuppusamy scale (2007) was assigned to the upper socioeconomic status and < 15 lower socioeconomic status. the factors found to be significant by univariate analysis, namely the family history of hypertension, diabetes mellitus, obesity, high socioeconomic status, and female gender were included for multivariate analysis. the data were collected and entered, after which we manually checked and rechecked for accuracy. those variables found to be significantly associated were then studied by multivariate analysis logistic regression. they were screened for hypertension and associated risk factors. there were 2107 girls and 1799 boys [table 2 ]. prevalence of hypertension among 10 - 17 year old children and adolescents by age and gender the overall prevalence of hypertension was 9.5% (371) of 3906 children / adolescents studied ; the prevalence of hypertension in boys was 8% (144 of 1799) with peak prevalence around 1215 years of age. children / adolescents with both systolic and diastolic hypertension were 31 (21%) out of 144. of the girls, the overall prevalence was 10.7% (227) of 2107 children, with peak prevalence around 1216 years of age. isolated systolic hypertension was present in 60 girls (26.4%) ; diastolic hypertension alone was seen in 106 children (47%) and 61 (26.6%) out of 227 children had both systolic and diastolic hypertension. univariate analyses of risk factors for hypertension in these children / adolescents were done [table 3 ]. univariate analysis for association between various risk factors and hypertension among 10 - 17 year old children and adolescents the overall prevalence of obesity was 2.7% among the hypertensives (106 out of 3906) ; 2.1% (75 out of 3535) in the normotensive obesity in boys was 2% (36 out of 1799) and 3.32% (70 out of 2107) in girls. the overall prevalence of overweight was 5.25% (205 out of 3906). in normotensives, the prevalence of overweight was 4.8% (170 out of 3535) and it was 9.43% (35 out of 371) in hypertensives. overweight in boys was 2.17% (39 out of 1799) and 7.87% (166 out of 2107) in girls. a positive family history of hypertension among hypertensives was 13.2% compared to 8.3% of the normotensives. a positive family history of diabetes mellitus in the hypertensives was 5.3% as against 3.6% of the normotensives. the prevalence of hypertension in children / adolescents of low socioeconomic families was 8.85% as against 10.2% in children / adolescents of high socioeconomic families. children / adolescents with hypertension were more likely to be obese than children / adolescents with normal bp (odds ratio [or ] : 1.21 [2.726.48 ] 95% confidence interval [ci ]). children / adolescents with hypertension were 1.6 times more associated with a family history of hypertension than children with normal bp (or : 1.66 [1.202.30 ] 95% ci) children who had hypertension were 1.3 times more likely to be girls than the normotensives (or : 1.39 [1.111.72 ] 95% ci). the factors found to be significant by univariate analysis were included in multivariate analysis [table 4 ]. family history of hypertension (or : 1.67 [1.212.33 ] 95% ci) obesity (or : 4.67 [3.007.27 ] 95% ci), and overweight (or : 2.17 [1.473.22 ] 95% ci) were found to be independent risk factors associated with hypertension in the study population. multivariate logistic regression showed that cases had 1.67 times higher family history, were 4.67 times more obese and were 2.17 times more overweight compared to control children. multiple logistic regression analysis - factors for hypertension in children and adolescents aged 10 - 17 years the mean systolic and diastolic bp levels of children were studied in relation to age in both males and females. in both sexes, systolic and diastolic bp of boys and girls with age noted agrees with the findings in the task force committee report and other studies. the varying results may be due to varying age groups in the study, the different criteria adopted to define hypertension, and the basic differences between racial groups as relates to geographic, dietary, and cultural factors. in this study, there were more hypertensive girls (10.8%) than boys (8.0%), results which do not correlate with those of other studies, in which hypertensive boys were 11.9% ; girls were 11.4% ; prevalence of overweight (7.87%) and obesity (3.32%) in girls was higher than overweight (2.17%) and obesity (2%) in boys. in our study, the prevalence of obesity was 2.7%, which is higher than that reported by another another study. positive family history of diabetes mellitus among hypertensives was 5.3% as against 3.6% in normotensives, which is similar to the study by chanda. hypertension in obese children / adolescents was 8.35%, which was twice what was observed by other study groups. in this study, there was a positive family history of hypertension in 8.3%, which is less than what was observed by another indian study. significant risk factors for hypertension in adolescents in our study by univariate analysis were obesity, overweight, and a positive family history of hypertension, which agreed with a previous study. there is an increasing trend toward a high prevalence of hypertension in children of school age as a result of obesity and positive family history of hypertension and diabetes mellitus. high socioeconomic status, faulty lifestyle, dietary habits, and physical inactivity are key factors which must be dealt with immediately and aggressively. based on our findings, hypertension is no more a disease that comes at a later stage in life. it is crucial to advise obese children to modify their lifestyle with respect to diet, exercise, and salt intake to maintain a normal bp and avoid the childhood onset of adult hypertension. | background : since the data of primary hypertension (ht) in children is scanty in india, this study attempted to evaluate ht by a multidimensional investigation of the various risk factors in children and adolescents.materials and methods : a total of 3906 subjects were recruited, all of whom lived in chennai, an urban area of tamil nadu. the children and adolescents aged from 10 to 17 years were selected by random sampling. the children / adolescents were randomized into one control and further divided into two groups. the national high blood pressure education program fourth report (2004) and anthropometric body mass index (bmi), food frequency questionnaire (pure) were followed in the study.results:out of 3906 children, 2107 were girls and 1799 boys. on screening, we found 9.5% to be hypertensive with the prevalence rate of boys and girls 8% and 10.8%, respectively. overall obesity was 2.7%, (boys 2%, girls 3.32%) ; hypertensives and normotensives were 8.4% and 2.1%, respectively. we found that overweight (odds ratio [or ] : 2.06 [1.403.01 ] 95% confidence interval [ci ]), obese children (or : 1.21 [2.726.48 ] 95% ci), and those with a family history of ht (or : 1.66 [1.202.30 ] 95% ci) had increased risk of hypertension. females were 1.39 times (or : 1.39 [1.111.72 ] 95% ci) more at risk of getting ht. multivariate analysis showed that obese children / adolescent were four times more likely to have ht than children with normal bmi (or : 4.67 [3.007.26 ] 95% ci].conclusion : family history of ht, obesity, and female gender are associated with a high risk of ht. the prevalence of ht was higher among obese adolescents than among slender subjects. this may be related to their sedentary lifestyle, faulty eating habits, high fat content in the diet and little physical activity. |
artificial insemination by donor (aid) is a reproductive medical procedure for infertile couples that entails insertion of a fine catheter directly into the uterus to deposit a sperm sample from a donor with the aim of achieving pregnancy. aid is used primarily in male spouses with incurable nonobstructive azoospermia or other related problems. however, its introduction in korea in 1993 has raised social and medical concerns related to the use of fresh sperm in aid. subsequently, the korean society of obstetrics and gynecology ethical outlines and operation procedures for aid were amended in the fifth revised edition, and the " declaration of artificial conception ethics " was also announced, which reiterated that the procedures and guidelines are ethically, medically, and administratively acceptable. recently, the ministry of health and welfare preannounced " legislation on bio - ethics and safety " to strengthen national authority on reproductive diagnoses and research on the ethics and safety of such procedures. we established the first public sperm bank in korea in april 1997, which at that point considered only self - produced sperm from spouses and nonspouses based on the declaration of artificial conception ethics and guidelines for gamete and embryo donation by the american society for reproductive medicine. the implementation of aid was followed by a rise in psychological anxiety and conflict in infertile couples because the sperm from a nonspouse is used. significant distress is likely to follow for the husband because of his own impaired reproductive health, the use of a stranger 's sperm, and concern about genetic differences between him and his future child. the wife may also feel depressed about the potential for problems in the relationship with her husband or with other family members as a result of becoming pregnant via aid. thus, a more careful consideration of the timing and frequency of the procedure and of the effect that it will have on the family relationship is warranted to minimize these problems. we conducted a series of surveys in couples with male infertility to collect information necessary for aid counseling. aid had been recommended to these couples, or they had already undergone the procedure, and we investigated how the decision to use aid was made and how the infertile husband felt about the situation. in total, 126 inquiry surveys (32.8%) were completed from among 384 distributed to couples with male infertility who lived in the busan and gyoungnam provinces and who had visited the fertility clinic at pusan national university hospital to receive or explore aid from november 1997 to november 2012. the questionnaire used in the study was developed for the purposes of this study and consisted of 18 questions in five different topic areas : (1) demographic characteristics (average age of the couple, marriage duration, number of children, and sex ratio), (2) background concerning the choice to use aid (route of choice, person who recommended and discussed aid, reasons for the decision), (3) subjective experiences related to using aid (expected degree of surgical procedure, presence of anxiety and its causes, and desire for an infant), (4) long - term effects of aid (effects of both success and failure of the pregnancy on psychological status, feelings after the pregnancy, changes in views of life, feelings about children growing up, and whether or not the child will be notified of aid), and (5) overall evaluation of aid (satisfaction, need for the medical procedure, preference for another procedure) (supplementary questionnaire). the average ages of the husbands and wives were 33.64.3 and 30.12.7 years, respectively (table 1). sixty - one males (48.4%) and 91 females (72.2%) were 30 - 34 years old. in addition, 52 participants (41.2%) had 69 children who were born through aid, and the boy : girl ratio was 2.28:1. about 37.3% of the infertile couples (47 respondents) learned about aid from doctors, 34.1% (43 respondents) from books and magazines, 11.1% (14 respondents) through television and the internet (news, blogs, internet cafs, information boards, etc.), 7.1% (9 respondents) from people around them, 3.2% (4 respondents) through the newspaper, 1.7% (2 respondents) from people who had previously undergone aid, and 1.6% (2 respondents) through movies. of these sources, mass media such as books, magazines, television, the internet, movies, and newspapers were the source of information for 50% (63 respondents)-the highest proportion. about 56% of the respondents (n=71) answered that the husband recommended aid, about 32.5% (n=41) that the wife recommended aid, and about 11.1% (n=14) that both the husband and wife recommended aid. with regard to other people with whom aid was discussed, the highest proportion, about 65% of respondents (n=82), answered that they discussed aid with their wives. about 19% of respondents (n=24) had discussed it with their parents, 8.7% (n=11) with their families, 5.5% (n=7) with their wives and friends, and 1.5% (n=2) with their wives, brothers, and sisters. the wife was regarded as the most important person when deciding whether to undergo aid. about 86% (n=109) of respondents answered that they wanted to undergo aid to form a perfect family, followed by 53.1% (n=67) who simply wanted children. keeping the marriage, maintaining a normal life, not interested in adoption, and preparation for later years were mentioned by 41.2% (52 respondents), 37.3% (47 respondents), 27.7% (35 respondents), and 22.2% (28 respondents). approximately 46% of respondents (n=58) answered that they strongly wanted aid, and 23.0% (n=29) answered that they were uncertain. a strong recommendation from the wife and no preference accounted for 20.6% (26 respondents) and 10.3% (13 respondents) of the answers (n=126). about 70% of respondents (n=88) were anxious when aid was being implemented. the reasons for the anxiety were the possibility of delivering a malformed infant in 73.8% of respondents (n=93), issues of confidentiality in 65.8% (n=83), difference in appearance between the father and child in 64.2% (n=81), the safety of the donated sperm in 62.6% (n=79), information leakage in 57.1% (n=72), success rate of the pregnancy in 41.2% (n=52), public judgment in 38.8% (n=49), and incompatible blood type in 11.9% (n=46) (fig. about 61% of respondents (n=77) answered that they very much wanted to participate in aid, followed by 36.5% (46 respondents) with a moderate interest in doing so. only 2.3% (3 respondents) had a low interest in aid as an option. when aid was successful (n=57), 45.6% of respondents (n=26) reported both good and bad feelings, whereas 8.7% (n=5) felt good and had a generally positive reaction about the pregnancy. when aid failed (n=37), 51.3% (19 respondents) wanted to forget the result, 29.7% (11 respondents) answered that they blamed their doctors, and 24.3% (9 respondents) reported regret, acceptance, or no thought at all about aid. this outcome represented failure of the pregnancy, which frustrated patients. in terms of their initial feelings upon holding the infant after birth (n=47), 68.0% of respondents (n=32) answered that they felt very good, 23.4% (11 respondents) that they had both good feelings and anxiety, and 8.5% (n=4) that they felt good. about 71% of 52 respondents (n=37) reported that aid positively changed their view of life, whereas 28.8% (n=15) had both positive and negative reactions. positive aspects of the experience were expressed in terms of family love by 65.3% (34 respondents), recovered self - esteem by 46.1% (24 respondents), being viewed as an acceptable person by 42.3% (22 respondents), being pleased with their work in 21.1% (11 respondents), and well - balanced feelings in 17.3% (9 respondents) (fig. 60.0% of respondents (n=9) were self - conscious about others ' reactions, 40.0% (n=6) felt a sense of alienation, and 13.3% (n=2) felt anxious about the growth of their child. about 63% of respondents (n=31) accepted infants born through aid as their own children, and 26.5% (n=13) expressed a positive reaction when similarities to them were found. about 20% of respondents (n=10) felt uncomfortable with others ' views, 14.2% (n=7) reported that the child looked different from them, and 6.1% (n=3) mentioned a difference in personality. in regard to telling their children about aid (n=77), 41.5% of respondents (n=32) strongly disagreed with telling the truth to their child, 29.8% (n=23) wanted to hide the truth, 19.4% (n=15) reported that they had not thought about this, and only 9.0% (n=7) wanted to decide depending on the situation (fig. nearly 75.0% of respondents (n=66) were satisfied with aid, 15.0% (n=12) were strongly satisfied, and 2.5% (n=2) expressed intense satisfaction. additionally, all 91 respondents agreed with the importance of aid as an option in cases of male infertility. about 54% of respondents (n=34) answered that they would consider undergoing aid again to have another child, 26.9% (n=17) disagreed with undergoing aid again, 12.6% (n=8) agreed with participating in aid again, and 6.3% (n=4) never wanted to undergo aid again. the average ages of the husbands and wives were 33.64.3 and 30.12.7 years, respectively (table 1). sixty - one males (48.4%) and 91 females (72.2%) were 30 - 34 years old. in addition, 52 participants (41.2%) had 69 children who were born through aid, and the boy : girl ratio was 2.28:1. about 37.3% of the infertile couples (47 respondents) learned about aid from doctors, 34.1% (43 respondents) from books and magazines, 11.1% (14 respondents) through television and the internet (news, blogs, internet cafs, information boards, etc.), 7.1% (9 respondents) from people around them, 3.2% (4 respondents) through the newspaper, 1.7% (2 respondents) from people who had previously undergone aid, and 1.6% (2 respondents) through movies. of these sources, mass media such as books, magazines, television, the internet, movies, and newspapers were the source of information for 50% (63 respondents)-the highest proportion. about 56% of the respondents (n=71) answered that the husband recommended aid, about 32.5% (n=41) that the wife recommended aid, and about 11.1% (n=14) that both the husband and wife recommended aid. with regard to other people with whom aid was discussed, the highest proportion, about 65% of respondents (n=82), answered that they discussed aid with their wives. about 19% of respondents (n=24) had discussed it with their parents, 8.7% (n=11) with their families, 5.5% (n=7) with their wives and friends, and 1.5% (n=2) with their wives, brothers, and sisters. the wife was regarded as the most important person when deciding whether to undergo aid. about 86% (n=109) of respondents answered that they wanted to undergo aid to form a perfect family, followed by 53.1% (n=67) who simply wanted children. keeping the marriage, maintaining a normal life, not interested in adoption, and preparation for later years were mentioned by 41.2% (52 respondents), 37.3% (47 respondents), 27.7% (35 respondents), and 22.2% (28 respondents). approximately 46% of respondents (n=58) answered that they strongly wanted aid, and 23.0% (n=29) answered that they were uncertain. a strong recommendation from the wife and no preference accounted for 20.6% (26 respondents) and 10.3% (13 respondents) of the answers (n=126). the reasons for the anxiety were the possibility of delivering a malformed infant in 73.8% of respondents (n=93), issues of confidentiality in 65.8% (n=83), difference in appearance between the father and child in 64.2% (n=81), the safety of the donated sperm in 62.6% (n=79), information leakage in 57.1% (n=72), success rate of the pregnancy in 41.2% (n=52), public judgment in 38.8% (n=49), and incompatible blood type in 11.9% (n=46) (fig. about 61% of respondents (n=77) answered that they very much wanted to participate in aid, followed by 36.5% (46 respondents) with a moderate interest in doing so. only 2.3% (3 respondents) had a low interest in aid as an option. when aid was successful (n=57), 45.6% of respondents (n=26) reported both good and bad feelings, whereas 8.7% (n=5) felt good and had a generally positive reaction about the pregnancy. when aid failed (n=37), 51.3% (19 respondents) wanted to forget the result, 29.7% (11 respondents) answered that they blamed their doctors, and 24.3% (9 respondents) reported regret, acceptance, or no thought at all about aid. this outcome represented failure of the pregnancy, which frustrated patients. in terms of their initial feelings upon holding the infant after birth (n=47), 68.0% of respondents (n=32) answered that they felt very good, 23.4% (11 respondents) that they had both good feelings and anxiety, and 8.5% (n=4) that they felt good. about 71% of 52 respondents (n=37) reported that aid positively changed their view of life, whereas 28.8% (n=15) had both positive and negative reactions. positive aspects of the experience were expressed in terms of family love by 65.3% (34 respondents), recovered self - esteem by 46.1% (24 respondents), being viewed as an acceptable person by 42.3% (22 respondents), being pleased with their work in 21.1% (11 respondents), and well - balanced feelings in 17.3% (9 respondents) (fig. 60.0% of respondents (n=9) were self - conscious about others ' reactions, 40.0% (n=6) felt a sense of alienation, and 13.3% (n=2) felt anxious about the growth of their child. about 63% of respondents (n=31) accepted infants born through aid as their own children, and 26.5% (n=13) expressed a positive reaction when similarities to them were found. about 20% of respondents (n=10) felt uncomfortable with others ' views, 14.2% (n=7) reported that the child looked different from them, and 6.1% (n=3) mentioned a difference in personality. in regard to telling their children about aid (n=77), 41.5% of respondents (n=32) strongly disagreed with telling the truth to their child, 29.8% (n=23) wanted to hide the truth, 19.4% (n=15) reported that they had not thought about this, and only 9.0% (n=7) wanted to decide depending on the situation (fig. nearly 75.0% of respondents (n=66) were satisfied with aid, 15.0% (n=12) were strongly satisfied, and 2.5% (n=2) expressed intense satisfaction. additionally, all 91 respondents agreed with the importance of aid as an option in cases of male infertility. about 54% of respondents (n=34) answered that they would consider undergoing aid again to have another child, 26.9% (n=17) disagreed with undergoing aid again, 12.6% (n=8) agreed with participating in aid again, and 6.3% (n=4) never wanted to undergo aid again. aid has been widely used for infertile couples with aspermia, incurable male infertility, or a high incidence of severe hereditary diseases passed through the sperm. in the united states, the annual rate of pregnancy by aid was aid has also been used as a major treatment for male infertility in korea, and the ethics and legality of the procedures have been emphasized. the declaration of artificial conception ethics indicates that aid should be used only for couples who are legally married and infertile. sperm from the same donor can be used for pregnancy no more than 10 times, and all information about the donor is kept confidential. in fact, the actual conditions and statistics regarding aid are incomplete, because many patients directly involved in aid prefer to hide that they are undergoing aid. therefore, appropriate counseling should be given to couples who want aid, and the psychological effect of aid on the couple should be studied. this survey was conducted in infertile male patients, who planned to have aid, to identify how they felt about the procedure. about 13% of the survey results (41/321) were collected by mail, which was lower than that (79.6%, 121/152) for a prospective survey at a fertility clinic. klock and maier reported that a mail survey can possibly threaten the confidentiality of couples and that this issue would affect the participation rate in a retrospective survey. most couples who participated in the current survey were aged 30 - 34 years, as older couples were less inclined to participate. according to nachtigall. additionally, 109 of 126 women (86.5%) who underwent aid and became pregnant gave birth at other hospitals. this may be because of the convenience of another hospital 's location and a desire to keep their status confidential. karow jr reported that confidentiality was so important to infertile couples undergoing aid that they often gave birth in a hospital where their children would not be recognized as aid - born children. this attitude was attributed to the fact that infertile women in western countries are generally supported by their family and friends, whereas infertile men may encounter negative responses, such as ridicule. until now our study indicated that more boys than girls (2.28 times) were born through aid ; however, the actual statistics are unclear. for example, some studies have shown a higher ratio of boys to girls, and others have shown the reverse [9 - 11 ]. to explain this difference, some researchers have shown that the lower basal body temperature of women is more likely to lead to the birth of a boy. others have suggested that the use of ovulation - induction treatments involving mixed ovulation increases the chance of a girl being born. from the point of view of the sample size of all reported studies, it remains difficult to form a conclusion about sex ratio of children conceived through aid. the psychological effect of deciding to undergo aid, and the procedure itself, is not negligible. nachtigall. stated that the male patients with infertility are more likely to develop psychological distress and lose self - respect than are infertile females., this is demonstrated by the observation that fertility and intercourse are more important to males than females ; thus, infertility in males is likely to have a greater negative impact on self - respect. we found that when aid was recommended to husbands, and for about two - thirds of them, discussions with their wives on the matter dealt only with keeping the procedure a secret. wright. found similar differences in attitudes and responses from males and females towards aid. as reducing anxiety due to aid is a priority, approximately two - thirds of respondents in the survey should have received active counseling. and klock. emphasized the expected effects of counseling on reducing anxiety and also suggested that medical advice from mental - health professionals is necessary before couples undergo aid, because the safety of the donor 's genetic and medical history is not fully guaranteed. we found that the possibility of having a child with a disability was 60% greater than with typical births.. showed that broader screening for genetic abnormalities is not needed, because the frequency of malformations (2.3%) in typical - birth infants was similar to the frequency (1.7%) in infants resulting from aid. however, a higher age at pregnancy negatively affects the success of aid (virro and shewchuk). thus, klock. suggested that physicians remind infertile couples of the availability of counseling. that study also stressed the importance of counseling for patients who have experienced pregnancy failure through aid and are unwilling to try again. most couples who have children through aid maintain a stable marriage, as evidenced by a lower than average rate of divorce in these families : 2.2% in norway and 7.2% in the united states. the positive effect of aid on marriage was shown by amuzu. and schover., who reported that the mental status and self - respect of infertile couples are within the normal range. our results suggest that about 70% of couples have an overall positive view of aid. with regard to notifying children that they were born through aid, nachtigall. stated that 30% of couples told their children that they were conceived through aid, klock. reported a figure of 27%, and other studies reported a figure of 14% to 20% however, in our study, only 7.6% of the respondents planned to notify their children. the success of pregnancy through aid has encouraged more couples to undergo aid and, according to curie - cohen., about 11% of infertile couples revisit the fertility clinic to have a second child via aid (12.6% prefer aid for having a second child). the result of our survey showed a high acceptance of aid among infertile males. however, anxiety about the procedure, the health of the infant, and confidentiality were considerations. therefore, medical information about aid and relevant counseling should be offered to infertile men. | purposeinfertile couples interested in nonspouse artificial insemination by donor (aid) not only require a thorough understanding of the medical procedure but also must scrutinize the effects it will have on family relationships, including those on the infant to be born. we conducted a series of surveys in couples with male infertility to collect information necessary for aid counseling.materials and methodsa total of 384 cases with noncurable male infertility were enrolled in this inquiry survey. the questionnaire consisted of 18 items that assessed demographic characteristics, background information concerning the choice to use aid, subjective experiences, long - term effects, and an overall evaluation.resultsa total of 126 surveys were returned (32.8%). aid was first suggested by the husband in about half of the cases. the major reason for considering the procedure was to form a complete family. two - thirds of the couples were anxious about the procedure, most often about possible congenital or acquired deformities in the infant. after the birth of the child, most couples were positive about their decision to have used aid. about half of the couples felt that the child was their own and expected not to tell the child about aid. overall, about 50% of the couples were satisfied with the procedure.conclusionsthose who underwent aid experienced various psychological effects, including anxiety about the child to be born. to overcome these problems, sufficient medical information and consultation about the process of selecting the donor and about aid procedures should be provided before the procedure is used. |
brugada syndrome (bs) was first described in 1992 as a new autosomal dominantly inherited channelopathy caused by a defective gene located on chromosome 3 in a structurally normal heart. it is characterized by st - segment elevation in the right precordial leads and increases susceptibility to ventricular tachyarrhythmias. importantly, fluctuations in ecg patterns seem to be common among bs patients. for instance, vagotonic agents, -adrenergic agonists, fever and bradycardia are some of the conditions that may reveal the abnormality on a surface ecg. subarachonoid hemorrhage results in repolarisation abnormalities and changes in autonomic nervous system activity. in this report, we present the case of a patient with subarachonoid hemorrhage who was admitted to the emergency department after suffering an out - of - hospital cardiac arrest with typical st - segment elevation and an ecg pattern characteristic of bs. a 48-year - old man with no past medical history was presented to our emergency department after collapsing suddenly while shopping. a store employee trained in basic life support was the first to assist the patient and started to cardiopulmonary resuscitation (cpr). upon arrival to the local emergency medical service, the paramedics commenced ventricular fibrillation (vf) and an automated external defibrillator was used to defibrillate the patient. after two separate defibrillations and 5 min of cpr the patient regained spontaneous circulation, but remained unconscious. he was flaccid, non - febrile and comatose (glasgow coma scale of 4), with a heart rate of 75 bpm and blood pressure of 110/75 mmhg. meanwhile, vf was performed several times and the patient was defibrillated successfully to a normal sinus rhythm. electrocardiography revealed bizarre coved - type st - segment elevation in leads v1 through v3, with t wave inversion consistent with the type 1 brugada pattern (fig. 1) and reciprocal st depression in inferior and lateral leads. emergent cardiac catheterization was performed, which revealed no stenosis or flow abnormalities in his coronary arteries. after contrast injection into those coronary arteries, st - segment elevation was resolved and did not recur (fig. 2). laboratory tests, including cardiac biomarkers and coagulation studies, produced results that were within normal reference limits. since the patient was not responding, a non - contrasted brain computed tomography scan was performed and revealed a diffuse subarachnoid hemorrhage. he was admitted to the intensive care unit and determined to be brain dead after further neurological testing. brugada syndrome is characterized by st - segment elevation in the right precordial ecg leads, specifically v1-v3, and a high incidence of sudden death due to ventricular tachyarrhythmias in patients with structurally normal hearts. the syndrome is generally thought to be responsible for 412% of all sudden deaths and at least 20% of deaths in patients with structurally normal hearts ; the most common presentation is syncope. the syndrome is inherited and auotosomally dominant, and in 25% of the cases the responsible mutation is found on the cardiac sodium transport gene (scn5a), located on chromosome 3. because the ecgs of patients with brugada syndrome are complex and often conceal the condition, it is difficult to estimate the true incidence of the disease in the general population. however, three types of repolarisation patterns in the right precordial leads are currently recognized. type 1 is diagnostic of bs and is characterized by a coved st - segment elevation 2 mm (0.2mv), followed by a negative t wave. type 2 has a saddleback appearance with a high take - off st - segment elevation of 2 mm, followed by a trough displaying 1 mm st - segment elevation and either a positive or biphasic t wave. type 3 has either a saddleback or coved appearance with an st - segment elevation of < 1 mm. sodium - channel blockers, vagotonic agents, -adrenergic agonists, -adrenergic blockers, tricyclic antidepressants, glucose - induced insulin secretion, fever, bradycardia, ischemia, hypothermia, hyperkalemia, hypokalemia, hypercalcemia, alcohol and cocaine can expose or induce these ecg patterns. additionally, st - segment elevation in the brugada patients is significantly influenced by heart rate and autonomic tone. the ventricular myocardium is composed of at least three electrophysiologically distinct cell types : epicardial, endocardial and m cells. the st - segment elevation and t wave inversions seen in the right precordial leads of those with bs are thought to be due to an alteration in the action potential of the epicardial and possibly the m cells, but not the endocardial cells. the resulting dispersion of repolarisation across the ventricular wall, which is most pronounced in the right ventricle, results in a transmural voltage gradient that is manifested in the electrocardiogram as st - segment elevation. this dispersion of repolarisation facilitates the development of phase 2 reentry, which generates a phase 2 reentrant extrasystole that takes advantage of the window of opportunity to precipitate the ventricular tachycardia and/or fibrillation that often results in sudden cardiac death. a bs diagnosis is confirmed when a type 1 st - segment elevation is observed in more than one right precordial lead (v1-v3), in the presence or absence of a sodium channel block, and in conjunction with one of the following : documented ventricular fibrillation, self - terminating polymorphic ventricular tachycardia, a family history of scd (< 45years), coved type ecgs in family members, inducibility of vt with programmed electrical stimulation, syncope or nocturnal agonal respiration. cardiac arrhythmias or repolarisation abnormalities occur after a stroke in approximately 6070% of patients and may have important prognostic implications. in one report, investigated the circulatory collapse mechanisms in patients who experienced out - of - hospital cardiac arrest (ohca) due to subarachnoid hemorrhage. pulseless electrical activity and asystole were common among study patients, but no ventricular fibrillation was observed. found that the return of spontaneous circulation rate was higher than other etiologies of ohca, but long - term survival was poor. a rate of vf similar to the initial cardiac rhythm was observed in a study by inamasu. researchers concluded that the prognosis was more favourable if the initial rhythm causing circulatory collapse was vf, but not brainstem damage. in another study, brouwers. demonstrated that ecg changes were most prominent 2472 hours after subarachnoid hemorrhage. specifically, this event leads to repolarisation and several electrocardiographic abnormalities, including qt segment prolongation, aberrant q waves, non - specific st - segment changes, t wave abnormalities and the appearance of u waves. evidence of subendocardial infarction or anterolateral ischemia is common after a stroke, especially after subarachnoid hemorrhage. myocardial injury during a stroke is most likely the result of a centrally mediated release of catecholamines, due to hypoperfusion of the posterior hypothalamus. transient coronary vasospasm secondary to increased sympathetic tone during a stroke has also been described. the depression of ica and activation of ik - atp during ischemia associated with vasospasm involving right ventricular outflow tract results in st - segment elevation similar to that observed in cases of bs. in our patient, subarachnoid hemorrhage created a transmural voltage gradient due to its effect on repolarisation or increased -adrenergic activity and resulted in a bs - like ecg pattern. subarachnoid hemorrhage may be one of the factors predisposing the patient to the electrocardiographic and arrhythmic manifestations of bs. to conclude, when a patient without known structural heart disease presents with ventricular tachyarrhythmia and bs - like st - segment elevation, subarachnoid hemorrhage should be kept in mind, since its prompt and accurate treatment could be life saving. | brugada syndrome is an autosomal dominantly inherited channelopathy estimated to be responsible for 412% of all sudden deaths, particularly among middle - aged men. it is characterized by st - segment elevation in the right precordial leads, in the absence of acute coronary syndrome. this report discuses a patient with subarachonoid hemorrhage who developed the characteristic electrocardiographic features of brugada syndrome. |
patients with end - stage renal disease (esrd), including those who are on peritoneal dialysis (pd), are at much higher risk for mortality than the general population. several factors such as age, comorbidities including diabetes and cardiovascular disease (cvd), malnutrition / hypoalbuminemia, reduced residual renal function, and inflammation have been associated with high mortality in pd patients (1 - 7). recently, peritoneal membrane transport status has attracted considerable attention as another contributor to decreased survival in these patients. high transport status, as defined by the increased ratio of creatinine in the dialysate to plasma after a 4-hr dwell (d / p cr4) from a peritoneal equilibration test (pet) (8), has been associated with several parameters that in themselves are well - known risk factors for mortality in pd patients. diabetes, cvd, hypoalbuminemia, poor nutritional status, and inflammation, as well as inappropriate ultrafiltration and large peritoneal protein loss have been shown to be more prevalent in high transporters compared to other peritoneal transporters. these comorbidities may also play a role in the higher rate of adverse outcomes observed in high transporters (3, 9 - 13). however, most studies, investigatng the adverse effect of high transport status on outcomes in pd patients, have been performed in the patients who were mainly on continuous ambulatory pd (capd), or in largely prevalent patient population. the association between high peritoneal transport and the long - term survival among the incident patients treated with automated pd (apd) has not been fully explored. we, therefore, undertook this study to evaluate the impact of peritoneal membrane transport characteristics, as measured by a pet, on mortality in incident patients who were on apd. we retrospectively analyzed a total of 117 patients who started apd at yonsei university health system from january 1996 to december 2008 and had a pet within 3 months of apd initiation. this study was approved by the institutional review board (irb number 4 - 2009 - 0680). all subjects were given a standard pet using 2.27% glucose pd fluid and were classified into one of the four peritoneal transport types according to the value for d / p cr4 defined by twardowski. (8) : high 0.81, high average 0.65 to 0.80, low average 0.50 to 0.64, and low < 0.50. the data included age, gender, body mass index (bmi, weight [kg]/height [m ]), duration of pd, cause of esrd, comorbidities, use of icodextrin, and the patient outcome. the following laboratory data obtained at the time of pd catheter insertion (within first week after starting pd) were considered as baseline : hemoglobin, blood urea nitrogen (bun), serum creatinine, calcium, phosphorus, total cholesterol, uric acid, and albumin concentrations, kt / v urea, percentage of lean body mass (% lbm), normalized protein catabolic rate (npcr), and residual glomerular filtration rate (gfr). cardiovascular disease was defined as a history of coronary, cerebrovascular, or peripheral artery disease. coronary disease was defined as a previous history of angioplasty, coronary artery bypass graft, myocardial infarction, or angina. cerebrovascular disease was defined as a previous transient ischemic attack, stroke, or carotid endarterectomy, and peripheral vascular disease as a history of claudication, ischemic limb loss, and/or ulceration or a peripheral revascularization procedure. technique failure was defined as transfer to hemodialysis due to peritonitis, ultrafiltration failure, inadequate dialysis, exit and tunnel infection, and mechanical problems. statistical analyses were performed using spss for windows ver 13.0 (spss, inc., data were analyzed using student 's t - test, chi - square test, or fisher exact test for comparisons. patient and technique survival was assessed using life table methods and comparisons were made with kaplan - meier analysis and log - rank tests. patients were censored at the point of transplantation or if lost to follow - up. to determine risk factors for mortality in apd patients, multivariate cox regression was performed, in which we included all of the significant covariates from the univariate analysis. the mean age of patients was 49.0 yr (range 20 to 86 yr), 70.1% were males, and patients were on pd for a mean period of 27.8 months (range 3.5 to 155.2 months). chronic glomerulonephritis was the most common cause of esrd (34.2%), followed by diabetes (29.9%) and hypertension (19.7%). among the 117 patients, 24 patients (20.5%) were high transporters, and 91 patients (77.8%) used icodextrin. the baseline mean hemoglobin was 9.61.9 g / dl, and serum albumin was 3.50.6 g / dl. the baseline kt / v urea and residual gfr were 2.20.6 and 2.93.7 ml / min/1.73 m, respectively. when the patients were divided into two groups based on a pet, high transporters (high group) were significantly older (p<0.05) and had a higher incidence of cvd (p<0.05) compared to non - high transporters (non - high group) (table 2). during the period of study, 66 patients (56.4%) were living on apd, and 20 patients (17.1%) died. infection (50.0%) was the most common cause of death, with four patients dying of peritonitis, followed by cvd (40.0%), upper gastrointestinal bleeding (8.3%), and unknown (8.3%). there was a tendency for higher incidence of infection in high group (75% vs. 33.3%) and cvd in non - high group (50% vs. 25%), but this difference was not statistically significant. transfer to hemodialysis occurred in 21 patients (17.9%), mainly due to peritonitis (57.1%). other reasons of technique failure were ultrafiltration failure (23.8%), inadequate dialysis (14.3%), and noncompliance (4.8%). another 9 patient (7.7%) underwent kidney transplantation, and only 1 patient (0.9%) moved to another center. table 3 presents the differences between survivors (n=97) and non - survivors (n=20). in non - survival group, diabetes (p<0.001), cvd (p<0.001), and high peritoneal membrane transport (p<0.05) were more prevalent, and serum albumin level (p<0.001) and residual gfr (p<0.001) at baseline were significantly lower than those observed in the survivor group. patient survival for years 1, 3, and 5 were 85%, 64%, and 35% for high group and 94%, 81%, and 68% for non - high group (p<0.01). as shown in table 4, multivariate cox regression revealed that age (p<0.01), diabetes (p<0.05), cvd (p<0.05), serum albumin level (p<0.05), and residual gfr (p<0.05) were independently associated with high mortality in patients treated with apd. however, high transport status was not a significant predictor for mortality in this population when the other covariates were included. estimated mean pure (death - censored) and combined (patient and death - censored) technique survival were 90.523.1 and 49.813.1 months in high group, and 100.511.9 and 79.110.4 months in non - high group, respectively. cumulative combined technique survival at the end of 1, 3, and 5 yr were 76%, 57%, and 16% for high group, and 83%, 66%, and 30% for non - high group. there were no significant differences in the risk of either technique failure between patients in two transport groups. the mean age of patients was 49.0 yr (range 20 to 86 yr), 70.1% were males, and patients were on pd for a mean period of 27.8 months (range 3.5 to 155.2 months). chronic glomerulonephritis was the most common cause of esrd (34.2%), followed by diabetes (29.9%) and hypertension (19.7%). among the 117 patients, 24 patients (20.5%) were high transporters, and 91 patients (77.8%) used icodextrin. the baseline mean hemoglobin was 9.61.9 g / dl, and serum albumin was 3.50.6 g / dl. the baseline kt / v urea and residual gfr were 2.20.6 and 2.93.7 ml / min/1.73 m, respectively. when the patients were divided into two groups based on a pet, high transporters (high group) were significantly older (p<0.05) and had a higher incidence of cvd (p<0.05) compared to non - high transporters (non - high group) (table 2). during the period of study, 66 patients (56.4%) were living on apd, and 20 patients (17.1%) died. infection (50.0%) was the most common cause of death, with four patients dying of peritonitis, followed by cvd (40.0%), upper gastrointestinal bleeding (8.3%), and unknown (8.3%). there was a tendency for higher incidence of infection in high group (75% vs. 33.3%) and cvd in non - high group (50% vs. 25%), but this difference was not statistically significant. transfer to hemodialysis occurred in 21 patients (17.9%), mainly due to peritonitis (57.1%). other reasons of technique failure were ultrafiltration failure (23.8%), inadequate dialysis (14.3%), and noncompliance (4.8%). another 9 patient (7.7%) underwent kidney transplantation, and only 1 patient (0.9%) moved to another center. table 3 presents the differences between survivors (n=97) and non - survivors (n=20). in non - survival group, diabetes (p<0.001), cvd (p<0.001), and high peritoneal membrane transport (p<0.05) were more prevalent, and serum albumin level (p<0.001) and residual gfr (p<0.001) at baseline were significantly lower than those observed in the survivor group. patient survival for years 1, 3, and 5 were 85%, 64%, and 35% for high group and 94%, 81%, and 68% for non - high group (p<0.01). as shown in table 4, multivariate cox regression revealed that age (p<0.01), diabetes (p<0.05), cvd (p<0.05), serum albumin level (p<0.05), and residual gfr (p<0.05) were independently associated with high mortality in patients treated with apd. however, high transport status was not a significant predictor for mortality in this population when the other covariates were included. estimated mean pure (death - censored) and combined (patient and death - censored) technique survival were 90.523.1 and 49.813.1 months in high group, and 100.511.9 and 79.110.4 months in non - high group, respectively. cumulative combined technique survival at the end of 1, 3, and 5 yr were 76%, 57%, and 16% for high group, and 83%, 66%, and 30% for non - high group. there were no significant differences in the risk of either technique failure between patients in two transport groups. these differences can best be classified and determined by the use of a pet, which helps to characterize the relationships among dwell time, solute transport, glucose absorption, drain volume, and net solute clearance (14). patients who have a greater rate of membrane solute transport are classified as high (or fast) transporters, and will tend to have enhanced clearance of small solutes, such as urea and creatinine, early in short dwells. however, these patients will have larger peritoneal loss of protein, will be more likely to fluid overload as a result of rapid reabsorption of glucose from the dialysate and subsequent ultrafiltration dysfunction, and will have greater systemic exposure to glucose (15 - 19). in addition, high transporters have been associated with poor nutritional status, more prevalent comorbid diseases, and chronic inflammation (3, 9 - 13). many conflicting results have been reported on the relationship between high peritoneal transport and mortality in pd patients. the single - center stroke pd study (18, 19) and the multicenter canusa study (2) found that high transport was associated with worse patient and technique survival independent of other important risk factors, such as age, comorbidities, and residual renal function. a recent meta - analysis of 20 observational studies (20) also demonstrated that a higher peritoneal membrane solute transport rate was associated with a higher mortality risk and a trend to higher technique failure. however, these findings were not confirmed by several other studies including ademex trial which showed that high transport does not have any influence on patient survival in pd patients (21 - 23). furthermore, some investigations have found an association on univariate analysis only, or with morbidity but not mortality (24 - 26). the reasons for these conflicting observations are not clear, but most studies investigating outcomes in pd patients have been performed in patients who were mainly on capd, or included a greater portion of prevalent patients. even though there has been a study, with small number of patients, reporting that apd patients with high peritoneal transport had a lower probability of patient survival, there is some evidence that apd mitigates the adverse effects of high transport (27). most recently, analysis from the anzdata registry, by far the largest study published to date, has confirmed that peritoneal transport type was only a significant predictor of mortality in patients on capd, not in those on apd (28). in another recent single - center observation cohort study (29), high transport status predicted a higher risk of death in patients who started pd between 1990 and 1997, but not in patients who started pd between 1998 and 2005. during the latter vintage, patients were more likely to be treated with apd or icodextrin. similarly, in the eapos study (30) of patients receiving apd, transport status had no bearing on increased risk of death at one year. taken together, it is likely that an increased peritoneal transport rate appears to be less important as a predictor of mortality in apd patients when compared to capd patients. in the present study, we found that there was a significant difference, as determined by univariate analysis, in mortality between high and non - high transporters. however, high transport status was confirmed not to be a significant risk factor associated with mortality of the incident apd patients. this situation was particularly evident when adjusted for age and other comorbidities such as diabetes, cvd, serum albumin level, and residual gfr. as these are well known risk factors for mortality on pd, it is probable that the association seen in this study between high transporter and mortality is related to the presence of these comorbid conditions. furthermore, it might be said that the strategies including optimization of the short dwell lengths using apd combined with icodextrin which will result in sustained ultrafiltration and thus prevention of reabsorption in the long dwell have been attributed to minimize the adverse effects of high transport on patient survival in these patients. it was an observational study based on retrospective data collected from a relatively small sample size. also we did not include other relevant data representing overall nutritional status and systemic inflammation such as subjective global assessment (sga) and other inflammatory markers to fully assess the impact of nutritional and inflammatory status. finally, the impact of icodextrin - based products on mortality could not be evaluated in this study because most of our patients were using icodextrin. in conclusion, the present study showed that age, diabetes, cvd, serum albumin level, and residual gfr were independent predictors for mortality in incident pd patients who were on apd. even though high transport was significantly associated with mortality in the univariate analysis, this association was not an independent risk factor for mortality. these findings suggest that the proper management of these comorbid conditions, as well as appropriate ultrafiltration by use of apd and/or icodextrin, must be considered as a protective strategy to improve survival in pd patients with high transport. | we undertook this study to elucidate whether baseline peritoneal membrane transport characteristics are associated with high mortality in incident automated peritoneal dialysis (apd) patients. this retrospective study includes 117 patients who started apd at yonsei university health system from 1996 to 2008 and had a pet within 3 months of apd initiation. high transporters were significantly older and had a higher incidence of cardiovascular disease. patient survival for years 1, 3, and 5 were 85%, 64%, and 35% for high transporter and 94%, 81%, and 68% for non - high transporter group (p<0.01). multivariate analysis revealed that age, diabetes, cardiovascular disease, serum albumin level, and residual renal function were independently associated with high mortality in apd patients. in contrast, high transport status was not a significant predictor for mortality in this population when the other covariates were included. even though high transport was significantly associated with mortality in the univariate analysis, its role seemed to be influenced by other comorbid conditions. these findings suggest that the proper management of these comorbid conditions, as well as appropriate ultrafiltration by use of apd and/or icodextrin, must be considered as protective strategies to improve survival in peritoneal dialysis patients with high transport. |
dry tap during sub - arachnoid block (sab) is a rare but troublesome incidence. the problem sometimes becomes difficult to solve or what to do next, kind of, due to its rare occurrence and sparse reporting. the annual incidence of spinal epidural abscess is 2.53 per 10,000 hospital admissions in the united states. we report a case of pyogenic ilio - psoas abscess extended up to the paravertebral and epidural spaces, diagnosed incidently after a dry spinal tap. we share this experience due to its unusual clinical presentation of a dry tap during spinal anaesthesia associated with epidural abscess. reports of the coincident cases of primary psoas (ilio - psoas) abscess with epidural abscess are very few. primary psoas abscess is also an unusual finding, usually abscess of the psoas muscle resulting from disease of the lumbar vertebrae, with the pus descending into the muscle sheath being common. the most common causative organism in primary psoas abscess is s. aureus and, in secondary psoas abscess, is tuberculous bacteria. a 40-year - old male trackman by occupation in the railways was posted for fasciotomy and drainage of right thigh and leg in emergency. his presenting complaint on admission was pain in the right knee since 10 days and swelling in the right lower limb and difficulty in walking since 4 days. he had a history of blunt trauma on right knee by metal trolley at workshop 10 days back. at the same time, he had developed diarrhoea as well, for which he took medicines and was relieved within 23 days. he had no history of any chronic medical illness, but was a chronic alcoholic. on the pre - anaesthetic check - up, his pulse was 110/min, blood pressure was 110/62 mmhg and respiratory rate was 16/min. investigations were : haemoglobin (hb), 13.2 gm% ; white blood cell count (wbc), 11500/mm ; differential counts, within normal limits ; fasting blood sugar (fbs), 245 mg% ; post - prandial blood sugar (ppbs), 245 mg% ; prothrombin time (pt), 13.8 s ; international normalised ratio (inr), 1.27 ; blood urea nitrogen (bun), 112.7 mg / dl ; creatinine 3.49 mg / dl ; total bilirubin, 1.7 mg / dl (direct, 0.9 mg / dl and indirect, 0.8 mg / dl) ; and sgpt, 69.4 u / l. doppler study of the lower limb was done to rule out deep vein thrombosis (dvt), which showed a normal vascular study but large abscess on deep fascia from mid thigh to knee, then below knee toward the medial aspect in between the fascia. intravenous (iv) fluid given to rehydrate the patient and injection (inj) insulin was started as per the sliding scale. repeat bun and creatinine had come down to 105 mg / dl and 2.35 mg / dl, respectively. the patient was taken to the operation theatre with american society anesthesiologist (asa) grade iii (e) physical status, with informed consent. the patient was given a left lateral position with partial flexion of the right limb for spinal anaesthesia after adequate pre - loading. then, after aseptic preparation, sab was attempted at the l3-l4 space with a 25 g quincke spinal needle. the subarachnoid space was located easily with give - way feeling, but cerebrospinal fluid (csf) flow did not come. the stylet was reinserted and removed to clear the lumen of the needle and the needle was then withdrawn gradually. it was further advanced gradually but csf could not be aspirated. then, the space changed to l4-l5 and then l2-l3 with a 23 g spinal needle, but csf flow was absent in spite of a good give - way feeling. finally, in the subarachnoid space at l2-l3 through a 23 g spinal needle after confirming with give - way feeling, aspiration of csf was tried but failed. then, the needle was angled towards the right lateral recess of the subarachnoid space by mild manipulation and again aspirated, but this attempt was also futile. then, while considering giving drug in this space even in the absence of csf to take chance, to great surprise, straw - coloured thick material at the hub of the spinal needle was noticed [figure 1 ]. the spinal needle removed and sent for culture and sensitivity of the pus. surgery was deferred temporarily to evaluate further and the patient was advised urgent magnetic resonance imaging (mri) of the dorsolumbar spine. pus coming out through the spinal needle mri scan on the second day reported that there was a large abscess in the right iliac fossa and gluteal region on either side with epidural extension of the abscess in the lumbar spine from l2 to the sacral segments compressing the thecal sac and traversing nerve roots [figure 2 ]. the screening whole spine also revealed a large localised abscess in the right supraclavicular region and around the right sternoclavicular joint. magnetic resonance imaging image showing epidural abscess in the right parasagittal section usg abdomen and thigh done on the second subsequent day showed no evidence of psoas abscess bilaterally. pus for acid fast bacillus stain was negative and hiv i and ii- tests were also negative. on the third day, bun and sr creatinine came down to 45.4 mg / dl and 1.22 mg / dl, respectively. u / l. culture and sensitivity (cands) of pus from the spinal needle and aspiration from the thigh showed growth of gram positive staphylococcus with coagulase test positive. on the third day inj ticarcillin disodium and clavulanate potassium 3.1 gm iv 8-hourly and inj metronidazole 100 mg iv 8-hourly was started with inj insulin. on the fifth day, pus cands after 48 h showed growth of gram positive staphylococcus with coagulase test positive. on the sixth day, mri of the pelvis showed a multiloculated abscess in the soft tissue musculature of the right iliac fossa, gluteal region bilaterally and the right thigh with diffuse alteration in the marrow signal intensity of the l5 vertebrae and along the right sacro - iliac joint. the screening of t2w images of the lumbar spine reveals an epidural extension of the abscess with compression of the thecal sac at the l2-l5 level. gradually, wound at the drainage site healed, pain subsided, he was able to walk and there was no neurological deficit. during this stay, his hb had gone down to 7.7 gm / dl and he received two units of blood transfusions. as an anaesthesiologist, we can come across a situation of dry tap during sab, where no csf comes out in spite of the needle being in the correct space. include a blocked needle, needle in the wrong space, post - spinal surgery and low csf pressures. csf or very low csf pressure, the subarachnoid space is obliterated as the arachnoid collapses on the pia. ramachandran and ponnusamy have described successful spinal anaesthesia after multiple attempts with a distinct give, but no free flow of csf. have described an electrical stimulation with insulated needle as a useful and reliable real - time technique to confirm intrathecal or subdural placement, even in the absence of csf flow.[35 ] psoas muscle abscess is a rare condition with vague clinical presentation, which presents a diagnostic challenge requiring a high index of suspicion. a psoas (or iliopsoas) abscess is a collection of pus in the iliopsoas muscle compartment. it may arise via contiguous spread from adjacent structures or by the hematogenous route from a distant site. the psoas muscle arises from the transverse processes and the lateral aspects of the vertebral bodies between the twelfth thoracic and the fifth lumbar vertebrae. from this origin, it courses downward across the pelvic brim, passes deep to the inguinal ligament and anterior to the hip joint capsule to form a tendon that inserts into the lesser trochanter of the femur. the fascia that envelops the iliopsoas compartment covers the iliacus, psoas major and psoas minor and courses through the retroperitoneal space from the lower part of the thorax to the lower lumbar vertebrae and defines the iliopsoas compartment. primary spinal epidural abscess is also an uncommon finding, the most common risk factor being diabetes mellitus, followed by spinal trauma (may be remote) or surgery, intravenous drug abuse, alcoholism, renal insufficiency, immunocompromised and post - spinal / epidural injections. secondary spinal epidural abscesses in 1030% of the cases result from direct extension of local infection, usually vertebral osteomyelitis, psoas abscess or contiguous soft - tissue infection. in this patient, diabetes mellitus and alcoholism were present as risk factors and also there was a history of trauma. it was either primary iliopsoas abscess extending to epidural space or primary epidural abscess extending to iliopsoas compartment. in conclusion, during anaesthesia, we should keep in mind the possibility of epidural abscess in case of dry tap during spinal block in patients with risk factors and in proven case of iliopsoas abscess. | we report a case of dry tap during spinal anaesthesia in a patient posted for incision and drainage of lower limb with cellulitis. when the patient was being given sub - arachnoid block (sab) for regional anaesthesia, it turned out to be a case of pyogenic ilio - psoas abscess extended up to the paravertebral and epidural spaces. the causative organism was staphylococcus aureus. this is probably the first case reported when epidural abscess is diagnosed during sab. |
bacterial strains and growth conditions - c. diphtheriae strains used in this study and their characteristics are listed in table i. these microorganisms were maintained in trypticase soy broth (tsb) (bd difco, usa) at 37c and stored in the same medium with 20% glycerol. escherichia coli top10 electrocomp (thermo fisher scientific inc invitrogen, usa) and e. coli op50 were grown in luria bertani (bd difco) medium at 37c. when appropriate, kanamycin (sigma - aldrich co, usa) was added (50 g ml). table ibiological properties of corynebacterium diphtheriaestrains used in this studystrainoriginbiovar/ sucrose fermentation tox gene tehak2teo3 mic (mg / ml-)k2teo3inhibition halo (mm)bath (%) glass/ polystyrene adherencehep-2 cells adherence patternreferencesldcic - l1cdc - e8392::pcr2.1-topocdc - e8392_813mitis / suc -+interrupted0.3127 0.41 51 0.82- /++dathis papercdc - e8392diphtheria / pharynx (usa)mitis / suc -++0.6223 1.1551 1.20- /++da mattos - guaraldi. (2009) a : toxicity evaluated by polymerase chain reaction for tox gene (pimenta. 2008) ; b : p 50% were considered highly hydrophobic, 30% bath values 0.01). a number of genetic te determinants have been identified in different bacterial species (taylor. 1994, liu & taylor 1999, toptchieva. 2003). one of the chromosomal tedeterminants is the operon tehab, originally described ine. homologues and orthologues of theteha gene have been identified in other bacterial species, such asvibrio cholerae, klebsiella pneumoniae, salmonella enterica andcorynebacterium glutamicum (chasteen. 2009, pei. 2013). recent studies have revealed that this determinant did not confer the temechanism of v. cholerae c6706, but was found involved in antibiotic resistance and intestinal colonisation (pei. 2013). for c. diphtheriae, a protein with similar sequence to teha in other species was identified. this protein, referred to as cdce8392_0813 in cdc - e8392 strain, was predicted as a te protein teha homologue using phyre software. in the present study, the contribution of te to c. diphtheriae pathogenesis was verified using the cdce8392_0813 mutant (ldcic - l1) constructed through chromosomal disruption. according to phyre, the interrupted region of the cdce8392_0813 gene likely corresponded to the protein active site because it contained many conserved residues. gene complementation was not performed in the present study and might be considered to be a limitation of this work. the influence of the cdce8392_0813 protein in the te mechanism of strain cdc - e8392 was also documented in the present study. two different protocols used to investigate the viability of ldcic - l1 in the presence of teo3 revealed that this gene interruption rendered the mutant more susceptible to this compound. it has been previously suggested that te depends on the expression of different enzymes involved in several bacterial functions, including nitrate reduction, oxidative stress response and phosphate and cysteine metabolism (taylor 1999, chasteen. 2014). however, the data obtained in the present study suggest that cdce8392_0813 participates in c. diphtheriae te and that this mechanism relies on other bacterial factors. the data also indicate that additional studies are needed to identify and characterise these other bacterial factors. a recent report indicated that teha protein participates in v. cholerae antimicrobial resistance (pei. in contrast, the findings presented here indicated that the teha homologue is not involved in the susceptibility of c. diphtheriae to the antimicrobial agents tested. it has previously been suggested that teo3 toxicity results, at least in part, from the generation of ros including h2o2. however, teo3 resistance is likely mediatedvia resistance to oxidative damage rather than the detoxification of the metal oxide itself (toptchieva. similar results were observed with a haemophilus influenzae mutant for tehb (whitby. because the participation of teha in bacterial pathogenesis has been described for other species, we evaluated the involvement of the putative tedeterminant cdce8392_0813 in the virulence of diphtheria bacilli. using c. elegans as an infection model, we considered a simple but versatile animal model for analysing the virulence of bacteria, including c. diphtheriae (broadway. 2013). herein, we demonstrated an attenuated ability of the ldcic - l1 mutant to kill nematodes. similarly, mutations in the te genes ofbacillus anthracis (ycegh) also reduced survival in c. elegans and increased susceptibility to teo3 compounds (franks. in addition to diphtheria toxin, adherence factors such as glycoconjugates, haemagglutinin and pili have been well studied. these factors might be involved in biofilm formation on abiotic surfaces and/or adherence to hep cells and extracellular components (mattos - guaraldi. although these studies have demonstrated that a ter determinant might assist e. coli o157:h7 in establishing an infection through participation in the adherence to eukaryotic cells (yin. 2009), the data obtained in the present study showed that cdce8392_0813 protein did not influence the adherence of c. diphtheriae to epithelial cells. furthermore, these results revealed that cdce8392_0813 did not act as an adhesin or modify the expression of bacterial factors involved in c. diphtheriae adhesion to abiotic surfaces. the internalisation and intracellular survival of c. diphtheriaestrains have been demonstrated for different human cells, including epithelial hep-2 cells (hirata jr. 2004), human umbilical vein endothelial cells (peixoto. 2014) and macrophage u937 cells (santos. 2010). these data showed that the intracellular survival of c. diphtheriae was reduced after the interruption of the cdce8392_0813 gene. because ldcic - l1 showed increased h2o2 sensitivity, it is likely that this determinant also contributes to c. diphtheriae resistance to eukaryotic intracellular defences, such as the production of ros, in addition to bacterial resistance to teo3 toxicity. the cdce8392_0813 gene interruption increased susceptibility to teo3 toxicity, indicating that the putative te protein (cdce8392_0813) (teha) might act as the factor responsible for the expression of te in c. diphtheriaestrains. furthermore, ter determinant might contributes to the pathogenesis of this species, as a direct correlation was verified between the expression of the cdce8392_0813 gene and the abilities of c. diphtheriae to survive within the intracytoplasmic compartments of hep cells and to kill the nematode c. elegans. | corynebacterium diphtheriae, the aetiologic agent of diphtheria, also represents a global medical challenge because of the existence of invasive strains as causative agents of systemic infections. although tellurite (teo32-) is toxic to most microorganisms, teo32 - -resistant bacteria, including c. diphtheriae, exist in nature. the presence of teo32 - -resistance (ter) determinants in pathogenic bacteria might provide selective advantages in the natural environment. in the present study, we investigated the role of the putative ter determinant (cdce8392_813gene) in the virulence attributes of diphtheria bacilli. the disruption of cdce8392_0813 gene expression in the ldcic - l1 mutant increased susceptibility to teo32- and reactive oxygen species (hydrogen peroxide), but not to other antimicrobial agents. the ldcic - l1 mutant also showed a decrease in both the lethality of caenorhabditis elegans and the survival inside of human epithelial cells compared to wild - type strain. conversely, the haemagglutinating activity and adherence to and formation of biofilms on different abiotic surfaces were not regulated through the cdce8392_0813 gene. in conclusion, the cdce8392_813 gene contributes to the ter and pathogenic potential of c. diphtheriae. |
guillain - barr syndrome (gbs) is the most common cause of acute neuromuscular paralysis. the most frequent variants of gbs include acute inflammatory demyelinating polyradiculoneuropathy (aidp) and acute motor axonal neuropathy (aman). campylobacter jejuni infection precedes the onset of gbs in 26% of the cases in western hemisphere and in two - thirds of patients in china, and it seems to be exclusively associated with aman. the aman variant of gbs is most frequently associated with antibodies to gangliosides gm1, gd1a, and galnac - gd1a. the association of gbs with antecedent c. jejuni infection proposed the mechanism of molecular mimicry in the immunopathogenesis of the disease. a specific serotype of penner 's 19 (o:19) is much more frequently isolated from gbs patients than from enteritis patients. the role of antibodies to the peripheral nerve myelin proteins and glycoproteins was not sufficiently investigated in gbs. gm1-positive sera from patients with gbs following infection with c. jejuni showed reactivity to a 63-kda flagellar protein purified from c. jejuni (o:19). it has also been shown that gm1 antibodies cross - react with gal - galnac - bearing glycoproteins from the peripheral nerve. we present the results of cross - reactivity of gm1-positive serum with several gal - galnac - bearing glycoproteins isolated from the human peripheral nerve and from c. jejuni (o:19), including the glycoprotein with electrophoretic mobility between 60 and 70 kda, present in both isolates. these data indicated the possible role of some protein antigens from c. jejuni in the pathogenesis of gbs. determination of the molecular structure of the glycoprotein structures present in the human peripheral nerve and the bacteria c. jejuni is necessary for elucidation of their antigenicity. the aim of this study was to examine the reactivity of the peptides obtained after digestion with trypsin of the cross - reactive glycoproteins isolated from the human peripheral nerve and c. jejuni (o:19) with peanut agglutinin (pna) as a marker for the gal - galnac determinant and with sera from patients with gbs. human peripheral nerve was obtained at autopsy within 8 h after death from patients who died from non - neurological disease ; it was kept frozen at -70 c (department of forensic medicine, faculty of medicine, university ss. the neural tissue was pulverized in liquid nitrogen, delipidated with chloroform : methanol (1:2) solution, solubilized by homogenization in 0.5% triton x-100, 0.4% sodium dodecyl sulfate (sds) with protease inhibitor cocktail, and heated at 65c for 10 min. the insoluble matter was removed by centrifugation at 4,200 rpm for 45 min at room temperature. the c. jejuni serotype (o:19) (obtained from atcc 43446) the identity of c. jejuni was confirmed by microscopic examination, by determining the mobility, staining according to gram and with biochemical tests at the institute for microbiology and parasitology, faculty of medicine, skopje. bacterial cells were collected in 0.9% nacl and centrifuged at 4,000 rpm for 30 min. pellets were resuspended in 8.0 ml of 0.1 m tris - hcl (ph 7.8) and disrupted by a ultrasonic cell disruptor (microson, ultrasonic cell disruptor xl, misonix incorporated, new york, usa). after centrifugation (45 min, 4,200 rpm), the proteins in the supernatant were dialyzed twice against 0.1 m tris - hcl (ph 7.5) at 4c for 3 h. gal - galnac - bearing glycoproteins from the human peripheral nerve and c. jejuni (o:19) were purified by affinity chromatography, using agarose - bound pna. purified glycoproteins isolated from the peripheral nerve and c. jejuni (o:19) were separated on 7.5% acrylamide / bisacrylamide gel (20 g total glycoproteins per well, 1 g purified glycoprotein per well) by sds - polyacrylamide gel electrophoresis (sds - page) and transferred electrophoretically onto nitrocellulose sheets. unreactive binding sites were blocked in 8% bovine serum albumin (bsa) in tris - buffered saline (tbs - 0.02 m tris base, 0.5 m nacl, ph 7.5) for 1 hour at room temperature. the blots were washed three times with tbs containing 1% tween 20 and incubated overnight at 4c with biotinylated pna (sigma - aldrich) (10 g / ml) and with sera from 10 patients with gbs and high titer of anti - gm1 antibodies (institute of neurology, clinical center of serbia, belgrade, serbia) diluted 1:100. after washing, the strips were incubated with avidin conjugated with peroxidase (1:1000), and with anti - human igg antibodies conjugated with peroxidase (1:500) for 1 hour at room temperature. visualization of the reaction products was done using diaminobenzidine (dab), 15 mm imidazole, and 0.025% h2o2 in water, (biorad laboratories, hercules, ca, usa). gal - galnac bearing glycoproteins were electrophoretically separated using 7.5% acrylamide / bisacrylamide gel (approximately 20 g total glycoproteins / well). after electrophoresis, a strip from the left side of the gel, including molecular weight marker and first line of the protein sample, was cut with a razor and stained with 0.1% amido black, 1% acetic acid, and 40% methanol in water. this strip was used as a reference gel strip to localize the bands of glycoproteins with mobility between 60 and 70 kda. after aligning the reference strip with the unstained gel portion, the bands of the gel that align with the stained protein of interest were cut from the unstained gel and rinsed with distilled water. gels containing proteins of interest were equilibrated in 1 ml 0.125 m tris (ph 6.8) for 10 - 15 min and added to the wells of a 15% acrylamide / bisacrylamide gel. enzyme trypsin in buffer was added to the wells and after 10 - 15 min electrophoresis was run. after the electrophoretic separation, the gel was stained with silver stain (silver stain plus, biorad laboratories, hercules, ca, usa) for visualization of the peptides. unreactive binding sites were blocked in 8% bsa in tbs (0.02 m tris base, 0.5 m nacl, ph 7.5) for 1 hour at room temperature. the blots were washed three times with tbs containing 1% tween 20 and incubated overnight at 4c with biotinylated pna (sigma - aldrich) (10 g / ml) and with the sera from patients with gbs (1:100). after washing, the strips were incubated with avidin conjugated with peroxidase (1:1000), and with anti - human igg antibodies conjugated with peroxidase (1:500) for 1 hour at room temperature. visualization of the reaction products was done using dab, 15 mm imidazole, and 0.025% h2o2 in water (biorad laboratories, hercules, ca, usa). human peripheral nerve was obtained at autopsy within 8 h after death from patients who died from non - neurological disease ; it was kept frozen at -70 c (department of forensic medicine, faculty of medicine, university ss. the neural tissue was pulverized in liquid nitrogen, delipidated with chloroform : methanol (1:2) solution, solubilized by homogenization in 0.5% triton x-100, 0.4% sodium dodecyl sulfate (sds) with protease inhibitor cocktail, and heated at 65c for 10 min. the insoluble matter was removed by centrifugation at 4,200 rpm for 45 min at room temperature. the c. jejuni serotype (o:19) (obtained from atcc 43446) the identity of c. jejuni was confirmed by microscopic examination, by determining the mobility, staining according to gram and with biochemical tests at the institute for microbiology and parasitology, faculty of medicine, skopje. bacterial cells were collected in 0.9% nacl and centrifuged at 4,000 rpm for 30 min. pellets were resuspended in 8.0 ml of 0.1 m tris - hcl (ph 7.8) and disrupted by a ultrasonic cell disruptor (microson, ultrasonic cell disruptor xl, misonix incorporated, new york, usa). after centrifugation (45 min, 4,200 rpm), the proteins in the supernatant were dialyzed twice against 0.1 m tris - hcl (ph 7.5) at 4c for 3 h. gal - galnac - bearing glycoproteins from the human peripheral nerve and c. jejuni (o:19) were purified by affinity chromatography, using agarose - bound pna. purified glycoproteins isolated from the peripheral nerve and c. jejuni (o:19) were separated on 7.5% acrylamide / bisacrylamide gel (20 g total glycoproteins per well, 1 g purified glycoprotein per well) by sds - polyacrylamide gel electrophoresis (sds - page) and transferred electrophoretically onto nitrocellulose sheets. unreactive binding sites were blocked in 8% bovine serum albumin (bsa) in tris - buffered saline (tbs - 0.02 m tris base, 0.5 m nacl, ph 7.5) for 1 hour at room temperature. the blots were washed three times with tbs containing 1% tween 20 and incubated overnight at 4c with biotinylated pna (sigma - aldrich) (10 g / ml) and with sera from 10 patients with gbs and high titer of anti - gm1 antibodies (institute of neurology, clinical center of serbia, belgrade, serbia) diluted 1:100. after washing, the strips were incubated with avidin conjugated with peroxidase (1:1000), and with anti - human igg antibodies conjugated with peroxidase (1:500) for 1 hour at room temperature. visualization of the reaction products was done using diaminobenzidine (dab), 15 mm imidazole, and 0.025% h2o2 in water, (biorad laboratories, hercules, ca, usa). purified glycoproteins isolated from the peripheral nerve and c. jejuni (o:19) were separated on 7.5% acrylamide / bisacrylamide gel (20 g total glycoproteins per well, 1 g purified glycoprotein per well) by sds - polyacrylamide gel electrophoresis (sds - page) and transferred electrophoretically onto nitrocellulose sheets. unreactive binding sites were blocked in 8% bovine serum albumin (bsa) in tris - buffered saline (tbs - 0.02 m tris base, 0.5 m nacl, ph 7.5) for 1 hour at room temperature. the blots were washed three times with tbs containing 1% tween 20 and incubated overnight at 4c with biotinylated pna (sigma - aldrich) (10 g / ml) and with sera from 10 patients with gbs and high titer of anti - gm1 antibodies (institute of neurology, clinical center of serbia, belgrade, serbia) diluted 1:100. after washing, the strips were incubated with avidin conjugated with peroxidase (1:1000), and with anti - human igg antibodies conjugated with peroxidase (1:500) for 1 hour at room temperature. visualization of the reaction products was done using diaminobenzidine (dab), 15 mm imidazole, and 0.025% h2o2 in water, (biorad laboratories, hercules, ca, usa). gal - galnac bearing glycoproteins were electrophoretically separated using 7.5% acrylamide / bisacrylamide gel (approximately 20 g total glycoproteins / well). after electrophoresis, a strip from the left side of the gel, including molecular weight marker and first line of the protein sample, was cut with a razor and stained with 0.1% amido black, 1% acetic acid, and 40% methanol in water. this strip was used as a reference gel strip to localize the bands of glycoproteins with mobility between 60 and 70 kda. after aligning the reference strip with the unstained gel portion, the bands of the gel that align with the stained protein of interest were cut from the unstained gel and rinsed with distilled water. gels containing proteins of interest were equilibrated in 1 ml 0.125 m tris (ph 6.8) for 10 - 15 min and added to the wells of a 15% acrylamide / bisacrylamide gel. enzyme trypsin in buffer was added to the wells and after 10 - 15 min electrophoresis was run. after the electrophoretic separation, the gel was stained with silver stain (silver stain plus, biorad laboratories, hercules, ca, usa) for visualization of the peptides. unreactive binding sites were blocked in 8% bsa in tbs (0.02 m tris base, 0.5 m nacl, ph 7.5) for 1 hour at room temperature. the blots were washed three times with tbs containing 1% tween 20 and incubated overnight at 4c with biotinylated pna (sigma - aldrich) (10 g / ml) and with the sera from patients with gbs (1:100). after washing, the strips were incubated with avidin conjugated with peroxidase (1:1000), and with anti - human igg antibodies conjugated with peroxidase (1:500) for 1 hour at room temperature. visualization of the reaction products was done using dab, 15 mm imidazole, and 0.025% h2o2 in water (biorad laboratories, hercules, ca, usa). isolated glycoproteins were tested on western blot for their reactivity with pna, as a marker for gal - galnac determinant and with gm1-positive sera from patients with gbs. pna staining of the separated glycoproteins isolated from the human peripheral nerve and c. jejuni (o:19) indicate the presence of the gal - galnac determinant in several proteins [figure 1 ]. western blot analysis of the reactivity of isolated proteins to sera from patients with gbs, revealed positive reactivity of one main protein band with mobility between 60 and 70 kda, present in both isolates, with tested sera from patients with gbs [figure 2 ]. figure 2 also shows positive reactivity of bands with molecular weight lower than 60 kda in both isolates. further studies are needed to determine whether these bands are degradation products of the main cross - reactive proteins, or are independent proteins that show positive reactivity with sera from patients with gbs. western blot of isolated glycoproteins from human peripheral nerve (lane 1) and c. jejuni (lane 2) stained with biotinylated pna. western blot of isolated glycoproteins from human peripheral nerve (1) and c. jejuni (2) stained with gm1-positive serum from patient with gbs. after electrophoretic separation of the glycoproteins isolated from the human peripheral nerve and from c. jejuni (o:19), a reference gel strip cut from the gel was stained with 0.1% amido black, 1% acetic acid, and 40% methanol in water [figure 3 ]. bands corresponding to the proteins with mobility of the cross - reactive glycoproteins (between 60 and 70 kda), as compared to standard, were cut from the unstained gel and used for further enzymatic digestion. sds - page of isolated glycoproteins stained with 0.1% amido black, 1% acetic acid, and 40% methanol in water. lane 1 : human peripheral nerve ; lane 2 : c. jejuni (o:19) ; lane 3 : protein standard. the cross - reactive glycoproteins from human peripheral nerve and c. jejuni (o:19) were enzymatically digested with trypsin and obtained peptides were separated on sds - page and visualized with silver stain [figure 4 ]. bsa served as a control for digestion and a well without protein served as blank. sds - page of the digested glycoproteins from c. jejuni (lane 2) and peripheral nerve (lane 3) stained with silver stain. lane 1 : bsa ; lane 4 : blank ; lane 5 : protein standard. western blot analysis of the separated peptides obtained after trypsin digestion revealed positive reactivity of several bands to pna, present in both digests from the peripheral nerve and c. jejuni (o:19), indicating the presence of the gal - galnac residue in these bands [figure 5 ]. after incubation with serum from patient with gbs associated with c. jejuni (o:19) infection, bands showing positive reactivity were revealed in both digests [figure 5 ]. serum from healthy individual did not show any reactivity to the obtained peptides (not shown). western blot of the digested glycoproteins from peripheral nerve (lane 2) and c. jejuni (o:19) (lane 3) stained with : (a) gm1 positive serum from patient with gbs, and (b) biotinylated pna. infection by c. jejuni pen 19 that bears a gm1-like lipopolysaccharide (lps) induces high production of igg1 and igg3 anti - gm1 antibodies. anti - gm1 antibodies bind to the nodes of ranvier and motor nerve terminal axons, inhibit motoneuron excitability, and produce muscular weakness. pathologic studies of early cases of aman have shown deposits of activated complement components and immunoglobulins at nodes of ranvier motor fibers. the disruption of paranodal region allows the entry of complement and immunoglobulins along the axolemma, with subsequent recruitment of macrophages, which invade the periaxonal space, leading to wallerian degeneration of motor fibers. the immunopathology of gbs associated with c. jejuni infection is caused by a mechanism of molecular mimicry between c. jejuni lps and gm1 ganglioside of the peripheral nerve. a single c. jejuni strain is shown to have several lpss with various ganglioside epitopes, and different penner 's serotypes have the same ganglioside epitope. these indicate that penner 's serotyping system is not dependent on ganglioside - like lpss. on the other hand, some anti - gm1 antibodies may be gm1-monospecific, whereas others may cross - react with other gangliosides or glycoproteins. the subtypes of anti - gm1 antibodies cross - reactive with neural glycoproteins may correlate with different gbs variant. our results showed positive cross - reactivity of the peptides from the human peripheral nerve and c. jejuni recognized by gm1-positive gbs serum associated with c. jejuni infection. we have previously shown that gm1 antibodies cross - react with several gal - galnac bearing glycoproteins at the node of ranvier in the peripheral nerve. two of these glycoproteins have been identified as oligodendrocyte myelin glycoprotein (omgp) localized at the paranodal region and hyaluronate - binding domain of versican localized at the nodal gap. a hyaluronic acid - like repeating unit of lps is proved to be an antigenic determinant of o : 19. the structural similarity exists between hyaluronic acid - like repeat unit of c. jejuni (o:19) and hyaluronate - binding domain of versican. this supports the hypothesis that pathology in gbs may be mediated by cross - reactive autoantibodies directed against the gal - galnac epitope of ganglioside gm1 and hyaluronate - binding domain of versican, whose production is triggered by homologous antigen in c. jejuni (o:19). the results of this study showed the presence of cross - reactive determinants in glycoproteins from the human peripheral nerve and c. jejuni (o:19), recognized by pna, and by gm1-positive serum from patient with gbs, associated with c. jejuni infection. these findings indicate the possible molecular mimicry between isolated cross - reactive glycoproteins and its role in the development of gbs in patients with previous infection with c. jejuni. further studies are needed to characterize and determine the molecular structure of the obtained cross - reactive glycoproteins and their epitopes. elucidation of the molecular structure and function of the cross - reactive glycoproteins present in the human peripheral nerve and c. jejuni will indicate their role in the pathogenesis of gbs and also help in understanding the mechanisms that trigger the immune responses in postinfectious autoimmune diseases. these data indicate the possible molecular mimicry between the cross - reactive glycoproteins present in c. jejuni and human peripheral nerve and also its potential role in the development of gbs following infection with c. jejuni (o:19). | objective : antibodies to ganglioside gm1 are associated with guillain - barr syndrome (gbs) in patients with serologic evidence of a preceding infection with campylobacter jejuni. molecular mimicry between c. jejuni lipopolysaccharide (lps) and ganglioside gm1 has been proven to be the immunopathogenic mechanism of the disease in the axonal variant of gbs. gm1-positive sera cross - react with several gal - galnac - bearing glycoproteins from the human peripheral nerve and c. jejuni (o:19). this study aimed to examine the immunoreactivity of the digested cross - reactive glycoproteins isolated from the human peripheral nerve and c. jejuni (o:19) with peanut agglutinin (pna) as a marker for the gal - galnac determinant, and with sera from patients with gbs.materials and methods : for this purpose, the cross - reactive glycoproteins from peripheral nerve and c. jejuni (o:19) were enzymatically digested with trypsin and the obtained peptides were incubated with pna and gbs sera.results:western blot analysis of the separated peptides revealed several bands showing positive reactivity to pna and to sera from patients with gbs, present in both digests from peripheral nerve and c. jejuni (o:19).conclusions : these data indicate the possible molecular mimicry between the cross - reactive glycoproteins present in c. jejuni and human peripheral nerve and its potential role in the development of gbs following infection with c. jejuni (o:19). |
tuberculosis (tb) is one of the leading infectious diseases worldwide and is still a serious public health problem in many countries. world health organization (who) estimates that one - third of the population is infected with tb and the infection rate increases nearly 1% per year. tb is relatively common in pregnant women ; the prevalence of active tb in pregnant and postpartum women from high burden countries is upper to 60 cases per 100 000 population per year and from low burden tb countries, the prevalence is lower to 20 cases per 100 000 population per year or it is lower about 10 cases in total. the incidence of tb on pregnancy is increasing in countries with limited socioeconomic resources. in most of these countries, increased incidence is associated with increased prevalence of tb in the population of women of childbearing age. latent pattern tb in pregnancy are correlated with a high risk of progression to active pattern that increases the risk of transmission from infected mother to child in the first 3 weeks of life. the disease is a rare complication in utero tb infection due to maternal haematogenous spread. congenital tb is hard to diagnose because it is seldom discernable from other neonatal or congenital infections, thereby the case of congenital tb has been broadly underreported. in the second or third week after childbirth, the symptoms usually emerge and precocious diagnosis is essential. however, the clinical presentation of tb during pregnancy and infancy is often nonspecific, making recognition difficult. only 300 cases were reported in the scientific literature till 1989 ; subsequently, 58 cases in 1994 and, from 2001 to december 2005, 18 more cases have been mentioned. in spite of difficult diagnosis, clinical suspicion and family history support diagnosis of congenital tb and precocious diagnosis avoids death in infancy period. the incidence of congenital tb is low ; however, its significance lays on a mortality rate of up to 50%. this review aims to expose the identity of rare and fatal congenital tuberculosis if untreated and highlight the clinical features and difficulty of diagnosis and awareness among pediatricians to perform immediate therapeutic management from the beginning of suspicion. this study proposes to detect that the prognosis is poor for newborns, followed by a fatal evolution when diagnosis is delayed. this review also shows the variability and nonexistence of uniform consensus for disease treatment in neonatology. an electronic search was carried out at pubmed, embase, cochrane library, and google search engine to realize this review. search was limited to literature and studies published in english, french, and spanish language. the keywords used were neonatal, congenital tuberculosis, and antitubercular therapy, either separately or in different association. data were collected from case reports in africa, asia, latin america, middle - east, united state, and europe. tuberculosis in the neonatal period classically has been divided into two types : congenital and postnatally acquired. essential diagnostic element included isolation of mycobacterium tuberculosis from the infant and either a primary hepatic complex or other discoveries consistent with tb disease in the first days after birth (excluding postnatal exposure). considering the mortality, the criteria for the introduction of isoniazid in 1952 became less pertinent as the number of autopsies decreased. in 1994, cantwell. the main criterion continues to be referred throughout the first week of life in newborn infants by the identification of mycobacterium tuberculosis infectious lesions. considering a more modern approach to diagnosis ; however, the secondary criteria were expanded. less - invasive technics have been established to replace widely the open abdominal surgery that is very heavy for the newborn. however, liver biopsy remains an acceptable alternative to a primary liver complex in order to identify caseating granulomas. discovery of mycobacterium tuberculosis in the female genital tract who has just given birth or in placenta was also added to the secondary diagnostic criteria for congenital disease. exclusion of postnatal acquisition by thorough investigation closely of the contacts remains an important secondary criterion. diagnosis of congenital tb can be established by the primary criteria and at least one of the secondary criteria. pregnancy creates a state of physiological immunosuppression, and tb in pregnant women is relatively common. the placenta plays a main role for a highly effective natural barrier preventing the spread of bacteria toward fetus, the vertical transmission of tb in children is obviously uncommon, and the documented cases of congenital tb are noticeable by their scarcity. on the other hand congenital tb has been presumed as an infection acquired in utero, owing to the age of the infant, lack of any known contact with an active case of tb, and generalized spreading of the disease. the mode of acquisition for congenital infection is assumed to be via maternal bacillemia transmitted to the placenta, amniotic fluid, and/or maternal genital tract. before penetrating to the infant 's liver or lungs to form a primary tuberculous complex, bacilli cross the placenta through the umbilical vein, and a primary focus develops in the fetal liver with involvement of the periportal lymph nodes and the bacilli infect secondarily the lung. therefore it is a hematogenous infection, and hence it is called congenital infection by vertical contamination of tb [911 ]. otherwise, the neonate may acquire the disease in utero or in intrapartum and/or at childbirth through aspiration or inhalation or ingestion of infected amniotic fluid causing primary infection of fetal lungs and gut or via direct contact with the infected maternal genital tract. mostly, the bacilli arriving in the fetal lungs remain inactive during the fetal period and until after birth. the existence of substantial increase in oxygenation and pulmonary circulation may activate tb after birth. dissemination is carried out via fetal circulation to other organ systems and may engender events such as tb meningitis. therefore, transplacental infection arises late in pregnancy and aspiration from infectious amniotic fluid occurs in the perinatal phase. regarding breastfeeding and tb, breast milk is intact of contamination so transmission of disease does not occur [11, 13 ]. clinical presentation of tb in the neonatal period is identical if the acquisition of the disease is congenital or postnatal. furthermore, known effects of tb in pregnancy are marked with the following problems : infertility, poor reproductive performance, repeated abortions, stillbirths, preterm labour, and premature rupture of membranes. as regards fetus, it may have intrauterine growth retardation and low birth weight and has increased risk of mortality. the average age of manifestation of congenital tb is 24 days (range, 1 to 84 days). infected infant is sometimes usually born prematurely, but symptoms of illness can arise from birth to several days or weeks of age and may occur acutely or chronically. signs in neonatal tuberculosis are frequently nonspecific or unusual presentations and their mothers are seldom symptomatic. the most common presentation is with poor feeding, fever, irritability, failure to thrive, failure to gain weight, cough, respiratory distress, hepatosplenomegaly, splenomegaly, lymphadenopathy, and abdominal distension. more severe presentations are meningitis, septicaemia, miliary, unresolving, or repeated pneumonia, and disseminated intravascular coagulation. lethargy, jaundice, ascitis, otitis media with or without mastoiditis, parotitis, osteomyelitis, paravertebral abscess, cold abscess, and papular or pustular skin lesions are different known features. on the other hand, obstructive jaundice owing to glands in the porta hepatis may also arise ; some of cases may have progressive deterioration of liver function in absence of respiratory symptoms. less common manifestations such as apnea, facial palsy, vomiting, cyanosis, jaundice, seizures, and petechiae have been reported in less than 10 per cent of cases. lastly, the course is frequently fulminant, considered in many cases by dissemination of the infection. tuberculosis in the neonate more often has no specific signs or unusual presentations and their mothers seem seldom healthy, and in this manner the diagnosis of tb is paramount. although congenital tb is a comparatively rare pattern or subtype, subsequently diagnosis remains difficult and may be missed. so detailed history of maternal health or infection such as notion of latent tb infection (ltbi) and of family contact has to be given particular consideration in the first line to support the early diagnosis of congenital tb thus preventing death in infancy period. during pregnancy the immune changes and it creates a state of physiological immunosuppression. thereby, in pregnant women, performing the screening of a potential latent mycobacterium tuberculosis infection in order to prevent maternal - child tb disease is very important. pregnancy is a way to screen for ltbi, but to identify pregnant women carrying latent infection remains a challenge, because pregnancy eliminates the t - helper 1 (th1) proinflammatory reaction, which may dissimulate symptoms while rising susceptibility to novel infection and reactivation of tb. the tuberculin skin test (tst) has low cost and requires no laboratory infrastructure but has low specificity and a potential cross - reactivity with bcg and environmental mycobacteria and it requires the patient to return in 4872 hours. in contrast a new second blood test, interferon - gamma release assay (igra), is more specific and suppresses the need for a return visit, with no cross - reactivity with bcg or ecological bacteria, but has high cost and needs laboratory infrastructure lacking in many hospitals in developing countries [2, 17 ]. thresholds interpretation of the tst or igra does not change during pregnancy ; a positive tst is induration 10 mm for hiv - negative and 5 mm for hiv - positive pregnant women whereas a positive igra is a difference in ifn- concentration of > 0.35 iu / ml quantiferon gold test in - tube (qgit) or > 6 spots (t-spot.tb) between the tb antigen and negative control sample, regardless of hiv status. in low incidence settings an igra may therefore be more specific and less sensitive than tst in pregnancy. on the other hand, in a high burden setting, igra may be more sensitive than tst ; so in pregnant women from high burden setting, some studies show that a positive igra is associated with an increased risk of developing active tb [2, 18 ]. there is a long - held suspicion that pregnancy - induced immune suppression affects ltbi screening tests, but studies on the relative findings of the tests in pregnancy occur exclusively from low incidence settings countries and show divergent findings. contrariwise, no studies had shown the comparison of performance of both tests in pregnant women in a high incidence setting countries. the centers for disease control and prevention (cdc) states that igras can be used in place of tst and are preferred in bcg - vaccinated individuals and those unlikely to return for interpretation. who does not recommend routine use of igras for latent tb screening. who recommends latest for high burden countries of tb to continue using the tst for ltbi screening, because it performs similarly to igras and has low cost. in several studies, ltbi faced the challenge of having no gold standard for diagnosis. however, further studies and methods are required for diagnosis of ltbi in pregnant women. obstetrician and trained nurses should be assets to inquire antenatal history and it is very beneficial in early diagnosis and resolving newborn outcome. however, it is helpful to investigate maternal genital tract, placenta 's morphology, and histology in suspected cases at the time of delivery. screening of household or family contacts may yield source of information about infection. in neonates, there are no exact signs and symptoms of congenital tb. later these signs and symptoms are attributed to other causes like prematurity, congenital viral infections or bacterial sepsis, and acute or chronic intrauterine infections [19, 20 ]. as the signs and symptoms may mimic bacterial infection and the condition does not improve with broad - spectrum antibiotics or conventional treatment, it should alert and suspect the pediatrician for diagnosis in an ill newborn infant. the noninvasive and moderately efficient methods could be performed in newborns in order to have samples for microscopy and culture including gastric aspirates, sputum (induced), tracheal aspirates (if mechanically ventilated), skin lesions, ear discharge, ascitic fluid, cerebrospinal fluid (csf), and pleural fluid (if present) for acid fast bacilli and cultured on standard egg based media for 12 weeks. in contrast, bronchoalveolar lavage (bal) is an imperative examination, because discovery of mycobacterium tuberculosis dna in bal fluid by polymerase chain reaction (pcr) is an efficient method, for diagnosis in newborn. liver or lymph node biopsy may be undertaken for histology and culture but it remains highly invasive method for neonate. moreover, early morning gastric aspirates to infants with pulmonary illnesses have a 75% positive yield, which is remarkably higher than older children. standard workup is less efficient in investigation for tb for neonate, such as complete blood count, c - reactive protein, erythrocyte sedimentation rate, liver function tests, and chest radiograph which may also be imperative and informative. in addition, a liver ultrasound may also be imperative and if abnormal features are discovered or the diagnosis is in doubt, a liver biopsy should be carried out to estimate for caseating granuloma formation. although, in the neonatal period, meningitis is a scarce presentation, a lumbar puncture with culture for acid fast bacilli (afb) is recommended. a fine needle aspiration of lymph node may also be requisite to detect afb in case of superficial adenopathy. in many cases of congenital tb illustrated, over 95% of cases related in mother were discovered as having open tb. however, at the time of diagnosis of the newborn, most of mothers are unmindful of their infection. accordingly, if the disease is suspected in the mother then screening and investigation of the mother for tb are paramount. indeed, if the mother is identified to be suffering from active tb, it will be important to revise her genital tract and the placenta in order to evaluate the presence of afb and granulomata. while the test is not often positive in 10% to 15% of cases and may only get positive several months after infection, tuberculin skin test (tst) in newborn is recommended in the investigation of congenital infection. since the immaturity of the immune system makes random tst, there are more recent investigations which have not been validated in children younger than the age of 5 years, as realizing assays that rely on interferon - gamma release, habitually, produce unspecified results [11, 23 ]. finally, once the mother and newborn are labeled tb, both should undergo for human immunodeficiency virus (hiv) testing because increased tb is often present in hiv infected patients. when a woman with tb gives birth, the purpose is to warrant tb - free survival of her neonate. in the general point of view, congenital tb is scarce ; thereby no therapeutic trials were conducted to improve the treatment of optimal manner. as a result, there is no tangible guideline to manage congenital tb. however, treatment should begin as soon as the diagnosis of active tubercular lesion is suspected without waiting for laboratory confirmation of results. drug susceptibility in both is crucial, particularly given the existence of multidrug - resistant tuberculosis (mdr tb)., newborns suffering from pulmonary and extrapulmonary disease should undergo a regimen of four drugs like older children and adults with active disease until sensitiveness is known [4, 9 ]. sometimes the discovery of tb in the mother is related to the suspicion of the disease in the newborn, occasionally the opposite. however, if the mother is suffering from the disease, after having been labeled with the different investigation, the implementation of treatment is paramount. there are two types of treatment of tuberculosis, namely, first - line treatment using isoniazid, rifampicin, pyrazinamide, and ethambutol ; second - line treatment involving aminoglycosides, capreomycin, ethionamide, fluoroquinolones, cycloserine, and para - aminosalicylic acid. treatment regimens should include at least 2 and preferably 3 drugs to which the organisms are presumably susceptible which are isoniazid, rifampin, pyrazinamide, and an aminoglycoside, such as amikacin or streptomycin. nowadays the accepted method of treatment is isoniazid (1015 mg / kg / day), rifampin (1020 mg / kg / day) and pyrazinamide (1530 mg / kg / day), and either streptomycin or ethambutol (1525 first 2 months, both drugs isoniazid and rifampicin should be streamlined to the patient 's treatment after 2 months which are given for an additional period of 4 to 10 months. in the instances of more severe presentation such as tuberculosis meningitis and endobronchial and miliary disease, an essential element of treatment is the close observance of regularity and duration of treatment. the infant should be closely monitored on a monthly basis to clinical point of view for adverse side effects to antitubercular therapies. regarding visitors and hospital staff, it is necessary to avoid for any transmission of active disease, and indeed family member visits and hospital staff should undertake precautions by avoiding transmission between neonates. tuberculosis remains a major public health scourge. as congenital tb continues as a rare presentation of a frequent infectious disease worldwide, only 300 cases have been reported until 1989. since then, more than 80 additional new cases have been reported and documented. most of the study that have been collected and analyzed consists of individual case reports, cases series, and reviews. it is lower in developed countries, making it an unknown disease and difficult to evoke. the mortality rate is very important and high, nearly 50%, which is often due to delayed diagnosis followed to delayed treatment, and 22% among patients receiving chemotherapy. furthermore, newborn infants who suffer from congenital tb after 4 weeks of age have a 77% existence rate compared with 44% survival in those who suffer before 4 weeks. according to the criteria suggested by beitzke in 1935 and reviewed in 1994 to cantwell, the demarcation or distinction between the acquired neonatal patterns of congenital type and neonatal acquired postnatal is still challenging to determine in clinical practice and has only epidemiological interest. our study has observed that most of case reports used the criteria of cantwell for the diagnosis of congenital tb. approximately, it has been noted that 50% of cases meet each of these paths. primarily in utero, it can be spread from the mother to the fetus through transplacental transmission, so the organisms reach the fetus through the umbilical vein, thus creating a primary focus of mycobacterium tuberculosis complex in the liver of neonate with secondary hematogenous spread. secondarily, by direct infected amniotic fluid yearning or ingestion induces formation of a primary mycobacterium tuberculosis complex in the gastrointestinal tract or the lungs. it appears if the caseous lesion in the placenta ruptures immediately into the amniotic cavity, and another explanation at delivery via inhalation of infected amniotic fluid through direct contact with the infected maternal genital tract. the second main route of infection seemed more probable in five case reports studies that we explored in those studies reporting that the patient had no liver damage departing, proven by the absence of liver enlargement with result of normal liver function. abdominal radiographic has shown a nonspecific intestinal dilatation [5, 2528 ]. in the opposite direction of those studies described above, the first transmission route was assumed in three case studies, with abdominal distention, progressive liver dysfunction, and absence or presence of simple respiratory symptoms with chest x - ray incidence normal [8, 15, 29 ]. congenital tb is a rare entity of tb. except for diagnostic challenge and underreporting, the scarcity of the state is yielded by the fact that genital tb or tuberculous endometritis in childbearing women usually leads to infertility. those women may still be able to procreate, due to advances in current assisted reproduction technology, as were the cases presented by wong. and flibotte. moreover, this circumstance is very risky because it still generates very complicated congenital tb. therefore, it is always necessary to take a complete history of the patient prior to in vitro fertilization (ivf) [26, 3336 ]. the more severe type of tb such as extrapulmonary, miliary, and meningeal tb in mother presents high index risk factors for congenital tb in newborn infant and threatens future offspring. in contrast, peng. noted in their analysis that 22 mothers with pleural tb were able to pass on the infection to her child. the vertical transmission rate is between 0% and 16%. vertical transmission appears less among mothers with pulmonary tb and to patients who already initiated treatment before childbirth. however, it is more common in patients with miliary and genital patterns of tb. in addition, scientific information regarding the increased risk of congenital tb to mothers with resistant tb or concurrent hiv infection in literature is less. mothers who have finished antitubercular treatment (att) before delivery or given att for at least two weeks duration before delivery are less probable to spread the disease to the newborn infant as compared to untreated mothers. in most case reports we have studied, it is noted that to discern the signs of congenital tb remains a challenge for all practitioners. classically, infected newborns are born prematurely with low birth weight for gestational age. as said in literature, symptoms appear only in newborns after third week of life, with a median age of 28 days. on the other hand, there have been cases of late onset up to 3 months of life or over, as the case study by vogel. has shown, describing the appearance of congenital tb manifestation at 154 days after birth. the clinical features comprise hepatosplenomegaly with liver and spleen lesion, abdominal distension, lymphadenopathy, and ascites ; pneumonia with respiratory distress, military, nodular, or lymphadenopathy in imaging finding, and no improvement in spite of use of broad - spectrum antibiotic treatment ; meningitis with involvement of cranial pairs of facial nerve, lymphocytosis, and decrease of biological levels of glucose and protein in cerebrospinal fluid ; and sepsis and finally other banal signs [11, 22, 38, 39 ]. but none of them is pathognomonic of congenital tb. several authors demonstrated that the complication of delay diagnostic of congenital tb incorporates military, meningitis tb, and otitis media, resulting in seizures, deafness, and death. the last complication is common, proven in most cases we have seen [33, 41, 42 ]. however, it is of utmost importance to document the antenatal history of mother owing to lack of pathognomonic sign following diagnostic difficulty. the knowledge of a potential latent or active mycobacterium tb infection during pregnancy is crucial. as in the case report study by aelami., doare., tomar., and chemsi. a recent study by peng. establishes that 162 mothers had open tb throughout pregnancy or postpartum period. of them, 121 had no past history of tb before getting pregnant and were diagnosed through pregnancy. in a review of 32 cases of congenital tb. furthermore, singh. described another opportunity to make the diagnosis of congenital tb. it includes newborn infant mainly from endemic areas unresponsive to conventional treatment for worsening pneumonia, if the mother was labeled to have tb and baby has no exact symptoms, when the cerebrospinal fluid was discovered to have a high lymphocyte count in the nonexistence of any identifiable bacterial pathogen and in manifestation of fever and hepatic and splenic enlargement. other diagnostic opportunity has been elucidated in several case reports we have seen. despite having features suggestive of congenital tb, infants are often categorized as septicemia, and the real diagnosis would be delayed. the likelihood of perinatal tb should be considered even in newborn infants suffering unresponsive pneumonia. investigation includes tst, early morning gastric aspirate for acid fast bacilli, and mycobacterium culture in all body fluid and biopsy swab from lymph node and liver. the tst is generally negative in newborn infants at first manifestation, while a study conducted by bor. suggests that tst reaction was positive (16 mm). frequently, the tst converts to a positive result months later after the first negativity result. correspondingly in another study of 9 infants with congenital tb, only 2 presented the positive reactions (> 10 mm). tuberculin skin testing is positive in less than 15% of cases of congenital tb while gastric or tracheal aspirates are positive for tb in 80% of cases. a recent report proved the value of bronchoalveolar lavage as a technique of isolating the mycobacteria in perinatal tb. liver biopsy is really possible because it can have a very high diagnosis sensibility, which is 100%. recently, interferon - gamma (ifn-) release assays have not been authenticated in children younger than the age of 5 years. they may be accepted in combination with tst but should not be utilized as a substitution. in contrast, zheng. attested t - spot assay in their case, based on ifn- release assays (igras) from specific t cells in vitro in response to stimulation of mycobacterium tuberculosis antigens and which has objectified a positive result in a premature newborn, conceived by in vitro fertilization. sometimes radiographic finding in some of cases is uneventful at the onset, but if diagnosis and treatment are delayed, radiographic progression will be poor very quickly. in our study, we noticed that discovery of miliary tb on chest x - ray is frequent in several index cases [36, 40, 47 ]. in 143 cases of congenital tb, chest radiographical findings reviewed by peng. which are 46.8% represented a miliary pattern. also, given the case reports we have analyzed, hepatosplenomegaly dominates the imaging abdominal finding associated with multiple focal lesions, as were the cases presented by raj and sarin, lee. (44,7% of 143 cases). finally, to complete the investigation, endometrial biopsy and histological examination of placenta are useful. treatment contains isoniazid, rifampicin, ethambutol, and kanamycin or amikacin for the first two months followed by isoniazid and rifampicin for 612 months or similar to miliary tuberculosis or isoniazid, rifampicin, and pyrazinamide along with streptomycin and kanamycin for 9 to 12 months. most specialists also advise using corticosteroids for tuberculosis meningitis to reduce both mortality rates and neurologic sequelae. the use of corticosteroids in other severe patterns of congenital tb infection, such as endobronchial and miliary disease, can also be accepted. note that most experts use the treatment scheme for 9 to 12 months as long as there is low immunologic ability in infants. timely identification and proper treatment regimens for congenital tb highly correlated with upgraded outcomes. according to the institution criteria by cantwell. in 1994, mortality rates from published cases were about 45%. several experts evoke and emphasize the improvement in mortality rate after the implementation of previously elucidated criterion. it is mandatory to investigate the antenatal history of the mother to best use these criteria and immediately institute the treatment under high suspicion. the risk of untreated tuberculous disease in newborn infant is higher than the side effects with antitubercular therapies. for some tb pregnant women, their diagnosis is essential as it will cause a fatal situation for the offspring, if not labeled. the treatment is the same as in nonpregnant women but has to be careful with side effects, especially when it is a multiple resistance drug tb. the admission of another drug pyrazinamide also is risky because its teratogenic effect is unknown and is not mentioned. prevention should be possible through early and timely detection of disease throughout pregnancy ; institution of proper therapy especially in endemic area and tb screening should be included in prenatal investigation care [4, 41 ]. so, the knowledge of a potential latent mycobacterium tb infection is key to avoid maternal - child active tb. in low burden countries, the cdc recommends latent tb screening only for high - risk women but pregnancy is not considered high risk by itself. in high burden countries, latent tb screening is not routinely recommended. the women with ltbi reactivated throughout pregnancy has a high risk of death, antenatal complications, and poor fetal outcomes. in those with a positive ltbi test, isoniazid (inh) preventive therapy (ipt) can restrict the risk of developing active tb by as much as 60%. the cdc currently recommend 69 months of ipt for pregnant women with a positive ltbi test, including those from high burden setting, noting that no studies have directly explored the safety of inh in pregnancy. in contrast, inh may increase the risk of hepatotoxicity in pregnancy, though a decision - analysis study concluded that proper monitoring minimizes the risk. it crosses the placenta but does not cause significant fetal toxicity. in most of the studies, who does not recommend routine practice of igras for latent tb screening in contrast to cdc the diagnosis of perinatal tb requires a high index of suspicion and thorough evaluation of both mother and infant is mandatory to establish the diagnosis. in the absence of an associated history of maternal tb, it is difficult to diagnose clinically the disease whereas it is easy to commence timely treatment. this review highlights that when maternal tb is not treated, a delayed diagnosis in children leads to a fatal prognosis and death can occur after an overwhelming sepsis. the need to develop specific protocols to deal with this situation is mandatory. finally, in poor response to conventional antibiotics therapy in newborn especially in endemic areas for tuberculosis or if the mother has risk factors for tuberculosis, practitioners should be conscientious to evoke a congenital tuberculosis. | tuberculosis continues to be a prevalent disease in the world and a global public health issue in many countries. the disease is more complicated in pregnant women because it imperils unborn offspring and results in congenital tuberculosis later if undiagnosed and untreated. congenital tuberculosis is rare entity and an uncommon disease along with a high mortality rate. congenital tuberculosis, a severe clinical type of tuberculosis caused by mycobacterium tuberculosis, is a serious and fatal disease if left untreated. our study emphasizes that it is necessary and mandatory to consider congenital tuberculosis in the differential diagnosis of neonatal or pulmonary infections in infants, essentially in countries where the incidence of tuberculosis is high burden. mother to neonatal transmission of disease is well known via transplacental transmission through the umbilical vein to the fetus, through the ingestion of infected amniotic fluid. early detection is challenging, because of the nonspecific nature of the signs and symptoms in tuberculosis during pregnancy and infancy. the degree of clinical suspicion is the essential component of diagnosis. furthermore, it generally has a difficult treatment and it should not be delayed while waiting for diagnostic test results. prompt identification and proper treatment regimens for congenital tuberculosis strongly relate with enhanced outcomes. |
according to the recent united states (us) census bureau report, the older population (65 + years of age) is projected to increase to 88.5 million by 2050, which is more than double the population of elderly people (40.2 million) in 2010. due to the surge in the aging population, the us health care system will face increasing challenges in caring for older adults in the near future. emergency rooms (er) have been increasingly visited by older adults who present with complex medical conditions and who are more likely to have longer stays, requiring extensive testing, and treatment regimens. the geriatric patients are a unique group and specific considerations should be included in the interventions for these patients. more specifically, psychogeriatric patients may have a variety of clinical presentations, including delirium, behavioral changes, mood disorders, and others. impaired mental status occurs in approximately one quarter of all older patients presenting to the er. delirium is a serious disturbance in a person 's mental abilities that results in a decreased awareness of one 's environment and confused thinking. the onset of delirium is usually sudden, often within hours or a few days. while several studies have been conducted that focus on the recognition and presentation of psychogeriatric patients in the er [46 ], only a few studies discuss patient management and disposition after the initial er visit, which are discussed below. lin and colleagues found that there were significant differences among elderly and nonelderly visitors to the er based on demographic and clinical characteristics. elderly visitors were more likely to have multiple psychotic disorders, mood disorders, dementia, or delirium and less likely to have schizophrenia and substance - related disorders. transfer to a general hospital for the elderly in the psychiatric er was associated with age and a greater number of previous psychiatric hospitalization. in addition, older adults with alterations in mental status particularly, alterations in consciousness and delirium, are at high risk for admission to an inpatient unit and institutionalization after discharge. finally, several studies of psychiatric patients regardless of their ages have reported factors such as danger to self, severity of psychosis, diagnosis of dementia, female gender, and referral to hospital by physician as favoring inpatient admission [6, 9, 10 ]. inpatient admission of psychogeriatric patients to a psychiatric unit was specifically examined in a study showing that out of the 645 geriatric patients admitted to the inpatient psychiatry unit, 30% of the patients came from the emergency room and the rest from physicians in private practice or other departments or hospitals, with the majority from private practice. the main reason for inpatient psychiatry admission was delirium, with endangering behavior to self or others as an important cause for admission. currently, there are no guidelines or recommendations concerning the indication for inpatient psychiatric admission [911 ]. understanding these factors may help ensure a more efficient and effective method of managing psychogeriatric patients in the er setting. therefore, the purpose of this study was to scientifically examine the presentation, management, and disposition of psychogeriatric patients 65 years of age or older who present to the er. in addition, we also intended to assess factors associated with psychiatric consultation in er for older patient population. this is a retrospective cohort study conducted at a large urban university teaching hospital er in the united states located in the state of missouri. the emergency room provides 24-hour emergency psychiatric consultation services by psychiatric residents, nurses, and attending physicians. in 2009 and 2010, this urban hospital emergency room received 54,047 patient visits, out of which 3886 were older adults (65 +) and of those, 95 patients were geriatric patients who presented to the er with a primary psychiatric complaint. data spanning two years, from january 2009 to december 2010, was gathered from review of electronic charts of patients meeting the three criteria : (1) age older than 65 years, (2) having a psychiatric disorder identified under the icd code, and (3) presenting with a psychiatric complaint as their primary reason for visit. subjects who did not present with a psychiatric complaint but were later diagnosed with a psychiatric condition were also excluded. of the 95 patient charts meeting all 3 criteria, 20 patients had more than 1 visit, giving a total of 138 psychogeriatric patient visits. a data collection sheet was employed to document selected demographic, psychosocial, and clinical features of the patients in the form of continuous and categorical variables. the variables included (1) gender, (2) age, (3) race, (4) location from which patient arrived and by whom the patient was accompanied, (5) reason for er visit, (6) primary diagnosis obtained by icd code, (7) specialists consulted, (8) discharge diagnosis from the er, and (9) patient disposition. the reason for er visit was established primarily using the icd codes for that particular encounter for a subject and was secondarily confirmed and/or modified by reviewing the physician documentation of chief complaints. for nonspecific complaints like psychiatric problems, the reason for visit was established based on the history of present illness documentation. the major categories for the reason for emergency room visit were (1) anxiety, (2) delirium, (3) dementia, (4) mood disorder, (5) psychosis, and (6) others, with each category containing a subset of complaints. subjects were categorized based on the location from which they arrived as accompanied by family, arriving alone by emergency medical service, walk in, arriving from home, nursing home, arriving from jail, brought in by police, and transferred from outside hospital. the disposition data was categorized into discharge of subjects to home, nursing home, psychiatric unit, medicine unit, and others. the other category included critical care, surgery, neurology, nephrology, gastrointestinal unit, and cardiovascular unit. data analysis included descriptive statistics with a report of the appropriate frequencies, means, and standard errors to describe the demographic and background characteristics of the study participants. chi square tests were conducted to determine differences among multiple categorical independent and parametric dependent variables. of the total subjects (n = 95) included in the study, about one third (33.7%) were males and two thirds (66.3%) were females with an average age of 75.5 years (s.e = 0.81). of the total visits (n = 138) females incurred majority (68.1%) of the visits. a breakdown by race indicated that caucasians comprised a plurality (44.2%) of the patient population and were responsible for 40.1% of the visits. the vast majority of patients were african americans (54.7%) who were responsible for 58.7% of the visits (table 1). as it relates to the mode of arrival, almost a third of the psychogeriatric patient visits were from a nursing facility (34.1%) and arrival from home unaccompanied by family via ems (32.6%). other major groups were walk - in patients unaccompanied by family (18.1%) and patients accompanied by family (11.6%) (table 2). in addition, the reason for er visit was categorized and majority (61.6%) of patients visited due to delirium. more than 1 in 10 visits were for anxiety disorder (16.7%) and mood disorders (12.3%) (table 2). provision of psychiatric consultation was assessed based on race, gender, and diagnosis. table 3(a) illustrates the race and gender based differences in provision of psychiatric consultation in the er. caucasians (32.1%) were significantly more likely than african - american patients (8.6%) to get a psychiatric consult. females (21.5%) were more likely than males (11.4%) to get a psychiatric consultation ; however, the difference was not statistically significant. the vast majority of patients with delirium did not get a psychiatry consultation as compared to patients with other psychiatric complaints (97.6% versus 50.9%, p < 0.001) (table 3(b)). the disposition comprising the largest percentage of both categories was to the medicine inpatient unit48.2% of delirium visits and 35.5% of all visits ended up in the medicine unit (table 4). only two (2.4%) delirium visits led to a disposition to the psychiatric inpatient unit while almost 1 in 6 (16.7%) of all other visits led to the psychiatric inpatient unit disposition. patients who had a psychiatric inpatient unit disposition were significantly more likely to have had a psychiatric consultation in the er as compared to patients who had other dispositions (p < 0.001). patients who had a medicine inpatient unit disposition were significantly less likely to have a psychiatric consult in the er as compared to patients who had other dispositions (p = 0.03). we further explored the clinical data for the two delirium visits made by patients who were admitted to the psychiatric inpatient unit. the first visit was made by a patient who was on four psychotropic medications an antidepressant, anxiolytic, antidementia drug, and a sedative - hypnotic. the second visit was by a patient who had previous psychiatric diagnoses of depression, schizophrenia, bipolar disorder, and obsessive compulsive disorder. in contrast, the median number of psychotropic medications of patients with delirium who were not admitted to psychiatry unit was 2 and the median number of previous psychiatric diagnoses was 2. of the delirium visits by patients that ended up in the medicine unit, 41% were on five or more classes of nonpsychotropic medications, 31% had elevated blood urea nitrogen (bun) and creatinine, 28% had electrolyte imbalances, 6% had urinary tract infections, and 5% were febrile. the purpose of this study was to investigate the management and disposition of psychogeriatric patients in the er as a function of variables such as gender, race, and chief complaint. an alteration in mental status was previously identified as a high risk for admission to an inpatient psychiatry unit and institutionalization after discharge. consistent with that finding, research by wetterling and colleagues showed that delirium was identified as the primary reason for inpatient psychiatric admission. in our study, we found that although delirium constitutes the main reason for er visit (61.6%) in the older population of psychogeriatric patients, it was not the main reason for obtaining a psychiatric consultation in the er and it was not the main reason for referral to a geriatric psychiatry inpatient unit. we found that patients with delirium, compared to those with other psychiatric illnesses, were actually less likely to get a psychiatry consult in the er and were less likely to be admitted to an inpatient psychiatric unit. subjects with reason for er visit other than delirium, such as anxiety disorder, mood disorder, and psychosis, were more likely to get a psychiatric consult and were more likely to have a psychiatric disposition. furthermore, patients with delirium as the presenting complaint were more likely to be transferred to inpatient medicine units and less likely to be transferred to a geriatric psychiatry inpatient unit compared to patients with any other diagnoses patients with delirium may have been preferably transferred to the medicine inpatient unit because those patients were medically unstable for transfer to the geriatric psychiatry unit. of the delirium visits by patients that ended up in the medicine unit, the largest proportion was on five or more classes of non - psychotropic medications. polypharmacy in the elderly leads to higher rates of adverse drug effects due to age - related changes in pharmacodynamics. in addition to polypharmacy, patients transferred to the medicine unit also had elevated bun and creatinine, electrolyte imbalances, urinary tract infections and were febrile. the fact that patients with these concomitant presentations were transferred to the medicine unit indicates that physicians prefer to treat these nonpsychiatric conditions there rather than in the psychiatric inpatient unit. the two patients with delirium who were admitted to the psychiatric unit did not have any concomitant presentations but were on more psychotropic medications and had more previous psychiatric diagnoses than the patients admitted to the medicine floor, indicating that physicians prefer to keep these patients in the psychiatric unit. we propose that a well - equipped geriatric psychiatry unit with a well - trained physician and nursing staff can manage common illnesses such as urinary tract infections, dehydration, and electrolyte imbalance. the geriatric emergency medicine task force recommends a mental status assessment for all elderly patients presenting to the er. elderly patients coming to the er with delirium caused by urinary tract infection, dehydration, or electrolyte imbalance may be routinely admitted to a well - equipped geriatric psychiatry ward. such proposal is prudent given that delirium is a diagnosis for 1456% of us elderly patients and is associated with hospital mortality rates of 2276%. also, in the case of delirium diagnosis, it is unrecognized in vast majority (6670%) of the cases. our proposal of a well - equipped geriatric psychiatric unit to manage cases of delirium may also be cost effective given the economic burden imposed by cases of delirium. delirium in hospitalized older patients accounts for more than 49 percent of all hospital days, complicates hospital stays for at least one in five elderly patients who are hospitalized each year, and is responsible for billions of dollars spent as medicare hospital expenditures. one finding of critical concern was the race based difference in getting a psychiatric consultation. caucasian patients were more likely to get a psychiatric consultation than minority patients in the er. to determine whether this difference is due to more caucasians having non - delirium visits, we found that even though caucasian patients comprised 40.1% of all visits to the er, they comprised only 25.9% of delirium visits and the rest were visits made by minority patients. this data shows that even though the difference in whether or not a patient obtains a psychiatric consult may not be due to race, it is more likely that caucasians are presenting with more nondelirium visits which are better handled with a psychiatric consult. the reason that minority groups are more likely than caucasians to present to the er with delirium may be because of decreased access to healthcare on a regular basis, making the acute illness more prevalent. another hypothesis is that minority patients may have multiple comorbidities which predispose them to delirium such as dementia, chronic kidney disease, end - stage liver disease, or terminal illness. several other factors have been reported to be predictors of delirium in individuals and some of these may disproportionately affect minority elders. a few notable examples include visual impairment, baseline psychoactive drug use such as narcotics, benzodiazepines, and anticholinergics, history of alcohol abuse, and malnutrition. we also found that females (21.5%) are more likely to get psychiatric consults than males (11.4%) even though the difference was not statistically significant. in order to validate this difference if this difference were indeed proved to be real, this finding would be contrary to er data in patients with acute myocardial infarction showing that men in the er are more likely to get fibrinolytic treatment than women. overall, the most disconcerting finding was how only a few geriatric patients presenting to the er with a psychiatric complaint as their primary complaint actually receive a psychiatry consultation. first, we included only those people who came to the er with psychiatric complaints that fit into the 6 categories mentioned in our study method. it is likely that some of the older adults come in with nonspecific complaints and are found to have a psychiatric diagnosis as an end result of the er investigations. second, our data set samples a select group of patients coming to the er of a university teaching hospital which is located in a predominantly african - american community. african americans comprise over 50% of the city 's population and this demographic is not representative of the us population. third, our study is a retrospective cohort study and can not help establish cause and effect relationships. the present study adds knowledge to the literature on diagnostic evaluation, disposition, and management of psychogeriatric patients in the er. in elderly patients presenting with a primary psychiatric diagnosis, delirium is the chief complaint in a majority of visits to the er and its cause is multifactorial. although delirium has been a primary psychiatric diagnosis in the dsm since its formulation, it is a relevant finding in our study that only 2.4% of elderly patients that came to the er with delirium as the presenting complaint had a psychiatric inpatient disposition, with the majority going to the medicine inpatient unit. patients who went to the psychiatric ward were taking more psychotropic medications and had more previous psychiatric diagnoses than patients admitted to medicine. compared with all psychogeriatric patients presenting to the er, patients with delirium as the reason for visit also received significantly fewer psychiatric consultations. these findings show that the psychiatric inpatient unit is not believed to be as well - equipped to handle delirium patients as the medicine inpatient unit. we propose that a well - trained physician and nursing staff can manage delirium caused by urinary tract infections, dehydration, and electrolyte imbalance and that er physician may routinely admit these patients to the geriatric psychiatry ward. future studies can focus on er physicians ' perception and knowledge about psychiatric illnesses in the elderly, criteria for obtaining psychiatric consults, use of screening tools for psychiatric illnesses, and objective determinants of disposition of psychogeriatric patients. | background. the growing geriatric population in the united states (us) has prompted better understanding of treatment of the elderly in the hospital and emergency room (er) settings. this study examines factors influencing the disposition of psychogeriatric patients after their initial presentation in the er. methods. data was collected on patients 65 years of age or older arriving at the er of a large urban hospital in the usa (january 2009december 2010). results. of the total subjects (n = 95) included in the study, majority were females (66.3%) with an average age of 75.5 years. the chief complaint for psychogeriatric patients coming to the er was delirium (61.6%). caucasians were significantly more likely than african - american patients to get a psychiatric consult (33% versus 9%). patients with delirium were less likely than patients with other psychiatric complaints to get a psychiatric consult in the er (1.2% versus 47.2%) and less likely to be referred to a psychiatric inpatient unit compared to patients with other psychiatric complaints (2.4% versus 16.7%). conclusion. even though delirium is the most common reason for er visits among psychogeriatric patients, very few delirium patients got a psychiatric consultation in the er. a well - equipped geriatric psychiatry unit can manage delirium and associated causes. |
laparoscopic splenectomy was first reported by delaitre and maignien in 1991 and soon became a procedure adopted as golden standard for most indications for splenectomy for haematologic diseases. advantages of laparoscopic splenectomy compared to the open procedure were demonstrated by many studies, including benefits as decreased blood loss, shorter hospital stay, rapid recovery and good cosmetic results. current efforts of the surgical community are to reduce even more the surgical trauma of minimally invasive procedures, and the single port approach has been proposed for several intra - abdominal surgical interventions. splenectomy represents a more complex procedure and shows specific problems for techniques as a single port, due to its volume and texture, and little clinical experience is available on the topic. hirschhorn syndrome is a rare genetic condition characterized by typical facial appearance, growth delay, psychomotor retardation and seizures, and is confirmed by a deletion of the wolf - hirschhorn critical region (whcr) in chromosome 4p16.3. splenomegaly and wandering spleen with a surgical indication for splenectomy in patients with the syndrome was not yet recorded in the literature. this study describes the first clinical application and technical aspects of single port access surgery for splenectomy for this disease. a 21-year - old female patient with typical facial appearance, growth delay, psychomotor retardation and seizures was diagnosed as wolf - hirschhorn syndrome (delection of whcr critical region, chromosome 4p16.3) within the 1 year after birth. greek warrior helmet appearance of the nose, high forehead, ocular hypertelorism, downturned mouth, micrognatia and small ears. the patient was submitted to three facial operations for leporine lip (buccal fissure) at 6 months, at 1 and 1 years. a large thyroid cyst (8 cm) was punctioned pre - operatively and showed no evidence of malignancy. the patient presented diffuse abdominal pain for 6 months, and consecutive abdominal computed tomography scans showed change of splenic status and location during this period, with growing of two large splenic cysts (10 cm and 9 cm), and wandering splenomegaly, with a spleen size of 25 cm with mainly pelvic location [figure 1 ]. body mass index of the patient was 26.6 kg / m, and pre - operative evaluation was classified as american society of anaesthesiologists i. white blood cell and platelet levels were at normal range, and no signs of anaemia were found in routine laboratorial examination. elective splenectomy was indicated, and single port access surgery was offered, when potential benefits and disadvantages of the method were explained. because of the nature of mental illness of the patient, the parents of the patient signed an informed consent for participating in the study. detail of the long splenic hilar vessels under general anaesthesia, the patient was placed in supine position, with a 20 reverse - trendelenburg inclination. a lateral position was not chosen, as the spleen had a full pelvic position with a long vascular supply. the operator was situated at the right side of the patient, and the first assistant was managing the camera at the left side of the patient, with the laparoscopic tower situated at the left shoulder of the patient. a 3 cm - long intraumbilical incision was performed, and the abdomen was entered with open technique, without previous insufflation. a single port access device (triport, olympus, japan) with three working channels (10 mm, 5 mm, 5 mm), was introduced through the incision, and pneumoperitoneum with 14 mm of co2 was gradually insufflated [figure 2 ]. right hand instruments used were straight laparoscopic monopolar scissors, straight maryland graspers and ultrasonic shears. a 30, 10 mm laparoscopic camera was used in the larger channel of the port. position of instruments for splenectomy the spleen was localized occupying the pelvis, and was fully mobilized to a left lateral position for vascular approach by careful manipulation with graspers. monopolar dissection was performed to separate arterial and venous vessels, and double proximal, external tied polypropylene 0 sutures were applied individually [figure 3 ]. distal ligation by the same method was possible only after section of polar vessels using ultrasonic coagulation (ultracision ace, ethicon endosurgery, cincinatti oh). percutaneous aspiration of the cysts content (about 800 ml) allowed extraction of the whole spleen transumbilically without use of an extraction bag [video 1 ]. after closure of the fascial defect, cosmetic aspect was satisfactory [figure 4 ]. ligature of splenic vessels using external tied polypropylene sutures individually applied post - operative aspect of transumbilical splenectomy the single port system used allowed confortable manipulation of the straight instruments, with few collisions or limitations. in this case, because of the characteristics of wandering spleen, there was no need for dissection of lateral attachments. difficult access for dissection was found with the spleen in the pelvic location, but it changed after mobilizing the organ to a left lateral position. operative time was 85 min, and 8 min were necessary for the abdominal opening and insertion of the device, and 12 min necessary for organ extraction and closure. the patient was offered liquid diet, and resumed oral intake on the same day, 2 h after the procedure without occurrence of nausea or vomiting. the post - operative course was uneventful and the patient was discharged in 48 h without medications. histopathological examination of the specimen showed 2 large cysts (9 cm and 8 cm diameter) with no malignancy. no complications were documented until follow - up consultation at 30 days post - operatively. under general anaesthesia, the patient was placed in supine position, with a 20 reverse - trendelenburg inclination. a lateral position was not chosen, as the spleen had a full pelvic position with a long vascular supply. the operator was situated at the right side of the patient, and the first assistant was managing the camera at the left side of the patient, with the laparoscopic tower situated at the left shoulder of the patient. a 3 cm - long intraumbilical incision was performed, and the abdomen was entered with open technique, without previous insufflation. a single port access device (triport, olympus, japan) with three working channels (10 mm, 5 mm, 5 mm), was introduced through the incision, and pneumoperitoneum with 14 mm of co2 was gradually insufflated [figure 2 ]. right hand instruments used were straight laparoscopic monopolar scissors, straight maryland graspers and ultrasonic shears. left hand instrument was a straight atraumatic grasper. a 30, 10 mm laparoscopic camera was used in the larger channel of the port. position of instruments for splenectomy the spleen was localized occupying the pelvis, and was fully mobilized to a left lateral position for vascular approach by careful manipulation with graspers. monopolar dissection was performed to separate arterial and venous vessels, and double proximal, external tied polypropylene 0 sutures were applied individually [figure 3 ]. distal ligation by the same method was possible only after section of polar vessels using ultrasonic coagulation (ultracision ace, ethicon endosurgery, cincinatti oh). percutaneous aspiration of the cysts content (about 800 ml) allowed extraction of the whole spleen transumbilically without use of an extraction bag [video 1 ]. after closure of the fascial defect, cosmetic aspect was satisfactory [figure 4 ]. ligature of splenic vessels using external tied polypropylene sutures individually applied post - operative aspect of transumbilical splenectomy the single port system used allowed confortable manipulation of the straight instruments, with few collisions or limitations. in this case, because of the characteristics of wandering spleen, there was no need for dissection of lateral attachments. difficult access for dissection was found with the spleen in the pelvic location, but it changed after mobilizing the organ to a left lateral position. operative time was 85 min, and 8 min were necessary for the abdominal opening and insertion of the device, and 12 min necessary for organ extraction and closure. the patient was offered liquid diet, and resumed oral intake on the same day, 2 h after the procedure without occurrence of nausea or vomiting. the post - operative course was uneventful and the patient was discharged in 48 h without medications. histopathological examination of the specimen showed 2 large cysts (9 cm and 8 cm diameter) with no malignancy. no complications were documented until follow - up consultation at 30 days post - operatively. wolf hirschhorn syndrome is characterized by typical facial features, post - natal growth retardation and mental retardation, seizures and feeding difficulties in more than 75% of the patients. all affected individuals have prenatal grown deficiency followed by post - natal growth retardation and muscle under - development. other findings are skeletal abnormalities, craniofacial asymmetry, abnormal teeth, antibody deficiency (50 - 75%), hearing defects, heart defects, eye or optic nerve defects, brain abnormalities and stereotypes (25 - 50%) and abnormalities for liver, gallbladder, gut, diaphragm, oesophagus, lungs and aorta (< 25%). surgical indications for splenectomy and wandering spleen in wolf - hirschorn syndrome patients were not reported yet in the literature. current laparoscopic techniques require several skin incisions (3 or 4 for splenectomy), meanwhile single port access surgery allows performing the same procedure by a single intraumbilical wound that produces one almost invisible scar. the major limitation of these techniques is the lack of triangulation to which laparoscopic surgeons are accustomed. the triport device allowed the working of two instruments parallel to the camera, and was confortable for splenectomy in the reported case, with few collisions between instruments, and with a reliable anatomical visualization. single port access splenectomy was described by targarona. performing two cases in 2008 for immune thrombocytopenic purpura and hodgkin disease. in one case, three trocars inserted transumbilically were used, in the other case the ports were placed in one subcostal single wound. in recent series by the same authors, eight cases were described without complications, mostly using the same device, but conversion to traditional laparoscopy was needed in two cases due to adhesions and splenomegaly. podolsky and curcillo published a series of cases of single access techniques, including adrenalectomy, splenectomy and cholecystectomy. they performed the operations using standard laparoscopic trocars inserted transumbilically with different fascial orifices. in the case described in this study, the situation of a wandering spleen facilitated the surgical technique, as the splenic vessels were very long, and there were no lateral attachments to the abdominal wall. use of the triport system was very adequate for this case, and there was no need for articulated instruments, neither for additional trocars. in our view, ligature of the vessels using unabsorbable sutures is the most efficient method for a safe vessel sealing. single port access surgery can be comfortably used for operative visualization, hilar transection and spleen removal, thus reducing parietal trauma and obtaining a scarless result. further studies are suggested to evaluate the role of single access techniques and proper indications in comparison to standard techniques. the incidence of cystic splenomegaly and wandering spleen for wolf - hirschhorn syndrome has to be evaluated in further case series. | wolf - hirschhorn syndrome is a rare genetic condition characterized by typical facial appearance, growth delay, psychomotor retardation and seizures, with a mosaic of other abnormalities reported in the literature. the occurrence of symptomatic wandering spleen with massive splenomegaly and with an indication for splenectomy has not been yet described for this disease. this study reports the first case in the literature of single port splenectomy for this rare condition. in a 21-year - old female patient with wolf - hirschhorn syndrome, with abdominal pain and the diagnosis of wandering spleen with splenomegaly (25 cm diameter) led to an indication of elective splenectomy. in supine position under general anesthesia, single port umbilical splenectomy was performed without laparoscopic assistance, splenic vessels were ligated by sutures, and the specimen was transumbilically extracted. operative time was 85 min, with minimal bleeding, and resumed oral intake on the same day. no intraoperative or post - operative complications occurred, and the patient was discharged in 48 h. single port access splenectomy is feasible and is evolving as an attractive alternative therapy for hematological diseases requiring splenectomy. |
toxic epidermal necrolysis (ten), also known as lyell 's syndrome, is a widespread life - threatening mucocutaneous disease where there is extensive detachment of the skin and mucous membrane characterized by full thickness necrosis of the epidermis. patients initially develop pain, tenderness or a burning sensation in the skin associated with fever and malaise, which generally begin abruptly. over the next 1 to 3 days, ill - defined erythematous macules or a diffuse erythema develops over the trunk and extremities. as the red areas enlarge, central dusky necrotic sites develop with subsequent bullae formation. as the disease progresses, a positive nikolsky sign (peeling - off of the epidermis in large sheets caused by a sliding touch) is an important diagnostic clue and precedes the onset of a life - threatening event. steven - johnson syndrome (sjs) involves less than 10% epidermal detachment and ten involves more than 30% of epidermal detachment. between 10%29% epidermal detachment the drugs blamed includes sulphonamides, aminopenicillins, quinolones, cephalosporins, carbamazepine, phenobarbital, phenytoyn, nsaids, and allopurinol. here we describe a case of toxic epidermal necrolysis in an adult male patient receiving carbamazepine for 3 weeks for complex partial seizures. a 38-year - old asian indian male patient presented with a rapidly progressive generalized eruption with fever. patient was diagnosed as having secondarily generalized complex partial seizures 3 weeks prior to the current illness and was prescribed carbamazepine at the dose of 100 mg twice daily with slow up - titration of the dose to 300 mg twice daily. on the18th day of carbamazepine, patient developed blisters which first appeared on the trunk, chest, and arms. later patient developed fluid filled lesions all over the body, eyes, mouth and genitalea. physical examination showed hypotension (systolic blood pressure 90mmhg) and tachypnoea (respiratory rate 50/minute). clinical examination of the skin revealed a generalized peeling of the skin with crusting seen almost all over the body including scalp and genitalea [figure 1 ]. the erythematous rash was covering almost all over the body with epidermal detachment of 70% body surface area. there was loss of eye lashes, congestion of conjunctiva with mucopurulent discharge and exposure keratitis. his total white blood cell count was 4.59 10/l (normal 410 10/l). liver function tests showed elevated aspartate aminotransferase (ast) 170 (normal 1045) u / l and elevated alanine aminotransferase (alt) 87 (normal648) 7.9mmol / l), which was corrected appropriately. wound swabs of the lesions grew staphylococcus aureus and psuedomonas aeruginosa. generalized peeling of the skin in toxic epidermal necrolysis the clinical impression was ten induced by carbamazepine. the erosions were smeared with fusidic acid and betamethasone combination and covered with sterile paraffin gauge. the patient was made to lie down on sterile banana leaf to prevent sticking of the skin to cotton bed. eye lesions were treated with topical antibiotic preparations (ciprofloxacin, gentamicin, chloramphenicol, moxifloxacin+dexamethasone) and ocular lubricant solution (lacrigel). supportive treatment given includes parenteral opioids (fentanyl, pentazocine) for pain management, intravenous fluids and intravenous albumin. patient was started on levetiracetam for complex partial seizures on the fourth day of admission. after one month, the progression of the skin lesions halted and general condition of the patient was improved. as a sequelae, on follow - up patient had developed hypertrophic scars in some areas. our patient presented with generalized peeling of the skin with mucosal ulceration after initiating the therapy with carbamazepine. several case reports have shown that carbamazepine is one of the culprits in inducing ten. incubation period for development of ten after initiating carbamazepine was less than 3 weeks, which is in conformity with earlier reports. our patient had a low white cell count, which is more commonly found in ten. specific epidemiological studies have not been published on the incidence of ten in developing countries like india. devi reported that the most common [53% ] group of drugs implicated as the cause of sjs / ten was anticonvulsants and majority of these cases [81% ] were due to carbamazepine. it is possible that frequency of ten in countries such as india could be much higher considering the fact that the main etiologic agent of ten, i.e. drugs such as antibiotics, anticonvulsants, and nonsteroidal anti - inflammatory drugs (nsaids) are easily available in these countries without any prescription. cytotoxic lymphocyte - mediated immune reaction (ctl) aimed at the destruction of the keratinocyte expressing foreign antigens as the primary causes for development of ten. tumor necrosis factor - a (tnf - a) and interleukin-6 (il-6) have also been involved in the pathogensis of ten as increased amount of these cytokines are found in the blister fluids in ten patients. these inflammatory cytokines may play their damaging roles by recruiting the cytotoxic t cells to the epidermis. they may also cause damages directly as cytokines such as tnf - a are known to cause increased apoptosis. drug metabolites such as hydroxylamines and arene oxides derived from sulfonamides and aromatic anticonvulsants, respectively, bind to cell constituents if they are not rapidly detoxified by epoxide hydrolase. these metabolites act as haptens and render the keratinocytes antigenic by binding to them. a defect in the detoxification system may be the cause of drug eruption. a strong association has been reported between human leucocyte antigen (hla)-b1502 and carbamazepine - induced sjs in han chinese patients. european studies suggested that hla - b1502 is not a universal marker but is ethnicity specific for asians. biopsy of the specimen shows necrosis of basal layer cells without massive inflammatory infiltration of the dermis ; in specimens with mature lesions it is possible to observe necrosis of keratinocytes involving all the epidermis with diffuse detachment of the epidermis at the level of the basal membrane. other possible medical therapies for the treatment of ten that are reported in the literature include the use of plasmapheresis, intravenous immunoglobulins, and cyclosporine. complete recovery of our patient was probably due to early and effective control of inflammation by treatment with systemic steroids and appropriate topical care of the eroded areas. as reported in the earlier literature, most of the patients with ten were treated with systemic steroids along with antibiotics and supportive measures. apart from control of seizures, carbamazepine is being increasingly prescribed for control of pain in neuralgias and diabetic neuropathy. awareness about the drugs implicated in life threatening drug reactions will help physicians in preventing them by judicious use of the drugs. | toxic epidermal necrolysis (ten), also known as lyell 's syndrome, is a widespread life - threatening mucocutaneous disease where there is extensive detachment of the skin and mucous membrane. many factors involved in the etiology of ten including adverse drug reactions. here we are reporting a case of toxic epidermal necrolysis in an adult male patient after receiving carbamazepine in a 38 year old male. on the 18th day of carbamazepine, patient developed blisters which first appeared on the trunk, chest and arms. the erythematous rash was covering almost all over the body with epidermal detachment of 70% body surface area. there was loss of eye lashes, congestion of conjunctiva with mucopurulent discharge and exposure keratitis. the clinical impression was ten induced by carbamazepine. carbamazepine was stopped immediately. he was treated with high dose intravenous betamethasone and systemic and topical antibiotics. after one month, the progression of the skin lesions halted and he was discharged. |
easy fatigability is a problem commonly seen in modern society. among fatigue - related disorders, chronic fatigue syndrome (cfs), which is defined by intractable physical and mental fatigue lasting more than 6 months with a number of accompanying symptoms, has been well investigated [2, 3 ]. in adults, several surveys have indicated the prevalence of cfs in the community as 0.0072.54% [1, 46 ]. generally, women tend to have a higher prevalence rate than men [1, 46 ]. on the other hand, the prevalence of cfs in adolescents is roughly estimated to be 0.070.5% [79 ]. there are several studies on fatigue in populations of healthy adolescents and children in western countries. these studies have demonstrated a wide variety of prevalence depending upon the study population and definition of fatigue [8, 9, 11, 12 ]. for example, the incidence of chronic fatigue in a general population of 842 british adolescents was 0.4%1.1%. chronic fatigue in this paper was defined as severe fatigue that was not helped by rest and lasted at least 6 months. in a population - based study of 8,586 us adolescents, 138 (1.6%) had fatigue for one month, and 107 (1.2%) had chronic fatigue for 6 months. here, fatigue was judged by information from the telephone interview with a parent or guardian. a recent dutch study indicated that 6.5% of boys and 20.5% of girls had severe fatigue, whose checklist individual strength (cis) scores were above the cutoff point during the last 2 weeks. notably, chronic fatigue is known to be associated with symptoms of depression or anxiety and with future occurrence of chronic fatigue syndrome in these reports [1, 12, 13 ]. reports about the actual conditions of fatigue in healthy asian adolescents are quite limited. as the only report in asian countries, to our knowledge, okamoto. investigated the characteristics of fatigue in association with lifestyle in 247 healthy japanese adolescents. although the fatigue scores were not evaluated, they found high frequencies of complaints of drowsiness and dullness and difficulty in concentration. however, their study included only a limited number of subjects, and it was carried out more than ten years ago. therefore, we tried to investigate the present fatigue status in healthy japanese adolescents, paying special attention to their lifestyle. this study was carried out in nara city in the spring of 2008 with 1,225 participants. nara is an urban city in japan with a population of approximately 370,000. among them, the approximate population of children and adolescents aged between 3 and 17 years was 45,000. the mean annual income of each household was almost similar to the average of japan (2006, census). the participants included 421 students in the 6th grade of elementary school (11 years), 226 in the 1st grade (12 years) and 243 in the 3rd grade (14 years) of junior high school, and 335 in the 2nd grade of senior high school (16 years)., they were asked to complete a questionnaire about their fatigue status and lifestyles on average over the past one month. we obtained consent from all students beforehand for using their data in our study. this project was approved by the ethical and epidemiological committee at nara women 's university. each question was scored from 0 to 3 : 0, not at all ; 1, a few times per month ; 2, a few times per week ; 3, almost every day. the scores given by the participant were then summed to calculate physical and mental fatigue scores separately (range : 012). subjects were also asked about seven cfs - related elements based on the diagnostic criteria of the disease, hereafter defined as the cfs - related score. the cfs - related score was determined after scoring these elements and summing them up (range : 021). questions about lifestyle were as follows : (1) sleep : daily sleep hours (0.7) are considered to be good for the internal consistency and to satisfy the reliability. next, we evaluated the reliability of our questionnaire in comparison with the same subscales in the chalder 's scale, which was already validated. correlation coefficients were 0.76 for physical fatigue scores, 0.64 for mental fatigue scores, and 0.78 for physical + mental fatigue scores. table 1 also indicates the mean and 95% confidence interval (ci) of physical fatigue, mental fatigue, and cfs - related scores for different ages and gender. significant increases of these scores with age were found in the male, female, and total populations (p <.01). there was no gender difference in physical and mental fatigue scores, whereas cfs - related scores were significantly higher in females except for 12-year - olds. in the present participants, cronbach 's s for physical, mental, and total fatigue scores were 0.76, 0.74, and 0.85, respectively this fact also showed the good internal consistency. by multiple regression analysis after adjusting for age and gender, these scores were found to be associated with all lifestyles except for snacks between meals in cfs - related scores (table 2). shorter duration of sleep, less extracurricular sports activity, lower food balance score (i.e., less balanced diet), and higher frequency of snacks or sugar - sweetened beverages were predictors of increased scores. in contrast, bmi did not show any significant association in each score. in order to evaluate the total quality of life, we have summed up the physical and mental fatigue scores as the total fatigue score. then, the total population was divided into two groups according to the total fatigue score, that is, low fatigue (scores 012) and high fatigue (scores 1324). logistic analysis was carried out to determine associations of either group with demographic factors, lifestyle, visits to the nurse 's room or bmi. as shown in table 3, age (p <.001), sleep duration (p <.001), food balance score (p <.001), frequencies of snacks and sugar - sweetened beverages (p <.05), and visits to the nurse 's room (p <.001) revealed significant association with the total fatigue score. although a self - reported questionnaire has the weakness of not being objective, it is still thought to be the most reliable and acceptable method of collecting activity data from a large population of adolescents. among various self - reported questionnaires [1719 ], the cis score, which was originally developed for adults, has been most widely used. the cis consists of 20 questions with 4 subclasses, that is, fatigue severity, concentration, reduced motivation, and physical activity.. the validity of cis scores has been established, and the use of cis scores makes it possible to make comparisons among different data. another popular questionnaire, chalder 's scale, consists of 14 elements and separates physical and mental symptoms. chalder 's scale is simple, and thereby is useful in large community samples. in the present study, we devised our own questionnaire, since the nuance of some questions in the previously validated questionnaire such as do you feel weak ? is difficult to be translated into japanese accurately. since the cis questionnaire consists of seven scales for each question, it is rather difficult for children to find an appropriate answer. inclusion of several symptoms closely related to cfs is the disadvantage of chalder 's scale. in our questionnaire, most elements appearing in the physical and mental fatigue questions except for those in mental fatigue, 3 and 4, were drawn from the cis with modification. as for cfs - related symptoms although exact comparison with previous studies is thus difficult, our study presents several issues. first, there was no gender difference in either physical or mental fatigue showing a contrast with previous studies demonstrating female dominance [8, 9 ]. the reason for this disparity is uncertain at present, but one possible explanation is that japan is a male - dominated society, and that boys are obliged to study hard at school from early childhood. on the other hand, notably, the order of the prevalence among 6 cfs - related symptoms was almost identical to that in the previous study (data not shown). second, we did not investigate the rate of school absence, but self - reported visits to the nurse 's room at school because of fatigue or tiredness increased with an increase of fatigue severity. this fact should be further investigated, since severe or chronic fatigue is thought to disrupt daily life, for example resulting in school absence. finally, various lifestyle factors were found to be closely associated with fatigue. among them, however, the role of sleep duration, sports activity or degree of obesity differs from study to study, presumably due to differences in study design [9, 12, 14 ]. second, this is a cross - sectional study done in a single period of spring, 2008. since the degree of fatigue in an individual may change among different seasons of the year, a longitudinal study for at least one year is warranted. finally, we did not ask anything about personal medical histories from the viewpoint of protecting personal information. in fact, it is very difficult to ask the question such as do you have any chronic disease, even if it is anonymous. therefore, there is a possibility that some students, especially those with severe fatigue, may have underlying disorders. in conclusion, we carried out the large cohort study on the present fatigue status in healthy japanese adolescents. the finding that there was not any significant gender difference in both physical and mental fatigue scores should be paid attention considering the female dominance in previous reports from western countries. however, generalization of our data directly to other asian counties should be cautious. in spite of the limitations, we still believe that our findings will be useful for understanding the similarities and differences of fatigue among healthy adolescents in different developed countries. a further followup study to investigate whether chronic or severe fatigue in adolescents is connected with cfs or cfs - like illness in later life is necessary. | in order to investigate the prevalence of physical, mental, and chronic fatigue syndrome-(cfs-) related fatigue and its relation to lifestyle, 1,225 adolescents (591 males, 634 females) aged 11 to 16 years were asked to complete a self - reported questionnaire on fatigue status and lifestyle in the past one month. there was no gender difference in physical and mental fatigue scores, but cfs - related scores were significantly higher in females than in males. these scores were found to increase with the increase of age. after adjusting for age and gender, multiple regression analysis showed that physical and mental fatigue scores were associated with sleeping hours, extracurricular sports activity, food balance, the frequencies of snacks between regular meals, intake of sugar - sweetened beverages, and visits to the nurse 's room. this paper is the first large cross - sectional study on fatigue in healthy adolescents in japan, albeit there were numerous such studies in western countries. |
according to a recently released ' the korean diabetes research report 2012 ' by korean diabetes association, one out of ten adults has diabetes disease, two out of ten have the impaired fasting glucose which is stage of diabetes, and three out of ten adults are threatened by high blood glucose. in addition, the aging society proceeds quickly, thereby the number of diabetes patients are predicted about 6 million in 2050, approximately a 2-fold increase compared to the current number of diabetes patients. also, the incidence of acute and chronic complications associated with diabetes is expected to increase. especially diabetic nephropathy occurs more frequently among the patients suffered from diabetes for a long time. also, it is a complication that has a large impact on patient 's quality of life. a balanced diet was recommended for diabetes mellitus patient as a key component of diet therapy. on the other hand, food intake increases burden to kidney function in diabetic nephropathy patients. therefore, the patient who proceeded to diabetic nephropathy needs nutrition education to properly manage the disease and to increase the quality of life.. diabetic nephropathy occurs in 20% to 40% of patients with diabetes, and is a most likely causes of end - stage renal disease reported worldwide. continuous microalbuminuria (30 - 299 mg / day) appears in the early stages of diabetic nephropathy with type 1 diabetes, and it is an indicator of nephropathy onset and the development of cardiovascular disease. a patient who had a progression from microalbuminuria to macroalbuminuria (300 mg / day) has a high risk of developing end - stage renal disease in few years. according to a recent study, the deterioration of renal function could be delayed by proactive management at the initial diagnosis point, therefore, it is important to implement a personalized diet customized to individuals as soon as possible. in this case report, the nutrition education for one patient with diabetic nephropathy is discussed. the patient was a 52-year - old woman who was diagnosed with type 2 diabetes mellitus approximately 6 years ago. the patient had been taking oral hypoglycemic agents (glimepiride) and insulin (glargine 18 - 20 iu before breakfast and 4 iu before bed) to control blood glucose level. the patient 's 2 hrs postprandial blood level was normally maintained between 280 - 300 mg / dl, however, the level increased to 300 - 400 mg / dl, in recent 2 - 3 weeks and the patient was hospitalized to control high glucose level. in addition to that, the patient had been receiving medical treatment for hypertension and dyslipidemia, and regular blood tests and urine tests were performed to monitor significant changes. the patient had been diagnosed with renal failure and proteinuria one year ago, and at the time of this hospitalization, the patient was diagnosed with stage 4 chronic kidney disease, and was consulted for nutrition education of diabetic nephropathy. the patient 's height and weight were 158 cm and 81.4 kg, respectively, percent of ideal body weight was 155.5%, indicating she was severely obese. the patient preferred a salty soup and stew, and the actual amount of intake exceeded the recommendation. when eating out once a week, the patient often ate a hamburger or a noodle meal. the patient 's diet history was analyzed by the 24-hr recall method using can pro 3.0 software (the korean nutrition society, seoul, south korea) (table 2). the patient consumed approximately 1,840 kcal / d with a protein intake of 67.5 g, and the energy ratio from carbohydrate, protein, and fat was 61.7% : 14.4% : 23.9%, respectively. the patient did not take any nutritional supplements, and did not drink alcohol, or smoke. the patient 's physical activity was rated to mild level of a homemaker ; she participated in weight training or bowling for 2 hrs (3 times a week). - energy : 1,600 kcal (30 kcal / kg x 52.4 kg ideal body weight [ibw ]) - protein : 40 g / d (0.8 g / kg 52.4 kg [ibw ]) - potassium : 2,000 mg / d this patient revealed problematic dietary habits including excessive carbohydrate intake, excessive protein intake, and excessive potassium intake (table 3). after analysing etiology, lack of knowledge and absence of education experience were selected as main causes. therefore nutrition education for diabetic nephropathy the nutritional problems of " excessive carbohydrate intake " and " excessive protein intake " were managed by establishing adequate nutrition through a diet comprising 1,600 kcal of energy, and below 60 percent of energy from carbohydrate and 40 g of protein per day. food models and a food exchange list were configured to provide nutritional training for the proper dietary intake. the association of carbohydrate intake and blood glucose control was discussed in relation to the nutritional problem of " excessive carbohydrate intake ". also, recommended amount of rice intake was 2/3 - 3/4 bowls (2.3 exchanges), which is reduced from one bowl (3 exchanges) a meal. usually, it was necessary to take a proper amount of fat for preventing malnutrition and lack of caloric intake arise when protein and carbohydrates were restricted. however the patient had dyslipidemia and limited intake of animal fat was recommended. in addition, the patient was provided with information on the importance of eating the low - salt diet and tips for how to eat the low - salt diet easily. 1) apply of spicy and sour flavor seasoning like pepper or vinegar, instead of salt or fermented soybean paste. 2) limit the intake of high - salt - containing foods, such as kimchi, and other salted and pickled foods, 3) consume side dishes during meals without the addition of salt, 4) grilled food rather than boiled was recommended and use the food 's own flavor effectively when cooking, 5) when salting, focus on one kind of food. the patient was instructed to limit their intake of high potassium - containing foods (grains, potatoes, sweet potatoes, corn, soybean, green vegetables, nuts, tomatoes, kiwi, banana, melon etc.). to reduce potassium intake, the intake of raw vegetables was recommended. it was also recommended to remove the shell before cooking, to use leaves rather than stem and to boil vegetables in water 4 - 5 times of their volumes. the results of nutrition education after 3 months are shown in table 4 - 6. the patient 's diet history during last 3 months was analyzed by the 24-hr recall method using can pro 3.0 software (the korean nutrition society, seoul, south korea). the patient consumed approximately 1,300 kcal / d with a protein intake of 37.6 g, and the energy supply from carbohydrate, protein, and fat was 71.3%, 11.6%, and 17.1%, respectively. after receiving the nutrition education for three months, the patient 's energy intake was reduced by 500 kcal compared to three months ago. this article is a case report of a patient with chronic kidney disease caused by diabetic nephropathy. because this patient had never received any nutrition education, the patient 's food and nutrition related knowledges was poor. as a result, the patient had problems including excessive intakes of carbohydrate, protein, and potassium, which was problematic for disease management. to solve this problem, three months after the education, the patient 's blood profile data was collected from electronic medical records (emr), and the patient 's dietary intake data was collected through direct interviews. after intervention, carbohydrate intake did not conform exactly to recommendation, but protein intake and limitation of high - potassium foods were fairly well complied. excessive carbohydrate intake should be avoided as far as possible owing to its blood glucose control issues. to slow the progression of kidney complications, protein intake should be limited to 0.8 - 1 g / kg ibw / d for those with microalbuminuria, and should be limited to 0.8 g / kg ibw / d for those with macroalbuminuria, and should be limited to 0.6 - 0.8 g / kg ibw / d for those with end - stage renal disease. adequate fat intake is necessary to prevent malnutrition, because a lack of caloric intake can induce the restricted protein and carbohydrate intake. dyslipidemia is one of the most common complication in patients with diabetic nephropathy and is correlated with disease progression. this patient needs to be screened for microalbuminuria to prevent the progression of diabetic nephropathy, and dyslipidemia should be treated to reduce cardiovascular mortality. the consumption of oils with saturated fatty acids and meat should be limited, and stir - fried vegetables and vegetable oil should be consumed in moderation. for strict blood pressure control, potassium is involved in the contraction and relaxation of muscles in the human body and is an essential electrolyte. however, when kidney function decreases, excess potassium can not be easily excreted and is accumulated in the body, creating a burden. therefore, potassium intake should be limited in chronic kidney disease or in the case of hyperkalemia. therefore, the intake of coarse grains and vegetables should be limited, and should be soaked in water for more than 2 hours, and then blanched in boiling water before cooking. phosphorus in combination with calcium is found in bones and teeth. in reduced renal function, the amount of phosphorus that is emitted through the kidneys decreases and the blood levels of phosphorus increase. therefore, drug therapy is required in chronic kidney disease stages and the intake of foods that contain high levels of phosphorus should be reduced. a diabetic diet entails consumption of a healthy and balanced diet. whereas a chronic kidney disease or diabetic nephropathy diet should be designed to delay the progression of kidney disease, uremia due to renal dysfunction, hypertension, edema, hyperkalemia, hyperlipidemia and to control blood glucose along with the regulation of sodium, protein, and potassium levels. thus compared to the diabetic diet, the diabetic nephropathy diet is a little more complicated and restrictive. however, a personalized diet plan and continuous monitoring are required in diabetic nephropathy patien according to the patient 's stage of disease. | in recent years, several studies have reported that the prevalence of diabetes mellitus is increasing every year, and also the acute and chronic complications accompanying this disease are increasing. diabetic nephropathy is one of chronic complications of diabetes mellitus, and food intake which is burden to kidney function should be limited. at the same time, diet restriction could deteriorate quality of life of patient with diabetic nephropathy. according to the results of previous studies, the aggressive management is important for delaying of the progression to diabetic nephropathy. also, the implementation of a personalized diet customized to individuals is an effective tool for preservation of kidney function. this is a case report of a patient with diabetic nephropathy who was introduced to a proper diet through nutrition education to prevent malnutrition, uremia and to maintain blood glucose levels. |
the search for new drugs and protein reagents usually involves single organic molecules which attach to protein binding sites. such studies are widely supported by computer - aided drug design tools [1, 2 ], however ongoing developments in supramolecular chemistry have directed the attention of researchers toward new types of reagents, formed by assembling several distinct chemical compounds. these reagents are potentially attractive due to their unique properties and possible applications in various fields [313 ]. from the medical and biological point of view interaction of supramolecular structures with proteins is a topic of great interest, yet unfortunately our knowledge of this phenomenon remains limited. interaction of this type is known to occur in cell membranes ; however surface interaction with proteins (such as in the cell membrane) is not sufficient to facilitate biological function. penetration of a ligand composed of assembled molecules into the protein interior seems necessary. out of many possible supramolecular architectures rode - like or ribbon - like organization appears to be the most promising for this purpose due to the existence of partly exposed hydrophobic portions of assembled compounds, favoring adhesion. congo red is perhaps the best recognized self - assembling dye of this type and hence commonly used as a model [1417 ]. it is a known amyloid stain but it also appears to form complexes with structurally unstable proteins, such as abnormal igg light chains derived from serum or urine of myeloma patients [1823 ]. molar excess of this dye usually attaches to proteins and while a large fraction of the bound dye may easily be removed by adsorption, some dye usually remains, suggesting penetration and anchorage within the protein body. a question therefore arises : should penetrating molecules be treated as assemblages of individual units or as an integral ligand ? support for the latter interpretation is provided by studies on some foreign compounds, e.g., rhodamine b intercalating into supramolecular congo red and penetrating, together with this dye, into a protein for which it has no affinity by itself. moreover, the observed correlation of self - assembling tendencies of different organic dyes and their capability for protein complexation strongly favors treating supramolecular liagands as coherent units [25, 26 ]. interaction of proteins with ligands is usually limited to a binding site at a specific location in the protein molecule. binding sites are commonly found as cavities in the protein body facilitating contact of the ligand with the hydrophobic interior and separating the ligand from direct dissociation pressure of the surrounding water solution. the specificity and strength of interaction which allows ligand - protein complexation is due to the specific shape of the binding site accommodating the ligand as well as to proper distribution of binding groups. the strength of non - specific low - contact interaction of organic compounds outside the binding site is generally insufficient to stabilize ligation, even if penetration into the protein interior is occasionally possible. it concerns self - assembled molecules creating rode - like or ribbon - like supramolecular structures. they are usually formed by elongated, planar aromatic ring - containing organic molecules with (possibly) symmetric distribution of charges in the molecule. congo red and related dyes are an example (fig. 1) [2733 ]. theoretical calculations enable modeling of such supramolecular structures, based initially on semi - empirical techniques and then using ab initio parameterization [17, 27 ]. in contrast to the molecular organization of supramolecular micellar structures with a standard globular shape, where the hydrophobic portions of amphipatic molecules are basically hidden in the micelle, fibrillar structures allow significant exposure, promoting adhesion. this property pieces of such ribbon - like supramolecular structures consisting of several or more assembled molecules have been confirmed to penetrate into proteins and bind as single ligands. -plates in proteins appear to be the most favored acceptor [26, 3436 ]. replacement of the least stable strand (away from the packing locus) to make room for the dye ligand is a frequently observed phenomenon (fig. well - packed proteins are mostly impervious to dye penetration and generally speaking certain structural instabilities seem essential to render the protein capable of binding supramolecular ligands. instability may occasionally be natural, as in the case of the so - called disordered proteins, but more often arises as a result of protein misfolding [4042 ], mutation - derived structural alteration or the presence of unfolding conditions [28, 38].fig. 1congo red single molecules (a, b) and supramolecular form of the dye (c) [17, 27]fig. 2schematic view of supramolecular congo red penetration into a locus of decreased stability in a -plate. replacement of one -strand by the dye (a, b) congo red single molecules (a, b) and supramolecular form of the dye (c) [17, 27 ] schematic view of supramolecular congo red penetration into a locus of decreased stability in a -plate. in some cases proteins become susceptible to penetration by supramolecular ligands as an effect of structural changes generated in the protein molecule by its function - related activities. this implies that primary structural changes in the protein molecule caused by the ligand itself are often connected with some distant secondary alterations and packing instability which allows congo red penetration and binding [16, 36, 4345 ]. in these cases complexation of supramolecular ligands arrests the primary structural changes connected with the protein s function. the mechanism of this process corresponds to a known type of enzymatic inhibition called uncompetitive inhibition. in the case of enzymes, strong binding of substrates without simultaneous release of products interferes with biological function, causing inhibition. function - related binding of dye may be studied, e.g., on the basis of known complexes involving acute phase serum proteins. figure 3 shows the distribution of serum proteins separated by two - dimensional agarose electrophoresis with congo red added to the second (perpendicular) run (placing the dye below the starting line of proteins) to select and expose proteins interacting with the dye. the rapidly migrating dye accelerates migration of proteins involved in its binding. as a result such proteins outpace the diagonal distribution of proteins which do not engage in binding dye. selective binding of dye to serum proteins associated with various diseases indicates that proteins exposed by the dye (i.e., those located above the diagonal) may have been altered by pathological processes. location of these particular proteins in electrophoretic fractions hints at the nature of the abnormal state in the organism. the phenomenon of function - derived generation of protein susceptibility for congo red binding is of great interest for theoretical and practical use in biology and medicine.fig. 3the effect of using two - dimensional agarose electrophoresis of serum proteins with congo red dye fast migrating added to the second ; perpendicular electrophoretic run in order to distinguish (by way of faster migration) proteins which become susceptible to binding the dye due to disease - modified function - related structural changes the effect of using two - dimensional agarose electrophoresis of serum proteins with congo red dye fast migrating added to the second ; perpendicular electrophoretic run in order to distinguish (by way of faster migration) proteins which become susceptible to binding the dye due to disease - modified function - related structural changes complexation of antibodies with large insoluble antigens (cells, bacteria) generates strains and structural changes in molecules, rendering them susceptible to congo red binding. the strains arise as a consequence of fitting and complexation of noncomplementary objects represented here by bivalent antibodies on the one hand, and by randomly distributed antigenic determinants on the other (fig. this effect concerns only complete bivalent antibodies and neither fab nor even (fab)2 complexation is capable of producing it [43, 44 ]. nevertheless, secondary structural alterations in the antibody molecule (caused by antigen ligation) increase its affinity for congo red and, as a result, promote formation of immune complexes [43, 44, 4951 ]. this enhancement effect caused by congo red binding to immune complexes formed by complete, bivalent antibodies was measured in the srbc - antisrbc system using polyclonal antibodies isolated by sephadex gel filtration and labeled by iodine-125. the curve clearly indicates the increased number of antibody molecules bound to red cell following increases in congo red concentration (fig. 5). experiments reveal binding of low - affinity antibodies, naturally present in polyclonal sera, removable without congo red by washing.fig. 4schematic presentation of the mechanism explaining generation of constraints in bivalent antibody molecules upon binding to antigenfig. 5increasing the affinity of antibodies to antigen and enhancement of immune complexation upon congo red binding. the curve shows increasing numbers of (radio - labeled) antisrbc antibodies (derived from polyclonal serum) bound to the red cell as the concentration of congo red increases. congo red binding appears to enable low - affinity antibodies to form immune complexes schematic presentation of the mechanism explaining generation of constraints in bivalent antibody molecules upon binding to antigen increasing the affinity of antibodies to antigen and enhancement of immune complexation upon congo red binding. the curve shows increasing numbers of (radio - labeled) antisrbc antibodies (derived from polyclonal serum) bound to the red cell as the concentration of congo red increases. congo red binding appears to enable low - affinity antibodies to form immune complexes the site of congo red binding is localized in immunoglobulin v domains but outside of the antigen binding site [16, 37, 38 ]. constraints destabilize the packing of the n - terminal polypeptide chain fragment in the v domain. destabilization further propagates to elbow regions, enabling rotational movements of polypeptides in the ch1 domain and, as can be expected, favoring complement fixation. theoretical modeling, confirmed by experimental observations, reveals structural changes associated with the binding of supramolecular ligands. [44, 51, 52 ] a schematic representation of this phenomenon in the v domain of l chain is presented in fig. 6schematic view of the igg l chain v domain showing the arrangement of polypeptide strands in -sheets (a, b) and the alterations produced by the complexation of congo red (c, d) schematic view of the igg l chain v domain showing the arrangement of polypeptide strands in -sheets (a, b) and the alterations produced by the complexation of congo red (c, d) the congo red ligand, composed of several dye molecules derived from a ribbon - like micelle, penetrates into the protein body. while its binding strength is rather high, a portion continues to protrude from the protein molecule, creating an external anchor point to which more dye can attach itself. as a result, the excess of dye associated with the protein - dye complex may be removed by gel filtration (using bio - gel) or brief reduction by sodium dithionate. confirmation for these predictions was provided by em analysis of the isolated by sephadexg200 gel filtration fraction involving igg molecules aggregated by heating in the presence of congo red. the picture shows individual or clustered igg molecules as white irregular spots, loaded with an excess of congo red, preventing the precipitation of partly unfolded (by heating) protein molecules (fig. the non - covalently stabilized supramolecular material attached to the protein may additionally bind foreign compounds, including drugs, by intercalation. in this way foreign compounds with no affinity for the given protein may be introduced to it as payload carried by supramolecular dye. immune complexes which selectively bind congo red may therefore represent an attractive target model for compounds potentially carried by supramolecular ligands. congo red with rhodamine b bound by intercalation was used as the medium for srbc - antisrbc agglutinating system to verify the validity of the above mechanism. microscope imaging fully confirms that immune complexes act as a receptor system which binds congo red and therefore becomes the carrier for the included rhodamine b (fig. 7em picture of igg (human) heated with congo red in conditions standard for aggregation, isolated as high molecular weight fraction by sephatexg200 gel filtration. single or aggregated molecules of igg are seen as small irregular white spots within clouds of (silver contrasted) congo redfig. 8the use of congo red as a carrier transporting and introducing rhodamine b (bound by intercalation) to srbc - antisrbc immune complexes. control : red cells treated with dye in the absence of antisrbc antibodies (a sample in uv, b sample in uv presented in black and white, c control) em picture of igg (human) heated with congo red in conditions standard for aggregation, isolated as high molecular weight fraction by sephatexg200 gel filtration. single or aggregated molecules of igg are seen as small irregular white spots within clouds of (silver contrasted) congo red the use of congo red as a carrier transporting and introducing rhodamine b (bound by intercalation) to srbc - antisrbc immune complexes. control : red cells treated with dye in the absence of antisrbc antibodies (a sample in uv, b sample in uv presented in black and white, c control) convincing evidence that immune complexes but not free antibodies may become an acceptor for congo red comes from observations concerning selective binding of dye by immune complexes in vivo. in vivo testing exposes congo red to highly diverse environmental conditions disturbing the carriage thus making the process reliable. as part of these studies, immune complexation was generated locally in the ear of immunized rabbit by antigen injection (arthus effect). owing to the low opacity of rabbit ear tissues, the collection of dye in the locus of injection of the antigen could be observed using a source of visible light. pictures were taken using filters which enabled differentiation of hbo2 and congo red due to their differing spectra. as a result, shades of red (which can not otherwise be differentiated without the use of filters) appear more blue for hbo2 and more violet for congo red (fig. 9ii presents the collection and disappearance of congo red from the vicinity of the antigen over time. the concentration of congo red in the observed area increases over approximately 2030 h and then slowly begins to decrease. 9the kinetics of congo red binding to immune complexes upon local introduction of an antigen to the ear of immunized rabbit (arthus effect) followed by intravenous administration of congo red. a source of visible light was placed in the background and suitable color filters were selected to differentiate hemoglobin and congo red (top figure). a without filters b with filters c hbo2 and congo red spectra. i the effect of using filters to differentiate hbo2 and congo red in solutions and directly in the ear of rabbit ii collection and dispersal of dye bottom figure the kinetics of congo red binding to immune complexes upon local introduction of an antigen to the ear of immunized rabbit (arthus effect) followed by intravenous administration of congo red. a source of visible light was placed in the background and suitable color filters were selected to differentiate hemoglobin and congo red (top figure). a without filters b with filters c hbo2 and congo red spectra. i the effect of using filters to differentiate hbo2 and congo red in solutions and directly in the ear of rabbit congo red also attaches to special complexes formed by monocytes or t - lymphocytes and red cells (rosettes) in the presence of specific anti - red - cells antibodies [5759 ]. the former is based on antibodies affixed to fc receptors distributed on the surface of monocytes, while the latter represents antibodies attached to red cells only. this confirms that structural changes in surface proteins engaged in complexation (antibodies fc receptors) are responsible for binding the dye. in the presented case, however, a portion of the attached congo red was induced to fluorescent emission, which hinted at penetration of dye to more hydrophobic portions of interacting proteins. this phenomenon only involves dye which is engaged in complexation directly on the surface of mouse monocytes (cell line j774a.1, attc tib67) (fig. 10formation of rosettes (mouse monocytes 3774a1 in srbc - antisrbc system) via susceptibility of surface proteins to congo red binding (a uv image ; a visible light image ; b model view) formation of rosettes (mouse monocytes 3774a1 in srbc - antisrbc system) via susceptibility of surface proteins to congo red binding (a uv image ; a visible light image ; b model view) microscopic pictures taken in uv and visible light reveals the nonhomogeneity of immune complexes formed as rosettes in the srbc - antisrbc system on the basis of monocytes as a source of fc receptors. congo red bound to primary antibodies affixed to fc receptors appears to emit yellow and red fluorescence, while molecules attached to poorly ordered parts of immune complexes remain inactive. such behavior seems to be connected with strain within proteins engaged in congo red binding. the induced fluorescence of congo red was also observed to appear when the dye was added to human monocytes interacting with epithelial human bladder transformed cells (hcv29 t, polish cellular and molecular biology network, unesco / pan) (fig. 11binding of congo red to surface proteins of interacting monocytes and cancer cells (hcv29 t human and human monocytes). fluorescence of congo red registered in uv and visible light binding of congo red to surface proteins of interacting monocytes and cancer cells (hcv29 t human and human monocytes). fluorescence of congo red registered in uv and visible light the dye binds and produces fluorescence only in conglomerates comprising both kinds of cells, suggesting their mutual interaction, induced strain and subsequent structural alterations of receptor proteins. from among many different types of supramolecular structures, rode - like or ribbon - like molecular assemblies reveal an unusual capacity for penetration and binding to protein molecules. the nature of this interaction differs from that of typical ligands as the structures in question bind to areas which are not biologically predisposed to ligation. this mechanism can be explained on the basis of numerical analyses of the congo red molecule structure (the dye chosen as the model), supported by experimental studies [17, 27, 28, 30, 31, 35, 36, 44 ]. having researched the problem for several years we believe we can now present some conclusions regarding this particular type of ligation. it appears to us that the unique properties of supramolecular assemblies of ribbon - like micellar structures forming nonstandard complexes with proteins and penetrating into their interior outside of the binding site are the result of : relatively large area of interaction (contact surface), ensuring sufficient binding strength for complexation;exposure of hydrophobicity along the ligand, favoring adhesion to polypeptide chains;plasticity of the supramolecular ligand which results from non - covalent stabilization and facilitating structural fitting. relatively large area of interaction (contact surface), ensuring sufficient binding strength for complexation ; exposure of hydrophobicity along the ligand, favoring adhesion to polypeptide chains ; plasticity of the supramolecular ligand which results from non - covalent stabilization and facilitating structural fitting. to satisfy the binding conditions, the supramolecular ligand must exhibit : a sufficiently strong self - assembling tendencies to preserve the integrity of the ligand during complexation with the protein molecule;b sufficient spacing of charges in the ligand molecule, which is necessary to avoid conflicting interactions upon penetration into the protein interior. sufficiently strong self - assembling tendencies to preserve the integrity of the ligand during complexation with the protein molecule ; sufficient spacing of charges in the ligand molecule, which is necessary to avoid conflicting interactions upon penetration into the protein interior. the binding requirements related to the protein structure can be summarized as follows : a necessary prerequisite for binding supramolecular ligands is a local structural instability, which may be caused by the presence of unfolding conditions or by structural alteration associated with the protein s function.-structures seem preferable as a binding target in proteins. a necessary prerequisite for binding supramolecular ligands is a local structural instability, which may be caused by the presence of unfolding conditions or by structural alteration associated with the protein s function. understanding of the supramolecular ligand binding mechanism creates interesting application opportunities in biological studies and medicine. | congo red dye as well as other eagerly self - assembling organic molecules which form rod - like or ribbon - like supramolecular structures in water solutions, appears to represent a new class of protein ligands with possible wide - ranging medical applications. such molecules associate with proteins as integral clusters and preferentially penetrate into areas of low molecular stability. abnormal, partly unfolded proteins are the main binding target for such ligands, while well packed molecules are generally inaccessible. of particular interest is the observation that local susceptibility for binding supramolecular ligands may be promoted in some proteins as a consequence of function - derived structural changes, and that such complexation may alter the activity profile of target proteins. examples are presented in this paper. |
type 1 diabetes (t1d) is an autoimmune disease in which the immune system is activated against the insulin producing -cells present in the pancreatic islets. the elimination of these cells impairs the mechanisms that control the glucose blood level and, up to now, the possible and most efficacious treatment for t1d is based on insulin administration and pancreas or pancreatic islet transplantation [2, 3 ]. while exercise represents a cornerstone in the treatment and prevention of type 2 diabetes mellitus, only recently its effects on glycemic profile and autoimmunity in t1d have been debated by several studies, due to the controversial data reported regarding the benefits of supervised exercise training on metabolic control in people with t1d [4, 5 ]. in fact, managing blood glucose in t1d while exercising is complex and involves multiple factors such as type of insulin used, time between food intake and sport activity, duration, and intensity of physical effort, known to deter people from enjoying the benefits of sport at both recreational and competitive levels [6, 7 ]. some speculative hypotheses instead point at the positive immunomodulatory effect of exercise with respect to both t1d and inflammation [8, 9 ]. showed how metabolic dysregulation precedes the autoimmune attack against -cells and suggested lifestyles modification as front - line prevention strategy. during exercise, skeletal muscle releases myokines (il-6) and the subsequent production of il-1 receptor antagonist (il-1ra) by monocytes and macrophages may frame a potent anti - inflammatory window. there are several studies investigating the effects of exercise in inbred rodents with naturally occurring type 2 diabetes or streptozotocin - induced diabetes [12, 13 ] ; however, few studies have been conducted in a nod mouse model which spontaneously develops t1d [1417 ] and resembles the disease progression in humans. by using the nod model, we tested the effect of moderate - intensity exercise in inducing immunological changes that would result in the delay of t1d progression. in particular, we analyzed the differences in cytokine profiles between trained and untrained animals and correlated these modulations with t1d appearance. eight - week - old female nod mice (jackson laboratory) were first acclimated to a six - lane treadmill (columbus, oh) by running for 10 min at 10 m / min followed by 2 min at 20 m / min (0 slope), in three running sessions over a week before exercise testing. animals were then trained on a treadmill following a chronic exercise regime (30 min / day, 5 days / week at the speed of 12 m / min) for 12 weeks. age - matched, control animals were left untrained. prior to and upon completion of the training period, mice underwent muscular performance evaluation determined by a submaximal incremental test (peak oxygen uptake (vo2) challenge), as previously described. to determine vo2 peak, mice were placed in a treadmill for 5 min at a 0 incline and 0 m / min. the nod mice were then challenged with 1.5 min intervals of increasing speed at a 15 incline. nonfasting glycemic levels of experimental mice were monitored 2 - 3 times a week using onetouchultra2 glucometers (lifescan). animals were considered diabetic and euthanized upon 3 consecutive blood glucose readings above 300 mg / dl. animal studies were performed in compliance with iacuc and the us department of health and human services guide for the care and use of laboratory animals. cytokine profiles were evaluated on the serum of the nod mice before and after 8 weeks of exercise training and upon completion of the 12-week endurance training program. the serum content of g - csf, gm - csf, ifn-, il-1, il-2, il-4, il-6, il-10, il-2p40, il-13, mcp-1, mip-1, mip-2, vegf, and tnf- was analyzed simultaneously using the cytokine bead assay (millipore) and data were collected using the luminex. pancreas of 20-week - old nod mice was collected and fixed in buffered formalin 10% overnight at 4c and subsequently in optimal cutting temperature (oct, tissue - tek) compound and frozen in dry ice. 5 m sections were obtained from the cryopreserved blocks, permeabilized with 0.3% pbs triton x-100, then incubated in universal blocker reagent (biogenex san raman ca) for 30 min, and washed in optimax wash buffer (biogenex). sections were then incubated overnight at 4c with guinea pig anti - insulin (biogenex ready to use polyclonal antibodies) and mouse antiglucagon (monoclonal clone k79bb10 diluted at 1 : 1000, sigma) primary antibodies and for 1 hr at room temperature with goat anti - guinea pig alexa fluor 488 (invitrogen) and goat anti - mouse alexa fluor 568 (invitrogen) secondary antibodies diluted in wash buffer at 1 : 300. as negative control samples, slides were incubated with the preimmune serum from animal of the same species instead of the primary antibody. dapi (invitrogen) was used for nuclear staining and slides were mounted with prolong antifade (invitrogen). pictures were acquired with a zeiss axiovert 200 m confocal microscope, accessorized with a hamamatsu camera, available at the imaging core facility of the diabetes research institute, university of miami. slides analyzed at the university of milan were acquired with nikon eclipse 50i microscopy and images were captured using nis - elements d 4.00 software (nikon instruments europe bv, netherlands). data were displayed and analyzed using adobe photoshop cs4. quantification of cellular composition (i.e., -cells, -cells, and nuclei) was performed by using the cells count macrowritten for image j (http://imagej.nih.gov/ij/). glucose profiles were shown as median and quartiles given the nonparametric distribution of the data, except where differently expressed. muscular performance data were presented as the mean sem and t - tests were used to calculate statistical significancy. cytokines were analyzed by a two - way anova with repeated measures followed by bonferroni 's post hoc test. since the distributions of g - csf, gm - csf, and il-10 showed deviations from normality due to the presence of outliers, these cytokines were subjected to logarithmic transformation prior to the execution of anova. deterioration of glycemic profile was appreciable around the 10th week of training in all nod mice under investigation, with slight lower glycemia in the exercising mice with respect to the untrained ones (figure 1(a)), although the impact of diabetes was remarkable already at week 6 in the trained mice, as indicated by the interquartiles and the diabetic incidence. a similar pattern was detectable among the diabetes - free mice (figure 1(b)), with a better glycemic profile in the nod mice on training compared to the controls. in the second part of the experiment, from weeks 6 to 12 of training, among the diabetes - free mice, the average glycemic values resulted in being significantly lower in the trained animals with respect to the controls (110 1.4 versus 116 2 mg / dl, means and sem, p < 0.05) (figure 2). an exercise - induced weight loss was registered in the trained mice after 6 weeks of training as compared to the sedentary mice (figure 4(a), p < 0.01). from week 7, the exercising mice continued to weigh less than their age - matched controls, and they remained leaner until the end of the experiment (figure 4(b), p < 0.01). at training week 7, 4 out of 20 exercising mice became diabetic and that reflected the diabetic incidence percentage, although not significantly, between exercising (10%) and control mice (3%) (figure 3(a)). in detail, 2 out of 14 mice on training were diabetic, whereas, among the controls, 5 out of 18 mice were diabetic. on the other hand, a substantial number of animals remained diabetes - free at the end of the experiment (12 trained mice versus 13 controls) (figure 2). the survival rate declined progressively in both groups, with no statistical difference between the exercising mice (70%) and the controls (88%), upon completion of the 12-week training program. this final rate was indirectly linked to the early diabetic incidence occurring in the trained mice, starting from week 7. in fact, those 4 mice that became diabetic after 7 weeks of training died concurrently during week 10. overall, 6 mice of the exercising group died because of diabetes ; likewise 2 control mice faced the same fate. a submaximal incremental running test was performed at baseline and upon completion of the 12-week chronic training program to determine the acute exercise capacity of the nod mice, putatively conditioned by the endurance training per se and, above all, by the diabetes progression. to evaluate this, we differentiated the results coming from all nod mice (trained versus controls, regardless of the diabetes diagnosis ; figures 5(a) and 5(c)) and those arisen from the comparison on all diabetes - free nod mice (trained versus controls, without diabetes ; figures 5(b) and 5(d)). at the end of 12 weeks of training, maximal running speed assessed during the submaximal test was found to be significantly decreased in all nod mice with respect to their pretraining values (p < 0.05), whereas no difference was found between trained and control animals when comparing their posttraining values (figure 5(a)). when diabetes - free mice were compared, trained mice worsened their maximal running speed at 12 weeks with respect to their baseline values (figure 5(b), p < 0.01). similarly, a significant reduction in the distance covered during the submaximal performance test was also found in the nod - exercising mice at week 12 with respect to their pretraining values (figure 5(c), p < 0.01) and the age - matched controls also (figure 5(c), p < 0.05). however, even the control mice deteriorated their performance after 12 weeks as compared to the maximal distance covered at baseline (figure 5(c), p < 0.05). a significant decrease in the maximal distance was also found in the diabetes - free trained mice at week 12 as compared to week 0 (figure 5(d), p < 0.01). typical islet from a diabetic exercising animal after 6 weeks of training is shown (figure 6(a)) in the pancreatic section triple stained for insulin, glucagon, and nuclei. immunostaining of pancreatic sections indicated the presence of larger infiltrates in control mice, along with a greater amount of -cells in the nod - exercising mice at the end of the 12-week training program (figures 6(b), 6(c), and 6(f) ; p = 0.052). pancreatic infiltrates were ubiquitously detected in mice on training and controls, whereas no -cells were found at the end of the study in all diabetic mice. serum pro- and anti - inflammatory cytokines measured at the baseline, after 8 weeks of training and at the conclusion of the 12-week training program, fluctuated with no statistical significance throughout the timeline in all nod mice (figure 7). only some cytokines seemed to be aligned to an exercise - promoted anti - inflammatory pattern : il-6 and mip-1 resulted in being lower, even though not significantly, at the termination of the training program in the trained animals compared to the sedentary controls, and with respect to their pretraining values. with this in vivo approach, we wanted to evaluate how physical activity as endurance training can contribute in controlling t1d progression and analyzing the role played by exercise on the immune system. preliminary studies have shown the importance and impact of physical exercise on controlling autoimmune diseases, by modulating different immune parameters and components [11, 1823 ]. most studies on the effects of exercise on immunity have shown that habitual, moderate - intensity training augments immune responses by increasing the expression of proinflammatory cytokines, including il-2, il-1, and tnf-, while exhaustive exercise tends to be immunosuppressive [2426 ]. on the basis of our data, nod mice appeared to be interesting for the studying of insulin - dependent diabetes although they remained a questionable model for running exercise studies with high significance for the autoimmunity. in fact, in nod mice, diabetogenesis is under complex polygenic control and the penetrance of these polygenes is greatly conditioned by wide disparate conditions (microbial and physical environment, diet, etc.) : some environmental pathogens may even offer more protection to nod mice against the t1d onset, by the simple activation of their immune system. in this perspective, our hypothesis to exploit the positive stimulation of physical exercise was tricky to be challenged. on a side, exercise, under adequate mild doses, would have counteracted the activation of diabetogenic innate immune responses or, at least, it would have exerted those preventive, protective effects in t1d by decreasing oxidative stress and preservation of -cell integrity. however, there is incomplete knowledge on how exercise acts in t1d, and therefore physical activity could be as stressogenic as many other detrimental conditions for which nod mice are highly susceptible to develop diabetes. in our study, the design failed to demonstrate a delay in the onset of t1d thanks to exercise ; on the contrary, an early diabetic incidence occurred in the exercising group (n = 4) as early as week 7 of the training program, although not significantly. cumulative diabetic incidence was though consistent with data of the literature, confirming expected percentages of t1d penetrance in this model. certainly, diabetes progression affected per se the exercise capacity of the mice irrespective of the endurance training : physical exercise represented an additional stress to the nod - exercising mice, even at moderate intensity. however, those nod mice, able to tolerate the exercise stress, showed at the same time a slightly ameliorated inflammatory metabolic profile, one that may be contrasting the diabetes progression and the inflammation attack toward the pancreatic islets. overall, exercise neither was able to modulate and control the immune attack toward autologous -cells even if initiated prior to the t1d onset, nor had ability to rescue -cells once lost, in accordance with previous studies [12, 13, 29 ]. however, after 10 weeks of training, diabetic and nondiabetic trained mice showed better glucose profiles than the control mice (figures 1 and 2). today the mechanisms by which exercise regulates glycemia in a t1d context are still unclear. previously, very few studies documented the possibility to positively control and lower blood glucose by means of exercise in t1d animal models. some of them were designed on rat models, using streptozotocin - induced diabetes, which rules out autoimmunity, a leading feature resembling human t1d [12, 13, 20, 2931 ]. nod - scid mice were also studied because they do not develop t1d, since they do not have a functional immune system. other studies relied on exogenous insulin treatments to reduce blood glucose, which provides disadvantages when interpreting data, because high glucose is toxic to the islet cells, and glucotoxicity represents a biasing factor [32, 33 ]. in the present study, nod mice were not treated with insulin. exercise had glucose - lowering effects, reaching statistical significance only in the late window of the observed training period (figures 1(a) and 2). the significant reduction of blood glucose was paralleled also in diabetes - free nod mice, particularly when referring to the mean glycemic values (figures 1(b) and 2). this could suggest a preserved ability by which exercise downregulates blood glucose, in nod mice, when the immune attack has not led yet to frank diabetes, that is, by insulin - stimulated glucose uptake in the skeletal muscle. over the 12-week study, both groups exihbited an expected increase in body weight (+ 1525%) ; however, from week 6, exercising mice began to display significant reductions in body weight compared to controls (15%) which remained significantly lower (p < 0.01) at the termination of the study, despite only a 1.4 g difference (figure 4). unfortunately, we were not able to ascertain whether this discrepancy was due to a simple exercise - induced leaner mass rather than a more cachectic state : no visible signs or discomfort or stress was though detected, except for polyuria in the diabetic mice. in addition, the expression profiles of serum inflammatory cytokines were not mirrored in the infiltrating immune cells, which are important mediators for -cell demise in the nod model. once precised, some of the cytokines measured in the blood at the termination of the study fluctuated in an anti - inflammatory fashion (il-6, mip-1) in the trained mice compared to controls, although without reaching statistical significance. therefore, these indications must be collected thoughtfully, especially considering the lack of statistical confirmation. besides, other cytokines (il-2, il-4, and il-10) seemed to act in a proinflammatory way at the end of the study in the exercised mice. however, the important anti - inflammatory cytokine il-10 was found higher in the serum of the trained mice over the remainder of the study (until week 10) compared to controls (figure 7). as to the inflammatory milieu in nod mouse islets, the morphological examination indicated a tendency for a decreased estimate of infiltrates in the trained mice along with a greater amount of -cell areas with respect to the diabetic controls (figure 6(f), p = 0.052). plesner. reported the nonbeta islet endocrine cell remodeling in diabetic nod mice : that study suggested that infiltrating immune cells may restrict alpha - cell expansion in nod mouse islet in the diabetic state. here, a greater alpha - cells - infiltrates ratio was also found in the diabetic states of trained mice sacrificed at week 7 of our study (figures 6(d) and 6(e)). whether the alpha - cell mass may be dependent on the stage of disease remains to be ascertained. moreover, it would be interesting to understand when (and possibly to which extent) exercise may represent a strategy to maintain normal islet architecture in diabetes. a further in - depth analysis is obviously required to address this ; however, a putative capability of the exercising mice to oppose the diabetic deterioration that progressively sacrifices -cells and damage the pancreatic islet remains intriguing. still, the mechanisms by which exercise might be responsible for these effects need to be elucidated. an alternate explanation would be that the selected intensity / amount of exercise for this running study was revealed to be too stressful for this nod mouse model and therefore inappropriate to test the working hypothesis and meet the soft and hard endpoints [38, 39 ]. our explorative studies set the base to further evaluate the implementation of likely exercise protocols along with the dosage of several autoimmunity markers and cytokine and chemokine profiles. in nod mice moderate - intensity exercise seemed to exert glucose - lowering effects only in the late states of diabetes. further studies are needed to clarify the utility of the nod mouse model to mimic and investigate the exercise effects in t1d, immunomodulation, and inflammation. specifically, dose - response studies in which exercise will be administered to nod mice at various levels of intensity will be necessary to determine the optimal regimen of physical exercise having clear - cut preventive effects on the development of t1d. a better understanding of the impact of exercise on immune function will be of assistance in designing improved treatments for patients with autoimmune diabetes in the clinical arena. | the nonobese diabetic (nod) mouse represents a well - established experimental model analogous to human type 1 diabetes mellitus (t1d) as it is characterized by progressive autoimmune destruction of pancreatic -cells. experiments were designed to investigate the impact of moderate - intensity training on t1d immunomodulation and inflammation. under a chronic exercise regime, nod mice were trained on a treadmill for 12 weeks (12 m / min for 30 min, 5 d / wk) while age - matched, control animals were left untrained. prior to and upon completion of the training period, fed plasma glucose and immunological soluble factors were monitored. both groups showed deteriorated glycemic profiles throughout the study although trained mice tended to be more compensated than controls after 10 weeks of training. an exercise - induced weight loss was detected in the trained mice with respect to the controls from week 6. after 12 weeks, il-6 and mip-1 were decreased in the trained animals compared to their baseline values and versus controls, although not significantly. morphometric analysis of pancreata revealed the presence of larger infiltrates along with decreased -cells areas in the control mice compared to trained mice. exercise may exert positive immunomodulation of systemic functions with respect to both t1d and inflammation, but only in a stringent therapeutic window. |
elderly patients are at risk for falls, secondary fractures, hospitalizations, and death following hip fracture surgery.17 accordingly, it would be valuable to be able to predict complications and mortality after rehabilitation in the elderly with hip fractures. the norton scoring system is a well - known scale used by nurses to evaluate the risk of pressure ulcers.8 it includes five domains that concern fundamental aspects of well - being, ie, physical condition, mental condition, activity, mobility, and continence. because the comprehensive geriatric assessment is a diagnostic as well as a prognostic tool,9 one may assume that the norton scoring system would have prognostic features other than merely predicting the risk of pressure ulcers. indeed, we have previously shown that low admission norton scale scores (anss) are associated with postoperative complications and inhospital mortality in elderly patients following hip fracture surgery.10 we have also shown that a low anss is associated with prolonged rehabilitation and a poor rehabilitation outcome in elderly patients following any type of hip surgery.11 in this study, we sought to evaluate if a low anss is also associated with falls, fractures, hospitalizations, and death after rehabilitation in the elderly with hip fractures. this was a historical prospective study conducted in the department of geriatrics at sourasky medical center, a tertiary medical facility in tel - aviv, israel. the electronic medical charts of consecutive elderly patients (65 years) admitted for rehabilitation following hip fracture surgery during 2009 were reviewed. data concerning demographics, comorbidities, routine admission laboratory tests, anss, and mini - mental state examination (mmse) scores, were retrieved from the charts. patients were followed up with a phone call made by one of the researchers (eh) between january and february 2012. the incidence of falls, number of falls, number of recent falls (< 6 months), incidence of fractures, number of hospitalizations, and deaths during the follow - up period were compared between patients with low and high anss. except for death rates, which were extracted from the israeli general register office database, all other follow - up measurements were self - reported. in order to overcome forgetfulness, patients, their spouses, and/or their caregivers a fall was defined as an unplanned descent to the floor with or without injury. also excluded were non - weight - bearing patients (n = 23), those with severe systemic complications during rehabilitation (n = 19), those with concurrent fractures other than hip fractures (n = 12), those who did not become ambulatory during rehabilitation (n = 7), those who chose to withdraw from rehabilitation earlier than scheduled (n = 2), and those who died during rehabilitation (n = 1). each of the five domains of the norton scoring system was assessed on a scale between 1 and 4 points (see appendix). a final score 14 points was considered low and represented high risk for pressure ulcers. a final score 15 points was considered high and represented low risk for pressure ulcers.8 patients with low anss were encouraged by their nurses to change position frequently in order to prevent pressure ulcers. the sensitivity and specificity of the norton scoring system in predicting pressure ulcers was 63% and 70%, respectively.12 continuous variables were expressed as the mean standard deviation, median, range, and interquartile range. the student s t - test was used to compare the mean values of continuous variables with parametric distributions. the mann - whitney test was used to compare the mean values of continuous variables with nonparametric distributions. nominal regression analysis was used to identify which variables were independently associated with falls and death. spss statistical software version 17.0 (spss inc, chicago, il) was used for all statistical analyses. this was a historical prospective study conducted in the department of geriatrics at sourasky medical center, a tertiary medical facility in tel - aviv, israel. the electronic medical charts of consecutive elderly patients (65 years) admitted for rehabilitation following hip fracture surgery during 2009 were reviewed. data concerning demographics, comorbidities, routine admission laboratory tests, anss, and mini - mental state examination (mmse) scores, were retrieved from the charts. patients were followed up with a phone call made by one of the researchers (eh) between january and february 2012. the incidence of falls, number of falls, number of recent falls (< 6 months), incidence of fractures, number of hospitalizations, and deaths during the follow - up period were compared between patients with low and high anss. except for death rates, which were extracted from the israeli general register office database, all other follow - up measurements were self - reported. in order to overcome forgetfulness, patients, their spouses, and/or their caregivers a fall was defined as an unplanned descent to the floor with or without injury. excluded were patients in whom anss was not documented (n = 3). also excluded were non - weight - bearing patients (n = 23), those with severe systemic complications during rehabilitation (n = 19), those with concurrent fractures other than hip fractures (n = 12), those who did not become ambulatory during rehabilitation (n = 7), those who chose to withdraw from rehabilitation earlier than scheduled (n = 2), and those who died during rehabilitation (n = 1). each of the five domains of the norton scoring system was assessed on a scale between 1 and 4 points (see appendix). a final score 14 points was considered low and represented high risk for pressure ulcers. a final score 15 points was considered high and represented low risk for pressure ulcers.8 patients with low anss were encouraged by their nurses to change position frequently in order to prevent pressure ulcers. the sensitivity and specificity of the norton scoring system in predicting pressure ulcers was 63% and 70%, respectively.12 continuous variables were expressed as the mean standard deviation, median, range, and interquartile range. the student s t - test was used to compare the mean values of continuous variables with parametric distributions. the mann - whitney test was used to compare the mean values of continuous variables with nonparametric distributions. nominal regression analysis was used to identify which variables were independently associated with falls and death. spss statistical software version 17.0 (spss inc, chicago, il) was used for all statistical analyses. the final cohort included 174 patients, of which 133 (76.4%) were women, with the mean age being 83.6 6.2 (median 83 years, range 65101, interquartile range 8087) years. the three most common comorbidities were hypertension, diabetes mellitus, and ischemic heart disease (table 1). most patients (n = 109, 62.6%) underwent open reduction and internal fixation hip surgery, while 63 (36.2%) had hemiarthroplasty and two (1.1%) patients had total hip replacement. the patients were followed for 29.8 3.7 (median 30, range 2336, interquartile range 2633) months. there were no statistical differences between the overall cohort and the remaining 127 patients in terms of clinical characteristics. of the surviving patients, 44 (34.6%) fell at least once, and 15 (11.8%) had secondary fractures (table 1). the mean anss was 14.7 1.8 (median 15, range 1020, interquartile range 1316), with 81 (46.6%) patients having a low anss. relative to patients with a high anss, those with a low anss were older, had lower albumin levels and mmse scores, had a higher likelihood of at least one fall, and fell more often (table 2). anss correlated negatively with the number of falls, while controlling for age, albumin levels, and mmse scores (figure 1). there were no differences between patients with low and high anss in terms of incidence of fractures, incidence of recent fractures, number of hospitalizations, and death rate. regression analysis showed that anss (as a parametric variable), low anss (as a nonparametric variable), and pressure ulcers were independently associated with falls, regardless of age, gender, comorbidities, albumin levels, and mmse scores (table 3). anss and low anss were not independently associated with fractures, hospitalizations, or mortality risk (data not shown). the sensitivity and specificity of a low anss in predicting falls was 61.4% and 67.5%, respectively. it is of great clinical importance to be able to predict falls, secondary fractures, hospitalizations, and death after rehabilitation in the elderly with hip fractures. overall, 32%56% of patients report one or more falls following hospital discharge for hip fracture surgery,13 3%14% sustain a secondary fracture,47 and 15% die within a year.7 the incidence of falls, the incidence of fractures, and death rates in our study have all been consistent with these observations. hence, our cohort represents the elderly with hip fractures well. in this study, we have shown for the first time that the norton scoring system may be used for predicting falls long after rehabilitation in the elderly with hip fractures. pressure ulcers are a major problem associated with morbidity and mortality in elderly immobile patients. risk assessment scales, such as the norton scoring system, have been available for more than 50 years for assessing the risk of pressure ulcers, but their usefulness in preventing these ulcers remains uncertain.13,14 the current study adds to the evidence showing that it is too early to abandon the norton scoring system, given that it can be used for purposes other than predicting the risk of pressure ulcers, including predicting postoperative complications and inhospital mortality in elderly patients following hip fracture surgery,10 predicting postoperative complications in elderly patients following spine fracture surgery,15 and predicting the duration and outcome of rehabilitation in elderly patients following any type of hip surgery,11 stroke,16 or hospital - associated deconditioning.17 age, congestive heart failure, poor quality of life, poor nutritional status,3 fear of falling,18 use of a gait device, and slow walking during rehabilitation2 are all associated with falls in the elderly following hip fracture surgery. except for age, most of these risk factors are difficult to measure. on the other hand, norton scale scores are simple to measure and, accordingly, can be used as a geriatric screening assessment tool by nurses and physicians who are not familiar with traditional geriatric and rehabilitation scales. there are few well - studied scales used for assessing the risk of falls in the elderly, including the falls risk assessment tool,19 berg balance scale,20 and timed up and go test.21 relative to these scales, the norton scoring system is not time - consuming. most importantly, it is already being used successfully throughout the world right now. in a recently published study, we have shown that the norton scoring system may be used for predicting mortality in the elderly long after rehabilitation following any type of hip surgery, stroke, and hospital - associated deconditioning.22 in the current study, anss and low anss were not associated with death long after rehabilitation in the elderly with hip fractures. this discrepancy may be explained in two ways, ie, the current study included elderly patients with a history of hip fractures, while the other study included elderly patients with a history of hip fractures as well as elderly patients with a history of elective total hip replacement, stroke, and hospital - associated deconditioning. moreover, the follow - up period in the current study was more than a year longer than that in the previous study. there is a place to study the predictive value of the norton scoring system in terms of mortality long after rehabilitation separately for elderly patients following total hip replacement, stroke, and hospital - associated deconditioning. one may claim that it should be no surprise that a low anss is independently associated with falls in the elderly with hip fractures, given that patients who develop pressure ulcers are more likely to fall, being partially immobile in the first place. however, regression analysis showed that anss as well as a low anss are independently associated with falls in the elderly with hip fractures, regardless of the appearance of pressure ulcers. another limitation is the sample size being too small for making population - based conclusions regarding lower anss cutoffs. although an anss of 14 represents a high risk for pressure ulcer,8 it is possible that a lower anss is more sensitive and specific in predicting falls. accordingly, it would be valuable to study the association between a lower anss and falls in the future in large - scale populations. in the meantime, in order to overcome this limitation, the regression analysis in table 3 has included low anss as a nonparametric variable as well as anss as a parametric variable. future studies should include interventional measures used to prevent falls and fractures in elderly patients with a low anss, ie, bisphosphonates and vitamin d supplementation.23 we propose that in addition to predicting pressure ulcer risk, the norton scoring system should be added to the tools used for predicting falls in the elderly with hip fractures. however, there is still a need to study these findings in large cohorts in a prospective manner. | backgroundin this study, we investigated if low admission norton scale scores (anss) are associated with falls, fractures, hospitalizations, and death, after rehabilitation in the elderly with hip fractures.methodsthis prospective historical study followed consecutive elderly patients (65 years) who were admitted for rehabilitation following hip fracture surgery during 2009 and followed up in january or february 2012. the incidence of falls, number of falls, incidence of fractures, number of hospitalizations, and death rates were compared between patients with low (14) and high (15) anss.resultsthe final cohort included 174 patients of mean age 83.6 6.2 years, with 133 (76.4%) being women. fifty - seven (27.0%) patients died during follow - up. of the remaining 127 patients, 44 (34.6%) fell at least once and 15 (11.8%) suffered fractures. overall, 81 (46.6%) patients had a low anss. relative to patients with a high anss, they had a higher incidence of falls (odds ratio 3.3, 95% confidence interval 1.57.1 ; p = 0.002) and fell more times (1.2 1.8 versus 0.6 1.7 ; p = 0.002). regression analysis showed that anss (as a parametric variable) as well as a low anss (as a nonparametric variable) were independently associated with falls (p = 0.002 and p = 0.009, respectively). there were no differences between patients with low and high anss in terms of incidence of fractures, number of hospitalizations, and death rates.conclusionthe norton scoring system may be used for predicting falls long after rehabilitation in the elderly with hip fractures. |
diabetes mellitus (dm) is a metabolic disorder affecting various organ systems including skin. chronic hyperglycemia resulting in production of advanced glycosylated end products (age) is responsible for most of the complications of diabetes. as most of the dm - specific cutaneous disorders are related to the duration of diabetes and chronic hyperglycemia, a study of cutaneous disorders in patients attending diabetic clinic was undertaken to know the impact of control of diabetes on the pattern of these disorders. a cross - sectional descriptive study of 500 consecutive patients attending diabetic clinic was conducted in a tertiary care hospital. patients who had not registered in diabetic clinic, either attending the dermatology clinic directly or referred from wards, were excluded from the study to ensure the uniformity in diabetes care received in diabetic clinic. a detailed history regarding age, gender, duration of dm, type of diabetes, and treatment taken for diabetes was taken. complete hemogram, urine analysis, fasting and postprandial plasma sugar tests were done in all the patients. serum creatinine, serum lipid profile, and fundus examination were also done to detect diabetic complications. the former was further divided into four categories : dermatoses with known pathogenesis, dermatoses without known pathogenesis, dermatoses that occur with increased frequency, and dermatoses due to diabetic treatment. the first two categories were correlated with gender, fasting plasma glucose (fpg), duration of diabetes, and complications of diabetes like retinopathy, nephropathy, and peripheral neuropathy. test and chi - square test with 5% confidence interval (p value 0.05). males and females constituted 57.2% (286/500) and 42.8% (214/500) of cases with mean age of 58.211.96 and 53.310.78 years, respectively. the mean duration of dm was 5.55.8 years. in 82% of patients, the duration of diabetes was 0.05) between the patients with or without dm - specific cutaneous disorders was noticed in the present study with particular reference to age and gender distribution, duration of dm, and fpg. this is mainly because the majority of specific skin disorders in the present study were acanthosis nigricans, acrochordon, and uncomplicated infections which are not related to chronic hyperglycemia (discussed in detail below). there was no statistically significant difference between the occurrence of peripheral neuritis and various dm - specific cutaneous disorders. low prevalence of systemic complications in the present study may be due to shorter duration of dm. acanthosis nigricans and acrochordon, manifestations of insulin resistance which may be present before the expression of dm, were the predominant dermatoses with known pathogenesis. increased levels of insulin act on insulin like growth factor (igf) receptors, resulting in development of acanthosis nigricans. acrochordon has been regarded as a sign of impaired glucose tolerance, dm, and increased cardiovascular (atherogenic lipid profile) risk. the association between dm and increased susceptibility to infection in general is not supported by strong evidence. however, streptococcal, pseudomonas, and candidal infections are known to occur with increased frequency in dm. there are no conclusive evidences that diabetic patients are susceptible to dermatophytoses or staphylococcal skin infections. however, the patients especially with poorly controlled diabetes are at increased risk of severe and recurrent infections, and complications. as in nondiabetics, rate of exposure to the organisms seems to determine the occurrence of infections in diabetic patients. the predominance of infection in males in the present study may be due to increased likelihood of exposure to the infectious organisms and humid climatic and working conditions. the absence of diabetic thick skin and severe infections, and the lower incidence of specific dermatoses with or without known pathogenesis in the present study when compared to other studies[1012 ] [table 4 ] is mainly due to difference in the diabetic population (type 1 vs. type 2), well - controlled diabetes, and shorter duration of dm in the majority of patients, and also the source from where patients were drawn, i.e., diabetic clinic. in spite of about half of the patients having peripheral neuritis, only one patient had diabetic foot. comparison of specific cutaneous disorders with or without known pathogenesis, with other studies certain dermatoses with underlying autoimmune pathogenesis like vitiligo are known to occur in dm as a part of polyglandular autoimmune syndrome. however, such an association was not noticed in several other studies, including the present one. an association between psoriasis and increased cardiovascular risk and metabolic syndrome has been reported. while treating psoriasis patients, screening for metabolic syndrome and cardiovascular risk factors insulin reactions may be local (erythema or urticarial pruritic nodules) or systemic (generalized urticaria, rarely anaphylaxis). the reactions are due to impurities in insulin preparations such as bovine or porcine proteins, additional peptides, preservatives, and additives. in the present study, similarly, lipodystrophy can be prevented by highly purified and recombinant insulin and injection site rotation. lower prevalence of insulin reactions in the present study may be due to the use of human insulin. the occurrence of nonspecific cutaneous disorders also has pathogenetic, prognostic, and therapeutic importance in diabetic patients. autonomic neuropathy or age of stratum corneum proteins has been attributed to the pathogenesis of ichthyosis, xerosis, and pruritus. the loss of cutaneous barrier in nonspecific disorders predisposes already susceptible diabetic patients to chronic and recurrent infections. while treating the dermatoses with underlying dm, three issues need to be kept in mind. usually, a prolonged systemic therapy is required because of chronicity and severity of dermatoses. patients with onychomycosis should be treated aggressively with oral antifungals to avoid devastating secondary bacterial infections. the second point is the interactions between the drugs used to treat dermatoses and oral hypoglycemic agents. therefore, blood glucose levels should be monitored carefully, and accordingly, the dosage schedules of antidiabetic treatment need to be adjusted. accelerated aging of skin has been reported in patients with both types of dm, especially type 1. however, in the present study, such skin lesions (seborrheic keratosis, senile comedones, senile purpura, solar elastosis, idiopathic guttate hypomelanosis) are mainly due to chronologic and photo aging. the main goals of diabetic care are good glycemic control, physical exercise, medical nutritional therapy, diabetes self - management education, foot care, and early detection of nephropathy, retinopathy, and metabolic alterations. a good glycemic control definitely reduces the incidence and severity of cutaneous disorders with or without known pathogenesis, as observed in the present study. however, several nonspecific cutaneous disorders that occur in diabetic patients can increase the likelihood of exposure to infectious organisms and contact allergens, resulting in chronic and recurrent infections and eczemas, respectively. long - term effects of dm on the microcirculation and on dermal collagen eventually result in skin disorders in almost all the diabetic patients. thus, dermatologists play an important role in reducing the dermatologic morbidity, improvement of quality of life, and management strategy of diabetic patients. it is necessary to have a dermatologist in the diabetic clinic along with other specialists for early detection of potentially grave or predisposing conditions and to provide a comprehensive diabetic care to the patients. | background : the metabolic complications and pathologic changes that occur in diabetes mellitus (dm) influence the occurrence of various dermatoses.aim:to study the impact of control of diabetes on the pattern of cutaneous disorders.materials and methods : a cross - sectional descriptive study of patients attending diabetic clinic in a tertiary care hospital. a total of 500 consecutive patients were studied. detailed history, clinical examination and relevant investigations were done to diagnose diabetic complications and cutaneous disorders. dermatoses with or without known pathogenesis were correlated with age, gender, fasting plasma glucose (fpg), duration of diabetes, and complications of dm. statistical analysis was carried out using student t test and chi - square test with 5% confidence interval (p value 0.05).results : majority of patients had well - controlled (fpg0.05) between the patients with or without dm specific cutaneous disorders was noticed with reference to age and gender distribution, duration of dm and fpg. signs of insulin resistance, acrochordon (26.2%), and acanthosis nigricans (5%) were common, followed by fungal (13.8%) and bacterial (6.8%) infections. eruptive xanthoma (0.6%), diabetic foot (0.2%), diabetic bulla (0.4%), diabetic dermopathy (0.2%), generalized granuloma annulare (0.2%), and insulin reactions (6.2%) and lipodystrophy (14%) were also seen.conclusion:well-controlled diabetes decreases the prevalence of dm - specific cutaneous disorders associated with chronic hyperglycemia. it is necessary to have a dermatologist in the diabetic clinic for early detection of potentially grave or predisposing conditions. |
one of the most attractive subjects in tissue engineering is the development of a scaffold, a three - dimensional porous solid structure that plays a key role in assisting tissue regeneration. ideally, a scaffold must be porous, bioactive, and biodegradable and possess adequate mechanical properties suited to the biological site. sufficient porosity is needed to accommodate cell proliferation and differentiation, which will eventually enhance tissue formation [2, 3 ]. it is also desirable for a scaffold to have high interconnectivities between pores for uniform cell seeding and distribution, and for the nutrients and metabolites exchange at the cell / scaffold construct [46 ]. a bioactive scaffold promotes cell - biomaterial interactions, cell proliferation, adhesion growth, migration, and differentiation. it also promotes extracellular matrix (ecm) deposition and permits transportation for nutrient and gases and waste removal for cell survival. a biodegradable scaffold allows the replacement of biological tissues via physiological extracellular components without leaving toxic degradation products. its degradation rate should match the rate of new tissue regeneration in order to maintain the structural integrity and to provide a smooth transition of the load transfer from the scaffold to the tissue. finally, as a mechanical support, a scaffold must possess adequate mechanical stability to withstand both the implantation procedure and the mechanical forces that are typically experienced at the scaffold - tissue interface and does not collapse during patient 's normal activities. mechanically, the major challenge is to achieve adequate initial strength and stiffness and to maintain them during the stage of healing or neotissues generation throughout the scaffold degradation process [3, 7, 8 ]. biodegradable polymers have been widely used and accepted as the most suitable materials for scaffolds due to their degradability, biocompatibility, and ease of processability [911 ]. synthetic biodegradable polymers such as poly(lactic acid) (pla), poly(glycolic acid) (pga), and their copolymers have been used in many clinical applications [1216 ]. biodegradable polymers degrade through hydrolysis process and are gradually absorbed by the human body thus allowing the supported tissue to gradually recover its functionality [8, 17 ]. biodegradability can be imparted into polymers through molecular design with a controlled rate in concert with tissue regeneration [1821 ]. for instance, pla could be combined with pga to form poly(lactic - co - glycolic acid) (plga), which has degradation rate tailored with the tissue healing period and has been shown to support osteoblast cells attachment and growth in vitro and in vivo [2224 ]. beside copolymerization, zhang and ma have developed a highly porous biodegradable polymer / apatite composite scaffold (95% porosity) through a thermally induced phase separation technique, which resulted in significant improvement in mechanical properties compared to polymer - only scaffold. the work by ma. has shown that osteoblast survival and growth were significantly enhanced in the plla / ha composite scaffolds compared to the plain plla scaffolds. one of the major concerns regarding the use of biodegradable polymers as scaffold is their poor mechanical properties. for hard tissue applications such as bone, a scaffold that possesses adequate strength and however, porous polymeric structures are relatively weak and may not achieve sufficient level of the required strength [8, 27 ]. during degradation, polymers could suddenly lose their mass and mechanical integrity. figure 1 illustrates mass loss and strength retention as the function of degradation period for some biodegradable polymers used for scaffold. there is a recent and fast - growing interest in the use of biodegradable metals for biomedical applications. the inherent strength and ductility owned by metals are the key features that make them appealing for hard tissue applications. magnesium- (mg-) based and iron- (fe-) based metals have been used, which include mg - re (rare earth elements) [2933 ], mg - ca- [34, 35 ], pure fe [36, 37 ], fe - mn alloys [38, 39 ], and fe foam for bone replacement scaffold. mg and its alloys have been proposed for orthopaedic implants due to their supportive physical properties to human bones. it has a density closer to that of natural bones (1.82 g / cm) and has been reported to support the activation of bone cells. mg degrades in vivo through electrochemical process, which produces mg hydroxide and hydrogen gas. combining their excellent mechanical properties and degradability, mg and its alloys therefore, this paper aims to review the potentiality of porous biodegradable metals as material for hard tissue scaffold. elaborations to their rationale, structure, mechanical properties, degradation, and fabrication method are presented. mg is largely found in bone tissue, it is an essential element to human body, and its presence is beneficial to bone growth and strength [5254 ]. it is a cofactor for many enzymes and serves as stabilizer of dna and rna structures. with approximately half of the total estimated 25 g content stored in bone tissue, mg is the fourth most abundant cation in the human body [56, 57 ]. in the extracellular fluid, the level of mg ranges between 0.7 and 1.05 mmol / l, and its homeostasis is maintained by the intestine and kidneys [52, 53 ]. the incidence of hyper - mg is rare due to the efficient excretion of the element in the urine [52, 56 ]. mg can be considered as osteoconductive and bone growth stimulator material as suggested by many studies. a significant increase of bone area has been observed in mg - based implants compared to those based on pla [41, 58 ]. the corrosion layer around mg implants has been observed to contain calcium phosphates, which appeared to be in direct contact with the surrounding bone. xu. have shown new bone formation around mg - mn - zn implants in their in vivo degradation in rats. observed that 3 months postoperatively, open porous mg scaffolds implanted in rabbits were largely degraded, foreign body giant cells phagocytizing the remaining corrosion products were rarely found, and no osteolytic changes were found around the implant site. it has been shown that porous mg has better degradation behavior in terms of lower ph change, slower hydrogen evolution, and slower decrement of compressive yield strength in simulated body fluid (sbf) immersion tests. reported an increasing bone cell adhesion on mg - enriched alumina as expressed by enhanced level of a5b1 integrin receptor and collagen extracellular matrix protein. two studies using mg - enriched apatites or collagen materials showed good biocompatibility on bone cell attachment and tissue growth [63, 64 ]. mg and its alloys are very lightweight metals having density ranging from 1.74 to 2.0 g / cm, which is less than that of ti alloys (4.44.5 g / cm) and is close to that of bone (1.82.1 g / cm). they have a wide range of elongation and tensile strength from 3% to 21.8% and from 86.8 to 280 mpa, respectively. mg possess a greater fracture toughness compared to that of ceramic biomaterials, and its elastic modulus (4145 gpa) is closer to that of the bone compared to other metals. mg also has better ductility than synthetic hydroxyapatite and higher strength than existing biodegradable polymers. table 1 shows the mechanical properties of pure mg compared to other metals and to bones. the elastic modulus of pure mg is closer to that of cortical and cancellous bones, which is a superior feature for bone scaffolds. mechanical property of mg can be further improved by alloying and thermo - mechanical processes. addition of alloying elements such as aluminium, silver, indium, silicon, tin, zinc, and zirconium could improve both the strength and elongation of mg alloys. moreover, some manufacturing processes such as hot rolling, hot extruding, and equal - channel angular pressing (ecap) could also contribute to the strength of mg alloys and in some cases also improve ductility [6769 ]. in physiological saline environment, mg and its alloys degrade through the following electrochemical (corrosion) process [65, 74 ] : (1)mg(s)+2h2omg(oh)2(s)+h2(g)(2)mg(s)+2cl(aq)mgcl2(3)mg(oh)2(s)+2cl(aq)mgcl2 + 2oh(aq) in the first reaction, gray mg(oh)2 film is developed on the surface of mg as it reacts with water and hydrogen bubbles are also produced. the metal can also directly react with chloride ions to form mg chloride (2). this highly soluble mgcl2 is also formed through the reaction of mg(oh)2 with chloride ions, as depicted in (3). unfortunately, pure mg corrodes very quickly in physiological solution. this may cause mg implant to lose its mechanical integrity before the tissue is completely healed. moreover, its corrosion reaction produces hydrogen gas at a rate that is too high to be dealt with by the host tissue [41, 76, 77 ]. this issue, along with the development of stainless steels in 1920s led to the abandonment of mg in spite of some early successful implantation results [76, 78, 79 ]. as the science and technology of mg processing advances, many improvements have been reported to corrosion resistance as well as to mechanical properties of its alloys. as an example, stroganov. reported that mg alloyed with 0.44 wt% res, and other trace elements such as cd and al, had a slowed corrosion rate, where 3 mm diameter pins resided for 5 months, and those 8 mm in diameter resided for 11 months in vivo. table 2 summarizes some reports on various treatments to mg and its alloys for biomedical applications. have shown that direct osteogenesis had taken place in the porous particles of hydroxyapatite rather than the solid particles in rat ectopic model. titanium implants recovered from sheep tibiae showed enhanced cortical shear strength from porous titanium coating, while further coating with hydroxyapatite beads did not result in significant improvement. although porosity will diminish the bulk properties of a material, porous mg still has the strength and stiffness in close range to that of native bone. the effects of porosity and pore size on the mechanical properties of porous mg scaffolds have been investigated [91, 92 ] and the results indicated that yield, compressive, and flexural strength as well as young 's modulus decreased with both the pore volume, and size. pore morphology, volume and size can significantly affect the mechanical properties of porous mg materials [91, 93, 94 ]. however, this is not critical for mg scaffolds since their mechanical properties are still comparable to bone [95, 96 ]. the lower limit of bone strength is about 3 mpa, whilst the compressive strength and young 's modulus of cancellous bone are 0.280 mpa and 0.012 gpa, respectively. hence, the range of bone stiffness and strength may be achieved by mg scaffolds by modulating their porosity and pore sizes. zhuang. had evaluated in vitro degradation behavior of two different mg porosities in physiological saline solution (0.9% nacl). the specimens with 55% porosity degraded faster than those with 36% porosity due to more connecting areas and transport channels for the solution to perform faster chemical reactions. porous architecture of mg scaffold has been proven to play a significant role in cell growth and proliferation. tan. reported their work on three - dimensional open - cellular mg structure fabricated by mechanical perforation method. by using the taguchi method, they concluded an optimum pore configuration at 70% porosity, 300 m pore size, and 90 pore arrangement angle whereas these three parameters had different effects on the compressive properties. pore distribution also influences rabbit cranial bone ingrowth behavior as proved by simon.. they observed a continuous ingrowth in the random pore size scaffolds from the outer periphery ; meanwhile, for the same sized pores and solid walls scaffolds, discontinuous ingrowth with bone islands throughout the whole scaffold was observed. in the recent years, synthesis of cellular metals having open or closed pores of either periodic or random pore topology has been extensively studied. there have been various routes to modulate the periodic structure topology to satisfy a range of applications including biomedical implants. random cellular mg can be fabricated via powder or chip sintering (conventional, laser assisted, or spark plasma), low pressure casting, or removable spacer methods. these fabrication routes generate a random cell structure, wide distributions of cell size, and morphology leading to unpredictable material properties over the range of hundred microns [102, 103 ]. processes that can be used to fabricate mg with topologically ordered open cell structure include solid free - form process, space holder method, leaching method, replication, electrodeposition, and vapor deposition. figure 2 shows example of porous mg scaffolds made by two different processes. this technique encompasses rapid prototyping and casting processes, where a step - by - step fabrication process from computer - aided design (cad) models is adopted. it is currently an ideal solution for manufacturing complex 3d porous structures by accurate controlling of the structure topology. the six basic steps in the synthesis of a topologically ordered porous mg (topm) are (1) creating a 3d model with the desired architecture using cad ; (2) printing a positive polymeric template of the model by rapid prototyping (rp) process ; (3) infiltrating the polymeric template with a nacl paste ; (4) removing the template by heating followed by sintering of nacl ; (5) casting liquid mg into nacl template, that is, with pressure assistance ; (6) removing nacl template by dissolution [51, 105 ]. this technique gives several advantages including the ease of providing considerable high surface area of scaffold, which is essential for cell growth and cell proliferation : also no toxic solvent is involved in the process., one of the pioneers in this technique, achieved high replication accuracy with a resolution of 0.8 mm and errors of 5~12% for their porous mg. reported their capability to create square pores with a size of at least 0.3 mm 0.3 mm, and witte. produced open porous mg scaffolds with 72 to 76% porosity and pore sizes ranging between 10 and 1000 m, and tested into the patellar cartilage of rabbits where new bone formation was observed. precautions should be taken during the removal process of nacl from the cast mg structure. the remaining salt will dissolve into aqueous solution and aggressive chloride ions will increase mg corrosion [108110 ]. hence, only fresh naoh solution should be used to dissolve nacl to reduce the buildup of chloride ions. overinfiltrating, partially infiltrating, and underinfiltrating should be avoided so as to obtain a perfect replicate casting of 3d cad model. it should be noted also that molten mg at high pressure will infiltrate not only pores of the nacl mould, but also the micropores between sintered nacl particles, resulting in the impossibility of the removal of all residual nacl from the structure. challenge in this technique includes dimensional change from polymer model to nacl template to mg structure. nguyen. reported dimensional change between 0.3 and 0.4 mm for strut sizes converted from rp model to nacl template as a result of low filling efficiency during nacl infiltration process. it was also identified that the use of nacl is limited by the strength or fragility of the sintered nacl template, which then limits casting capability. the use of larger nacl particle distribution size (i.e., from 20 to 65 mm) has been suggested to improve the flow of nacl paste and the strength of sintered template. resolution of the rp printer is also another limitation to produce finer structures at a size similar to the hierarchical structure of human bone. the limitation in obtaining homogenous pore size by powder metallurgical method can be solved by the use of space holder materials [9193 ]. as an example, carbamide (co(nh2)2) has been used as a spacer material to fabricate porous structures of pure mg. the process produced open - cellular mg (porosities : 3655% ; pores : 200400 m) having mechanical properties close to that of natural bone. the leaching method has been applied to produce porous mg - calcium - phosphate (mcp), where macropores and micropores were created by nacl particles and saturated nacl solution, respectively. electrodeposition involves the use of metallic ions solution to deposit metallic elements on electrically conductive polymeric foam ; meanwhile vapor deposition uses chemical reactants in gaseous phase, which were heated by radiation prior to their deposition on polymeric precursor substrate. fe is an essential element that plays significant roles in human body metabolism including transport, activation, and storage of molecular oxygen, reduction of ribonucleotides and dinitrogen, and decomposition of lipid, protein, and dna damages. fe has a higher elastic modulus (211 gpa) compared to that of mg (41 gpa) and its alloys (44 gpa) and 316l stainless steel (190 gpa) [116, 117 ]. are among the first who proposed fe as a biodegradable metal, where they reported an in vivo implantation test of fe stents in the descending aorta of rabbits. they showed evidence that pronounced inflammatory response and systemic toxicity were not observed up to 18 months of the study. have studied fe foam coated with calcium - phosphate for bone replacement scaffold where human mesenchymal stem cells proliferated and differentiated more on coated fe foams than on uncoated ones. the coating gave enhanced bioactivity and inhibited degradation of fe foams ; however, the latest is actually questionable since fe was generally viewed as having too slow degradation for implant applications. the open porous fe and fe - phosphorous alloys have been investigated as biodegradable bone replacement, and the results showed that addition of phosphorus increased compressive yield up to 11 mpa, higher than that of pure fe of 2.4 mpa, and resulted in a young 's modulus of 2.3 gpa which is comparable to that of typical bone. the alloys showed also faster in vitro degradation than pure fe but still considered slow as large fraction of material was observed during 12 months in vivo study. nevertheless, alloying fe with phosphorous seems to be a promising way to optimize both mechanical and degradation properties of fe especially for bone scaffold. porous fe has been fabricated via several methods including solid - gas eutectic solidification process [120, 121 ], co - co2 gas foaming powder metallurgy process, or powder metallurgy with the use of polymer foaming agent [119, 123 ], or even using wood as template. however, those techniques hardly provide the topologically ordered porous as desired for bone scaffold. moreover, owing to its very high melting temperature, the solid free - form method as applied to mg seems to be nonapplicable for fe where the excessive heat might destruct the nacl template. biodegradable metals as tissue scaffolding materials have been viewed as alternative to polymers for hard tissue regeneration exploiting mostly their superior mechanical properties over biodegradable polymers. biodegradable metals such as mg and its alloys possess mechanical properties in close range to those of native human bone and have shown encouraging results when used as tissue scaffolds. porous fe could also be viewed as a potential scaffold material but available data is scarce especially in its relation to bone tissue. among many promising techniques to fabricate metal scaffolds, solid free - form is currently viewed as the most potential method to fabricate biodegradable metal scaffolds having optimized pore morphology for cell growth and cell proliferation. this technique permitted the design and realization of topologically ordered porous mg with periodic structure for enhanced mechanical efficiency and function of a porous scaffold. further investigations are needed in the solid free - form fabrication method to develop a scaffold with properties specifically tailored for cell regeneration and tissue growth. overall, application of biodegradable metals for tissue engineering scaffold is just in the beginning. the directions could be in finding suitable process for making porous structure from all prospective biodegradable metals, understanding the influence of porous structure to mechanical and degradation properties, and understanding the cell regeneration and degradation product transport in the porous structure. | scaffolds have been utilized in tissue regeneration to facilitate the formation and maturation of new tissues or organs where a balance between temporary mechanical support and mass transport (degradation and cell growth) is ideally achieved. polymers have been widely chosen as tissue scaffolding material having a good combination of biodegradability, biocompatibility, and porous structure. metals that can degrade in physiological environment, namely, biodegradable metals, are proposed as potential materials for hard tissue scaffolding where biodegradable polymers are often considered as having poor mechanical properties. biodegradable metal scaffolds have showed interesting mechanical property that was close to that of human bone with tailored degradation behaviour. the current promising fabrication technique for making scaffolds, such as computation - aided solid free - form method, can be easily applied to metals. with further optimization in topologically ordered porosity design exploiting material property and fabrication technique, porous biodegradable metals could be the potential materials for making hard tissue scaffolds. |
the objective of this research was to estimate the unconfounded influence (either singly or in combination) of : (a) patient attributes (age, gender, race, and socioeconomic status) and (b) provider characteristics (physician gender and years of clinical experience) on medical decision making when providers are presented patients who show identical signs and symptoms strongly suggestive of coronary heart disease (chd) (a common medical problem). we conducted a factorial experiment that permits estimation of unconfounded main effects and interactions of any 2 of the variables listed above. the experiment focused on a range of clinical decisions as they relate to a case of chd 6, 7. research methods are summarized below (see also mckinlay 2006, 8. a version of the videotaped chd condition (varying by age, race, or gender) was shown to each of the physicians recruited as subjects for the experiment. we recruited a total of 128 massachusetts licensed, randomly sampled internists and family physicians. we stratified subjects according to gender and level of clinical experience, including eligible physicians until each cell was complete. the patient (reluctantly made the appointment) presents with a complaint of indigestion and features of chronic atypical chest pain. for the estimation of main effects, a total sample of 128 physicians gives 80% power to detect an absolute difference in means of 25%. for 2-way interactions, the effect size is a ratio of the variability of the hypothesized means divided by the variability of the observations. for 2 means with a difference, standard deviation of subjects s, the effect size /2s9. immediately after viewing the selected video for the experiment this interview included questions concerning how they would manage the case of chd depicted in the video in their everyday clinical practice, including their most likely diagnoses, their certainty with respect to the diagnosis, test ordering, prescriptions, lifestyle recommendations, and what other information they might seek. qualitative techniques were employed to elicit the reasons why decisions were made. professional actors and actresses patient presenting to a primary care provider with the signs and symptoms of chd. patient s age (55 vs. 75 years to get some separation between the middle aged and older patients), race (white vs. black), gender and socioeconomic status (lower vs. higher social class a janitor vs. a teacher). potentially relevant nonverbal indicators were embedded in the script, such as the levine fist. each videotaped encounter simulated an initial interview with either an internist or family practitioner and was of 78 minutes in duration, reflecting the average length of a consultation (face time) with a primary care physician (not including a physical exam 10). chd was selected because : (a) it is among the most common and costly problems presented by older patients to primary care providers 11 ; (b) it is a relatively well - defined organic medical condition ; and (c) it can result in a range of possible diagnostic, therapeutic, and life style actions. a script for the case of chd was developed from tape - recorded role - playing sessions with experienced, clinically active advisors. patients in the chd vignette presented with symptoms suggestive, although not pathophenomic, of chd (including, for example, heartburn, indigestion unrelieved with antacids, new substernal discomfort, which is exertional and resolves after several minutes rest, pain in the back between the shoulder blades, stress, and elevated blood pressure). to be eligible for selection, an equal number of male and female physicians had to : (a) be internists or family practitioners ; (b) have 12 years clinical experience (graduated between 1989 and 1996) or 22 years experience (graduated between 1965 and 1979) to get clear separation by level of experience ; (c) be trained at an accredited medical school in the us ; and (d) be currently providing clinical care at least half time. eligible physicians were randomly sampled from throughout massachusetts to fill 4 design cells (gender by level of experience). screening telephone calls were conducted to identify eligible subjects and an hour - long, in - person interview was scheduled (at which time informed consent was obtained). each physician subject was provided a modest stipend ($ 100) to partially offset lost revenue and to tangibly acknowledge participation. assessment of the quality of decision making requires some gold standard against which physician behavior can be compared. we originally planned to derive this standard from 2 main sources : (a) official clinical guidelines promulgated by, for example, ahrq and aha ; and (b) the recommendations of a respected group of local clinical peers as to what any minimally competent provider should do when encountering the videotaped patient. this approach was designed to accommodate the competing interests of different groups by developing a consensus view triangulated from these 2 sources on the most appropriate management of the presenting table 1 depicts considerable divergence between the actions listed in the clinical guidelines and the recommendations made by clinically active peers. furthermore, there was little consensus among the clinical peers as a group about the recommended action for the clinical case. this divergence may partly explain the fact that when asked whether their knowledge of guidelines contributed to their decisions with respect to the patient in the videotape, 75% of the physician subjects, said no : there were no significant differences in the use of guidelines depending on physician gender (p = 1.0) level of experience (p =.69), or their interaction (p =.69). for the purposes of this paper, clinical guidelines developed by acc / aha / acp - asim (guidelines for the management of patients with chronic stable angina 12, 13 for chd were used as 1 useful gold standard (recognizing there are others) against which physician decision making could be assessed. the clinical actions recommended in these guidelines were grouped into 5 categories, following the logical order of the encounter : information seeking, physical examination, test ordering, drug prescriptions, and life style recommendations. whereas chest x - ray is not required for all patients with chd, the guidelines strongly recommend it if there is evidence of congestive heart failure, valvular heart disease, pericardial disease, aortic dissection, or pulmonary disease. table 1the concordance or discordance between 6 boston area clinical experts and clinical guidelines on key aspects of care for chdguidelinesclinician agreementinformation seekingquality of pain - duration of pain - provoking factorsreliving factors - patient medical historyfamily history - physical examinationheart - lungs - abdomenperipheral extremities - vascular neck exam - test orderingecg / ekghemoglobin - glucose - lipids - chest x - ray - stress testdrug treatmentsaspirinbeta blockershort acting nitrateslifestyle recommendationsdiet or weight - exercise - smoking- = 3 physicians in agreement with guidelines = > 3 physicians in agreement with guidelines= 3 physicians in agreement with guidelines= 3 physicians in agreement with guidelines = 50%) concerning the acquisition of information regarding provoking factors and patient history ; the examination of the heart, lungs and abdomen ; ordering egg, hemoglobin, and stress tests ; and making dietary recommendations. there was lower adherence (50%) concerning the acquisition of information regarding provoking factors and patient history ; the examination of the heart, lungs and abdomen ; ordering egg, hemoglobin, and stress tests ; and making dietary recommendations. there was lower adherence (< 20%) regarding the acquisition of information regarding the duration of pain, factors that relieve it, and family history ; the examination of the extremities and neck ; ordering glucose tests and x - rays ; and making recommendations to increase exercise level. influence of patient attributes the influence of the patient s gender on chd guideline adherence is depicted in fig. 2. female patients are significantly less likely to receive 4 of the 5 components of the physical examination : cardiac (heart ; 84% of men vs 64% of women), pulmonary (lungs) (87% vs 64%), peripheral vascular (extremities) (18% vs 6%), and vascular neck exam (26% vs 9%). whereas many of the patient gender differences in chd guideline adherence do not reach statistical significance, there is general consistency in the results. the female patients received less than males on 2/3 of the specific clinical actions suggested in the guidelines (16 of the 23 listed). figure 3 summarizes results concerning the effect of patient age (55 vs 75 years) on chd guideline adherence. the only significant difference concerned the recommendation that the patient stop smoking - younger patients were twice as likely (40%) to receive such advice as older patients. no significant differences or consistent patterns were evident with respect to either the race (white vs black) or socioeconomic status (lower vs higher) of the patient and physician adherence to guidelines. the influence of physician characteristics figure 4 summarizes the overall (main) effects of physician level of experience as to whether they follow guidelines when encountering a patient with chd. the gender of the physician in the study did not appear related to his or her adherence to the chd guidelines. a physician s level of clinical experience, however, did produce several significant findings. table 2 shows that older / more experienced providers were more likely to inquire about factors provoking chest pain (for older patients), to order a glucose test (for male patients) and to prescribe short - acting nitrates (62.5% of more experienced physicians vs 21.9% of less experienced physicians, p <.0001). there was a consistent pattern (although results did not achieve statistical significance) of younger / less experienced doctors conducting all 5 components of the physical examination, whereas the older / more experienced physicians were more likely to order all 6 of the tests listed. the percentage of primary care physicians who follow clinical guidelines when encountering a patient with coronary heart disease. y axis = actions recommended by clinical guidelines. the percentage of primary care physicians who follow clinical guidelines when encountering a patient with coronary heart disease : patient gender. the percentage of primary care physicians who follow clinical guidelines when encountering a patient with coronary heart disease : patient age. x axis = percent of physicians who follow guidelines. blue bars = 75 years old. the percentage of primary care physicians who follow clinical guidelines when encountering a patient with coronary heart disease : physician level of experience. in this experiment, we provided physicians with a standardized clinical scenario to examine their clinical decision making, and compared this against 1 recognized standard of clinical guidelines for the evaluation of possible chd. we found that whereas there was high physician adherence to some of the clinical guidelines for management of chd, many physicians would not follow others moreover, characteristics of both the provider and the patient appear to play a role in adherence to guidelines. the gender of the patient appears to be influential : female patients received fewer of the actions recommended by clinical guidelines for the diagnostic evaluation of chd. an explanation for this may be found in the reaction of a physician colleague who stated, i ve got older patients and i ve been going on for years about their smoking. a physician s years of clinical experience were also associated with significant differences : less experienced doctors conducted more components of the physical examination, whereas more experienced physicians were more likely to recommend diagnostic testing. the use of clinical guidelines as the gold standard for clinical care was chosen for several reasons : they are a) thought to reflect a consensus opinion based upon the current medical evidence (panels of experts from professional societies), and b) a useful standard because they include history of symptoms, clinical examination, diagnostic testing, and lifestyle and pharmacologic intervention recommendations. it is noteworthy that several parts of the clinical history and physical examination are inadequately addressed, as these are inexpensive and provide potentially critical information to elucidate the problem. the majority of physicians included the two diagnostic tests directly related to diagnosis of chd, namely ekg and stress testing, whereas there was greater variability on tests for related or alternative diagnoses, such as glucose testing for undiagnosed diabetes, or chest x - ray for alternative diagnosis. considering those guidelines directly concerned with diagnosing and treating chd and unstable or new angina, we find that providers generally follow the testing guidelines well, but are less adherent to those pertaining to historical information, and early treatments with aspirin, beta blockers or short - activating nitrates. likewise, the general differences in eliciting historic information suggests that these differences are important and could account for some of the gender disparities observed. guidelines that relate to primary and secondary prevention, or assessment of important comorbidities may be considered less important at the first evaluation, and thus their lower use by physicians is perhaps understandable. some of the variability from the guidelines may reflect timing issues, where providers would postpone beta blocker therapy until after ekg and exercise stress testing, when the extent of disease and potential risk of unstable angina is understood. however, the prescription of short - acting nitrates or aspirin are recommended for their potential protection against cardiac events, even in this case of heartburn where upper gastrointestinal pathology may account for symptoms. the lack of exercise counseling could reflect caution until the diagnosis is established, but the same would not hold for the 2/3 of providers who would not recommend smoking cessation. our findings corroborate and extend the work of others, and indicate that even when there are evidence - based guidelines for the management of a condition as common as suspected chd, some physicians use of guideline activities continues to lag. for example, regular monitoring of blood sugar is considered essential to the effective treatment of diabetes and prevent complications 14. however, saaddine and colleagues 15 found that only 29% of diabetic patients reported having their blood sugar tested during the previous year. another study by mcglynn and colleagues 4 found that 24% of diabetic patients received 3 or more glycosylated hemoglobin tests over a 2-year period. grant and colleagues 5 found fewer than half of all diabetics with elevated glycosylated hemoglobins had a change in medication, and only 10% of patients with elevated blood pressure readings had a change in management. prior literature suggests reduced rates of revascularization, or delay in care for acute coronary events in women compared to men, as an explanation for higher morbidity and mortality for chd in women 1622. however, our findings suggest that gender disparities in evaluation may begin even earlier in the clinical history and physical examination for chd. that is, female physicians did not provide more guideline - based care to either male or female patients than did their male counterparts. similarly, we found no differences based on patient race in recommendations for guideline appropriate chd care. the findings based on physician experience are mixed. whereas more experienced providers ordered more diagnostic testing when the patient was older, their less experienced counterparts conducted more thorough physical examinations. the reduced behavioral counsel to older patients in the vignette may reflect a bias that older patients are less likely to adopt smoking cessation and other behavioral change. however, some evidence suggests that older patients are as or more likely to adopt change 23. first, whereas the rigorous experimental design permits excellent internal validity, external validity remains a threat. four precautionary steps were taken to hopefully minimize this threat (physicians were involved in script development ; study subjects [physicians ] were specifically asked how typical the patient was compared with patients in everyday practice ; subjects viewed the tapes in the context of their practice day ; subjects were specifically instructed to view the patient as 1 of their own patients). second, the response rate of 64.9 & (while high for a study of us physicians in the present climate) means over a third of those eligible and selected did not agree to participate. this is an unavoidable consequence of the decision to randomly sample in an attempt to increase the generalizability (external validity) of the research findings. third, the level of adherence to guidelines may depend on which guidelines are selected as the gold standard. the guidelines used in this research were recommended by clinical colleagues as promulgated by a reputable professional organization and considered to have wide visibility among providers. the implications of this study rest on the assumption that physicians need to adopt and adhere to evidence - based guidelines in their everyday practice. evidence - based disease management strategies, including early use of aspirin and short - acting nitrates, can not reach their full potential if not incorporated into clinical care. the widely reported gender inequalities in coronary heart disease are unlikely to be reduced if improvements in the illness behavior of women (personal risk assessment, symptom recognition, and earlier help - seeking) are not matched by appropriate diagnoses, test ordering, and lifestyle recommendations by providers 24. the question is how to ensure the incorporation of clinical guidelines into everyday practice : that is, how to institutionally support and reimburse physicians adherence to their own, or their colleagues own, recommendations (possibly pay - for - performance). whereas there is considerable literature addressing patient barriers to adherence to treatment recommendations, less some authors cite inadequate professional training 25, especially the limitations of training of primary care providers to address so many complex medical conditions. other barriers to adherence to guidelines include provider concerns about cookbook medicine, perceived regulatory intrusion into practice and unwillingness to buy into the concept of management guidelines. other barriers may be a lack of systems support, such as electronic medical records, which incorporate guideline management recommendations to ensure uniformity in care ; or lack of patient participation in decision support 26. lastly, the number of guidelines propagated and the lack of concurrence among them make it difficult for providers to find a clear consensus on the best management practices 27. first, whereas the rigorous experimental design permits excellent internal validity, external validity remains a threat. four precautionary steps were taken to hopefully minimize this threat (physicians were involved in script development ; study subjects [physicians ] were specifically asked how typical the patient was compared with patients in everyday practice ; subjects viewed the tapes in the context of their practice day ; subjects were specifically instructed to view the patient as 1 of their own patients). second, the response rate of 64.9 & (while high for a study of us physicians in the present climate) means over a third of those eligible and selected did not agree to participate. this is an unavoidable consequence of the decision to randomly sample in an attempt to increase the generalizability (external validity) of the research findings. third, the level of adherence to guidelines may depend on which guidelines are selected as the gold standard. the guidelines used in this research were recommended by clinical colleagues as promulgated by a reputable professional organization and considered to have wide visibility among providers. the implications of this study rest on the assumption that physicians need to adopt and adhere to evidence - based guidelines in their everyday practice. evidence - based disease management strategies, including early use of aspirin and short - acting nitrates, can not reach their full potential if not incorporated into clinical care. the widely reported gender inequalities in coronary heart disease are unlikely to be reduced if improvements in the illness behavior of women (personal risk assessment, symptom recognition, and earlier help - seeking) are not matched by appropriate diagnoses, test ordering, and lifestyle recommendations by providers 24. the question is how to ensure the incorporation of clinical guidelines into everyday practice : that is, how to institutionally support and reimburse physicians adherence to their own, or their colleagues own, recommendations (possibly pay - for - performance). whereas there is considerable literature addressing patient barriers to adherence to treatment recommendations, less some authors cite inadequate professional training 25, especially the limitations of training of primary care providers to address so many complex medical conditions. other barriers to adherence to guidelines include provider concerns about cookbook medicine, perceived regulatory intrusion into practice and unwillingness to buy into the concept of management guidelines. other barriers may be a lack of systems support, such as electronic medical records, which incorporate guideline management recommendations to ensure uniformity in care ; or lack of patient participation in decision support 26. lastly, the number of guidelines propagated and the lack of concurrence among them make it difficult for providers to find a clear consensus on the best management practices 27. | backgroundhealth services research has documented the magnitude of health care variations. few studies focus on provider level sources of variation in clinical decision making - for example, which primary care providers are likely to follow clinical guidelines, with which types of patient.objectivesto estimate : (1) the extent of primary care provider adherence to practice guidelines and the unconfounded influence of (2) patient attributes and (3) physician characteristics on adherence with clinical practice guidelines.designin a factorial experiment, primary care providers were shown clinically authentic video vignettes with actors portrayed different patients with identical signs of coronary heart disease (chd). different types of providers were asked how they would manage the different patients with identical chd symptoms. measures were taken to protect external validity.resultsadherence to some guidelines is high (over 50% of physicians would follow a third of the recommended actions), yet there is low adherence to many of them (less than 20% would follow another third). female patients are less likely than males to receive 4 of 5 types of physical examination (p <.03) ; older patients are less likely to be advised to stop smoking (p <.03). race and ses of patients had no effect on provider adherence to guidelines. a physicians level of experience (age) appears to be important with certain patients.conclusionsphysician adherence with guidelines varies with different types of patient and with the length of clinical experience. with this evidence it is possible to appropriately target interventions to reduce health care variations by improving physician adherence with clinical guidelines. |
acute fibrinous and organizing pneumonia (afop) was first described by beasley. in 2002 as a condition characterized by alveolar damage, eosinophilic pneumonia, and organizing pneumonia. the features that distinguish it histologically are the presence of intra - alveolar fibrin balls, absence of usual hyaline membranes and eosinophils and many foci of fibroblastic activity. it has been described in almost all age groups with associations including autoimmune disease and connective tissue, drugs, occupational, and environmental exposures and other infectious agents. they are usually two forms of this illness, a severe form which leads to rapid respiratory failure and a subacute form which has a much better prognosis. there is no specific treatment though immunosuppressant and steroids produce good results in patients with sub - acute afop. the chest radiograph findings of afop are almost identical to those seen in cryptogenic organizing pneumonia, consistent with migratory, patchy, diffuse, alveolar opacities with bilateral, and peripheral distributions. a 42-year - old female was admitted with complaints of dry cough of 5 days, high - grade fever since 15 days, generalized malaise and progressive worsening shortness of breath since 5 days. no known chemicals, fumes or occupational or allergen exposure. upon examination, she was dyspneic, blood pressure of 110/70 mmhg and had fever of 103 f. she had a respiratory rate of 32/min, heart rate of 120 beats / min. she had no icterus, edema, clubbing, rash, skin lesions, cervical lymphadenopathy, or joint swelling. her arterial blood gas (abg) analysis revealed ph of 7.47, pco2 of 41 mmhg, and po2 of 39 mmhg. chest radiographic findings showed inhomogeneous bilateral opacification in lower lung zones. the rest of the laboratory tests, including liver function test, kidney function test, coagulation profile, urine examination, etc. work up of anti - nuclear antibodies, angiotensin converting enzyme, dsdna antibodies, antinuclear and cytoplasmic antibodies, rheumatoid arthritis factor, extractable nuclear antigen profile, and anti - phospholipid anti bodies were negative. she was initially treated with noninvasive ventilation, oxygen therapy, antibiotics such as combination antibiotic regimen with pipercillin - tazobactam with and clarithromycin. high - resolution computed tomography (hrct) thorax revealed bilateral diffuse confluent consolidation in lower lung zones [figure 1a c ]. bronchoscopy followed by bronchoalveolar lavage (bal) was performed (gene xpert real - time pcr). transbronchial lung biopsy was performed from the right lower lobe, biopsy report of which came out to be afop [figure 1d and e ]. she was treated with 40 mg prednisolone twice daily along with bronchodilators and oxygen therapy. her abg also improved significantly with po2 at 92 mmhg and her saturation at 95%. she was initially on high flow oxygen mask which came down to minimum level and eventually she did not require any oxygen therapy after 5 days of steroid therapy initiation. (a) axial and (b) cornal computed tomography through lungs : geographical distribution of widespread consolidation with ground glass opacities and septal thickening in both lungs. (c) axial computed tomography taken after 15 days after treatment : resolution of large component of organizing consolidation with residual ground glass opacities and mild septal thickening. (d and e) intra - alveolar fibrin in the form of fibrin balls without formation of hyaline membranes (h and e, 100) afop has been reported in all age groups with average age being 62 years originally described by beasley. it has been reported that afop may occur as an idiopathic variety or in association with clinical conditions, including collagen vascular diseases, drug reactions, occupational or environmental exposures, as well as various infections. retrospective follow - up of these patients shows two varieties of progression. a subacute variety and a severe variety which usually leads to respiratory failure and the prognosis of the severe variety is not promising. on average, severe form of afop this variety seems to resemble cryptogenic organizing pneumonia (cop) in terms of prognosis and recovery following corticosteroid treatment. afop has been described with many other conditions in the past while twelve reported cases were idiopathic. therefore, there could be an association between autoimmune disease and afop. in our case, there was no evidence of malignancy or any other factors known to be related with pneumonia. however, lung biopsy revealed that the patient has unusual histological pattern that was identified as afop. nevertheless, it is important to note that sub - acute forms of this disease seem to be mistaken for cop. therefore, histological diagnosis is essential for distinguishing the two through ct - guided or bronchoscopic biopsy. the most commonly used methods to obtain a tissue sample include video - assisted thoracoscopic biopsy and a ct - guided biopsy. diagnosis of afop in indian case reports has been achieved through ct guided biopsy followed by treatment of the disease by prednisolone. she required intensive care support for 5 days eventually being discharged home after 10 days of hospitalization. by this study, we suggest that afop should be taken into consideration and differential diagnosis of severe acute pneumonias with no significant co - morbidities. diagnosis is mostly biopsy proven, and treatment through corticosteroids is quite promising. | acute fibrinous and organizing pneumonia (afop) is a rare disease characterized by bilateral basilar infiltrates and histological findings of organizing pneumonia and intra - alveolar fibrin in the form of fibrin balls. here, we report a 43-year - old female with complaints of fever, dry cough, and shortness of breath with hypoxemia. high - resolution computed tomography thorax revealed diffuse confluent consolidation in bilateral lung zones. bronchoscopy and transbronchial biopsy revealed features of afop. with prednisolone treatment, there was an improvement in her condition. afop is a rare disease and should be taken into consideration and differential diagnosis of severe acute pneumonias with no significant comorbidities. |
higher education in europe and in the balkan s countries is undergoing major reforms (1 - 3). goals of the higher education transformation in europe was determined by the bologna declaration (signed in 1999 by ministries of 29 countries in europe) and sorbonne declaration signed on may 25, 1998 on harmonizing the architecture of the european higher education system (1, 4 - 7). both declarations, together with the documents adopted through a process of reform of higher education in europe represent the legislative base of the bologna process. the bologna process was a major reform created with the claimed goal of providing responses to issues such as the public responsibility for higher education and research, higher education governance, the social dimension of higher education and research, and the values and roles of higher education and research in modern, globalized, and increasingly complex societies with the most demanding qualification needs (8). bologna process aims to create a unified european system of university education and research while recognizing and preserving diversity of national specificities (culture, language, traditions, etc.). in this manner it aims to create a more flexible and efficient system of education in europe, more competitive at the global market of knowledge. continually changes of bologna declaration have been applied and influenced the medical schools curricula, especially medical informatics programs. the quality of teaching at the universities in different countries in europe depends on many factors, among which are : adequate space for teaching, teaching staff, equipment and technical aids to assist in the teaching process. fulfilling these standards and norms is essential in order to successfully follow the curricula at biomedical faculties by the bologna process (9 - 11). without improving the quality of medical education the progress of health care is impossible to assess the quality of the teaching process very important is opinion of students and teaching staffs (11). launched in 1999 by the ministers of education and university leaders of 29 countries, the bologna process aims to create a european higher education area (ehea) by 2010 ; it has further developed into a major reform encompassing 46 countries. taking part in the bologna process is a voluntary decision made by each country and its higher education community to endorse the principles underlined in the european higher education area (10 - 12). the bologna declaration aimed to create a coherent and cohesive european higher education area (ehea) by 2010. the main objectives outlined in this statement were as follows : a) to adopt a system of easily readable and comparable degrees adopt a system with two main cycles (undergraduate / graduate) ; b) to establish a system of credits (ects) ; c) to promote mobility by overcoming legal recognition and administrative obstacles ; d) to promote european co - operation in quality assurance ; e) to promote a european dimension in higher education (4). the bologna process does not aim to harmonize national educational systems but rather to provide tools to connect them. the reforms are based on ten simple objectives which governments and institutions are currently implementing (13 - 15). most importantly, all participating countries have agreed on a comparable three cycle degree system for undergraduates (bachelor degrees) and graduates (master and phd degrees). the main actors in the bologna process are : a) education ministers of countries that signed the bologna declaration ; b) representatives of european universities (eua), professional higher education institutions (eurashe), students (esu), quality assurance agencies (enqa), the un educational, scientific and cultural organization european centre for higher education (unesco - cepes), education international (ei) and business europe. the process is also supported by the european commission and the council of europe all actors are involved in the bologna follow up group (bfug) which meets regularly to further elaborate on the 10 action lines and supports the implementation of the bologna declaration. a ministerial meeting is held every two years to take stock of the latest implementation stage and review its course. the uk and germany signed the sorbonne declaration on the harmonization of the architecture of the european higher education system (5). since the adoption of the bologna declaration in 1999, education ministers of the european countries have met every two years to further discuss and build upon the initial objectives. it is at this time that the ministers produce a communiqu : the prague (2001), berlin (2003), bergen (2005) and london (2007) communiqus each outline the progress made thus far as well as future short and long term priorities. eua welcomes the fact that the communiqu takes up many of the key points stressed in its recent prague declaration to ministers. in particular, the communiqu underlines the importance of increasing the quality and quantity of mobility in europe, together with many of the other key issues underlined in the eua declaration including taking forward lifelong learning and improving researcher careers. in prague, it was agreed to add three more action lines : a) inclusion of lifelong learning strategies ; b) involvement of higher education institutions and students as essential partners in the process ; c) promotion of the attractiveness of the european higher education area (16). in berlin, they agreed to speed up the process by setting an intermediate deadline of 2005 for progress on : a) quality assurance ; b) adoption of a system of degree structures based on two main cycles ; c) recognition of degrees. moreover, they decided to add the additional action line doctoral studies and promotion of young researchers, including specific mention of doctoral programs as the third cycle in the bologna process (17). on march 11 - 12, 2010, the budapest and vienna ministerial conferences and the 2 bologna policy forum took place. with the budapest - vienna declaration, eua has reflected on the achievements of the bologna process so far, and on the new steps to be taken in the first decade of the ehea (18). data from the literature and the media speak about increasing discrepancies in the implementation of previously set goals and actions. insufficient are the qualifications of teachers, financial resources and teaching staff which is lacking everywhere, professors are getting old, and more and more students quit schooling. one of the reasons for dissatisfaction with the bologna process is the introduction of high costs of studying, which caused a reduction in the number of foreign students at german universities by 20 percent. masic i and begic e. from bosnia and herzegovina presented the experiences in the implementation of the bologna declaration at bosnia and herzegovina universities (1, 6, 7). according to available data, the quality of medical education at the universities at such level that none of biomedical faculties in bosnia are internationally accredited (19 - 21). this is a consequence of the war and postwar conditions in the country, unregulated socio - political system, poor legislation in higher education, small investments in infrastructure, facilities, personnel, equipment, especially in the ict resources used in education. both models of education are still used : the old austro - hungarian model and the new bologna model (22 - 24). measuring of education quality according to both models is performed for several years, so on this occasion will be presented the results and experiences with recommendations for the future. his opinion is that for potential students it is important to be aware of the quality of educational programs in medical informatics in which someone is interested. it is important to know how an educational program compares with international programs. for educational programs it is worthwhile to show to students, but probably also to their university that their educational program compares well with other international programs. for example, international medical informatics association (imia), european federation for medical informatics (efmi), european public health association (eupha), etc., tried to give the input of how these scientific associations can improve bologna model education followed the changes of bologna declaration (25). bologna declaration started in balcan countries (croatia, in 2001), about 15 years ago, but the process is in constant change and refinement. the new programs are not sufficiently aligned with those in europe, the credit system has increased the graduation success rate, but not the quality, the number of teachers has remained almost the same, while the obtained degrees are not aligned with the needs of the economy. the bologna declaration is ratified by more than 40 european countries. the declaration was signed by most of the balkan countries, starting with bulgaria, greece, hungary, romania and slovenia in 1999, then croatia in 2001, albania, bosnia and herzegovina, serbia and macedonia in 2003, and montenegro in 2007 (8). in 2013, a discussion was initiated in serbia on whether the state should give up the process, after research conducted by the university in belgrade showed that two thirds of the students were not satisfied with the way it was implemented, and there was certain degree of dissatisfaction as well with the professors. on a scale from one to five a debate also took place in croatia, after the professors warned that the problem with bologna is the fact that students take longer time to complete their studies, while the professors are suffocating in bureaucratic procedures because of the ects points, whereas the mobility has not increased significantly (26). the republic of macedonia became a member of the bologna process in 2003 but the basic principles of that system were only partially implemented. in 2005, the ministry of education and science prepared and passed updates of the law on higher education. priority areas for legal intervention are : the degree structure, enhancement of the university - faculty relations promoting an integrated university of which faculties are constituent parts. with regard to the question of restrucuring curricula, higher education institutions have continued to restructure existing and develp new study programs compatible with similar ones in the developed countries. most of the faculties in macedonia have decided to implement cts in 2005 according to the ects as a standard. according to the official reports a number of positive changes have been made in all areas of activities of the universities. but, there are a number of weaknesses in terms of learning outcomes, competences, and the appropriate qualification framework due to an objective economic situation in r. macedonia or to a subjective understanding of bologna philosophy (9, 27). in general, this is an expensive process, operation or system which, realistically speaking, requires more resources, and secondly, the capacity of the larger number of higher education institutions were not prepared enough to accept that process in order to be able to implement it fully. officials from the ministry of education and science consider that it could nt fully revoke the bologna process, but it leaves space for modification. most probably, the changes will consist of oral exam besides the existing written one, and exploration of the possibilities regarding the three - year study process. some experts recognized that one of the catastrophic consequences of the bologna process is that by wanting to grade students knowledge with points, the process itself has become dehumanized and mechanic causing degrading the higher education. professors barely have direct in - person contact with the students because students are the majority. the shortage of appropriate teaching staff, even without teaching assistants, create the situations for a professor to work with more than 200 students at the same time (9, 26, 27). education even in the most developed countries of europe is not spared from the problems, especially in the field of biomedicine. the bologna process is a series of ministerial meetings and agreements between european countries designed to ensure comparability in the standards and quality of higher education qualifications. the bologna process has created the european higher education area, in particular under the lisbon recognition convention and bologna declaration. corrections that are constantly being introduced in order to eliminate identified deficiencies does not provide adequate results, so that in some areas there are considerations about leaving the bologna model of education, especially in medicine, because of its specificity. changes in the curricula, modernization of facilities and their alignment with the programs of other european universities, employment of a larger number of assistants, especially in the clinical courses at our universities are necessary. moreover, it is necessary to continue to conduct further detailed analysis and evaluation of teaching content and outcomes in the future. if the main goal is high quality higher education, it is necessary all participants in the bologna process to take seriously recommendation for improvement and to try to avoid the catch of distorted bologna. | higher education in europe and in the balkan s countries is undergoing major reforms. the bologna process was a major reform created with the claimed goal of providing responses to issues such as the public responsibility for higher education and research, higher education governance, the social dimension of higher education and research, and the values and roles of higher education and research in modern, globalized, and increasingly complex societies with the most demanding qualification needs. changes in the curricula, modernization of facilities and their alignment with the programs of other european universities, employment of a larger number of assistants, especially in the clinical courses at our universities are necessary. also, it is necessary to continue to conduct further detailed analysis and evaluation of teaching content and outcomes in the future. in this review authors expressed their views and experience of using bologna model of education in the balkan s countries with emphasis on bosnia and herzegovina and the republic of macedonia. |
high frequency of established coagulopathy (30%) in multiply injured trauma patients has been reported, which accounts for up to 40% of all trauma - related deaths. the standard laboratory screening tests of coagulation are the prothrombin time (pt) and activated partial thromboplastin time (aptt), which can be affected adversely by poor sampling technique ; they vary in their complexity, turnaround time for clinical decision - making, and result reproducibility and have a need for special preparation or personnel. thromboelastography (teg) is a noninvasive diagnostic assay to evaluate the viscoelastic properties during blood clot formation and clot lysis, yielding a graphical and numerical output relating to the cumulative effects of various plasma and cellular elements of all phases of the coagulation and fibrinolysis. numerous studies have reported the utilization of teg as a monitoring device for hemostasis and transfusion management in various clinical settings, for example, cardiac surgery, liver transplantation, identification of patients with overt disseminated intravascular coagulation, hypercoagulability, and prediction thromboembolic events in surgical patients. studies claim that teg is a point of care device for rapid diagnosis and differentiation of hypercoagulable and hyperfibrinolytic conditions. teg 's ability to assess hemostasis in whole blood renders it to be ideal for rapidly identifying patients with trauma induced coagulation and transfusion guidance, as trauma patients present a spectrum of different coagulopathies that can be identified by teg. animal studies have depicted that the conventional laboratory tests most clinicians use to evaluate clotting function in trauma patients are inadequate to document the significant changes, due to hypothermia and hemorrhage. as values of viscoelastic haemostatic assays (vha) parameters differ in different ethnic populations, there is a lack of standard protocol based on vha parameters in indian population to guide transfusion of blood component therapy in bleeding patients. the purpose of this study was to compare teg with respect to the conventional coagulation tests and assess whether teg can serve as a screening test or replace the conventional routine test for the identification of coagulopathy due to trauma ; therefore we retrospectively studied hemostasis in critically injured trauma patients, admitted in level 1 trauma care center. patients were segregated as hypercoagulable and hypercoagulable with respect to the laboratory established reference range, manufacturer given range, and teg coagulation index. based on the ability of the above teg ranges to identify coagulation abnormalities in comparison to the conventional coagulation tests this was a retrospective study conducted at the department of laboratory medicine, of a level 1 trauma care center, over a period of six months (january june 2013). trauma patients with severe trauma (n = 150) admitted to our level 1 trauma care center were retrospectively considered for the study, if their teg was analyzed on admission. patients between the age group of 16 and 50 years were included in the study. patients receiving anticoagulation therapy with warfarin or antiplatelet agents, patients with known underlying coagulopathy, and patients with clinical evidence of brain death at the time of admission, or evidence of other severe comorbidities, such as liver disease, diabetes mellitus, and known history of hypertension, which may influence the outcome, were excluded. the samples used for teg analysis were drawn on arrival of the patient to the emergency department, prior to any fluid administration. platelet count was done on sysmex xe-2100 hematology analyzer (sysmex, kobe, japan). prothrombin time (pt) and activated partial thromboplastin time (aptt) were estimated on a sta compact automated analyzer (diagnosticastago, france). thromboelastometry was performed on tem - a automated thromboelastometer (framarbiomedica, rome, italy), using whole blood nonadditive (360 l). all analyses were performed with teg disposable cups and pins as devised by the manufacturer and measurements were performed within 4 minutes of sampling. teg evaluates the physical properties of the clot, via the torsion in a pin connected with a mechanical electrical transducer, suspended in cup. as the blood sample clots, the changes in rotation of the pin are converted into electrical signals that a computer uses to create graphical output. reference values successfully established in our laboratory for four tem parameters : reaction (r - time) time (time from start to initial fibrin formation) ; k - time (clot kinetics, measuring time taken for a certain level of clot strength is reached) ; -angle (clot kinetics of clot buildup and cross - linking) ; and maximum amplitude (ma) (absolute clot strength), for 95% of 200 healthy volunteers (100 male and 100 female), were r - time : 1.814.2 (min), k - time : 0.77.3 (min), -angle : 27.372.3 (), and ma : 32.187.9 (mm) (table 1). all patients underwent detailed clinical evaluation using the patient 's record, and data was complied which included age, gender, date of admission, description of injury, glasgow coma score, and injury severity score. coagulopathy was defined as > 1.5 times control pt & aptt values and/or inr > 1.6. depending on the shape of the teg tracing, the hemostatic condition of a patient was defined as hypocoagulable (if 2 or more parameters are observed : prolonged r - time, prolonged k - time, decreased -angle and/or ma) or hypercoagulable (if 2 or more of the following parameters are observed : short r - time, short k - time, increased -angle and/or ma). the teg coagulation index (ci), derived from a linear equation that combines all the teg variables, was also calculated based on which the haemostatic condition of a patient was defined as hypercoagulable (ci > 3) ; hypocoagulable (ci < 3). all patients were categorized as normal and outliers based on the normal range for the (1) plasma based routine coagulation test, (2) our laboratory established reference range, and (3) manufacturer 's reference range for teg parameters. true positive (tp), true negative (tn), false negative (fn), and false positive (fp) were defined with conventional coagulation tests as standard. sensitivity, specificity, and accuracy were described in terms of tp, tn, fn, and fp (the percentage of all patients with disease present who have a positive test) = tp/(tp + fn) = (number of true positive assessment)/(number of all positive assessments). specificity. (the percentage of all patients without disease who have a negative test) = tn/(tn + fp) = (number of true negative assessment)/(number of all negative assessments). accuracy. (the efficiency of a test is the percentage of the times that the test gives the correct answer compared to the total number of tests) = (tn + tp)/(tn + tp + fn + fp) = (number of correct assessments)/(number of all assessments). the other two basic measures of diagnostic accuracy, that is, positive predictive value (ppv) and negative predictive value (npv), which are related to sensitivity and specificity through disease prevalence, were also calculated. the predictive value of a test is a measure (%) of the times that the value (positive or negative) is the true value ; that is, the percent of all positive tests that are true positives is ppv and npv is the proportion of negative test results that are true negative : positive predictive value = tp/(tp + fp) negative predictive value = tn/(fn + tn). positive predictive value = tp/(tp + fp) negative predictive value = tn/(fn + tn). one hundred and fifty injured patients presented to the emergency department from january through june 2013 were included in the study. 55.3% had incurred injury to the head (hi) of which 64 (77.1) had severe hi. average injury severity score was observed to be 28.4 11.3 ; mean glasgow coma scale (gcs) was 7.85 3.2table 2. pt, aptt, and teg parameters for all patients are shown in table 2. fifty - one patients were defined as coagulopathic by the conventional coagulation test, with an average hb of 10.2 3.15 mm / hg, platelet count 144.7 87.6 lakh, pt 21.6 5.4 sec, aptt 38.8 14.9 sec, and inr 1.8 0.6. thirty patients were defined as coagulopathic by teg based on their haemostatic conditions, out of which twelve were hypercoagulable and eighteen hypocoagulable. this was done on the basis of the reference range that was established in our laboratory for indian population ; however when we applied the reference range of the manufacturer, there were 105 patients who developed coagulopathy, out of which 53 were hypercoagulable and 52 were hypocoagulable. patients were also defined as coagulopathic based on the teg coagulation index ; we observed that 73 were hypercoagulable and 7 were hypocoagulable. on comparing the identification of coagulopathy by conventional test to teg (with laboratory reference range) we observed 15 patients to be true positive (tp), 15 were false positive (fp), whereas 84 were true negative (tn) and 36 were false negative (fn) ; based on the above defined formulas the sensitivity was observed to be 29.4%, specificity was 84.8%, ppv was observed to be 50%, and 70% was the npv. when the identification of coagulopathy by conventional to manufacturers range for teg indices was compared, we observed 38 patients to be true positive (tp), 67 were false positive (fp), whereas 32 were true negative (tn) and 13 were false negative (fn) ; based on the above defined formulas the sensitivity was observed to be 74.5%, specificity was 32.3%, ppv was observed to be 25.3%, and 71.1% was the npv. for teg coagulation index we observed 23 tp, 57 fp, 42 tn, and 28 fn patients, with sensitivity 45.1% and specificity 42.4%, table 3. many tests provide information regarding coagulation status, including platelet count, prothrombin time, international normalized ratio, activated partial thromboplastin time, d - dimer, and fibrinogen levels. none is satisfactory in a trauma setting, as they take a considerable time to measure and represent a single point in a potentially ongoing process of bleeding. by the time the test results are available, the patient may already have entered an irreversible state of hypothermia, acidosis, and coagulopathy. as a result, there is growing interest in point - of - care testing, with capability for repeated measurements and rapid results within minutes. pt and aptt reflect the overall activity from plasma clotting factors involved in the extrinsic and intrinsic pathways, respectively. pt or aptt do not adequately reflect coagulation defects from hypothermia and hemorrhage, as pt and aptt are performed in platelet poor plasma, which exclude the interaction of platelets and other blood components, which significantly contribute to trauma coagulopathy. teg variables are interdependent, measuring the interaction of the coagulation cascade and platelets in whole blood rather than specific endpoints in centrifuged plasma samples. enabling readily available analysis of coagulation in a shorter period of time than laboratory coagulation tests, thus providing useful and prompt identification of coagulation disorders. some studies report teg to be a useful research tool in comparison to six common tests, hematocrit, platelet count, fibrinogen, pt, aptt, and fibrin split degradation, suggesting a strong relationship. similar results were found between teg and standard laboratory tests of coagulation by kang., depicting a good correlation between r - time and aptt. however teg continues to be a second - level hemostasis test due to the lack of its quality assurance procedures and that teg is not validated, as far as international standards are concerned. as a consequence of the dependence of teg on manual procedures, its versatility in terms of the type of sample and different initiators that could be used resulting in difficulty to establish standards and reference values, it still persists as an expensive, nonvalidated point - of - care device. there is also very limited published commercial data on performance with regard to assay precision or inter - assay variability that again leads to skepticism. other limitations associated with this technology are that, although it is sensitive to a deficiency or excess of coagulation factors, specific clotting factor deficiencies can not be identified, have a relatively long measurement time, and require technical expertise. the present study was conducted to evaluate the efficiency of thromboelastography in a trauma care setup to assess the changes in the hemostatic conditions of severely injured patients, in comparison to the routine coagulation tests. incidence of coagulopathy was observed to be 34% by the conventional coagulation tests ; this decreased to 20% by our laboratory established range, indicating that routine assays recognize certain patients as coagulopathic which may not have the clinical presentation, and as teg analyzes the whole hemostatic condition of the patient, it depicts these patients as normal ; 70% developed coagulopathy according to the manufacturer 's reference range, suggesting that many trauma patients would be incorrectly identified as coagulopathic by the manufacturer 's reference values. we found teg to have a sensitivity of 29.41% and a specificity of 84.84% for trauma coagulopathy, using our reference range. in their study to establish normal values for canadian population, scarpelini. reported a specificity of 81% for thromboelastography. in a prospective study of 36 adult patients undergoing cardiopulmonary bypass (cpb) to determine the utility of teg versus platelet studies and standard coagulation tests to more effectively discriminate patients likely to benefit from platelet or fresh frozen plasma (ffp) transfusion, essell. reported a sensitivity of (71.4%) and the specificity (89.3%) of teg. sensitivity is the proportion of true positives that are correctly identified by a diagnostic test ; it shows how good the test is at detecting a disease. specificity is the proportion of the true negatives correctly identified by a diagnostic test, suggesting how good the test is at identifying normal (negative) condition. we observed that the range given by the manufactures has a higher sensitivity (74.5%) but a low specificity (32.3%) compared to our laboratory range, which indicates that the manufacturers range may identify coagulation abnormalities in a number of patients, because a test with high sensitivity tends to capture all possible positive conditions without missing anyone. however a low specificity suggests that these patients may not have clinical presentation of coagulopathy. also high sensitivity but low specificity may result in that many patients who do not have coagulation abnormalities being identified as coagulopathic are then subjected to further investigation, using laboratory established range. the major limitation of both sensitivity and specificity is that they are of no practical use when it comes to helping the clinician estimate the probability of disease in individual patients. positive and negative predictive values describe a patient 's probability of having a condition once the results of the tests for this condition are known. in our present study teg using the laboratory range had ppv of 50% and npv of 70% ; for the manufacturers range ppv of 25.3% and npv of 71.1% were observed. the higher the ppv, the more likely a positive result is able to predict the presence of coagulopathy.. it will therefore be wrong for clinicians to directly apply published predictive values of a test to their own populations, when the prevalence of disease in their population is different from the prevalence of disease in the population in which the published study was carried out. accuracy measures how correct a diagnostic test identifies and excludes a given condition and can be determined from sensitivity and specificity with the presence of prevalence ; it measures the degree of veracity of a diagnostic test on a condition. we report an accuracy of 66% for teg using laboratory established range and 46.6% for the manufacturers. limitations of the present study are that teg investigations were not done in duplicate, as is the case for classical coagulation assays ; we did not take into account the transfusion requirements ; thus we could not assess the transfusion guidance using out teg reference values. however, point of care testing for hemostasis is emerging and its role in patient management remains to be demonstrated in prospective studies. based on the current study, it is concluded that for specific diagnosis of underlying etiology of bleeding, conventional coagulation tests remain the most sensitive tests compared to thromboelastography ; however in emergency trauma situations, where immediate corrective measures need to be taken based on coagulation parameters and conventional coagulation tests may cause delay, teg can give highly specific results depicting the underlying coagulopathy. however it is suggested that the reference range of teg tests should be established for each lab and its results eventually should be confirmed by specific coagulation tests. | background. thromboelastography (teg) unlike conventional coagulation assays evaluates the dynamic interaction of clotting factors and platelets indicating an overall clot quality. literature assessing the efficacy of teg in identifying trauma associated bleeding is lacking. aim. to compare teg with conventional plasma based coagulation tests and assess whether teg can serve as a screening test or replace the conventional routine test. materials. retrospective data was collected for 150 severe trauma patients. patients with known evidence of severe comorbidities, which may influence the outcome, were excluded. detailed evaluation of the patient 's clinical and laboratory records was conducted. diagnostic characteristics such as sensitivity, specificity, and accuracy were calculated. results. fifty - one patients were defined as coagulopathic by the conventional coagulation test, 30 by the laboratory established range for teg indices and 105 by manufactures range. specificity and sensitivity for the laboratory established range for teg were 29.4% and 84.8% ; for manufactures range sensitivity was 74.5%, specificity was 32.3%. conclusion. we observed that conventional coagulation assays are the most sensitive tests for diagnosis of coagulopathy due to trauma. however in emergency trauma situations, where immediate corrective measures need to be taken, coagulation parameters and conventional coagulation tests may cause delay. teg can give highly specific results depicting the underlying coagulopathy. |
the demand for having more esthetic teeth and restorations has led several studies to be done in the field of tooth bleaching and its effects on the properties of teeth and the quality of composite restorations.12 while altered surface texture, hardness, fracture toughness34 and increased surface roughness of enamel,5 have been reported, some studies have shown little or no effect on the physical properties of enamel.67 hydrogen peroxide has been suspected to cause denaturation of proteins in the organic components of dentin and enamel,8 reduce microhardness values9 and result in changes in the mechanical properties of dentin,4 and could reduce the bond between resin restorations and tooth.10 it is suggested that dentin is more affected by hydroxide base materials due to its less mineral content and more organic matrix.11 the success of composite restorations depends on bonding them to hard tooth tissue that will retain the restoration to the cavity preparation and prevent microleakage.4 the dental adhesives used in dentistry have different tooth - composite interface morphologists,1213 different bond strengths1416 and different abilities in microleakage prevention.1719 so, the bonded interfaces may be affected by the bleaching agents differently. some researchers have investigated the effects of preoperative bleaching on microleakage and sealing ability of tooth coloured restorative materials.2022 some researchers also have studied the effects of bleaching agents on microleakage of existence restorations. the researches done by crim23, owens.24, ulukapi.25 and moosavi. have indicated that bleaching is an effective factor on the sealing ability of existent composite restorations whereas klukowska.,27 khoroushi.28 and white.29 showed that bleaching had no influence on microleakage of composite restorations. the purpose of this in vitro experimental study was to evaluate the effect of bleaching with carbamide peroxide on the microleakage of existent composite restorations treated with one etch and rinse and two self etch adhesive systems. seventy two non - carious extracted human anterior teeth were selected, cleaned and stored in 0.2% thymol solution until ready to use. standardized class v cavity preparations (3 2 2 mm) were placed in the buccal surfaces at the cemento - enamel junction, with the incisal margins in enamel and the gingival margins in cementum. the enamel margin of restoration was bevelled with a carborundum point (shofu, kyoto, japan). teeth were randomly divided into 6 groups of 12 specimens each (3 control and 3 experimental or bleached groups). after completion of the preparations, the bonding agents, scotch bond multipurpose (3m - espe), prompt l - pop(3m - espe) and ibond (heraeus - kulzer) were applied according to the manufacturers instructions (table 1) on the control and bleached groups to form sc and sb, pc and pb, ic and ib groups, respectively. the cavities were incrementally restored with a light curing composite material, filtek z 250 (3m - espe,), in a total of 3 equal increments, each one photoactivated for 40 seconds (coltolux ii, coltene, switzerland). the restorations were finished and polished with polishing disks (sof - lex, 3 m espe). after 24 hours, all teeth were thermo - cycled for 500 cycles between 5 2c and 55 2c with dwell time of 30s for each and a transfer time of 10s (mp based, kara 1000, tehran, iran). technique used for each adhesive the bleached group 's teeth were bleached with vital bleaching method. the teeth were bleached with 15% carbamide peroxide gel (opalescence pf, ultradent, products inc, usa) for 8 hours / day during 15 days. all teeth thermo - cycled for 500 cycles between 5 2c and 55 2c with dwell time of 30s for each and a transfer time of 10s (mp based, kara 1000, tehran, iran). the tooth surfaces were covered with two coats of nail varnish except for the restorations and 1 mm from the margins and then, immersed in 0.5% basic fuchsin solution for 24 hours at room temperature. teeth were stored in artificial saliva (ph = 7.4) except during the bleaching process, thermocycling and dye penetration testing. then, the teeth were sectioned longitudinally in a buccolingual direction using a cutting machine (dentarapid, krupp dental 759 dr 2, hilzingen, germany). the degrees of dye penetration in the enamel and dentin cavity walls were assessed separately under a stereomicroscope (olympus co, tokyo, japan) at x16 magnification. the following microleakage scores were used to assess the extent of dye penetration at the dentin and enamel walls : 0= no dye penetration, 1 = dye penetration less than halfway to the axial wall, 2= dye penetration greater than half way to the axial wall but not involving it, and 3= dye penetration along the axial wall. the data were analyzed using kruskal - wallis test followed by mann - whitney and bonferroni 's correction for multiple testing (= 0.05). degrees of microleakage for enamel and dentinal walls are presented in figures 1 and 2. there was no significant difference between the microleakage scores of the control and bleached groups of each adhesive at the enamel margins (scotch bond multipurpose, p = 1.000, prompt l - pop, p = 0.061, ibond, p = 0.252). there was also no significant difference between the control and bleached groups of scotch bond multipurpose and ibond for gingival margins (p = 0.102 and p = 0.054, respectively). however, for prompt l - pop group, dentinal micro - leakage increased after bleaching (p = 0.001). micro leakage degrees of the control and bleached groups of three bonding agents at the enamel margins. micro leakage degrees of the control and bleached groups of three bonding agents at the ginival margins. there was a significant difference among the control groups of three dentin bonding agents for enamel walls (p = 0.004). the microleakage scores of enamel walls for ibond control group were significantly greater than that for scotch bond multipurpose (p = 0.002) and prompt l - pop (p = 0.010). there was no significant difference between the control groups of scotch bond multipurpose and prompt l - pop at enamel walls (p = 0.148). there was a significant difference among the bleached groups of three adhesives at enamel margins (p = 0.002). the bleached group of scotch bond multipurpose showed significantly less microleakage at the enamel wall compared to prompt l - pop (p = 0.006) and ibond (p < 0.001). there was no significant difference between prompt l - pop and ibond in scores of microleakage at enamel margins of bleached groups. under the condition of this study, the two self etch adhesives, prompt l - pop and ibond, showed compatible results to the etch and rinse adhesive, scotch bond multipurpose, in gingival margins of unbleached teeth. although most of the self - etching products evaluated in the literature appear to produce adhesion to dentin that is no worse than their total etch predecessors1630 and compatible marginal seal,1718 concerns remains about the ability of such products to adequately seal enamel margins, and to bond to enamel with sufficient strength to retain large composite restorations.31 in this study, there was no statistically significant difference between the control groups of prompt l - pop self etch adhesive and scotch bond multipurpose total etch adhesive in enamel walls that was not in agreement with the research by brackett.32 also, in our research, ibond self etch adhesive showed the worst results in enamel margins in both control and bleached groups. this finding is in agreement with the results of researches that showed more microleakage scores for ibond compared to scotch bond multipurpose in unbleached teeth.1932 in another study in contrast to ours, ibond did not exhibit more microleakage scores than scotch bond multipurpose did.33 van meerbeek. classified self etching products as strong, intermediate or mild, according to their ph. strong is referred to those having a ph value of 1 or less and mild are products with ph values about 2. it has been proved that the strong self - etching adhesives create more effective etching patterns in enamel than the milder ones do.12 since ibond has a ph of bout 2.134 and prompt l - pop has a ph of 1 or less, this difference could be the cause of the greater degrees of enamel microleakage in ibond compared to prompt l - pop. the results of this study suggest that in the situation of using scotch bond multipurpose as an adhesive system, bleaching has no significant effect on rising the enamel and gingival microleakage scores of existent restorations. it seems that the appropriate bond in cavity margins3536 are likely to protect the restorations margins from the risk of peroxide penetration. this fact besides it 's least microleakage scores in the control groups, could be the indicators of the effectiveness of this adhesive for clinical applications. for prompt l pop adhesive, bleaching caused a significant rising in microleakage scores in dentinal margin whereas in the enamel, no significant change in microleakage was seen. these findings indicate that dentinal margins may be more affected by bleaching agents when this self - etching adhesive system is used. these effects may be due to less mineral content and more organic matrix of dentin.11 either hydrogen peroxide or carbamide peroxide may denature dentin proteins, resulting in morphological changes that could reduce the bond between resin restorations and dentin.10 the exposure of dentin to bleaching agents reduces microhardness values9 and the alterations in dentinal organic / inorganic composition may also result in changes in mechanical properties of dentin4 that may make it more prone to be affected by bleaching agents. ulukapi. suggested that both pre and post operative bleaching with 10% carbamide peroxide can increase microleakage scores of composite restorations margins.25 these findings are not in agreement with our results regarding scotch bond multipurpose and i bond groups, and would be due to differences between the kinds of adhesives and restorative materials, bleaching time and some other factors. khoroushi.28 showed that light activated bleaching did not significantly affect the microleakage of existing tooth - colored restorations restored with single bond adhesive resin and z100 resin composite, prompt l - pop adhesive resin and f2000 compomer. the findings for prompt l - pop at gingival margin in her study were not similar to ours. maybe using prompt l - pop with f2000 compomer material according to manufactures recommendation led to better dentinal margin sealing. klukowska.27 explored the effects of different concentrations of hydrogen peroxide and carbamide peroxide agents on the enamel margin microleakage of composite restorations. in their study and also in white.29 research, in agreement with ours, bleaching agents could not increase the microleakage scores of filtek z250 bonded with scotch bond. found that postoperative bleaching with carbamide peroxide could increase microleakage in the dentinal margins of composite restorations. under the condition of this study : post operative bleaching could increase the microleakage scores of composite restorations dentinal margins, treated with prompt l - pop self - etching adhesive. however, this procedure did not affect enamel margins.scotch bond multipurpose total etch adhesive exhibited the best enamel and dentinal marginal sealing among bleached groups.ibond showed the most enamel microleakage among unbleached groups of three adhesives. post operative bleaching could increase the microleakage scores of composite restorations dentinal margins, treated with prompt l - pop self - etching adhesive. bond multipurpose total etch adhesive exhibited the best enamel and dentinal marginal sealing among bleached groups. | background : bleaching the discoloured teeth may affect the tooth / composite interface. the aim of this in vitro experimental study was to evaluate the effect of vital tooth bleaching on microleakage of existent class v composite resin restorations bonded with three dental bonding agents.methods:class v cavities were prepared on buccal surfaces of 72 intact, extracted human anterior teeth with gingival margins in dentin and occlusal margins in enamel, and randomly divided into 3 groups. cavities in the three groups were treated with scotch bond multi - purpose, a total etch system and prompt l - pop and ibond, two self - etch adhesives. all teeth were restored with z250 resin composite material and thermo - cycled. each group was equally divided into the control and the bleached subgroups (n = 12). the bleached subgroups were bleached with 15% carbamide peroxide gel for 8 hours a day for 15 days. microleakage scores were evaluated on the incisal and cervical walls. data were analyzed using kruskal - wallis, mann - whitney and bonferroni post - hoc tests (= 0.05).results : bleaching with carbamide peroxide gel significantly increased the microleakage of composite restorations in prompt l - pop group at dentinal walls (p = 0.001). bleaching had no effect on microleakage of restorations in the scotch bond multi - purpose and ibond groups.conclusion:vital tooth bleaching with carbamide peroxide gel has an adverse effect on marginal seal of dentinal walls of existent composite resin restorations bonded with prompt l - pop self - etch adhesive. |
cancer is a major social problem, and it is the main cause of death between the ages 4565 years. in the treatment of cancer, hadron therapy, thus, has great prospects for being used in early stages of tumor disease not amenable to surgery. light particles are often used for radiation therapy because they have a well - defined penetration in tissue, the depth being dependent on the incident energy of the particles and the nature of the irradiated tissue. the other main reason for using these particles in radiation therapy lies in their physical, the ability to deliver the dose to the interest target. beams of charged particles have specific dose distribution, exhibiting a flat entrance dose relatively (plateau), followed by a sharp dose peak, the bragg peak, in which the particles lose rest of their energy. due to their physical and radiobiological properties, they allow one to obtain a more conformal treatment, sparing better the healthy tissues located in proximity of the tumor and allowing a higher control of the disease. indeed, its relative biological effectiveness (rbe) does depend on the linear energy transfer (let) and can become substantially large at the falling edge of the bragg peak [3, 4 ]. treatment planning in radiation therapy uses mathematical and physical formalisms to optimize the delivering a high and conformal dose to the target and limiting the doses to critical structures. the dose tolerance levels for critical structures, as well as the required doses for various tumor types, are typically defined on the basis of decades of clinical experience. then by proper choosing of different types of particles like h and the other light particles can be reduced the relevant dose to critical organs. it is well recognized that h are extremely valuable to treat tumors close to critical structures such head and neck, brain stem, prostate, spinal cord, eye or optic nerves. the main types of radiation therapy induced fatalities that have been widely reported are secondary cancers. so, the most efficient way to prevent these secondary cancers is reducing the amount of dose scattered to the internal organs ; for example choosing a radiation technique or proper particle that minimizes the scattered dose to the other organs. in the regards to the secondary cancers, a recent review showed that secondary tumors occur more frequently in organs that are close to radiation fields, in the high / intermediate dose areas, and that is important to evaluate the scattered dose to those the internal organs along with their secondary cancer. all these light particles deliver different levels of scattered dose to the internal organs and hence may induce different risks of secondary cancers. the aim of this study is to evaluate the amount of the scattered dose to the internal organs situated in the intermediate / high dose region including the spine and nerves, etc. recently, orecchia has been reported that the potential indications for proton therapy to treatment of thyroid cancer is about 50 patients per year in the national center for oncological hadron therapy in pavia, italy. taheri has investigated the potential advantages of intensity modulated h therapy (impt) compared with intensity modulated radiation therapy (imrt) in nasopharyngeal carcinoma. they found that impt plans reduced the averaged mean dose of the thyroid gland by a factor of two related to imrt. in this study, we have calculated the light particles energy deposition in the thyroid gland, for different particles such h, h, he, and he by mcnpx monte carlo code, and estimation of the total photon and neutron production due to interaction of incident particles by tissue, that is very important in order to evaluate the risk of secondary cancers. one of the major concerns in hadron therapy is due to the neutrons and photons. because of their long rang, they can damage the critical organs and increase the probability the secondary cancers. mcnpx is a general purpose monte carlo radiation transport code designed to track many particles over broad ranges of energies. the code deals with transport of more than 40 particles, and coupled transport, such transport of secondary gamma rays and neutrons resulting from different interactions in hadron therapy. it is important that a dose calculation algorithm to be able to model complex and heterogeneous density mediums, as well as, calculating of the primary and secondary particles dose. a cylindrical geometry was used to describe the neck phantom, having 6 cm of length and 6 cm of diameter. the layers of the phantom include 0.12 cm skin, 0.4 cm adipose and 0.6 cm skeletal muscle, after these layers we consider the thyroid gland as cylindrical with 0.6 cm of diameter, vertebrae and spine with 0.4 cm diameters, respectively. figure 1 shows the geometry of the neck phantom and we derived their material compositions and densities from icrp publications. four light particles including h, h, he and he are used in our simulation. geometry of the neck phantom including layers from left to right : 0.12 cm skin, 0.4 adipose, 0.6 cm skeletal muscle, 0.6 thyroid, 1 cm vertebrae, 0.4 spine. we have calculated the energy deposition variation with depth for the same range particles to compare their bragg peaks in the target organ. as well as, the suitable energy interval for scanning of the thyroid organ with step of 1 mev have been obtained : 37 - 53 mev for h, 50 - 71 mev for h, 128 - 190 mev for he and finally 146 - 214 mev for he. light particles slow down in tissue, mainly through myriad coulomb interaction with electrons of atoms. as it is well known, the dominant interactions in tissue are ionization and excitation processes in more 99.9% of energy loss and the rest is belong to the nuclear interactions. in the treatment plan of hadron therapy, the energy of light particles with the same range of 50 mev for h (2.14 cm) in thyroid organ are, 68 mev, 176mev, and 200 mev for h, he, he, respectively. figure 2 shows the variation energy deposition with depth in the neck phantom for these particles. variation of the energy deposition with depth in the neck phantom for any particles with the same range is shown in figure 2. the sharper peak with less width, have more concentration for adjusting beam on the tumor and also beam energy spread. it is well known that the fwhm and peak to plateau ratio (ptpr) are two significant factors that can be studied in treatment planning. these results have been listed in table 1 and show that he with the highest value for ptpr and the minimum value for fwhm factor is a good choice. according to the figure 2, with comparing the particles with same range can be understand the energy deposition in peak rises by increasing of the particle mass and atomic number. peak to plateau ratio and fwhm. in hadron therapy of thyroid gland, vertebrae, spine and nerve can be considered as the critical organs which maybe damaged by the exposure of neutrons and photons secondary particles. we have evaluated the total flux of the secondary particles as recorded in table 2. total flux for photons and neutrons secondary particles per one particle of beam. as it is well known, presence of neutron and photon secondary particles in hadron therapy, a fraction of dose can be deposited inside the thyroid gland and other far organs. tables 3 and 4 indicate that how much energy fractions of neutrons and photons deposited in the tumor and other important healthy organs in the phantom. the obtained results in table 3 and 4 indicated that secondary particles of h beam deposits maximum percentage dose in thyroid gland but the maximum damage for other sensitive organs is related to the h beam. the results illustrated that we have the maximum absorption in thyroid region and then in spine and vertebrae, respectively. (a) dose curves for neutron in sensitive organs and (b) dose curves for photons in sensitive organs. consequently, when assessing the impact of neutron and photon doses, not only the absorbed dose is important but also the neutron and photon energy distribution spectra are essential in radiobiological effects evaluation. the secondary neutrons may have energies up to the primary particle beams energy. based on the hadroinc model, neutrons with energy in excess of 10 mev produced by an intranuclear cascade processes are mainly forward - peaked and below 10 mev neutrons produced by an evaporation process, and are emitted more isotropically. figure 4 shows the simulated energy distribution of neutrons entering the neck by light particle beams. the results show that neutrons produced by h interactions in the patient body have an average energy lower than the neutrons produced by other hardron beams with also wider energy distribution. because of neutron elastic scattering in the soft tissue, there is a prevailing field of low energy. furthermore of low energy neutron dose, a large fraction of the neutron dose is induced by fast neutrons. neutron spectra produced by h, h, he, and he beams. for low energies neutrons, the most likely interaction in the body, because of the presence of hydrogen, is elastic scattering. in the low / thermal energy region, there is a decreasing probability of neutrons slowing down, as low - energy neutrons sparsely interact with the body s material. as a result, an extensive part of the patient s body may be exposed to the secondary photon and neutron radiation fields. the small amount of dose from uncharged particles - neutrons and photons- measurement or simulation is difficult and may be time consuming. in this research, two types of have been done : first, calculation of the secondary particle flux according to the energy of secondary particle, and the second is evaluation of the secondary particle flux according to the primary particle energy. the neutron and photon energy spectra have been illustrated in figures 4 and 5, respectively. spectra of photon flux for (a) h, (b) h, (c) he, and (d) he. the neutron spectra for these particles have significant high intensity smooth peak in low energy region. thermal neutrons have a different and often much larger effective neutron absorption cross section for a nuclides in tissue than fast neutrons, and can therefore often be absorbed more easily by an atomic nucleus, creating a heavier, often unstable isotope as a neutron activation process. after the peak, there is a continuum flat that the intensity is decreased smoothly by increase in neutron energy. the photons flux spectra are important remarkable quantity need to study, deeply. according to the results of simulation, there are some peaks which related to elements that have been specified in figure 5. some peaks are known very well, 4.43 mev from c excitation, 5.22 from cl, 6.13 and 6.92 from o. total neutron and photon production for different energies of h, h, he, and he primary beams have been illustrated in figures 6 - 9. photon production result is fitted by polynomial third order function for h energy, whereas for other beams it is described by a linear function. the figures show that the neutron total flux increased for he, he, h and h, respectively. the total photon flux production due to h, he, he and h are increasing. variation of (a) neutron and (b) photon flux in terms of h energy. variation of (a) neutron and (b) photon flux in terms of h energy. variation of (a) neutron and (b) photon flux in terms of he energy. variation of (a) neutron and (b) photon flux in terms of he energy. in this research, we simulated simplified neck phantom involving a tumor placed in 2.14 cm depth with mcnpx monte carlo code for h, h, he and he. the results show that by increasing the atomic number, the bragg peak becomes sharper and the incident beam can deposit more energy in tumor. as mentioned before, one of the important factor in external therapy is secondary particles that produced by nuclear interaction with tissue. we evaluated the flux and energy deposition of the secondary particles including neutron and photon in critical organs such spine and vertebrae placed after thyroid gland. based on the dose of secondary particles, it can be concluded that h and he are the best therapy choices for thyroid glands whereas h is the worse particle. | background : hadron therapy is a novel technique of cancer radiation therapy which employs charged particles beams, 1h and light ions in particular. due to their physical and radiobiological properties, they allow one to obtain a more conformal treatment, sparing better the healthy tissues located in proximity of the tumor and allowing a higher control of the disease. objective : as it is well known, these light particles can interact with nuclei in the tissue, and produce the different secondary particles such as neutron and photon. these particles can damage specially the critical organs behind of thyroid gland. methods : in this research, we simulated neck geometry by mcnpx code and calculated the light particles dose at distance of 2.14 cm in thyroid gland, for different particles beam : 1h, 2h, 3he, and 4he. thyroid treatment is important because the spine and vertebrae is situated right behind to the thyroid gland on the posterior side. results : the results show that 2h has the most total flux for photon and neutron, 1.944e-3 and 1.7666e-2, respectively. whereas 1h and 3he have best conditions, 8.88609e-4 and 1.35431e-3 for photon, 4.90506e-4 and 4.34057e-3 for neutron, respectively. the same calculation has obtained for energy depositions for these particles. conclusion : in this research, we investigated that which of these light particles can deliver the maximum dose to the normal tissues and the minimum dose to the tumor. by comparing these results for the mentioned light particles, we find out 1h and 3he is the best therapy choices for thyroid glands whereas 2h is the worst. |
protein - based therapeutics such as antibodies, blood derived products, and vaccines have been widely investigated in the past decade to treat a variety of disorders. development of a nanoparticulate - based dosage form of these molecules is still considered as a major challenge by scientists in the drug delivery field. single emulsion (o / w), double emulsion (w / o / w), and emulsion polymerization have been widely employed to prepare nanoparticles. except emulsion polymerization, the other two methods (single and double emulsion) employ organic solvents and sonication during nanoparticle preparation. protein - based therapeutics tend to exhibit rapid denaturation and conformational change due to sonication and exposure to organic solvents [2, 3 ]. these molecules may aggregate and eventually lose their biological activity due to physical and chemical stress observed during formulation development, for example, exposure to organic solvents and sonication. these molecules may also denature or lose their biological activity during storage and lyophilization [46 ]. however, sonication may result in large pressure and temperature gradient which may cause denaturation and aggregation of the protein molecule. moreover, sonication also causes generation of high shear force and free radicals which cause protein denaturation. normally, these nonpolar amino acids are present in the core of the protein structure. as a result, in presence of organic solvents, the native structure and conformation of the protein another crucial formulation - related limitation of protein molecules is their hydrophilicity. due to their hydrophilic nature, these molecules often partition poorly into the polymeric matrix during encapsulation resulting in minimal loading in nanoparticles. due to poor loading of these molecules, a higher amount of polymer poly lactic - co - glycolic acid (plga) is one of the most widely employed biocompatible and biodegradable polymers utilized in the preparation of nanoparticles. however, higher amounts of plga can lower the stability of protein molecules as protein molecules were found to be unstable in presence of lactic acid and glycolic acid which are degradation products of plga [6, 8, 9 ]. hydrophobic ion pairing (hip) complexation based approach has gained wide acceptance in the delivery of peptide and protein based therapeutics [1014 ]. in this approach, ionizable functional groups of a drug molecule are ionically complexed with a surfactant or polymer with oppositely charged functional groups. the resulting drug - polymer or drug - surfactant complex since the hydrophilic protein molecule exists in a complex form which is relatively hydrophobic, its partition into the polymeric matrix can be significantly enhanced during encapsulation [10, 15 ]. protein and polymer (used for hip complexation) primarily interact due to ionic interactions resulting in the formation of a hip complex further, hip complexation would obviate the use of any covalent modification in proteins to impart these molecules more hydrophobicity. covalent modifications may also result in irreversible loss in the biological activity of these molecules. various studies have been performed in the past to understand the nature of protein - surfactant interactions. hip complexation approach has been studied with various peptide and protein based therapeutics such as leuprolide, insulin, melittin, lysozyme, and so forth [1013 ]. hip complexation of protein - based therapeutics has been attempted to overcome various barriers associated with delivery of protein molecules such as bioavailability and stability [13, 16 ]. large molecules usually contain many groups with opposite charges which may hinder the complexation process. so far, basic amino acids have been employed (mainly lysines and arginines) to form a hip complex with anionic surfactant molecules. however, in large protein, aspartic acid and glutamic acid are also present on the surface in significant numbers which would repel the negatively charged complexing molecules. there is usually more surface area per charge in a large protein than for a small protein molecule. hence, selection of a surfactant or polymer with an appropriate chain length is necessary to form the hip complex. these structures are stabilized by various noncovalent interactions such as electrostatic interactions, hydrogen bonds, van der walls forces, and hydrophobic interactions [1719 ]. hence, a complexing agent which would not perturb the secondary and tertiary structure of the protein must be selected. so far, various surfactant molecules have been selected to prepare hip complex. in the present study, we have investigated hip complex formation by employing dextran sulphate, a polysaccharide - based molecule. it is globular in shape and has been widely used as a model protein [20, 21 ]. dextran sulphate, (ds, molecular weight : 920 kda), a polysaccharide - based polymer, has been selected for complexation. in this (s / o / w) emulsion method has been employed to prepare nanoparticles. after preparation, nanoparticles have been characterized with respect to particle size and surface morphology. finally, the effect of hip complexation and nanoparticle preparation on the secondary and tertiary structure of bsa has been studied by circular dichroism and intrinsic fluorescence assay, respectively. materials : bovine serum albumin, dextran sulfate sodium salt (molecular weight 900020000 da), poly (dl - lactide - co - glycolide) (plga 85 : 15, molecular weight of 50,00075,000 da), bicinchoninic acid (bca), and copper sulphate were procured from sigma aldrich. all the solvents and other reagents of analytical grade were purchased from local suppliers and used as received without any further purification. stock solutions of bsa and ds were prepared in citrate buffer ph 4.4 and ddw, respectively. bsa consists of various basic amino acids (60 lysine and 26 arginine residues) while ds contains 2.3 sulphate groups per glucosyl residue. these molar ratios represent the addition of different amounts of ds into previously prepared bsa solution (5 mg / ml in ph 4.4 citrate buffer). once formed, hip complex was vigorously vortexed for 3 minutes followed by centrifugation at 10000 rpm for 10 minutes to separate the supernatant. percentage of complexed bsa was calculated according to the following equation : (1)% complexed bsa=[initial amount of bsa amount of bsa in supernatantinitial amount of bsa ] 100. dissociation of bsa from hip complex was studied to characterize the nature of interaction between bsa and ds. freeze dried complex containing 5 mg of bsa was accurately weighed and incubated in presence of di water and aqueous solution containing 10 mm na2hpo4. these solutions were vortexed and kept for equilibrium for 3 hrs at room temperature. after 3 hrs ftir analysis of bsa, ds, and hip complex was carried out with an infrared spectrophotometer (perkin - elmer, waltman, ma). the samples were brought into intimate contact with the diamond crystal by applying a loading pressure. samples were casted on diamond crystal top - plate of attenuated total reflectance (atr) accessory and scanned between 6501800 cm. spectra obtained using this device represents the average of 32 individual scan possessing a spectral resolution of 4 cm. nanoparticles were prepared by using solid in oil in water (s / o / w) emulsion method published earlier with minor modifications. briefly, 5 mg of bsa in complex form was used for preparation of nanoparticles. two different ratios of bsa : plga 85 : 15 (1 : 5 and 1 : 10) were employed to prepare the nanoparticles. total volumes of methylene chloride and vortexing time were optimized to obtain s / o dispersion. about 4 - 5 ml of methylene chloride was required to completely disperse the hip complex. sonication was performed for about 3 minutes using tip sonicator (fisher 100 sonic dismembrator, fisher scientific) at power output of 2530 w to obtain the fine s / o dispersion. to this s / o dispersion, external aqueous phase (30 ml, 1% pva) was added followed by further sonication for 3 - 4 minutes. this procedure resulted in s / o / w nanoemulsion which was kept on a shaker bath at room temperature for 1520 minutes followed by complete evaporation of methylene chloride using a rotavap. following evaporation, the nanodispersion was centrifuged for 50 minutes at 22,000 g. nanoparticles were washed two times with di water to remove any surface bound bsa and pva. similarly, blank nanoparticles were also prepared by employing only polymer (plga 85 : 15) in similar amounts. entrapment efficiency was measured according to an earlier published protocol [20, 21 ] with minor modifications. briefly, 1ml of nanosuspension was added to 9 ml of methylene chloride solution which was then vortexed for 1015 minutes to dissolve the polymer completely. later, this solution was subjected to centrifugation which resulted in formation of a protein pellet. methylene chloride was carefully separated and the pellet was dissolved in 10 ml of pbs buffer. absorbance from the samples were corrected by subtracting the absorbance from blank nanoparticles prepared using plga 85 : 15. previously published protocol was followed to measure the mean particle size and polydispersity of nanoparticles using a dls instrument (brookhaven inst. particle size analysis was carried out at an operating angle of 90c and temperature of 25c. a dilute sample of the nanosuspension was taken for particle size analysis, and at least three measurements of each batch were carried out. for sem analysis, freeze dried specimen was applied on a sticky carbon film positioned on an aluminum stub. specimens were sputter coated with gold - palladium and observed with the field - emission sem xl30 (fei, hillsboro, or). for tem study, a drop of nanosuspension was deposited on tem cooper grid with carbon film. after drying, hip complex was dissociated in presence of 1 ml of 10 mm na2hpo4 solution, and free bsa was quantified using bca assay. previously prepared plga nanoparticles were incubated in presence of 1 ml of 10 mm na2hpo4 solution and kept overnight. bsa released from the nanoparticle formulation was quantified on the following day with bca assay. finally, standard solution of bsa was prepared in 10 mm na2hpo4 solution and used as a control. final concentration of each sample was adjusted to 0.05 mg / ml. circular dichroism (cd) spectra were collected using jasco 720 spectropolarimeter at room temperature. the spectra of all the samples were collected over a range of 200250 nm with a cuvette of 1 cm path length at a scan speed of 20 nm / min. data was further processed for blank subtraction and noise reduction and an average of three signals was recorded. fluorescent measurements were carried out at room temperature with fluorescence spectrophotometer (photon technology international). the procedure to recover bsa after dissociation of hip complex and from nanoparticles has been mentioned previously. standard and test samples were prepared in 10 mm na2hpo4 solution (final bsa concentration was adjusted to 0.1 mg / ml). we compared fluorescence spectra of standard with bsa obtained after dissociation from hip complex and bsa released from nanoparticles. all samples were excited at a wavelength of ex 295 nm, and emission spectra were collected between 310400 nm. ex 295 nm was chosen to selectively excite tryptophan amino acid of bsa. proteins and peptides represent a rapidly growing class of therapeutic drugs with more than 200 biopharmaceuticals in the market and many more at different stages of development. design of nanoparticle - based formulations for protein - based therapeutics has become a major challenge for drug delivery scientists because of poor encapsulation in polymeric matrix and rapid denaturation in presence of organic solvents and sonication [2, 3 ]. hip complexation based approach can be explored to deliver peptide and protein - based therapeutics. it can overcome various stability related issues, enhance drug loading in nanocarriers and improve drug permeation across biological membrane [1014, 22 ]. so far, hip complex based approach has been only studied with small peptide and protein - based therapeutics. hence, bsa was selected as a model protein in the present study because of its higher molecular weight (66.3 kda) and well - known secondary and tertiary structure. isoelectric point (pi) of bsa is 4.5, and the protein consists of various basic amino acids (60 lysine and 26 arginine residues). hence, we have slightly altered the ph of bsa solution and prepared stock solution of bsa at ph 4.4 in citrate buffer. being hydrophilic in nature, these amino acids are mostly found on the protein surface. amino groups of these basic amino acids are protonated based on the ph of surrounding medium. at this ph, this data confirms the importance of ph of the protein solution prior to hip complexation. in general, it is crucial to understand the effect of ph on stability of protein molecule. one should also consider the possibility of other stability related issues which may arise by changing the ph of protein solution prior hip complexation. the effect of molar ratios of ds / bsa on hip complex formation has been studied. we calculated the molar ratios based on the total number of lysine amino acids present on the surface of bsa (60 lysine amino acid). hip complexes were prepared using the following molar ratios of ds / bsa (0.29, 0.58, 0.87, and 1.15). theoretically, these molar ratios represent the amounts of ds added which was sufficient to complex with 15, 30, 45, and 60 basic amino acids of bsa. figure 1 shows the complexation of bsa with ds at different molar ratios.an excellent correlation is observed between increments in the molar ratio of ds / bsa with the amount of bsa complexed with ds (figure 1).in fact at a molar ratio of 1.15, more than 90% of bsa molecules were ionically complexed with ds. this data clearly indicates the involvement of basic amino acids in the formation of hip complex. we also hypothesized ionic interactions as a driving force for complexation of bsa with ds. in order to confirm our hypothesis, we performed dissociation studies of the hip complex in presence of oppositely charged ions (hpo4). when hip complex was incubated in di water, no dissociation of bsa from hip complex was observed. however, the presence of 1 ml of 10 mm na2hpo4 solution caused complete dissociation of the hip complex and the solution became clear. these data further confirm the presence of ionic interactions between amino group of basic amino acids in bsa and sulphate group of ds. dissociation of hip complex in presence of counter ions has also been reported by other investigators [13, 15 ]. ftir study was performed to understand the nature of interactions between amino group of basic amino acids in bsa and sulphate group of ds. ftir analysis was performed by other investigators to characterize ionic interactions between oppositely charged functional groups [12, 23, 24 ]. due to overlapping shift in a ftir spectrum following are the characteristic peaks of sulphate group of ds in the ir region : (a) 802 cm : s - o - s vibration, (b) 1017 cm : symmetric soo stretching vibration, and (c) 1225 cm : asymmetric soo stretching vibration. appearance of these peaks in the ir spectra is close to previously published results [2325 ]. due to ionic interaction between amino and sulphate groups in hip complex, the peak intensity of the sulphate group in the ir region may be attenuated significantly. these results clearly indicate a significant reduction in the peak intensities of sulphate group in the ir region which again confirmed the presence of ionic interactions between amino and sulphate groups in the hip complex. this method of preparation offers significant advantages over conventional methods of nanoparticles preparation such as single and double emulsion method. in the conventional methods of preparation, protein is initially dissolved in an aqueous phase and later emulsified in the presence of an organic phase using sonication. most protein denaturation occurs during this stage of nanoparticle preparation due to water - organic phase interface. excessive stress during sonication process and generation of free radicals can cause protein unfolding and denaturation. in s / o / w emulsion method, protein - polysaccharide powder was employed in the preparation of nanoparticles instead of protein in solution form. further, in the powder form, kinetic mobility of the protein is restricted compared to solution form [20, 21 ]. moreover, complexation with ds would not only restrict conformational flexibility of bsa but would also impart additional steric shielding to the protein molecule. we optimized the total volume of organic solvent needed and the sonication time to prepare nanoparticles. nanoparticles were also characterized with respect to particle size (table 1) which range between 150200 nm. one of the important goal of the present study was to achieve higher encapsulation of bsa in nanoparticles by employing minimal amounts of polymer (plga 85 : 15). nanoparticles were prepared by employing two different ratios of protein : plga (1 : 5 and 1 : 10). bsa entrapment in nanoparticles was more than 65% in both cases (table 1). this data clearly shows a significant entrapment of bsa in plga matrix. as the amount of plga was increased to prepare nanoparticles, entrapment of bsa in nanoparticles was enhanced as well. this could be attributed to enhanced hydrophobic interactions of bsa in hip complex with plga polymer. due to these hydrophobic interactions, partition of bsa (in hip complex form) in the polymeric matrix of plga was also significantly enhanced. the effect of hip complexation and nanoparticle preparation on secondary structure of bsa was evaluated by cd spectra. weak physical interactions such as electrostatic interactions, hydrogen bonds, van - der - waals forces, and hydrophobic interactions stabilize secondary structure of the protein. during hip complex formation, so, it is quite possible that ds has altered the native conformation of bsa. similarly, during nanoparticle preparation, powder form of bsa - ds complex was sonicated in presence of organic solvents. cd analysis was performed to understand the impact of these formulation factors on secondary structure of bsa. figure 6 depicts the cd spectra of standard bsa solution, bsa obtained from dissociation of hip complex, and bsa released from both batches of nanoparticles. results clearly show a significant overlap in peak shape throughout the region studied. this data also confirms that the secondary structure of bsa was not perturbed due to hip complexation or treatment with organic solvent and sonication. enhanced stability of bsa towards organic solvents and sonication may be explained by the following reasons. first, hip complexation might have provided conformation stability and steric shielding to the bsa molecule. moreover, with s / o / w emulsion method, the probability of protein denaturation has been significantly minimized compared to conventional method such as w / o / w emulsion method. in s / o / w emulsion method, protein molecules are encapsulated in the solid state relative to w / o / w emulsion method where solution form of protein is employed. in the solid state, the detrimental effect of sonication at water - organic phase interface is also minimal. we compared the intrinsic fluorescence spectra of freshly prepared bsa with bsa obtained after dissociation from hip complex and bsa released from different batches of nanoparticles. changes in the fluorescence intensity, wavelength of maximum fluorescence emission, and quantum yield are accepted parameters to study tertiary structure of protein. it is very clear from this data that intensity and wavelength of maximum fluorescence (335 nm) are similar in all the samples. this data confirmed that tertiary structure of bsa was not significantly altered following dissociation from hip complex and also after release from nanoparticles. this result also corroborates with our previous cd spectra results where we have observed no significant change in secondary structure of bsa due to hip complexation and nanoparticle preparation. this study for the first time shows the feasibility of forming hip complex of a large protein such as bsa with dextran sulphate as a complexing polymer. this study confirms the involvement of basic amino acids in the formation of hip complexation. dissociation studies of hip complex in presence of oppositely charged ions (hpo4) as well as ftir studies have revealed presence of ionic interactions between basic amino acids in bsa and sulphate groups of ds. we successfully prepared and characterized nanoparticles of bsa in hip complex form using s / o / w emulsion method. sem and tem studies revealed smooth surface and spherical shape of nanoparticles. significant entrapment of bsa in nanoparticles was obtained when low amounts of plga 85 : 15 was employed. finally, cd analysis and intrinsic fluorescence data revealed that secondary and tertiary structures of bsa were not affected due to hip complexation and nanoparticle preparation. hip complexation approach can be employed to enhance loading of large proteins including antibody - based therapeutic molecules in colloidal dosage forms. | the objective of the present study is to formulate and characterize a nanoparticulate - based formulation of a macromolecule in a hydrophobic ion pairing (hip) complex form. so far, hip complexation approach has been studied only for proteins with molecular weight of 1020 kda. hence, we have selected bovine serum albumin (bsa) having higher molecular weight (66.3 kda) as a model protein and dextran sulphate (ds) as a complexing polymer to generate hip complex. we have prepared and optimized the hip complex formation process of bsa with ds. ionic interactions between basic amino acids of bsa with sulphate groups of ds were confirmed by ftir analysis. further, nanoparticles were prepared and characterized with respect to size and surface morphology. we observed significant entrapment of bsa in nanoparticles prepared with minimal amounts of plga polymer. finally, results of circular dichroism and intrinsic fluorescence assay have clearly indicated that hip complexation and method of nanoparticle preparation did not alter the secondary and tertiary structures of bsa. |
we focused on the geographic range of denvs in latin america and the caribbean, where dengue is widespread and expanding in range. we attempted to identify areas contiguous with previously known dengue - endemic zones where new denv transmission is occurring by using reports of recent outbreaks. known dengue - endemic areas were defined as dengue risk areas identified by the us centers for disease control and prevention (atlanta, ga, usa) health information for international travel (commonly referred to as the yellow book), 2010 (7) and 2012 (8) editions. each edition of this book reflects the known distribution of dengue risk in the prior 2 years. to characterize spread according to the yellow book, we identified areas that were classified as no known dengue risk in 2010 but were changed to risk areas in the 2012 edition (hereafter referred to as new dengue - endemic areas). outbreak data for december 1, 2009march 18, 2011, were collected from healthmap (http://www.healthmap.org/en/an), an open access online infectious disease outbreak monitoring system (9,10). healthmap integrates outbreak - related data from > 30,000 electronic sources, including the news media, promed - mail, and other electronic public health reporting sources, by using algorithms to classify the diseases and locations associated with each report. because we wanted to identify spread into new dengue - endemic zones, we limited our analyses to areas that were identified as having no known dengue risk in the 2010 yellow book but that were contiguous with > 1 risk areas in the 2010 yellow book. we fitted a bivariate gaussian mixture model to the extracted healthmap alerts to model a continuous surface of outbreak density (technical appendix). this modeled outbreak probability density surface represents a risk map of recent denv spread into areas of previously unknown dengue endemicity according to the 2010 yellow book (figure 1). we compared our map with the geographic distribution of new dengue - endemic areas identified in the 2012 yellow book. details of the datasets, models, and statistical methods are available in the technical appendix. b) central mexico ; c) central south america ; d) eastern amazonas, brazil.. areas to which dengue was identified in the 2010 yellow book are shaded in gray. new dengue - endemic areas identified in the 2012 yellow book are outlined in blue. modeled healthmap alert probability density surface is shown in a gradient from yellow to red with yellow areas predicted as having lower alert densities and red areas predicted as having higher alert densities according to the model. areas outlined with heavy black solid lines were classified as high healthmap alert density but were not identified in either yellow book edition as dengue risk areas. areas outlined with heavy black dashed lines were classified as low healthmap alert density but were identified in the 2012 yellow book as areas at risk for dengue. figure 1 shows that high dengue outbreak activity occurred adjacent to previously recognized dengue - endemic zones in 6 states in central mexico and in parts of northern argentina, southern brazil, bolivia, and paraguay. we used receiver - operating characteristic analysis with cross - validation (figure 2) to set a threshold dengue report density that best identifies new dengue - endemic areas (figure 1 ; technical appendix). of the 19 new dengue - endemic areas reported in the 2012 yellow book, this threshold identified 14 (74%) as being at elevated risk of endemicity, according to the dengue outbreak probability density estimated by our model. of the 41 areas that remained unidentified as dengue - endemic areas in the 2012 yellow book, our model classified 35 (85%) as having reduced risk of endemicity. receiver - operating characteristic plot of 5-fold cross - validated healthmap alert density - based classification with new dengue - endemic areas identified by the 2012 yellow book as the standard. when compared with the yellow book, our model incorrectly classified 6 areas as at elevated risk (figure 1). all alerts in these areas described outbreaks of cases acquired in a nearby known dengue - endemic region of the country. one alert also warned of the recent discovery of dengue vector mosquito larvae by the local surveillance program. the model also classified 5 yellow book dengue - endemic areas as at reduced risk (figure 1). although other explanations likely exist, the low observed sensitivity in these areas illustrates certain limits of any system that relies on internet - based information flow for monitoring disease spread. electronic event based surveillance systems such as healthmap and others are frequently used by public health authorities, travelers, physicians and patients, to gain a real - time understanding of global outbreak activity. the healthmap dengue feed, denguemap, is currently part of the online dengue information resource of the centers for disease control and prevention (http://www.cdc.gov/dengue/). used in combination with traditional case reporting, healthmap and other electronic surveillance systems have proven value for enhancing the timeliness of outbreak discovery and information dissemination (11). however, these information sources may also provide added value for monitoring ongoing spread. although the signal of denv activity detected by healthmap is relatively robust, it has certain limitations. first, the signal tends to be sparse in areas with limited reporting because of low population density or incomplete coverage by the news or social media. second, the signal can be surrounded by background noise because separating reports caused by cases in travelers from true autochthonous transmission is difficult with automated methods. by limiting our analysis to areas contiguous with known dengue - endemic areas and smoothing outbreak alerts into an outbreak - density surface although this analysis was performed retrospectively, the timeliness of this signal far outperforms any traditional surveillance data stream. passive case report - based surveillance systems typically operate at a delay of weeks to months, which limits their value for providing a picture of geographic spread, especially on an international scale where surveillance delays may be even more prolonged. we have demonstrated a novel approach to real - time monitoring of recent expansion of denv activity in latin america. using outbreak reports captured by healthmap, we identified a signal of geographic expansion of dengue activity that would precede official reports of the geographic distribution of dengue - endemic areas. currently, no reliable surveillance system is in widespread use that reports the distribution of denv activity on an ongoing basis and enables near real - time monitoring of trends in geographic expansion. such a system should enhance the ability of regional and global public health authorities to dynamically allocate resources within a time frame that might effectively avert a full - blown epidemic. like other large - scale surveillance data sources, our results must be interpreted cautiously. however, when used in conjunction with traditional surveillance methods, our approach has the potential to provide a timely estimate of changes in the geographic distribution of dengue, a critical component of targeted prevention and control efforts. bivariate gaussian mixture model applied to extracted healthmap alerts to model a continuous surface of outbreak density. | dengue, a potentially fatal disease, is spreading around the world. an estimated 2.5 billion people in tropical and subtropical regions are at risk. early detection of outbreaks is crucial to prevention and control of dengue virus and other viruses. case reporting may often take weeks or months. therefore, researchers explored whether electronic sources of real - time information (such as internet news outlets, health expert mailing lists, social media sites, and queries to online search engines) might be faster, and they were. although information from unofficial sources should be interpreted with caution, when used in conjunction with traditional case reporting, real - time electronic surveillance can help public health authorities allocate resources in time to avert full - blown epidemics. |
melatonin, the main product of the pineal gland, is found in high concentrations in other body fluids and tissues [1, 2 ] and possesses anti - inflammatory and antioxidant actions [36 ]. we have evaluated the prophylactic as well as the therapeutic effect of melatonin in heatstroke rats under general anesthesia and showed the therapeutic effects of melatonin on heatstroke - induced multiple organ dysfunction syndrome. according to a more recent review, the ischemic and oxidative damage to the hypothalamus during heatstroke may cause multiple organ dysfunction or failure through hypothalamic - pituitary - adrenal (hpa) axis mechanisms. studies are warranted to know whether the heatstroke - induced brain (or hypothalamic) inflammation and damage, thermoregulatory deficits, and multiple organ dysfunction can be affected by melatonin therapy in an unanesthetized and unrestrained mouse model [1012 ]. to deal with the hypothesis, we assessed the temporal profiles of cellular markers of ischemia (e.g., glutamate and lactate / pyruvate ratio), damage (e.g., glycerol), inflammation (e.g., tumor necrosis factor - alpha (tnf-), interleukin-1 (il-1), il-10, and myeloperoxidase (mpo) activity), and oxidative damage (e.g., prooxidant enzymes (e.g., lipid peroxidation and glutathione oxidation), anti - oxidant defenses (e.g., glutathione peroxidase (gpx), and glutathione reductase (gr), oxidant radicals, nitric oxide metabolites (nox), and dihydroxybenzoic acid (dhba)) in the hypothalamus that occurred after heat regimen in mice treated with or without melatonin therapy. in addition, the influence of melatonin therapy on the heatstroke - induced thermoregulatory deficits as well as increased plasma levels of multiple organ dysfunction or failure [1012 ] was assessed. present studies were performed in male icr mice (2937 g), whose stock originated from the institute of cancer research of the national institutes of health in the usa. they were purchased from the national animal center (taipei, taiwan) and kept under a 12-hour light - dark cycle at controlled temperature (21 2c) with free access to food and tap water. institute of cancer research male mice 8 to 10 weeks old were exposed to whole body heating (wbh ; 41.2c ; relative humidity 50%55% ; 1 h) in an environment - controlled chamber [1012 ]. the heat - stressed mice were returned to the normal room temperature (26c) after the end of the heat exposure. mice that survived to day 4 of heat treatment were considered survivors, and the data were used for analysis of the results. core temperatures were measured every 1 min with a copper constant thermocouple inserted into the rectum and connected to a thermometer (hr1300 ; yokogawa, tokyo, japan). before the start of thermal experiments, mice were housed at an ambient temperature (26c) below the neutral zone for this species. after 1-hour heating period, animals were properly fed and hydrated. in separate experiments, 4 h post - wbh, animals were sacrificed and their brains and blood were obtained for biochemical verification [1012 ]. three hundred mice were randomly divided into 3 major groups : (a) nonheated mice treated with vehicle solution (n = 60) : these groups of animals were s.c. injected with one dose of 0.2 ml of 0.25% ethanol - saline immediately post - wbh ; (b) heated mice treated with vehicle solution (n = 60) ; and (c) heated mice treated with melatonin (n - acetyl-5-methoxytryptamine) (0.2 mg / kg, 1 mg / kg, or 5 mg / kg) immediately post - wbh (n = 180). in experiment 1, effects of heat exposure on body core temperature and % survival of different groups of mice were assessed (n = 60). in experiment 2, effects of heat exposure on cellular ischemia and damage markers in brain (or hypothalamus) of different groups of mice were measured (n = 60). in experiment 3, effects of heat exposure on inflammatory mediators in brain (or hypothalamus) of different groups of mice were measured (n = 60). in experiment 4, effects of heat exposure on oxidative stress markers in brain (or hypothalamus) of different groups of mice were measured (n = 60). in experiment 5, effects of heat exposure on serum levels of multiple organ dysfunction indicators, acth, and corticosterone of different groups were measured (n = 60). hypothalamic samples were homogenized in 0.05 m phosphate buffer at ph7.0 and then centrifuged at 4000 g for 20 min at 4c. the supernatants were used for the determination of cellular levels of glutamate, lactate - to - pyruvate ratio, glycerol, nitric oxide, and hydroxyl radicals. the dialysis probe (4 nm in length c cma/12 ; carnegie medicine, stockholm, sweden) was put into the supernatants to obtain the dialysates. the nitric oxide (nox) concentration in the dialysates of hypothalamus was measured with the eicom eno-20 nox analysis system (eicom, kyoto). in the eicom eno-20 nox analysis system, after the no2 and no3 in the sample have been separated by the column, the no2 reacts in the acidic solution with the primary aromatic amine to produce an azo compound. following this, the addition of aromatic amines to the azo compound results in a coupling that produces a diazo compound, and the absorbance rate of the red color in this compound lactate - to - pyruvate ratio, and glycerol, the dialysates were injected onto a cma600 microdialysis analyzer (carnegie medicine, stockholm, sweden). the concentrations of hydroxyl radicals were measured by a modified procedure based on the hydroxylation of sodium salicylates by hydroxyl radicals, leading to the production of 2,3-dihydroxybenzoic acid and 2,5-dihydroxybenzoic acid. lipid peroxidation was assessed by measuring the levels of malondialdehyde (mda) with 2-thiobarbituric acid (tba) to form a chromophore absorbing at 532 nm. about 0.1 g of tissue was homogenized with 1.5 ml of 0.1 m phosphate buffer at ph3.5. the reaction mixture (0.2 ml of sample, 1.5 ml of 20% acetic acid, 0.2 ml of 8.1% sodium dodecyl sulfate, and 1.5 ml of aqueous solution of 0.8% tba, up to 4 ml with distilled water) was heated to 95c for 1 h, and then 5 ml of n - butanol and pyridine (15 : 1 vol / vol) was added. the mixture was vortexed vigorously and centrifuged at 1500 g for 10 min, and the absorbance of the organic phase was measured at 532 nm. the values were expressed as nanomoles of tba - reactive substances (mda equivalent) per milligram of protein. tissues were homogenized in 5% 5-sulfosalicylic acid (1 : 10 wt / vol) at 0c, and the supernatants were used for analysis of total and oxidized glutathione. total glutathione (reduced - form glutathione (gsh) + oxidized - form glutathione (gssg)) was analyzed according to the tietze method, and gssg was determined as described by griffith. the recycling assay for total glutathione is oxidized by 5,5-dithiobis (2 acid) (dtnb) to give gssg with stoichiometric formation of 5-thio-2-nitrobenzoic acid. gssg is reduced to gsh by the action of the highly specific glutathione reductase (gr) and nicotinamide adenine dinucleotide phosphate (reduced form ; nadph). the rate of 5-thio-2-nitrobenzoic acid formation is followed at 412 nm and is proportional to the sum of gsh and gssg present. tissues were homogenized in 0.05 m phosphate buffer, ph7.0 and then centrifuged at 4000 g for 20 min at 4c. the gpx and gr activities were performed with a commercial gpx assay kit (sigma, usa) and a gp assay kit (sigma, usa), respectively. one unit of gpx and gr activity was defined as the amount of sample required to oxidize 1 mmol of nadph per minute based on the molecular absorbance of 6.22 10 for nadph. mpo activity, an indicator of polymorphonuclear leukocyte accumulation, was determined in the hypothalamus as described previously at 4 hours after heat stress. mpo activity was defined as the quantity of enzyme degrading 1 mol of peroxide / min at 37c and was expressed in milliunits / gram of wet tissue. the homogenates were incubated on ice for 30 min and then centrifuged (15,000 g, 30 min, 4c) twice. the concentrations of these cytokines in the supernatants were determined by commercially available elisa kits (r & d systems, minneapolis, mn, usa) according to the manufacturer 's instructions. optical densities were read on a plate reader set at 450 nm for these cytokines. the concentrations of these cytokines in the samples were calculated from the standard curve multiplied by the dilution factor and were expressed as pg / g. creatinine, blood urea nitrogen (bun), alanine aminotransferase (alt), aspartate aminotransferase (ast), and alkaline phosphatase (alp) were estimated in blood samples collected 4 hours after the start of heat stress or the equivalent time point for the nonheated animals. the serum levels of creatinine, bun, alt, ast, and alp were determined by spectrophotometry (hitachi 7600, tokyo, japan). plasma corticosterone and acth were assessed using corticosterone double antibody ria kit (mp biomedicals, solon, oh, usa) and acth (rat, mouse)-ria kit (phoenix pharmaceuticals, burlingame, ca, usa), respectively. all values in the tables and text are expressed as mean s.e.m. of n observations, where n represents the number of animals studied. statistical evaluation was performed by using analysis of variance (anova) followed by a multiple - comparison test (scheffe 's test). a p value of less than 0.05 was considered to be statistically significant. as summarized in table 1, the body core temperature values of heated mice were significantly lower than those of nonheated mice kept at a normal ambient temperature (26c) (33.2 0.2c and 37.2 0.3c, resp.) additionally, the fraction survival of heated mice was significantly lower than those of nonheated mice (1/12 and 12/12, resp.) the heat - induced hypothermia and lethality were significantly reduced by melatonin therapy (table 1 and figure 1). table 2 summarizes the effects of heat exposure on cellular levels of glutamate, lactate - to - pyruvate ratio, glycerol, nitrite, and dhba in the hypothalamus in different groups of mice. as compared with nonheated mice, the heated mice had higher levels of glutamate, lactate - to - pyruvate ratio, glycerol, nitrite, and dhba in the hypothalamus (p 40c immediately after the termination of wbh and profound hypothermia at + 4, + 6, and + 20 h after. we further demonstrate that heat - induced hypothermia in mice can be significantly and dose - dependently prevented by melatonin therapy. however, the contention is not consistent with the findings of leon., who reported on mice exposed to an ambient temperature of ~39.5c until a maximal core temperature of 42.7c was attained. during their recovery, the mice had hypothermia (29.3c) and, after 24 h of recovery, a fever - like elevation (37.8c). the hypothalamus is believed to be involved in regulating homeostasis, motivation, and emotional behavior ; these functions are mediated through hypothalamic control of autonomic and endocrine activity. the hypothalamus allows the output of pituitary hormones to response to changes in the autonomic nervous system activity and to the needs of temperature regulation, water balance, and energy requirements. the hypothalamo - pituitary - adrenocortical (hpa) axis is also mobilized, as suggested by the increase in c - fos - positive cells and c - fos mrna content in the hypothalamic paraventricular nucleus, as well as the increase in blood adrenocorticotrophic - hormone (acth) and corticosterone concentrations [27, 28 ]. decreased heat tolerance has been associated with hpa axis impairment. more than half a century ago, thermal injury to the thermoregulatory centers of the hypothalamus was hypothesized to be the primary mechanism of mortality. indeed, according to a more recent review, ischemic and oxidative damage to the hypothalamus may be responsible for heatstroke. severe heat stress also decreases mean arterial pressure, increases intracranial pressure, and decreases cerebral perfusion pressure, all of which lead to cerebral ischemia and hypoxia. compared with normothermic controls, rodents with heatstroke have higher values of cellular ischemia (e.g., glutamate and lactate - to - pyruvate ratio) and damage (e.g., glycerol) markers, prooxidant enzymes (e.g., lipid peroxidation and glutathione oxidation markers), proinflammatory cytokines (e.g., interleukin-1 and tumor necrosis factor-), inducible nitric oxide - synthase - dependent nitric oxide and an indicator for the accumulation of polymorphonuclear leukocytes (e.g., myeloperoxidase activity) as well as neuronal damage (e.g., apoptosis and necrosis) in the hypothalamus after heat stroke. hypothalamic values of antioxidant defenses (e.g., glutathione peroxidase and glutathione reductase), however, are lower. melatonin therapy, in addition to attenuating heat - induced hypothermia (thermoregulatory deficits), significantly attenuates heat - induced inflammatory, ischemic and oxidative damage to the hypothalamus. furthermore, our present results demonstrated that melatonin therapy significantly enhanced hpa axis mechanisms (as reflected by increased plasma levels of both acth and corticosterone in response to heat stress), led to reduction of multiple organ dysfunction or failure (as reflected by decreased plasma levels of bun, creatinine, alt, ast, and alp), and resulted in attenuation of lethality in heatstroke mice., melatonin improved the clinical outcome of the septic newborns as judged by measurement of sepsis - related serum parameters via reducing the serum levels of lipid peroxidation products. a major brain metabolite of melatonin acts as a potent nitric oxide scavenger, inhibitor, and/or downregulator of neuronal and inducible nitric oxide synthase and as a mitochondrial metabolism modulator. melatonin protected against mitochondrial reactive oxygen species - mediated apoptosis in astrocytes and isoproterenol - induced myocardial injury in the rat via its antioxidative mechanism. melatonin also may attenuate peritonitis - induced lethality in conscious rats by exerting its antioxidant effect. these observations prompted us to think that these multiple mitochondrial layers of protection provided by melatonin may be crucial for future therapeutic prevention and treatment of heatstroke. systemic inflammatory response syndrome is characterized by increased serum levels of tnf-, icam-1, e - selectin, il-1, and il-6 [3740 ]. increased levels of these systemic inflammatory response syndrome molecules have also been shown in patients or rats. in addition, the increased serum levels of these molecules during heatstroke in an anesthetized rat model could be reduced by melatonin treatment. the present results further showed that the increased levels of some of these molecules in the hypothalamus in a mice could also be reduced by melatonin. additionally, melatonin therapy increased the hypothalamic levels of il-10 in heatstroke, which was believed to be anti - inflammatory cytokine. these results indicate that melatonin may reduce heat - induced activated inflammation by reducing the levels of these systemic inflammatory response molecules in the hypothalamus. it is known that melatonin intensifies the expression of protective heat shock proteins and that it enhances heat shock protein 27 expression as well as having anti - inflammatory properties and antioxidant properties. in summary, we report here that when untreated mice underwent heat stress, they displayed thermoregulatory deficit (e.g., animals display hypothermia during room temperature exposure), brain (or hypothalamic) inflammation, ischemia, and oxidative damage, hpa axis impairment, multiple organ dysfunction or failure, and lethality. melatonin therapy may improve outcomes of heatstroke in mice by reducing brain inflammation and oxidative damage, and multiple organ dysfunction. | we report here that when untreated mice underwent heat stress, they displayed thermoregulatory deficit (e.g., animals display hypothermia during room temperature exposure), brain (or hypothalamic) inflammation, ischemia, oxidative damage, hypothalamic - pituitary - adrenal axis impairment (e.g., decreased plasma levels of both adrenocorticotrophic hormone and corticosterone during heat stress), multiple organ dysfunction or failure, and lethality. melatonin therapy significantly reduced the thermoregulatory deficit, brain inflammation, ischemia, oxidative damage, hypothalamic - pituitary - adrenal axis impairment, multiple organ dysfunction, and lethality caused by heat stroke. our data indicate that melatonin may improve outcomes of heat stroke by reducing brain inflammation, oxidative damage, and multiple organ dysfunction. |
the goal of implantation of multifocal intraocular lenses (miols) is restoration of vision over a range of distances and reduction of spectacle dependence after cataract surgery. miols generally provide vision at various distances by either concentric rings with different focusing powers (refractive miols) or division of light into two or more images with different diffractive orders (diffractive miols), among which the diffractive bifocal design provides vision mainly at distance and near. in clinical practice, there are patients who do not have cataract but only suffer from presbyopia. refractive lens exchange (rle) can be a permanent surgical solution to correct the preexisting refractive error and presbyopia. previous studies [24 ] have reported good visual outcomes at distance and near after rle with diffractive bifocal miol in presbyopic, non - cataractous patients with good preoperative visual acuity (va). however, the intermediate vision, which is important for most people in daily activities, for example, computer use, shopping, and cooking, was rarely reported. compared a group of patients who underwent rle in a clinic setting with a population from a cataract surgery registry and found that the former group was significantly younger. since younger presbyopic patients seeking rle are less likely to have complaints at intermediate distance and implantation of diffractive bifocal miols can lead to the loss of natural accommodation, the overall impact of rle is unknown. these patients not only expect substantial gain in near vision after rle but are also concerned about potential losses in distance and intermediate vision. [amo ], santa ana, ca) is a diffractive miol with a bifocal design and equal light energy distribution between the distance and near portion of the miol [610 ]. implantation of the three - piece tecnis miol, the zma00 (amo), provided excellent distance and near vision in patients after cataract surgery [8, 11 ] and rle. in three recent studies [6, 12, 13 ] that evaluated the performance of the single - piece tecnis miol, the zmb00 (amo), all patients underwent cataract extraction and the postoperative intermediate vision was not reported. in the current study, we evaluated the va at distance, intermediate, and near ; contrast sensitivity and visual symptoms ; and spectacle dependence in patients without cataracts who underwent rle with implantation of the zmb00 6 months postoperatively. because this group of patients had good vision preoperatively, we could fully assess the potential of this miol. this retrospective case series included patients who underwent rle with implantation of the zmb00 in one or both eyes between november 2010 and may 2013 at the hong kong sanatorium and hospital. the inclusion criteria were + 1.25 diopters (d) or more of presbyopia, corrected distance va (cdva) of 20/20 or better in the operated eye, cdva of 20/25 or better in the unoperated eye (for unilateral rle), and availability of data on the distance - corrected va at 6 months postoperatively. the exclusion criteria were an iol other than the zmb00 implanted in either eye, time interval exceeding 6 months between the first- and second - eye implantation (for bilateral rle), cataract, other preexisting ocular conditions (i.e., age - related macular degeneration, or glaucoma), systemic diseases that might affect the postoperative vision (e.g., uncontrolled diabetes mellitus), and a history of corneal refractive surgery. this surgeon generally recommends bilateral surgery to hyperopes and high myopes and unilateral surgery first for low myopes and emmetropes with low presbyopia (+ 1.50 d). the zmb00 is a single - piece foldable acrylic diffractive miol with + 4 d near addition (about + 3.2 d at the spectacle plane). the miol has a biconvex design with an anterior aspheric surface and a posterior diffractive surface. the overall diameter is 13 mm and the optic diameter is 6 mm. the energy distribution between the distance and near foci is symmetrical (50/50) and independent of pupillary size. all surgeries were performed under topical anesthesia (oxybuprocaine 0.4%) and intracameral lidocaine 1% or 2%. preoperatively, the surgeon used nepafenac ophthalmic suspension 0.1% (nevanac, alcon laboratories inc., fort worth, tx) and 0.5% tropicamide 0.5%-phenylephrine hydrochloride 0.5% (mydrin - p, santen pharmaceutical co., ltd., a 2.25 mm clear corneal incision was created either superiorly or temporally with a keratome. discovisc ophthalmic viscosurgical device (alcon laboratories inc.) was injected into the anterior chamber and a manual continuous curvilinear capsulorhexis was created with a forceps. after hydrodissection and nuclear splitting, coaxial phacoemulsification was performed using the infiniti vision system (alcon laboratories inc.). irrigation / aspiration of the residual cortex and posterior capsule polishing were performed using a coaxial system. limbal relaxing incision was indicated when the corneal astigmatism was 0.75 d. the iol power calculation was based on the srk / t and haigis formulas. a comprehensive eye examination was carried out preoperatively, which included a detailed history taking particularly for dry eyes, visual distortion, systemic diseases (e.g., thyroid dysfunction and uncontrolled diabetes mellitus), and rheumatoid symptoms, slit - lamp biomicroscopy to assess dry eye, corneal irregularity, and cataract, and fundus examination especially for macula to exclude epiretinal membrane or pigmentary changes. follow - up examinations were scheduled 1 day, 1 week, and 1, 3, and 6 months postoperatively. the data that were extracted included the preoperative noncycloplegic subjective refraction and cdva ; postoperative noncycloplegic subjective refraction, uncorrected distance va (udva), cdva, scotopic cdva, uncorrected intermediate va (uiva) at 67 cm, distance - corrected intermediate va (dciva) at 67 cm, uncorrected near va (unva) at 30 cm, and distance - corrected near va (dcnva) at 30 cm ; photopic contrast sensitivity at the spatial frequencies of 3, 6, 9, and 18 cycles per degree and scotopic pupillary size. the intermediate vision at 67 cm and near vision at 30 cm were measured using the sloan two - side edtrs format near vision chart (precision vision, la salle, il) (designed for use at 40 cm). the actual va at its corresponding distance was calculated by the visual angle subtended and then converted to the logarithm of the minimum angle of resolution (logmar) for statistical analyses [3, 14 ]. the photopic contrast sensitivity was recorded using the csv-1000e (vector vision, greenville, oh). photopic and scotopic assessments were performed at 85 and 3 candelas / m, respectively. the patients were asked to complete a questionnaire at the 6-month visit (after the second - eye surgery for bilateral rle) regarding visual symptoms (halos, night glare, and starbursts), satisfaction, and spectacle independence (at distance, intermediate, and near). the patients rated the level of visual symptoms from 0 to 5 (0, none ; 1, very mild ; 2, mild ; 3, moderate ; 4, severe ; 5, very severe) and satisfaction from 1 to 5 (1, very dissatisfied ; 2, dissatisfied ; 3, neutral ; 4, satisfied ; 5, very satisfied). other data assessed included the axial length, anterior chamber depth (both measured with the iolmaster, carl zeiss meditec ag, oberkochen, germany), average keratometry (measured with a manual keratometer), and iol power. the wilcoxon signed - rank test was used to compare the preoperative cdva and postoperative cdva and preoperative and postoperative refraction. the pearson correlation was used to identify a relationship between the scotopic pupillary size and va at different distances. the mann - whitney u test was used to compare the level of visual symptoms and satisfaction between patients with unilateral and bilateral implantations. in the subgroup of patients who underwent bilateral implantation, the mann - whitney u test was used to compare the satisfaction between patients who were emmetropic (manifest refraction spherical equivalent [mrse ] within 0.50 d and refractive astigmatism within 0.50 d in both eyes) and ametropic preoperatively. the fisher 's exact test was performed to assess the relationship between spectacle independence and unilateral / bilateral rle. the mean age of 28 patients (7 men, 21 women ; 9 underwent unilateral rle and 19 underwent bilateral rle) was 52.0 5.3 years (sd) (range, 40 to 62). the mean preoperative refractive error was 1.45 3.95 d (range, 12.50 to + 3.75) sphere and 0.45 0.46 (range, 0.00 to + 1.75) cylinder with mrse of 1.22 3.92 d (range, 12.38 to + 4.00). the mean preoperative near addition was 2.04 0.47 d (range, 1.25 to 3.25). the mean iol power was 19.93 5.06 d (range, 8.0 to 27.5). the mean postoperative refractive error of the 47 eyes was 0.16 0.50 d (range, 1.25 to 1.25) sphere and 0.37 0.38 (range, 0.00 to 1.25) cylinder with mrse of 0.03 0.44 d (range, 1.00 to 1.50). the mean preoperative and postoperative values for sphere, cylinder, and mrse did not differ significantly (p > 0.05 for all comparisons). postoperatively, 25 (53%) and 43 eyes (91%) achieved a mean mrse of 0.25 d and 0.50 d, respectively. the mean error of the mrse from the target refraction was + 0.23 0.42 d (range, 0.70 to 1.39). table 1 shows the mean monocular vas ; figures 1, 2, and 3 show the cumulative percentages of monocular vas at the 6-month visit. thirty - five (74%) and 45 eyes (96%) had an udva of 20/20 or better, respectively. the scotopic cdva was similar to the photopic cdva in that 40 of 42 available eyes (95%) achieved 20/20 or better. measurement of the near vision at 30 cm showed that 40 (85%) and 45 eyes (96%) achieved an unva and dcnva of 20/32 or better, respectively. measurement of the intermediate vision at 67 cm showed that 29 (62%) and 22 eyes (47%) achieved an uiva and dciva of 20/40 or better, respectively. the mean scotopic pupillary size was 5.17 1.01 mm (range, 3.50 to 8.00). the scotopic pupillary size was not correlated significantly with the cdva (r = 0.102, p = 0.550), scotopic cdva (r = 0.265, p = 0.119), dciva (r = 0.318, p = 0.055), or dcnva (r = 0.063, p = 0.713). seven eyes (15%) had a one - line loss of cdva (5 eyes from 20/15 to 20/20 and 2 eyes from 20/20 to 20/25), of which one eye had mild posterior capsular opacification. twenty (74%), 22 (81%), and 10 patients (37%) reported halos, night glare, and starbursts, respectively. the differences in the median score for all visual symptoms between unilateral and bilateral rle group was not significant (p = 0.117, 0.164, and 0.766, resp.), and the median satisfaction score also did not differ significantly between the groups (p = 0.097) (table 2). twenty - six patients (96%) reported a satisfaction score of 3 or higher. the remaining one patient (4%) who underwent bilateral rle procedures had a score of 2 ; she did not require spectacle at any distance but reported moderate halos and night glare and very severe starbursts. additional analysis of satisfaction was performed according to the preoperative refractive error for the bilateral rle group. no significant difference was found between emmetropes (n = 3 ; median, 3 ; range, 35) and ametropes (n = 3 ; median, 4 ; range 25) (p = 0.614). data on spectacle independence were available for 25 patients (table 3), of which two patients (12%) in the bilateral rle group required spectacles for intermediate and near vision, respectively ; one patient (6%) required spectacles for both intermediate and near vision ; and two patients (25%) in the unilateral rle group required spectacles at different distances. since the introduction of miols, presbyopia can be corrected by crystalline lens exchange, that is, rle. patients who undergo rle generally are younger and have higher expectations regarding refractive and visual outcomes than those with cataracts. to enable patients to be spectacle - free while engaging in daily activities, the miol must provide adequate functional vision at various distances. in the current study, this is consistent with the results from previous studies of the zmb00 [6, 12, 13 ] and zma00 [3, 8, 11 ]. the adoption of a similar design to the zma00, which has a good modulation transfer function value at distance for different pupillary sizes, could explain the result. similar findings have been reported with other bifocal diffractive miols, for example, the restor sn6ad3/sn60d3 (alcon laboratories inc.) [4, 1621 ] and at lisa 809 m (carl zeiss meditec ag) [22, 23 ]. the distance va of the zmb00 did not worsen under scotopic condition because of the pupillary - independent full diffractive optic design. moreover, the contrast sensitivity was maintained in the normal range when compared to a population cohort, because the aspheric anterior surface corrected the spherical aberration from the cornea [10, 11, 13, 16, 17, 22, 23, 25, 26 ]. regarding near vision, the zmb00 in the current study provided a mean dcnva of 20/25, which was within the range of the reported values with schmickler. (20/28) and other diffractive miols with a similar near addition (+ 3.75/+4 d), for example, the at lisa 809 m, zma00, and restor sn6ad3/sn60d3 (range, 20/3220/20 at 3040 cm) [4, 1620, 22, 23 ]. despite good distance and near vision, relatively poor intermediate vision is a disadvantage of bifocal diffractive miols because of the limitations of the optical design, as illustrated by measurement of the intermediate va at various distances [3, 10, 1620, 23, 27 ] and the defocus curves [13, 16, 17, 20, 25, 28 ]. the mean dciva in the current study was 20/44, which agreed with the studies that reported the monocular dciva of other bifocal diffractive miols with + 3.75-d or + 4-d near addition (range, 20/5020/25 at 5080 cm) [3, 1720, 23 ]. this also agrees with the intermediate va provided by the zmb00 measured with a binocular defocus curve of about 20/50 that schmickler. since our patients were young presbyopes (mean age, 52.0 years) and still retained some accommodative ability preoperatively, they might not have much difficulty with computer work. therefore, the implanted miol must provide usable intermediate vision ; otherwise complaints of worsening overall intermediate vision may arise, especially after bilateral implantation. at an intermediate distance of 67 cm, an estimated va of 20/73 in fact, with bifocal diffractive miols, minimal light energy is distributed to the area that provides intermediate vision [9, 28, 29 ]. however, pupillary size affects the intermediate vision of miols, depending on the optical design and near addition of the miol [810, 25, 26, 29, 30 ]. we found that a smaller scotopic pupil was correlated with better photopic intermediate va although not significantly so. this agreed with the results that smaller pupillary size favored the intermediate vision of the restor sn60d3/sn6ad3 and the zma00/tecnis zm900 in terms of va [8, 10, 26 ] and image sharpness. in contrast, the results for the restor sn6ad1 were conflicting [25, 29, 30 ] because of the lower near addition (+ 3 d). alfonso. proposed that the effect of pupillary size on intermediate vision could be a weighted combination of higher order aberration, energy distribution, depth of focus (i.e., pinhole mechanism), and neural processing. since the zmb00 has the same energy distribution between the distance and near foci across all pupillary sizes, future studies can measure both the scotopic and photopic intermediate va to identify a correlation with pupillary sizes under different light conditions for this particular miol. spectacle independence is a useful measure of the performance of a miol. in most previous studies, miols were implanted bilaterally [4, 10, 11, 13, 14, 16, 18, 19, 21, 27 ]. in contrast, the current study included a unilateral rle group in which the unoperated eyes had a wide range of refractive errors, which might have affected the spectacle independence. for instance, very high myopia in an unoperated eye may require correction and the patient may experience discomfort due to aniseikonia. however, mild to moderate myopia (e.g., 1 d) may help intermediate vision and eliminate the need for spectacles. therefore, we focused more on the bilateral rle group for the analysis of spectacle independence. we found that implanting the zmb00 bilaterally provided complete spectacle freedom for distance, intermediate, and near vision in most patients (82%). this is consistent with the results reported by schmickler. that 88% of patients achieved spectacle freedom at distance and near with bilateral implantation of the zmb00. two patients (patients 1 - 2, table 4) underwent unilateral rle and reported needing spectacles at different distances postoperatively. the mrse of the unoperated eye for them was near plano and 3.50 d, respectively, which did not help the intermediate vision. on the other hand, two patients (patients 3 - 4) in the bilateral rle group required spectacles for intermediate and near tasks, respectively. the other patient was a quality - control inspector who required excellent near vision ; she wore near spectacles postoperatively even though she had good unva in both eyes. since then, we routinely clarify preoperatively and exclude patients whose work requires very fine vision. another patient (patient 5) had good uiva and unva but still preferred spectacles for intermediate and near tasks. a previous study showed that bilateral implantation of miol significantly improved distance, intermediate, and near vision as a result of neural summation. in contrast, hayashi. suggested that unilateral implantation of a miol in younger patients with unilateral cataract preserved the intermediate vision of the unoperated eye and provided useful binocular vision at all distances. according to our findings, the refractive error in the unoperated eye in the unilateral rle group was a decisive factor in spectacle independence. this, together with the preoperative intermediate vision (as indicated from the near addition), is important for deciding between unilateral or bilateral rle. the accommodative demand at 67 cm is only 1.50 d. therefore, emmetropes with low presbyopia, for example, + 1.50 d, can undergo surgery in the nondominant eye only ; otherwise they may complain that they have lost their good intermediate vision. patients frequently report visual symptoms after implantation of miols [3, 19, 21, 23, 27, 32 ], which are important causes of postoperative dissatisfaction. about 80% of the current patients reported halos and night glare, while less than half reported starbursts. nevertheless, the overall satisfaction was still high (score 3 in 96% of the patients). schmickler. reported that better preoperative va is a predictor of lower postoperative satisfaction. in the current study, no patients had cataracts ; therefore, the surgeons had to be cautious regarding patient expectations. as mentioned previously, preoperative near addition is also a consideration when deciding the laterality of implantation and might have contributed to patient satisfaction. our patients were well informed that implantation of a miol is associated with the risk of losing one - line of cdva (slight distance blurriness), worsening in intermediate vision, decreased contrast sensitivity (sharpness in vision), visual symptoms, and residual refractive error requiring spectacles or lasik enhancement. the current study had some limitations. we realized that the data on visual symptoms and spectacle independence were more informative in the bilateral than unilateral rle group, but the visual outcomes in the unilateral group were still useful for evaluating the optical performance of the miol. finally, we lacked data on binocular va and defocus curves for comparison between unilateral and bilateral rle groups. a prospective study should be conducted to address the limitations and further investigate this miol. in conclusion, we showed that the zmb00 provided satisfactory visual outcomes at various distances and a high rate of spectacle independence. with bilateral implantation, 82% of patients did not need spectacles in their daily activities, including intermediate tasks. surgeons must discuss with patients, especially younger patients who undergo a rle, the possibility of reduced intermediate vision. | purpose. to report visual outcomes and patient satisfaction after unilateral or bilateral refractive lens exchange (rle) with a single - piece bifocal diffractive multifocal intraocular lens (miol). methods. all patients underwent rle with the zmb00 miol (abbott medical optics). patient charts were reviewed to evaluate the distance, intermediate, and near visual acuity (va), contrast sensitivity, extent of visual symptoms (05), satisfaction (15), and rate of spectacle independence between unilateral and bilateral rle group. results. forty - seven eyes of 28 patients were included. no intraoperative complications developed. mean monocular uncorrected va at distance, intermediate (67 cm), and near (30 cm) were 0.01 0.12 (standard deviation), 0.27 0.18, and 0.15 0.11, respectively. no eyes lost > 1 line of corrected distance va. monocular contrast sensitivity remained at normal level. median scores of halos, night glare, and starbursts for 27 patients were 2.0, 3.0, and 0.0, respectively. median score of satisfaction was 4.0. there were no differences in visual symptom scores or satisfaction between unilateral and bilateral group (p > 0.05). eighty percent of 25 patients reported total spectacle freedom, with similar rate between bilateral (82%) and unilateral group (75%) (p = 1.000). conclusions. rle with the bifocal diffractive miol was safe in presbyopic patients and resulted in a high rate of spectacle independence. |
portal hypertension is the most common complication of chronic liver disease, leading to the development of ascites, portal - systemic encephalopathy, and gastroesophageal varices. hemorrhage from gastroesophageal varices is among the most lethal complications of cirrhosis and portal hypertension. esophageal varices develop at a rate of 5% per year in patients with cirrhosis and portal hypertension [1, 2 ]. in patients with esophageal varices, hemorrhage occurs at a yearly rate of 5 - 15% [1, 2 ]. esophageal variceal bleeding is associated with a 15 - 20% early mortality [1, 2 ]. in patients who survive the initial hemorrhage, the risk of rebleeding is as high as 60% within 2 years, with a 33% mortality. because of the high mortality associated with variceal hemorrhage, as well as the high likelihood of rebleeding after a first episode, the treatment of portal hypertension includes attempts at preventing the first bleed (primary prophylaxis), management of acute variceal hemorrhage, and the prevention of rebleeding (secondary prophylaxis) [1, 2 ]. primary prophylaxis constitutes treatment with a non - selective beta - blocker to reduce portal pressure. for those who can not tolerate beta - blockade, endoscopic therapy in the form of endoscopic variceal band ligation can be performed and repeated until the varices are obliterated. in those patients who have recovered from acute esophageal variceal hemorrhage, secondary prophylaxis or prevention of further variceal bleeding should be performed in the form of endoscopic variceal ligation, in addition to portal pressure - reducing medication. the treatment of choice for bleeding esophageal varices is a combination of pharmacologic therapy with somatostatin and its analogues (such as octreotide) or terlipressin, and endoscopic therapy, preferably variceal ligation [1, 2 ]. blood spurting or oozing from a varix confirms the diagnosis of variceal hemorrhage, however in most cases the bleeding has ceased by the time endoscopy is performed. it is therefore important for the endoscopist to identify and recognize signs of recent variceal hemorrhage. the most commonly seen stigmata are red color signs, including red wale marks (longitudinal red streaks on varices that resemble red corduroy wales), cherry red spots, and hematocystic spots (raised discrete red spots on the surface of varices that appear as blood blisters) [1, 3, 4 ]. a less commonly recognized stigma of recent variceal hemorrhage is a white nipple - like projection from a varix into the esophageal lumen [1, 2, 4, 5, 6 ]. this platelet - fibrin plug, also referred to as the ' white nipple sign ', is indicative of a site of recent bleeding [1, 4, 5, 6 ]. recognition of this stigma of recent hemorrhage is necessary so that endoscopic therapy may be performed in order to prevent further variceal bleeding [4, 5, 6 ]. a 53-year - old male with a past medical history of alcoholic cirrhosis, hypertension, and depression presented to the emergency department with a history of hematemesis of frank red blood and clots. admission vital signs were : heart rate 83, respiratory rate 18 with spo2 94% and blood pressure 188/99 mm hg. physical examination revealed no jugular venous distention. admission laboratory data included inr 1.3, wbc 4,400/l, hemoglobin 12.2 g / dl, and platelets 51 106/l. his basic metabolic panel revealed serum sodium 143 mmol / l, potassium 3.6 mmol / l, chloride 103 mmol / l, bicarbonate 28 mmol / l, bun 6 mg / dl and creatinine 0.6 mg / dl. ast and alt were 60 and 154 u / l respectively, alkaline phosphatase 201 u / l, total bilirubin 1.6 mg / dl, total protein 7.8 g / dl and albumin 3.3 g / dl. in the emergency department, he was started on octreotide infusion and given intravenous pantoprazole. emergent endoscopy revealed grade ii - iii esophageal varices without any active bleeding. there were no red wale markings or other red color signs. however, one of the larger varices had a protuberant white spot (fig. it was then inadvertently dislodged with gentle suctioning, resulting in brisk hemorrhage (fig. 2). variceal band ligation was promptly performed with successful control of bleeding (fig. 3). the patient was monitored in the intensive care unit post - procedure and was maintained on octreotide infusion for 96 h. antibiotic prophylaxis with intravenous piperacillin - tazobactam was initiated. he continued to demonstrate hemodynamic stability without evidence of recurrent bleeding and was transferred out of the intensive care unit 2 days later. the remainder of the hospitalization was uneventful and the patient was successfully discharged home 6 days after admission on beta - blocker therapy. though not widely mentioned as a stigma of recent variceal hemorrhage, this finding was first reported by chung and lewis in 1984. they described it as a white nipple on top of a varix protruding into the lumen and noted its presence in up to 5% of cases of variceal bleeding. it was thought to represent a platelet - fibrin plug at the site of recent variceal rupture. they noted that dislodgement would be accompanied by jet - like bleeding and called it ' mount st. two prospective studies have evaluated the finding of the ' white nipple sign ' as a diagnostic sign of recent hemorrhage. siringo. evaluated the white nipple sign prospectively in 203 separate admissions for esophageal variceal bleeding in 145 cirrhotic patients. endoscopic therapy was not initially delivered to these patients in order to evaluate the risk of rebleeding. they felt that the white nipple sign was diagnostic of a varix that had recently bled but found that it had no adverse prognostic significance. in another study done in taiwan, 166 patients with recent variceal hemorrhage were prospectively studied with respect to presence or absence of the white nipple sign and to risk of rebleeding following endoscopic therapy. the authors noted a white nipple sign in 21% of their cases of variceal hemorrhage. they concluded that the white nipple sign suggested recent variceal hemorrhage and was more likely to be seen if endoscopy was performed soon after the bleeding episode. our case reaffirms the finding of a white nipple sign as a definite stigma of recent variceal hemorrhage. it is likely that endoscopists are not as familiar with this sign as they are with red color signs. as chung and lewis initially suggested, it should ' alert the endoscopist to take urgent measures to avert a disaster '. recognizing it as such, attempts to dislodge the lesion must be avoided and endoscopic therapy should be undertaken. | blood spurting or oozing from a varix confirms the diagnosis of variceal hemorrhage. in most cases of variceal hemorrhage, however, the bleeding has ceased by the time endoscopy is performed. endoscopists rely on identification of stigmata of recent hemorrhage to determine whether varices are the cause of bleeding and to predict the likelihood of rebleeding. most of the attention has focused on red color signs, such as red wale markings, described by beppu. [gastrointest endosc 1981;27:213 - 218 ] and well known to endoscopists. here we describe our experience with a less recognized stigma of variceal hemorrhage known as the white nipple sign, which resulted in active hemorrhage when manipulated. |
arterial dissection is the second leading cause of stroke in patients younger than age 45 (lisovoski and rousseaux, 1991). current endovascular recanalization approaches for acute stroke focus on either removal of the distal clot using either a retrieval device or aspiration, or displacement via angioplasty and/or self - expanding stent. this approach is problematic in the setting of cervical carotid or vertebral dissection because microcatheter and microguidewire navigation across the dissection has the potential to enlarge the false lumen. we present a case of an acute carotid terminus occlusion caused by clot from a cervical carotid dissection initially worsened by attempts at gaining microcatheter access to the distal clot. however, with proximal flow arrest and primary aggressive proximal guide catheter aspiration, we were able to successfully recanalize the internal carotid artery and its branches, leading to a better than expected clinical outcome. a 34-year - old man was driving a car when he was hit by another car causing the vehicle to spin completely around. he walked away from the accident with neck discomfort but no neurologic deficits. a week later, he developed sudden onset complete left arm weakness and global aphasia. intravenous thrombolytics were given, and he was transferred to our hospital with a national institute of health stroke scale score of 16. initial cervical carotid catheter angiography revealed a right posterior cervical carotid intimal flap indicating an intimal - media arterial dissection (figure 1). cerebral views showed delayed anterograde filling in the internal carotid artery associated with a carotid terminus occlusion (figure 2). attempts at advancing a penumbra 41 reperfusion catheter (penumbra inc, alameda, ca, usa) intracranially were unsuccessful because the edge of the reperfusion catheter could not be advanced past the dissection flap at the distal cervical carotid artery (figure 3). subsequent angiography showed a more proximal occlusive lesion, suggesting that the intimal flap had extended into the petrous carotid with further compromise of the luminal diameter (figure 4). right lateral common carotid digital subtraction angiography cervical view showing an intimal flap and smooth tapered cervical carotid dissection extending up to the cervical / petrous junction. right lateral common carotid digital subtraction angiography cerebral view showing markedly delayed anterograde flow in the internal carotid artery with a supraclinoid occlusion and flow defects in petrous and cavernous section of carotid artery. right lateral common carotid digital subtraction angiography cervical view showing microguidewire in the dissected segment of cervical carotid artery, worsening the underlying pathology. right lateral common carotid digital subtraction angiography cerebral view showing a near occlusive intimal flap at the cervical petrous section. using a merci 8f balloon guide catheter (concentric medical, mountain view, ca, usa), a merci 18l (concentric medical, mountain view, ca, usa) microcatheter was advanced over a microguidewire into the m1 segment. using standard technique, with a pull lasting 23 min, an l6 merci retrieval device (concentric medical, mountain view, ca, usa) retrieved some clot but only timi the microcatheter was again advanced up into the m1 segment, a l5 merci retriever (concentric medical, mountain view, ca, usa) deployed, the balloon inflated, and this time, more aggressive proximal aspiration was performed using a 60-cc syringe. the retriever was visualized under fluoroscopy not to deform its shape during the entire withdrawal, which again lasted only about 1 min, suggesting little or no clot was engaged or retrieved. subsequent angiographic runs, however, demonstrated timi 3 recanalization of the internal carotid artery with a persisting but non - occlusive intimal flap along the petrous / cervical section (figure 5). after proximal flow arrest and aggressive proximal guiding catheter aspiration, timi 3 flow in the internal carotid is restored. the dissection is now seen to extend into the petrous section, but is not flow limiting. once flow was restored, we decided against placing a stent into the cervical and petrous sections of the carotid artery. the patient had already received 0.9 mg / kg of intravenous t - pa hours before. we felt that he would have an unacceptably high risk of hemorrhagic transformation by adding the loading dose of abciximab as a prerequisite for stent placement. mri and mra of the head and neck was done the following day, showing a stable appearance to the dissection and a right superior division mca territory stroke (figure 6). he was discharged from the hospital 5 days later with an nihss of 1. six weeks later, his nihss score remained 1 with slight word finding difficulties and mra showed persistence of the right cervical / petrous dissection. he was maintained on anticoagulation for 6 months and on 12 month followup, his nihss score was 0 and he was back to work in construction. diffusion weighted mri showing increased signal in a superior division middle cerebral artery branch territory. in patients younger than age 45, arterial dissection is a leading cause of stroke (lisovoski and rousseaux, 1991 ; schievink., 1994). carotid artery intimal tears leading to dissection usually occur a few centimeters distal to the carotid bulb, at the c2c3 level, and the dissection usually extends distally until the carotid artery enters the foramen lacerum. the typical angiographic finding is a relatively smooth or slightly irregular tapered mid - cervical narrowing (provenzale, 1995). carotid subintimal dissections are dynamic lesions, and depending on the size, can cause just minor luminal narrowing, or complete occlusion. as a result, symptoms are variable and can range from cranial nerve compromise, to a horner 's syndrome, to ischemia in vascular territories distal to the lesion. most ischemic symptoms occur within 1 week of the onset of pain, as was the time course in this patient (biousse., 1995). most infarctions are territorial, rather than borderzone, indicating an embolic rather than hemodynamic etiology (provenzale, 1995). increasing familiarity with endovascular revascularization devices allows us to tailor our approach based on our attempts at understanding stroke pathophysiology. mechanical revascularization of severe carotid dissections using microcatheters and wires may worsen the underlying pathology. dissections are delicate, dynamic lesions that are not easily navigated around using existing biplane angiographic imaging. with an occlusive distal clot, furthermore, in the acute phase, anterograde blood flow is steadily applying a force underneath the intimal flap, predisposing it to worsen. with conscious sedation rather than general anesthesia being a commonly used, patient movement during the procedure is not only to be expected, but adds additional challenge to not only discerning the false from the true lumen, but also navigating a microcatheter past the lesion (abou - chebl., 2010). pharmacologic, intra - arterial thrombolysis may also be problematic in the setting of acute stroke caused by arterial dissection. published small case series of intra - arterial thrombolysis for acute stroke due to arterial dissection have not shown significant rates of rupture of dissected vessels, cervical or subarachnoid hemorrhage, intracranial hemorrhage, or peri - interventional arterial embolism (arnold., 2000). however, chemical thrombolytics such as urokinase or t - pa carry the theoretical risk of extending the arterial wall hematoma, independent of the microcatheter inadvertently widening the false lumen. another approach to this complicated scenario is to treat and stabilize the cervical carotid or vertebral dissection first, thereby facilitating access to the distal intracranial thromboembolus. several reports have described cervical carotid angioplasty and stent placement as treatment option for arterial dissection (abboud. this approach may have a role in not only acute recanalization, but also for secondary stroke prevention, permitting immediate and durable recanalization of the artery but associated with use of dual antiplatelet therapy instead of anticoagulation. first, the passage of a wire or embolic protection device and stent delivery catheter past the dissection may, again, widen the false lumen. secondly, distal embolic protection devices may not be as easily used as the dissected segment often extends to the cervical / petrous section. another concern for stent placement in a dissected artery is the weakened structural integrity of the vessel wall, unlike that of an atherosclerotic vessel wall, which is the pathology for which this device is designed to treat. the vessel may be undergo additional injury with either balloon angioplasty and/or stent placement. lastly, dissected segments, unlike atherosclerotic lesions for which currently available stents are designed for, are often much longer, and difficult to accurately determine the proximal and distal margins. accurately reopposing proximal aspiration through an 8f guiding catheter has been previously described in case reports to treat carotid bulb occlusion (xu., 2005). however, without a proximal balloon and the ability to induce flow arrest, they were limited in their ability to mechanically disrupt the clot for fear of distal emboli. in both cases however, pretreatment angiography suggested a significant clot burden that was amenable to aggressive proximal aspiration. the concept behind proximal flow control to support retrieval of thrombus was published prior to the release of the merci retrieval system in 2004. it was based on the concept that anterograde flow maintained the clot in place like a cork, and reducing this force would then facilitate its removal (mayer., 2002). in our case, precious time was spent gaining access and attempting to retrieve the distal clot with microcatheters and wires. furthermore, at one point, the dissection was worsened as a result of these maneuvers. we were most successful with recanalization when we applied proximal flow arrest followed by aggressive proximal aspiration through the 8f guide catheter situated below the dissection. fortunately, placing the end of the guide catheter at the level of the carotid bulb appears safe as most carotid dissections occur just distal to the bulb. proximal flow arrest with proximal aspiration appears to be a safe and effective adjunctive technique for these lesions. some may argue that aspiration alone may have accounted for the recanalization. as such, the dissection is not mechanically disturbed by attempts at advancing a microcatheter past it. furthermore, flow reversal is associated with a retrograde force on the intimal flap that may facilitate re - apposition of the normal arterial layers. an analogous situation occurs with an occlusive lesion that extends from the distal cervical carotid to the supraclinoid carotid with intact interhemispheric flow via the anterior communicating artery. again, passing any type of device through or within the distal aspect of the clot runs the risk of compromising the functioning circle of willis collaterals. a proximal - to - the - clot approach may have an advantage of preserving the circle of willis collaterals. the use of acute endovascular stroke therapy for a large artery ischemic stroke secondary to arterial dissections involves unique modifications to the conventional procedural protocol. this case review highlights the importance of careful navigation of any microcatheters, wires, and devices across the arterial dissection, as well as the potential utility of aggressive aspiration via a large bore guiding catheter proximal to the dissection. ethics approval statement : this study was approved by rush university medical center, chicago, il, usa, irb#07110702. the author declares that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest. | in the setting of an acute stroke caused by arterial dissection, navigating a microcatheter and microguidewire past the dissected artery to gain access to the distal thromboembolic lesion may exacerbate the underlying pathology. we review a case report whereby successful recanalization of an acute carotid terminus occlusion due to intimal - media dissection in the cervical carotid artery emphasizing the importance of aggressive proximal guide catheter aspiration in conjunction with flow arrest from the carotid bulb proximal to the dissection. we discuss the strengths and limitations of this approach and underscore the importance of a pathology - based approach to acute stroke therapy. |
pulmonary sclerosing hemangioma (sh) was first described by liebow and hubbell in 1956 (1). sh is thought to be a rare benign neoplasm, but it has uncertain histogenesis and biologic behavior. sh comprises a mixture of four histologic patterns, such as papillary, sclerotic, solid and hemorrhagic. sh consists of two cell types ; eosinophilic cuboidal epithelial lining cells and round cells with either eosinophilic or clear cytoplasm forming sheets. the lining epithelial cells are termed as surface or cuboidal cells, while the other as round, stromal, or lesional cells. although sh originally termed a variant of hemangioma (1), subsequent authors have suggested the origin of sh as mesenchymal (2), mesothelial (3) and neuroendocrine (4) derivation. now there is a consensus that they are epithelial tumors (5, 6). the finding that sh has features of a neoplasm was the reason for its being moved from the category of tumor - like lesions in the 1981 world health organization (who) classification of lung tumors (7) to the category of miscellaneous tumors in the new 1999 who / international association for the study of lung cancer classification (iaslc) (8). we reviewed the clinicopathologic features of sixteen cases diagnosed as sh including five cases with unusual presentations. all sixteen cases of pulmonary sh diagnosed in the department of pathology, samsung medical center, seoul, korea, from 1996 to september, 2003 were retrieved (table 1). hematoxylin and eosin - stained slides were reviewed to reconfirm the diagnosis and to find the multiple histologic features by two experienced pathologists. immunohistochemical stainings were performed on paraffin - embedded tissue of all 16 cases using labeled streptavidin - biotin peroxidase technique. the panel of antibodies included anti - thyroid transcription factor-1 (ttf-1) (1:50, dako, glostrup, denmark), anti - pancytokeratin (ae1/3, 1:80, zymed, san francisco, ca, u.s.a.), anti - epithelial membrane antigen (ema) (1:50, dako), antisynaptophysin (1:40, dako), chromogranin (1:2,000, dako), cd34 (1:100, dako), cd56 (1:20, monosan, uden, netherlands), smooth muscle actin (sma) (1:100, dako), p53 protein (bp 53.12, 1:400, zymed) and ki-67 (1:100, dako). a case was regarded as positive for ttf-1 if more than 10% of the specific cell population showed nuclear staining. the mean age of the patients ranged from 37 to 73 yr (mean 50.6 yr). among the 16 cases, there was marked female predominance, with a female to male ratio of 15:1. one case of sh was located at the interlobar fissure of the lung, one was a visceral pleural - based pedunculated lesion and the rest were intraparenchymal lesion. six tumors were located at the left lower lobe, four at the right middle lobe, three at right lower lobe, two at the left upper lobe, and one at the right upper lobe. the size of sh ranged from 0.3 cm to 8 cm (mean 2.6 cm) in 17 masses out of 16 cases. macroscopically, the tumors were rather well circumscribed and mostly pale yellowish and dark red in color if they were of hemangiomatous variety. the major histologic patterns composed of a variable proportion of all four patterns in 9 out of 17 masses. hemorrhagic pattern was observed in all except for the smallest one (0.3 cm). all tumors composed of more than two histologic patterns and none demonstrated a single pattern (table 1). the tumors were composed of varying proportions of two cell types, namely surface ' lining cells ' or ' cuboidal ', and pale polygonal ' lesional cells ' or ' round cells '. these lining cells resembling type ii alveolar cells were most prominent in the areas with papillary pattern (fig. the round lesional cells were pale round cells showed uniform, medium - size polygonal nuclei with moderate amounts of pale, eosinophilic or clear cytoplasm. mitotic figures were rarely seen in the cell population of the two cases. there were scattered alveolar macrophages, multinucleated giant cells, clumps of hemosiderin pigments, mast cells and eosinophils. occasionally psammoma bodies were seen in five cases, cholesterol clefts in three cases and intralesional adipose tissue in one case. immunohistochemical study showed that both surface cells and round cells of sh were diffuse positive for ttf-1 in nucleus (fig. 1f), and negative for synaptophysin, chromogranin, cd34 and sma in all cases. cd56 however, round cells rarely reacted with cytokeratin except one case that showed focal positivity for cytokeratin (fig. the index of positivity of p53 protein ranged from negative to 20% (mean 6%) and the ki-67 labeled proliferating index ranged from negative to 10% (mean 4.5%). we experienced five unusual presentations of sh including one case with two nodules (1.2 cm and 0.3 cm) and multiple small atypical alveolar hyperplasia (aah)-like nodules in background of the lung parenchyma. one case showed papillary adenocarcinoma - like area, and one case with one sh having regional lymph node metastasis. one case showed an alveolar adenoma - like area, and one case revealed a visceral pleural - based pedunculated mass that presented as a mediastinal mass clinically. the first case is a 42-yr - old female patient who was found to have a right lower lobe mass on chest radiograph without subjective symptoms. the size of the two tumors were 1.2 cm and 0.3 cm, respectively (fig. the first case of 1.2 cm sized nodule showed four histologic patterns of papillary, solid, sclerotic and hemorrhagic, and focal mild atypia. the second case of the smaller nodule showed two histologic patterns of papillary and sclerotic. we could also find twelve small - sized aah - like nodules with some papillae and micropapillae in background lung parenchyma of same lobe (fig. the histology was similar to that of alveolar adenoma or aah, but these had papillary or micropapillary structure and variably distributed irregular pattern. the size of the small nodules ranged from 0.1 cm to 0.7 cm (mean 0.35 cm). immunohistochemically, the lining cells of the small nodular lesion reacted with ttf-1 and ema, and the interstitial stromal cells were focally positive for ttf-1 (fig. 2d) and ema. the second was a 37-yr - old female patient who presented with a 2 cm sized sh with one peribronchial regional lymph node metastasis (nodal stage, n1). the metastatic tumor cells showed predominantly papillary structure lined by cuboidal cells and round cells (fig. the third case was a 36-yr - old female patient with a 3 cm sized tumor with alveolar adenoma - like area peripherally to the main mass. the alveolar adenoma - like area continued to the main mass and had thin - walled multiple cystic spaces lined by low cuboidal cells, measuring 1 cm in length (fig. the fourth case was a 59-yr - old female patient who presented with a mediastinal mass. chest computed tomography showed a large pleural based mass that was located adjacent to the right cardiac border. on gross examination, the mass measured 8 cm in the greatest diameter, and was in continuity with the right middle lobe of the lung. the tumor displayed three major histologic patterns of sh ; predominantly hemorrhagic, solid and papillary. the areas showing hemorrhagic pattern were composed of large blood - filled spaces lined by epithelial cells and were reminiscent of a cavernous hemangioma (fig. this case was proven as sh by gross examination, operative record, histologic features and immunohistochemical study. the last case was a 43-yr - old female patient with one 1.3 cm sized tumor with an adenocarcinoma - like area, measuring 0.4 cm in the longest diameter (fig. the ki-67 labeled proliferating index and the index of p53 protein were 5% and 20%, respectively. all 16 patients were alive and well without recurrence or metastasis during a follow - up period of 1 month to 6.8 yr (mean 2.3 yr). although sh originally termed a variant of hemangioma (1), subsequent authors have suggested the origin of sh as mesenchymal (2), mesothelial (3) and neuroendocrine (4) derivation. now, there is a consensus that they originated from primitive epithelial cells (5, 6). the epithelial origin of the tumor was also supported by ttf-1 and ema positivity in both the surface cells and round cells in the majority of the cases (6, 9). ttf-1 is expressed in the thyroid, lung, and the diencephalons of the brain. in the lung, it binds to the surfactant a, b, c and clara cell secretory protein genes. it is expressed in the non - ciliated columnar cells of the fetal lung as early as 11 weeks of gestation, and in type ii pneumocytes and clara cells of the adult lung (10, 11). the ttf-1 expression of both cells supported that both cells were derived from a primitive respiratory cell or may represent incompletely differentiated pneumocytes or clara cells (5, 6, 12). pancytokeratin (ae1/3) usually reacts with surface cells, and not with round cells. however, round cells rarely reacted with cytokeratin except one case that showed focal positivity for cytokeratin. the immunohistochemical findings of the round cells were positive for ttf-1 and cytokeratin, suggesting that intermediate differentiation between differentiated epithelial cuboidal cells and undifferentiated round pale cells (5, 6). although it is thought to be benign, rare cases apparently showed metastatic potential. in 1986, tanaka and colleagues reported the first case of sh with lymph node metastasis (13). we found thirteen cases in nine previously reported literatures with metastasizing pulmonary sh (table 3) (5, 6, 13 - 20). including the current case, there were seven cases of single lymph node metastasis and six cases of multiple (> 2) lymph nodes metastases. two cases of mediastinal (nodal stage, n2) lymph node metastases were found (17, 18). the primary tumor size ranged from 1.5 to 10 cm (mean 4.7 cm). we assumed that the primary tumor size and male ratio in the metastasizing pulmonary sh had increased as compared to the population with no lymph node metastasis, however we do not have statistical data. in the 9 cases, the mean time was 3.4 yr (ranging from 1 to 10 yr) (table 3). the metastatic lymph node of the current case also showed both surface and round cells like that of previously described cases. the prognosis did not appear to be affected by the presence of regional lymph node metastases. a study using microdissection technique demonstrated that both surface cells and round cells of sh showed similar clonality and represented a variable differentiation from a common progenitor cell (21). a few series have described multiple sh (6, 14, 22 - 29) and the incidence was 4 - 5% (6, 24, 26, 28). to our knowledge, two cases of bilateral multiple sh were described in the english - language literature (27, 29). the cases of aah in continuity with multiple sh (25), alveolar adenoma with sh (17), and transition from atypical hyperplasia of type ii pneumocyte to sh (29) have been described. the reports suggested that aah of type ii pneumocytes could be a focus of atypical growth of lining epithelial cells of sh. in our series, there was one case of alveolar adenoma - like area in the peripheral portion of the sh. another case with two sh had a background of multiple aah with papillae in the right lower lobe. we could not verify whether this case indicated multicentric origin of the sh or intrapulmonary metastasis, or incidental findings. even if the aah - like lesion with papillae is presumptive precursor lesion of sh, there are limitations for the postulation so far. a longer follow - up data, ample cases, and further studies are needed to support that. the sh could be presented clinically with mediastinal mass, and be located at the interlobar fissure (6, 30). sakamoto. (31) reported a case of sh isolated in the mediastinum, and suggested the hypothesis of three mechanism that may account for the development of mediastinal sh. the second mechanism was that the tumor could have originated from ectopic lung tissues, such as bronchogenic cysts. the final mechanism was that the sh developed from the lung as a pedunculated pleural mass that slowly pulled away from the lung surface. all three of these potential mechanisms are plausible ; however, the first mechanism was against findings that all previously reported cases of lymph node metastasis from sh had evidence of primary tumor. a case report of sh arising in the extrapulmonary sequestration was described in the english literature and may support the second mechanism (32). in the cases that presented as a pleural based or mediastinal mass, however, after careful review of the operative findings, chest radiographs, and histologic findings, it was apparent that these lesions arose from the periphery of the lung and protruded from the visceral pleural surface, giving the initial impression of an extrapulmonary origin (6, 33). our current case which presented mediastinal mass also revealed a pulmonary origin after check of additional gross examination, operative findings, and compatible immunohistochemical studies. (28) and aihara and nakajima (34) studied both estrogen receptors (er) and progesterone receptors (pr) immunohistochemically. they reported that most patients were positive for both er and pr, suggesting a relationship between this tumor and female sex hormones. one case showed a focus of papillary adenocarcinoma - like area within the sh, measuring 0.4 cm in the longest diameter, and mitotic figure was not absent. the diagnoses included insufficient specimen in four, malignancy versus sh in two and suspicion of adenocarcinoma in four. the severe cytologic atypia made it difficult to make a diagnosis of sh in aspiration cytology. the above findings ; lymph node metastasis, severe atypia, and multifocal distribution, may suggest that sh is a low grade malignancy. however, sh is a clinically benign tumor and has a good prognosis. all our current cases showed no recurrent or metastasis after excision, and the patients all are alive and well at present. in conclusion, sh may show hilar or mediastinal lymph nodes metastases, cytologically severe atypia, and multicentricity. complete excision of lesion is a curable treatment method and leads to an excellent prognosis. further studies on many cases of sh are necessary to elucidate the mechanism of metastasis, multiplicity, and extrapulmonary manifestation. | sclerosing hemangiomas (sh) of the lung are uncommon tumors and are thought to be benign. however, the biologic behavior of this tumor has not yet been characterized adequately. the clinicopathologic features were reviewed and analyzed for 16 cases of sh. the age of the patients ranged from 37 to 73 yr (mean 50.6 yr). there were fifteen female and one male patient. the sh located at the intraparenchyme in 14 cases, the interlobar fissure in one case and the visceral pleura in one case. the size of sh ranged from 0.3 cm to 8 cm (mean 2.6 cm). there were five unusual presentations of sh including a case having two sh with multiple nodules of atypical adenomatous hyperplasia in the same lobe, a case showing adenocarcinoma - like area within the sh, a case showing one peribronchial lymph node metastasis (n1 nodal stage) with location of interlobar major fissure, a case showing alveolar adenoma - like area within the sh, and one case with a large visceral pleural - based pedunculated mass presenting as mediastinal mass. all patients were alive and well without recurrence at the last follow up. here, we reviewed previously published literatures and discussed the histogenesis of sh. |
microorganisms such as bacteria and viruses have several components called pathogen - associated molecular patterns (pamps). pattern recognition receptors (prrs) of host innate immune system such as tlrs can recognize these components during infections (1, 2). toll - like receptor proteins are members of a big family, which have extracellular domains with leucine - rich repeat (lrr), a transmembrane domain, and a intracytoplasmic region called the toll / interleukin-1 receptor (il-1r) homology (tir) domain (1, 2). at least 10 members of this family have been identified in mammalian cells, which can recognize specific components conserved among microorganisms (1, 3). therefore, tlr proteins can act as primary stimulators of the innate immune system at the start of microbial infections (1, 3, 4). pathogen recognition by tlrs stimulates rapid activation of innate immunity by producing proinflammatory cytokines, chemokines, anti - microbial small molecules such as nitric oxide and upregulation of co - stimulatory molecules. activated innate immunity subsequently leads to the development of effective antigen - specific adaptive immunity (1 - 3). therefore, the use of tlr - ligands in vaccines could result in more potent and efficacious vaccines that can activate innate and adaptive immunity (5). flagellin, the major protein constituent of bacteria agella from both gram - positive and gram - negative bacteria, is a mammalian tlr5 agonist. the activation of epithelial cells in response to salmonella identified flagellin as a stimulatory ligand for tlr5 (7). tlr5 is expressed in epithelial cells, endothelial cells, macrophages, immature dcs, and t cells (2, 8 - 10). numerous studies have demonstrated the effectiveness of agellin as a systemic and mucosal adjuvant to generate antigen - specic antibodies and to stimulate t cells in mice and nonhuman primates when it is administered either as a native puried protein or as a hybrid protein with physical linkage to target antigens and poorly immunogenic peptides (5, 12 - 17). besides, systemic administration of agellin may be a relatively safe means of providing temporary non - specic protection against a variety of challenges (18). with this description, dna encoding the tlr5 agonist (flagellin) as a potent adjuvant, with the ability to effectively stimulate the immune system, can be used either admixed or genetically linked to target antigens, particularly in studies of dna vaccines. in a recent study, we generated a pvax - flic recombinant plasmid consisting of salmonella enterica typhimurium agellin, which is a tlr5 ligand and can be used as a genetic adjuvant candidate in eukaryote vector pvax1 and we evaluated its expression in eukaryotic cells. in the present study, the flic gene of s. enterica subsp. enteric serovar typhimurium atcc 14028, encoding flagellin protein, was cloned into a the pprime cloning vector and sub - cloned into a pvax1 expression vector, and transfected into hela cells, hek293 cells and chinese hamster ovary (cho) eukaryotic cells. the main goal of this study was to construct the recombinant plasmid pvax - flic as an adjuvant candidate for dna vaccines and evaluate its expression in eukaryotic cells. s. enterica subsp. enteric serovar typhimurium (atcc 14028) was obtained from the american type culture collection (atcc, manassas, va., usa) and cultured on salmonella shigella agar medium (oxoid cm0099, uk) and neutrient broth (himedia, india) at 37c and 5% co2. germany) was used for cloning the pcr products, while pvax1 (invitrogen, carlsbad, ca, usa) was used for sub - cloning the flic gene. eukaryotic expression vector pvax1 carries the human cytomegalovirus (cmv) immediate early promoter, the bovine growth hormone (bgh) polyadenylation signal for transcription termination, the kanamycin resistance gene and the puc origin of replication for maintenance in e. coli. the vector was constructed to be consistent with the food and drug administration (fda) document. genomic dna of salmonella enterica was extracted by high pure pcr template preparation kit (roche, germany), according to the manufacturer s instruction. concentration and quality of the genomic dna were assessed by uv absorbance and electrophoresis on 1% agarose gel. pcr reaction was performed in a total volume of 50 l containing 10 ng of dna, 20 pmol of each primer, 200 m dntp, 5 l of 10x pcr buffer, 1.5 mm mgcl2 and 2.5 u expand high fidelity pcr system. a pair of oligonucleotide primers were designed based on flic dna sequence that was recorded in genbank (accession number nc_016856, region : 2059063 - 2060550). forward primer : 5'-aa gctagcggatccaccatggcacaagtcattaataca-3 ' containing nhei and bamhi restriction sites with a simple kozak sequence (ccaccatgg) just before the start codon to ensure proper translation of prokaryotic genes in eukaryotic cells and reverse primer : 5'-aagctcgaggaattcttaacgcagtaaagagaggac-3 ' containing xhoi and ecori restriction sites with a translation stop codon. pcr reaction was carried out with 30 cycles of denaturation at 94 c for 1 minute, 58c for 1 minute, 72c for 2 minutes. the reaction was initiated at 94c for 5 minutes as initial denaturation before beginning the pcr cycle, and it was ended with a final extension at 72c for 10 minutes in a thermal cycler (techne, uk).finally, the amplified dna of flic gene was visualized by electrophoresis on 1% agarose gel and flic gene fragments were purified from the pcr product using a high pure pcr product purification kit (roche, germany). recovered flic gene was cloned into pprimecloning vector by perfect pcr cloning kit (5prime), according to the manufacturer s instruments. ligation reaction was prepared in a 10 l volume containing ; 54 ng of flic gene, 50 ng of pprimecloning vector, 5 l of 2x ligation master mix and 2.5 l of distilled water. the ligation reaction was transformed to e. coli dh5 strain competent cells and dispensed on agar plate containing 50 g/ ml of kanamycin (sigma, usa), 200 mg/ ml of isopropyl -d-1-thiogalactopyranoside iptg (sigma, usa) and 20 mg/ ml of x - gal (sigma, usa) to discriminate between recombinant (white) and non - recombinant (blue) cells. a number of white colonies were assayed by colony pcr. after selecting the recombinant clones, the recombinant flic plasmid was extracted from the overnight culture by high pure plasmid isolation kit (roche, germany) according to the manufacturer s protocol. the recombinant plasmids were detected by restriction digestion with nhei and xhoi enzymes (new england biolabs, usa) and confirmed by sequence analysis (bioneer, korea). the recombinant plasmid pprime - flic and eukaryotic expression vector pvax1 (invitrogen, carlsbad, ca, usa) were digested by xhoi and nhei enzymes (new england biolabs, usa) at 37c for 16 hours. after the enzymes thermal inactivation, the products of digestion were analyzed by electrophoresis on 1% agarose low melting point gel (roche, germany) and bands of flic fragments and digested pvax1 plasmids were purified from the agarose gel by the agarose gel dna extraction kit (roche, germany). ligation reaction was prepared in a 20 l volume containing ; 300 ng of flic gene, 200 ng of digested pvax1, 2 l of 10x ligation buffer and 1 l of t4 dna ligase enzymes (new england biolabs, usa). the recombinant pvax - flic plasmid was transformed into competent e. coli dh5 cells and recovered in super optimal broth with catabolite repression (soc) free of antibiotic at 37c for one hour. next, the cells were cultured on lb agar medium containing 50 g / ml of kanamycin (sigma, usa), and incubated at 37c for 16 hours. a number of colonies were assayed by colony pcr and recombinant plasmids with the correct restriction pattern were selected by restriction digestion with nhei and xhoi enzymes (new england biolabs, usa) and used for dna sequencing with the t7 forward and bovine growth hormone (bgh)reverse primers (bioneer, korea) to confirm that flic gene is cloned in the proper orientation. hela cells and hek293 cells were cultured in dulbecco 's modified eagle 's medium (dmem) (gibco - brl) supplemented with 10% fetal calf serum (fcs) in the presence of penicillin g (100 u/ ml), streptomycin (100 g/ ml), gentamycin (50 g/ ml) and amphotericin b (2.5 g/ ml) (gibco - brl) at 37c with 5% co2 and transiently transfected with either pvax - flic or pvax1 by electroporation. briey, growing cells were trypsinized, spun down, and resuspended in hebs buffer (25 mm hepes ph 7.1, 140 mmnacl, 5 mm kc1, 0.75 mm na2hpo4) at cell concentration of 5106/ ml containing 100 g/ ml plasmid, and electroporated at room temperature in a 2 mm gap cuvette with 200 l of sample, exponential decay waveform of 160v pulse and 500 f capacitance by gene pulserxcell electroporation system (biorad - usa). electroporated cells were cultured in six - well culture plates (nunc, denmark) at 37c in a 5% co2 environment. forty - eight hours after transfection, the cells were xed with cold methanol acetone (1:1) for 20 minutes, then rinsed and blocked with 2 ml of 0.15 m phosphate buffered saline (pbs) containing 1% bovine serum albumin (bsa). flagellin expression was detected using the indirect immunouorescence assay (ifa), with 2.5 g / ml mouse anti - flic (flagellin) antibody (biolegend, usa) followed by staining with 10 g / ml fluorescein isothiocyanate (fitc)-labeled anti - mouse igg (abcam, usa). next, 1 g / ml 4',6-diamidine-2'-phenylindole dihydrochloride (dapi) (roche, germany) was used for staining the nuclei of the cells. after rinsing with pbs, cover slips were immediately observed under a uorescence microscope (nikon, usa). the expression of flagellin in electroporated cho cells and hek293 cells was identied by western blotting. the transfected cells were maintained in dmem - f12 (gibco - brl) at 37c and 5% co2 atmosphere. after 48 hours of incubation, the cells were collected and boiled in the sodium dodecyl sulfate (sds) sample buffer (60 mmtris hcl ph 6.8, 2% sds, 1 mm ethylene diaminetetraacetic acid (edta), 10% glycerol, 0.005% bromophenol blue and 5% -mercaptoethanol) for 10 minutes. proteins of transfected cells were separated using 10% (w / v) sds - page gel. following electrophoresis, the resolved proteins were blotted onto a 0.45 m pore polyvinylidene uoride (pvdf) membrane (roche, germany) in towbin buffer (0.025 m tris, 0.192 m glycine (ph = 8.3) with 20% methanol) using a semi - dry transfer cell (bio - rad, usa) at 15v for 1 hour and the membrane was blocked for 1 hour at room temperature with 3% (w / v) bsa diluted in tris - buffered saline (tbs) (50 mm tris ph = 7.5, 150 mm nacl). the membrane was incubated with 1 g / ml mouse anti - flic (flagellin) antibody (biolegend, usa) overnight at 4c. after washing with tbs containing 0.1% tween 20, the membrane was stained with diluted goat anti - mouse igg horseradish peroxidase (hrp)-labeled secondary antibody (1:2,000 ; biolegend, usa) for 1 hour. the reaction was detected using 3, 3-diaminobenzidine (dab) reagents (sigma - alderich, usa). transcription of flagellin gene at the level of mrna in cho and hela cells was also identied by rt - pcr. total rna isolation from the cells by rneasy mini kit (qiagen, germany) and rt - pcr was performed according to the manufacturer s protocol using a qiagen one step rt - pcr kit (qiagen, germany) by specific primers (forward primer : 5'-cgtatcaacagcgcgaaaga-3 ' and reverse primer : 5'-ctggatggagtcgaggtcag-3 ') ; the final product was then electrophoresed on 2% agarose gel. s. enterica subsp. enteric serovar typhimurium (atcc 14028) was obtained from the american type culture collection (atcc, manassas, va., usa) and cultured on salmonella shigella agar medium (oxoid cm0099, uk) and neutrient broth (himedia, india) at 37c and 5% co2. germany) was used for cloning the pcr products, while pvax1 (invitrogen, carlsbad, ca, usa) was used for sub - cloning the flic gene. eukaryotic expression vector pvax1 carries the human cytomegalovirus (cmv) immediate early promoter, the bovine growth hormone (bgh) polyadenylation signal for transcription termination, the kanamycin resistance gene and the puc origin of replication for maintenance in e. coli. the vector was constructed to be consistent with the food and drug administration (fda) document. genomic dna of salmonella enterica was extracted by high pure pcr template preparation kit (roche, germany), according to the manufacturer s instruction. concentration and quality of the genomic dna were assessed by uv absorbance and electrophoresis on 1% agarose gel. pcr reaction was performed in a total volume of 50 l containing 10 ng of dna, 20 pmol of each primer, 200 m dntp, 5 l of 10x pcr buffer, 1.5 mm mgcl2 and 2.5 u expand high fidelity pcr system. a pair of oligonucleotide primers were designed based on flic dna sequence that was recorded in genbank (accession number nc_016856, region : 2059063 - 2060550). forward primer : 5'-aa gctagcggatccaccatggcacaagtcattaataca-3 ' containing nhei and bamhi restriction sites with a simple kozak sequence (ccaccatgg) just before the start codon to ensure proper translation of prokaryotic genes in eukaryotic cells and reverse primer : 5'-aagctcgaggaattcttaacgcagtaaagagaggac-3 ' containing xhoi and ecori restriction sites with a translation stop codon. pcr reaction was carried out with 30 cycles of denaturation at 94 c for 1 minute, 58c for 1 minute, 72c for 2 minutes. the reaction was initiated at 94c for 5 minutes as initial denaturation before beginning the pcr cycle, and it was ended with a final extension at 72c for 10 minutes in a thermal cycler (techne, uk).finally, the amplified dna of flic gene was visualized by electrophoresis on 1% agarose gel and flic gene fragments were purified from the pcr product using a high pure pcr product purification kit (roche, germany). recovered flic gene was cloned into pprimecloning vector by perfect pcr cloning kit (5prime), according to the manufacturer s instruments. ligation reaction was prepared in a 10 l volume containing ; 54 ng of flic gene, 50 ng of pprimecloning vector, 5 l of 2x ligation master mix and 2.5 l of distilled water. the ligation reaction was transformed to e. coli dh5 strain competent cells and dispensed on agar plate containing 50 g/ ml of kanamycin (sigma, usa), 200 mg/ ml of isopropyl -d-1-thiogalactopyranoside iptg (sigma, usa) and 20 mg/ ml of x - gal (sigma, usa) to discriminate between recombinant (white) and non - recombinant (blue) cells. a number of white colonies were assayed by colony pcr. after selecting the recombinant clones, the recombinant flic plasmid was extracted from the overnight culture by high pure plasmid isolation kit (roche, germany) according to the manufacturer s protocol. the recombinant plasmids were detected by restriction digestion with nhei and xhoi enzymes (new england biolabs, usa) and confirmed by sequence analysis (bioneer, korea). the recombinant plasmid pprime - flic and eukaryotic expression vector pvax1 (invitrogen, carlsbad, ca, usa) were digested by xhoi and nhei enzymes (new england biolabs, usa) at 37c for 16 hours. after the enzymes thermal inactivation, the products of digestion were analyzed by electrophoresis on 1% agarose low melting point gel (roche, germany) and bands of flic fragments and digested pvax1 plasmids were purified from the agarose gel by the agarose gel dna extraction kit (roche, germany). ligation reaction was prepared in a 20 l volume containing ; 300 ng of flic gene, 200 ng of digested pvax1, 2 l of 10x ligation buffer and 1 l of t4 dna ligase enzymes (new england biolabs, usa). the recombinant pvax - flic plasmid was transformed into competent e. coli dh5 cells and recovered in super optimal broth with catabolite repression (soc) free of antibiotic at 37c for one hour. next, the cells were cultured on lb agar medium containing 50 g / ml of kanamycin (sigma, usa), and incubated at 37c for 16 hours. a number of colonies were assayed by colony pcr and recombinant plasmids with the correct restriction pattern were selected by restriction digestion with nhei and xhoi enzymes (new england biolabs, usa) and used for dna sequencing with the t7 forward and bovine growth hormone (bgh)reverse primers (bioneer, korea) to confirm that flic gene is cloned in the proper orientation. hela cells and hek293 cells were cultured in dulbecco 's modified eagle 's medium (dmem) (gibco - brl) supplemented with 10% fetal calf serum (fcs) in the presence of penicillin g (100 u/ ml), streptomycin (100 g/ ml), gentamycin (50 g/ ml) and amphotericin b (2.5 g/ ml) (gibco - brl) at 37c with 5% co2 and transiently transfected with either pvax - flic or pvax1 by electroporation. briey, growing cells were trypsinized, spun down, and resuspended in hebs buffer (25 mm hepes ph 7.1, 140 mmnacl, 5 mm kc1, 0.75 mm na2hpo4) at cell concentration of 5106/ ml containing 100 g/ ml plasmid, and electroporated at room temperature in a 2 mm gap cuvette with 200 l of sample, exponential decay waveform of 160v pulse and 500 f capacitance by gene pulserxcell electroporation system (biorad - usa). electroporated cells were cultured in six - well culture plates (nunc, denmark) at 37c in a 5% co2 environment. forty - eight hours after transfection, the cells were xed with cold methanol acetone (1:1) for 20 minutes, then rinsed and blocked with 2 ml of 0.15 m phosphate buffered saline (pbs) containing 1% bovine serum albumin (bsa). flagellin expression was detected using the indirect immunouorescence assay (ifa), with 2.5 g / ml mouse anti - flic (flagellin) antibody (biolegend, usa) followed by staining with 10 g / ml fluorescein isothiocyanate (fitc)-labeled anti - mouse igg (abcam, usa). next, 1 g / ml 4',6-diamidine-2'-phenylindole dihydrochloride (dapi) (roche, germany) was used for staining the nuclei of the cells. after rinsing with pbs, cover slips were immediately observed under a uorescence microscope (nikon, usa). the expression of flagellin in electroporated cho cells and hek293 cells was identied by western blotting. the transfected cells were maintained in dmem - f12 (gibco - brl) at 37c and 5% co2 atmosphere. after 48 hours of incubation, the cells were collected and boiled in the sodium dodecyl sulfate (sds) sample buffer (60 mmtris hcl ph 6.8, 2% sds, 1 mm ethylene diaminetetraacetic acid (edta), 10% glycerol, 0.005% bromophenol blue and 5% -mercaptoethanol) for 10 minutes. proteins of transfected cells were separated using 10% (w / v) sds - page gel. following electrophoresis, the resolved proteins were blotted onto a 0.45 m pore polyvinylidene uoride (pvdf) membrane (roche, germany) in towbin buffer (0.025 m tris, 0.192 m glycine (ph = 8.3) with 20% methanol) using a semi - dry transfer cell (bio - rad, usa) at 15v for 1 hour and the membrane was blocked for 1 hour at room temperature with 3% (w / v) bsa diluted in tris - buffered saline (tbs) (50 mm tris ph = 7.5, 150 mm nacl). the membrane was incubated with 1 g / ml mouse anti - flic (flagellin) antibody (biolegend, usa) overnight at 4c. after washing with tbs containing 0.1% tween 20, the membrane was stained with diluted goat anti - mouse igg horseradish peroxidase (hrp)-labeled secondary antibody (1:2,000 ; biolegend, usa) for 1 hour. the reaction was detected using 3, 3-diaminobenzidine (dab) reagents (sigma - alderich, usa). transcription of flagellin gene at the level of mrna in cho and hela cells was also identied by rt - pcr. total rna isolation from the cells by rneasy mini kit (qiagen, germany) and rt - pcr was performed according to the manufacturer s protocol using a qiagen one step rt - pcr kit (qiagen, germany) by specific primers (forward primer : 5'-cgtatcaacagcgcgaaaga-3 ' and reverse primer : 5'-ctggatggagtcgaggtcag-3 ') ; the final product was then electrophoresed on 2% agarose gel. genomic dna of s. enterica serovar typhimurium extracted using a commercial kit showed a concentration of 170 g/ ml and good quality on agarose gel. the full protein - coding region of the flic gene of s. typhimurium was amplified using designed specific primers. the size of pcr product on agarose gel electrophoresis for flic gene was 1.5 kbp (figure 1). the pcr products were cloned into a pprime cloning vector and this resulted in a recombinant pprime - flic plasmid that was transformed successfully into e. coli bacteria. the recombinant plasmids from the white colonies were pcr positive against the flic gene and vector primers. the recombinant pprime - flic plasmids were confirmed by double digestion with nhei and xhoi restriction enzymes (figure 2). sequencing analysis of the constructed plasmid also confirmed no amplification errors in sequence of the cloned flic gene. next, this pprime - flic plasmid was digested by nhei and xhoi restriction enzymes and flic gene was successfully inserted between the nhei and xhoi restriction sites of the pvax1 expressing eukaryote vector and the pvax - flic plasmids were transformed into e. coli dh5 cells. the recombinant pvax - flic plasmids were detected by digestion with nhei and xhoi restriction enzymes (figure 3) and were then confirmed by sequence analysis and compared with flic sequences in the genbank database. in order to examine the in vitro expression of the flagellin protein, eukaryotic expression vector pvax - flic was electroporated successfully into hela cells, hek293 cells and cho cells. transcription of flic mrnas was confirmed by rt - pcr method ; finally the results were electrophoresed on 2% agarose gel, which identified a band 231 bp (figure 4). expression of flagellin protein in hela cells and hek293 cells was evaluated by ifa, 48hours post - electroporation (figure 5). also, expression of the flagellin protein was evaluated by western blotting with cell lysates of transient transfected cho cells and hek293 cells. the molecular weight of the flagellin protein was about 52 kda (figure 6). lane 1 : 100bp dna ladder cinagen ; lane 2 : negative control ; lane 3, 4 and 5 : pcr products for flic gene (approximately 1500bp) of salmonella enterica serovar typhimurium ; lane 6 : 1kbp dna ladder vivantis. lane 1 to 6 : extracted pprime - flic plasmids ; lane 8 to 13 : pprime - flic plasmids digested by xhoi ; lane 15 to 20 : pprime - flic plasmids digested by xhoi and nhei ; lane 7 and 14 : 1 kbp dna ladder vivantis. lane 1 : pvax - flic plasmid digested by xhoi had one band (4419 bp) ; lane 2 : double digestion by nhei and xhoi on pvax - flic plasmid had two bands that were 1509 bp (down) and 2910 bp (up) ; lane 3 : 1 kbp dna ladder vivantis. lane 1 : 100 bp dna ladder cinnagen co. lane 2 : rt - pcr product of the flic gene (231 bp) from transfected cells with pvax - flic plasmid ; lane 3 : rt - pcr product of the flic gene from transfected cells with pvax plasmid (negative control). the cells were previously electroporated with pvax - flic and detected using mouse anti - flic antibody and fitc - labeled goat anti - mouse igg antibody. untransfected (lane 2) and transfected with pvax1-flic (lane 3) or transfected with pvax1 (lane 4) cho cells were detected by western blotting ; lane 1, prestained protein ladder (cinagen, iran). production of a strong immune response and induction of both humoral and cellular immunity against vaccine antigens strongly depend on a formulation with adjuvants. immunologic adjuvants are agents incorporated into vaccine formulations to enhance the immunogenicity of vaccine antigens (19). many natural and synthetic compounds as immunological adjuvants including inorganic salts such as aluminum hydroxide, nano and micro particles, oil emulsions, cytokines and microbial compounds, have been studied in vaccine researches (19, 20). the use of microbial - adjuvants in human prophylactic vaccines which can induce the production of endogenous cytokines have priority over the use of recombinant cytokines as adjuvants that have high incidence of local and systemic adverse side effects (21). a primary mechanism of action for most microbial - based immunological adjuvants is to present pathogen - specific molecular patterns (pamps) in association with protective antigens triggering pathogen recognition mechanisms and the activation of innate immunity. the recognition of pamps in mammalian cells is mediated by innate immune receptors such as pattern recognition receptors (prrs), which are expressed by antigen - presenting cells (apc). however, activation of the prrs such as tlrs not only induces strong inflammatory responses but also stimulates protective adaptive immune responses (3). recent advances in the eld of innate immune system have disclosed cellular and molecular mechanisms behind the adjuvant effects of pamps and have led to the use of tlr ligands as adjuvants (1, 6). tlrs are a type of prr which react with pamp - based adjuvants or microbial adjuvants. therefore, the use of tlr agonists such as agellin (a bioactive tlr5 ligand) as adjuvants is a promising approach to enhance the effectiveness of vaccines and may be the most useful for vaccines that may lack sufficient recognition by host innate immune mechanisms. flagellin, a tlr5 ligand, is the major protein component of bacterial agella, which provide motility and chemotaxis, and allow adhesion to host mucosal tissues (22). the tlr5 ligand is a potent t - cell antigen and has potential as a vaccine adjuvant. unlike other tlr agonists, flagellin tends to produce mixed th1 and th2 responses rather than strong th1 responses. additionally, in contrast to other vaccine adjuvants, such as complete freund 's adjuvant, agellin may exert strong adjuvant effects on both humoral and cellular immune responses following administration through mucosal routes (12). flagellin can be used as an adjuvant mixed with the antigen but it is more frequently fused to a recombinant vaccine antigen (5, 11, 12). in addition to the upregulation of tlr5 expression, tlr3 expression was also found to be activated by agellin, thus it could be auseful against for rna viruses (16). flagellin is a strong activator of a broad range of cell types involved in innate and adaptive immunity. established that agellin can promote robust responses against weakly immunogenic antigens of vaccinia virus (23). the efficacy of preventive vaccines against infectious diseases declines dramatically with the progression of age among older adults (24). adjuvants which lead to an increase in immunogenicity, are required to stimulate the appropriate immunity in the elderly. bates. indicated that flagellin can promote adaptive immune responses in aged mice (13). according to the study of vijay - kumar., systemic treatment of puried agellin in mice did not induce serological, histopathological and clinical hallmarks of inammation that are induced by lipopolysaccharides, yet protected mice against chemicals, pathogens and ionizing radiation (18). in addition, bacterial genes typically contain immunostimulatory unmethylated cpg motifs (pupucpgpypy) within their dna backbone (25). we investigated the cpg motifs in the entire sequence of the ic gene and observed that the ic gene s sequence contains four immunostimulatory cpg motif sites, including agcgtc at positions 89 - 94, aacgct at positions 199 - 204, agcgcc at positions 353 - 358 and aacgtc at positions 1465 - 1470 (based on genbank accession number nc_016856, region : 2059063 - 2060550). the aim of the present study was to construct the expression plasmid pvax - flic and evaluate its expression in eukaryotic cells. initially, the full - length of flic gene from s. typhimurium was amplified using specific primers containing the kozak sequence and cloned in thepprime vector and then sub - cloned in expression plasmid pvax1. next, cloning and subcloning was confirmed by pcr, restriction enzyme digestion and dna sequencing. the dna sequencing results also confirmed the authenticity of the cloned flagellin gene sequences. following this step, mrna synthesis of flagellin in eukaryotic cells transfected with pvax - flic also, the presence of flagellin protein was determined in these cells by immunouorescence assay and western blotting using a monoclonal antibody. better results were seen for the immunouorescence assay with hek293 cells compared to hela cells. western blot analysis showed a protein band slightly lower than the 57 kda band of the protein marker, which was in agreement with the expected molecular weight of flagellin protein (52 kda). the results of this study indicated that the flagellin gene was successfully cloned into the expression plasmid pvax1, and the expression of this gene at the level of transcription and translation was confirmed in eukaryotic cells. the construction of the pvax - flic recombinant plasmid is the first step towards the use of this plasmid as a genetic adjuvant candidate in vaccine studies in the future. cloned the membrane - associated form of flagellin in expression vector pcdna3.1 (26). however, in our study, the full - length flic gene was cloned in the pvax1 expression vector, and the sequence of the transmembrane domain or secretory signal sequence was not used. this is because the immune response to antigens that are on the cell surface may be different from the antigens, which are not on the cell surface and could play a role in the polarizing immune responses and raising different profiles of t - cells (27). an increasing number of studies have demonstrated that agellin contributes to the efcacy of various novel vaccines for yersinia pestis (15), west nile virus (28), plasmodium falciparum (29), schistosoma mansoni (30), tetanus toxoid (31) and inuenza (17, 32 - 34). flagellin activates tlr5-positive dendritic cells (dcs), neutrophils and epithelial cells (2, 35). therefore, a powerful vaccine can be created by fusion of flagellin with an antigen in order to enhance the immunopotency of the antigens (19). however, in most mentioned studies they used flagellin as a recombinant protein for vaccine adjuvants, however in this study, for the first time, we inserted flic gene in pvax1 for dna vaccine as an adjuvant candidate. in conclusion, the recombinant plasmid of pvax - flic that was successfully constructed in the present study could be used either for cocktail or physical linkage to target antigens as an effective dna microbial - adjuvant for future dna vaccine studies against infectious diseases. | background : flagellin is the main structural protein of the agella of many pathogens including salmonella typhimurium. it is a potent trigger of innate immune responses that enhance adaptive immune responses to a variety of protein antigens. flagellin has intrinsic adjuvant activity mediated through toll - like receptor (tlr) 5 and is an attractive candidate for highly effective vaccine adjuvant conferring enhanced antibody and cellular immune responses to proteins or peptides. in the present study, we cloned the flic gene from s. enterica typhimurium in eukaryote vector pvax1 and evaluated its expression in eukaryotic cells.objectives:the main aim of the present study was to construct a dna vaccine expressing flic as an adjuvant.materials and methods : the flic gene of s. typhimurium (atcc 14028) was amplified by pcr with specific primers and cloned into the pprime cloning vector and successfully subcloned into expression vector pvax1. the recombinant plasmid pvax - flic was finally expressed in eukaryotic cells.results:cloning and subcloning of the flic gene were confirmed by colony pcr, restriction enzymes digestion and dna sequencing of the recombinant plasmids pprime - flic and pvax - flic. the expression of flagellin protein in eukaryotic cells was approved by immunouorescence assay (ifa), western blotting analysis and the reverse transcriptase polymerase chain reaction (rt - pcr) method.conclusions:the results of this study demonstrated that the flic gene in recombinant plasmid pvax - flic was successfully expressed in eukaryotic cells and produced flagellin protein, which could be used as an effective adjuvant for dna vaccine research. |
hypertension is an important worldwide public health problem and is a major risk factor for cardiovascular disease, the leading cause of death and disability worldwide. testing for hypertension is the most commonly performed screening test in medical practice and is important not least because individuals with a normal blood pressure (bp) at the age of 50 still run a 90% life - time risk of developing hypertension. furthermore, trial evidence indicates that even small differences in systolic bp of 24 mm hg are clinically important, thus accurate measurement is vital. errors in measurement occur through three main sources : device errors, user errors and patient errors. device errors are potentially the most fundamental of these three sources, and, in particular, accurate measurement is underpinned by the requirement for an instrument that measures pressure accurately in patients across the range of pressures. for many years, the standard instrument for bp measurement was a mercury sphygmomanometer, but in recent years this has been superseded in many clinical settings by automated electronic devices. the need to validate these protocols stipulate the minimum testing population with an acceptable range of mean and s.d. of errors or an s.d. below a threshold, which is dependent on the level of mean difference, but do not specify the proportion of individuals within those populations that should have accurate readings. however, it is possible for a bp monitor to meet the above validation criteria, but still record bp measurements in error by > 5 mm hg in half of the individuals assessed. it has, therefore, been argued that validation standards should be based, in part, on the percentage of individual readings within an accurate range. to understand the potential effect of such a change in policy, we aimed to systematically examine the proportion of accurate readings attained by automatic digital bp devices in published clinical validation studies. we included all published studies of automatic digital bp devices that (1) validated studies of bp devices using a recognized protocol in a clinic setting or in the community ; (2) used a sphygmomanometer with upper arm bp measurement ; (3) included adult patients (18 years of age) with no significant severe intercurrent health problems and (4) included data on the mean and s.d. of the bp difference between calibrated standard sphygmomanometer (mercury or random - zero sphygmomanometers) and (semi-)automatic (oscillometric or aneroid) sphygmomanometer. reasons for study exclusion were devices used in special clinical situations (for example pregnancy, at altitude, during exercise, in trauma patients, neonates, children and serious diseases), measurements not from upper arm bp monitoring devices (for example wrist and abpm), comparison with other sphygmomanometers (for example direct central pressure and ambulatory intra - arterial pressure) and published papers reporting no mean difference or s.d.. we searched ovid versions of medline and embase, and cochrane library through wiley interscience from january 1989 to june 2008. medical subject headings and synonym terms used were sphygmomanometer, bp, hypertension, calibration and monitor device. two authors reviewed the titles and abstracts of all identified articles and selected full - text papers. we extracted data on the percentage of bp measurements within 5 mm hg, mean and s.d. we also obtained information on detail of process, including study design, sample size, device characteristics and the relevant guidelines used to assess the device accuracy. one author (yw) extracted data and this was rechecked by a second author (ch) independently, disagreements were resolved by discussion with a third author (rp). the reviewers were not masked to any aspect of the studies (for example journal type, author names or institution). copenhagen : the nordic cochrane centre, the cochrane collaboration, 2008 for the statistical analysis and forest plots (sorted by mean effect and device type for systolic bp and diastolic bp). of differences between measured and observed bp (the observer control measurement used in the protocol), and proportion of measurements within 5 mm hg of observed bp and ordered the rows of the figures by the percentage of measurements with errors 15%, whereas the international protocol requires only 33 patients (less than the other protocols), and can only detect differences between devices of > 24%. moreover, devices passing a protocol are not necessarily more accurate than devices that failed, and devices that pass may perform substantially worse when tested in a community setting. in addition, a device that passes validation does not mean that it provides accurate readings in all patients ; inaccuracy is more likely in older and diabetic patients. in general, we found devices performing badly do so because of wide variation between differences (large s.d.) rather than systematic over- or underestimation of bp (figures 2, 3, 4). this is reflected in the relatively stable mean difference, which leads to a large number of additional measurements for devices relative to only a small drop off in precision (that is lower proportion of measurements within 5 mm hg). this effect is negated by multiple readings over multiple clinic visits. yet, as a bp approaches the threshold for diagnosis, this inaccuracy can substantially under- or overestimate the burden of hypertension. in addition, community clinic - based validations were fewer and the results much worse. this is particularly of concern, as this setting is where devices are most often used for the assessment and ongoing management of hypertension. however, it is worth noting that the change from mercury to electronic bp measurement in practice has led to no consistent change in mean bp after their introduction, but there was a large and significant fall in terminal digit preference suggesting improved precision of recording with electronic devices. this study had a number of limitations : the reproducibility of protocol testing is currently unknown. we found no studies, which repeated earlier validations. some studies may have been missed. although the search of 5912 potentially relevant records was comprehensive, with analysis of 3356 potentially relevant records, studies in which machines failed the validation are less likely to be published, particularly if the manufacturer is involved in the funding. however, missing such studies would have the effect of worsening the results and hence would not alter the conclusions. all validation studies found used the standard cuff size. a significant proportion of adults will need to use the larger cuff and yet there is no evidence as to whether this will be accurate. the analysis was limited by the lack of reporting of proportional data in some cases. development of an international consensus on minimal standards of reporting, including representations of proportional data, would go some way to allowing comparison of devices under different validation protocols. our estimates of the proportion within 5 mm hg of the observed value may not be accurate, because they assume a study - specific normal distribution that leads to some degree of inaccuracy, but were sufficient to inform the ordering of the figures. for example, the aami protocol allows a choice of data collection methods (simultaneous vs sequential) and a choice of data - analysis methods, either of which may affect the final results. problems with validation protocol methods not being detailed enough has earlier been cited as a problem for interpretation. second, not all protocols directly address the margin of error between measurement and observed value, and those that do allow margins of error as wide as 10 or 15 mm hg, result in measurements that are up to half the time > 5 mm hg from the observed value in some monitors that pass protocols. third, we found few examples of the protocols being tested in community settings (that is, real clinics rather than artificial settings), and the results from these studies were generally poor. this is of concern because it may suggest that most protocol studies overestimate device quality, although we found too few community studies to draw firm conclusions. finally, the british and american protocols are difficult or costly to obtain, which could discourage further evaluation of bp monitors. protocols that include measurements for a certain proportion of readings to be within a certain value and have unambiguous procedures could encourage the manufacture of higher quality bp monitors. monitors need to be re - evaluated in community settings (real clinics ') to verify their accuracy in practice. the advent of a central, open access repository of evaluation studies would be beneficial to clinics and healthcare providers when choosing digital monitors. devices may pass even rigorous protocols with as few as 60% of readings within 5 mm hg of the observed value. the limited evidence available suggests that performance in clinical practice will be even worse than under protocol testing. bp standards are essential to provide clinicians and patients with accurate information on which to base diagnostic and treatment decisions. | the aim of this study is to systematically examine the proportion of accurate readings attained by automatic digital blood pressure (bp) devices in published validation studies. we included studies of automatic digital bp devices using recognized protocols. we summarized the data as mean and s.d. of differences between measured and observed bp, and proportion of measurements within 5 mm hg. we included 79 articles (10 783 participants) reporting 113 studies from 22 different countries. overall, 25/31 (81%), 37/41 (90%) and 34/35 (97%) devices passed the relevant protocols [bhs, aami and esh international protocol (esh - ip), respectively ]. for devices that passed the bhs protocol, the proportion of measured values within 5 mm hg of the observed value ranged from 60 to 86% (aami protocol 4794% and esh - ip 5489%). the results for the same device varied significantly when a different protocol was used (omron hem-907 80% of readings were within 5 mm hg using the aami protocol compared with 62% with the esh - ip). even devices with a mean difference of zero show high variation : a device with 74% of bp measurements within 5 mm hg would require six further bp measurements to reduce variation to 95% of readings within 5 mm hg. current protocols for validating bp monitors give no guarantee of accuracy in clinical practice. devices may pass even the most rigorous protocol with as few as 60% of readings within 5 mm hg of the observed value. multiple readings are essential to provide clinicians and patients with accurate information on which to base diagnostic and treatment decisions. |
before the 1970s, the majority of high - grade musculoskeletal tumors involving the distal femur were treated with transfemoral amputation owing to an unacceptably high rate of recurrence associated with local resection [10, 19, 31, 47 ]. as effective chemotherapeutic regimens were developed, limb salvage using various techniques gained popularity among orthopaedic oncologists [1, 11, 19, 20, 24, 37, 45, 49, 60, 69 ]. today, with effective neoadjuvant chemotherapy, limb salvage is indicated in as much as 90% of patients with musculoskeletal malignancies involving the distal femur [6, 7, 14, 44, 5355, 57 ]. numerous studies document relatively high implant survival after limb salvage for tumors involving the distal femur [3, 4, 8, 26, 27, 29, 35, 43, 44, 50, 54, 55, 57, 61, 71 ]. studies that are available, however, do not stratify patients on the basis of tumor grade, stage of disease, or life expectancy to define the disease - specific survival of implants. this makes it difficult for surgeons to accurately predict how long the implants will last for a given patient population and life expectancy. additionally, there are limited data available with which to compare implant survival of contemporary modular implant designs with older custom - designed implants no longer in use [8, 44, 48, 70 ]. critics of a cemented endoprosthetic reconstruction technique cite rates of aseptic loosening from 8.4% to greater than 30% [2, 30, 38, 63 ] as the main rationale for abandoning its use in favor of newer designs. given the paucity of long - term data concerning cemented distal femoral implants and the heightened interest in alternate fixation designs, we sought to answer the following four questions : (1) do newer cemented modular implant designs have improved survivorship compared with older custom - designed components ? (2) does tumor grade or stage influence implant survival ? (3) what is the typical long - term functional result after a cemented distal femoral replacement ? we retrospectively reviewed the electronic and paper charts of all 254 patients who underwent cemented distal femoral endoprosthetic reconstructions for musculoskeletal tumors between december 1980 and december 2008. we excluded 68 patients : 39 patients had distal femoral reconstructions or a diagnosis other than musculoskeletal tumor ; 27 with a tumor - related diagnosis were skeletally immature and underwent distal femoral reconstruction with the intent to perform multiple expansion procedures at a later date, possibly including complete prosthesis exchange ; two patients underwent reconstruction with a cementless implant. we previously reported our results of expandable and cementless implants for tumors of the distal femur [16, 17, 36, 64 ] and did not include them in the current analysis. these exclusions left 186 patients : 98 (53%) males and 88 (47%) females. their mean age at the time of surgery was 29.0 years (range, 1279 years). we further divided the 186 patients into three subgroups based on disease grade or stage : group 1 (n = 43) were patients with low - grade malignancy (stage ia or ib), parosteal osteosarcoma, or benign diagnoses ; group 2 (n = 122) was comprised of patients with high - grade localized disease (stage iia or iib) ; and group 3 (n = 21) included patients with stage iii primary malignancy of the distal femur, along with patients with metastatic carcinoma to the distal femur, and the single cases of myeloma and lymphoma (table 1). the latter group was treated as a single cohort owing to similarity in life expectancy among patients with these four diagnoses. at the most recent followup, the minimum followup was 1 month (mean, 96 months ; range, 1336 months ; median, 54.5 months) for all patients and 1 month (mean, 130.4 months ; range, 1336 months) for the 121 surviving patients. eight patients were lost to followup but were well at the time of the last evaluation (range, 313 months). we obtained prior approval from our institution s office for protection of research subjects (ucla irb # g08 - 10 - 100 - 01).table 1diagnosesdiagnosisnumber of patientsgroup 1 (low grade) giant cell tumor18 (9.7%) parosteal osteosarcoma14 (7.5%) chondrosarcoma (low grade)7 (3.8%) desmoid of bone3 (1.6%) chondroblastoma1 (0.5%) total group 143 (23.1%)group 2 (high - grade localized) osteosarcoma (classic high grade)102 (54.8%) chondrosarcoma (high grade)7 (3.8%) malignant fibrous histiocytoma5 (2.7%) ewing s sarcoma2 (1.1%) synovial sarcoma2 (1.1%) malignant giant cell tumor1 (0.5%) leiomyosarcoma1 (0.5%) fibrosarcoma1 (0.5%) alveolar soft parts sarcoma1 (0.5%) total group 2122 (65.6%)group 3 (stage iii / disseminated) osteosarcoma (stage iii)11 (5.9%) metastatic disease4 (2.2%) malignant fibrous histiocytoma2 (1.1%) fibrosarcoma2 (1.1%) myeloma1 (0.5%) lymphoma1 (0.5%) total group 321 (11.3%)total all groups186 (100.0%) from the charts, we recorded the index diagnosis and disease stage at the time of presentation (according to the system described by enneking. [22, 25 ]), length of followup, postoperative function scores, implant type and manufacturer, and any major postoperative events (systemic or local complications, repeat surgery for any reason, revision of stemmed components, and/or local recurrence). all endoprosthetic reconstructions were performed by the same surgeon (jje), and all tumor resections followed generally accepted oncologic principles [7, 12, 14, 15 ]. a longitudinal medial incision extended from the tibial tubercle proximally following the course of the sartorius muscle, and the neurovascular bundle all previous open biopsy sites were left in continuity with the resected mass ; needle biopsy sites were ignored. the femoral and tibial osteotomies were made with the intention that postreconstruction leg lengths would be equal. a rotating - hinge knee mechanism was used in all cases that incorporated an 8-mm all - polyethylene nonmetal - backed tibial component. the distance between the distal end of the metal femoral component and the undersurface of the all - polyethylene tibial component when assembled was 17 mm. to ensure leg length equality, the femoral osteotomy was made 1 cm longer than the femoral component length, and 7 mm of proximal tibia was resected. the location of the patella relative to the joint line was never a conscious consideration. the level of resection was marked on the femur proximally with an osteotome, followed by a slightly more proximal mark on the femur and a mark on the proximal tibia (distal to the level of resection). a final mark was placed at the most anterior aspect of the femur to ensure proper femoral component rotation as the location of the linea aspera was not always exactly posterior. after the femoral osteotomy, the proximal marrow was sent for frozen - section analysis to confirm a negative marrow margin. a trial tibial component was placed, and in all cases, an intraoperative radiograph was obtained to ensure placement perpendicular to the mechanical axis of the tibia. the trial hinge mechanism was reduced, and restoration of the preresection extremity length and rotation were verified using marks previously made on the proximal tibia and femur. the neurovascular bundle was palpated to ensure there was not excessive tension on the vessels, and a doppler probe at the ankle confirmed the presence of the posterior tibial and dorsalis pedis pulses. the all - polyethylene tibial and patellar components were cemented first, followed by the femoral component separately. all patients were administered 100 mg solu - cortef (pfizer inc, new york, ny) before placement of the femoral component, and the prosthesis was introduced slowly to avoid causing a fat embolism. implants were manufactured by one of three companies : stryker / howmedica (mahwah, nj), techmedica (camarillo, ca), and dow - corning wright corp (arlington, tn). the 156 implants (83.9%) manufactured by stryker / howmedica used the kinematic rotating - hinge mechanism. the 28 implants (15.1%) manufactured by techmedica used the noiles rotating hinge, whereas the two (1.1%) manufactured by dow - corning wright used the lacey rotating - hinge knee (figs. 1, 2). initially, the first 101 (54.3%) prostheses were custom designed by two of the senior authors (jmk, jje) as a one - piece femoral component. seventy - three of 101 custom implants were co - cr - mo alloy components manufactured by howmedica. the bodies were casted using the lost - wax method, and the casted stems, based on the zickel nail design, were welded to the body. all patellae were resurfaced using a nonmetal - backed all - polyethylene single central - pegged component.fig. c(a) a custom endoprosthesis featuring a body casted by the lost - wax method and used from 1980 to 1985 is shown. the stem, based on the zickel nail design, was welded to the body. (b) an extramedullary porous coating was added to the prosthesis used from 1985 to 1990, which acts as a scaffolding for soft tissue ingrowth. (c) a contemporary modular endoprosthesis used since 1990 features titanium segments and co - cr - mo alloy morse tapers that prevent cold welding.fig. 2the lacey, kinematic, and noiles rotating - hinge mechanisms used in this series are shown. (a) a custom endoprosthesis featuring a body casted by the lost - wax method and used from 1980 to 1985 is shown. the stem, based on the zickel nail design, was welded to the body. (b) an extramedullary porous coating was added to the prosthesis used from 1985 to 1990, which acts as a scaffolding for soft tissue ingrowth. (c) a contemporary modular endoprosthesis used since 1990 features titanium segments and co - cr - mo alloy morse tapers that prevent cold welding. the lacey, kinematic, and noiles rotating - hinge mechanisms used in this series are shown. before the introduction of the continuous passive motion (cpm) machine, patients initially were immobilized in a cast for 2 to 3 weeks before physical therapy. since the introduction of the cpm machine in the early 1980s, all patients were placed into a cpm machine in the operating room. motion was commenced from 5 extension to 30 to 45 flexion and gradually increased to greater than 90 flexion before discharge. a towel roll under the heel was used three times daily for 1 hour to ensure full extension was achieved. on the third postoperative day, patients were made weightbearing as tolerated with ambulatory supports and a knee immobilizer, which were used for 6 to 8 weeks. the cpm machine was used at home for 12 hours a day for 1 month to help ensure maximum flexion was achieved. patients were followed every 2 to 3 weeks for the first 2 months after surgery, then on a quarterly basis for 2 years, semiannually for an additional 2 years, and annually thereafter. radiographs of the affected limb were obtained at each postoperative visit, along with quarterly chest radiographs and semiannual chest ct. postoperative function was evaluated for each patient using the musculoskeletal tumor society (msts) function score. one hundred sixty of the 186 patients (86.0%) were available for functional evaluation and did not undergo amputation during the followup period. patient and prosthesis survival rates and 95% confidence intervals (cis) were determined for all three groups using the kaplan - meier product - limit method. prosthesis survivorship was determined for custom and modular implants separately using revision of the stemmed components for any reason as an end point. for purposes of implant survival, we did not include surgery attributable to failure of the bushings, the axle, or the metal tibial bearing component, all of which were managed successfully without the need for revision of major stemmed components. implant and patient survival curves for the two types of implants and three grades or stages of malignancy were compared using the log - rank method. statistical analysis was performed using a commercially available statistics package (r, version 2.9.0, the r foundation for statistical computing, vienna, austria). modular implants had greater survivorship (p = 0.011) than those of a custom design, with a 15-year survivorship rate of 93.7% versus 51.7% (fig. 35 stemmed components (18.8%) were revised : 32 revisions were performed owing to mechanical failure, whereas an additional three revisions were necessary owing to nonmechanical complications. thirty - one custom - casted stems were revised ; 19 were revised for aseptic loosening of the femoral stem, nine for fatigue fracture, two for infection, and one for local recurrence. only four of 85 forged modular components were revised : three for aseptic loosening and one for a fatigue fracture of a casted (not forged) morse taper component. failure of the rotating - hinge mechanism necessitated replacement of the bushings and/or axle without revision of the stemmed components in 22 patients (11.8%) at a mean of 159.7 months (range, 1.6291.1 months) from the index procedure ; six of these patients (3.2%) ultimately required a second bushing change. using revision of the stemmed components for any reason as an end point, overall prosthesis survival rates at 10, 20, and 25 years were 77.2%, 57.9%, and 50.2%, respectively (fig. 3a b kaplan - meier survivorship analyses show (a) custom (n = 101) versus (b) modular (n = 85) implant survival. 4the kaplan - meier survivorship analysis shows overall prosthesis survival (n = 186). the dashed lines represent the 95% ci.table 2implant survival, patient survival, and overall limb salvage datasurvival5 years10 years15 years20 years25 years%95% ci%95% ci%95% ci%95% ci%95% cilowerupperlowerupperlowerupperlowerupperlowerupperimplant survival low grade (n = 43)83.3%71.9%96.5%73.5%58.5%92.3%73.5%58.5%92.3%61.2%40.1%93.6%30.6%7.2%100.0% stage iia / iib (n = 122)89.8%83.5%96.5%78.4%68.2%90.2%55.7%41.6%74.7%50.7%35.8%71.7%45.0%29.7%68.4% stage iii (n = 21)85.7%63.3%100.0%nananana custom (n = 101)83.5%75.2%92.7%69.2%58.1%82.4%51.7%39.1%68.4%48.7%35.9%66.0%42.2%29.4%60.7% modular (n = 85)93.7%87.9%99.9%93.7%87.9%99.9%93.7%87.9%99.9%nana overall (n = 186)87.7%82.2%93.7%77.2%68.7%86.7%61.6%50.1%75.7%57.9%45.6%73.5%50.2%36.8%68.5%patient survival by diagnosis low grade (n = 43)100.0100.0100.0100.0100.0 stage iia / iib (n = 122)65.3%56.9%74.9%57.7%48.7%68.4%56.0%46.8%67.0%56.0%46.8%67.0%56.0%46.8%67.0% stage iii (n = 21)25.6%11.6%56.4%nananana overall limb salvage91.3%86.7%96.3%89.0%83.5%94.8%85.2%77.9%93.1%78.8%68.6%90.6%78.8%68.6%90.6%ci = confidence interval ; na = not available. kaplan - meier survivorship analyses show (a) custom (n = 101) versus (b) modular (n = 85) implant survival. the kaplan - meier survivorship analysis shows overall prosthesis survival (n = 186). implant survival, patient survival, and overall limb salvage data ci = confidence interval ; na = not available. modular implant survival was greater (p = 0.001) than patient survival for those in disease groups 2 and 3. all patients initially diagnosed with low - grade or aggressive benign tumors (group 1, n = 43) survived (fig. 5 ; table 2). the 10-, 20-, and 25-year disease - specific survival rates for patients diagnosed with high - grade localized disease (group 2) were 57.7%, 56.0%, and 56.0%, respectively (fig. the 5- and 10-year disease - specific survival rates for patients diagnosed with stage iii sarcomas, metastatic disease, lymphoma, and myeloma (group 3) were 25.6% and 0%, respectively (fig. 7 ; table 2).fig. analysis shows survival among patients with low - grade or benign disease (group 1 ; n = 43).fig. 6the kaplan - meier survivorship analysis shows survival among patients with high - grade localized (stage iia / iib) disease (group 2 ; n = 122). 7the kaplan - meier survivorship analysis shows patient and prosthesis survival among patients with stage iii primary sarcoma, metastatic disease to the distal femur, myeloma, or lymphoma (group 3 ; n = 21). the kaplan - meier survivorship analysis shows survival among patients with low - grade or benign disease (group 1 ; n = 43). the kaplan - meier survivorship analysis shows survival among patients with high - grade localized (stage iia / iib) disease (group 2 ; n = 122). the kaplan - meier survivorship analysis shows patient and prosthesis survival among patients with stage iii primary sarcoma, metastatic disease to the distal femur, myeloma, or lymphoma (group 3 ; n = 21). the dashed lines represent the 95% ci. among the 160 patients for whom we had functional evaluations and who retained their implants, the mean postoperative msts score was 86.7% (mean score, 26.0 ; range, 1129). the postoperative rom on final assessment revealed mean flexion of 110.0 (range, 45140), mean passive extension to 1.3 (range, 040), and mean active extension lag of 6.9 (range, 0120). a postoperative flexion contracture was observed in seven patients, with a mean value of 10.0 (range, 540). seven systemic complications occurred in seven patients, including four cardiac arrhythmias, and single cases of chemotherapy - related fungal sepsis, acute leukemia, and steroid - induced avascular necrosis of multiple joints. one hundred four local complications occurred in 88 patients ; a single complication occurred in 72 patients, and 16 patients experienced multiple complications. complications included mechanical failure in 54 (29.0% ; fig. 8), superficial wound - related issues in 13 (7.0%), local recurrence in 13 (7.0%), temporary peroneal nerve palsy in seven (3.8%), deep infections in six (3.2%), cement extrusion through a vascular channel in three (1.6%), flexion contracture in three (1.6%), patellofemoral subluxation in two (1.1%), positive oncologic margins in two (1.1%), and stress fracture in one (0.05%). thirty - two were stemmed component revisions and 22 involved replacement of the bushings only, as described previously. six of 13 patients with local recurrence were treated with an amputation, and seven were palliated. eight of the 13 patients (61.5%) with local recurrence ultimately died of their disease, and five of the 13 (38.5%) are alive. of the five patients who currently are alive, four remain disease - free at 50, 141, 166, and 205 months. one patient currently is alive with metastatic pulmonary disease at 38 months after the index procedure. eighteen of the 186 patients (9.7%) ultimately required amputation after either the index or later revision procedure and were categorized as having failed limb salvage efforts. the reason for amputation was infection in nine patients, local recurrence in six, positive surgical margins in two, and metastasis to the pelvis in one.fig. 8a d the common modes of mechanical failure seen in this series of cemented rotating - hinge distal femoral endoprostheses from 1980 to 2008 are shown. (a) a radiograph shows aseptic loosening of a custom - casted femoral stem 24 years after the index reconstruction. the absence of extramedullary porous coating on the proximal body is evident. in our series, there were 22 total instances of aseptic loosening : 19 custom and three modular. (b) fatigue fractures of a custom - casted femoral stem (right) and femoral body (left) are illustrated. there was only one fatigue fracture of a modular component, which was a casted (not forged) morse taper segment. in our series (c) an axial photograph shows a fractured hollow, custom - casted femoral body. (d) in our series, there were 22 failures of the rotating - hinge bushings, as illustrated in this photograph, 15 custom and seven modular. the common modes of mechanical failure seen in this series of cemented rotating - hinge distal femoral endoprostheses from 1980 to 2008 are shown. (a) a radiograph shows aseptic loosening of a custom - casted femoral stem 24 years after the index reconstruction. the absence of extramedullary porous coating on the proximal body is evident. in our series, there were 22 total instances of aseptic loosening : 19 custom and three modular. (b) fatigue fractures of a custom - casted femoral stem (right) and femoral body (left) are illustrated. there was only one fatigue fracture of a modular component, which was a casted (not forged) morse taper segment. in our series (c) an axial photograph shows a fractured hollow, custom - casted femoral body. (d) in our series, there were 22 failures of the rotating - hinge bushings, as illustrated in this photograph, 15 custom and seven modular. historically, a debate existed among orthopaedic oncologists regarding which was the most durable method of reconstruction after distal femoral resection. although high long - term implant survival and functional scores have been reported with a wide variety of reconstructive methods [5, 7, 14, 44, 5355, 57, 65 ], our experience with osteoarticular allografts between 1975 and 1979 was poor, and in 1980 we abandoned this method of reconstruction in favor of a cemented endoprosthetic technique [13, 14, 51 ]. recently, critics of this technique have cited high rates of aseptic loosening as the major reason for using alternative fixation methods [2, 38 ]. such criticism does not consider the potential improvement in cemented implant survival over historical rates attributable to design modifications. we asked the following four questions : (1) do newer implant designs perform better than older custom - designed implants ? (2) does tumor diagnosis influence implant survival ? (3) what is the typical long - term functional result after distal femoral replacement ? (4) what are the complications associated with endoprosthetic reconstruction of the distal femur ? the major limitations of this study are its retrospective design, the lack of a control group, and the lack of a prestudy power analysis. first, musculoskeletal tumors are rare, and although a prospective design certainly would enhance the validity of our conclusions, it would be exceedingly difficult to amass a large series of patients prospectively. second, comparison to a control group is virtually impossible because other methods of reconstruction were used only rarely at our institution. in the absence of a prestudy power analysis, we have limited our conclusions to address the differences in survival rates and refrained from drawing conclusions when no difference was seen in the data. the questions addressed at the start of this paper will be addressed in light of these few but important limitations. largely owing to the low incidence of musculoskeletal sarcomas, few studies document the long - term durability of contemporary cemented distal femoral endoprostheses (table 3). published implant survival rates vary from 46.3% to 93.0%, potentially a reflection of heterogeneous patient and implant study populations. when compared with primary total joint implants, the modifications made to cemented endoprosthetic designs have been relatively few. these modifications include the addition of extramedullary porous coating, the development of modular segments, and the use of forged metals that have the potential to reduce the incidence of fatigue fracture [8, 28, 45, 62 ]. the evolution of the implants used at our institution reflects this general development of endoprosthetic design (table 4). the data presented here suggest the use of contemporary modular components improve the durability and longevity of the cemented prosthesis when used in distal femoral applications. although custom - casted stems can last two to three decades, modular designs maintain the intrinsic benefit of immediate availability and the ability to intraoperatively tailor components based on the resection level. numerous authors [8, 43, 48, 70 ] have similarly reported modular endoprostheses survive longer than historical custom - designed implants. in our series, the mean time to revision of the four failures among modular implants was 12.5 months (range, 1.621.4 months), indicating these failures were possibly the result of technical error rather than implant design (fig. three of four modular failures were attributable to aseptic loosening, likely the result of poor cement technique as noted previously. the fourth failure of a modular implant was attributable to fatigue fracture of a casted, not forged, morse taper segment, emphasizing the importance of this particular design feature. the revision implants for the three cases of aseptic loosening have outlasted the original primary reconstructions. currently, the mean time from revision surgery for these patients is 138.6 months (range, 107.4181.2 months). all four patients who underwent revision of a modular implant still maintain successful limb salvage. although an improvement in survival was seen in this series, we recognize the need for novel implant designs in special circumstances, such as short residual periarticular segments, which we have dealt with by designing a custom implant with cross - stem pin fixation. a compressive intramedullary device based on wolff s law (compress ; biomet inc, warsaw, in) was developed to improve fixation in such situations and to reduce the need for custom - designed cemented implants. five- to 10-year reports of implant survivorship after the use of this device have been promising [2, 38].table 3review of the available literaturestudyyearnumber of patientsmean followup (years)implant survivorship / revision ratemean msts scoreamputationinfectionlocal recurrence09 years1014 years1519 years 20 yearsbradish. 1993612 - 6042%7e, 19 g, 15f, 20p8.2%8.2%4.9%capannna. 1994954.375%20e, 43 g, 12f, 9p7.4%5.0%5.3%rougraff. 1994341132.4%76.7%26.0%na11.0%malawer and chou 1995313.580.0%80.0%na12.9%19.4%0.0%choong. 1996323.56.7%6e, 14 g, 9f, 3p0.0%3.3%3.1%kawai. 2008228968.6%46.3%na9.2%12.7%5.3%current study2010186887.7%77.2%61.6%50.2%86.7%9.7%3.2%7.0%numbers (as reported) converted to percentages for ease of comparison ; according to the 1987 scoring system described by enneking. ; e = excellent, g = good, f = fair, p = poor, according to the 1987 msts scoring system ; all uncemented implants ; neither revision rates reported nor survivorship analysis done ; reported as percentage of good or excellent clinical results ; data for all limb salvage reconstructions reported ; percentage of implants revised reported ; data given for all 73 patients who had limb salvage (including rotationplasties, allograft and allograft - prosthetic composites, and others) ; data for implants at all anatomic sites reported ; median ; function for all sites reported at 83.3% with no significant difference between anatomic sites ; functional outcomes only evaluated ; data reported for all 63 implants ; 83 of 144 patients reported who survived greater than 5 years ; only patellofemoral complications reported ; includes 162 fixed - hinge knees and 173 rotating - hinge knees ; survival of rotating - hinge knees only shown ; all prostheses custom - made ; kaplan - meier survivorship of implant ; msts = musculoskeletal tumor society ; na = not available or not studied.table 4distal femoral implant evolution at university of california los angelesdateimplant designmanufacturer / featurestumor group (n = 186)19801990custom (jje / jmk)stryker / howmedica73 kinematic rotating hinge made of vitallium casted hollow body by lost - wax method welded zickel nail stem extramedullary porous coating added in 1985 techmedica28 all - titanium one piece noiles hingetotal custom implants10119902003modularstryker / howmedica53 kinematic rotating hinge forged modular replacement system titanium segments extramedullary porous coatingdow - corning wright2 modular titanium lacey hinge20032008modularstryker global modular replacement system30 kinematic rotating hinge forged modular components titanium segments extramedullary porous coating larger axle and bushings press - fit stem option (none in this series) cobalt - chrome morse tapertotal modular implants85 all components in this series were cemented ; all tibial components were nonmetal - backed, all - polyethylene ; all used a rotating - hinge knee mechanism ; all patellar components were all - polyethylene, nonmetal - backed, with a single central peg.fig. 9a b (a) an ap radiograph of the femur shows aseptic loosening of the femoral stem 12 months after endoprosthetic reconstruction with a contemporary modular implant. we suspect this occurred owing to last - minute rotational adjustment of the stem as the cement was curing. (b) a lateral radiograph shows the femur 12 years after revision to a larger cemented stem and in this case with cross - stem pin fixation, which is our preferred method of reconstruction for the majority of failures attributable to aseptic loosening. review of the available literature numbers (as reported) converted to percentages for ease of comparison ; according to the 1987 scoring system described by enneking. ; e = excellent, g = good, f = fair, p = poor, according to the 1987 msts scoring system ; all uncemented implants ; neither revision rates reported nor survivorship analysis done ; reported as percentage of good or excellent clinical results ; data for all limb salvage reconstructions reported ; percentage of implants revised reported ; data given for all 73 patients who had limb salvage (including rotationplasties, allograft and allograft - prosthetic composites, and others) ; data for implants at all anatomic sites reported ; median ; function for all sites reported at 83.3% with no significant difference between anatomic sites ; functional outcomes only evaluated ; data reported for all 63 implants ; 83 of 144 patients reported who survived greater than 5 years ; only patellofemoral complications reported ; includes 162 fixed - hinge knees and 173 rotating - hinge knees ; survival of rotating - hinge knees only shown ; all prostheses custom - made ; kaplan - meier survivorship of implant ; msts = musculoskeletal tumor society ; na = not available or not studied. distal femoral implant evolution at university of california los angeles all components in this series were cemented ; all tibial components were nonmetal - backed, all - polyethylene ; all used a rotating - hinge knee mechanism ; all patellar components were all - polyethylene, nonmetal - backed, with a single central peg. (a) an ap radiograph of the femur shows aseptic loosening of the femoral stem 12 months after endoprosthetic reconstruction with a contemporary modular implant. we suspect this occurred owing to last - minute rotational adjustment of the stem as the cement was curing. (b) a lateral radiograph shows the femur 12 years after revision to a larger cemented stem and in this case with cross - stem pin fixation, which is our preferred method of reconstruction for the majority of failures attributable to aseptic loosening. by stratifying patients according to disease grade and/or stage, we found a comparison of implant to patient survival provides a useful measure of disease - specific implant efficacy (fig. patients with low - grade tumors have a normal life expectancy and thus should expect to outlive their prostheses. as a result, this group almost certainly will require at least one revision procedure in their lifetime. however, none of the patients with disseminated, stage iii disease outlived their prosthesis in this series. for patients with high - grade localized disease (stage iia / iib), overall prosthesis survivorship remained greater than patient survival up to a critical time, at which point the rate of prosthetic failure became greater than patient survival. the rate of modular implant survival, however, continued to exceed patient survival with high - grade localized disease to 15 years. as long - term survival of patients with high - grade disease approaches 70% to 80% [3941, 46, 52, 66, 67 ], the improved longevity of modular implants seen in this series supports the notion that a cemented endoprosthesis will continue to provide a durable method of reconstruction.fig. modular implants performed better than custom implants, with 15-year survival rates of 93.7% versus 51.7%, respectively. patients with low - grade or benign disease and long - term survivors with high - grade localized disease should expect to undergo at least one revision procedure in their lifetime. modular implants performed better than custom implants, with 15-year survival rates of 93.7% versus 51.7%, respectively. patients with low - grade or benign disease and long - term survivors with high - grade localized disease should expect to undergo at least one revision procedure in their lifetime. the functional scores were high for the majority of patients who underwent endoprosthetic distal femoral reconstructions (table 3). functional scores are assigned subjectively, and although newer scoring systems have attempted to eliminate subjective terminology, a precise and accurate measurement of function remains elusive. despite these limitations, however, our results confirm the findings of previous studies, that favorable long - term function is possible after cemented distal femoral endoprosthetic reconstructions. the most common local complications in our patients included mechanical failure, tumor recurrence, and infection. all 54 cases of mechanical failure (including modular and custom implants) were salvaged with revision to a larger stem, cross - stem fixation, or new components. similar to findings described elsewhere, mechanical failures of this nature did not seem to compromise the overall limb salvage effort [59, 68 ]. five of 19 patients with wound - related complications that occurred after the index procedure required an amputation, and among an additional six patients who had a deep infection after a second or third procedure, four required an amputation. the total amputation rate in this series for all wound - related complications after either the index or revision procedure was nine of 25 (36.0%). we previously reported our preferred method of caring for patients with wound - related issues after endoprosthetic replacement. local recurrence portended a poor prognosis in this series as 61.5% of patients had died by the time of the most recent followup. our study reports the improved survival of cemented distal femoral endoprostheses during the past three decades. contemporary modular forged implants performed better than the custom - designed prostheses of the 1970s and 1980s. although failures may occur, mechanical complications can be revised and potentially outlast the original reconstruction. we recognize revision procedures will be necessary for patients with long - term life expectancy, and the need for continued improvement in reconstruction techniques and implant design, as high - grade disease - specific survival rates may continue to improve. | backgroundadvocates of newer implant designs cite high rates of aseptic loosening and failure as reasons to abandon traditional cemented endoprosthetic reconstruction of the distal femur.questions/purposeswe asked whether newer, modular distal femoral components had improved survivorship compared with older, custom - casted designs.patients and methodswe retrospectively reviewed 254 patients who underwent distal femoral endoprosthetic reconstruction. we excluded two patients with cementless implants, 27 with expandable prostheses, and 39 who had a nontumor diagnosis. this left 186 patients : 101 with older custom implants and 85 with contemporary modular implants. the minimum followup was 1 month (mean, 96.0 months ; range, 1336 months). the tumor was classified as stage iia / iib in 122 patients, stage ia / ib or benign in 43, and stage iii or metastatic in 21.resultskaplan-meier analysis revealed overall 10-, 20-, and 25-year implant survival rates of 77%, 58%, and 50%, respectively, using revision of the stemmed components as an end point. the 85 modular components had a greater 15-year survivorship than the 101 custom - designed implants : 93.7% versus 51.7%, respectively. thirty - five stemmed components (18.8%) were revised for aseptic loosening in 22 patients, implant fatigue fracture in 10, infection in two, and local recurrence in one.conclusionscemented modular rotating - hinge distal femoral endoprostheses demonstrated improved survivorship compared with custom - casted implants during this three - decade experience. patients with low - grade disease and long - term survivors of high - grade localized disease should expect at least one or more revision procedures in their lifetime.level of evidencelevel iv, therapeutic study. see the guidelines for authors for a complete description of levels of evidence. |
reversible posttranslational modification by ubiquitin and ubiquitin - like proteins (ubls) plays a crucial role in dynamic regulation of protein function, fate, binding partners, activity, and localization. small ubiquitin - related modifier (sumo) is a member of ubls family that is covalently attached to lysine residues of their protein targets in cells, altering function and subcellular localization. sumoylation has been implicated in the regulation of numerous biological processes including transcription and cell cycle control. the sequential actions of e1, e2, and e3 enzymes catalyze the attachment of sumo to target proteins, while deconjugation is promoted by sumo - specific proteases. in addition, like other ubls, sumo polypeptide is synthesized as an inactive precursor, which requires a c - terminal cleavage to expose the glycine residue for substrate conjugation. the catalytic activity is maintained within a highly conserved 200 amino acid region at the c - terminus of the proteases [46 ]. excessive sumo conjugation using knockouts for either senp1 or senp2 induced an embryonic lethal phenotype [7, 8 ] and deregulation of either sumo conjugation or deconjugation can contribute to cancer progression as reviewed by. in humans there are six senp enzymes (senp1, -2, -3, -5, -6, and -7) that deconjugate mono - sumoylated proteins or disassemble polymeric sumo side chains, while in saccharomyces cerevisiae there are only two desumoylating enzymes, ulp1 and ulp2. based on these activities and affinities for sumo isoforms, senps can be categorized into three independent subfamilies : senp1 and senp2 ; senp3 and senp5 ; senp6 and senp7. the initial molecular characterization of sumoylation pathway in s. mansoni showed the presence of two sumo paralogs called smt3c and smt3b, suggesting a variety of targeted substrates for these modifications. recently, our group reported the conservation of sumo conjugating enzyme smubc9 by phylogeny, primary and modeled tertiary structures, as well as mrna transcription and protein levels throughout the s. mansoni life cycle. our data showed that smubc9 transcription levels are upregulated in early schistosomula, suggesting the utilization of this posttranslational modification mechanism s. mansoni development, particularly at the initial phase of invasion of the vertebrate host. to extend the investigation of the sumoylation pathway in s. mansoni, we firstly retrieved through homology - based searches putative smsenps using the publically available s. mansoni databases. furthermore, the levels of smsenp1/7 transcripts were evaluated by qrt - pcr using mrna from cercariae, adult worms and mechanically - transformed schistosomula (mts) in vitro - cultivated during 3.5 h, 1, 2, 3, 5, and 7 days. we also measured the endopeptidase activities of smsenps in cercariae and adult worm crude extracts. the present study reveals differences in the gene expression profile of smsenp1/7 during schistosomula development. in addition, similar smsenp1 activity was observed in cercariae and adult worms, suggesting the importance of this proteolytic activity during the parasite 's life cycle. all experiments involving animals were authorized by the ethical committee for animal care of federal university of ouro preto, and were in accordance with the national and international regulation accepted for laboratory animal use and care. le strain was maintained by routine passage through biomphalaria glabrata snails and balb / c mice. the infected snails were induced to shed cercariae under light exposure for 2 h and the cercariae were recovered by sedimentation on ice. adult worm parasites were obtained by liver perfusion of mice after 50 days of infection. briefly, cercariae were recovered, and washed in rpmi 1640 medium (invitrogen), before vortexing at maximum speed for 90 s and immediately cultured during 3.5 h at 37c, 5% co2. then the recovered schistosomula were washed with rpmi 1640 until no tails were detected. for subsequent incubations, the parasites were maintained in m169 medium supplemented with 10% fbs, penicillin, and streptomycin at 100 g / ml and 5% schneider 's medium at 37c on 5% co2 during 3.5 h, 1, 2, 3, 5, and 7 days. smsenp1/7 sequences were retrieved from the s. mansoni genome database version 5.0 available at http://www.genedb.org/genedb/smansoni/ through blast searches. amino acid sequences from drosophila melanogaster, caenorhabditis elegans and homo sapiens senp orthologs were used as queries. the blastp algorithm, underpinned by the pfam (v26.0), allowed detection of conserved protein domains or motifs from s. mansoni sequences. multiple alignments of smsenp1/7 were performed by clustalx 2.0 and phylogenetic analysis was conducted in mega 5. the bootstrap consensus tree inferred from 1000 replicates was used to represent the evolutionary history of the taxa analyzed. the percentage of replicate trees in which the associated taxa clustered together in the bootstrap test (1000 replicates) is shown next to the branches. the tree was drawn to scale, with branch lengths in the same units as those of the evolutionary distances used to infer the phylogenetic tree. total rna from adult worms, cercariae, and schistosomula was obtained using a combination of the trizol reagent (gibco - brl) and chloroform for extraction, and then on column purified using the sv total rna isolation system (promega, belo horizonte, brazil). the preparation was treated with rnase - free dnase i in 3 different rounds by decreasing enzyme concentration (rq1 dnase ; promega). rna was quantified using a spectrophotometer and an aliquot containing 1 g of total rna reverse transcribed using an oligodt primer from the thermoscript rt - pcr system (invitrogen so paulo, brazil) as described by the manufacturer. the efficiency of dnase i treatment was evaluated by pcr amplification of the cdna reaction mix without the addition of the thermoscript enzyme. s. mansoni specific senp1/7 primers were designed using the program generunner for smsenp1 (genedb access number smp_033260.2) (forward 5-aggaaacggaggcgggattc-3, reverse 5-acactggagacacgggatgagc-3) and for smsenp7 (genedb access number smp_159120) (forward 5-tcagttacacggccctttatc-3, reverse 5-cctgagaagtggatgcgatc-3). reverse - transcribed cdna samples were used as templates for pcr amplification using sybr green master mix udg - rox (invitrogen) and 7300 real time pcr system (applied biosystems, rio de janeiro, brazil). specific primers for s. mansoni-tubulin were used as an endogenous control (genbank access number m80214) (forward 5-cgtattcgcaagttggctgacca-3, reverse 5-ccatcgaagcgcagtgatgca-3). the efficiency of each pair of primers was evaluated according to the protocol developed by the applied biosystems application (cdna dilutions were 1 : 10, 1 : 100 and 1 : 1000). for all investigated transcripts three biological replicates were performed and their gene expression normalized against the -tubulin transcript according to the 2 method using the applied biosystems 7300 software. to determine the enzymatic activity of senp proteases present in adult worms and cercariae crude extracts we used the fluorogenic substrate sumo-1-amc that is specific for senp1 (enzo life sciences, so paulo, brazil). in these assays 10 g of total protein were used and 0,45 m of the fluorogenic substrate in 50 mm tris - hcl ph 8, 10 mm mgcl2 0,45 m sumo-1-aldehyde (enzo life sciences) to control for specific enzyme inhibition. each enzymatic assay was conducted in a final volume of 100 l for both extracts, followed by 60 minutes incubation at 37c. the fluorometric readings were taken at wavelengths of 380 nm (excitation) and 440 nm (emission) in a spectrofluorimeter (turner quantechtm fluorometer), and the results expressed in fluorescence units per g of total protein. statistical analysis was performed using graphpad prism version 5.0 software package (irvine, ca, usa). normality of the data was established using one way analysis of variance (anova). tukey post tests were used to investigate significant differential expression of sumo proteases throughout the investigated stages. in all cases, in silico analysis of smsenps revealed the conserved putative domains of sumo proteases in s. mansoni. the parasite database has two sequences encoding putative senps : smp_033260.2 (putative senp1) and smp_159120 (putative senp7). our results showed that each senp was grouped in 2 distinct clades, reinforcing their structural conservation among the thirteen analyzed orthologs (figure 1). to confirm that these predicted proteases are cysteine - family members, analyses using the pfam protein domain database were conducted. for both smsenps entries our in silico analysis demonstrated smsenp1 more closely related to hssenp1 (genbank access number np_055369.1), whereas smsenp7 is related to hssenp7 (genbank access number np_065705.3). alignment of their catalytic domains with the human senps showed the presence of the three essential catalytic residues (cys - his - asp), highlighted in figure 2. we designed specific primers to amplify smsenp1 and smsenp7 transcripts in the cercariae - schistosomula transition and adult worm (figure 3). we observed that smsenp1 and smsenp7 transcripts are expressed in basal levels from mts-2d to 7 days and adult worms. the levels of the senps transcripts were significantly higher in mts-3.5 h being approximately 10-fold higher when compared to levels in adult worms and during schistosomula development (mts-2, 3, 5, and 7 days) and 3-fold higher when compared to cercariae and mts-1d. we also observed that smsenp1 and smsenp7 transcription levels were not significantly different (p < 0.05) within a given stage, except for mts-3.5 h where smsenp7 levels are 3 fold - higher than smsenp1. in vitro endopeptidase assays the smsenp1 enzymatic activity was slightly higher in cercariae compared to adult worms, although the levels were not significantly different (p < 0.05). enzyme activities were also recorded in the presence of a commercially available hssenp1 inhibitor but significant differences were not observed in the analyzed stages. previous reports from our group showed the presence of two sumo paralogs (smt3c and smt3b) in s. mansoni, exhibiting differential expression between larvae and adult worms. furthermore, our group demonstrated a differential expression profile for ubc9 throughout the parasite life cycle. the structural sumo conservation in s. mansoni reinforces sumo as a candidate for a transcription regulator and a degradation signal by facilitating ubiquitylation of certain target proteins during parasite development. in order to understand the role of sumoylation in s. mansoni, we evaluated the conservation of sumo proteases and their gene expression profile in cercariae, schistosomula, and adult worm. firstly, we retrieved, through homology - based searches, two sequences containing conserved domains of sumo proteases. a phylogenetic approach then revealed two putative proteases closely associated to human senp1 and senp7. alignment of parasite sequences with their human counterparts also demonstrated conservation of the catalytic triad for both proteases. the active site residues within the core domain of ulp1 and ulp2 have been proven to be necessary for catalytic activity and in vivo function in yeast [19, 20 ]. furthermore, ulp1 lacks obvious sequence similarity to any known deubiquitinating enzyme so it is unlikely that it is able to process ubiquitin - linked substrates. considering that the sumoylation pathway dictates the function of a variety of substrates, and the existence of two sumo paralogs in s. mansoni, it is plausible that the worm utilizes distinct sumo proteases for sumo maturation and desumoylation of target substrates. discrimination between sumo-1 and sumo-2/3 paralogs may also account for distinct functions of senp proteases in s. mansoni. in mammalian cells, it is well established that senp1 processes sumo-1 in preference to sumo-2, and has a very low catalytic constant for sumo-3. in contrast, the recent characterization of the catalytic domain of senp7 in humans demonstrated a greater deconjugating activity for sumo-2/3 chains. as discussed by shen senp7 acts as a sumo-2/3 specific protease that is likely to regulate the metabolism of polysumo-2/3 rather than sumo-1 conjugation in vivo. in the present investigation, the transcriptional profile of sumo proteases was also evaluated by qpcr, using total rna from distinct stages of the s. mansoni life cycle. the gene expression data revealed similar expression profile for smsenp1 and smsenp7 at any given stage, but with a remarkable differential expression for both proteases comparing the larvae and adult stages. the differential gene expression profile observed for smsenp1/7 throughout the s. mansoni life cycle attests for the distinct patterns of sumo conjugates observed during parasite development. polysumoylation has been reported to increase during heat - shock treatment and stress conditions, with senp7 being responsible for dismantling sumo polymers [25, 27 ]. given that the levels of smsenp1/7 transcripts were significantly higher in cercariae and mts-3.5 h, we suggest a stress - induced expression of the sumoylation machinery during the parasite 's body adaptation to the new metabolic and morphological alterations it undergoes. our findings are also in agreement with pereira which demonstrated a similar pattern of gene expression profile for smubc9 in the aforementioned parasite stages. we have not observed a positive correlation between differential transcriptional levels of smsenp1 and enzymatic activity evaluated using synthetic sumo-1-amc substrate. the levels of enzymatic activity for smsenp1 were slightly higher in extracts of cercariae compared to adult worms. in the presence of a specific inhibitor, no significant change in enzymatic activity was detected. this may account for the limited amino acid sequence identity (28%) shared between smsenp1 and its human ortholog, from which the synthesis of sumo-1 aldehyde is based. additional studies aimed at elucidating substrate selection of smsenp1/7 in s. mansoni and a detailed kinetic analysis of their enzymatic activities, particularly during the cercarie to schistosomula transition may provide further insights into the biological activities of these enzymes and the role of sumo conjugation in s. mansoni. | small ubiquitin - related modifier (sumo) is involved in numerous cellular processes including protein localization, transcription, and cell cycle control. sumoylation is a dynamic process, catalyzed by three sumo - specific enzymes and reversed by sentrin / sumo - specific proteases (senps). here we report the characterization of these proteases in schistosoma mansoni. using in silico analysis, we identified two senps sequences, orthologs of mammalian senp1 and senp7, confirming their identities and conservation through phylogenetic analysis. in addition, the transcript levels of smsenp1/7 in cercariae, adult worms, and in vitro cultivated schistosomula were measured by qrt - pcr. our data revealed upregulation of the smsenp1/7 transcripts in cercariae and early schistosomula, followed by a marked differential gene expression in the other analyzed stages. however, no significant difference in expression profile between the paralogs was observed for the analyzed stages. furthermore, in order to detect desumoylating capabilities in crude parasite extracts, smsenp1 enzymatic activity was evaluated using sumo-1-amc substrate. the endopeptidase activity related to sumo-1 precursor processing did not differ significantly between cercariae and adult worms. taken together, these results support the developmentally regulated expression of sumo - specific proteases in s. mansoni. |
lung cancer is the leading cause of cancer - related mortality in both men and women throughout the world. it is also the most commonly diagnosed cancer worldwide with most of them at an advanced stage with a poor prognosis. a 78-year - old male smoker patient diagnosed to have non - small cell lung cancer (nsclc), stage iv (adrenal and liver metastasis) was subjected to whole body bone scan to detect skeletal metastases, if any. the patient had received local palliative radiotherapy 20 gy/5 # for 1 week and was on chemotherapy with gefitinib since 12 days. increase in tracer uptake was noticed in the lower cervical vertebrae, right first rib, and medial cortical margin of the lower third of shaft of left femur [figure 1a and b ]. hybrid single photon emission computed tomography / computed tomography (ct) localized the cervical uptake to left articular process of c6 and left transverse process of c7 vertebrae with dense sclerotic changes likely degeneration due to altered weight distribution. tc99m - methylene diphosphonate whole body bone scan in (a) anterior projection (b) posterior projection showing abnormal tracer uptake in the lower third of shaft of left femur (arrow). hybrid single photon emission computed tomography / computed tomography (ct) localized the ct images (c and d) of the lower third of the left femur showed lysis of the anteromedial cortical margin (arrow) ct scan of the lower third of the left femur showed lysis of the anteromedial cortical margin with no soft tissue component [figure 1c and d ]. on the basis of bone scan and pattern of cortical bone destruction, the diagnosis of a skeletal metastasis from a bronchogenic carcinoma was suggested. incidence of bone metastases in cancers of the breast, prostate, lung and kidney, is very high, approximately 70% of all patients. the reported incidence of bone metastasis from nsclc is around 15%-40%, most of which involves spine, rib, and pelvis and 6% in femur. bronchogenic carcinoma is an established entity in causing cortical bone metastases literature review also shows primaries in lung, breast, kidney, and pancreas as causes of cortical metastasis. of particular interest is the involvement of femur with studies reporting osteolytic cortical lesions preferentially located at the femur as typical of bronchogenic carcinoma. the reason for this special predilection for implantation in the cortical bone, particularly the femur, is still unknown. it is speculated that the vascular network, originating in the overlying periosteum of the long bones, serves as a pathway for metastatic deposits to destruct the cortical bone. literature review not only shows predominance of femoral involvement in bronchogenic carcinoma, but also patients with only pure cortical metastases had exclusive femoral involvement. four distinctive patterns of bone destruction in bronchogenic carcinoma have been described. a small focal intra - cortical lesions (cookie - bite or cookie - cutter pattern) ; large osteolytic lesions ; saucerized intra - cortical lesions with well defined periosteal reaction ; and lesions with predominant cortical destruction extending into the soft tissue as well as the medullary cavity. the term cookie bite metastasis was initially coined for a small intra - cortical lesion. although these lesions are not entirely pathognomonic, literature review shows that such lesion within the skeleton as initial diagnosis should alert the radiologist to the possibility of a primary neoplasm of the lung. our case further illustrates how a high degree of suspicion is needed in interpreting isolated uptake in bones scan in the femur in patients with bronchogenic carcinoma. moreover, as described in literature, the characteristic pattern of cortical destruction if found in a patient with carcinoma of unknown primary, then the search for an occult primary neoplasm should be started without delay. | detection of skeletal metastasis in patients with lung cancer is important from management point of view. we report the bone scan finding in a patient with non - small cell lung carcinoma showing isolated abnormal tracer in femur and having a characteristic appearance in computed tomography, highlighting the importance of bone scan in patients with bronchogenic carcinoma. |
traumatic intracranial pseudoaneurysm is a rare condition, accounting for less than 1% of all aneurysms.7) of these, post - traumatic vertebral artery pseudoaneurysm is not well known, because the incidence of isolated trauma to the vertebral artery is extremely low. majidi.4) reported that incidence of vertebral artery dissection was 0.01% of patients with head and neck trauma. traumatic pseudoaneurysm ruptures are associated with a high mortality rate, because of high risk of rebleeding or regrowth. we report on a rare case of post - traumatic pseudoaneurysm arising from the right v4 segment of the vertebral artery. a 9-year - old child was admitted to the emergency room after a pedestrian car accident. on admission, motor power of all extremities showed a good grade but movement showed abnormal flexion in response to painful stimuli. brain computed tomography (ct) showed subarachnoid hemorrhage (sah) with intraventricular hemorrhage (ivh), multiple facial bones, and temporal bone fracture (figure 1). external ventricular drainage and suboccipital craniectomy were performed for acute hydrocephalus and decompression of posterior fossa swelling. follow - up ct demonstrated resolution of the hemorrhage and his clinical condition recovered to stupor mentality. on the 15th hospital day, the patient showed decreased mentality into semicoma and ct scan revealed the onset of a new 3rd, 4th ventricle hemorrhage and aggravation of hydrocephalus. ct angiography and digital subtraction angiography confirmed a pseudoaneurysm measuring approximately 15 mm in size arising from the right v4 segment of the vertebral artery, near the origin of the posterior inferior cerebellar artery (pica) (figure 2). the dominancy of the vertebral artery was even in size and blood flow to the right pica territory was supplied from the right anterior inferior cerebellar artery (aica), meaning the aica - pica complex (figure 3). therefore, we decided to occlude the parent artery for complete obliteration of the pseudoaneurysm. final angiography confirmed complete obliteration of the pseudoaneurysm with preservation of the right aica - pica complex (figure 4). after endovascular treatment, the patient did not show worsening of neurological condition. despite receiving intensive neurosurgical care, he died of acute respiratory distress syndrome on the 52nd hospital day (figure 5). the mechanism is direct vessel injury from the foreign body or bony fragments due to skull fracture, or vascular torsion, stretching, and pressure against adjacent structures. the location of these pseudoaneurysms is varied, and they are commonly found in the anterior circulation. biffl.2) reported that vertebral artery injuries are presented in 0.5% of blunt cervical traumas. detection of traumatic pseudoaneurysms is still a clinical challenge due to its diverse presentation and lack of widely accepted diagnosis and management guidelines.5) clinical manifestation of vertebral pseudoaneurysm rupture could be a local neck mass, or neurologic symptoms related to posterior circulation due to microembolization. these pseudoaneurysms carry significant risk of embolic stroke and mortality, with cited figures of 13%, respectively.13) however, some pseudoaneurysms of the vertebral artery, like v3 or v4 segment, which proceeds from c1 to a junction with the contralateral vertebral artery, could present with intracranial hemorrhage. in general, deterioration of traumatic pseudoaneurysms may occur within several weeks after initial trauma. after the formation of a pseudoaneurysm, sudden onset of rebleeding could be associated with increased intracranial pressure or clot lysis. the pseudoaneurysms might be safely observed because spontaneous thrombosis could occur, but rebleeding could sometimes occur.6) therefore, early diagnosis and proper treatment of a pseudoaneurysm is also mandatory and highly important. intervention could also be an effective method for management of pseudoaneurysm, particularly posterior circulation with poor clinical grade. in the current case, the patient presented with post - traumatic sah and ivh, which was mistaken for simple traumatic sah, and there was no initial evaluation for vascular injury. formation of a pseudoaneurysm should be suspected in patients with trauma, if there is thick sah accompanying a basal skull fracture. the mechanism of traumatic brain injury is also an important consideration for development of pseudoaneurysm. on the 15th hospital day with deterioration of level of consciousness, angiography confirmed a rupture of a pseudoaneurysm arising from the right v4 segment of the vertebral artery. at the time of admission, there was no cervical spine injury that could affect dynamic injury to the vertebral artery. the child was pushed by a reversing school minivan with very low velocity immediately after leaving his car. then, he fell down and was run over by the right rear wheel. therefore, the exact mechanism of vascular injury is ambiguous ; however, considering angiographic findings, we thought that pseudoaneurysm formation was due to the rupture of a perforating artery by traction injury or dissection. the definite treatment of traumatic pseudoaneurysm is a destructive method, meaning parent artery occlusion. we could occlude the right vertebral artery just proximal to the aica origin, because there was no visualization on initial angiography and non - dominant vertebral artery compared with the contralateral side. we report an extremely rare case of traumatic pseudoaneurysm rebleeding arising from the intracranial vertebral artery. post - traumatic intracranial pseudoaneurysm should be considered in any patient who exhibits neurological deterioration after head trauma. therefore, brain ct angiography is mandatory for evaluation of vascular injuries in patients with traumatic sah and for achievement of a better outcome, especially in cases showing thick sah around the brain stem or sah with accompanying basal skull fractures. | this case report describes a traumatic pseudoaneurysm arising from the right v4 segment of the vertebral artery, near the origin of the posterior inferior cerebellar artery. post - traumatic vertebral artery pseudoaneurysm is rare, but associated with a high mortality rate. we report on an extremely rare case of post - traumatic pseudoaneurysm of the vertebral artery with delayed manifestation. a 9-year - old child was admitted to the emergency room after a pedestrian car accident. a computed tomography (ct) scan showed subarachnoid hemorrhage with intraventricular hemorrhage (ivh), multiple facial bones, and temporal bone fracture. external ventricular drainage and decompressive suboccipital craniectomy were performed for acute hydrocephalus and posterior fossa swelling. the patient 's clinical condition became suddenly aggravated on the 15th hospital day, and brain ct confirmed appearance of a new 4th ventricle ivh. digital subtraction angiography revealed a ruptured pseudoaneurysm arising from the right v4 segment of the vertebral artery. parent artery occlusion using detachable coils was achieved. despite intensive care, the patient 's clinical condition showed continuous deterioration and the patient died of respiratory complications on the 52nd hospital day. |
it is personal, highly transportable, and widely used, particularly in the western countries (1, 2). however, text messaging coupled with specific management strategies has yet to be utilized effectively in developing countries with high prevalence of diabetes. several studies showed that mobile phone might offer a useful means of providing information between clinic visits and might increase adherence to diabetes therapy regimens (3 - 5). the aim of this study was to evaluate the feasibility of short message service (sms) and its effect on glycemic control in adults with type 2 diabetes. a total of 100 patients with type 2 diabetes with disorder duration of more than one year and no end organ complications who were on oral hypoglycemic agents and were followed at the diabetes clinics, security forces hospital, were recruited. the following parameters were recorded before initiating sending sms : glycosylated hemoglobin (hba1c), frequency of simple hypoglycemic attacks (defined as blood glucose level 9.99 mmol / l), mean fasting blood sugar (fbs) level, mean postprandial blood glucose level, and frequency of blood glucose monitoring. twenty educational multiple - choice questions for assessing patients knowledge were distributed. after four month of sending sms, the above parameters were recorded again and ten scoring questions to assess the quality of sms were answered by the participants. the content of the sms program short messages prepared in simple, understandable, constructive arabic language. the educational messages covered general diabetes care knowledge that included diabetes symptoms, signs, pathophysiology, etiology, diagnosis, diet therapy, psychotherapy, press news concerning diabetes, etc. these messages were considered as reminding messages about blood glucose check - up and medications intake. the messages were written by specialist in diabetes and diabetic educators, and then reviewed by the authors. statistical analyses were performed using the wilcoxon signed rank test, to evaluate the differences in hba1c, fbs, postprandial blood glucose levels, incidence of hypoglycemic / hyperglycemic episodes, and other variables before and after the intervention. the tests were two tailed and p < 0.05 was considered as significant deviation from the null hypothesis. a written informed consent with the security forces hospital institutional board review approval was obtained from participants. the average number of submitted sms messages was six messages (range, 5 - 7) per patient per week with the total number of approximately 9600 messages over four months for all patients. a total of 100 phone calls were primarily made to ensure that the patients had received the messages at the middle the trial. mmol / l, the median frequency of documented simple hypoglycemic and hyperglycemic attacks per week were respectively zero and two, the mean hba1c was 9.9% 1.8%, the median frequency of blood glucose monitoring per day was zero, and the median score at the patient 's knowledge testing was 17 (the maximum score was 20). post - sms delivery and during the last month of the tele - educational period were as follow : the mean fbs level, 8.60 3.16 mmol / l ; the mean postprandial blood glucose level, 10.65 3.20 mmol / l ; the median frequency of documented simple hypoglycemic and hyperglycemic attacks per week, zero and two, respectively ; the mean hba1c, 9.5% 1.7%, the median frequency of blood glucose monitoring per day, one ; and the median score at the patients ' knowledge testing, 19. the mean score of sms quality, assessed by the parents, was 8.7 out 10. data are presented as median (interquartile range) or mean sd. abbreviations : sms, short message service ; fbs, fasting blood sugar ; and hba1c, glycosylated hemoglobin. growing evidence suggests that utilizing mobile phones might improve diabetes self - management and clinical outcomes (6 - 10). a meta - analysis examined the effectiveness of mobile phone technology in diabetes mellitus care by reviewing 15 english - language articles, published between january 2002 and march 2012. studies that used mobile phone intervention and reported changes in diet, physical activity, and blood glucose and/or hba1c levels were retrieved. overall, significant improvements were observed in blood glucose and/or hba1c concentration, adherence to medication, healthy lifestyle, and self - efficacy (11). our study is probably among the first ones to be conducted in the arab peninsula where diabetes prevalence is very high. in our study, the change in post prandial blood sugar was remarkable, which significantly decreased the level of hba1c. holtz. identified peer - reviewed articles published between 2000 and 2010 and analyzed 21 articles in a systematic literature review. overall, 71% of the studies had used a study - specific application, which had supplemental features in addition to text messaging. the outcomes varied considerably across studies, but some positive trends such as improved self - efficacy, hba1c, and self - management behaviors were noted (12). in our cohort, sms positively modified patients behavior. although the frequency of blood glucose monitoring was not increased significantly, the rate of glycemic control was improved. a feasibility study was conducted to evaluate the utility of sms in supporting 42 iraqi adults with newly diagnosed type 2 diabetes over 29 weeks. hba1c decreased from 9.3% (sd, 1.3%) to 8.6% (sd, 1.2) (p = 0.001). mean knowledge score rose from 8.6 (sd, 1.5) at baseline to 9.9 (sd, 1.4) six months after receipt of sms (p = 0.002). all patients were satisfied with the text messages and wished the service to be continued after the study (13). the effect of distance education via mobile phone text messaging on knowledge, attitude, practice, and self - efficacy was evaluated in patients with type 2 diabetes mellitus in iran. the results in the experimental group showed significant improvement in hba1c (p = 0.024), low density lipoprotein (p = 0.019), cholesterol (p = 0.002), and micro albumin (p 0.001). the knowledge (p 0.001), practice (p 0.001), and self - efficacy (p 0.001) were also improved (14). in a randomized study in india, the acceptability and feasibility of using sms via cell phones to ensure adherence to management prescriptions was tested. we did not test medications adherence in our study ; however, the patients admitted that their compliance with drug intake was better. a one - way video message about diabetes self - care was sent to 65 patients with type 2 diabetes for one year. participants were randomized to receive the usual care or the self - care video messages from their diabetes nurse practitioner. participants who received the messages had a larger rate of decline in hba1c than people who received usual care had (0.2% difference over 12 months) (16). we believe that multimedia message service might have a better audiovisual effect in comparison to regular sms ; however, it should be tested in further studies. mobile phone text educational and interactive messaging service might provide benefit in supporting diabetes self - management. the results of this study might help to design future text message interventional support programs for other chronic illnesses. | background : mobile phone text messaging has rapidly become a socially popular form of communication. several studies showed that mobile phone might offer a useful means of providing information between clinic visits and might increase adherence to diabetes therapy regimens.objectives:we conducted a study to evaluate the effect of mobile phone short message service (sms) on glycemic control in saudi patients with type 2 diabetes.patients and methods : one hundred patients (mean age, 41 9.5 years) were selected at the security forces hospital, riyadh, saudi arabia, and provided with daily educational, reminding sms messages for four months. glycosylated hemoglobin (hba1c) level, frequency of hypoglycemic and hyperglycemic attacks, and compliance with blood glucose monitoring were recorded before and after the trial.results:in addition to significant improvement in patients knowledge, mean fasting blood glucose level improved from 8.60 3.16 to 7.77 3.11 mmol / l and mean hba1c decreased from 9.9% 1.8% to 9.5% 1.7%.conclusions : mobile phone text messaging increased adherence to diabetes therapy and improved the clinical outcome in saudi patients with type 2 diabetes. |
a review of epidemiologic studies demonstrates a prevalence of co - morbid depression in a range of 6%80% of copd patients, with an average among the majority of the strongest studies of approximately 40%. this compares to a rate of 15% in the general population (light 1985 ; van ede 1999 ; yohannes 2000 ; aydin and ulusahin 2001 ; kunik 2005). in cardiac patients the range is 15%23% (carney 1997 ; ariyo 2000 ; ziegelstein 2001) and in cancer patients over a range of 13%38% (kathol 1990). in a cluster of studies that have compared depressive disorders across diverse chronic illnesses, copd patients suffer from depression with greater frequency and a greater chronicity of the mood symptoms (kurosawa 1983 ; katon and sullivan 1990 ; evans 1999 ; cruess 2003). evidence suggests, however, that the depression experienced by copd patients is not a homogenous entity. to manage this co - morbidity as effectively as possible it is important to first understand the potential contributors to an individual patient s depression. chronologically the earliest risk may be a genetic predisposition to depression, followed by the environmental assaults imposed by the respiratory illness itself and finally the direct neuropsychiatric effects of chronic respiratory disease. the goal of this review is to explore each of these elements to help inform clinical management of this patient population. in the psychiatric literature the heritability of a vulnerability to depression has been well established. first - degree relatives of individuals with major depression are 2 to 3 times as likely to develop depression when compared to the first - degree relatives of controls. the latter show a concordance rate of 50% in monozygotic twins, 10%25% in dizygotic (kaplan and sadock 1988 ; sullivan 2000 ; kendler 2006). the age at which this increased risk manifests varies widely from individual to individual, but is often already evident in adolescence (elely 2004). this vulnerability plays a role in the eventual development of copd in that adolescents and young adults who are depressed or have a history of depression are more likely to progress in their use of and dependence on nicotine (breslau 1993 ; ferguson 1996 ; patton 1996). the genetic underpinning of this vulnerability has recently gained increased support with the finding that the likelihood of an adolescent s smoking progressing from initial nicotine exposure to regular smoking was doubled by each additional copy of an identified allele (drd2a1) for a subtype of a dopamine receptor. the presence of depressive symptoms magnified the effect (audrain - mcgovern 2004). these data would suggest that smoking interventions that have been implemented in adults such as the administration of antidepressants might also be useful to help adolescents stop smoking, but there is currently very limited evidence for any effective interventions in this population. smoking, copd and depression are interrelated in a sort of trinity, with depression playing a role in the initiation and maintenance of smoking, smoking leading to the development of copd and copd, in turn, contributing to the genesis of depression. because of depression s role in the development of nicotine dependence, it might also be considered a risk factor for copd. in adults, continued smoking increases the morbidity and mortality experienced in copd. a history of either recent or distant depression has been associated with diminished success in smoking cessation, more persistent withdrawal symptoms and an increased likelihood of recurrence of the depression if nicotine is discontinued (covey 1997, 1998 ; covey 1999). the application of antidepressant therapy in smokers who endorsed some level of depressive symptoms did increase abstinence rates up to three months out from quit dates (hitsman 1999), a finding consistent with previous reports (hurt 1997 ; hall 1998 ; niaura 2001). there is suggestion that the benefits from the application of antidepressants is not exclusively due to the relief of depressive symptoms but potentially because the vulnerability to nicotine dependence and to depression share a common genetic source, possibly one that defines some characteristic of the dopamine pathways (lerman and berrettini 2003). the responses to the question of why depression arises so frequently in copd reflect an evolving understanding of the complex relationships between these two disease entities. early theory reaction to the losses imposed by the illness an understandable grieving (agle and baum 1977). since that time loss of functionality is a strong mediator of the development of depression in chronic illness, with an attributable risk measured at 34% (dunlop 2004). functional impacts may include decreased mobility, inability to carry out prior occupational activities, shifted roles within the family constellation and decreased ability to physically participate in previously enjoyed recreational activities. another common insult to self - image that copd patients struggle with is the use of supplemental oxygen. in fact, this insult often contributes to patients reluctance to utilize oxygen therapy (earnest 2002). the psychological losses attached to each of these insults are first the loss of the phenomenon itself and secondly of the emotional or material benefits derived from it. a second factor in a patient s ability to adjust to the burden of illness is the patency of internal coping mechanisms including self - efficacy and sense of mastery. the stronger patients sense of mastery or ability to impact the daily experience of their illness, the lower is their risk for depression (brown 1986, holahan and holahan 1987). in a cohort of 208 severe copd patients their level of perceived self - efficacy and functionality had a greater impact on variability in perceived quality of life than either objective or subjective pulmonary function (kohler 2002). a third influence on a patient s resilience in the face of the stress of dealing with a chronic illness is their perceived level of social support. overall the greater the level of perceived social support the less likely a patient will report symptoms of depression (mccathie 2002). in a study of 719 elderly individuals with a variety of chronic medical issues both strong social supports and effective personal coping strategies were associated with favorable effects in reducing levels of depression. in addition, for the 280 subjects in this study with lung disease (asthma, chronic bronchitis or emphysema), diffuse relationships, those that were defined as less intimate, community - based relationships, were helpful in buffering the negative effects of the illness (penninx 1998). associated with higher reports of depressive symptoms across all groups was patients receipt of instrumental support tangible assistance with disease management. the suggested interpretation is that receiving high levels of instrumental support reinforces feelings of dependence and helplessness, countermanding feelings of self - efficacy and mastery (penning and strain 1994). a single study focusing on determinants of depression in copd patients found that the risk of depression was significantly increased for subjects who lived alone, who had poor reversibility of fev1 on spirometry and those who suffered severe functional impairment (van manen 2002). these studies suggest that educating patients and caregivers in strategies that maximize independence, encouraging patients to develop and nurture their support systems and to participate in effective rehabilitation can help with both the physical and the psychosocial aspects of copd. certainly copd can impose staggering losses on copd patients and many of these same losses occur in other chronic illnesses, yet copd patients demonstrate higher rates of depression. the explanations for this disparity include the early vulnerability posited by genetics studies and the longitudinal physiologic effects of chronic respiratory disease. magnetic resonance imaging (mri) is a non - radiological imaging technique that offers detailed study of soft tissues. in the t2-weighted mri scans csf and other areas of acute anoxia or elevated fluid content, such as multiple studies have noted an increased prevalence of these hyperintensities in subcortical areas in the brains of elderly subjects, collectively called subcortical hyperintensities (sh). the concentration of these subcortical lesions increases with advancing age but they are not universally associated with clinical pathology, appearing in imaging studies of both clinically compromised and healthy elderly subjects (grafton 1991 ; guttmann 1998). when present, sh are typically seen in the deep white matter, periventricular areas, the basal ganglia, the thalamus and the pons. these areas are particularly vulnerable to vascular insult because they are in identified watershed or border zones of vascular supply. considering all sites, the odds - ratio of finding sh increases by approximately 5% per additional year of age (coffey 1992). while the lesions are seen in individuals without clinical disease, the prevalence and severity of sh do increase with cardiovascular risk factors as well as with a high burden of medical co - morbidity (awad 1986 ; brown 1992). the differential diagnosis for the lesions includes malignancies, infarcts and multiple sclerosis as well as less clinically apparent, although still pernicious, conditions typically associated with aging. these include arteriosclerosis and the diminution of autoregulation of blood pressure and subsequent aberrations in blood flow (campbell and coffey 2001). in the absence of identified cerebrovascular disease, other factors that have been associated with greater sh burden on mri include clinically silent stroke, elevated systolic blood pressure and lower forced expiratory volume in 1 second (fev1). when these factors are controlled for, smoking also emerges in positive association with sh (longstreth 1996). several studies have found that the concentration of sh is also elevated in elderly patients with depression, with an even higher prevalence among the subset of patients whose depression developed after their 5th decade (krishnan 1988, 1993 ; figiel 1991 ; coffey 1993 ; howard 1993 ; lesser 1996). in a meta - analysis a common odds ratio of 3.2 (95% ci 2.114.82) was found for the presence of sh in all patients with major depression (videbech 1997). while not consistent across studies, there is some evidence that when compared to individuals who developed depression prior to 40 years of age, a higher concentration of sh is seen in older depressed subjects (salloway 1996). the concept of vascular depression was developed as a putative explanation for elders increased vulnerability to depression. evidence supporting the concept includes literature showing that cerebrovascular disease often predates the onset of the depression ; the increased prevalence of depression in individuals who also suffer from hypertension or coronary artery disease ; and an increased finding of depressive symptoms in patients with vascular dementia when compared to those with non - vascular alzheimer s disease. accumulating mri evidence that shows a high concentration of sh in elderly, depressed patients, and the localization of those lesions in areas at increased risk for vascular compromise, contrasting studies in late onset depression have found a smaller association with sh but a stronger one with decreased total brain volume, preserving the concept of structural damage albeit with a different manifestation (rainer 2006). attempts have been made to identify a constellation of clinical factors that help with the identification of late - onset depression. late - onset depression has been found to be more refractory to treatment with antidepressants (coffey 1988 ; hickie 1995), associated with a greater degree of patient apathy (krishnan 1995) and less often associated with a family history of depression (fujikawa 1994 ; krishnan 1997). additionally, patients are less likely to achieve and sustain remission of their depressed symptoms (fujikawa 1994 ; taylor 2003). relevant to clinical management, the concentration of sh has been associated with more problematic side effects in response to somatic treatments including delirium and parkinsonism with medications and ect (figiel, coffey 1989 ; figiel, krishnan 1989 ; fujikawa 1996). there is strong evidence of an association between sh and late - onset depression, as well as between copd and an increased severity of sh (van dijk 2004). smoking has been shown to be cytotoxic to endothelial cells and, as is discussed further below, this intravascular damage is a likely contributor to the observed sh (blann and mccollum 1993). smoking has also been shown to increase the risk for permanent brain injury following exposure to what might, in the absence of a smoking history, have been a transient ischemic insult (wang 1997). the fundamental insult in ischemia is a failure to deliver sufficient oxygen to the site of involvement and that insufficiency can be caused by either hypoperfusion or hypoxemia. by the very nature of the disease process copd the consequences of chronic hypoxemia include both impaired cognitive function and depression, although the evidence supporting the latter is less robust (el - ad and lavie 2005 ; ozge 2006). in a comparison of cognitive function between healthy subjects, copd patients and patients with alzheimer s disease (ad) with mild hypoxemia the ad patients had the worst performance, with the copd patients showing significant impairment relative to the normals (kozora 1999). imaging studies demonstrate that worse hypoxemia in copd is associated with decreased perfusion of anterior cortical and subcortical areas and decreased performance on cognitive testing relative to normals (antonelli 2003). most studies of hypoxemia and depression arise from the sleep apnea literature where one of the primary identified sequelae of recurrent nocturnal hypoxemia is depressed mood (aloia 2004). it should be noted that depression itself has been identified as a risk factor for cerebrovascular insult, and so may contribute to the formation of lesions manifesting as sh. the severity of depressive symptoms is predictive of stroke after controlling for a host of variables including measured blood pressure (simonsick 1995), smoking, body mass index, hypertension or diabetes (everson 1998). a large, longitudinal study of 6095 stroke - free individuals followed for an average of 16 years found that after adjusting for multiple previously identified risks for stroke (age, gender, ethnicity, systolic blood pressure, alcohol use, serum cholesterol level, diabetes and heart disease) being in the top third of measured depression levels increased the risk of stroke over the duration of the study period by 50%106% when compared to subjects in the lowest third. the relative risk for stroke due to depression was roughly equivalent to a 40-point increase in systolic blood pressure (jonas and mussolino 2000). finally, there is growing evidence that depression and copd impose similar microvascular and biochemical insults that would be expected to contribute to the accumulation of sh. both depression and chronic respiratory disease have been associated with processes that jeopardize the microvasculature of the brain. in depression levels of 8-hydroxy-2-deoxyguanosine were directly correlated with the severity of the depression and with the level of the resultant oxidative damage was correlated with the chronicity of the depression (forlenza and miller 2006). oxidative stress has also been associated with biochemical alterations in the cell membrane and function of erythrocytes in patients with mental illness. these cell membrane aberrations are thought to interfere with effective transduction of neurotransmitter signaling (ponizovsky 2003). in a treatment study after treatment with antidepressants depression measures improved and oxidative stress was reduced (khanzode 2003). in both copd and depression there is evidence for increased platelet activation that may potentially lead to thrombotic insult to the microvasculature, the type of injury to which the narrow perforating arteries of the brain are particularly vulnerable. in copd the synthesis of a marker of platelet activation was significantly elevated and inversely related to arterial oxygen tension (davi 1997). in a comparison of depressed patients and controls, the patients demonstrated increased platelet activation at baseline as well as increased platelet reactivity (musselman 1996). in a small study of depressed patients treatment with the antidepressant sertraline diminished a pre - treatment elevation in platelet activation (markovitz 2000). copd is a chronic, progressive disease and as such exerts an escalating burden over time. as the size of the elderly population grows, the number of people suffering with this debilitating disease is certain to increase. in spite of the high prevalence of copd, treatment continues to be primarily symptomatic and rates of functional impairment and mortality have not significantly decreased in the past several decades. while our understanding of the disease continues to progress, our ability to halt, or better still reverse, the progression of the disease has not. improved management of morbidity must then become a parallel goal and one of the areas with the greatest potential for improvement is the management of patients co - morbid depression. depression in copd is a heterogeneous entity with a potentially composite etiology including genetic predisposition, environmental losses and stressors, as well as direct damage to the brain mediated by the physiologic effects of chronic respiratory illness. as such, the relationships between depression, copd and smoking are not linear but, rather, interconnected with each element influencing the others to different degrees in any given patient at any given time. over the course of their lifetimes copd patients may have experienced multiple exposures that increase their risk for the development of depression. the advantage to recognizing the inter - dependent relationship of these contributing factors is the corollary recognition that effective intervention in any one of them will have a cascading, positive impact on the others. effectively targeting depression, or lost functionality or chronic hypoxemia will decrease morbidity in that dimension, and potentially in the others as well. there is much research that remains to be done to delineate what the most effective interventions are, but they are progressing. as noted above, identification of direct genetic influences opens the door for early intervention in juvenile vulnerability to nicotine addiction. research into improved rehabilitation efforts, and a clarification of the best use and format of oxygen supplementation is ongoing with an eye to both decreased physiologic morbidity and increased functionality. at the same time patients are learning self - advocacy and developing support groups to share information and lastly, we continue to search for the best ways to manage depression in patients with copd. the likely answer will be a combination of psychopharmacology and psychotherapy, but in view of the often refractory nature of the depression there is also a role for electroconvulsive therapy in this population. this developing armamentarium can then be customized to the unique constellation of contributing factors active for a given patient at a given time. | there is significant evidence supporting an increased prevalence of depression in patients with copd, but that depression is not a homogenous entity because there are multiple contributing etiologies for the depressive symptoms. additionally the relationship between copd and depression is neither exclusively linear, nor unidirectional. early onset depression is defined as depression that develops prior to the diagnosis of copd, often during an individual s youth. this is often reflective of a genetic vulnerability to depression which increases adolescents risk for developing addiction to nicotine, setting up a life - long exposure to tobacco the single greatest risk factor for the development of copd. when copd does develop it brings with it attendant losses, particularly in level of independent function and self image that contribute to a reactive depression that is not distinct from the losses experienced by those suffering with other chronic illnesses. lastly there is increasing evidence through magnetic resonance imaging (mri) and biochemical markers that systemic, physiologic changes associated with copd have direct effects on the brain s vasculature that have also been associated with depression in the elderly, termed late onset depression. the conclusion is that the presence of depression in a copd patient does not reflect a single pathologic pathway. rather the two disorders each contribute to the morbidity of the other. this review discusses the evidence supporting each of these contributors and suggests that an understanding of these varying elements can direct healthcare interventions. |
water can be found everywhere in nature in each three states (solid, liquid, and gaseous). base of liquid dosage forms is almost exclusively water, but it can be found in half - solid dosage forms, such as hydrophilic ointments, as well. in the case of solid dosage forms usually it is essential to keep the water content low, because it could harmfully affect the physico - chemical, chemical, and microbiological stability of product. however, manufacturing processes often involve the use of water (e.g., wet granulation, spray - drying, coating processes, etc.), but most of them have to be removed in later steps of manufacturing. most common dosage form is the tablet, where largest part of the total weight is frequently composed of different excipients. therefore, it is of impact to analyse the interaction of water molecules with excipients and the possible outcomes of these interactions. the main categories are the crystalline, the amorphous and their mixture, the semi - crystalline or partially amorphous state. the amorphous state has gained considerable attention in pharmaceutical industry because in this state the material is thermodynamically unstable, and characterised by its unique physico - chemical features reviewed by several articles.[14 ] unlike to crystalline solids, an amorphous solid may have only a short - range molecular order, and it has no long - range order of molecular packing like in the crystalline state. since the molecules or clusters of molecules are randomly arranged, they occupy the volume in larger extent than that of the crystalline state having the same chemical composition. the excess volume (the so - called free volume) that is available for rotational and translational motions can be considered as microvoids inside the polymer domain. one of the most important parameter of an amorphous material is its glass transition temperature (tg). under the glass transition temperature an amorphous solid is in the glassy state where rotational or translational motions of the molecules are restricted and only vibration is possible. by heating the solid over its tg value large scale molecular movements the amorphous state commonly occurs with high molecular weight pharmaceutical excipients and large peptides and proteins, but it can be found in the case of small organic or inorganic molecules, as well. however, in the latter case crystallization can easily take place due to the heating of the system or water vapour absorption. amorphous solids are in not - equilibrium state therefore some pharmaceutical excipients have the property to exist persistently in amorphous form, while others require careful usage to prevent crystalline transition. in the light of excipient - water interactions amorphous or in fact, hodge. investigated the semi crystalline poly (vinyl alcohol) samples and showed that water first encountered with the amorphous region of the material and the crystalline region was only affected by the amorphous / crystalline interface if excess water was available. in contrast to the hydrophilic polymers, hydrophobic polymers sorb only low amount of moisture from the environment therefore serious changes can not be expected. the importance of amorphous state in the case of water vapour sorption can be pointed out by the example of various sugar - based materials that are widely used in the pharmaceutical industry. crystalline sugars can interact with water vapour by adsorption and deliquescence mechanisms, because the predominant interaction in this case is the surface adsorption by weak interaction forces. if the relative humidity reaches a critical value one can experience the phenomenon of deliquescence when sugar molecules start to dissolve at the surface. on the other hand amorphous sugars have a tendency to absorb large amount of water molecules. this is due to the fact that water molecules are absorbed into the bulk structure of amorphous materials, rather than being restricted on the surface of individual particles. this water absorption is the cause of the marked changes in the physicochemical properties of amorphous sugars, since in this case every sugar molecule is affected by interaction with water molecules. a number of excipients used in the pharmaceutical industry are amorphous or partially amorphous hydrophilic polymers. these materials owing to its polar functional groups are able to sorb (adsorb and absorb) large amount of water that can affect their functionalities. the interaction of water with amorphous solids lowers the glass transition temperature due to its universal plasticizing activity. the underlying molecular mechanisms may involve the binding of water molecules to the polar groups of the materials, that weaken the attracting forces between the polymer chains consequently it can increase the free volume [figure 1 ]. water molecules penetrate into the hydrophilic polymer matrix, the distance between the polymer chains will increase and thus more free volume will be available for molecular movements. in some cases, at higher water contents, the glass transition temperature of an excipient can decrease to room temperature and the material undergoes glassy - to - rubbery transition causing significant changes in their properties, such as increased reactivity and reduced chemical stability. possible effect of water sorption on the free volume of polymer materials dlubeck. investigated plasticized polyamide 6 samples as a function of water content and temperature by positron annihilation lifetime spectroscopy (pals). pals is a unique method, which is able to measure free volume of polymers and other materials assuming spherical microholes (free volumes) in materials. it was found that the free volume of polyamide 6 decreased at low water contents compared to the initial (dry) free volume value and it was followed by an increase in the free volume at high water contents. this behaviour explained by the filling of the holes with water molecules at low water contents (initial stage of water sorption). at higher moisture contents water molecules weakened the hydrogen bonds between polymer chains and it led to the plasticization of the material and the increased the free volume. there are several methods that could characterize water - excipient interactions, such as inverse gas chromatography, nmr spectroscopy, dielectric relaxation spectroscopy, near infrared spectroscopy, etc. a conventional method is the determination of the amount of sorbed water of materials as a function of environmental water activity (in practice, relative pressure, or relative humidity). water sorption isotherms can be constructed by plotting the mass of sorbed water per unit mass of dry solid versus the relative pressure of water vapour (p / p0) or the relative humidity (100(p / p0)), where p0 is the vapour pressure of liquid water. cellulose- and starch - based excipients are the most widely investigated materials by means of water sorption isotherms in the pharmaceutical field. the sorption - desorption curves of these excipients always show hysteresis, i.e., smaller amount of moisture leaves the material at a given relative humidity during desorption than it could be expected based on its sorption isotherm. the explanation of this phenomenon can be associated with the conformational change of the polymeric chains during water sorption, since water, penetrating into the structure of polymers, could alter the systems of inter- and intramolecular bonds. the shape of water sorption isotherms in the case of cellulose- and starch - based excipients was sigmoid, indicating the suitability of the use of equations developed for describing the physical adsorption of gases. although the mechanisms of the water vapour absorption of amorphous materials greatly differ from the physical adsorption of gases on solid surfaces, due to the similarity of the shape of sorption isotherms, the well - known brunauer teller (bet) equation was successfully applied for the evaluation of the nature of the water vapour absorption. the brunauer - emmett - teller (bet) equation : where w is the weight of sorbed water per unit mass of dry solid at a relative pressure of p / p0 ; p is the actual vapour pressure ; p0 is the vapour pressure of liquid water ; wm is the water content corresponding to one water molecule per sorption site ; cb is a constant related to thermodynamical data of the system. the bet model assumes water sorption in two distinct thermodynamical states, where water molecules exist in a strongly bound state and as multilayer water similar to bulk water. water sorption data of cellulose- and starch - based materials follow the bet equation only up to 0.3 - 0.4 relative pressure. however this relative pressure range is sufficient to obtain the constants, wm and cb, and to gain some information about water vapour sorption. zhang and zografi investigated the water sorption isotherms of poly (vinyl pyrrolidone) (pvp) excipients of different molecular weights and they found that despite the significant differences between the values of calculated constant, cb, the shape of the isotherms and the bet - parameter wm were very similar. the obtained results indicated that wm referred to the available hydration sites, whereas cb gave information about the overall free energy of absorption that could be varied with molecular weight of excipients. in the case of dried proteins it was observed, that its stability decreased if its water content exceed the monolayer value, because high water content allowed enhanced flexibility of macromolecules and increased the molecular mobility. on the other hand, if the water content of proteins was low enough it could also cause instability problems. therefore, it seems to be favourable to keep water content of proteins at an intermediate level (near the monolayer value) to obtain satisfactory stability data. the gab equation, developed by guggenheim, anderson and de boer, could also provide the monolayer water sorption values (wm) and usually cover the water sorption data over the entire range of relative humidity, but minimum up to 80% rh. the gab model assumes three state of water ; i.e. free, tightly bound and intermediate water. where w and wm are the same as in the bet equation, cg and k are constants. the disadvantage of this equation is that the conformity of all constant to physical meanings is hardly possible. rokar and kmetec investigated the water sorption of several excipients (e.g. microcrystalline cellulose, crospovidone, copolividonum, magnesium stearate) using the bet and the gab equations. they found that the experimental water sorption data were in good agreement with the bet model up to 55% rh and with the gab model over the entire humidity range. the calculated wm values of water sorption of the excipients were similar in the case of both models, and the high values of these constants indicated that more than one layer of water molecules sorbed on some excipients. particularly, in the case of crospovidone and copolividonum, where the wm values were high and these excipients were also very hygroscopic. in the case of polymeric materials the states of absorbed water are often characterized by differential scanning calorimetry (dsc). with dsc method three states of water based on dsc measurements are the followings : (1) free water (fw), which undergoes similar phase transition near 0c during heating (or freezing) as liquid water ; (2) freezable bound water (fbw), which, due to the interaction with the polymer chains and/or capillary effects in the microholes of the polymer, undergoes phase transition at different temperature like liquid water ; and (3) non - freezing (strongly) bound water (nbw), which does not undergo phase transition during the dsc experiments. the nbw is in direct contact with polar groups of polymers therefore it is unable to form ice crystals during freezing. the nbw is undetectable by the dsc method however its amount can be calculated if the total water content and the amount of fbw and fw are known. hodge. investigating poly (vinyl alcohol) samples of different water contents found three states of water by dsc experiments. up to 22% water content there was no detectable phase transition due to water molecules. over 22% water content a sharp peak showed up with increasing intensity up to 28% water. at higher water contents the sharpness of the peak was due to the interaction of water molecules with polymer chains and to capillary effects. the broad peak at higher water contents was due to the phase transition of free water. subtracting the amount of fbw and fw from the total water content of a sample the amount of non - freezing water three states of water have also been observed by several researchers using differential scanning calorimetry investigating various polymers.[142426 ] guan. investigated various polymers containing water using dsc and infrared spectroscopy. they found two endothermic dsc peaks in the case of each polymer associated with the freezing of freezable bound water (at lower temperatures) and freezing of free water (around 0c). the peaks at low temperatures were hardly observable in the case of some polymers therefore an isothermal treatment was carried out on these samples. at the isothermal treatment samples were kept a little above the transition temperature of its freezable bound water for a predetermined interval. during the time of the isothermal treatment more freezable bound water (fbw) was able to interact with the surrounding water molecules forming ice crystals than without the treatment since the structure and the amount of freezable bound water is not permanent and depends on the thermal history. in the case of one investigated polymer the researchers observed that the freezing temperature of fbw shifted to higher values after the isothermal treatment indicating that the small peak was due to the transition of the fbw. the fourier transform infrared (ftir) spectroscopy is a useful method to investigate the states of water in polymers. compared to the dsc and water sorption experiments it could offer substantially more information, since it provides an insight into the chemical structure of the investigated materials and after assignment of the infrared absorption bands to functional groups of polymers it is possible to determine the groups that are mainly affected by water molecules.. investigated hydrophilic polymers of different water contents by dsc and ftir methods. according to the dsc curves they found that the maximal amount of non - freezing bound water (nbw) of the polymers was dependent on its polar functional groups. for example, in the case of poly (vinyl pyrrolidone) four water molecules existed as nbw per c = o groups indicating that one c = o group can strongly interact with water molecules in two layers because one c = o group have only two acceptor sites for hydrogen - bonding. for investigating water molecules of polymers the 3800 - 2900 cm infrared region is the most suitable, because water molecules have strong absorption in this region due to its stretching vibrations. however the polymer molecules often also have infrared (ir) absorption in this region, therefore difference spectra could be more informative for water molecules as the original ones. to construct the difference spectra the normalized spectrum of dry sample has to be subtracted from the normalized spectra of the wetted samples. the shape of the difference spectra in the 3800 - 2900 cm region will be characteristic of the water molecules in the polymer. investigated poly (vinyl alcohol) (pva) samples of different water contents by ftir spectroscopy and evaluated the difference spectra. they found that the 3800 - 2900 cm region markedly differed from the spectrum of liquid water, because system of hydrogen - bonds of water molecules changed due to their interaction with the polymer. the band intensities in this region increased with increasing water content of the samples. in this region two distinct, overlapping bands were seen at nearly fixed wavenumber values but with different intensities according to the actual water contents of the samples. the peak at lower wavenumber, 3280 cm, was more intense up to 20% water content but at higher water contents the peak at 3400 cm was more pronounced. based on this observation, water molecules of the polymer could be classified into two main categories ; strongly hydrogen - bonded and water molecules of bulk (free) water. the strongly hydrogen - bonded water molecules appeared in the lower wavenumber region, because the interactions with polar groups of the polymer caused shift in the infrared absorption of water molecules to the lower wavenumbers. the changes in the relative intensities of the two distinct peaks of water molecules indicated that the ratio of strongly hydrogen - bonded water molecules moved to free water as the water content increased due to the saturation of strong binding sites of pva. the broad band of stretching vibrations of water in the difference spectra can be further evaluated by deconvoluting (other words decomposing) this region into components using curve fitting algorithms. after deconvolution the components could be assigned to water molecules of different strength of hydrogen - bonds, because in the reality water molecules exist in many different states [figure 2 ]. lasagabaster. investigated stretching vibrations of water molecules absorbed by polypropylene (pp)/ethylene - alcohol vinyl (evoh) films based on difference spectra. they deconvoluted the water stretching region into four components assume gaussian - shape of the individual components. according to the wavenumber values of the components they classified water molecules into categories : non hydrogen - bonded, weakly hydrogen - bonded, medium hydrogen bonded and strongly hydrogen - bonded. according to other experiments, there exist some water molecules even in the liquid water, which are not hydrogen - bonded based on ir spectral data. the medium hydrogen - bonded water molecules were attributed to the second hydration layer in the case of pp / evoh films and the strongly hydrogen bonded molecules (deconvoluted component at the lowest wavenumber) to water molecules attached directly by polymer chains. consequently, the band deconvolution could provide abundant information about water molecules hydrogen - bonded of different strengths, however the interpretation of data is more difficult compared to the dsc results due to the complex nature of an infrared spectrum, which is not detailed here. possible association of water with the polymer molecules ; (a) water molecules strongly attached to the polar groups of the polymer chains by hydrogen - bonds in two layers ; (b) microscopic voids inside the polymer filled with excess water ; (c) individual water molecules attached to the non - polar region of the polymer by weak interaction forces other authors investigated water absorption of epoxy matrices and they also deconvoluted the stretching vibrations of water into four components to obtain the individual spectra of water molecules of different hydrogen - bonds. they found that plotting the intensity of the components versus relative humidity the ratio of weakly hydrogen - bonded molecules increased with increasing water contents. this result were in accordance with the expectation that with increasing water content the ratio of weakly hydrogen bonded water molecules increase compared to the strongly hydrogen - bonded ones due to the saturation of the polar groups of the epoxy samples. they recorded ir spectra of samples kept at 80% rh for each 10% rh for 60 minutes to water absorption. two distinct peaks, at 3600 and 3200 cm were observed on the difference spectra of the samples of different water contents. surprisingly, the same relative peak heights were found in the case of each sample suggesting that weakly hydrogen - bonded and strongly hydrogen - bonded water molecules were present in similar amount even at low water contents. this result is contradictory to the model based on dsc results, where, in the case of hydrophilic polymers, the presence of strongly bounded water molecules is supposed at low water contents and freezable bound water appears only with increasing water contents which is followed by the free water. in the ft - ir experiments the evolving of the two peaks with same relative heights indicated water absorption by clusters, where water clusters adhere simultaneously to all binding sites of the polymer even at low water contents [figure 3 ]. similar discrepancies were found by other authors, too. there is a lack of a proper physical model that is able to explain all findings observed by water sorption method, dsc and ftir spectroscopy. possible mechanisms of water vapour absorption into hydrophilic amorphous polymers at the initial stage of water absorption ; (a) water attached by clusters of molecules to polymer chains simultaneously absorbing to binding sites of different strengths ; (b) water molecules first bounded to the strongest binding sites of the polymer chains there are several methods that could characterize water - excipient interactions, such as inverse gas chromatography, nmr spectroscopy, dielectric relaxation spectroscopy, near infrared spectroscopy, etc. a conventional method is the determination of the amount of sorbed water of materials as a function of environmental water activity (in practice, relative pressure, or relative humidity). water sorption isotherms can be constructed by plotting the mass of sorbed water per unit mass of dry solid versus the relative pressure of water vapour (p / p0) or the relative humidity (100(p / p0)), where p0 is the vapour pressure of liquid water. cellulose- and starch - based excipients are the most widely investigated materials by means of water sorption isotherms in the pharmaceutical field. the sorption - desorption curves of these excipients always show hysteresis, i.e., smaller amount of moisture leaves the material at a given relative humidity during desorption than it could be expected based on its sorption isotherm. the explanation of this phenomenon can be associated with the conformational change of the polymeric chains during water sorption, since water, penetrating into the structure of polymers, could alter the systems of inter- and intramolecular bonds. the shape of water sorption isotherms in the case of cellulose- and starch - based excipients was sigmoid, indicating the suitability of the use of equations developed for describing the physical adsorption of gases. although the mechanisms of the water vapour absorption of amorphous materials greatly differ from the physical adsorption of gases on solid surfaces, due to the similarity of the shape of sorption isotherms, the well - known brunauer teller (bet) equation was successfully applied for the evaluation of the nature of the water vapour absorption. the brunauer - emmett - teller (bet) equation : where w is the weight of sorbed water per unit mass of dry solid at a relative pressure of p / p0 ; p is the actual vapour pressure ; p0 is the vapour pressure of liquid water ; wm is the water content corresponding to one water molecule per sorption site ; cb is a constant related to thermodynamical data of the system. the bet model assumes water sorption in two distinct thermodynamical states, where water molecules exist in a strongly bound state and as multilayer water similar to bulk water. water sorption data of cellulose- and starch - based materials follow the bet equation only up to 0.3 - 0.4 relative pressure. however this relative pressure range is sufficient to obtain the constants, wm and cb, and to gain some information about water vapour sorption. zhang and zografi investigated the water sorption isotherms of poly (vinyl pyrrolidone) (pvp) excipients of different molecular weights and they found that despite the significant differences between the values of calculated constant, cb, the shape of the isotherms and the bet - parameter wm were very similar. the obtained results indicated that wm referred to the available hydration sites, whereas cb gave information about the overall free energy of absorption that could be varied with molecular weight of excipients. in the case of dried proteins it was observed, that its stability decreased if its water content exceed the monolayer value, because high water content allowed enhanced flexibility of macromolecules and increased the molecular mobility. on the other hand, if the water content of proteins was low enough it could also cause instability problems. therefore, it seems to be favourable to keep water content of proteins at an intermediate level (near the monolayer value) to obtain satisfactory stability data. the gab equation, developed by guggenheim, anderson and de boer, could also provide the monolayer water sorption values (wm) and usually cover the water sorption data over the entire range of relative humidity, but minimum up to 80% rh. the gab model assumes three state of water ; i.e. free, tightly bound and intermediate water. where w and wm are the same as in the bet equation, cg and k are constants. the disadvantage of this equation is that the conformity of all constant to physical meanings is hardly possible. rokar and kmetec investigated the water sorption of several excipients (e.g. microcrystalline cellulose, crospovidone, copolividonum, magnesium stearate) using the bet and the gab equations. they found that the experimental water sorption data were in good agreement with the bet model up to 55% rh and with the gab model over the entire humidity range. the calculated wm values of water sorption of the excipients were similar in the case of both models, and the high values of these constants indicated that more than one layer of water molecules sorbed on some excipients. particularly, in the case of crospovidone and copolividonum, where the wm values were high and these excipients were also very hygroscopic. in the case of polymeric materials the states of absorbed water are often characterized by differential scanning calorimetry (dsc). with dsc method three states of water states of water based on dsc measurements are the followings : (1) free water (fw), which undergoes similar phase transition near 0c during heating (or freezing) as liquid water ; (2) freezable bound water (fbw), which, due to the interaction with the polymer chains and/or capillary effects in the microholes of the polymer, undergoes phase transition at different temperature like liquid water ; and (3) non - freezing (strongly) bound water (nbw), which does not undergo phase transition during the dsc experiments. the nbw is in direct contact with polar groups of polymers therefore it is unable to form ice crystals during freezing. the nbw is undetectable by the dsc method however its amount can be calculated if the total water content and the amount of fbw and fw are known. hodge. investigating poly (vinyl alcohol) samples of different water contents found three states of water by dsc experiments. up to 22% water content there was no detectable phase transition due to water molecules. over 22% water content a sharp peak showed up with increasing intensity up to 28% water. at higher water contents the sharpness of the peak was due to the interaction of water molecules with polymer chains and to capillary effects. in this state water molecules the broad peak at higher water contents was due to the phase transition of free water. subtracting the amount of fbw and fw from the total water content of a sample the amount of non - freezing water three states of water have also been observed by several researchers using differential scanning calorimetry investigating various polymers.[142426 ] guan. investigated various polymers containing water using dsc and infrared spectroscopy. they found two endothermic dsc peaks in the case of each polymer associated with the freezing of freezable bound water (at lower temperatures) and freezing of free water (around 0c). the peaks at low temperatures were hardly observable in the case of some polymers therefore an isothermal treatment was carried out on these samples. at the isothermal treatment samples were kept a little above the transition temperature of its freezable bound water for a predetermined interval. during the time of the isothermal treatment more freezable bound water (fbw) was able to interact with the surrounding water molecules forming ice crystals than without the treatment since the structure and the amount of freezable bound water is not permanent and depends on the thermal history. in the case of one investigated polymer the researchers observed that the freezing temperature of fbw shifted to higher values after the isothermal treatment indicating that the small peak was due to the transition of the fbw. the fourier transform infrared (ftir) spectroscopy is a useful method to investigate the states of water in polymers. compared to the dsc and water sorption experiments it could offer substantially more information, since it provides an insight into the chemical structure of the investigated materials and after assignment of the infrared absorption bands to functional groups of polymers it is possible to determine the groups that are mainly affected by water molecules. investigated hydrophilic polymers of different water contents by dsc and ftir methods. according to the dsc curves they found that the maximal amount of non - freezing bound water (nbw) of the polymers was dependent on its polar functional groups. for example, in the case of poly (vinyl pyrrolidone) four water molecules existed as nbw per c = o groups indicating that one c = o group can strongly interact with water molecules in two layers because one c = o group have only two acceptor sites for hydrogen - bonding. for investigating water molecules of polymers the 3800 - 2900 cm infrared region is the most suitable, because water molecules have strong absorption in this region due to its stretching vibrations. however the polymer molecules often also have infrared (ir) absorption in this region, therefore difference spectra could be more informative for water molecules as the original ones. to construct the difference spectra the normalized spectrum of dry sample has to be subtracted from the normalized spectra of the wetted samples. the shape of the difference spectra in the 3800 - 2900 cm region will be characteristic of the water molecules in the polymer. ping. investigated poly (vinyl alcohol) (pva) samples of different water contents by ftir spectroscopy and evaluated the difference spectra. they found that the 3800 - 2900 cm region markedly differed from the spectrum of liquid water, because system of hydrogen - bonds of water molecules changed due to their interaction with the polymer. the band intensities in this region increased with increasing water content of the samples. in this region two distinct, overlapping bands were seen at nearly fixed wavenumber values but with different intensities according to the actual water contents of the samples. the peak at lower wavenumber, 3280 cm, was more intense up to 20% water content but at higher water contents the peak at 3400 cm was more pronounced. based on this observation, water molecules of the polymer could be classified into two main categories ; strongly hydrogen - bonded and water molecules of bulk (free) water. the strongly hydrogen - bonded water molecules appeared in the lower wavenumber region, because the interactions with polar groups of the polymer caused shift in the infrared absorption of water molecules to the lower wavenumbers. the changes in the relative intensities of the two distinct peaks of water molecules indicated that the ratio of strongly hydrogen - bonded water molecules moved to free water as the water content increased due to the saturation of strong binding sites of pva. the broad band of stretching vibrations of water in the difference spectra can be further evaluated by deconvoluting (other words decomposing) this region into components using curve fitting algorithms. after deconvolution the components could be assigned to water molecules of different strength of hydrogen - bonds, because in the reality water molecules exist in many different states [figure 2 ]. investigated stretching vibrations of water molecules absorbed by polypropylene (pp)/ethylene - alcohol vinyl (evoh) films based on difference spectra. they deconvoluted the water stretching region into four components assume gaussian - shape of the individual components. according to the wavenumber values of the components they classified water molecules into categories : non hydrogen - bonded, weakly hydrogen - bonded, medium hydrogen bonded and strongly hydrogen - bonded. according to other experiments, there exist some water molecules even in the liquid water, which are not hydrogen - bonded based on ir spectral data. the medium hydrogen - bonded water molecules were attributed to the second hydration layer in the case of pp / evoh films and the strongly hydrogen bonded molecules (deconvoluted component at the lowest wavenumber) to water molecules attached directly by polymer chains. consequently, the band deconvolution could provide abundant information about water molecules hydrogen - bonded of different strengths, however the interpretation of data is more difficult compared to the dsc results due to the complex nature of an infrared spectrum, which is not detailed here. possible association of water with the polymer molecules ; (a) water molecules strongly attached to the polar groups of the polymer chains by hydrogen - bonds in two layers ; (b) microscopic voids inside the polymer filled with excess water ; (c) individual water molecules attached to the non - polar region of the polymer by weak interaction forces other authors investigated water absorption of epoxy matrices and they also deconvoluted the stretching vibrations of water into four components to obtain the individual spectra of water molecules of different hydrogen - bonds. they found that plotting the intensity of the components versus relative humidity the ratio of weakly hydrogen - bonded molecules increased with increasing water contents. this result were in accordance with the expectation that with increasing water content the ratio of weakly hydrogen bonded water molecules increase compared to the strongly hydrogen - bonded ones due to the saturation of the polar groups of the epoxy samples. they recorded ir spectra of samples kept at 80% rh for each 10% rh for 60 minutes to water absorption. two distinct peaks, at 3600 and 3200 cm were observed on the difference spectra of the samples of different water contents. surprisingly, the same relative peak heights were found in the case of each sample suggesting that weakly hydrogen - bonded and strongly hydrogen - bonded water molecules were present in similar amount even at low water contents. this result is contradictory to the model based on dsc results, where, in the case of hydrophilic polymers, the presence of strongly bounded water molecules is supposed at low water contents and freezable bound water appears only with increasing water contents which is followed by the free water. in the ft - ir experiments the evolving of the two peaks with same relative heights indicated water absorption by clusters, where water clusters adhere simultaneously to all binding sites of the polymer even at low water contents [figure 3 ]. similar discrepancies were found by other authors, too. there is a lack of a proper physical model that is able to explain all findings observed by water sorption method, dsc and ftir spectroscopy. possible mechanisms of water vapour absorption into hydrophilic amorphous polymers at the initial stage of water absorption ; (a) water attached by clusters of molecules to polymer chains simultaneously absorbing to binding sites of different strengths ; (b) water molecules first bounded to the strongest binding sites of the polymer chains it is well - known that moisture sorption of solid dosage forms can affect its chemical, physico - chemical and microbial stability. one of the most important issues is the chemical stability of the active pharmaceutical ingredient (api) of the final dosage form. the amorphous state is of impact in this field, because an amorphous solid is able to absorb large amount of water to its bulk structure, and usually the degradation rate of an api is dependent on the water content. in addition to this, several researchers showed that the reactivity of an amorphous substance is greater than its crystalline equivalent under identical conditions. shalaev and zografi detailed four possible mechanisms that can be responsible for the degradation activity of water : (1) water could be a direct participant in several degradation reactions of drugs (e.g., hydrolytic reactions), therefore its concentration could largely affect the stability of the final product ; (2) it could be a product of specific reactions, in this case its increasing amount could inhibit the progress of these reactions ; (3) the water dissolved in the amorphous matrix could be also the medium of reactions by changing the polarity and the reactivity of the surrounding molecules ; (4) finally, water acts as a plasticizer which could significantly reduce the glass transition temperature, and increase the molecular mobility and the free volume of the system. on the other hand, effects of water are not independent therefore it is difficult to distinguish its role as reactant, medium of reactions, and plasticizer in degradation processes. lai. investigated the effect of sorbed water and glass transition temperature on deamidation of an asparagine - containing hexapeptide lyophilized with pvp. glycerol was added to the mixture in different extents to modifiy the glass transition temperature of the system containing a given amount of water. therefore, it was possible to make samples of similar water contents but different glass transition temperatures (tg) and samples of similar tg values but different water contents. the stability testing was performed at 50c and due to the different plasticization of the lyophilised mixtures there were samples in the glassy and also in the rubbery state during the stability testing. decreased stability was observed with increased glycerol but similar water content indicating that reduced tg adversely affected the chemical stability of the peptide even if the water content was not significantly different. it was also showed that the deamidation of the investigated peptide samples was differently affected by water in the glassy and in the rubbery state. along with increasing water content, in the glassy state of similar tg values the degradation rate constants of samples also increased, while in the case of samples in the rubbery state only the tg determined the rate constant. consequently, water induced degradation mechanisms in pharmaceuticals could be explained by the role of water as direct participant in chemical reactions but also by its plasticizing effect that can change the properties of the entire complex delivery system (e.g., molecular mobility, free volume, polymer chain conformation, etc.). the molecular mobility often plays an important role in the degradation rate. along with the glassy - to - rubbery transition of an amorphous material the molecular mobility of the system change therefore the tg value of the material could play an important role from the point of chemical stability. in fact, both degradation of various small molecules and aggregation of proteins showed change in the slope of the temperature dependence of the degradation rate around tg, indicating a non - arrhenius like behaviour in this temperature range. besides the chemical stability, residual water could affect a range of parameters that are important in view of quality, safety, and efficacy of pharmaceuticals. optimum water content could enhance both the plastic deformation of the particles and the compressibility. examined the influence of the properties of cellulose powders on the moisture - induced degradation of acetylsalicylic acid (asa). different grades of cellulose powders were used of various crystallinity, specific surface area, and moisture absorption. the crystallinity and water content of the excipients had a great influence on the degradation rate, the cellulose powder of the lowest crystallinity (and consequently of highest moisture absorption and content) provided the highest stability of the drug. on the other hand, highest instability was observed in the case of cellulose sample of highest crystallinity and specific surface area but of low hygroscopicity, despite the hydrolytic mechanism of asa degradation. the authors concluded that, the location and availability of sorbed moisture was more important than the overall water content of the system. water content of amorphous or partially amorphous hydrophilic polymers has a great importance during tableting processes, because the properties of these pharmaceutical excipients could markedly change due to the plasticizing effect of water. minimum water content is essential for direct compaction of starch - based materials, because water could provide good compressibility and plastic deformation of particles. investigated the behaviour of amylodextrin in the 0.07 < xw < 0.4 moisture fraction (xw) range. the tg of amylodextrin - water blends was equal to room temperature at 0.19 moisture fraction determined by dsc. plasticizing effects of water on amylodextrin compacts was evaluated by compressive stress - strain experiments. the elastic modulus of the system steeply decreased between xw= 0.17 and 0.23 that was in accordance with the glassy - to - rubbery transition of the material of 0.19 xw at room temperature. the compressibility of powder was also markedly changed in the rubbery state. absorbed water could change the free volumes of moisture sensitive excipients in dosage forms. the effect of free volume changes during storage at high relative humidity values on drug release characteristics was studied on tablets. the release rate of theophylline, a crystalline non - hygroscopic drug from wet - granulated tablets containing amorphous pvp as binder was greatly affected by storage conditions, showed by zelk and svegh. storage of the excipient at 65% rh for 30 days induced a glassy - to - rubbery transition and according to pals measurements this relative humidity value and the consequent water sorption was high enough to the phase transition. the structural changes of the binder began at 65% rh also affected the properties of the tablets and the release of the drug was slightly retarded. at 75% rh, where the complete transition of the binder occurred, the mean release time of theophylline was reduced to the half of the original value due to the large scale changes of the binder molecules. polymeric excipient molecules with polar groups are able to form hydrogen bonds with drug molecules during tablet preparation and dissolution. investigated the interaction of metronidazole with carbomer excipient (carbopol) using ftir spectroscopy and ab initio computational calculations. based on these calculations it could be expected that a special arrangement could occur between carbopol and metronidazole with relatively high hydrogen - bonding energy. it was observed that after two - week of storage of the tablets at 75% rh the dissolution profile was markedly changed. the authors concluded that absorbed water molecules were able to break the bonds between metronidazole and excipient molecules inducing faster release of drug molecules. in the case of protein - containing inhalation powders the storage environment of inhalation powders could affect the physical stability of the dosage form and the chemical stability of the api, as well. investigated the physical stability of protein preparations blended with lactose carrier and they found that it was less affected after exposure to different relative humidity circumstances. however, the protein preparations were hygroscopic and its chemical stability was largely affected by storage conditions. it was found that the aggregation of the anti - ige antibody preparation was increased with increasing relative humidity and at higher temperatures the effect of environmental relative humidity was more pronounced on the aggregation rate than at lower temperatures. in the case of inhalation powders the storage conditions must be well - defined, since even if the carrier excipient is not hygroscopic and the physical stability of the product is maintained, the drug molecules could decompose induced by water if the active part of the formulation is able to absorb moisture. | in this paper we give an overview about the interaction of water molecules with pharmaceutical excipients. most of these excipients are amorphous or partially amorphous polymers and their characteristics are very sensitive to the water content. in the course of the manufacturing processes water sorption is possible, therefore in some cases it is important to strictly control the residual moisture content of a dosage form. there are several mechanisms of water sorption, like water is able to bind to polar groups of hygroscopic excipients and could also exist in the capillary system of amorphous excipients. several techniques are available to characterise the states of water inside the materials and the effects of residual water on polymers. for this purpose water sorption measurements, differential scanning calorimetry and the fourier - transform infrared spectroscopy are reviewed. the importance of water content and storage conditions of pharmaceuticals on the properties of the final dosage forms are also demonstrated with practical examples. |
congenital dyserythropoietic anemias (cdas) are inherited disorders that result from anomalies during the final stages of erythropoiesis and consequently present defective production of red blood cells 1. cdas are characterized by chronic hyporegenerative anemia with inadequate reticulocyte count for the degree of anemia, except for cda type iv, and mild hemolysis. the most common complications associated with cdas are iron overload, cholelithiasis, and splenomegaly 2, 3. dyserythropoiesis and morphological features of erythroblasts are commonly identified in other related anemias (hereditary hemolytic anemia, hereditary stomatocytosis, diamondblackfan anemia, fanconi anemia, and other inherited bone marrow failure syndromes) that should be excluded in clinical practice. moreover, the overlapping phenotypes shown in cdas, even in patients with the same genetic variation, can make differential diagnosis difficult 1. the identification of the causative genes of cdas allowed the classification of these diseases, as well as increasing understanding of pathogenesis and clinical management of cdas 4, 5, 6, 7, 8. three classic types of cdas are distinguished by morphological abnormalities in erythroblasts ; the most recent classification recognizes six different types of cdas : ia, ib, ii, iii, iv, and thrombocytopenia xlinked with or without dyserythropoietic anemia, resulting from variants of cdan1, c15orf41, sec23b, kif23, klf1, and gata1 genes, respectively 1. congenital dyserythropoietic anemias are a rare group of anemias, and their estimated frequency in europe is variable, the lowest 0.08 cases / million in scandinavia to the highest 2.60 cases / million in italy 9. to date, more than 100 cases of cda type ia have been reported 3, several members of a family with cda type ib 6, more than 400 cases of cda type ii 10, members of two families with cda type iii 7, and only four patients with cda type iv 8, 11. the different genetic variants causing disease are compiled in the human gene mutation database (http://www.hgmd.cf.ac.uk/ac/) : thirtyfour in the cdan1 gene, eightyeight in the sec23b gene, and sixtythree in klf1 gene but only one variant responsible for dyserythropoietic anemia. we report the case of a patient diagnosed with unclassified cda ; genetic study allowed the identification of the pathogenic variant c.973g > a, p.glu325lys, in the heterozygous state in the klf1 gene, this being the fifth case reported with cda type iv. a female patient aged 13 exhibited systolic murmur, hepatosplenomegaly, polyarthralgia, weight loss as result of high temperature, and signs of anemia onset, dyserythropoiesis, and mild hemolysis. in the neonatal period her twin brother and other siblings have no signs of anemia, her mother has iron deficiency anemia, and her father and grandparents have no known diseases. the blood count data of this patient at 14 years of age were indicative of normocytic hyperegenerative anemia : decreased red blood cells, hemoglobin and hematocrit, increased red distribution width, and reticulocytes ; other parameters were within the normal range (table 1). serological data were distinctive from hemolysis : increased lactate dehydrogenase, hyperbilirubinemia due to indirect fraction, and haptoglobin was undetectable (table 1). there were no signs of iron overload, transferrin saturation, and iron and ferritin values were within the normal range (table 1). the hemoglobin electrophoresis test was normal except for increased fetal hemoglobin, 12% (normal range of hbf 0.82). normal ranges in brackets : red blood cells (rbc 3.55), hemoglobin (hb 1215.5), hematocrit (ht 3646), red distribution width (rdw 10.514.5), reticulocytes (retic. 01.5), median corpuscular volume (mcv 8098), median corpuscular hemoglobin (mch 2733), median corpuscular hemoglobin concentration (mchc 3235), platelet (ptl 120450), total bilirubin (01.2), lactate dehydrogenase (ldh 10250), transferrin saturation (tf sat. 2045), iron (37130), ferritin (10160, females), hepcidin (226). data morphology of peripheral blood cells of the patient aged 13 was as follows : presence of poikilocytosis, anisocytosis, basophilic stippling, polychromia, and mild macrocytosis with 10% erythroblasts. bone marrow morphology aspirated from the patient aged 18 showed intense hyperplasia of red cell series mostly at the last maturation stages, myeloid cells / nucleated erythroid cells ratio of 0.1 (m / e normal range in adults from 1.2 to 5). binuclearity appears in 15% of orthochromatic erythroblasts, multinuclearity, and abundant iron in mononuclear phagocyte cells with a small number of sideroblasts (a, p.glu325lys). congenital dyserythropoietic anemias are rare inherited disorders characterized by a reduced reticulocyte production and hyperplasia in bone marrow. the anemia and hyperbilirubinemia are usually observed in childhood and young adults. the clinical presentation in these patients could lead to misdiagnosis such as hemolytic anemia, thalassemia, hereditary spherocytosis, or iron deficiency anemia, and as consequence, to inappropriate therapies. therapies for cda patients are red cell transfusions, iron chelation to prevent organ damage, splenectomy to abrogate transfusion requirements, or special therapies such as interferon in cda i patients 12 or stem cells transplantation in severe cases of cda 13, 14, 15. the morphological abnormalities of bone marrow erythroblasts support the differential diagnosis of cdas, mainly represented by cda types i and ii. cda type i presents megaloblastic binucleated erythroblasts (25%), chromatin bridges between nuclei, spongy, or swisscheese appearance of heterochromatin and invagination of cytoplasm into the nucleus. cda type ii presents normoblastic binucleated and multinucleated erythroblasts (1035%) and peripheral double plasma membranes. cda type iii presents giant multinucleated erythroblasts, intranuclear clefts into heterochromatin, autophagic vacuoles, and karyorrhexis. cda type iv presents dyserythropoietic morphology similar to cda types i and ii : binucleated erythroblasts, rare immature erythroid cells with marked heterochromatin 2, 3. the analysis of erythrocyte membrane proteins facilitates the diagnosis given that the hypoglycosylation of band 3 is the diagnostic hallmark of cda type ii 16. the cda type iv (omim 613673) is an autosomaldominant disorder caused by variants in the klf1 gene (chr 19p13.2) which encodes for the krppellike factor 1 (klf1), an essential erythroidspecific transcriptional factor member of the krppellike family. klf1 can act as a transcriptional activator and repressor of erythroid gene expression, an activator of genes for heme and globin synthesis, blood group antigens, and other erythroid factors 17, 18. sixtythree variants on klf1 gene have been described so far and result in different phenotypes such as : hereditary persistence of fetal hemoglobin, borderline elevated levels of hemoglobin a2, microcytosis and/or hypochromia, lutheran blood type, congenital hemolytic anemia, congenital dyserythropoietic anemia type iv 19, 20. recently, homozygosity for null variants has been associated with embryonic lethality 21. to date, four patients with cda iv have been reported, all of them exhibiting the same autosomaldominant variant c.973g > a, p.glu325lys, in the heterozygous state in the klf1 gene, 4, 10, the same genetic variant as the case reported in the present work. this pathogenic variant is found in the second zinc finger of klf1, an essential region for binding to dna motif in the regulatory regions of many erythroid genes. all of the patients reported as cda type iv, and the patient in this work, showed normocytic anemia, normal or slightly increased reticulocyte count, elevated values of hbf, elevated ldh, hyperbilirubinemia, and reduced haptoglobin. in two cases, anemia had been found at birth and required repeated blood transfusions. in another case, anemia was associated with hydrops fetalis and treated with intrauterine transfusions ; thalassemic facies and female genitalia with a male karyotype were also presented 8. almost all patients exhibit hepatomegaly and splenomegaly, one was splenectomized aged 4 8, and the present patient was splenectomized aged 36. in one case, the liver showed a moderate iron overload, not caused by blood transfusion therapy 11. these patients showed similar features in peripheral blood smear and in bone marrow aspirate : anisopoikilocytosis, polychromasia, erythroid hyperplasia, dyserythropoiesis signs, basophilic stippling of erythroblasts and erythrocyte, bi and multinucleated erythroblasts with internuclear bridges and enlarged nuclear pores. moreover, erythrocytes of patients reported had low protein expression of cd44 and aqp1 water channel, both expression genes regulated by klf1 8, 11. as klf1 is a transcriptional regulator of the switch from fetal to adult hemoglobin, and of many red blood cell membrane proteins, the clinical characteristics of cda type iv are a combination of hemoglobinopathy, red blood cell defect, and hereditary persistence of fetal hemoglobin features. these conditions together distinguish cda type iv from other diseases such as thalassemia, hereditary spherocytosis, and hereditary persistence of hbf 11. the wide variety of phenotypes observed in cda patients makes differential diagnosis difficult ; the identification of the genetic variants plays a crucial role in the clinical management of patients. genetic diagnosis would contribute to classify cda patients, and even to identify genetic factors that modify phenotype severity. the detection of a genetic variant in misdiagnosed or unclassified cda patients would mean these inherited disorders were more frequent than at present. sdlii : acquired, analyzed, and interpreted the clinical data and morphological images, and revised the manuscript. mjmj : designed the genetic study, analyzed and interpreted genetic variants, and wrote the article. | key clinical messagecongenital dyserythropoietic anemias (cdas) are displayed by ineffective erythropoiesis. the wide variety of phenotypes observed in cda patients makes differential diagnosis difficult ; identification of the genetic variants is crucial in clinical management. we report the fifth case of a patient with unclassified cdas, after genetic study, with cda type iv. |
the incidence of post - operative morbidity and mortality is higher in geriatric patients owing to the increased incidence of complications such as myocardial ischaemia (mi), stroke, dementia, renal dysfunction, pulmonary embolism (pe) and other respiratory complications. beta blocker usage, deep vein thrombosis (dvt) prophylaxis and use of regional anaesthesia (ra) have been shown to improve the outcome. however, intra - operative hypotension, intra - operative bleeding and neurological complications like stroke resulting from these management strategies may adversely affect the outcome. very few studies have evaluated the overall impact of these management practices on the outcome of geriatric patients. frequent use of beta blockers, dvt prophylaxis and combined spinal and epidural (cse) anaesthesia in place of spinal anaesthesia alone were introduced into clinical practice in our institute from the year 2000 and were established by the year 2006. we aimed to evaluate the impact of these factors on the peri - operative management of geriatric patients undergoing elective orthopaedic lower limb surgeries by comparing the patients operated before and after the establishment of these changes in practice. after institutional ethics committee 's approval, a retrospective comparative study was undertaken on patients aged over 65 years who underwent elective lower limb orthopaedic procedures in the years 1999 and 2007. the major changes in the management since 2000 included use of perioperative low molecular weight heparin (lmwh) for dvt prophylaxis, perioperative beta - blocker in patients with high cardiac risk, regional anaesthesia by cse and post - operative pain management by epidural analgesia. the year 2007 was chosen as most of the management changes were established and implemented by then. thirty - eight patients operated in the year 1999 (group 1999) were compared with 107 patients operated in the year 2007 (group 2007). the chart review focused on pre - operative co - morbid diseases, intra - operative events, post - operative complications and post - operative mortality. pre - operative factors noted included demographic information (such as age and gender), diabetes, hypertension, beta blocker usage, cardiac problems (abnormal echocardiography findings, coronary artery disease (cad), valvular heart disease, arrhythmias, conduction blocks), neurologic disorders, respiratory disorders, renal disease, abnormal electrolyte findings, history of smoking, history of fever and dvt prophylaxis with lmwh. the intra - operative variables noted were the type of anaesthesia, occurrence of episodes of hypotension, hypertension and cardiac ischaemia. hypotension in the peri - operative period was defined as systolic blood pressure (sbp) 25% lower than the baseline value for 5 or more minutes, patients requiring fluid boluses, vasopressors or inotropes for management of haemodynamics. cardiac ischaemia was diagnosed when the new st - t changes were more than 1 mm for more than 15 minutes, elevation of troponin t enzyme levels and/or associated hypotension or hypertension. hypertension was labelled when the sbp was > 160 mmhg and / or diastolic blood pressure > 110 mmhg for more than 10 minutes in the intra - operative period, requiring boluses or continuous infusion of vasodilators like nitroglycerin. the post - operative complications of cardiac ischaemia, deep vein thrombosis (dvt)/ pulmonary thromboembolism (pte), fluid and electrolyte abnormalities, gastrointestinal complications, respiratory complications, neurologic complications, wound infections and other complications were noted until discharge or death. dvt was assessed clinically by symptoms and signs of lower limb swelling, localised tenderness along the lower limb veins, calf tenderness and calf swelling. patients having nausea, vomiting, diarrhoea and abdominal pain were considered to have gastrointestinal complications. patients presenting with delirium, stroke or transient ischaemic attack were considered to have neurologic complications. patients having cough with expectoration, crepitations, new infiltrates on chest radiograph and inadequate respiratory effort were considered to have respiratory complications. the length of post - operative hospital stay (lpohs) (interval between surgery and discharge from the hospital or death) was noted. the occurrence of intra - operative and post - operative complications was considered as a surrogate measure of outcome of the anaesthetic protocols and in - hospital mortality as a final measure of anaesthetic management. the peri - operative variables were noted and the measures of outcomes were compared between the two groups. although not considered during the initial planning of the study, independent risk factors for intra - operative and post - operative complications and mortality were determined post - hoc from the total data set. statistical analysis was performed using spss13. comparison of continuous variables like age, serum sodium levels (meq / dl), haemoglobin (hb gm%), blood urea (mg / dl), serum creatinine, sbp, fasting blood sugar (fbs) and lpohs between the two groups- group 1999 and group 2007 was made using independent sample t test. comparison of categorical variables like hypertension, diabetes, presence of hyper / hyponatraemia, coronary artery disease, use of beta blockers, x - ray changes, abnormal echocardiography findings, valvular heart disease (vhd), arrhythmias, conduction block defects, neurological disorders, respiratory disorders, smoking, bed sore, fever, dvt prophylaxis, abnormal renal findings and hyperkalaemia were compared between the two groups using chi - square test. a p value 1) for the variables which were found to be significant. the mean age in the group 1999 was 73.53 6.96 and in group 2007 was 71.6 6.32. the male : female ratio in the group 1999 was 23:15 and 98:9 in the group 2007. the surgical indications in both the groups were : out of 38 patients in group 1999 and 107 in 2007, hip surgeries 33/81, femur surgeries 4/5, leg surgeries 1/10 and other degenerative conditions 0/11. the type of anaesthesia in both the groups are compared and listed in table 1. there was a statistically significant increase in the incidence of cse anaesthesia in group 2007 compared to that in the year 1999. the numbers of patients who had epidurals for management of post - operative pain were significantly greater in 2007. among the pre - operative variables tested in both the groups, male gender, use of beta blockers, dvt prophylaxis with lmwh and electrocardiographic (ecg) changes were found to be comparatively higher in group 2007 [table 2 ]. the pre - operative hb levels were comparatively lower and sbp was better controlled in group 2007 [table 3 ]. comparison of type of anaesthesia in both the groups comparison of pre - operative categorical variables between the groups comparison of pre - operative continuous variables in both the groups the intra - operative and post - operative complications between 1999 and 2007 are compared in tables 4 and 5. the number of patients who did not develop any intra - operative or post - operative complications was higher in 2007. the incidence of intra - operative hypotension was found to be significantly lower in the year 2007. the mean lpohs was 12.26 days in group 1999 and 11.1 days in group 2007 (p = 0.38). the mortality rate in groups 1999 and 2007 was 5.4% and 2.8%, respectively [table 6 ]. two patients in group 1999 and three patients in group 2007 had mortality and this was not significant between the two groups. out of two patients in group 1999, one patient had received epidural anaesthesia with stable haemodynamics but had post - operative pulmonary thromboembolism and finally succumbed. the other patient had intraoperative hypotension with spinal anaesthesia and treated but finally had stroke in the post - operative patient. in group 2007, out of 3 patients with mortality, one patient received spinal anaesthesia with stable intraoperative period, but he had severe inferior wall myocardial infarction and finally died with uncontrolled cvs instability. the second patient had received general anaesthesia but finally succumbed with stroke and its complications. the other patient had undergone surgery under spinal anaesthesia with stable haemodynamics but had massive pulmonary embolism and died. comparison of intra - operative parameters in both the groups comparison of post - operative parameters and mortality in both the groups odds ratio for significant variables which correlated with the outcome the factors which were found to be significant for the mortality on univariate analysis were presence of intra - and post - operative complications. the independent risk factors associated with mortality for the entire set of patients included in the study were occurrence of intra - operative complications like hypotension (spearman rho () = 0.2, p = 0.017) and post - operative complications like cardiac ischaemia (= 0.3, p = 0), dvt (= 0.38, p = 0.0) and neurologic changes (= 0.24, p = 0.004). odds the factors like intra - operative hypotension, post - operative cardiac changes, dvt and neurological changes were found to have significant association with mortality. there is evidence that the use of protocols that have included use of dvt prophylaxis, beta blockers and regional anaesthesia have improved the outcome. the implementation of these protocols is likely to result in complications like intra - operative bleeding, hypotension and neurological effects. the impact of the use of these protocols on peri - operative management has not been evaluated. hence, the peri - operative anaesthetic management and the complications in both the group were studied and compared. the incidence of ischaemic ecg changes and the use of beta blockers in the pre - operative period were significantly high in 2007. though there was significantly higher proportion of patients with both ecg changes and clinical cad in 2007, there was no significant difference in the incidence of peri - operative ischaemia. the incidence of intra - operative hypotension was significantly lower in the year 2007 than in the year 1999 despite higher incidence of use of beta - blockers. the decreased incidence of cardiac complications in 2007 again may be attributed to the increased use of beta blockers. randomised clinical trials which evaluated the effects of beta - blockers on all - cause mortality in patients undergoing non - cardiac surgery have yielded conflicting results. pre - operative detection of coronary insufficiency and optimisation of such cases with beta blockers and modification in the anaesthetic management could have also resulted in lowering the post - operative cardiac risk in our study. this was an indirect evidence that beta blockers had a protective effect in high cardiac risk patients. though the current data is insufficient to demonstrate benefits of beta - blockers, the literature suggests that peri - operative beta - blockers provide a benefit which is usually restricted to patients undergoing high - risk surgery. compared to the mean hb levels preoperatively in the year 1999, the levels in the year 2007 were lower, indicating changing acceptable thresholds preoperatively. mantilla and colleagues have shown that existing co - morbidities rather than pre - operative anaemia were independently associated with major morbidity and mortality in patients undergoing major orthopaedic arthroplasty. the post - operative neurological changes were found to have significant correlation with the outcome. however, our data reveal that there was no difference in the neurological complications between the two time periods. there was an increasing emphasis on controlling the systolic hypertension in addition to diastolic hypertension in geriatric patients. several studies have evaluated the relative risk of specific components of blood pressure (e.g. sbp, diastolic blood pressure, pulse pressure and mean arterial pressure) in high - risk, older patients and showed that increased sbp has been associated with increased cardiovascular adverse outcomes. in the year 2007, pre - operative blood pressure was more stringently controlled when compared to that in the year 1999. this also correlates with the beta blocker usage in 2007 and indirectly would attribute to the lesser incidence of post - operative cardiac changes. the incidence of clinical pte was not significantly different between both the groups despite the increased use of dvt prophylaxis with lmwh in 2007. absence of surveillance using sensitive monitors could have resulted in low reported incidence of dvt. the time of ambulation following surgery was varied as this study involved a heterogenous group of orthopaedic patients. therefore, the role of ambulation on dvt can not be commented from this study. the major differences in anaesthetic care were greater use of regional anaesthetic techniques like cse and epidurals for post - operative analgesia. there was a significant increase in the use of regional anaesthesia with cse in the year 2007 compared to the group 1999. administration of regional anaesthesia in patients with dvt prophylaxis was in accordance with the american society of regional anesthesia guidelines for placement and removal of epidural catheters. there was no significant difference in the incidence of intra - operative hypotension due to bleeding. post - operative neurological changes due to epidural haematoma or excessive bleeding were not seen in the same group of patients, thus establishing that strict adherence to guidelines significantly mitigates the side effects. the early onset of anaesthesia with spinal and increased satisfaction with post - operative epidural analgesia has greatly favoured the increased use of cse. there were less of intra - operative and post - operative complications in the year 2007 compared to the year 1999. recent literature has shown that epidural analgesia provides superior pain relief, thus facilitating early post - operative mobilisation of patients which explains the improved outcome. evidence has shown the beneficial effects of regional anaesthesia in reducing the incidence of intra and post - operative ischaemic events, especially in cad patients. distinct benefits like lower incidence of respiratory infections, lesser transfusion requirements, lower incidence of graft failure in vascular surgery patients, etc. was seen with epidural anaesthesia compared with ga. though there was no statistically significant difference, there was a trend towards reduction in the intra - operative and post - operative complications in group 2007. it has been shown that presence of peri - operative complications was associated with adverse outcomes. the changes in anaesthetic practice did not have any impact on the length of post - operative hospital stay. the gastrointestinal fluid and electrolyte changes, renal, respiratory, infectious and other complications were comparable in both the groups. hyponatraemia is a common finding in geriatric patients and studies have shown its deterioration with stress and surgery. implemented an evidence - based scientific conduit for nursing of elderly patients with a hip fracture. post - operative morbidity was reduced and it did not have any impact on in - hospital mortality or overall costs of inpatient care. the varying trends in health care and its effect can not be ruled out, but it had a positive impact in decreasing the complications in some subset of population. the overall incidence of peri - operative complications that were likely to prolong the post - operative stay was low in both the the groups and the current sample size is small to draw conclusions regarding this. there are certain limitations to this study. the retrospective data collection, the discrepancy in the number of patients operated in the years 1999 and 2007 and the heterogeneity of the surgical procedures are the major limitations. the increased awareness and affordability are the main reasons for such an increase in the number of geriatric patients undergoing orthopaedic surgeries. despite the apparent heterogeneity of the surgical procedures the influence of variation in anaesthetic management, the surgical technique and expertise on the inferences drawn from this study is also a limitation. factors that were contributing to the mortality in this study were found to be dvt, cardiac ischemia and neurologic changes. use of epidural anaesthesia with extended management of post - operative pain and beta blockers in high - risk cardiac cases was effective in reducing the complications in geriatric patients undergoing surgery. dvt prophylaxis with lmwh was safe and reduced the incidence of disastrous complication of pte. the use of dvt prophylaxis, beta blockers in high - risk cases and use of epidural analgesia for post - operative pain management influence the outcome of geriatric patients undergoing lower limb surgery. | background and aims : several changes in the management protocols of anaesthesia for geriatric patients were introduced into clinical practice to improve the outcome. very few studies have evaluated the impact of these management protocols. the aim of our study was to evaluate impact of some of the changes in the peri - operative management protocols of geriatric patients undergoing elective orthopaedic lower limb surgeries on the outcomes.methods:a retrospective chart review of thirty - eight surgical patients from 1999 (group 1999) before the introduction of changes and 107 patients from 2007 (group 2007) after establishing changes was performed and data of peri - operative variables were collected and analysed. the primary outcome measured was in - hospital mortality. the secondary outcomes were occurrence of intra - operative and post - operative complications. comparison of continuous variables between the two groups was performed using independent sample t test and categorical variables using chi - square test. multivariate logistic regression was done to identify independent predictors of mortality.results:the use of beta blockers, deep vein thrombosis prophylaxis with low molecular weight heparin and epidural technique for post - operative analgesia was higher in group 2007. despite higher prevalence of patients with electrocardiographic changes and anaemia, the incidence of intra - operative or post - operative complications was lower in 2007, though the mortality rate in both the groups was comparable. the independent risk factors for mortality in these geriatric patients were intra - operative hypotension (odds ratio (or) = 11.33) and post - operative myocardial ischaemia (or = 34.5), pulmonary embolism (or = 17.1) and neurologic changes (or = 17.1).conclusions : implementation of new management practices had significantly reduced the incidence of intra- and post - operative complications. |
fish has been and will continue to be one of the major sources of animal protein for humans. it will likely become more important as the population heads towards 8 billion in about 20 years as food production (e.g., growing of crops, breeding of domestic animals) has and will continue to compete with other human activities (e.g., transportation, housing, industry) for the limited usable / inhabitable land. besides being a more affordable animal protein many species of marine fishes have beneficial health components which include the polyunsaturated fatty acids (e.g., omega 3). however, the capture - fishery is either stagnant or has been in decline as natural fish stocks in many parts of the world have been reduced significantly because of over and/or indiscriminate fishing and/or the destruction of spawning grounds. many undesirable discharges (e.g., organophosphates, heavy metals) into the aquatic environments, especially from industries, are known to reduce fish survival and reproduction. in some areas fish are no longer suitable for human consumption because of the high levels of accumulated pollutants, and no new fishing grounds have been discovered. according to the food and agriculture organization, aquaculture continues to be the fastest food producing sector with about a 10% annual increase intensive culture of freshwater and marine fishes in cages is well developed in many countries, especially in those that have large numbers of rivers and lakes and/or long coastlines (e.g., china, chile, norway). however, disease outbreaks become more frequent as intensive fish culture tends to facilitate the transmission of parasites between fish in cages and the acquisition of pathogens from feral fishes that are attracted to the uneaten food in cages. the piscine immune system is well developed, and in many ways it is similar to that in mammals (e.g.,) which include a comparable set of immunocompetent cells. in general, the adaptive immune response is slower to develop in fish than in mammals, and this is in part due to its lower body temperature. however, the innate immunity in fish is as well developed and is as responsive as that in mammals. the present discussion is in two parts ; the first part (section 2) is a brief review on cryptobia and the pathobiology in cryptobiosis information which are relevant to the discussion on the development of strategies against the pathogen and disease (section 3). cryptobiais a parasitic flagellate that has worldwide distribution, and a few species are known to cause disease in marine and freshwater fishes. this extracellular parasite is elongated and is a little larger than a fish red blood cell. the parasite has an anterior flagellum and a recurrent flagellum that attaches to the body and exit as a free flagellum at the posterior end. salmonid cryptobiosis is caused by the haemoflagellate cryptobia (trypanoplasma) salmositica (figure 1)., along the west coast of north america, and outbreaks of cryptobiosis with high fish mortalities have occurred in both freshwater hatcheries and in sea cage cultures. the parasite multiplies by binary fission, and the parasitaemia peaks at about 4 - 5 weeks after infection (e.g., [79 ]). the severity of the disease (e.g., the anaemia) is directly related to the parasitaemia and clinical signs include exophthalmia (figure 2), general oedema, abdominal distension with ascites, a microcytic and hypochromic anaemia, positive antiglobulin reaction (or positive coombs ' test) of red cells (figure 3), and anorexia [7, 10, 11 ]. anorexia is a double - edged sword it is beneficial to the host in that it reduces the severity of the disease by lowering plasma proteins and subsequently the parasitaemia but it is also detrimental to the fish in that it contributes to the immunodepression [11, 12 ]. during acute disease in addition, plasma thyroxine (t3 and t4), protein, and glucose are reduced along with depletion of liver glycogen. the metabolism and swimming performance of infected rainbow trout are also significantly reduced, and the bioenergetic cost of the disease in juvenile fish is considerable. these are contributing factors to the retarded growth as there are significant reductions in food consumption, dry weight and energy gained, energy concentration, and gross conversion efficiency. however, the attenuated vaccine strain (section 3.3.1) has no detectable bioenergetic cost to juvenile fish. the cysteine protease consisting of four polypeptide bands (49, 60, 66, and 97 kda) is a metabolic enzyme while the metalloprotease (200 kda) is a histolytic enzyme. consequently, it is an important contributing factor to the anaemia which is a very consistent clinical sign of the disease. also, the purified metalloprotease readily degrades types i, iv, and v collagens (figure 5) and laminin. it is secreted by the parasite in fish and in culture, and it contributes significantly to the development of the disease and histopathogical lesions in infected fish. briefly, metalloprotease activities can be neutralized by either a monoclonal antibody (section 3.1) or a natural antiprotease (section 3.2.2) or the antibody against the dna vaccine (section 3.3.2) ; this neutralization essentially disarms the pathogen so that the host immune system can more readily control the infection. a murine igg1 monoclonal antibody (mab-001 ; figure 6) has been produced against the 200 kda glycoprotein (cs - gp200). it significantly lowers the parasitaemias in fish and this is similar to the effects of the inoculation of antisera from fish that had recovered from cryptobiosis. also, mab-001 has prophylactic effects in fish ; however, it does not fix complement but agglutinates live parasite. in vitro exposure of the parasite to mab-001 reduces its survival and infectivity when inoculated back into fish. the monoclonal antibody also inhibits parasite multiplication and its aerobic respiration, and it completely neutralizes the activity of the metalloprotease. the cs - gp200 epitope consists of carbohydrate determinants and conformational polypeptide with internal disulphide bonds. the epitope has its asparagine - bound n - glycosidically linked hybrid - type carbohydrate chain with the minimum length of a chitobiose core unit. it has a phosphatidylinositol residue which anchors the conformational polypeptide (with disulphide bonds) to the surface of the pathogen. the molecule is extensively posttranslationally modified, has high mannose components, and appears as a doublet in the pathogenic strain and as a single band in the attenuated vaccine strain. in the present discussion the first is absence of disease in an infected fish (pathogen - tolerant fish) and the second is resistance to infection by a fish (pathogen - resistant fish). some laboratory / hatchery raised brook charr, salvelinus fontinalis, can not be infected with c. salmositica, and this is innate resistance to infection. resistance to cryptobia infection is inherited by progeny and it is controlled by a single dominant mendelian locus. cryptobia - susceptible brook charr are homozygous recessive while the cryptobia - resistant fish are either homozygous or heterozygous dominant for the locus. consequently, we can now breed resistant fish by initially testing the freshly collected plasma from the brood fish for cryptobiacidal effects. briefly, under in vitro conditions fresh plasma from cryptobia - resistant charr lyse the parasite via the alternative pathway of complement activation. there is no detectable difference in the immune responses of both cryptobia - tolerant (section 3.2.2) and cryptobia - resistant charr to other antigenic stimulations including a commercial vaccine. not much is known about this type of resistance and its inheritance by progeny ; consequently, further studies on innate resistance to infections in other animals would be most rewarding because it can be a good strategy against some pathogens. parasitaemias in some infected brook charr are just as high as those in oncorhynchus spp. cryptobia - tolerant brook charr are resistance to disease because the metalloprotease secreted by c. salmositica is neutralized by the 2 macroglobulin (a natural antiprotease) in the blood. the amount of 2 macroglobulin is higher in brook charr than in rainbow trout prior to infection and it remains high (about 40%) even at peak parasitaemia while that in trout drops to about 12% [21, 33 ]. parasitaemias in both infected rainbow trout and brook charr peak at about 46 weeks after infection and as antibodies are produced the parasitaemias decline ; however, the parasitaemia fluctuates in rainbow trout while that in infected cryptobia - tolerant charr rapidly declines after peak parasitaemia. neutralization of the metalloprotease by 2 macroglobulin was demonstrated under both in vivo and in vitro conditions [18, 21, 33 ]. since cryptobia - tolerant charr do not suffer from clinical disease, the immune system readily controls the infection and the fish recover much more rapidly than trout from the infection. an obviously option to control cryptobiosis in salmon is to consider producing transgenic cryptobia - tolerant salmonids. it is expected that the transgenic salmon will maintain high levels of 2 macroglobulin in their blood, essentially to neutralize the metalloprotease secreted by the pathogen the additional 2 macroglobulin will eliminate or at least reduce the severity of the disease. since the disease is absent or less severe, the fish immune system can more effectively control the infection. this proposal is a novel approach to the management of an infectious disease in animals and it perhaps needs further discussions. an obvious downside with this approach is that it may increase the pool of reservoir animals (with infections but no disease) in the population but one very obvious advantage is that no further human interventions (e.g., vaccination, chemotherapy) are required once the transgenic animal is produced. adaptive immunity has also been exploited to protect the susceptible oncorhynchus spp. from cryptobiosis. two distinctly different experimental vaccines (a live attenuated vaccine and a metalloprotease - dna vaccine) have been developed. fish inoculated with the live attenuated cryptobia vaccine are protected from infection when challenged with the parasite. however, the metalloprotease - dna vaccine does not prevent an infection in vaccinated fish but antibodies produced in the vaccinated fish neutralize the disease - causing factor secreted by the pathogen. although the dna - vaccinated fish is infected, it does not suffer from cryptobiosis, and it essentially turns the pathogenic cryptobia into a nonpathogenic flagellate as in the case of the cryptobia - tolerant brook charr (section 3.2.2). c. salmositica was attenuated by prolonged in vitro culture and the attenuated parasite is maintained in tissue culture medium and it has remained avirulent since 1990. it produces a low infection in rainbow trout, does not cause disease, circulates in the blood for at least 6 months, and is protective when the fish is challenged with the pathogen. it is adapted to in vitro culture and hence multiplies much more readily than the pathogenic strain in tissue culture medium [35, 36 ]. a single injection of the strain protects 100% of vaccinated fish and consequently it is used routinely as an experimental vaccine to study the development and mechanism of protective immunity in salmonids and the pathobiology of the disease. the vaccine has no detectable bioenergetic cost to juvenile rainbow trout, and it protects various species of juvenile and adult salmonids from the pathogen (e.g., [8, 9, 3741 ]). rainbow trout vaccinated in fresh water and transferred to sea water are also protected on parasite challenge. vaccinated fish are partially protected if they are challenged at 2 weeks postvaccination (wpv) while all vaccinated fish are protected (e.g., no drop in packed cell volume and virtually no detectable infection after parasite challenge) at 4 wpv. protection is via the production of complement fixing antibodies and under in vitro conditions activated macrophages from head kidneys of vaccinated fish show antibody - independent and antibody - dependent cytotoxicities. also, in the presence of antiserum macrophages are very efficient in engulfing living parasites (figure 7). the complement fixing antibody titres (e.g.,) and cell - mediated response (e.g.,) in vaccinated fish rise significantly soon after parasite challenge (classical secondary responses), and the responses in vaccinated and challenged fish are similar to those in nave fish at 6 weeks after infection. humoral and cell - mediated immunity are important components of the protection against c. salmositica in both vaccinated and recovered fish (e.g., [8, 9, 40, 43 ]). as indicated earlier (sections 3.1 and 3.2.2) the disease causing metalloprotease (200 kda glycoprotein) can be neutralized. this is accomplished either by the 2 macroglobulin (a natural antiprotease) in cryptobia - tolerant brook charr [18, 21, 33 ] where the parasitaemia does not fluctuate and the fish recovers rapidly or by an antibody (mab-001) produced against the 200 kda glycoprotein. the monoclonal antibody (mab-001) agglutinates the parasite and reduces its survival and infectivity. neutralization of the metalloprotease by antibodies in vaccinated fish is the basis of our current dna vaccine. briefly, the metalloprotease and cysteine protease genes of c. salmositica were sequenced [45, 46 ] and inserted into plasmid vectors (pegfp - n) to produce a metalloprotease - plasmid vaccine and a cysteine - plasmid vaccine. rainbow trout and atlantic salmon, salmo salar, injected intramuscularly with the metalloprotease - plasmid vaccine consistently had lower packed cell volume (as metalloprotease was secreted into the blood) than controls (fish inoculated either with plasmid alone or with cysteine - plasmid vaccine) at 24 wpv. however, the packed cell volume in metalloprotease - vaccinated fish returned to normal by 5 wpv this was because the metalloprotease was neutralized as antibodies were produced. agglutinating antibodies against c. salmositica were detected 57 wpv in the blood (and not before 5 wpv) in metalloprotease - vaccinated fish, but not in fish injected with either the cysteine - plasmid or plasmid alone injected fish. fish were challenged with the pathogen at 7 wpv and the metalloprotease - vaccinated fish had lower parasitaemia, delayed peak parasitaemia, and faster recovery than control infected fish. in a recent review on the use of dna vaccines in aquatic organisms many protozoa that are of medical and economic importance (e.g., trypanosoma spp. some of these pathogens also modify their surface coats to evade the host immune response (e.g., antigenic variations as in the glossina - transmitted mammalian trypanosomes in africa) ; consequently vaccines based on surface membrane epitopes are not effective. however, an enzyme - based vaccine may be worth serious considerations as enzymes are quite conserve. also, an enzyme - based vaccine will most likely protect against all isolates of the pathogen including those from different geographical locations which may have different surface membrane antigens. enzymes are generally quite conserve and this is true even among different pathogens ; for example, sequences of pcr - derived fragments of the metalloprotease gene of c. salmositica are similar to those in other kinetoplastids, such as leishmania chagasi, l. donovani, trypanosoma cruzi, and t. brucei. major surface protease (msp) also known as gp63 or leishmanolysin is a highly abundant zinc metalloprotease present on the cell surface of leishmania spp. the ncbi - conserved domain search shows that the alignment for the metalloprotease of c. salmositica has 78.3% similarity with peptidase_m8, leishmanolysin domain. chemotherapy is essentially differential toxicity ; that is, the drug is more toxic to the target organism than it is to the host. severity of the side effects of chemotherapy is dependent partly on tissue damage and adverse reactions by the host to the drug. however, the drug can be directed more specifically to the pathogen if it is conjugated to an antibody specific for the target organism. immunochemotherapy will obviously increase costs and is generally not meant for routine use ; it may however be a useful tool under certain circumstances as it reduces the drug dosage and its side effects. for example, it can be used to treat infected brood fish as about 50% of brood fish annually die from cryptobiosis in some hatcheries on the west coast of north america. it is expected the side effects and accumulation of drug residues in host tissues will be reduced in immunochemotherapy, and this may also lower the risk of the development of drug - resistance by the pathogen. reduction in drug residue in host tissues is also an important consideration if the fish are for human consumption. in tropical africa isometamidium chloride (samorin) is widely used against trypanosomiasis in domestic animals, and it is also used as a prophylactic drug against bovine trypanosomiasis. in fish, samorin (1.0 mg / kg weight) reaches peak level in the blood 2 - 3 weeks after intramuscular injection. the drug is therapeutic against c. salmositica in rainbow trout during pre- and post - clinical phases of the disease. however, it is not effective during acute disease partly as we believe that the drug modifies surface epitopes of the parasite so that they are not lysed by complement fixing antibodies. the drug is more effective in infected atlantic salmon, and at a higher dose (2.5 mg / kg) the infection is eliminated in about 30% of adult fish and significantly reduces the parasitaemias in remaining fish. also all infected juvenile chinook salmon, oncorhynchus tshawytscha, treated with isometamidium chloride (1.0 mg / kg) survived the disease while 100% of untreated infected fish died with massive parasitaemias. the drug also has prophylactic value, and it does not seem to affect fish growth, food consumption, blood complement levels, or haematocrit values in fish. samorin accumulates rapidly in the kinetoplast of the parasite, causes condensation of its kinetoplast dna, forms vacuoles, and swells the mitochondrial cristae (figure 8). although the parasite normally undergoes aerobic respiration, it also has glycolytic enzymes sequestered in microbodies called glycosomes. the in vitro oxygen consumption and carbon dioxide production decrease significantly after drug exposure with very significant increases in secretion of glycolytic products (lactate and pyruvate) as the parasite switches from aerobic respiration to glycolysis after its mitochondrion is damaged by the drug. also, in vitro exposure to sublethal levels of the drug reduces infectivity of the parasite to fish and changes the surface glycoprotein antibody - receptor sites of the parasite. this alteration of surface epitopes explains the protection of some parasites from lysis by complement fixing antibodies when rainbow trout with acute infections were treated with the drug. ardelli and woo conjugated isometamidium chloride to polyclonal antibodies (from recovered fish) and the monoclonal antibody (mab-001, section 3.1). the conjugated drug is on the entire parasite while the unconjugated drug accumulates only in the kinetoplast (figure 9). before drug conjugation polyclonal antibodies - conjugated drug (paic) lyses most of the parasite and it no longer agglutinates the parasite. in contrast, the mab-00-conjugated drug does not lyse c. salmositica but agglutinates it. after in vitro exposure to paic the infectivity of the parasite and subsequent parasitaemias in inoculated fish fish survival (table 1) was much higher in juvenile chinook salmon infected with parasites exposed to the polyclonal antibodies - conjugated drug (paic) than to drug alone (drug) or to polyclonal antibodies alone (antibody) or to drug plus polyclonal antibody (pai). also, preliminary studies indicate the drug - antibody conjugate to be effective when injected into infected fish. the results are encouraging and further studies are needed, for example, to determine dosages needed, refinement of the approach (e.g., stage of infection, species of salmonids). our concerted efforts to better understand the biology of cryptobia and the mechanism of the disease have allowed us to develop more rational strategies against the pathogen and disease. we have been relatively successful in exploiting the piscine immune system to protect salmonids against c. salmositica and cryptobiosis. this is an ongoing and evolving research program and there is obviously a great deal of work that needs to be conducted. however, i hope our research will be of interest and perhaps be useful to colleagues who are also developing control measures against similar pathogenic organisms. the research has been both challenging and fascinating, and i would like to think the best is yet to come. | salmonid cryptobiosis is caused by the haemoflagellate, cryptobia salmositica. clinical signs of the disease in salmon (oncorhynchus spp.) include exophthalmia, general oedema, abdominal distension with ascites, anaemia, and anorexia. the disease - causing factor is a metalloprotease and the monoclonal antibody (mab-001) against it is therapeutic. mab-001 does not fix complement but agglutinates the parasite. some brook charr, salvelinus fontinalis can not be infected (cryptobia - resistant) ; this resistance is controlled by a dominant mendelian locus and is inherited. in cryptobia - resistant charr the pathogen is lysed via the alternative pathway of complement activation. however, some charr can be infected and they have high parasitaemias with no disease (cryptobia - tolerant). in infected cryptobia - tolerant charr the metalloprotease is neutralized by a natural antiprotease, 2 macroglobulin. two vaccines have been developed. a single dose of the attenuated vaccine protects 100% of salmonids (juveniles and adults) for at least 24 months. complement fixing antibody production and cell - mediated response in vaccinated fish rise significantly after challenge. fish injected with the dna vaccine initially have slight anaemias but they recover and have agglutinating antibodies. on challenge, dna - vaccinated fish have lower parasitaemias, delayed peak parasitaemias and faster recoveries. isometamidium chloride is therapeutic against the pathogen and its effectiveness is increased after conjugation to antibodies. |
the mucosal surfaces of our body are a primary component of our innate immune system and serve as a barrier against endogenous microflora as well as against external pathogens. this barrier is made of polarized epithelial cells, specialized immune cells, and secreted mucus. many pathogens have evolved strategies to circumvent this barrier, including entering into cells or traveling through them by transcytosis, crossing through intercellular junctions, or directly disrupting the barrier by killing cells in the epithelium (kazmierczak., 2001a). the mucosal barrier epithelium is comprised of one or more layers of epithelial cells that have specialized and distinct apical and basolateral surfaces, separated by tight junctions (tjs), that form selective permeability barriers between biological compartments (wang and margolis, 2007 ; martin - belmonte and mostov, 2008). the apical surface faces the lumen of the cavity, while the basolateral surface faces adjoining cells and the underlying basement membrane. the apical and basolateral membrane domains are distinguished by unique assemblies of proteins and lipids, creating specific membrane domains with distinct roles in formation and maintenance of barrier function, as well as the myriad of physiological barrier functions, such as nutrient exchange. the apical surface contains transporters and enzymes that are specialized to interact with the external environment. the basolateral plasma membrane of the epithelial cell contains many transporters and receptors that are involved in uptake of nutrients and hormones from the circulation. the basolateral surface can be divided into lateral domains, which contact other cells, and basal domains, which contact the basement membrane and blood vessels. the lateral surface contains specialized cell cell contact domains, including tjs and adherens junctions (ajs). the tj is located at the apical - most region of the lateral surface and defines the boundary between the apical and basolateral surfaces (ebnet, 2008). this function enables the epithelial monolayer to restrict permeability to solutes or larger particles, including pathogens. second, the tj acts as a fence to prevent diffusion or intermixing of plasma membrane components between the apical and basolateral domains. the tj contains three classes of integral membrane proteins : occludins, claudins, and jams, each of which forms homophilic interactions that are responsible for gate function of the tj. the tj is attached to the cytoskeleton by a set of adaptor proteins including zonula occludens protein 1 (zo-1). the aj consists mainly of classical cadherin family members and nectins, which are integral membrane proteins whose large extracellular domains interact in a homophilic or heterophilic manner to connect adjacent cells. in addition to providing the structural linking of neighboring cells, cadherins function as organizing nodes for multiprotein complexes that regulate cell cell contacts, an essential function for morphogenesis and remodeling of tissues and organs (meng and takeichi, 2009). a wide network of proteins and lipids regulates the formation and maintenance of epithelial cell polarity. the first step in the formation of apical basolateral polarity is the formation of cell cell junctions. activation of small rho gtpase family members, leads to cytoskeleton rearrangement and recruitment of structural and regulatory proteins, resulting in the formation of mature tjs and ajs (iden and collard, 2008). junction maturation is coupled to the development of apical basolateral asymmetry in the cell, where the newly formed aj serves as a site for basolateral protein sorting (yeaman., 2004). maintenance of cell polarity and junction integrity involves continuous sensing of external cues such as extracellular matrix content and cell cell contacts. these cues are translated into cellular signals that are received by a regulatory core of three protein complexes : par3/par6/apkc, the crumbs complex (crumbs-3, pals1, and patj), and the scribble complex (scribble, lgl1/2, and dlg1). basolateral polarity (bryant and mostov, 2008 ; iden and collard, 2008). in addition to the asymmetric distribution of key polarity proteins described above, phosphoinositides have emerged as important determinants of membrane identity. these lipids bind to specific protein domains, particularly to those involved in the regulation of the cytoskeleton. in mammalian cells, phosphatidylinositol 4,5-bisphosphate (pip2) is found primarily on the apical surface whereas phosphatidylinositol 3,4,5-trisphosphate (pip3) localizes to the basolateral surface (martin - belmonte and mostov, 2008). the apical basolateral polarity regulation system is increasingly recognized as an important target for pathogens. our understanding of the interactions between pathogens with the mucosal barrier has been greatly aided by the use of epithelial cell lines, such as dog kidney (mdck) cells, calu-3 (a cell line derived from a human adenocarcinoma), and 16hbe (derived from human bronchial epithelial cells) cells that grow as a single confluent monolayer and recapitulate the development of polarized epithelium when grown on porous filter supports (transwells ; mostov., 2005). when grown at high densities under these conditions, the cells can obtain nutrients from the basolateral medium and will form polarized epithelium with distinct apical and basolateral surfaces and functional tjs and ajs within 24 h. with continued culture, cell polarity develops further. furthermore, by using confluent monolayers, it is possible to compare microbe interactions between the apical and basolateral surfaces without having to take into account the effect of increased access to the basolateral surface that occurs in subconfluent cells or in the setting of epithelial injury (kazmierczak., 2001a). finally, some of the epithelial cells, including mdck cells and primary mouse alveolar type ii cells, can be grown as three - dimensional (3d) cysts when cultured on extracellular matrix in which the basolateral surface faces outward (bryant and mostov, 2008). these models may more closely mimic organs ; in addition, they facilitate the examination of interactions of pathogens with the basolateral surface in the absence of the porous filter support (barrila. these reductionist systems provide a platform to analyze host pathogen interactions, which can then be further validated in animal studies. important human mucosal pathogens, including viruses and bacteria, have been shown to directly target components of the polarity regulation network. here neisseria meningitidis, a devastating and common cause of bacterial meningitis, recruits par3/par6/apkc to subvert junctional proteins at the endothelial cell surface. ectopic intercellular junctional domains are formed at the site of binding of microcolonies by subverting an endothelial specific g - protein coupled receptor, the 2-adrenergic receptor, and an associated scaffolding protein, -arrestin (coureuil., 2010). this event leads to depletion of junctional proteins at the cell cell interface and opening of intercellular junctions at the brain endothelial interface, potentially explaining the tropism of this pathogen for the human central nervous system (coureuil., 2009). notably, these events are not observed in epithelial cells, as they appear to require the endothelial specific proteins ve - cadherin and 2-adrenergic receptor. enteropathogenic escherichia coli, a leading cause of diarrhea in children in the third world, induces pip2 and pip3 clustering at the bacterial - induced actin - rich pedestal in mdck cells (sason., 2009 ; smith., caga, the only known helicobacter pylori effector translocated through its type iv secretion system, recruits the tj proteins zo-1 and jam - a to the site of bacterial attachment in polarized mdck cells (amieva., 2003). caga also directly interacts with and inhibits the serine / threonine kinase par-1, causing it to dissociate from the membrane and leading to junction and polarity defects (saadat., 2007). these events may contribute to the h. pylori - induced disorganization of gastric epithelial architecture and subsequent mucosal damage, inflammation, and cancer (saadat., 2007). the disruption of epithelial barrier polarity by caga has also been reported to create a nutrient - rich niche for h. pylori replication at the apical surface, allowing growth of microcolonies directly over the intercellular junctions (tan., 2009). listeria monocytogenes, a gram - positive, food - borne pathogen uses e - cadherin as a binding receptor and as an internalization platform. binding of the bacterial surface protein internalin a to e - cadherin initiates a process of actin rearrangement and aj protein recruitment near the bacterial binding site that stimulates endocytosis and internalization of the bacteria (bonazzi., 2009). several viruses, including adenovirus, -herpes viruses, reoviruses, and hepatitis c target junctional complexes and polarity regulators as well (bergelson, 2009). interactions of various pathogens with polarized cells. the tj (upper) and aj (lower) are indicated by a dashed rectangle. the major components of tjs (claudin, occludin, zo, and jams) and ajs (e - cadherin, b - catenin, and a - catenin) are shown. pi3k, pip3, ship2, and pip2 are recruited by tir (the translocated intimin receptor) to the actin - containing pedestal, along with actin, arp2/3, nck, and n - wasp (not shown). (b) illustrates h. pylori recruiting junctional components, including jams, zo-1, and par (not shown) to form a replicative niche at the ap surface. (c) represents endothelial cells, shows n. meningitidis disrupting intracellular junctions and breaching the blood brain barrier by recruiting components of the tj and the aj (including par-6, apkc, par-3, claudin, zo-5, ve - cadherin, b - catenin, and p-120 catenin) to the site of binding of the bacterial microcolony at the ap surface. the loss of the tj and aj is illustrated by the rectangles with dotted lines. for opportunistic pathogens, of which pseudomonas aeruginosa is an important example, the mucosal barrier represents a formidable challenge to bacterial - mediated damage or entry. however, in the setting of injured or incompletely polarized epithelium, p. aeruginosa can initiate colonization and unleash its arsenal of potent virulence factors, which include the type iii secretion system (t3ss) and its secreted effectors (engel, 2003 ; engel and balachandran, 2009). indeed, this gram - negative pathogen is a leading cause of nosocomial infections in hospitalized patients (mandell., 2010). its predilection for injured tissue explains its propensity to cause ventilator - associated pneumonia, skin infections in burn patients or at the site of surgical incisions, and catheter - related infections, amongst others. p. aeruginosa is also a cause of chronic lung infections and ultimately death in patients with cystic fibrosis (cf ; mandell., 2010). studies of the interaction of p. aeruginosa with polarized epithelium in culture and in vivo show that the degree of polarity significantly affects the final outcome of infection. bacterial - induced host cell cytotoxicity or internalization is enhanced when bacteria are added to cells whose polarity has been altered by various manipulations (fleiszig., 1997, 1998 ; finally, p. aeruginosa preferentially adheres to, enters, and injures wounded epithelium (yamaguchi and yamada, 1991 ; zahm., 1991 ;, 1996a, b, c ; geiser., 2001). in this review, we describe selected recent advances in our understanding of p. aeruginosa interactions with polarized epithelium at each step of the infection process. the primary adhesins for p. aeruginosa binding to epithelial cells include type iv pili (tfp), polarly localized pili that can extend and retract, and flagella, that power swimming motility. for both adhesins, the molecular details of attachment to polarized epithelium remain to be clearly defined (engel, 2007). in recent exciting studies, the role of retractile tfp in adherence of p. aeruginosa (strain pak) to human lung epithelial primary cells grown as pseudostratified epithelium on a porous filter support was further examined (heiniger., 2010). the authors compared infection of the apical surface of the intact pseudostratified epithelium to infection of mechanically injured cells, in which the cells comprising the basolateral layer of the pseudostratified epithelium are exposed. binding to the intact pseudostratified epithelium required tfp but was not dependent upon pilin retraction. in contrast, pilin retraction (powered by the atpase pilt) as well as the surface pilin associated protein pily1, was required to penetrate into the basolateral portions of the monolayer. in the future, it will be of interest to determine whether pily1 can directly bind to eukaryotic cells, whether antibodies directed against pily1 can block this binding, and whether pily1 binds specifically to one or more host cell proteins. (2010) examined the binding and subsequent downstream events during exposure of p. aeruginosa to the apical or basolateral surfaces of epithelial cells grown at various states of polarization. confluent monolayers of mdck and calu-3 cells were plated on transwells and grown for different lengths of time to recapitulate various stages of polarization. these cells were infected with two different p. aeruginosa strains (pa01 and pak) and the role of glycans or heparan sulfate proteoglycans (hspgs) was examined. n - glycans were of special interest because previous work had revealed that mdck cells with defects in cell surface glycosylation were resistant to p. aeruginosa infection, indicating that bacteria might require n - glycans for initial adhesion and subsequent host cell injury (apodaca., indeed, the authors found that n - glycan chains at the apical surface were necessary and sufficient for p. aeruginosa binding, invasion, and cytotoxicity to mdck and calu-3 cells grown at various states of polarization. enhanced expression and/or expression of more complex mannose - containing glycans increased binding, invasion, and cytotoxicity toward well - polarized epithelial cell monolayers, whereas pharmacologic inhibition of n - glycosylation or infection of concanavalin a - resistant mdck cells resulted in decreased binding, invasion, and cytotoxicity. at the basolateral surface, the sulfation of heparan sulfate (hs) chains of hspgs was found to be critical for p. aeruginosa binding, cytotoxicity, and invasion. in incompletely polarized epithelium, hspg abundance was increased at the apical surface, explaining at least in part the increased susceptibility of injured epithelium to p. aeruginosa colonization and damage. using mdck cells grown as 3d cysts as a model for epithelial organs, p. aeruginosa was shown to specifically co - localized with hs - rich areas at the basolateral membrane. p. aeruginosa was also shown to bind hs chains and n - glycans coated onto plastic surfaces, with the highest binding affinity toward hs chains, suggesting that n - glycans and hs may be major regulators of p. aeruginosa binding to apical and basolateral membranes, respectively. together, these findings demonstrate that p. aeruginosa recognizes distinct receptors on the apical and basolateral surface of polarized epithelium. in the future, it will be of interest to examine whether tfp and flagella play different roles in adhesion at the apical versus basolateral surface, whether they display different binding specificities toward n - glycans and hspgs, and whether these specificities are observed in vivo as well. it would also be informative to test whether n - glycosylation or hspgs are upregulated in lungs of cf patients. identifying the specific n - glycosylated apical receptor for p. aeruginosa will be an important step for our understanding of p. aeruginosa pathogenesis. even in the absence of a defined apical receptor, this work suggests that therapies that target both n - glycosylation and hspg synthesis, that compete with binding to n - glycans or hspgs (such as simple sugars or heparin), or that restore polarized segregation of these molecules may be useful adjuncts to more standard antibiotic therapy. pseudomonas aeruginosa binding activates a central host signaling molecule, phosphatidylinositol 3-kinase (pi3k), which is required for the synthesis of pip3 and for activation of a downstream effector, the serine / threonine kinase akt. activation of the pi3k / pip3/akt pathway was shown to be necessary and sufficient for p. aeruginosa entry from the apical surface of polarized epithelial cells (kierbel., 2005a). interestingly, pip3 has recently emerged as a key polarity regulator that serves as a scaffold at the basolateral cytoplasm (di paolo and de camilli, 2006 ; gassama - diagne., 2006). in follow - up studies, kierbel and colleagues (gassama - diagne., 2006 ; have shown that p. aeruginosa subverts the pi3k / pip3/akt pathway to transform a patch of the apical surface into one with basolateral characteristics and to gain entry from the apical surface (figure 2). in polarized monolayers, p. this event leads to a remarkable remodeling of the apical membrane in which protrusions enriched for pip3 and actin form at the apical surface at the site of bacterial binding. notably, no disruption of the tjs could be detected, suggesting that the bacterial - induced rerouting of basolateral markers involved transcytosis rather than diffusion. consistent with this notion, a dominant negative mutant of dynamin also blocked delocalization of basolateral proteins to the bacterial - induced apical protrusion. the end result is that this bacterium transforms apical into basolateral membrane, creating a local microenvironment that facilitates its colonization and entry into to the mucosal barrier. aeruginosa infection : subversion of host cell polarity to transform apical into a basolateral membrane. tj, tight junction ; aj, adherens junction ; tgn, trans - golgi network ; n, nucleus. an aggregate of p. aeruginosa recruits pi3k to the apical surface, generating local production of pip3. bl recycling of proteins is redirected to the ap surface, creating a basolateral environment at the apical surface. (c) an aggregate of p. aeruginosa is internalized into the host cell, possibly at least in part through the transient protrusion. basolateral polarity is highly regulated in epithelial cells, it will be interesting to identify the initial events that lead to protrusion formation. preliminary results suggest that polarity regulators are recruited to the bacterial binding site prior to pi3k (unpublished results). analysis of the dynamics of protrusion formation, determining whether ajs or tjs are formed at the site of aggregate binding, and elucidating the molecular mechanisms by which they are redirected to the apical surface, will be key to understanding pa - induced apical protrusions. for both p. aeruginosa and n. meningitidis, it is possible that a threshold number of bacteria are required to activate this response or that these structures represent a specific host response to a physically large cluster. while bacterial aggregates are observed in stationary phase cultures in the absence of host cells (allesen - holm., 2006), it will be interesting to determine whether they are preformed or whether they form in response to host cells, as suggested by earlier work that described pack - swarming motility (dacheux. finally, comparison of the interactions of the polarized epithelium with single bacteria versus aggregates, the requirement for the major adhesins tfp and flagella, and the role of the t3ss in the formation of protrusions will be of interest to examine. indeed, treatments that inhibit entry, such as inhibitors of pi3k or of the actin cytoskeleton, also inhibit protrusion formation (kierbel., 2005b). alternatively or in addition, protrusion formation may represent a response that could be beneficial to the host. for example, recruitment of basolateral constituents to the apical surface could trigger the innate immune response in a spatially restricted manner. the relationship of the pi3k / akt pathway to other signaling pathways activated upon p. aeruginosa binding and internalization, including translocation of nf - kb to the nucleus and cytokine production, remains to be explored. an important question in the study p. aeruginosa pathogenesis is the fate of the adherent bacteria, whether they be aggregates or single bacterial cells. for chronic infection, such as in lungs of cf patients, p. aeruginosa is thought to grow as biofilms in the thick layer of mucus overlying airway epithelial cells rather than adhering and invading directly into to the airway epithelium (moreau - marquis., 2008). in contrast, during acute infection, bacterial internalization, host cell destruction, and penetration to the basolateral surface are observed (kazmierczak., 2001a). the general trend emerging from these studies is that loss of cell polarity enhances adhesion and favors subsequent downstream events, including cell death, disruption of cell junctions, inhibition of wound repair, and/or bacterial internalization (kazmierczak., 2001a ; garrity - ryan., 2004 ; bucior., 2010), but differences in cell types, infection conditions and in the spectrum of t3ss toxins influences the outcome. for example, exou - secreting strains are associated with rapid host cell death by necrosis ; exos - secreting p. aeruginosa strains lead to slower host cell death with features of apoptosis ; and strains engineered to produce only exot lead to apoptotic cell death by adp ribosylation of crk (alaoui - el - azher., 2006 ; shafikhani. out of the four known p. aeruginosa t3ss effectors proteins, exos and exot are logical candidates for interfering with cellular polarity and disrupting cell junction integrity (engel and balachandran, 2009 ; hauser, 2009). these two highly homologous bifunctional enzymes encode an n - terminal gtpase - activating protein (gap) domain with activity toward rho family gtpases and a c - terminal adp ribosyltransferase domain. the gap domains of both exot and exos inactivate the rhoa family gtpases, ccd42, rac1, and rhoa. the exos adprt domain targets a variety of effectors involved in regulating the actin cytoskeleton, including ras, ral, rabs, and erm proteins, while the adprt domain of exot specifically targets crki and crkii, scaffolding proteins associated with focal adhesions (sun., 2004). recent studies from the prince lab have examined in more detail the effect of t3ss effectors on epithelial barrier function (soong., 2008). human airway cells grown on transwell filters were infected with various informative isogenic mutants of pak, a representative non - exou - producing strain. exos was found to be necessary and sufficient to alter the integrity of tjs in the absence of host cell death, as measured by accessibility to biotin, permeability to small and large molecular weight dextrans, bacterial transmigration, and the absence of ldh release or trypan blue staining under the conditions of the experiments. in pak strains engineered to express only exos, the adprt domain was necessary and sufficient to alter epithelial cell permeability. pak strains expressing exos disrupted zo-1, occludin, and ezrin localization, decreased membrane - associated occludin, and blocked ezrin phosphorylation as would be predicted from adp ribosylation of ezrin. the authors conclude that the adprt domain of exos is sufficient to disrupt epithelial barrier integrity. of note, the exact mechanism it could represent a general cellular response to exos - mediated cell death or to the disruption of the actin cytoskeleton, or it could be a direct consequence of exos on junctional components. an emerging theme in microbial pathogenesis is the recognition that pathogens exploit or disrupt components of the mucosal barrier in order to facilitate colonization, to create a specialized niche for replication where they remain shielded from the host immune response, and/or to disseminate to distant tissues or to new hosts. host cell polarity determinants are logical targets for pathogens, as control of epithelial cell polarity requires constant sensing of external cues. in addition, the signaling nodes emanating from polarity determinants may interface with the host innate immune response, although this connection has just begun to be explored. this review highlights recent advances and suggests future directions in furthering our understanding of how p. aeruginosa exploit the host polarity machinery to establish infection. these studies may lead us to discover new bacterial virulence mechanisms and therapeutic targets against this highly antibiotic resistance pathogen. finally, it will extend our understanding of the initiation and maintenance of epithelial cell polarity, an area important in development, cancer biology, and pathogenesis. the authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest. | the lumenal surfaces of human body are lined by a monolayer of epithelia that together with mucus secreting cells and specialized immune cells form the mucosal barrier. this barrier is one of the most fundamental components of the innate immune system, protecting organisms from the vast environmental microbiota. the mucosal epithelium is comprised of polarized epithelial cells with distinct apical and basolateral surfaces that are defined by unique set of protein and lipid composition and are separated by tight junctions. the apical surface serves as a barrier to the outside world and is specialized for the exchange of materials with the lumen. the basolateral surface is adapted for interaction with other cells and for exchange with the bloodstream. a wide network of proteins and lipids regulates the formation and maintenance of the epithelium polarity. many human pathogens have evolved virulence mechanisms that target this network and interfere with epithelial polarity to enhance binding to the apical surface, enter into cells, and/or cross the mucosal barrier. this review highlights recent advances in our understanding of how pseudomonas aeruginosa, an important opportunistic human pathogen that preferentially infects damaged epithelial tissues, exploits the epithelial cell polarization machinery to enhance infection. |
from march 1997 to 2010, a total of 114 cases of malarplasty with l - shaped osteotomy through intraoral approach were performed, including 103 cases for women and 11 cases for men, with ages ranging from 16 to 48 years, all caused by congenital abnormality or heteroplasia. measurement of the ratio between the facial width and the bony facial width was done after full discussion with the patient. the amount of zygoma to be reduced was calculated using routine x - ray films (water s view, submentovertex view) or facial three - dimensional computed tomographic images. the osteotomy line was drawn on the x - ray films or computed tomographic images. a routine checkup was done and facial pictures were taken (including the frontal view, bilateral profile views, bilateral three - fourth views, and the worms - eye view) before surgery. incision was made on the intraoral region with the mucosa being slightly upward ; then separation of the periosteum was done. subperiosteal elevation was done with periosteal elevator at the maxilla anterior wall, the zygomatic body, and the posterior end of the zygomatic arch. careful attention was paid to the position of the infraorbital foramen so as not to injure the nerves and vessels. the osteotomy line was marked with gentian violet (an l - shaped osteotomy 35 mm in width). we designed the l - shaped osteotomy line as shown in figure 1, with the width of the osteotomy line determining the amount of the osteotomy. a part (approximately 1 cm) of masseteric and the zygomaticus major muscles were detached from the inferior border of the zygoma and the zygomatic process of the maxilla to facilitate the approach to the inner side of the zygomatic arch. at this point, care was taken to minimize the detachment of the zygomaticus major and masseter muscle to prevent postoperative cheek drooping. the posterior end was reached following the inner side of the zygoma between the zygomatic arch and the coronoid - temporalis muscle, and approximately 1 cm of the periosteum was dissected from the bone on both the inner and outer sides of osteotomy point. the saw blade was turned to the outer side approaching the zygomatic tubercle to prevent damage to the muscles and vessels at the inner side. although a blind procedure, the saw blade was stopped when the zygomatic tubercle was reached. during the osteotomy at the zygomatic arch, special attention should be paid to protect the facial nerve at the outer side of the osteotomy point to protect the lateral soft tissue and nerve from accidental injury by the saw blade. the osteotomy was done from the inside out, horizontally within the temporal fossa, with the osteotomy angle being 20 degrees using a reciprocating saw. if the zygomatic arch was extraordinarily wide, the middle portion of the zygomatic arch was notched to cause a greenstick fracture so that the prominent zygomatic arch was corrected. the parallel bone gap was made simultaneously using the specially designed reciprocating saw blade (double - bladed zygoma reciprocating saw blade ; prima, seoul, republic of korea), with 2 saw blades fixed at 3 and 5 mm apart. during the osteotomy, a gauze was put under the zygomatic body to protect the vessels and nerves from damage (fig. design : the view of l - shaped osteotomy of zygomatic body and the zygomatic arch osteotomy line with an angle of 20 degrees horizontally. the width of the l is the width of osteotomy, which determines the reduction of the prominent zygoma after the surgery. a, during the osteotomy from the inside out of the zygomatic arch, the periosteum around the osteotomy line only approximately 1 cm need to be dissected ; the isolation should be conducted outside the zygomatic arch to protect the facial nerve in osteotomy. b, osteotomy on the zygomatic body with the saw blade (3 or 5 mm) : make the bone groove as the osteotomy line and then remove the bone with the straight reciprocating saw. after the osteotomy, the bone fragments were removed and infracture of the zygomatic arch was done. protection of the periosteum of the dissociated part and the soft tissues around the osteotomy line was done to avoid bleeding. if the patient had a fatty cheek, a part of the fat pad was removed after full communication with the patients (fig. both sides of the osteotomy line were put together to push the dissociated malar inside and upward. then, the bone segment was fixated using surgical wire after drilling on both sides of the osteotomy line. osteotomy to the contralateral side was done in the same way, and attention was paid to ensure that the height and width of the zygoma were equal after fixation on both sides. a and b, operative views showing the l - shaped osteotomy area clearly from the incision (after osteotomy). c, bones that were removed and the cheek fat picked out in the operation. measurement of the ratio between the facial width and the bony facial width was done after full discussion with the patient. the amount of zygoma to be reduced was calculated using routine x - ray films (water s view, submentovertex view) or facial three - dimensional computed tomographic images. the osteotomy line was drawn on the x - ray films or computed tomographic images. a routine checkup was done and facial pictures were taken (including the frontal view, bilateral profile views, bilateral three - fourth views, and the worms - eye view) before surgery. incision was made on the intraoral region with the mucosa being slightly upward ; then separation of the periosteum was done. subperiosteal elevation was done with periosteal elevator at the maxilla anterior wall, the zygomatic body, and the posterior end of the zygomatic arch. careful attention was paid to the position of the infraorbital foramen so as not to injure the nerves and vessels. the osteotomy line was marked with gentian violet (an l - shaped osteotomy 35 mm in width). we designed the l - shaped osteotomy line as shown in figure 1, with the width of the osteotomy line determining the amount of the osteotomy. a part (approximately 1 cm) of masseteric and the zygomaticus major muscles were detached from the inferior border of the zygoma and the zygomatic process of the maxilla to facilitate the approach to the inner side of the zygomatic arch. at this point, care was taken to minimize the detachment of the zygomaticus major and masseter muscle to prevent postoperative cheek drooping. the posterior end was reached following the inner side of the zygoma between the zygomatic arch and the coronoid - temporalis muscle, and approximately 1 cm of the periosteum was dissected from the bone on both the inner and outer sides of osteotomy point. the saw blade was turned to the outer side approaching the zygomatic tubercle to prevent damage to the muscles and vessels at the inner side. although a blind procedure, the saw blade was stopped when the zygomatic tubercle was reached. during the osteotomy at the zygomatic arch, special attention should be paid to protect the facial nerve at the outer side of the osteotomy point to protect the lateral soft tissue and nerve from accidental injury by the saw blade. the osteotomy was done from the inside out, horizontally within the temporal fossa, with the osteotomy angle being 20 degrees using a reciprocating saw. if the zygomatic arch was extraordinarily wide, the middle portion of the zygomatic arch was notched to cause a greenstick fracture so that the prominent zygomatic arch was corrected. the parallel bone gap was made simultaneously using the specially designed reciprocating saw blade (double - bladed zygoma reciprocating saw blade ; prima, seoul, republic of korea), with 2 saw blades fixed at 3 and 5 mm apart. during the osteotomy, a gauze was put under the zygomatic body to protect the vessels and nerves from damage (fig. 2). design : the view of l - shaped osteotomy of zygomatic body and the zygomatic arch osteotomy line with an angle of 20 degrees horizontally. the width of the l is the width of osteotomy, which determines the reduction of the prominent zygoma after the surgery. a, during the osteotomy from the inside out of the zygomatic arch, the periosteum around the osteotomy line only approximately 1 cm need to be dissected ; the isolation should be conducted outside the zygomatic arch to protect the facial nerve in osteotomy. b, osteotomy on the zygomatic body with the saw blade (3 or 5 mm) : make the bone groove as the osteotomy line and then remove the bone with the straight reciprocating saw. after the osteotomy, the bone fragments were removed and infracture of the zygomatic arch was done. protection of the periosteum of the dissociated part and the soft tissues around the osteotomy line was done to avoid bleeding. if the patient had a fatty cheek, a part of the fat pad was removed after full communication with the patients (fig. 3). both sides of the osteotomy line were put together to push the dissociated malar inside and upward. then, the bone segment was fixated using surgical wire after drilling on both sides of the osteotomy line. osteotomy to the contralateral side was done in the same way, and attention was paid to ensure that the height and width of the zygoma were equal after fixation on both sides. a and b, operative views showing the l - shaped osteotomy area clearly from the incision (after osteotomy). c, bones that were removed and the cheek fat picked out in the operation. there were a total of 114 patients who received zygoma reduction using this method, and all patients were satisfied with their results. in these cases, 87 cases were bilateral malarplasty with simultaneous bilateral mandible angle reduction, 19 cases were bilateral malarplasty with simultaneous genioplasty, and 8 cases were simple bilateral malarplasty without any other associated operations (table 1). seventy - six patients accepted the l osteotomy and removed a 5-mm fragment, whereas 38 patients cut the fragment on 3 mm. all cases were done bilaterally, with the purpose of each surgery being to achieve beauty in all patients. after the malarplasty, the patients were followed up over 6 months. in all cases, the wounds healed well without any cases of infections. in 3 cases, nonunion at the osteotomy site was seen because of erroneous pressure on the operation site postoperatively in 2 patients and faulty fixation of the bone segment during the operation in 1 patient. in the patient with faulty fixation of the bone segment, skin shading caused by step - off deformity of the zygomatic body was also seen and needed a second surgery to correct it. in the initial period, 2 patients showed cheek drooping because of the wide subperiosteal dissection, and each underwent a midface lifting. in 4 patients, a slight difficulty in mouth opening was seen immediately after the surgery because the osteotomy was made too near the temporomandibular joint, but symptoms improved in 3 or 4 months. one patient complained of temporomandibular joint pain and responded to preventive antibiotics and anti - inflammatory drugs for suspicious capsulitis for 1 week. only 1 patient had slight under - lip and mouth corner numbness but recovered in 6 months. most of the patients showed soft tissue sagging immediately after the operation, and the wrinkles were also deepened. this subsided, however, within 3 or 4 months postoperatively because of wound healing and recovery of soft tissue elasticity (table 2). older patients, patients who have a very prominent zygoma, and patients with severe soft tissue sagging would benefit from this procedure. postoperative complications radiologic findings. a and b, preoperative x - ray films. the prominent zygomatic body and arch can be seen clearly. c and d, postoperative x - ray films. the zygomatic arch was completely reduced and the bone was moved backward, upward, and inward, which led to the reduction of zygomatic body. a 26-year - old woman with osteotomies on the zygomatic body were done using 2 saw blades fixed 5 mm apart. both the patient and the doctor were satisfied with the result in the one - and - a - half year of follow - up period (fig., preoperative view shows that the woman has a seriously prominent zygoma that makes her cheek obviously hollow. below, postoperative view shows that the prominent zygoma is drawn inward and upward after the intraoral approach l - shaped osteotomy for both sides of the malar reduction and that her face looks soft and younger, without deep facial wrinkle caused by the facial drooping. a 44-year - old woman with prominent zygomatic bones and mandibular angles accepted the l - shaped osteotomy zygoma reduction. osteotomies on the zygoma body were done using 2 saw blades fixed 3 mm apart, and the bone fragments were removed. the patient was satisfied with the results, but without the mandibular angle reduction, her prominent mandibular angle makes her facial profile a square shape (fig. 6). a 44-year - old woman with prominent zygoma and mandibular angle for comparison. the comparison of her photograph before and after the surgery shows her corrected malar and natural arc from body to arch. above, preoperative view. her prominent mandibular angle is extraordinarily obvious to make her facial profile a square shape. a 26-year - old woman with congenital bilateral prominent zygoma underwent surgery under general anesthesia. osteotomies on the zygomatic body were done using 2 saw blades fixed 5 mm apart. both the patient and the doctor were satisfied with the result in the one - and - a - half year of follow - up period (fig., preoperative view shows that the woman has a seriously prominent zygoma that makes her cheek obviously hollow. below, postoperative view shows that the prominent zygoma is drawn inward and upward after the intraoral approach l - shaped osteotomy for both sides of the malar reduction and that her face looks soft and younger, without deep facial wrinkle caused by the facial drooping. a 44-year - old woman with prominent zygomatic bones and mandibular angles accepted the l - shaped osteotomy zygoma reduction. osteotomies on the zygoma body were done using 2 saw blades fixed 3 mm apart, and the bone fragments were removed. the patient was satisfied with the results, but without the mandibular angle reduction, her prominent mandibular angle makes her facial profile a square shape (fig. 6). a 44-year - old woman with prominent zygoma and mandibular angle for comparison. the comparison of her photograph before and after the surgery shows her corrected malar and natural arc from body to arch. above, preoperative view. her prominent mandibular angle is extraordinarily obvious to make her facial profile a square shape. the approaches for zygoma reduction can be simply divided into 2 parts : the external approaches (such as the coronal incision, temporopreauricular incision, preauricular incision, etc) and the intraoral approach. the external approaches are endowed with good exposure but followed with visible scars, much bleeding and long operation time. compared with the external approaches, the intraoral approach has no visible scars, little bleeding, and short operation time. it is associated, however, with some problems such as cheek drooping caused by a wide dissection, limited operative exposure in the area of the zygomatic arch, difficult fixation, and the possibility of facial nerve injury. hence, we need to minimize the periosteal dissection, shorten the operative duration, and provide a postoperative elastic facial dressing to avoid the cheek drooping. the intraoral approach has been widely used as the most common method to reach the zygomatic body. however, to reach the posterior end of the zygomatic arch with the purpose of reducing the scar is not so easy. to overcome this defect, we use the method that reaches the posterior end of the zygomatic arch along the medial side of the arch. hence, we are able to reach the zygomatic tubercle safely and simply even in a blind procedure without any nerve injury or serious cheek drooping. the operating methods for malarplasty can mainly fall into the following : the zygoma reduction method with large burr to thin the zygomatic thickness, the infracture through greenstick fracture, and bone cutting. shaving, however, as a single simple method of zygoma reduction, has not overcome the limitations. if the facial protrusion is only caused by the wide and large zygomatic arch, the zygoma reduction can not be fully realized only with burring. furthermore, we can not avoid the cheek drooping if we use the intraoral approach because of the wide subperiosteal dissection. we can also see that, if the greenstick fracture is carried out at the arch, the fragments in operation can only be moved to the inside ; it is impossible to move backward or upward or downward. to get the best effect from surgery, it is necessary to move the protruding part of the zygoma to the inside, upward, and backward. the zygoma reduction result of this method depends on the amount of the bone cutting. this facilitates the adjustment of the zygoma reduction and the movement of the fragments so that the best operating effect can be ensured through the best positioning. (the position of the osteotomy line and the moving direction of the protruding malar can be determined during the presurgery assessment.) there are 2 designs of osteotomy for the zygomatic body : i - shaped osteotomy and l - shaped osteotomy. baek described an i - shaped osteotomy by removal of the malar complex and contouring of the bone with replacement as a free bone graft. although it is effective to reduce the facial width, the operation is hard to control and the bone graft has a high possibility to be absorbed. meanwhile, the shape of the osteotomy line makes it easy for bone fragment displacement and the pulling of the masseter muscle will move the fragment downward. the l - shaped osteotomy can avoid the fragment displacement because the fragment is only removed between 2 l - shaped cuttings but from the inferior border so that, after osteotomy, if we fixate both sides of the osteotomy line, the masseter muscle can not drag the fragment downward because of the countercheck of the inferior border. that is why we did not have cheek drooping cases in our follow - up period that still can be seen in other s reports. another operative method using an intraoral approach has been reported, but this method also required extensive subperiosteal dissection from the upper intraoral incision to the posterior area of the arch to approach the lateral aspect of the arch. theoretically, facial nerve injury is possible during this procedure. our method can solve this problem because we do zygoma reduction with l - shaped osteotomy by approaching the arch osteotomy point through the medial side. with our method, we do not require subperiosteal dissection because the osteotomy of the arch is from the inside out within the temporal fossa. the horizontal cutting angle can only push the fragment inside, and it may cause the result to be less effective. we do osteotomy at the zygomatic arch using a new horizontal osteotomy with the reciprocating saw. our method provides for the perfect movement of the fragment, making our horizontal osteotomy the most effective method. we can move the fragment backward and inside because we cut the arch horizontally with an angle of 20 degrees. another important thing that one needs to pay attention to is the height proportion of the zygoma and the mandibular angle. if the mandibular angle is not wide and large, the malarplasty alone can provide the adjustment to the facial profile ; however, if the zygoma is protruding and the mandible angle is prominent simultaneously, the malarplasty alone may lead to a more obvious angle of the mandible. therefore, for this kind of patient, the zygoma osteotomy should be synchronized with the mandibular angle reduction to satisfactorily improve the facial profile in one step and avoid the need for a second operation to adjust. among the 114 cases of malarplasty mentioned previously, 87 of them received simultaneous mandible angle reduction, covering approximately 76 % of all the patients to sum up, using this method of an intraoral approach and l - shaped osteotomy with fixation can protect the nerves from damage during the operation and will leave no scars on the skin or the scalp. also, especially important is the 20 degrees to horizontal angle from the inside to the outside osteotomy that can make the dissociated bone be easily moved inward and upward. this means the structure can be adjusted on the basis of the patients unique requirements that can lead to a perfect result after the operation. as a safe and effective method, it can reduce the incision, lower the surgery risk, mitigate patient pain, and shorten the operation time. | backgroundbecause of the various defects of malarplasty, including a large incision, much bleeding, visible scars after the operation, and so on, caused by the conventional coronal incision or the temporal incision with the intraoral incision approach, the malarplasty by simple intraoral approach is an innovative development.methodsthrough the intraoral approach and subperiosteal dissection, we can reach the osteotomy point on the zygomatic body directly and arrive at the osteotomy point at the zygomatic arch end along the medial side of the zygoma. a new l osteotomy is applied with the reciprocating saw. in addition, the osteotomy was performed on the zygomatic arch from the inside out with an angle of 20 degrees horizontally.resultsfrom 1997 to 2010, we were satisfied with the results of 114 cases of malarplasty with the intraoral approach and l osteotomy as the observed objects. there are 103 cases for women and 11 for men. ages ranged from 16 to 48 years. the mean operation time is approximately 1 hour. we just had a few complications : 3 nonunion at the osteotomy line and needed a second surgery to repair as well as 2 slight cheek drooping during the initial period and required face lifting.conclusionsthe method of intraoral approach and l - shaped osteotomy for zygoma reduction can reduce prominent zygoma while maintaining the natural curves of the zygomatic body and arch. because of the simple procedures, fewer complications, and excellent results, this method will be considered a relatively desirable way.level of evidencetherapeutic, iii. |
this study aims to determine the frequency of opthalmyomyiasis externa and the ocular findings of disease in southern khorasan. all patients referred to the emergency department of valiaser hospital during the year 2011 with external ophthalmomyiasis were enrolled in this study. the diagnosis of external ophthalmomyiasis was made according to clinical findings and the presence of oestrus ovis larvae. there were 18 cases of external ophthalmomyiasis in the emergency department of valiaser hospital in 2011. most cases had the common signs and symptoms of allergic conjunctivitis, except for three males who were referred with respective complaints of red eye, foreign body sensation, and swelling around the eyelids after contact injury the previous day ; corneal infiltration was present in three cases. the visual acuity among the three cases that had peripheral corneal involvement was 20 / 30 in both eyes. the bulbar conjunctiva showed chemosis in all cases and a ropy pattern discharge that was clinically compatible with external ophthalmomyiasis. however, in one case, microscopic slit lamp examination did not show oestrus ovis larvae. although external ophthalmomyiasis usually manifests as allergic conjunctivitis, coronary - like corneal infiltration may be considered in the differential diagnosis of external ophthalmomyiasis or toxic insult. all patients referring to the emergency department of the main general hospital with red eye during the year 2011 were enrolled in this study. the clinical findings were recorded in a questionnaire sheet that was prepared for this reason. an external ophthalmomyiasis diagnosis was made according to clinical findings (foreign body sensation, lids edema, conjunctival congestion and watering eye, chimosis, and ruppy pattern discharge) and the presence of oestrus ovis larvae. topical anesthetic drops were used to remove the larva with a plain fine forceps, and topical steroid and antibiotic drops were prescribed for five days thereafter. the frequency of external ophthalmomyiasis in valiaser hospital 's emergency department during the year 2011 was 18 cases (table 1). all the cases occurred in males who had jobs as farmers or who lived in a rural area. all cases included a history of traveling to desert places or an environment with sheep six to 24 hours earlier, and all patients reported something striking their eye. most patients had the signs of allergic conjunctivitis shown in table 1, including conjunctival injection along with foreign body sensation, ropy pattern discharge, chemosis, periorbital lid edema, pseudomembrane and corneal infiltration. there was not a remarkable change in visual acuity during or after removal of the larvae. three cases (75-, 59-, and 60-year - old residents) from rural areas referred to the emergency department at valiaser hospital reported that their foreign body sensation began immediately after exposure, and that tap water irrigation of their eyes did not relieve the discomfort. overnight they experienced lid edema, epiphora, and the sensation that the foreign body was moving around their eye. the visual acuity did not change much, with a clear central cornea without intraocular inflammation. the visual acuity among these three cases with peripheral corneal involvement ranged from 20 / 20 to 20 / 30 in both eyes. after initial treatment, one patient no longer experienced the sensation of a moving foreign body ; however, the other patients ' symptoms and signs were not relived after two days of treatment (figs. 1 and 2). no larva was found on the external surface of eyeball due to late referral in one case, but the external ophthalmomyiasis was characteristic. 3 and 4 showed the larva in the eye of one patient and corneal involvement in the other two cases. the clinical presentation of external ophthalmomyasis is similar to viral or allergic conjunctivitis, with tearing, itching, hyperemia, and foreign - body sensation. keratouveitis has been reported after conjunctivitis ; however, there are a few cases of corneal involvement consisting of diffuse corneal edema, linear subepithelial corneal opacities and endothelial keratic precipitates. this survey is the first ophthalmomyiasis report in the eastern area of iran that was associated with well - defined signs such as red eye, conjunctival chemosis, and a ropy pattern discharge. circumlimbal coronary - shape corneal infiltration is the specific finding in this report that we were not able to find in previous literature, except for a similar finding on conjunctiva as a gelatinous superior limbal conjunctival elevation with overlying fine white plaques (tanas dots) in vernal limbitis. the other finding of our study is the frequency and similarity of unilateral conjunctivitis without intraocular involvement as described by masoodi and hosseini from the fars province in southern iran. the symptoms began while the affected individual was outdoors during the daytime, after the sense of something striking their eye. none of the patients had a history of allergic reactions. also, the first symptoms of foreign body sensation and itching in the eye appeared abruptly in all cases, unlikely related to other possible insults or causes. however, whether these corneal involvements are a result of direct mechanical insult or a toxic reaction is still uncertain and requires future study. if it has spread to the interior of the eye (ophthalmomyiasis interna), the resulting uveitis and endophthalmitis may require aggressive treatment such as vitrectomy and intra vitreal instillation of antibiotics, especially in cases where the visual prognosis remains poor. this report encourages ophthalmologists to suspect external ophthalmomyiasis in people living outdoors and in rural places. the high frequency of external ophthalmomyiasis without intraocular involvement was another interesting finding of our study. the most probable reason that larvae did not invade the intraocular space in this survey may be related to early access to the medical department for the removal of larva. the other possible hypothesis is that this lack of intraocular involvement could be due to the type of masques or number of larval infestations. a coronary pattern of corneal infiltration is the first report of an additional clinical finding in external ophthalmomyiasis, especially in patients with a history of an object striking the eye and in patients who reside in a rural location. awareness of ophthalmomyiasis amongst ophthalmologists working in rural areas is important for the timely diagnosis and treatment of this infestation. a thorough examination of the eye under magnification and prompt removal of the larvae could obviate the disastrous complications of internal ophthalmomyiasis. limiting the exposure to adult flies and exterminating the flies will play a major role in preventing the disease. | purposethis study aims to determine the frequency of opthalmyomyiasis externa and the ocular findings of disease in southern khorasan.methodsall patients referred to the emergency department of valiaser hospital during the year 2011 with external ophthalmomyiasis were enrolled in this study. the diagnosis of external ophthalmomyiasis was made according to clinical findings and the presence of oestrus ovis larvae.resultsthere were 18 cases of external ophthalmomyiasis in the emergency department of valiaser hospital in 2011. most cases had the common signs and symptoms of allergic conjunctivitis, except for three males who were referred with respective complaints of red eye, foreign body sensation, and swelling around the eyelids after contact injury the previous day ; corneal infiltration was present in three cases. the visual acuity among the three cases that had peripheral corneal involvement was 20 / 30 in both eyes. the bulbar conjunctiva showed chemosis in all cases and a ropy pattern discharge that was clinically compatible with external ophthalmomyiasis. however, in one case, microscopic slit lamp examination did not show oestrus ovis larvae.conclusionsthe frequency of external ophthalmomyiasis was high in this region. although external ophthalmomyiasis usually manifests as allergic conjunctivitis, coronary - like corneal infiltration may be considered in the differential diagnosis of external ophthalmomyiasis or toxic insult. |
mononuclear cell recruitment, one of the hallmarks of allograft rejection 12, is thought, conceptually, to follow the now classic sequence of leukocyte rolling along vascular endothelium, followed by stimulus - dependent attachment, triggering and transmigration, and directed migration along a chemotactic gradient 3. however, the chemokine - dependent phase of leukocyte recruitment, especially the mechanisms leading to graft infiltration by host t cells, which are key to allograft rejection, is still the least understood, with little in vivo data available 4. indeed, in contrast to most other areas of medicine, knowledge of the involvement of chemokine pathways is somewhat better established in humans than in experimental animals due to a paucity of appropriate tools for in vivo studies, leading to insufficient mechanistic and interventional studies 56. our preliminary data 7 from the blinded molecular and immunohistologic evaluation of endomyocardial biopsies from patients with cardiac allografts showed that acute rejection was associated with intragraft expression of cxc chemokine receptor 3 (cxcr3 [8, 9 ]) and its ligands, which include ifn-inducible protein of 10 kd (ip-10 ; reference 10), monokine induced by ifn- (mig [11, 12 ]), and ifn - inducible t cell chemoattractant (i - tac [9, 13 ]). these clinical findings have led to our serial analysis of intragraft chemokine and chemokine receptor expression using mhc fully mismatched mouse cardiac allografts, including expression of cxcr3 and its ligands during cardiac rejection. our studies demonstrate that compared with control cxcr3 mice, cxcr3 mice show significantly delayed, or in some cases an absence of, acute or chronic rejection, and that anti - cxcr3 mab can reverse the course of developing rejection such that targeting of cxcr3 may prove to be of clinical therapeutic significance. a mouse 129 genomic library (genome systems) was screened with mouse cxcr3 cdna 14. a 13-kb genomic fragment containing exon 2 of the gene was used to construct the targeting vector ; a 2.5-kb hindiii and xbali fragment was deleted and replaced by pgk - neo. the targeted vector was linearized and electroporated into esi-1 embryonic stem cells (genome systems). chimeric males were bred to balb / c females to yield germline transmission of the targeted allele. mice used in this study were backcrossed at least six generations onto the c57bl/6 strain. cardiac allografting (15 ; n = 10/group) was performed using balb / c (h-2) donors and fully mhc - mismatched c57bl/6 (h-2) recipients ; b6 mice were cxcr3 (f6) versus littermate or commercial cxcr3 mice (the jackson laboratory). cyclosporine a (csa ; sigma - aldrich) was dissolved in olive oil and administered daily (10 mg / kg intraperitoneally), and mab therapy, using reagents described below, involved intraperitoneal injection of 500 g every second day ; in each case, therapy was begun at transplantation and stopped at 14 d after transplant. in additional experiments, the effects of mab administration beginning at day 4 after transplant were also tested. mouse mabs (bd pharmingen [16, 17 ]), plus quantitative morphometry 15. preparation and use of the cxcr3 probe for in situ hybridization was performed as described 15. spleen cells were stimulated with con a and cultured in il-2 for 812 d to generate cxcr3 t cell blasts 8 for use in chemotaxis and flow cytometry studies 18. northern blot analyses of t cells and t cell clones used cd3 mab activated spleen cells supplemented with il-12 plus anti northern blots and rnase protection assays for cytokines, chemokines, and their receptors (bd pharmingen) were undertaken, with normalization to glyceraldehyde 3-phosphate dehydrogenase (gapdh) or l32 genes 1518. mouse cxcr3 mab (4c4, igm) was generated by immunization with cxcr3 l1.2 cell transfectants, detection of binding to transfectants by flow cytometry, and screening for inhibition of chemotaxis of transfectants and t cell blasts to mouse recombinant cxcr3 ligands, as described 18. a mouse 129 genomic library (genome systems) was screened with mouse cxcr3 cdna 14. a 13-kb genomic fragment containing exon 2 of the gene was used to construct the targeting vector ; a 2.5-kb hindiii and xbali fragment was deleted and replaced by pgk - neo. the targeted vector was linearized and electroporated into esi-1 embryonic stem cells (genome systems). chimeric males were bred to balb / c females to yield germline transmission of the targeted allele. mice used in this study were backcrossed at least six generations onto the c57bl/6 strain. cardiac allografting (15 ; n = 10/group) was performed using balb / c (h-2) donors and fully mhc - mismatched c57bl/6 (h-2) recipients ; b6 mice were cxcr3 (f6) versus littermate or commercial cxcr3 mice (the jackson laboratory). cyclosporine a (csa ; sigma - aldrich) was dissolved in olive oil and administered daily (10 mg / kg intraperitoneally), and mab therapy, using reagents described below, involved intraperitoneal injection of 500 g every second day ; in each case, therapy was begun at transplantation and stopped at 14 d after transplant. in additional experiments, the effects of mab administration beginning at day 4 after transplant were also tested. infiltrating cells were detected by immunoperoxidase staining of cryostat sections with rat anti mouse mabs (bd pharmingen [16, 17 ]), plus quantitative morphometry 15. preparation and use of the cxcr3 probe for in situ hybridization was performed as described 15. spleen cells were stimulated with con a and cultured in il-2 for 812 d to generate cxcr3 t cell blasts 8 for use in chemotaxis and flow cytometry studies 18. northern blot analyses of t cells and t cell clones used cd3 mab activated spleen cells supplemented with il-12 plus anti northern blots and rnase protection assays for cytokines, chemokines, and their receptors (bd pharmingen) were undertaken, with normalization to glyceraldehyde 3-phosphate dehydrogenase (gapdh) or l32 genes 1518. mouse cxcr3 mab (4c4, igm) was generated by immunization with cxcr3 l1.2 cell transfectants, detection of binding to transfectants by flow cytometry, and screening for inhibition of chemotaxis of transfectants and t cell blasts to mouse recombinant cxcr3 ligands, as described 18. as allograft rejection is a t lymphocyte dependent event 2, we undertook northern blot analysis of cxcr3 expression by primary t cells and t cell clones in culture, and assessed cxcr3 involvement in allograft rejection in vivo. freshly isolated mouse splenocytes lacked cxcr3 expression, but upon activation and culture in conditions that promote th cell differentiation, th1 cells expressed cxcr3 mrna (fig. 1 a). established th1 clones (pl17 and of6), but not th2 clones (cdc35 and d10), also expressed cxcr3 mrna (fig. heterotopic cardiac allografts in the fully mhc - mismatched balb / c to c57bl/6 combination survive 78 d 17. rnase protection assays showed that normal hearts and isografts lacked cxcr3 mrna, whereas allografts showed progressive cxcr3 mrna expression, peaking at day 6 after transplant, just before end - stage rejection (fig. cxcr3 mrna expression closely followed intragraft mrna levels of the three known cxcr3 ligands ip-10, mig, and i - tac, plus ifn- (fig. expression of cxcr3 mrna was localized to infiltrating leukocytes by in situ hybridization (fig. 1 d), and cxcr3 mononuclear cell infiltration was confirmed by immunohistology (fig these results show that activated t cells, especially th1 cells, express cxcr3 and infiltrate cardiac allografts in conjunction with graft expression of the ligands ip-10, mig, and i - tac 19. to establish the role of cxcr3 expression in allograft rejection, we used homologous recombination to disrupt exon 2 of the x chromosome linked 20 cxcr3 gene (fig. mice heterologous and homozygous for the cxcr3 mutation were normal in appearance, growth, and fertility. cxcr3 deficiency was transmitted in a mendelian fashion, as identified by southern blot analysis of tail dna (fig. t cell blasts from homozygous cxcr3-deficient (cxcr3) mice lacked cxcr3 protein expression (fig. 2 c), and failed to respond in chemotaxis assays to ip-10 (fig. 2 d) or mig, indicating that cxcr3 is the sole functional receptor for these chemokines. with relevance to subsequent in vivo studies, t cell blasts from cxcr3 but not cxcr3 mice were also labeled using the cxcr3-specific mab (fig. the addition of anti - cxcr3 mab reduced the mlr of wild - type mice (fig. 3 c), but had no effect on mitogen responses (data not shown). whereas cxcr3 mice rejected balb / c cardiac allografts within 1 wk, cxcr3 mice accepted corresponding allografts for a mean of 58 3 d (p 100 d, p < 0.001) in cxcr3 mice (fig. 3 d) ; evaluation of the latter allografts harvested at day 100 after transplant showed normal morphology, with a lack of graft leukocyte infiltration, myocardial injury, or evidence of transplant arteriosclerosis (data not shown). use of the cxcr3 mab in cxcr3 mice significantly prolonged allograft survival when used from the time of transplantation, and was also effective when commenced once rejection had begun, i.e., at day 4 after transplant (fig. these findings demonstrate a profound effect of targeting cxcr3 on the development of cardiac allograft rejection. histologic analysis of allografts harvested at day 5 after transplant showed that in contrast to control grafts, grafts in cxcr3 or cxcr3 mab had significantly reduced numbers of cd4 and cd8 t cells and macrophages, and no il-2r (cd25) cells indicative of immune activation (fig. 4 e). allografts in cxcr3 recipients contained decreased ifn- mrna (fig. 4 f), and decreased expression of the chemokines macrophage inflammatory protein (mip)-1 and regulated upon activation, normal t cell expressed and secreted (rantes ; fig. consistent with the latter findings, allografts in cxcr3 mice showed decreased expression of the corresponding chemokine receptors ccr1, ccr2, and ccr5, produced by t cells and macrophages (fig. 4 h). in conclusion, this effect is associated with significantly decreased intragraft accumulation of activated t cells producing ifn- and consequent impairment of chemokine - dependent recruitment of multiple effector cell types, suggesting a rationale for targeting of cxcr3, in synergy with conventional immunosuppression, in clinical transplantation, and potentially in the management of acute allograft rejection. | chemokines provide signals for activation and recruitment of effector cells into sites of inflammation, acting via specific g protein coupled receptors. however, in vitro data demonstrating the presence of multiple ligands for a given chemokine receptor, and often multiple receptors for a given chemokine, have led to concerns of biologic redundancy. here we show that acute cardiac allograft rejection is accompanied by progressive intragraft production of the chemokines interferon (ifn)-inducible protein of 10 kd (ip-10), monokine induced by ifn- (mig), and ifn - inducible t cell chemoattractant (i - tac), and by infiltration of activated t cells bearing the corresponding chemokine receptor, cxcr3. we used three in vivo models to demonstrate a role for cxcr3 in the development of transplant rejection. first, cxcr3-deficient (cxcr3/) mice showed profound resistance to development of acute allograft rejection. second, cxcr3/ allograft recipients treated with a brief, subtherapeutic course of cyclosporin a maintained their allografts permanently and without evidence of chronic rejection. third, cxcr+/+ mice treated with an anti - cxcr3 monoclonal antibody showed prolongation of allograft survival, even if begun after the onset of rejection. taken in conjunction with our findings of cxcr3 expression in rejecting human cardiac allografts, we conclude that cxcr3 plays a key role in t cell activation, recruitment, and allograft destruction. |
an expert consultation organized by the world health organization in 2005 made an inventory of available research on births spacing. the experts recommended an interpregnancy interval (ipi) of at least 6 months after a miscarriage before attempting a next pregnancy, in order to reduce morbidity and mortality risks for mother, fetus, and newborn. an ipi of at least 24 months was recommended after a live birth, corresponding to a birth interval of at least 33 months. the consultation team also concluded that future research is needed on the mechanisms underlying the relation between interval length and pregnancy outcomes. more studies using datasets from both rich and poor countries could contribute to more in - depth knowledge. contradicting results of research on the effect of short intervals on the risk of adverse pregnancy outcomes [16 ] conducted after 2005 confirmed the relevance of these statements. the few studies on the effect of intervals after a previous pregnancy disruption show a large variation by country. davanzo and colleagues emphasized that studies on the effects of interpregnancy intervals should take into account the outcome of the previous pregnancy. our study contributes to the debate on pregnancy loss and interpregnancy intervals (ipis) in line with these recommendations. we focus on the effect of the duration of the ipi on pregnancy losses by combining the effect of the interval duration and the type of previous pregnancy outcome (pregnancy loss, live births that survived infancy or died in the first year), and controlling for important confounders. in this study, the term pregnancy loss includes all pregnancy outcomes (spontaneous and induced abortion, fetal death, and stillbirth) opposite to a live birth. fetal loss has got limited attention compared to other issues, neither in the field of reproductive health nor in development debates among policy makers, nor in debates among scholars in population studies. this lack of attention is regrettable, because for many women the loss of a pregnancy is an emotional experience which affects their subsequent reproductive health and behavior. fetal loss and stillbirths constitute the majority of the world 's perinatal deaths and, yet, the absence of easy accessible and reliable secondary data on pregnancy loss is mentioned as a reason for neglecting the topic of fetal deaths by scientists [7, 8 ]. reducing adverse pregnancy outcomes contributes to the health of the mother. contrary to the reduction of maternal morbidity and of infant mortality, reducing pregnancy loss is not a policy objective but should become so in the future. the outcome of our analysis will be discussed in the framework of results of a few [1, 4, 7, 911 ] available studies that followed the same approach by including the ipi duration and the previous pregnancy outcome to estimate the risk of a pregnancy loss. the majority of these studies focus on the effect of ipi duration on adverse pregnancy outcomes after a previous spontaneous or induced abortion while only a few have a broader perspective and include also other prior pregnancy outcomes (see table 4). the studies differ on essential points, such as various types of mothers in the sample, nulliparous or multiparous women ; various types of adverse pregnancy outcomes, pregnancy loss, preterm births, and low birth weight ; reference group ; categories of ipi ; data collection method ; and geographical region, which could contribute to explain the variety in the findings. only two studies, one from the usa and the other from latin america, did not find significant associations between ipi duration and a fetal or neonatal death after a spontaneous or induced abortion [7, 9 ]. the other studies do find an association between ipi duration and adverse maternal and pregnancy outcomes after a previous fetal loss, but the associations between ipi duration and recurrent pregnancy losses are weak or nonexistent for late fetal deaths (stillbirths) [911 ]. some results from usa and scotland are even the opposite of what is expected on the who recommendations after early fetal deaths (miscarriages) [5, 6 ]. they find that, after a previous early fetal loss, short ipi intervals are associated with a higher likelihood on a live birth compared to longer ipis. for bangladesh, no differences between these likelihoods were found after a fetal loss according to ipi length except after very long ipi (> 74 months). however, the studies [10, 11 ] that focus on the association between ipi duration and the risk of a fetal death (and other adverse pregnancy outcomes) show higher risks of an adverse outcome after a fetal loss and a short ipi relative to a previous live birth combined with a healthy ipi. the meta - analyses included many countries from all over the world and consequently examples with good and poor health care systems. a study on sweden, a country with an advanced medical health care system, however, stated that risks are only found for long intervals and that the impact of short intervals may have been overestimated in other studies. from all those studies, we learn that it is important to include the outcome of the previous pregnancy in the analysis and to focus on several previous pregnancy outcomes when analyzing the effect of short ipis on fetal losses. therefore, we will follow this approach in our analysis about pregnancy loss in rwanda. since 2000, rwanda is experiencing a steady economic growth and after 2005 a rapid demographic and health transition [13, 14 ] thanks to the extension of access to reproductive health facilities. the health service infrastructure, which was badly damaged during the civil war of the ninety - nineties, has been rebuilt to a large extent. at local level, community health centers are established and more than 45,000 community health care workers, male and female, have been trained to provide basic medical care and drugs and to give information on health matters. the number of qualified medical staffs increased yet is still insufficient according to international standards : one medical doctor and one professional midwife per 16,500 and 23,400 inhabitants, respectively. the government improved access to community health care also by introducing a community based insurance system. today, more than 90% of the population participates in these mutuelles de sant health mutualities which give access to community level health services and, with additional payment, to a package of extra health care at district hospitals. this percentage of more than 90% explains an impressive increase in access to health care, given the fact that this percentage was only 7% in 2003. the prenatal checks and the costs of a normal delivery assisted by a nurse or midwife are covered by the basic health insurance schemes but exclude the 200 rwf per visit to a health center. yet, the health - seeking behavior among pregnant women still needs improvement although, according to the 2010 demographic and health survey (dhs), less than two percent of the women did not have any antenatal medical test before the delivery. however, only 35 percent of them went for four antenatal checks, as recommended by the who. most pregnant women got their first medical examination in the second trimester of their pregnancy and some even later [1619 ]. the demographic and health survey (dhs) is an internationally recognized data collection method that provides current and reliable data based on a national representative sample. data from three successive rwanda demographic and health surveys (rdhs 2000, rdhs 2005, and rdhs 2010) were merged in this study to analyze the last pregnancy outcome of women within the dhs calendar periods of five years preceding the moment of interview. pregnancies and pregnancy outcomes that occurred in the eight months before the month of the interview were not included in our analysis to be sure that all pregnancies in the analysis had the same probability of ending in a pregnancy termination or a live birth after nine months. to identify the moment of the start of the last pregnancy, we used the detailed recording in the calendar of the dhs, which gives the pregnancy status for each month over a period of 59 months before the month of the interview. the nature and timing of the previous event the exact months of all births, deaths, and pregnancy terminations are recorded in the dhs. the duration of the ipi is measured by subtracting the date of the previous pregnancy outcome from the date of the start of the last pregnancy. the month of the previous outcome is registered at any time before the start of the last pregnancy. in total, 21532 women had at least one pregnancy outcome in the three reduced calendar periods before 2000, 2005, and 2010 ; for 3631 women, it was their first pregnancy (primigravida) ; for the other 17901 women, we calculated the date and type of the previous pregnancy outcome. in case of a long interpregnancy interval, the dhs datasets enable the calculation of the exact date (in terms of month and year) of the events in the reproductive history of women in the sample if one combines answers to various questions in the questionnaire. we constructed century month codes (cmc), the number of months elapsed since january 1900, of the pregnancy outcomes (pregnancy loss, infant death, and live birth) reported by the mothers to calculate the ipis. in case of a live birth as last pregnancy outcome, the pregnancy was supposed to start 9 months before the cmc of the birth. in case of a fetal loss as last pregnancy outcome, the mother did report the duration of the pregnancy in months. data from retrospective studies, like the demographic and health surveys, are biased by errors due to memory lapses as the respondents have to report the number and date of the events in the past. this is in particular the case when one asks for matters as pregnancy losses and induced abortions. early pregnancy losses may not be noted or easily forgotten and induced abortions may not be reported as these are illegal in many societies. by focusing on the two last pregnancies of which the last one (and in many cases the previous as well) occurred during the calendar period, we reduced the risk of memory errors. for our analysis, we calibrated a binary logistic regression model using the statistical package stata 12. the dependent variable is the outcome of the last pregnancy (fetal loss coded as 1, live birth coded as 0). we checked whether a distinction between early and late losses gave different results, but this turned out not to be the case. to construct a more powerful model we defined the two main independent variables : length of the interpregnancy interval and previous pregnancy outcome as follows. interpregnancy intervals (ipi) were calculated as the time between the outcome of the previous pregnancy that ended either in a pregnancy loss or live birth and the last conception. short intervals are defined as shorter than 4 months or 4 up to 12 months after a previous pregnancy loss and shorter than 1 year or between 1 and 2 years after a live birth. a healthy interval after a live we categorized the live births of the previous pregnancy in two groups : infants that survived the first year of their life or infants that did not survive. the reason behind this categorization relates to the maternal depletion hypothesis and the quick return of the ovulation combined with the replacement strategy. in regard to the maternal depletion, the idea is to test whether a surviving breastfed infant will increase the depletion of maternal resources and therefore affect the survival of the next pregnancy that is conceived after a short ipi. secondly, the death of the previous infant might be related to an unhealthy physiological status of the mother and the wish to quickly replace the infant, thus shortening the ipi. subsequently, we constructed variables to represent the interaction between those two main independent variables in which we used different classifications for the ipi duration after the previous pregnancy outcomes. we tested for several confounding factors but, in the final model, included only four control variables that turned out to be of significance. the first is the inevitable biodemographic control variable age of the mother at conception which is an indicator for her physiological condition at the start of and during her pregnancy. we specified mother 's age as a categorical variable to allow for nonlinear effects as we will focus on broad age categories and compare young (below the age of 21) and especially older mothers (over the age of 35) with women of a more optimal reproductive age. age refers to the reproductive condition that contributes to a healthy pregnancy and the birth of a healthy infant. in particular, we want to test if older mothers have higher pregnancy loss risks compared to younger ones. question v228 of the dhs women 's questionnaire asks the responding woman whether, at the time she became pregnant for the last pregnancy, she wished to become pregnant, she wished to wait until later, or she did not want to have any more children at all. response categories included the following : wanting pregnancy then, wanting pregnancy later, wanting no more children, or unknown / vague answer. the latter category is used as a proxy for intended pregnancy losses together with the third included variable : place of residence that distinguishes between urban and rural residence. the available dataset does not make a distinction between induced and spontaneous pregnancy losses, which is an omission seen in the different relations between the two types of abortions at the beginning of the ipi, length of the ipi, and pregnancy outcome found in other researches. however, we expect that rwandan women will not easily indicate that they had an induced abortion as it is illegal, except when the physical health of the mother is in great danger. the study of basinga and colleagues estimated the rate of induced abortion in rwanda in 2009 between 18 and 31 per 1,000 women in the 1544-year - old group. their study also revealed that the induced abortion rate was remarkably higher in the capital city kigali compared to the situation in the provinces. in most african rural settings, induced abortion remains a taboo and social control in communities that watch over virginity as a core value, the reason why in particular rural women support legalization of abortion less compared to urban women.. stated that in the early nineties induced abortion did not occur traditionally in this country. for that reason, we expected that in case this situation changed during the last two decades abortions will be chiefly an urban phenomenon. we tried to control for it by including place of residence (urban versus rural) in the analysis. the percentages of unknown / vague answers in our dataset were, respectively, 27.9 and 23.6 for urban and rural women. finally, we included the year of the interview to check for changes over time in reproductive health : notably, the extent of the possible reduction of fetal mortality. the results presented in table 1 illustrate that many rwandan women still have to deal with pregnancy losses, the death of an infant, and unwanted pregnancies : 36 out of 1000 last pregnancies in our sample population ended in a pregnancy loss. among the women with at least two pregnancies, 15 percent mourned a fatal outcome of the previous pregnancy : five percent had a pregnancy loss and nearly ten percent got a child that died in infancy. the results indicate also that the percentages of pregnancies ending in a pregnancy loss are the highest after an ipi shorter than 24 months that started after a pregnancy loss. higher percentages of pregnancy loss than the mean of 3.6 per cent were found after a live - born infant that died in its infancy and an ipi of more than two years and after a surviving live birth and a very long ipi (> 60 months). the descriptive statistics in table 1 show a modest decline of the rate of fetal losses during the period under study. for the three consecutive research periods, the rate of pregnancy loss diminished from 41 out of 1000 pregnancies (19962000) to 36 (20012005) and finally to 33 in the most recent period 20062010. it is difficult to assess if the total number of reported pregnancy losses in the three dhss used in this study, 36 per 1000 pregnancies, is in line with expectations or not. the frequency fits within an indication given in medical literature that states that the number of fetal losses in the month after conception is high but that after a gestation of 8 weeks the loss is about 3 percent. this could mean that women in rwanda did not mention losses that occurred in the first one or two months of a pregnancy, when they were not fully aware of being pregnant. the early pregnancy losses reported in the dhs are probably underestimated as in poor countries the number of stillbirths (after a gestation of 28 weeks) is higher compared to that of rich countries and the stillbirth rate in countries in the central part of sub - saharan africa varies between 25 and 40 or more per 1000 births. with women who were pregnant for the first time reported the highest percentage of wanted pregnancies (nearly 60%, see table 2). of all last pregnancies by the other women, only 40 percent were wanted at that time, while more than a third were unwanted or the mother gave an unclear answer (or answer not known). the cross tabulation presented in table 2 shows that after a pregnancy loss or the loss of an infant a large portion of the women want to replace this loss. very low numbers of wanted pregnancies are found among women who became pregnant within two years after the birth of the previous child that survived the first year of its life. those two groups of women had liked to become pregnant later in time (indicated by 40 and 31%, resp.). a large portion of the women became pregnant again before the recommended time (by who) for recovery was over. from the women whose previous pregnancy ended with a fetal loss, 43 percent were expecting a child again within half a year. for women who had a live - born child that died afterwards in infancy, 71 percent were pregnant again within two years after the last delivery, which could point at a replacement effect or at a lack of protection against pregnancy. for women whose child survived the first year of its life, this percentage was much lower (47%). this group of women is probably temporarily subfecund due to a longer amenorrhea period caused by lactation. the constant (table 3) reflects the risk of a pregnancy loss for the reference category : rural women in 2000, in age category of 2135 years at the time of the last conception, whose last pregnancy was wanted and started after a healthy ipi (2559 months), and whose previous pregnancy resulted in a child that survived its infancy. the estimate of the risk of experiencing a pregnancy termination for these women is very low (2%). the other variables exp() give the odds ratios for women in the categories that deviate from the reference category. linking the risk of a pregnancy termination with both the outcome of the previous pregnancy and the length of the ipi (interaction variables) shows significant deviations from the risk estimated for the reference group : all except one point at a higher risk. the highest odds are found for women who became pregnant shortly after a previous pregnancy loss. women who conceived again within 3 months after the previous pregnancy loss are 3.68 times more likely to lose the next pregnancy than the reference group with a healthy interval. the odds ratio is 2.648 for those that waited 412 months and even women who waited 1214 months were almost twice as likely to lose the next pregnancy. women with an ipi of more than two years after a previous fetal loss had a lower risk compared to the reference group, but the association is not significant. the higher odds of pregnancy loss for all groups with a previous pregnancy loss suggest that some women are prone to repeated losses, regardless of ipi duration. repeated or recurrent pregnancy loss is phenomenon that puzzles medical experts like gynecologist already for decades and that is probably associated with more than genetic factors of the woman alone [25, 26 ]. after a live birth, regardless of whether the newborn survived its infancy or not, the likelihood of a pregnancy loss after an ipi considered as unhealthy (< 2 years) is not higher compared to the reference group with a recommended ipi duration. for the mother that became pregnant within, respectively, one to two years after the previous birth, the signs of the coefficients are negative but only significant for women whose infant stayed alive and conceived within one year. any pregnancy after a live birth seems to prepare for a successful next pregnancy, regardless of the interpregnancy interval. this mechanism vanishes after some years, as an ipi of more than 5 years results in a substantial higher likelihood of a pregnancy loss (1.6 times more likely). the risk of a pregnancy loss for mothers who are pregnant for the first time is of the same magnitude (1.5 times more likely). the physiological regression hypothesis states that after a very long ipi the body of a women has lost the beneficial physiological adaptations in her reproductive system that occur after a pregnancy [10, 12 ]. this is reflected in the higher likelihood of a pregnancy loss (2.3 times more likely) for women who were older than 35 years when they became pregnant. the positive coefficients found for urban women and for women who gave a vague answer or did not answer the question on whether they wanted the last pregnancy could point at the occurrence of induced pregnancy terminations. as induced abortions are prohibited and a taboo, women who had an illegal abortion will probably answer evasively when asked for their pregnancy timing. the higher risk of pregnancy losses among urban women in our sample fits in with research findings by basinga and colleagues who calculated that induced abortions occur more frequently in the capital city of kigali compared to other regions of rwanda. the finding that women who explicitly declared that the last pregnancy was not wanted have a significant lower risk of losing the next pregnancy gives food for thought. maybe these are highly fecund women who become pregnant easily and therefore more often unwanted, and who do not encounter pregnancy problems. we remark that the likelihood of a pregnancy termination decreased significantly between 2000 and 2010. for 2005, the sign of the coefficient () is negative, but the decrease is not significant. in 2010, however, the decrease is significant. further analyses, not shown here, showed that this decrease pertained to late pregnancy loss only. this may be seen as an indication that improved health - seeking behaviour among pregnant women in particular during the second half of their pregnancy contributed to less pregnancy losses. the first important result of our analyses is that one needs to take the previous pregnancy outcome into account when estimating the effects of ipis on the risk of a pregnancy loss. the second main finding is that negative outcomes (in terms of a higher risk of recurrent pregnancy loss) were found for ipis up to 24 months after a prior pregnancy loss, a period four times as long as the recommended healthy ipi of only 6 months. in contrast, an ipi shorter than 2 years after a live birth does not seem to increase significantly the risk of a pregnancy loss. we are aware that a pregnancy loss is not the only possible adverse pregnancy outcome. shorter ipis than two years after a live birth do not give higher risks of a pregnancy loss, but they will affect other pregnancy outcomes such as preterm birth, low birth weight, low apgar scores, and a higher neonatal death. we found clear indications for negative effects of the replacement mechanism after the loss of a pregnancy. the replacement wish after a fetal death leads to shorter ipis and therefore to a higher risk of another pregnancy loss. finally, the results of our study confirm the physiological regression hypothesis : a higher risk of a fetal death when ipis are longer than 5 years. also older women have a higher likelihood of a pregnancy loss compared to younger ones. our results are partially in line with the ones from davanzo and colleagues in bangladesh [1, 11 ] based also on a general sample of women with all types of prior pregnancy outcomes. to avoid a higher risk of a next miscarriage or stillbirth also in bangladesh, women should wait longer than the recommended 6 months (up to 15 months) to become pregnant again after a former pregnancy loss. the researchers found a significant increased risk of a pregnancy loss after a live birth and an ipi < 6 months. for longer ipi durations up to 74 months after a live birth, no significant higher risks of a pregnancy loss were found. based on the results of this study on bangladesh and ours on rwanda, one could conclude that, in societies without an advanced health care system, the who recommendations concerning spacing after a fetal loss still count. workers in the health care system should advise women, even if they are eager to become pregnant again, to take actions to prevent a quick new pregnancy and wait even longer than a year to become pregnant again. the improvements in the rwandan health care system between 2000 and 2010 and in particular the increased access to this system contributed to a lower pregnancy loss frequency. probably, the increased antenatal checks during the last pregnancy period had an impact, as the significant decrease in pregnancy losses between 2000 and 2010 resulted in particular in fewer late fetal losses (after a pregnancy duration of 20 weeks). with a policy that recommends to women an ipi of at least a year to two years after a fetal death and more early pregnancy visits to the community health facility, a decrease in an early fetal death | in 2005, a who consultation meeting on pregnancy intervals recommended a minimum interval of 6 months after a pregnancy disruption and an interval of two years after a live birth before attempting another pregnancy. since then, studies have found contradictory evidence on the effect of shorter intervals after a pregnancy disruption. a binary regression analysis on 21532 last pregnancy outcomes from the 2000, 2005, and 2010 rwanda demographic and health surveys was done to assess the combined effects of the preceding pregnancy outcome and the interpregnancy intervals (ipis) on fetal mortality in rwanda. risks of pregnancy loss are higher for primigravida and for mothers who lost the previous pregnancy and conceived again within 24 months. after a live birth, interpregnancy intervals less than two years do not increase the risk of a pregnancy loss. this study also confirms higher risks of fetal death when ipis are beyond 5 years. an ipi of longer than 12 months after a fetal death is recommended in rwanda. particular attention needs to be directed to postpregnancy abortion care and family planning programs geared to spacing pregnancies should also include spacing after a fetal death. |
the study was approved by the emory university institutional review board and used data from 1,573 adults in the sigt study, described previously (5). briefly, this study recruited participants without known diabetes between january 2005 and march 2008. the participants first visits were at different times of the day, without an overnight fast. rcg and rpg were measured, a 50-g glucose drink was given, and gctcap and gctpl glucose levels were measured 1 h later. at a second visit, a1c was measured and a 75-g oral glucose tolerance test (ogtt) was begun before 11:00 a.m., after an overnight fast. diabetes included fasting glucose 126 mg / dl (7 mmol / l) or 2-h ogtt glucose 200 mg / dl (11.1 mmol / l) ; a1c 6.5% (48 mmol / mol) was included in sensitivity analyses. our definition of prediabetes110 included the following : ifg110, which is fasting glucose 110125 mg / dl (6.16.9 mmol / l) and 2-h ogtt glucose 55 years ; bmi 35 kg / m ; waist circumference with cut - offs of 55 years ; bmi 35 kg / m ; waist circumference with cut - offs of 55 years, bmi > 35 kg / m, or systolic blood pressure 130 mmhg compared with 1019% in the corresponding lower - risk groups. baseline characteristics of 1,573 participants from the sigt study the health system cost components and overall assessment for screening (and 3 years of treatment) for dysglycemia110 are shown in supplementary table 1. these health system costs and the differences in health system costs for screening versus no screening are shown by risk group for each screening test in table 2 and fig. 1 ; in these analyses, negative cost differences for screening versus no screening indicate projected net cost - savings. the relative cost - savings of screening versus no screening would be greater (more negative) for the higher - risk groups for every risk group assessed (p 35 kg / m (p 35 kg / m (p 35 kg / m or elevated blood pressure, with 11% savings compared with no screening. in contrast, societal costs for screening and treatment of diabetes (supplementary table 10) would produce broader cost - savings in both high - risk and lower - risk groups. when we included a1c 6.5% (48 mmol / mol) in our definition of diabetes, we identified 10 additional participants with diabetes in this cohort ; however, the total number of participants with dysglycemia110 did not change. screening the higher - risk groups for diabetes continued to be significantly more cost - saving compared with no screening and compared with screening the equivalent low - risk group. for example, screening with gctpl for those with an elevated blood pressure versus those without an elevated blood pressure resulted in cost - savings of 37.5 versus 2.5%, respectively (p 35 kg / m or elevated blood pressure, with 11% savings compared with no screening. in contrast, societal costs for screening and treatment of diabetes (supplementary table 10) would produce broader cost - savings in both high - risk and lower - risk groups. our previous analyses demonstrated that screening the sigt study population for either diabetes or dysglycemia110 would be cost - saving from a health system perspective over a 3-year horizon (4). we now show that the majority of cost - savings would come from screening individuals with higher risk, based on any one of the characteristics of age, bmi, triglycerides, hdl cholesterol, waist circumference, systolic blood pressure, or family history of diabetes. in most of the higher - risk groups, however, the greatest cost - savings would be attained with screening of individuals with bmi > 35 kg / m or systolic blood pressure 130 mmhg. of the five screening tests considered, the gctpl appears to be the least expensive screening test in most higher - risk groups. higher - risk groups would have higher costs associated with no screening. because these groups have a higher prevalence of diabetes and dysglycemia110, failure to screen would result in more patients with missed diagnoses, with associated increases in downstream treatment costs. and as the costs of no screening increase, greater cost - savings can be obtained with a more accurate test, i.e., gctpl compared with rcg (supplementary fig. one review concluded that it would be very cost - effective to screen for diabetes using current american diabetes association guidelines among african americans 4554 years of age (16). another study examined screening with fasting plasma glucose on the basis of age or blood pressure or both and found that it would be more cost - effective to screen at 3045 years of age than at older age, and even more cost - effective to screen beginning at 30 years of age in people with hypertension (2). two other studies found that targeted screening for diabetes with fasting or rcg based on hypertension, and for prediabetes based on obesity, would be more cost - effective compared with universal screening (17,18), but those studies also did not consider other risk factors or other screening tests. whether screening should target prediabetes as well as diabetes also has been debated. most analyses have found that it should be cost - effective to screen for and treat prediabetes to reduce both the risk of cardiovascular disease and progression to diabetes (1820). our study confirms that even over a 3-year time period, it should be cost - saving to screen for and treat dysglycemia110 (prediabetes110 as well as diabetes), particularly among higher - risk groups. the study participants were volunteers, which might have resulted in selection bias from disproportionate participation of those at high risk. however, the prevalence of prediabetes and diabetes in the study population was similar to or lower than that in recent national surveys, such as nhanes 20052006 (21). although we did gather information regarding risk of diabetes, information on history of gestational diabetes was not collected or used as a risk factor in our analyses. we also did not calculate costs associated with screening for either dysglycemia110 or diabetes with a fasting glucose alone. whereas a fasting glucose may be considered an acceptable test for patients who do not mind fasting before a visit, many cases of postchallenge dysglycemia would be missed, leading to a higher number of false - negative results and higher overall costs. our analyses rely on estimates of testing, treatment, and false - negative result costs, which may not be applicable to every health system. our estimates for the cost of false - negative results (that 10% of projected incremental 3-year medical costs of diabetes or dysglycemia110 could be reduced with detection and management) might be excessive. however, we project that cost - savings still could be achieved in higher - risk groups with a false - negative result cost of at least 5%, which was achieved in the tightly controlled environment of the dpp study (8). some groups have found the cost of undiagnosed diabetes and prediabetes to be lower than the costs we used in our analyses, but it is still to be determined how much of these costs could be reduced with detection and management (22,23). we are not aware of other sources for the costs of false - negative results. in sensitivity analyses addressing costs associated with lifestyle changes as treatment for dysglycemia110 or diabetes, we based our costs on group - based interventions designed by the dpp study. more recent studies have found that community - based interventions based on the dpp protocol could be performed with reduced costs. these studies generally have found that treatment with lifestyle interventions are cost - effective in the long - term (2426) and possibly even are cost - saving in the short - term (26). finally, our cost estimates projected a 3-year time period. such a period might be relevant to employer - based health systems in which insurers are changed every few years, but lifetime cost analyses would be needed to determine if the cost - savings found in higher - risk groups are likely to be sustained. our findings show that screening and treatment for diabetes and dysglycemia110 should be cost - saving from a health system perspective in people with any single risk factor for these conditions. this likely is a large proportion of the united states adult population, because at least one such risk factor was present in 98% of our study subjects and in 96% of adult african american and white participants in nhanes 20052006. we also found that the greatest cost - savings likely would be attained with screening of individuals with bmi > 35 kg / m, systolic blood pressure 130 mmhg, or age > 55 years. the gctpl, previously shown to have the greatest accuracy for detection of diabetes or dysglycemia110, appears to be the least expensive screening test in most higher - risk groups and should be considered for use in clinical practice. | objectivealthough screening for diabetes and prediabetes is recommended, it is not clear how best or whom to screen. we therefore compared the economics of screening according to baseline risk.research design and methodsfive screening tests were performed in 1,573 adults without known diabetes random plasma / capillary glucose, plasma / capillary glucose 1 h after 50-g oral glucose (any time, without previous fast, plasma glucose 1 h after a 50-g oral glucose challenge [gctpl]/capillary glucose 1 h after a 50-g oral glucose challenge [gctcap ]), and a1c and a definitive 75-g oral glucose tolerance test. costs of screening included the following : costs of testing (screen plus oral glucose tolerance test, if screen is positive) ; costs for false - negative results ; and costs of treatment of true - positive results with metformin, all over the course of 3 years. we compared costs for no screening, screening everyone for diabetes or high - risk prediabetes, and screening those with risk factors based on age, bmi, blood pressure, waist circumference, lipids, or family history of diabetes.resultscompared with no screening, cost - savings would be obtained largely from screening those at higher risk, including those with bmi > 35 kg / m2, systolic blood pressure 130 mmhg, or age > 55 years, with differences of up to 46% of health system costs for screening for diabetes and 21% for screening for dysglycemia110, respectively (all p 35 kg / m2, systolic blood pressure 130 mmhg, or age > 55 years, for whom screening can be most cost - saving. gctpl is generally the least expensive test in high - risk groups and should be considered for routine use as an opportunistic screen in these groups. |
parasites are eukaryotic pathogens, and broadly comprise protozoa, fungi, helminths and arthropods (figure 1) that complete part or all of their life cycle within a host organism. like other pathogens they succeed in this through a great diversity of strategies for avoiding immune detection, suppressing cellular immunity and deflecting immune attack mechanisms. it has been suggested that the need to overcome suppressive mechanisms of parasites may have led to compensatory adjustments in immune genes that, in an environment where parasitic infection is not endemic, may increase the likelihood of inappropriate responsiveness to self - antigens (autoimmunity) and environmental allergens (allergy). two recent papers, from jackson. and fumagalli. an ectoparasite (a louse of mice) has recently been found to exert similar immunomodulatory effects to those associated with gastrointestinal helminth infection in a wild wood mouse population. shown are, clockwise from top left, leishmania mexicana protozoal promastigotes (l. prieto - lafuente) ; candida albicans (from) ; ixodes hexagonus (from wikipedia) ; and heligmosomoides polygyrus adult nematode worms (c finney). the first line of defense against parasites, as with other pathogens, is the innate immune system, which is ' hardwired ' (faithful to genomic sequence) and primed even in the absence of infection. serum proteins and intracellular and cell - surface receptors known as pattern recognition receptors (prrs) that recognize generic molecular structures associated with different groups of pathogens. among other actions, these receptors mobilize macrophages and granulocytes, unleashing antimicrobial proteins and reactive metabolites. they also mobilize dendritic cells, which activate the lymphocytes of the adaptive immune system, inducing proliferation of t cells and antibody - producing b cells with variable receptors that specifically recognize the parasite. the canonical pattern - recognition receptor of the innate immune system is the cell surface toll - like receptor-4 (tlr-4), which binds to the cell wall lipopolysaccharide (lps) of gram - negative bacteria. detailed phylogenetic analysis of the tlr family indicates strong conservation of sequence and function, but there is significant fine - detail polymorphism across the tlr - related pathway within the human population, linked to differences in immune responsiveness to bacterial infection it is most likely that they are maintained by variations in tlr ligands among pathogens. but while the function of the innate receptors is to activate immediate reactions to microbial infection, some eukaryotic parasites can negatively signal through the same receptors, suggesting a complex trade - off for the host, resulting in selection of both ligand - binding and signaling variants which would resist pathogen repression. innate immunity alone seldom eliminates successful parasites, but it inhibits growth while recruiting the antigen - specific t and b cells of the adaptive immune system to proliferate and differentiate into effector cells competent to attack the infection. it is therefore the evasion of adaptive immunity that is indispensable to parasite survival, and for rapidly proliferating protozoa an effective evasion strategy is antigenic variation, in which the expression of distinct surface molecules allows new variants to escape immune recognition, quickly replacing those killed by the adaptive immune system. this type of antigenic variation is not an option for the more long - lived helminth parasites, which survive as individual organisms for months or years. for these creatures, a more subtle but no less effective stratagem has been to directly down - modulate the intensity and efficacy of host immune responses. it has been well established, for example, that patients carrying chronic schistosome or filarial infections lose the ability to mount parasite - specific t cell responses. this unresponsiveness has been attributed to parasite stimulation of endogenous host immunosuppressive controls both in humans and animal models. the best - understood of these suppressive systems is the regulatory t cell (treg), a cellular safety catch on the immune response that normally blocks autoimmunity and reactivity to food antigens and allergens. indeed, infection with the mouse gut nematode heligmosomoides polygyrus stimulates tregs that are able broadly to suppress responses to allergens. in a recent study on ' real - world ' infections, wild wood mice (apodemus sylvaticus) infected with h. polygyrus were found to mount diminished cytokine responses following tlr stimulation, consistent with the broader immunosuppression seen in laboratory models. by targeting innate immune responses, the parasite is also reducing cytokine - based stimulation of the adaptive immune system. moreover, similar effects were exerted by ectoparasites, in particular the louse polyplax serrata. this is the first evidence of systemic down - regulation by arthropod parasites, raising the question of whether ectoparasite infestation could be an important environmental factor in human immune responsiveness. the need to resist down - regulation of tlr signaling by parasites may explain why some alleles of tlr4 and its co - receptor cd14 are associated with the development of allergic asthma. immune system genes are exceptionally polymorphic, reflecting in part selection by diverse and rapidly varying pathogens, but also the need to balance effective pathogen elimination against the risk of self - destructive reactions. this is well recognized for polymorphisms affecting the structural domains of proteins that function in pathogen recognition. the effect of parasites, for example, has been to dampen, rather than fully ablate, immune responsiveness, and the degree of immunosuppression varies markedly between pathogen species. these graduated effects may, in turn, have driven quantitative polymorphisms in the contemporary immune system that control the strength of the immune response, exemplified by nucleotide variation in regions controlling expression levels rather than variations in amino acid sequence in structural domains (figure 2). schematic diagram of the polymorphic elements in immune responsiveness and where pathogen immunomodulation has driven evolution. in black bold type are the immune system families that have diversified primarily at the level of receptor - ligand specificities ; those loci in red italic type are loci encoding cytokines, transcriptional regulators and cell surface molecules that are generally polymorphic in promoter, intronic and 3 ' utr sequences suggesting a regulatory or quantitative effect of polymorphism. loci above the bifurcation generally determine t cell activation, and those below down - regulation, although the distinction is blurred : for example, il-2 promotes both effector t cell proliferation and treg survival. clr, c - type lectin receptors, which recognize conserved glycans of pathogens ; nlr, nod - like receptors, intracellular receptors that recognize pathogen products ; tlr, toll - like receptors, which recognize conserved molecular ligands from pathogens ; mhc, major histocompatibility molecules, which bind peptide fragments of pathogen proteins and display them for recognition by t cells ; tcr, t cell receptor, the highly variable receptor through which t cells recognize their targets. this may be the explanation for the link between pathogen richness (number of diverse species) and host genetic diversity that has recently been documented in a report on cytokine gene polymorphism by fumagalli.. in an analysis of nearly 100 human interleukin genes, they found the highest single nucleotide polymorphism (snp) frequencies in geographical areas with the highest number of endemic helminth species ; those loci showing greatest variability included some encoding cytokines controlling both innate immune responses (such as the il-1 family) and adaptive th2 responses (such as il-4 and il-4r). strikingly (in terms of the hygiene hypothesis) 6 out of 9 alleles known to predispose to inflammatory bowel disease (an immunopathology due to reactivity with commensal bacteria) were more frequent in pathogen - rich locations. earlier studies have linked noncoding polymorphisms in immune gene variants previously identified as asthma predisposition loci with resistance to parasitic helminths. for example, the il-13 promoter allele -1055 t increases risk of asthma, but decreases schistosome egg load ; similarly, non - coding variants of the transcriptional regulator stat-6, which is on the il-4 pathway, are associated with higher asthma incidence and decreased susceptibility to the roundworm ascaris. most snps associated with both helminth resistance and predisposition to allergy appear to be in non - coding regulatory regions (promoters, intronic regions or 3 ' untranslated regions (utrs)), although some structural allelisms are known (for example, in il-4r). this suggests that, in the main, parasite - maintained polymorphisms control the intensity of an immune response (or indeed, the strength of a suppressive treg effect). such ' allelic rheostats ' are also known in autoimmunity - associated loci : for example, in one cohort of systemic lupus erythromatosus patients, the frequency of circulating tregs was depressed in those carrying a disease - associated 3 ' utr snp allele of ctla-4, a surface molecule of t cells that acts as a brake on t cell activation. as with tlr polymorphisms, the presence of allelic forms for many adaptive immune system genes (in particular, at treg - associated loci) suggests that there is no certain genetic optimum and that, in an environment with diverse pathogens demanding conflicting response patterns, the fine - tuning effect of multiple allelic variants allows the immune system to be variably calibrated across the population. in the absence of infection, and where genotypes tend to the higher end of reactivity (for example, where they result in low treg frequencies), the immune response is more likely to overshoot, and responses may develop to innocuous targets such as self - antigens and allergens. although the hygiene hypothesis is couched in very general terms, there is strong evidence that specific gene - environment (and more specifically, gene - parasite) interactions can contribute to the development of damaging immune reactions in autoimmunity and allergy. the identification of precise genetic variants controlling both parasite susceptibility and immunopathology offers the possibility of pinpointing mechanisms that require inhibition or amplification for treatment of disease, identifying genotypes that may be exceptionally susceptible to either infection or pathology, and a deeper understanding of the intimate co - evolution of pathogens and the immune system. the author 's research is supported by grants from the wellcome trust, the medical research council and the european commission contract inco - ct-2006 - 032436. | parasites are accomplished evaders of host immunity. their evasion strategies have shaped every facet of the immune system, driving diversity within gene families and immune gene polymorphisms within populations. new studies published recently in bmc biology and journal of experimental medicine document parasite - associated immunosuppression in natural populations and suggest that host genetic variants favoring resistance to parasites may be detrimental in the absence of infection. |
xenon anesthesia allows a fast recovery of cognitive functions and provides cerebral protective effects in experimental models [2, 3 ] these advantages suggest that xenon may be an attractive alternative to the various techniques of general or regional anesthesia [5, 6 ] usually proposed during carotid surgery. measurement of frontal cortex cerebral oxygen saturation (srco2) can allow and indirect evaluation of the cerebral perfusion quality. reported a good correlation between the modifications of srco2 during the clamping and the modifications of other techniques of monitoring such as the transcranial doppler. a decline of more than 12% of srco2 or an absolute value lower than 55%, is predictive of cerebral ischemia (detected by electroencephalogram (eeg) or somaesthetic evoked potentials) or of modifications of the transcranial doppler or the stump pressure which can incite the use of a shunt. this protocol was approved by our research ethics board and patients were enrolled after their informed consent was obtained. a preliminary study estimated at 60% the number of operated patients presenting a decrease below 55% of srco2 during carotid clamping under conventional general anesthesia. in order to observe a decrease of two third in the number of patients developing a decrease below 55%, with risks alfa = 5% and beta = 10%, 68 patients had to be included in the study. patients with uncontrolled hypertension, and/or severe chronic obstructive pulmonary disease (copd), and/or hypoxemia at rest, were excluded. treatments taken chronically by the patients, were continued or not, according to the latest french guidelines : continuation of cardiovascular treatments except angiotensin - converting - enzyme inhibitor andor angiotensin ii receptor antagonist (aiir1a) which were discontinued 48 hours before surgery, continuation of antidiabetic agents except metformin. treatment by clopidogrel was stopped 8 days before surgery and replaced by aspirin if necessary and except for specific indication. for all patients, monitoring included an invasive measure of blood pressure, monitoring of pulsed pressure index (vpp, philips medical systems, eindhoven, the netherlands), bispectral analysis of the eeg (bis aspect, covidien, elancourt, france) and srco2 (nirs, covidien, elancourt, france). bis sensor was positioned on the opposite side of the operated carotid, and nirs sensor was positioned on operated carotid side. all patients initially received propofol (schnider model) and remifentanil (minto model) via a target controlled infusion (tci) (primea, fresenius - vial, brezins, france) and cisatracurium. ventilation parameters included a positive end - expiratory pressure (peep) at 5 mmhg and a fio2 at 35% with a closed circuit. patients were then divided into 2 groups according to the drug administered for the maintenance of anesthesia : in control group, anesthesia was maintained with tci propofol and remifentanil;in xenon group, anesthesia was maintained with xenon (target inspired concentration of 60%) and tci remifentanil. in control group, anesthesia was maintained with tci propofol and remifentanil ; in xenon group, anesthesia was maintained with xenon (target inspired concentration of 60%) and tci remifentanil. patients in the xenon group were the ones scheduled for surgery in the operative theater equipped with the xenon anesthesia system (taema flix dual, air liquide sant international, paris, france). postoperative analgesia was initiated 30 minutes before skin closure and included paracetamol 1 g and morphine 0.05mg / kg. maintenance of anesthesia was stopped at the end of skin closure in both groups of patients, anesthesia was conducted with the following objectives : hemodynamic stability with the smallest variation possible in systolic blood pressure compared with preoperative value. in case of hypotension (decreased of more than 20% in comparison with preoperative value lasting more than 3 minutes) associated with a high vpp index, patients received a volume expansion (hydroxyethylstarch (he s) 130/0.4 voluven, fresenius - kabi, brezins, france). in case of low vpp index, patients received ephedrine using titration;bis was maintained between 40 and 50 ; trachea was extubated at the end of surgery in patients free of neurological defect. hemodynamic stability with the smallest variation possible in systolic blood pressure compared with preoperative value. in case of hypotension (decreased of more than 20% in comparison with preoperative value lasting more than 3 minutes) associated with a high vpp index, patients received a volume expansion (hydroxyethylstarch (he s) 130/0.4 voluven, fresenius - kabi, brezins, france). in case of low vpp index, patients received ephedrine using titration ; bis was maintained between 40 and 50 ; trachea was extubated at the end of surgery in patients free of neurological defect. cerebral oxymetry was continuously recorded, but was not taken into account in a decision - making algorithm. srco2 data were analyzed after the end of patients enrollment. per routine, and at the discretion of the surgeon, a shunt was performed prior to the carotid clamping in case of a controlateral carotid occlusion andor a non functional circle of willis. an angiogram was performed to assess the success of the carotid endarterectomy after the release of a cross - clamp. in patients with a blood pressure higher than 180 mmhg after the carotid artery has been declamped, systolic blood pressure was maintained below 160 mmhg, heart rate below 80 b / min, using nicardipine andor atenolol and/or administration of pre existing chronic treatments as needed. an electrocardiography (ecg) was performed at recovery and on postoperative day 1 and day 2. a measurement of cardiac troponin i (ctni) was systematically done 6 hours after the end of surgery, and on postoperative day 1 and day 3. the purpose of this study was to compare the effects of xenon on srco2 with those of propofol using tci. the secondary endpoints were awaking delay, postoperative adverse events, and cardiovascular follow - up until the patient was discharged from the hospital. statistical analysis between srco2, automatically recorded during procedures, statistical analysis included a student s t test for continuous variables, or a chi square test for ordinal variables. demographics data, american society of anesthesiologists score (asa) physical status, chronic treatments and intraoperative data were not different between the 2 groups (table 1). demographic and perioperative characteristics. at clamping, a decrease of srco2 below 55% was less frequently observed in the xenon group (7/37 patients vs 15/37 ; p=0.01) (table 2). arterial blood pressure, heart rate and cerebral oxygen saturation in the xenon and in the control group. decrease in srco2 at clamping was significantly less important in xenon group (average variation : 1211% vs 1714%, p=0.04). after anesthesia induction, no hypotension was noted in patients treated with xenon, while this observation was almost constant with propofol and remifentanil tci. systolic blood pressure (14313 vs 14315 mmhg), petco2 (322 vs 313 mmhg) and bis values (395 vs 4310) were identical in the two groups during carotid clamping. the same level of blood pressure during cross - clamping was obtained with less volume expansion (850240 vs 1020315 ml, p<0.01) and a smaller dose of ephedrine (911 mg vs 1618 mg, p=0.04) in xenon group (tables 2 - 4). reduction in cerebral oxygen saturation, hemodynamic data, drugs and volume requirements in the xenon and control group. heart rate was significantly lower during all the procedure in the xenon group (5510 vs 6514 at clamping, p<0.01) (table 3).all the patients in the xenon group were awakened and trachea was extubated in the operating room (table 5). in comparison, eleven patients in the control group were extubated after a 10 to 50 minutes delay (timing started after remifentanil administration was stopped, and when the effect - site concentration reached 0.5 ng / ml). three patients in the control group developed excitement or disorders of consciousness, all of which resolved within the first postoperative hour. four patients presented a neurological transient stroke (contra lateral hemi paresis), all regressive within one hour (3 in the xenon group, 1 in the control group). one patient in the control group presented a worsening of a previous cognitive disorder (table 5). as shown in the table 6, no correlation seems to exist between these neurological abnormalities and the symptomatic characteristics of the operated lesion, the use of a shunt, and srco2. clinical characteristics of patients with postoperative transient ischemic attack (n=4) or other postoperative neurologic abnormalities (n=4). the main result of the study is that xenon anesthesia is associated to a smaller decrease in srco2 during carotid clamping and that a decrease below 55% was less frequently observed in the xenon group. these results add to the experimental literature showing a cerebral protective effect of xenon anesthesia. after induction of general anesthesia, the usual hypotension is related to the well described vasodilator effect of the conventional agents such as propofol. in patients undergoing vascular surgery, the hypotension is exacerbated by chronic hypertension and use of chronic antihypertensive treatments. xenon use was associated with higher systolic and mean blood pressures after carotid declamping and at the end of surgery (table 2). even if the hypertension is partially artificial and partially related to the administration of vasoactive agents, it is necessary to remember that this increase is quasi - constant, appears in the first 2 or 3 minutes following carotid cross - clamping, and is due to a baroreceptor reflex stimulation [16, 17 ]. with xenon, the pressure profile is quite different, with a later and more important rise of blood pressure, requiring in some patients an increase of remifentanil concentration, or administration of nicardipine. this hypertension with xenon was previously described as frequent, and its mechanism needs to be clarified. a sympathetic activation can not be a definitive explanation because a bradycardia (50 to 60 b / min) was always associated to the operation. xenon- induced hypertension may confound the clinician s understanding of the depth of anesthesia and therefore some sort of cerebral function monitoring indicative of the depth of anesthesia should be employed. another hemodynamic observation was a stable bradycardia observed even in patients not treated with a b - blocking agent. this phenomenon can not be related to the increase in remifentanil concentrations as it appeared previously. we did not consider as an objective of this study the incidence of postoperative neurological events because they are rare (near 1%) in patients scheduled for carotid surgery. moreover, mortality and morbidity are both extremely low within all skilled teams, and, so far, no agent or technique of anesthesia has demonstrated its superiority in decreasing them. although cerebral neurological accidents occurring during carotid surgery are largely related to thromboembolisms (atheromatous, clot or gaseous) which arise before the clamping or after the removal of an arterial clamp, a postoperative stroke can also arise in a situation of poor cerebral perfusion during clamping, more frequently observed in case of occlusion of the contra lateral carotid, or of discontinuity of the circle of willis. the main measurement of this study was the variation of srco2, a non - invasive but relevant parameter of the cerebral perfusion. amongst all the monitoring systems available, most of them used for several years, none is perfect. transcranial doppler is unfeasible for anatomical reasons in up to 20% of the patients, eeg and monitoring of the somaesthetic potential can have a poor sensitivity andor a poor specificity, while they are perturbed by agents of anesthesia, measurement of stump pressure is poorly sensitive in indicating the need of a shunt, while furthermore, it is only a punctual measure during a test of clamping, influenced by numerous factors such as arterial pressure, paco2 and agents of anesthesia. measurement of srco2 in regard of the frontal cortex is one of elements that can allow and indirect evaluation of the quality of the cerebral perfusion. it is a technique which is neither invasive, nor observer dependent [8, 19,20,21,22 ]. this parameter is in fact a mixture of sao2, svo2 and tissue saturation in o2. all elements which contribute to modify one of its constituents can explain a decrease of srco2. several studies concerning the monitoring of srco2 in carotid surgery, in particular those of murkin., reported a good correlation between the modifications of srco2 during the clamping and the modifications of the other techniques of monitoring such as the transcranial doppler., a decline of more than 12% of srco2 or an absolute value lower than 55%, would be predictive of a cerebral ischemia (detected by eeg or somaesthetic evoked potentials) or of modifications of the transcranial doppler or the stump pressure which can incite the use of a shunt [8, 9 ]. several criticisms can be made concerning these studies since a high incidence of neurological complications was recorded and no study focused on patient operated under general anesthesia. nevertheless, monitoring of srco2, can allow improvement of hemodynamic status in patients with high cerebral risk. under xenon, we noted that, compared with a conventional general anesthesia, decline of srco2 at clamping is less important and is observed in fewer patients. this result is in agreement with the hypothesis of a neuroprotection conferred by this molecule. the neuroprotection may be related in part to a better respect of cerebral perfusion andor its regulation. these neuroprotective properties imply complex mechanisms involving : inhibition on the n - methyl - d - aspartic acid (nmda) receptors, decrease of the glutamate, opening of potassium channels (trek), comparable to a preconditioning against the ischemic effects. many cell targets are evoked, at the origin of this preconditioning : mitochondrial, k - atp canals, pi3-akt kinases, serine threonine and tyrosine kinases, no - synthetase, inhibition of free radical scavengers. the second advantage theoretically brought by xenon is cardioprotection. a modification of the activity of the enzyme cyclooxygenase-2 could be involved in this cardioprotective effect the limits of this study are mostly methodological since this study was not randomized and the patients were included in one or the other group depending on which operative room had been scheduled. furthermore the use of xenon can have several limits such as the necessity of specific equipment, a phase of learning for its manipulation, an important cost, and the existence of contraindications. a strength of the study was that the cerebral oxymetry was continuously recorded, and was not taken into account in a decision - making algorithm. in this pilot, non - randomized study xenon was associated with higher cerebral oxygen saturation values when compared to propofol anesthesia during cross - clamping for carotid endarterectomy. other studies are needed to confirm these results, to further understand the mechanisms of action and to suggest its use in patients at high - risk of cerebral adverse events. | introductionthe cerebral protective effect of xenon anesthesia could be of interest during carotid surgery. the purpose of this study was to compare the effects of xenon on cerebral oxygen saturation with those of propofol during carotid clamping.methodsafter approval of research ethics board and patient informed consent, 74 patients scheduled for carotid endarterectomy were enrolled. patients were not randomized but were well matched by preoperative characteristics. patients in the xenon group were the ones scheduled for surgery in the operative theater equipped with the xenon anesthesia system. anesthesia was started with a target control infusion of propofol and remifentanil. patients were then divided into the control group (37 patients) with anesthesia maintained with target control infusion propofol and remifentanil and the xenon group with anesthesia maintained with xenon (target inspired concentration of 60%) and target control infusion remifentanil. remifentanil and xenon or propofol were stopped at the end of skin closure.resultsa cerebral oxygen saturation decrease below 55% was less frequently observed in the xenon group during carotid cross - clamping (7/37 patients vs 15/37 ; p=0.01). compared with values observed before clamping, the decrease in cerebral oxygen saturation during clamping was significantly less important in the xenon group (1211% vs 1714%, p=0.04). blood pressure and heart rate were not different between groups during carotid clamping.conclusionsthis pilot study suggests that xenon anesthesia may be associated to higher cerebral oxygen saturation values when compared to propofol anesthesia during cross - clamping for carotid endarterectomy. |
solid pseudopapillary tumour (spt) of the pancreas is one of the rare found primary tumors of the pancreas, making up approximately 0.172.7% of cases. there have been controversies regarding the terminology and according to its macroscopic and microscopic pathological characteristics over the years. it has been given multiple descriptive names such as papillary - cystic tumour, solid cystic tumor, papillary epithelial neoplasm, solid, and papillary neoplasm, papillary tumour of the pancreas, or frantz 's tumor until in 1996 the who pancreatic tumour working group recommended the use of the term solid pseudopapillary neoplasm. one of its characteristics is that this tumour seems to preferentially affect mainly young women usually in the second or third decade of life. extrapancreatic spt cases in the retroperitoneum, liver, omentum, and mesocolon have been published. some of them were considered to arise from an ectopic pancreas [46 ]. to the best of our knowledge, an 18-year - old woman complaining of abdominal pain, nausea, and vomiting for one month was admitted to our hospital for further evaluation. she had no history of abdominal trauma or surgery, drug usage or smoking. tumour markers (alpha - fetoprotein, carcinoembryonic antigen, ca-125, ca15 - 3, ca19 - 9, and ca72 - 4) of serum and other biochemical analyses were within normal limits. abdominal ultrasonography (usg) showed an encapsulated solid mass of 5 5.5 cm in diameter located on the subhepatic region displacing the second part of the duodenum laterally, and the computer tomography confirmed a well - encapsulated mass of 48 51 mm diameter located in the mesenteric region neighboring the superior mesenteric artery and vein, with no distinct separation from the head of the pancreas. the patient then underwent surgery, and exploration revealed an encapsulated mass of 5 5 cm in diameter that was adherent to the mesentery of the transverse colon. the tumor was not infiltrating the pancreatic tissue. no vascular invasion or lymph node metastasis pathologic examination of biopsy material revealed small cells with uniform spherical nuclei with narrow eosinophilic cytoplasm and tumoral cells forming glandular structures (figure 1). neuron - specific enolase (nse), chromogranin, cd10, cd99, cd68, lca, calcitonin, cea, ema, hmw ck, lmw ck, ck 7, ki 67, and synaptophysin antibody staining were negative ; however, the tumoral cells were stained remarkably with progesterone receptor antibody and vimentin (figures 2(a) and 2(b)). in light of these findings, spt is a rare disease with a reported incidence of 0.13% to 2.7% of all pancreatic tumors, and cases often have been misunderstood. the spt has usually occurred in young women during the second to fourth decades of life. abdominal discomfort is the prevailing symptom associated in some cases with a palpable mass, anorexia, and weight loss. the most common extrapancreatic sites are mesocolon, liver, retroperitoneum, or greater omentum [47 ]. only four spt, developed from mesocolon, have been described previously (table 1). the presence of ectopic pancreatic tissue is seen in all of these published cases [5, 6, 8, 9 ]. ishikawa. described the first spt case arising from an ectopic pancreas in the mesocolon. patient was 13-year - old girl, and 8-cm, well - encapsulated, and partly calcified tumor which protruded from the mesocolon was resected surgically. at the base of this tumor, small pancreatic tissues (islet, acinar, and ductular cells) were detected in the mesocolic tissue. these four tumours (table 1) tended to grow to a large size (60210 mm), usually occurred in young female patients (only one was in a man), and produced similar clinical signs. in all four published cases the tumour was found to be separate from the main pancreas at surgery. a case of spt arising in the omentum without pancreatic tissue mentioned that the occurrence of a few spts in the retroperitoneal space outside the pancreas can be related to the localization of the genital ridge during embryogenesis and speculated that spt might originate from genital ridge - related cells that were incorporated into the pancreas during organogenesis. this theory might suggest one explanation for the occurrence of spt in the mesocolon in the presented case. spt can be readily diagnosed by routine histologic examination, but accuracy of diagnosis may be improved with the help of immunohistochemical staining because such tumours are typically negative for cytokeratin, pancreatic enzyme markers, and endocrine markers but positive for vimentin, cd 10, cd 56, and alpha - antitrypsin [37, 9, 10 ]. we encountered an extremely rare case of spt arising in the mesocolon without ectopic pancreatic tissue. | a solid pseudopapillary tumour (spt) is an uncommon pancreatic tumour. very rarely it has also been described outside the pancreas, usually arising from heterotopic pancreatic tissue. in this paper, we described a case arising from the transverse mesocolon without heterotopic pancreatic tissue in an 18-year - old girl. |
emphysematous urinary tract infections (utis) are infections associated with gas formation that may present as cystitis, pyelitis, or pyelonephritis. uncontrolled diabetes mellitus is a major risk factor for this type of infection, as it provides a favorable microenvironment for the gas forming organisms to grow,. we present a case of emphysematous pyelitis caused by candida tropicalis with good outcome due to early recognition and treatment. a 49 year old man presented to the emergency department on day 0 with a two week history of intermittent right flank pain associated with nausea and vomiting. his medical history included diabetes mellitus, hepatitis c, schizophrenia, and intravenous (iv) substance abuse. his home medications included nateglinide, metformin, clonazepam, risperidone, fluoxetine, trazodone, and benztropine. on initial physical examination, he had a fever of 38.7 c (101.6 f), blood pressure of 150/80 mm hg with a heart rate of 80 beats per minute, and right costovertebral angle tenderness, with otherwise unremarkable findings. the initial laboratory workup showed a hyperglycemia of 496 mg / dl, but no leukocytosis or abnormal renal functions. urine analysis was positive for white and red blood cells with negative nitrite and leukocyte esterase. computed tomography (ct) scan showed free air within both collecting systems and urinary bladder with no signs of air inside the renal parenchyma. iv ceftriaxone and insulin therapy were started, foley catheter was placed, and urine cytology was sent to the lab. on further questioning, the patient reported passing friable pinkish material with his urine, like chicken fat he described. on day 1, the patient 's fever persisted and antibiotic were switched to piperacillin - tazobactam. on day 2, the hemoglobin a1c was 14.9% and a repeat ct scan with iv contrast was still suggestive of emphysematous pyelitis (fig. enterovesical fistula was ruled out by an oral - activated charcoal test. on day 4, the urine culture came back positive for c. tropicalis (> 100,000 cfu / ml) identified by vitek ms system. iv fluconazole 400 mg was started followed by 200 mg daily. on day 5, a final ct scan on day 6 showed resolution of the emphysematous pyelitis with some remaining mild parenchymal edema and he remained afebrile. the patient was discharged on oral fluconazole 200 mg to complete two weeks of therapy. emphysematous infections are usually caused by gas - producing organisms ; mainly bacterial like escherichia coli, klebsiella pneumoniae, proteus mirabilis and pseudomonas aeruginosa. fungal etiology has rarely been reported, but in this case the infection was caused by c. tropicalis. the method of choice for diagnosis and follow up of emphysematous uti is ct scan. class 1, is when gas is only limited to the collecting system. in class 2, gas is found in the renal parenchyma without extension to the extrarenal space. in class 3a, gas extends to the perinephric space and in class 3b, it extends to the pararenal space. in class 4, there is bilateral renal involvement or emphysematous pyelonephritis of a solitary kidney,. the new approach in treating emphysematous utis is the use of systemic antibiotics, together with percutaneous drainage of gas and purulent material. if urinary tract obstruction is present, it must be relieved as well,,. in this case, the patient was class 1 and was successfully managed by systemic antibiotic and antifungal therapy, together with decompression of the urinary system by foley catheter. no invasive intervention was required. he responded well to treatment, mainly due to early diagnosis, sequential radiological assessment, and the fact that it was pyelitis rather than pyelonephritis. | a patient with uncontrolled diabetes mellitus presented with fever and flank pain. a computed tomography scan showed free air within both collecting systems. a diagnosis of emphysematous pyelitis was made after other alternative diagnoses were ruled out. urine culture grew candida tropicalis. the emphysematous pyelitis resolved with conservative management using antifungal therapy. |
meningeal hemangiopericytoma (mhpc) was first reported by stout and murray in 19422832). mhpc tumors arise from zimmermann 's pericytes around capillaries and post - capillary venules. begg and garret have reported several similarities between mhpc and angioblastic meningioma, and have additionally used immunohistochemistry and genetic analyses to demonstrate the ways in which mhpc differs from meningioma516). although mhpc was initially considered to be a transformation of meningioma, it was ultimately recognized as a distinct pathological entity with clinical behaviors, immune cell features, and ultrastructural features that differ from meningiomas7182226). in 1993, the world health organization recognized mhpc as a distinct clinicopathological entity, based on mhpc 's tendencies toward recurrence and extraneural metastasis, its distinct clinical behavior, and its immunohistochemical, ultrastructural, and genetic characteristics28). they tend to recur even after macroscopic total resection, with local recurrence rates as high as 91%. a significant number of patients with mhpc live as long as 15 years and beyond after the initial surgery, developing second and third local recurrences as well as distant metastasis, thus mandating vigilant long - term follow - up26). in this study, we explored treatment outcomes, recurrence, and clinicopathological characteristics in patients with surgically treated mhpc. this study included 15 patients who underwent surgical resections performed by one senior neurosurgeon between 1997 and 2013. clinicopathological characteristics, such as age, sex, tumor location, tumor size, extent of surgical resection, adjuvant radiotherapy, recurrence, and survival were retrospectively collected from medical records. prior to surgery, the researchers explained to the patients that their medical records would be used for research. complete resection (cr) refers to cases in which the tumors were not visible to the naked eye and could not be seen in postoperative imaging. we analyzed characteristics such as age, sex, tumor size and location, extent of resection, status of adjuvant radiotherapy, and the histological grade of the recurrence. all statistical analyses were performed using spss (version 16.0, ibm spss inc., chicago, il, usa). the relationships between various factors and recurrence times were assessed using the log - rank test. this study included 15 patients who underwent surgical resections performed by one senior neurosurgeon between 1997 and 2013. clinicopathological characteristics, such as age, sex, tumor location, tumor size, extent of surgical resection, adjuvant radiotherapy, recurrence, and survival were retrospectively collected from medical records. prior to surgery, the researchers explained to the patients that their medical records would be used for research. complete resection (cr) refers to cases in which the tumors were not visible to the naked eye and could not be seen in postoperative imaging. we analyzed characteristics such as age, sex, tumor size and location, extent of resection, status of adjuvant radiotherapy, and the histological grade of the recurrence. all statistical analyses were performed using spss (version 16.0, ibm spss inc., chicago, il, usa). the relationships between various factors and recurrence times were assessed using the log - rank test. the patient 's ages ranged from 33 to 76 years (mean 47.2 years). twelve (80%) patients had tumors in the supratentorial region and 3 (20%) patients had tumors in the infratentorial region. one patient had received transcatheter arterial chemoembolization and adjuvant radiotherapy for hemangiopericytoma of the liver prior to the diagnosis of intracranial mhpc. in this case, the tumor had already spread to the lungs and spine, as identified using a preoperative positron emission tomography scan. two (13%) patients with tumors that were at least 100 mm in size had received tumor embolization before surgery. patient characteristics, such as the extent of tumor resection, adjuvant radiotherapy, recurrence, time to recurrence, and status at last follow - up, are summarized in table 1. recurrence occurred in 3 (20%) patients : 1 patient (case no. 15) developed recurrence at the original site (fig. 1) and 2 patients (case nos. recurrence occurred in 1 patient who had received radiosurgery and 2 patients who had not received adjuvant radiotherapy. there was no significant relationship between recurrence and adjuvant radiotherapy (p=0.3) (fig. 2). among the patients who developed recurrence during follow - up, the average time to the first recurrence was 66.7 months. the 10-year recurrence - free survival (rfs) rate was 80%, whereas the median rfs was 146 months. the mean ki-67 index differed significantly between patients who did and did not develop recurrence (43% vs. 14% ; p=0.001) (fig. 3). comparison of 2 groups in terms of age, sex, tumor size, location, adjuvant radiotherapy status, histological grade, the ki-67 index are summarized in table 2. the relationship between recurrence and the resection rate could not be assessed because cr was performed in all patients. one of them underwent radiosurgery (18 gy at the 90% isodose line)for the single lesion. the others underwent conventional radiotherapy (50 gy in 25 fractions) because of tumors at the multiple brain sites. although the patient who received radiosurgery experienced temporal recurrence within 3 years, neither of the patient who received conventional radiotherapy experienced recurrence. we investigated recurrence status according to histological grade and found that 2 (67%) of the patients with recurrence had grade ii disease, and 1 (33%) of the patients with recurrence had grade iii disease. among patients without recurrence, 8 (67%) had grade ii disease and 4 (33%) had grade iii disease. accordingly, recurrence rates did not differ significantly according to histological grade (p=0.931)33). the 5- and 10-year overall survival rate was 88.3%, while the 5- and 10-year recurrence - free survival rates were 83% and 52%, respectively (fig. two patients died of respiratory problems during the follow - up period : 1 patient with metastatic lung tumors died of acute respiratory distress syndrome in 12 months after surgery, and the other patient died of pneumonia 1 month after surgery. because mhpc carries high risks of recurrence and spread to other sites, precise identification of the tumor 's features is necessary to provide appropriate treatment and accurate assessments of prognosis45891214152225). long - term studies have shown that mhpc tends to recur in brain and spinal meninges, but not at the original site4578151622). galanis.12) and guthrie.15) have emphasized the importance of achieving cr during the first surgery to reduce the risk of recurrence and prolong survival. they have also suggested that aggressive surgical therapy plays an important role in the success or failure of treatment. in a study of mhpc, schiaritis.28) reported rfs rates of 77% after cr and 3% after incomplete resection. they stated that the time to recurrence after cr was 63 months longer than the time to recurrence after incomplete resection. in the current study, this value is substantially lower than has been observed in other studies that included cases of incomplete resection. accordingly, the results of the current study also tend to suggest that cr poses a lower risk of recurrence than incomplete resection. a literature review of recent studies on meningeal hemangiopericytomas showed an average cr rate of 57.7% (table 3). adjuvant radiotherapy has been reported to reduce recurrence rates and extend survival24102330). in 1976 guthrie.15) reported a 52% recurrence rate in patients treated with adjuvantradiotherapy, as compared with an 86% rate in those who did not receive adjuvantradiotherapy. further, the average times to recurrence were 75 and 34 months for patients who did and did not receive adjuvantradiotherapy15). in guthrie.'15)s study, adjuvant radiotherapy was performed in 4 patients with surgical findings of an unclear boundary between the tumor and the normal brain tissue ; biopsy results showed where the normal brain tissue had been invaded by tumor cells in the boundary area. in 1 of the 3 patients who developed recurrence, recurrence occurred in the boundary of the area where the tumor had originated. it is logical to suggest that adjuvant radiotherapy is helpful when incomplete resection is performed ; however, even in cases of cr, adjuvant radiotherapy may be helpful when the boundary area of the tumor is not clear. radiosurgery is an effective treatment for recurrent mhpc with well - separated, small tumors. bastin and mehta4) reported that the tumor was effectively reduced by a single fraction of stereotactic radiosurgery for recurrent mhpc. galanis.12) performed radiosurgery on 17 tumors in 7 patients who had recurrent tumors or persistent tumors, even after they had received conventional fractionated radiotherapy with 50 to 60 gy. guthrie.15) demonstrated that recurrence rates reduced with increasing levels of radiation, and found no recurrence in patients who had received more than 50 gy of radiation. dufour.9) reported recurrences in 2 patients who had received less than 30 gy of radiation, but no recurrence in patients who had received doses of 50 and 64 gy. in our study, recurrence was observed in 1 patient who had received radiosurgery with 18 gy, but no recurrence was observed in either of the 2 patients who received conventional radiotherapy with more than 50 gy. even though we did not observe a statistically significant difference in recurrence rates, we consider a dose of at least 50 gy to be both helpful and within the range of tolerable doses. several clinicians have performed adjuvant radiotherapy before surgery for cases of mhpc that are associated with elevated surgical risk. carella.6) presented the hemangiopericytic variant of angioblastic meningioma, which had better responses to adjuvant radiotherapy than normal meningioma. in an analysis of 5 patients who had undergone adjuvant radiotherapy before surgery, uemura.35) reported that tumors were easily removed without substantial bleeding and, further, that many tumor cells were pathologically reduced after adjuvant radiotherapy. however, it is difficult to obtain histological findings before surgery, and it is necessary to fully consider adjuvant radiotherapy after surgery. preoperative adjuvant radiotherapy should be performed only when surgical treatment is predicted to be difficult. vuorinen.34) suggested that the ki-67 index was not correlated with clinical outcomes, even though survival times tended to be longer among patients with a ki-67 index < 5%. in our study, the ki-67 index was significantly higher in patients who developed recurrence, as compared with patients who did not develop recurrence (43% vs. 14% ; p<0.001). galanis.12) reported recurrence in 32 of 34 cases, including 19 patients with recurrence at the original site, 11 with recurrence at both the original site and a distant site, and 2 with leptomeningeal seeding at the site of the original tumor, but no recurrence. in our study, 1 patient had a recurrent tumor at the original site, and 2 patients had recurrent tumors at different sites. however, leptomeningeal seeding was not observed. mhpc also tends to recur in at sites that are distant from the nervous system. extraneural metastasis simultaneously occurs in the bones, lungs, kidneys, pancreas, adrenal glands, and liver. galanis.12) showed that metastasis is most common in the bones and liver, whereas brunori.5) reported more frequent metastasis in the lungs, bones, soft tissues, and liver. the current study includes 1 case in which extraneural metastasis had already occurred in the lungs, bones, and liver at the time of diagnosis with intracranial mhpc. reported a 5-year recurrence rate of 33% and brunori.5) reported that the average time to the first recurrence was 84 months. guthrie.15) stated that the 10-year recurrence rate after surgery was 76% and goellner.14) reported that the 15-year recurrence rate was 76%. schiariti.28) reported that the time to recurrence after the first surgery averaged 80 months. in this study, the 5- and 10-year overall survival rate were 91.7% and 88.3%, respectively, while the 5- and 10-year recurrence - free survival rates were 83% and 52%, respectively. recurrence after surgery has been described as the last stage in the natural history of hpc45141517). therefore, it may be necessary to continue follow - up observations for as long as is possible. the duration of observational follow - up has an important effect on the selection of treatment methods because a long duration of observational follow - up allows an effective method, such as radiosurgery, to be selected for small recurrent tumors (in addition to surgical treatment), before the tumor has had the opportunity to grow large. moreover, it is important to identify metastatic status during follow - up because extraneural metastasis frequently occurs in mhpc. in retrospective analyses, stout.32) and adegbite.1) demonstrated rates of extraneural metastases of 12% and 57%, respectively. treatment methods, surgical outcomes, and many other factors may lead to differences in the rate of extra - neural metastasis. guthrie.15) presented 5-, 10-, and 15-year metastasis rates of 13%, 33%, and 64%, respectively. koyama.20) reported that metastases occurred an average of 8 years after initial treatment, and have tracked patients for 16 years., cr must be followed by adjuvant radiotherapy and periodic follow - up that is commensurate with the degree of surgical resection. | objectivealthough surgical resection is used to treat meningeal hemangiopericytoma (mhpc), there is a high risk of subsequent recurrence. this study investigated factors associated with treatment outcomes and recurrence in patients who had undergone surgical resection of intracranial mhpc.methodsfifteen patients underwent surgical treatments performed by one senior neurosurgeon between 1997 and 2013. clinical data, radiologic images, surgical outcomes, recurrence, and other relevant characteristics were reviewed and analyzed.resultsfifteen patients were included in the analysis, 12 (80%) of whom had tumors in the supratentorial region, and 3 (20%) of whom had tumors in the infratentorial region. complete resection was achieved in all 15 patients, and 3 (20%) patients were administered radiosurgery and conventional radiotherapy after surgery as adjuvant radiotherapy. three patients developed recurrence, 2 of whom had not received adjuvant radiotherapy. in 1 of the patients who had not received adjuvant radiotherapy, recurrence developed at the original tumor site, 81 months after surgery. the other 2 recurrences occurred at other sites, 78 and 41 months after surgery. the 5- and 10-year overall survival rates were 88.3%, while the 5- and 10-year recurrence - free survival rates were 83% and 52%, respectively. additionally the mean ki-67 index differed significantly between patients who did and did not develop recurrence (43% vs. 14% ; p=0.001).conclusionbecause of the high risk of mhpc recurrence, mhpc tumors should be completely resected, whenever feasible. however, even when complete resection is achieved, adjuvant radiotherapy might be necessary to prevent recurrence. |
rheumatoid arthritis (ra) is a disabling and progressive chronic autoimmune disease that carries a significant burden.1 although ra affects people of all ages, its prevalence increases with increasing age and it is more common in women than in men.2,3 a prevalence of 0.5%1% and a mean annual incidence (ie, rate of new cases) of 0.02%0.05% have been estimated in studies carried out in northern europe and in north america.4 the prevalence of ra in southern europe has been estimated to be lower than that in northern europe, with rates of 0.45% and 0.66% reported in the two areas, respectively.5 the annual incidence of ra is also lower in southern than in northern european countries.6 estimates of prevalence are often very variable as a result of several factors, including the time period when the study was undertaken ; the age distribution of the country reporting the estimates ; differences in the health care organizations in the reporting countries ; and the source of information.6 similarly, changes in the epidemiology of ra are difficult to predict ; while some studies might suggest a decline in incidence among countries with high rates of ra,5 other investigators suggest that the incidence is expected to increase in europe because of the growing proportion of older people.7,8 ra is associated with a significant economic burden for patients, families, and health care systems.9 moreover, an increase in the costs associated with ra is anticipated as a result of the aging population.7 there is a great amount of variability in estimates of the cost of ra across countries ; these estimates are affected by methods of calculation, reimbursement policies, and availability (and time of availability) of drugs and social services. differences in country - specific treatment guidelines on when to introduce newer costly drug classes (ie, biological agents) for patients with severe active and erosive disease also contribute to the variation in costs across the european union (eu).6 however, the macroeconomic condition and the treatment guidelines remain the most important determinants that drive choice of therapy.6 italy has the highest proportion of people aged 65 years or older in the eu and it has been estimated that, by 2029, 25.7% of the population in italy will be 65 years.7 thus, the health care costs associated with age - related diseases like ra are likely to increase in italy. the introduction of newer costly therapies may further contribute to the expected increase in the economic burden of ra in italy. this review aims to evaluate the economic impact of ra in italy in the past two decades and to compare the costs of ra before and after the introduction of biological agents. in addition, the review will attempt to predict the future costs of ra in italy, and to compare these costs with those in other european countries. while this is not designed as a systematic review as such, it does follow a similar procedure for identification of publications of relevance. comprehensive electronic searches of pubmed / medline were performed using the search terms (in any field) : prevalence or cost and rheumatoid arthritis and italy, with no language restriction. the search identified 414 papers ; abstracts of these publications were assessed for their relevance. in total, six papers reporting data on the prevalence of ra in italy1015 and four papers reporting economic data1619 were initially considered as adequate for the objectives of this review. in addition, further data were extracted from the websites of italian or european public health agencies and from italian journals to add to the previously identified published literature on the health care costs of ra in italy. this led to the inclusion of a further two articles6,20 that add important information on the past and current costs of ra in italy, as well as on estimates of future costs. although the small population samples and limited coverage of the studies do not allow a firm estimate of the national prevalence of the disease, the studies do give a rough idea of the likely prevalence and also highlight potential geographical variations. a study10 undertaken in 19911992 in chiavari, a small town located on the ligurian coast, found that ra had a prevalence of 0.33% (95% confidence interval [ci ] 0.130.53) in the general population, 0.13% (95% ci 00.31) in men, and 0.51% (95% ci 0.180.84) in women. this study included 3,294 individuals (73.9% of those contacted), aged 16 years, identified from four general practices. the mean age of subjects was 48.3 years, which may account for the relatively low prevalence reported in this study. a higher prevalence of 0.46% (95% ci 0.330.59) was reported in another study11 conducted from april 2004 to june 2004 in 2,155 subjects aged 18 years in the marche region. similar estimates were reported from a survey conducted in 20022003 in tempio pausania (northern sardinia) that involved 30,264 subjects aged 18 years;12 prevalence was estimated to be 0.46% in the general population, 0.73% in women, and 0.19% in men. another study carried out in the province of pisa in the years 2006 and 200714 evaluated the prevalence of ra, the reliability of the ra diagnosis and prevalence estimated by general practitioners (gps), and the economic impact of the disease in a total of 26,709 subjects aged over 18 years. each gp completed a questionnaire on their patients ; patients considered by gps to have ra were then invited to attend an appointment at a specialist rheumatology center for confirmation or rejection of the diagnosis made. the estimated prevalence of correctly diagnosed ra was 0.51% (95% ci 0.440.57) and the reliability of gps when making a diagnosis of ra was 69% overall, although there was a high degree of heterogeneity among gps. benucci evaluated the incidence of early ra (new cases) in a suburban area of florence between september 2005 and august 2006 and suggested a rate of 0.98 (95% ci 0.641.32) in the overall population, and 1.42 (95% ci 0.851.99) for females and 0.51 (95% ci 0.160.87) for males. the mean age of newly diagnosed subjects was 47.7 years in females and 54.9 years in males. the incidence rate observed in this study was higher than that observed in other european countries, possibly due to tight adherence to diagnostic criteria for early ra and to the use of the criteria of the american college of rheumatology (acr)21 as a method of assessment. the most recent treatment - driven estimation of the prevalence and incidence of ra in italy, performed in a cohort of 2,268,514 males and 2,446,769 females, and based on a diagnosis made according to prescription of at least three ra - specific drugs (corticosteroids, disease - modifying anti - rheumatic drugs, and biological agents), was calculated for the year 2011.15 patients were classified as follows : those on specific drugs were classed as having active ra ; those who had never had more than four prescriptions in the past were classed as unlikely ra ; and those previously on chronic treatment but who had discontinued therapy for > 1 year were classed as having ra in remission. a diagnosis of ra was made by a qualified specialist in a total of 22,801 of these subjects (0.48%), with a prevalence of active ra, ra in remission, and confirmed ra (active + remission ra) of 0.32%, 0.09%, and 0.41%, respectively. the yearly incidence of active ra per 100,000 subjects was 48 (95% ci 4057) for females and 20 (95% ci 1030) for males. the female : male ratio for both prevalence and incidence was ~3.5:1 before the fifth decade of life and tended to decline to about 2:1 in subjects aged > 70 years. a modeling analysis of the prevalence of ra in 27 countries in the eu (plus iceland, norway, and switzerland) conducted in 20086 estimated that the overall prevalence of ra in italy was 0.49% and was exactly the same as the calculated average prevalence in europe. in this analysis, italy was ranked as eighth in terms of estimated prevalence of ra and was one of four european countries (together with the uk, sweden, and germany) in which subjects aged 65 years contributed more than 50% of the diagnosed cases of ra. the data also showed that italy and germany were the european countries with the highest proportion of people aged 65 years. taken together, these data6 suggest that the prevalence of ra will further increase in europe and in italy in line with projected increases in the elderly population. few studies have estimated the costs associated with ra in italy before the availability of biological agents. a retrospective, prevalence - based, multicenter, cost - of - illness study, undertaken in 1998 in ten rheumatology institutes located in northern, central, and southern italy,19 evaluated the direct (hospitalizations, specialist visits, treatments, diagnostics, and nonmedical costs), indirect (productivity loss and informal care), and intangible (deterioration in health - related quality of life [hrqol ] of patients, their families, and their friends) costs associated with ra in 200 patients aged 1865 years. participants were categorized into four classes of severity according to the acr ra functional status index in place at the time of the study.22 the results showed that indirect costs accounted for the largest part of the disease management costs and that social costs (direct plus indirect costs) increased as ra worsened. the calculated average annual cost for each patient varied significantly depending on disease severity and correlated with the health assessment questionnaire disability index23 and acr criteria.22 total costs ranged from 3,718.3 for patients in functional class i to 22,946.0 for patients in class iv. both the direct costs (respectively, 1,643.4, 2,910.2, 4,236.5, and 5,696.8 per patient from class i to class iv) and the indirect costs (2,074.9, 9,566.4, 12,183.1, and 17,249.2 per patient, respectively) over the 12 months of observation increased significantly (p 1 year were classed as having ra in remission. a diagnosis of ra was made by a qualified specialist in a total of 22,801 of these subjects (0.48%), with a prevalence of active ra, ra in remission, and confirmed ra (active + remission ra) of 0.32%, 0.09%, and 0.41%, respectively. the yearly incidence of active ra per 100,000 subjects was 48 (95% ci 4057) for females and 20 (95% ci 1030) for males. the female : male ratio for both prevalence and incidence was ~3.5:1 before the fifth decade of life and tended to decline to about 2:1 in subjects aged > 70 years. a modeling analysis of the prevalence of ra in 27 countries in the eu (plus iceland, norway, and switzerland) conducted in 20086 estimated that the overall prevalence of ra in italy was 0.49% and was exactly the same as the calculated average prevalence in europe. in this analysis, italy was ranked as eighth in terms of estimated prevalence of ra and was one of four european countries (together with the uk, sweden, and germany) in which subjects aged 65 years contributed more than 50% of the diagnosed cases of ra. the data also showed that italy and germany were the european countries with the highest proportion of people aged 65 years. taken together, these data6 suggest that the prevalence of ra will further increase in europe and in italy in line with projected increases in the elderly population. few studies have estimated the costs associated with ra in italy before the availability of biological agents. a retrospective, prevalence - based, multicenter, cost - of - illness study, undertaken in 1998 in ten rheumatology institutes located in northern, central, and southern italy,19 evaluated the direct (hospitalizations, specialist visits, treatments, diagnostics, and nonmedical costs), indirect (productivity loss and informal care), and intangible (deterioration in health - related quality of life [hrqol ] of patients, their families, and their friends) costs associated with ra in 200 patients aged 1865 years. participants were categorized into four classes of severity according to the acr ra functional status index in place at the time of the study.22 the results showed that indirect costs accounted for the largest part of the disease management costs and that social costs (direct plus indirect costs) increased as ra worsened. the calculated average annual cost for each patient varied significantly depending on disease severity and correlated with the health assessment questionnaire disability index23 and acr criteria.22 total costs ranged from 3,718.3 for patients in functional class i to 22,946.0 for patients in class iv. both the direct costs (respectively, 1,643.4, 2,910.2, 4,236.5, and 5,696.8 per patient from class i to class iv) and the indirect costs (2,074.9, 9,566.4, 12,183.1, and 17,249.2 per patient, respectively) over the 12 months of observation increased significantly (p 40 skin nevi (12%) and of framingham score > 20% (59%). although the high prevalence of some of these comorbidities may be related to the medications used (eg, corticosteroids) or to traditional risk factors (eg, tobacco smoking), some others (eg, depression) may be a direct consequence of systemic inflammation and its associated symptoms and effect on hrqol.40 a task force of the acr and the european league against rheumatism has recently highlighted the importance of comorbidities in the management of ra and in the treatment decision - making strategies.41 while the use of biologic response modifiers is not associated with an increased risk of malignancy,42 improvements in disease activity following 1-year treatment with biologic agents is associated with important gains in terms of qalys and hrqol,43 suggesting that successful treatment of ra can result in lower levels of depression. the recent published editorial20 on the 30-year costs of untreated ra in italy, which has shown that actual costs may rise in the coming years if the disease is not managed, highlights that costly interventions aimed at sparing future expenses are of particular relevance in countries like italy, where ra and associated comorbidities will make a significant contribution to the economic burden for the nhs, given the increased proportion of elderly people expected in years to come. further research is needed to develop estimates of the economic impact of different therapeutic approaches in patients with ra in italy. in particular, accurate pharmacoeconomic analyses would be valuable to help guide treatment decisions, ensuring effective spending without compromising the quality of care delivered. | this literature review examines available evidence on the current and past costs associated with rheumatoid arthritis (ra) in italy, together with the future health - economic prospects for the disease. studies have been conducted to date on the prevalence, or the associated costs, of ra in italy. although future changes in the incidence of ra are a matter of debate, the impact of ra on health care costs is expected to grow in coming decades in line with projected increases in life expectancy and in the proportion of elderly people in italy. it has been estimated that the indirect (productivity loss and informal care) and intangible (deterioration in health - related quality of life) costs of the disease will contribute to an increase in national health service expenditure, which will correspond to 1% of the total health care costs of the nation in the near future. the introduction of biological agents for the treatment of rheumatic diseases has resulted in an increase in the direct costs of ra ; however, economic analyses that exclude indirect costs will underestimate the full economic impact of ra. the effectiveness of innovative therapies in preventing disease progression and functional impairment may, over time, attenuate the cost impact of ra in terms of hospitalizations and work absenteeism. further research is needed to develop estimates of the economic impact of different therapeutic approaches in patients with ra in italy, in order to provide tools that can drive the choice of the most cost - effective therapeutic option while maintaining high - quality care. |
chronic hepatitis b (hbv) and c virus (hcv) infection are major causes of morbidity and mortality in the united states (us). it is estimated that approximately 1.3 million and 5.2 million people in the us suffer from chronic hbv and hcv infection, respectively.1,2 both chronic infections can lead to cirrhosis, hepatocellular carcinoma, and liver transplantation. during the last decade, screening guidelines for hbv and hcv have improved to assist in the recognition of populations at higher risk (table 1). individuals born in areas of high or intermediate prevalence rates for hbv, including immigrants and adopted childrena us born persons not vaccinated as infants whose parents were born in regions with high hbv endemicity household and sexual contacts of hbsag - positive persons people who have ever injected drugs people with multiple sexual partners or history of sexually transmitted disease men who have sex with men inmates of correctional facilities individuals with chronically elevated alt or ast individuals infected with hcv or hiv patients undergoing renal dialysis persons needing immunosuppressive therapy at least once in people born between 19451965 people who have use injected or intranasal illicit drugsin the recent and remote past, including those who injected only once and do not consider themselves to be drug users people with conditions associated with a high prevalence of hcv infection, including people with : hemophilia who received clotting factor concentrates prior to 1987 people who have ever been on hemodialysis people who were incarcerated people who received tattoos in unregulated settings unexplained abnormal aminotransferase levels prior recipients of transfusions or organ transplants prior to july 1992 including persons who : were notified that they had received blood from a donor who later tested positive for hcv infection received a transfusion of blood or blood products received an organ transplant children born to hcv - infected mothers health care, emergency medical and public safety workers after a needle stick injury or mucosal exposure to hcv - positive blood current sexual partners of hcv - infected persons annual testing for people with ongoing risk factors for hcv exposure areas of high or intermediate prevalence rate for hbv : asia, africa, south pacific islands, middle east (except cyprus and israel), european mediterranean (malta and spain), the arctic (indigenous populations of alaska, canada, and greenland), south america (ecuador, guyana, suriname, venezuela, and amazon regions of bolivia, brazil, colombia, and peru), eastern europe (all countries except hungary), caribbean (antigua and barbuda, dominica, granada, haiti, jamaica, st. kitts and nevis, st. lucia, and turks and caicos), central america (guatemala and honduras). with unprecedented advances in the treatment against cancer, autoimmune and connective tissue diseases, transplantation, and the prevention of graft - versus - host disease, data are emerging that point towards an increased risk of hbv and hcv reactivation after the use of biologics. hbv reactivation has been reported in 20% to 50% of hbv carriers undergoing immunosuppressive therapy or chemotherapy.36 the spectrum of clinical manifestations can range from asymptomatic hepatitis fiares to hepatic decompensation, fulminant hepatic failure, and death. in contrast, hcv reactivation is rare, but if severe hepatitis develops, the mortality rates are similar to that of hbv infected patients.713 some of the biologics identified to increase the risk of hbv and hcv reactivation include monoclonal antibodies to t and b cells. these include rituximab, alentuzumab, and tumor necrosis factor (tnf)- antagonist with or without combination therapy (including corticosteroids).1429 here, we review the pathophysiology of the reactivation of hbv and hcv in patients receiving biologic therapy and provide approaches for the diagnosis, prevention, and treatment of hbv and hcv reactivation. the natural course of hbv infection is determined by the interplay between virus, host, and environment.30 the rate of progression from acute to chronic hbv infection ranges from 90% in newborns, 25% to 30% in infants and children under five, and to less than 5% in adults.3134 chronic hbv infection can be classified into five phases : immune tolerant, immune active, inactive chronic infection, chronic disease, and recovery. each phase of infection has characteristic serologic patterns and correlate with the patient 's immune response to hbv.31,3537 a good understanding of hbv serologic test results is essential for diagnosis and management (table 2). hbsag : hepatitis b surface antigen ; hbsab : hepatitis b surface antibody ; hbcab : hepatitis b core antibody ; hbeag : hepatitis b envelope antigen ; hbeab : hepatitis b envelope antibody. patients with serologic evidence of resolution, spontaneously or after treatment, show clearance of hepatitis b surface antigen (hbsag), positive hepatitis b core antibody (hbcab), and hepatitis b surface antibody (hbsab). in these patients, hbv reactivation is defined as the reappearance of active hepatic necroinfiammatory disease in a person known to have the inactive hbsag carrier state or resolved hepatitis b infection.3839 it has been reported in 20% to 50% of hbv carriers undergoing immunosuppressive therapy or chemotherapy.36 clinical manifestations include nonspecific symptoms like fatigue, general malaise, jaundice, hepatic decompensation, fulminant hepatic failure manifested with hepatic encephalopathy, coagulopathy, and even death. patients can also present with asymptomatic hepatitis fiares identified only by biochemical and molecular profiling. the proposed mechanism of hbv reactivation is divided into three stages.7,3840 the initial stage is characterized by viral replication, which is due to the host 's decreased immune response. during this stage, serum levels of hbv dna, hbeag, and hbsag are increased, and hbsab level is decreased. immunosuppressive agents, such as corticosteroids, may also play a stimulatory role in the production of hbv dna. infected hepatocytes are identified as carrying viral antigens and undergo cytotoxic t cell mediated destruction. during this stage, there is active hepatic necroinflammation with an elevation of the aminotransferases and a potential decrease of hbv dna. the third stage is the recovery phase, where there is resolution of the necroinflammation, normalization of the aminotransferases, and decrease of hbv dna to baseline. patients with evidence of acute on chronic liver disease are at higher risk of developing liver failure.39 in a systematic review encompassing all studies from 20062010, 25 articles with a total of 35 cases of hbv reactivation subsequent to tnf- inhibitors were identified.16 all 35 cases were hbsag positive prior to initiation of the inhibitors. infliximab was used in 17 cases, etanercept in 12 cases, and adalimumab in six cases. infliximab was associated with a greater than 2-fold increase in alanine aminotransferase (six of nine cases) and greater than 1,000-fold increase in hbv dna viral load (three of four cases). pei. identified 115 b cell lymphoma patients who received rituximab - containing therapy. hbsag positivity was found in 15 patients, where five received lamivudine prophylaxis and did not develop hbv - related hepatitis. eight of 10 patients who were hbsag positive without lamivudine prophylaxis experienced hbv - related hepatitis, including one fatal hepatic failure. four (4.2%) of 95 hbsag negative patients experienced seroconversion and developed de novo hbv - related hepatitis, two of which died of fulminant hepatitis.17 rituximab, a chimeric monoclonal antibody against the protein cd20 in b cells, is a major risk factor for the development of hbv reactivation. it causes apoptosis of b cells, therein limiting the immunehost response towards hbv by decreasing antigen presenting cell activity and cytotoxic response of cd8 t lymphocytes.7,3840 hbv reactivation related morbidity and mortality rates can be reduced by identifying early patients at risk and initiating prophylactic antiviral treatment.31,4046 the asian pacific association for the study of liver disease (apasl) recommends that all patients in need of the use of biologics and other immunosuppressive therapy should be screened for hbsag prior to utilization of treatment (table 3).59 the american association for the study of liver disease (aasld) and the european association for the study of liver disease (easl) recommend performing hbv serologies and liver function tests to diagnose hbv infection.31,45 if there is evidence of past or present hbv infection, quantitative hbv dna viral load should be tested, and patients should be referred to a hepatologist for evaluation. both active and inactive carriers need to start prophylactic antiviral treatment. following the most recent guidelines issued by the aasld and easl, hbsag positive patients should be treated with lamivudine or telbivudine if the anticipated duration of treatment is less than 12 months and baseline serum hbv dna is not detectable. patients with baseline hbv dna < 2,000 iu / ml should continue treatment for 6 months after completion of chemotherapy or immunosuppressive therapy, while patients with higher baseline hbv dna levels should continue the same treatment strategy as immunocompetent patients.31,45 hbsag - negative patients with positive hbcab should be tested for hbv dna. however, if hbv dna is undetectable, current data is insufficient to advocate for the use of prophylactic antiviral treatment. in that case, very close follow up of alanine aminotransferase (alt) and hbv dna testing is necessary, and prophylactic antiviral treatment should be initiated if hbv dna becomes detectable (fig. easl guidelines recommend monitoring every 13 months, depending on the type of immunosuppressive therapy and comorbidities (table 4). all patients in need of the use of biologics and other immunosuppressive therapy must have hbv serologiesto diagnose hbv infection. hbsag - positive and hbcab - negative patients should be treated with lamivudine or telbivudine if the anticipated duration of treatment is less than12 months and baseline serum hbv dna is not detectable.. however, if hbv dna is undetectable, current data is insufficient to advocate for the use prophylactic antiviral treatment. in that case, very close follow up of alt and hbv dna testing every 13 months is necessary, and prophylactic antiviral treatment should be initiated if hbv dna becomes detectable. approximately 5.2 million people in the us suffer from chronic hcv infection.2 among patients exposed to hcv, up to 85% will become chronically infected, and 525% of those cases will develop cirrhosis after 10 years.47 in contrast to hbv reactivation, hcv reactivation is very uncommon.713 following immunosuppressive therapy, an increase of viral load to at least one log10 iu / ml above the baseline has been reported.13,39,48 the clinical manifestations of hcv reactivation may vary from asymptomatic to at least a three - fold increase in aminotransferases. cases of severe hepatic failure have been reported.713,39,48 the incidence of hepatic toxicity in hcv infected patients receiving chemotherapy is higher than in patients without hcv infection. mahale. reported hcv reactivation in 36% of patients with chronic hcv and cancer.13 it was difficult to identify the specific chemotherapeutic agents causing hepatotoxicity in the mahale study, as various agents were utilized. the most commonly used agents preceding hcv reactivation were cytarabine, etoposide, and rituximab. other reports have been published regarding potential hcv reactivation when utilizing rituximab.13,2528 aksoy. reported a case of a patient with history of hcv cirrhosis who presented with a breast lesion due to large b - cell lymphoma.26 the patient was treated with rituximab monotherapy for three consecutive weeks, but treatment had to be discontinued as a result of hematological toxicity. the hcv viral load was increased three and ten weeks after therapy, but the biochemical profile remained unchanged. tsutsumi. also reported increases in hcv viral load in four patients receiving rituximab for the treatment of non - hodgkin 's lymphoma.27 the hcv viral load was elevated after the administration of rituximab or a rituximab containing regimen, and, in one case, viral load was decreased after switching to a treatment without rituximab. the pathogenesis of hcv reactivation following immunosuppressives remains to be elucidated, although an increase in hcv replication as a direct cytopathic effect has been postulated.10,40 this, followed by the reconstitution of the immune system upon discontinuation of immunosuppressive agents, might lead to direct hepatotoxicity and cell death. recurrence of hcv has also been reported in patients after solid organ transplant.47,4952 after liver transplant, hcv recurrence is universal and the majority of patients will demonstrate histological evidence within the first year after transplantation. accelerated progression of fibrosis is seen in 623% of patients, who will develop cirrhosis after a median of 3.4 years. the exact mechanism by which this occurs is unknown, although immunosuppressive therapy is thought to play an important role.47 similarly, studies performed on various solid organ transplants, including patients with chronic hcv, have reported higher mortality rates due to liver related causes.47,53 the evidence regarding hcv infection and the use of a tnf- antagonist is rather different. in a double - blind, randomized, placebo controlled trial ; 50 patients with chronic hcv were randomly assigned to receive interferon alfa-2b and ribavirin with either etanercept or placebo for 24 weeks. the results showed that patients in the etanercept plus standard antiviral therapy group had substantially greater viral suppression than the standard antiviral therapy group, 63% vs. 32%, respectively.54 despite the fact the rate of hcv reactivation is very low, during or after the use of biologic and other immunosuppressive agents, it still remains a significant cause of morbidity.55 optimally, these patients would undergo screening for hcv prior to initiation of treatment. until more prospective studies demonstrate this relationship, caution should be exercised and careful monitoring is recommended for patients with hcv. current treatment for hcv infection is rapidly evolving. in 2011, we experienced the beginning of a new era with the food and drug administration (fda) approval of a new group of direct acting antiviral agents (daa), namely telaprevir and boceprevir. since late 2013, additional daas, such as sofosbuvir, simeprevir and ladipasvir, were included in the therapeutic armamentarium against hcv. sofosbuvir is the prodrug of a nucleotide analogue inhibitor of the hcv nonstructural (ns) 5b ribonucleic acid (rna)-dependent rna polymerase.5658 simeprevir is a specific inhibitor of the hcv ns3/4a serine protease.58 in october 10, 2014, the ledipasvir / sofosbuvir combination therapy of daas was approved by the fda for patients with genotype 1. currently, the next generation of daas, including paritaprevir, ombitasvir, dasabuvir, daclatasvir, and asunaprevir among others, are being evaluated by the fda and other international agencies. although the guidelines regarding the utilization of the new daas should be reviewed prior to or during the utilization of the chemotherapeutic agents, it might be beneficial to consider testing these patients in order to avoid reactivation of the hcv disease. as previously mentioned, hbv reactivation has been reported in 2050% of hbv carriers undergoing immunosuppressive therapy or chemotherapy.36 in contrast, hcv reactivation is rare, although the morbidity and mortality rates are similar to that of hbv reactivation.713 the high incidence of hbv reactivation has allowed researchers to identify three stages of pathogenesis.7,3840 these are characterized by viral replication in response to decreased host immunity, immune reconstitution and active hepatic necroinflammation of infected hepatocytes mediated by cytotoxic t cells, and resolution of necroinflammation. there are still knowledge gaps in the pathogenesis of hcv reactivation following immunosuppressives, but it is thought to be related to an increase in hcv replication leading to direct hepatotoxicity and cell death.10,40 over the last decade, the utilization of biologics and immunosuppressive agents for the treatment of cancer and autoimmune diseases has increased, accentuating the need for hbv and hcv screening. data suggest that the risk for hbv and hcv reactivation is increased during and after the use of biologics. active hbv patients and inactive carriers should be carefully monitored, and prophylactic antiviral treatment should be started preemptively. the possibility of hcv reactivation during the use of biologics and chemotherapeutic agents remains to be determined. there is a significant gap in available information, and this lack of datapoints towards an increased need for prospective studies targeting this population. until more data become available, caution should be exercised and liver enzymes and the viral load should be monitored closely in vulnerable patients. | hepatitis b (hbv) and hepatitis c (hcv) reactivation may occur after the use of biologic agents. during the last decade, utilization of biologics has changed the fate of many treated for cancer, autoimmune and connective tissue disease, maintenance of transplanted organs, and the prevention of graft - versus - host disease among others. hbv reactivation has been reported in up to 50% of hbv carriers undergoing immunosuppressive therapy, and there is emerging data pointing towards an increased risk for hcv reactivation. if reactivation of hbv and hcv occurs, the spectrum of clinical manifestations can range from asymptomatic hepatitis flares to hepatic decompensation, fulminant hepatic failure, and death. therefore, identifying patients at risk and early diagnosis are imperative to decrease significant morbidity and mortality. the purpose of this article is to review the pathophysiology of the reactivation of hbv and hcv infection in patients receiving biologic therapies and the approaches used to diagnose, prevent, and treat hbv and hcv reactivation. |
arthroscopic fixation of tibial spine fracture without damage to the growth plate is very important in patients with open physis. the present article describes a simple and effective technique being used for the first time to treat this condition. a 16-year - old boy sustained avulsion fractures of tibial spine while playing. he was treated arthroscopically with excellent result. arthroscopic fixation of tibial spine fracture in patients with open physis with two cannulated screws perpendicular to each other is a very simple technique which provides strong construct, and allows early mobilization without risk of damage to the growth plate. avulsion fractures of tibial spine leading to discontinuity of anterior cruciate ligament fibers are uncommon but well described in literature in both pediatric and adult population. these injuries are commonly seen in children aged between 8 - 14 years and are usually sports related injuries. in adults, these injuries are commonly related to high energy trauma usually road traffic accidents [1, 2 ] and have high incidence of associated injuries. the cause of increased incidence amongst children is hypothesized as being secondary to relative weakness of incompletely ossified tibial eminence compared to native acl fibres. meyers and mckeever classified these injuries in 1959 as non - displaced (type i), partially displaced or hinged (type ii) and completely displaced (type iii) fractures. this classification was modified by zaricznyj to include comminuted avulsion fractures (type iv). the patient had severe pain and swelling and was unable to bear weight in the affected knee. x - rays revealed displaced tibial spine fracture [fig. 1, 2 ], and the young boy was treated with cast. however, the patient was uncomfortable with the cast and came to our institute. it was displaced fracture. note the heterogenous palpable mass about 35 28 30 mm in posterolateral aspect of the left lateral malleolus. notice the incision scar of foot shortening operation, the patient underwent at adolescent age. both the portals should be standard or slightly low as higher portal may put the scope above the fractured fragment and one may not be able to see the fracture clearly. it also involved significant portion of medial tibial platue [fig. 4, 5 ]. fracture was reduced with help of acl zig and under c- arm guidance provisionally fixed with guide wire from superolateral portal taking care not to cross physis, as it was a large fragment it was not sitting completely from medial side so another wire was used from superomedial portal to fix medial side of fragment perpendicular to lateral wire, again without crossing the physis. two 3.5 mm partially threaded cannulated screws (zimmer) were directly used 45 mm from lateral side and 35 mm from medial side [fig. stability of the fragment was assessed with a probe and was found to be stable [fig. 6 ]. post - op x - rays showed proper postion of both the screws [fig. 8, knee range of motion was allowed from 0 - 90 for 2 weeks than 0 - 120 for next 2 weeks. after one month, he was allowed to walk without knee brace. at 6 months, patients was allowed to run. mri clearly shows the heterogeneous large soft tissue mass lesion on the posterior aspect of left ankle. appearance of the ankle after local recurrence, which lead to dehiscence of surgical area. arthroscopic fixation of displaced tibial spine fracture is a standard procedure [8, 9 ]. commonly, tibial spine is fixed either with cannulated screws or strong non absorbable sutures. in patients with open physis, injury to physis is a serious concern as it may lead to various growth disturbances [10, 11 ]. in patients with open physis, suture fixation is considered safer than cannulated screw fixation but even suture fixation requires drilling through the physis which may cause damage to the physis, incidence of growth disturbances have been reported even with transphyseal suture technique which lead to development of transepiphyseal suture technique. both transphyseal and transepiphyseal suture techniques are quite complex and require more time as compared to screw fixation technique. biomechanical studies on strength of various fixation techniques have produced mixed results [5, 6, 7 ]. in porcine model, egger & colleagues demonstrated that fiber wire (arthrex) suture were superior to ethibond suture (ethicon) and 1 or 2 ante grade cannulated screws in single and cyclical loading protocol. in bovine model, mahar and colleagues found no difference between ethibond suture, bioabsorbable nails, single bioabsorbable screw or single metal screw in an ultimate failure test. in cyclical loading test, tsucada and coworkers found a statistically significant difference in displacement favoring cannulated screw over ethibond suture. in cases of comminuted fractures suture technique is preferred as screws are unlikely to provide adequate fixation [5, 6, 7 ]. in this case as this was large fragment, we used two cannulated screws (zimmer) perpendicular to each other holding only in epiphysis for fixation. thus avoiding any risk of physeal damage. these self tapping screws are directly used after provisional fixation with guidewire as no drilling is required. we started full weight bearing mobilization in post knee brace from second post op day. for first two weeks knee rom from 0 - 90 was allowed which was increased to 120 for next two weeks. thus, arthroscopic fixation with two cannulated screws perpendicular to each other is a very simple technique providing a strong construct and thus allows early mobilization. arthroscopic fixation of tibial spine fracture in patients with open physis with two cannulated screws perpendicular to each other is a very simple technique that provides a strong construct and allows early mobilization without any risk of damage to growth plate. arthroscopic fixation of tibial spine fracture in patients with open physis with two cannulated screws perpendicular to each other is very strong construct, allowing early mobilization without risk of damage to growth plate. | introduction : arthroscopic fixation of tibial spine fracture without damage to the growth plate is very important in patients with open physis. the present article describes a simple and effective technique being used for the first time to treat this condition.case report : a 16-year - old boy sustained avulsion fractures of tibial spine while playing. he was treated arthroscopically with excellent result.conclusion:arthroscopic fixation of tibial spine fracture in patients with open physis with two cannulated screws perpendicular to each other is a very simple technique which provides strong construct, and allows early mobilization without risk of damage to the growth plate. |
volume repletion in the acutely hypovolemic injured patient is essential for maintaining perfusion to critical organs. traditionally, this has been achieved through the infusion of isotonic crystalloids, sometimes in massive quantities. however, it is increasingly recognized that overzealous crystalloid administration in critically ill - patients is detrimental to the outcome. for example, excessive fluid gain has been associated with increased risk of anastomotic dehiscence, abdominal compartment syndrome, risk of multiple - organ dysfunction, prolonged mechanical ventilation, delayed return of gastrointestinal function, and excess mortality. after resuscitation is complete, it is suggested that diuresis to rapidly remove excess fluid gained could be beneficial. just as controlled resuscitation with prespecified endpoints (i.e., goal - directed resuscitation) has been demonstrated to be superior to an unstructured approach, the converse (i.e., fluid removal) might similarly benefit from a planned approach. loop diuretics are the most commonly prescribed diuretics in the intensive care unit (icu) setting, and they work by blocking chloride reabsorption in the ascending loop of henle. importantly, all diuretics (except spironolactone) must reach the luminal side of the nephron in order to exert their action. in addition, the drug concentration must exceed a minimum threshold concentration at that site of action to evoke a response. above this threshold, the diuretic response increases with increasing dose up to a maximum response, at which point escalating drug doses only serve to increase toxicity without diuretic benefit. the goal of diuretic therapy, then, should be to maintain luminal drug concentrations somewhere between the minimum threshold and the maximum response for as long as possible. the extent of diuretic response is also dependent upon the time course of drug delivery to the active site. intermittent bolus dosing is associated with peaks and troughs and variability of luminal drug concentration, resulting in substantial time spent below the minimum threshold of efficacy. theoretically, continuous infusion dosing results in a lower peak serum concentration, with more consistent drug delivery and urine output. this may translate into reduced risk of renal failure, ototoxicity, or electrolyte derangements. studies in healthy volunteers have concluded that an intravenous (iv) bolus is the least efficient mode of administration and that controlled infusion at maximum efficiency could increase diuretic response up to 2.3 times higher. it has previously been reported that the use of furosemide in critically ill, fully resuscitated trauma patients is safe and effective in promoting diuresis. however, the optimal mode of delivery has not been adequately investigated. in clinical practice, intermittent bolus dosing results in brisk, immediate diuresis, but this effect soon wears off, and the degree of fluid removal is often sub - optimal, especially when repeat dosing is reliant upon physician discretion. a nurse - driven continuous infusion protocol, on the other hand, may enhance overall diuretic use when explicit diuresis goals are stated at the outset and strict parameters guide subsequent dose adjustments. similar nurse - driven protocols for heparin and insulin infusion have been in long - standing use and are widely accepted as superior to dosing based on individual physician discretion. in 2011, we developed a sliding scale continuous furosemide infusion (cfi) protocol that stated a daily net negative fluid balance goal (600 to 2000 ml) at the outset. with the end point set in advance, we were thus able to calculate the necessary hourly net negative fluid balance required to achieve that goal and adjust the cfi accordingly. the aim was to achieve more reliable and consistent diuresis with less variability in urine output and potentially less hemodynamic swings. we hypothesized that the use of a protocolized cfi is safe and more effective in fluid removal than intermittent bolus injection by physician discretion in diuretic - nave, fully resuscitated, fluid overloaded critically ill trauma patients. this is a prospective case control study in which we compared patients that were treated following the new cfi protocol (cases - cfi) with contemporaneous patients who received intermitted bolus injection of furosemide guided by physician discretion (controls - ibi). matching criteria were age (10 years), gender, injury severity score (iss) (10), apache 2 score (3), and net fluid balance at the initiation of diuresis (2.5 l). based on our review of the literature as well as our hospital data, we developed the cfi protocol. within our division, we reached consensus on the addition of this protocol to daily practice in which diuresis based on physician discretion had been the standard of care. the inclusion criteria for patients to enter the cfi study group were : admission to the surgical icu, an attending physician judgment that the patient needed diuresis, age > 18 years, > 5.0 l net fluid positive since icu admission, anticipated icu length of study > 24 h after initiation of diuresis, and a hemodynamically stable status (defined as mean arterial pressure > 60 without vasopressor requirement for > 12 h, heart rate (hr) 3). the cfi protocol began with a 10 mg iv furosemide loading dose, followed by an initial infusion rate of 2 mg / h. after 4 h (and every 4 h thereafter), the net fluid balance was assessed for underachievement, overachievement, or target diuresis. if the net negative fluid balance was under the stated goal, an additional 10 mg iv loading dose was given, and the infusion rate was increased by 1 mg / h. if the net negative fluid balance was over the stated goal, the infusion was temporarily discontinued for 1 h and resumed at a rate 1 mg / h less than the previous rate. no changes were made if the target diuresis was achieved [figure 1 ]. in the ibi group, furosemide was prescribed as per usual clinical practice in diuretic - naive patients ; initial doses were usually 10 mg or 20 mg iv, and subsequent doses were given at the clinician 's discretion. continuous furosemide infusion protocol safety parameters for discontinuation of the gdd protocol are stated in figure 2. serum potassium levels were monitored twice a day and aggressively replaced as per standard of care. safety limits to discontinue gdd protocol data collection included baseline demographics (age, gender, race), mechanism of injury, surgical diagnosis, comorbid medical conditions, physiologic parameters (such as systolic blood pressure, mean arterial blood pressure, hr, urine output, and net fluid balance), laboratory data (creatinine, potassium, blood gas), and clinical outcomes. the primary outcomes of interest were the total milligrams of furosemide and total urine output for the 1 day of diuresis. secondary outcomes included net 24 h fluid balance, hospital and icu length of stay (los), ventilator - free days (vfd), and mortality. we compared the cfi (cases) and ibi (controls) groups to identify differences in patient characteristics and outcomes. continuous variables were summarized using mean standard deviation and compared by student 's t - tests, or summarized using median with interquartile and compared by wilcoxon rank sum tests, whichever appropriate. all statistical analyses were performed using sas version 9.3 (the sas institute, cary, nc, usa). 2011p002771) and complies with the ethical standards laid down in the 1964 declaration of helsinki and its later amendments. this is a prospective case control study in which we compared patients that were treated following the new cfi protocol (cases - cfi) with contemporaneous patients who received intermitted bolus injection of furosemide guided by physician discretion (controls - ibi). matching criteria were age (10 years), gender, injury severity score (iss) (10), apache 2 score (3), and net fluid balance at the initiation of diuresis (2.5 l). based on our review of the literature as well as our hospital data, we developed the cfi protocol. within our division, we reached consensus on the addition of this protocol to daily practice in which diuresis based on physician discretion had been the standard of care. the inclusion criteria for patients to enter the cfi study group were : admission to the surgical icu, an attending physician judgment that the patient needed diuresis, age > 18 years, > 5.0 l net fluid positive since icu admission, anticipated icu length of study > 24 h after initiation of diuresis, and a hemodynamically stable status (defined as mean arterial pressure > 60 without vasopressor requirement for > 12 h, heart rate (hr) 3). the cfi protocol began with a 10 mg iv furosemide loading dose, followed by an initial infusion rate of 2 mg / h. after 4 h (and every 4 h thereafter), the net fluid balance was assessed for underachievement, overachievement, or target diuresis. if the net negative fluid balance was under the stated goal, an additional 10 mg iv loading dose was given, and the infusion rate was increased by 1 mg / h. if the net negative fluid balance was over the stated goal, the infusion was temporarily discontinued for 1 h and resumed at a rate 1 mg / h less than the previous rate. no changes were made if the target diuresis was achieved [figure 1 ]. in the ibi group, furosemide was prescribed as per usual clinical practice in diuretic - naive patients ; initial doses were usually 10 mg or 20 mg iv, and subsequent doses were given at the clinician 's discretion. continuous furosemide infusion protocol safety parameters for discontinuation of the gdd protocol are stated in figure 2. serum potassium levels were monitored twice a day and aggressively replaced as per standard of care. data collection included baseline demographics (age, gender, race), mechanism of injury, surgical diagnosis, comorbid medical conditions, physiologic parameters (such as systolic blood pressure, mean arterial blood pressure, hr, urine output, and net fluid balance), laboratory data (creatinine, potassium, blood gas), and clinical outcomes. the primary outcomes of interest were the total milligrams of furosemide and total urine output for the 1 day of diuresis. secondary outcomes included net 24 h fluid balance, hospital and icu length of stay (los), ventilator - free days (vfd), and mortality. we compared the cfi (cases) and ibi (controls) groups to identify differences in patient characteristics and outcomes. continuous variables were summarized using mean standard deviation and compared by student 's t - tests, or summarized using median with interquartile and compared by wilcoxon rank sum tests, whichever appropriate. all statistical analyses were performed using sas version 9.3 (the sas institute, cary, nc, usa). 2011p002771) and complies with the ethical standards laid down in the 1964 declaration of helsinki and its later amendments. fifty - five patients were included, with 19 cfi cases, and 36 ibi controls matched 1:2 except for two patients for whom second ibi controls could not be found. for cfi cases, mean age was 54 years, mean iss was 32.7, and mean initial tbb was + 7.7 l. after 1-day of diuresis with cfi versus ibi, net 24 h fluid balance was negative (0.55 l vs. + 0.43 l, p = 0.026) and potassium and creatinine values were not significant different. p < 0.001) and urine output (4.2 l vs. 2.8 l, p < 0.001) were significantly increased in the cfi group, compared with the ibi group, and vital signs before and after initiating diuresis were not significantly different in both groups. there were no statistically significant differences in icu or hospital los, vfd, po2/fio2 (p / f) ratio or mortality [table 1 ]. in this case control study, we report that the use of protocolized cfi, or goal - directed diuresis, resulted in significantly more furosemide administration with resultant more diuresis and net negative fluid balance when compared with diuresis directed by physician discretion and intermittent bolus injection. it is reassuring to note that in both groups, vital signs were not affected, and usual clinical parameters of acute kidney injury (blood urea nitrogen, creatinine) were likewise unchanged. although our study focused exclusively on critically ill injured patients, our results are consistent with those in other studied populations, mainly cardiac surgery and congestive heart failure patients. two meta - analyses of randomized controlled trials in patients with acute decompensated heart failure have demonstrated superior weight loss with cfi compared to ibi without any significant differences in electrolyte imbalances or side effects. trials in cardiac surgery have similarly reported improved diuretic efficiency with continuous infusion compared to bolus dosing : more negative fluid balance, decreased time to extubation, and significantly decreased oxygen requirements with fewer alterations in cardiac index and filling pressures. in one report, cardiac index, central venous pressure, and diastolic pulmonary artery pressures remained unchanged and vasopressor support requirements decreased, despite an average of 5.7 l of urine output over a 24 h period. cfi was also shown to be superior to bolus injection (at the same overall dose) in patients with chronic renal insufficiency, despite a six - fold lower peak plasma drug concentration. drug - induced myalgias occurred exclusively during bolus injection dosing. in a randomized trial of 22 micu patients with pulmonary edema or fluid overload, mojtahedzad reported that cfi, compared to bolus injection, was more effective in promoting diuresis and improved p / f ratio and had less dramatic changes in hr and potassium concentrations. reported in a systematic review of eight randomized trials (n = 254) that cfi dosing resulted in greater diuresis and a better safety profile (less tinnitus and hearing loss) when compared to bolus injection. a randomized study of protocolized continuous infusion versus protocolized bolus injection furosemide in mixed medical - surgical patients was terminated early for futility when interim analysis showed the equivalency of net diuresis. the authors also compared enrolled protocolized patients (of either arm) with nonrandomized, nonprotocolized patients, and reported significant differences in net cumulative fluid balance (4.5 l vs. 1.3 l), attributed to less cumulative furosemide dose (diuretic efficiency). for those patients who survived to discharge, the act of protocolization, rather than a mode of delivery, appeared to drive the superior outcomes in this study. it is important to note that if a cfi is to be employed, it should be accompanied by a loading dose to achieve drug levels quickly above minimum efficacious threshold. without this loading dose, the onset of diuresis is delayed approximately 3 h. a meta - analysis of continuous versus intermittent dosing of loop diuretics in hospitalized patients concluded that superior urine output and weight loss occurred only in trials where a loading dose preceded the continuous infusion. first, this was not a randomized trial and therefore there may be unmeasured confounders, despite our best attempts to match the cases to controls. for example, the mere act of protocolization itself, rather than the continuous infusion, may have been the reason for the increased furosemide administration and diuresis. at the time of this study, we did not have a protocol for intermittent injections and hence we could not test this hypothesis. regardless, we do not feel that this significantly detracts for the conclusion that protocolization resulted in significantly more diuresis than individual discretion. when this occurred, it was almost always early cessation of the infusion (in the absence of laboratory or clinical derangements). other protocol deviations, such as absent loading dose and inappropriate dose de - escalations, were common as well. however, in this early experience with cfi in this patient population, we felt it prudent to allow protocol deviations. rather than quantify and catalog each deviation, we chose instead to analyze the patients on an intention - to - treat basis rather than per - protocol. as such, it is important to emphasize that our analysis and conclusions are on the strategy of goal - directed diuresis using cfi and not the flawless implementation of the protocol. thirdly, we did not continue data collection beyond the first 24 h after initiating furosemide in either group. the reason for this is because we found that many patients had their infusion discontinued between the 2 and 4 day of diuresis. we allowed the clinicians to discontinue the infusion once adequate diuresis (in their judgment) was complete. fourthly, the sample size is admittedly small and therefore there is a risk of type 2 statistical error. our study is underpowered to detect differences in clinically meaningful outcomes such as ventilator - free days, complications (pulmonary, gastrointestinal, cardiac, infectious, etc.), icu or hospital los, and mortality. our findings should be interpreted with caution and should be viewed as hypothesis - generating for future adequately powered studies. nevertheless, this preliminary description of the use of protocolized furosemide infusion demonstrates proof of concept in this patient population and we have found our protocol to be generally well - tolerated and effective in attaining the goal of achieving negative fluid balance. at our own institution, we have become more comfortable with the protocol with increasing experience and continue to use it in appropriately selected patients. in significantly fluid overloaded, icu trauma patients, goal - directed diuresis using a protocolized continuous furosemide infusion results in increased fluid removal without demonstrable morbidity. | background : excessive crystalloid administration is common and associated with negative outcomes in critically ill trauma patients. continuous furosemide infusion (cfi) to remove excessive fluid has not been previously described in this population. we hypothesized that a goal - directed cfi is more effective for fluid removal than intermittent bolus injection (ibi) diuresis without excess incidence of hypokalemia or renal failure.materials and methods : cfi cases were prospectively enrolled between november 2011 and august 2012, and matched to historic ibi controls by age, gender, injury severity score (iss), and net fluid balance (nfb) at diuresis initiation. paired and unpaired analyses were performed to compare groups. the primary endpoints were net fluid balance, potassium and creatinine levels. secondary endpoints included intensive care unit (icu) and hospital length of stay (los), ventilator - free days (vfd), and mortality.results:55 patients were included, with 19 cases and 36 matched controls. mean age was 54 years, mean iss was 32.7, and mean initial nfb was + 7.7 l. after one day of diuresis with cfi vs. ibi, net 24 h fluid balance was negative (0.55 l vs. + 0.43 l, p = 0.026) only for the cfi group, and there was no difference in potassium and creatinine levels. cumulative furosemide dose (59.4 mg vs. 25.4 mg, p < 0.001) and urine output (4.2 l vs. 2.8 l, p < 0.001) were also significantly increased with cfi vs. ibi. there were no statistically significant differences in icu los, hospital los, vfd, or mortality.conclusions:compared to ibi, goal - directed diuresis by cfi is more successful in achieving net negative fluid balance in patients with fluid overload with no detrimental side effects on renal function or patient outcome. |
atrophic acne scars are dermal depressions commonly caused by destruction of collagen after inflammatory acne. many therapeutic measures such as chemical peeling, subcision, dermabrasion, fillers and punch techniques have been performed to improve acne scarring but with sub - optimal outcomes. ablative lasers such as er : yag lasers or co2 lasers produce significant improvement at the cost of long recovery times and post - inflammatory hyperpigmentation. recently, newer techniques such as microneedling fractional radiofrequency (mfr) has been shown to be clinically efficient in managing acne scars without causing direct damage to the epidermis. after damage to the reticular dermis, long - term dermal remodelling, neoelastogenesis, and neocollagenogenesis results in dermal thickening. mfr device was evaluated over a period of 1 year (dec 2012 to nov 2013) in 31 patients of skin type iii a retrospective photographic analysis of 31 patients treated with mfr for facial atrophic acne scarring was done between november 2012 and december 2013. patients were excluded if they had received treatment with any other lasers during treatment or follow - up period. thirty - one patients (15 male and 16 female) met the inclusion criteria. patients had undergone four sessions of mfr treatment for their acne scars with an interval of 6 weeks between each session, since the time for collagen remodelling lasts around 4 - 6 weeks. the procedure area was painted with povidone iodine and cleaned with rectified surgical spirit prior to the procedure. penetration depth was limited to 1.5 mm on forehead, temple areas and areas with bony prominences. patients with predominantly ice pick scars and mixed scarring were given a needle depth of 3.5 mm on the first pass, 2.5 mm on the 2 pass and 1.5 mm on the 3 pass with minimal or no overlapping. higher energy settings (35 w-40 w) at depths of 3.5 mm with successively lower energy levels (30 w-35 w, 25 w-30 w, respectively) were used at lower penetration depths to prevent epidermal coagulation. post - procedure pain was managed by oral non steroidal anti - inflammatory drugs (nsaids) for 2 to 5 days. patients were advised strict sun protection along with re - epithelizing agents containing cyclopentasiloxane, cyclohexasiloxone and sodium hyaluronate. objective assessment of physician scores of improvement was determined by global acne scarring classification of goodman & baron [tables 1 and 2a and b ]. goodman and baron 's qualitative acne scar grading system (a) goodman and baron 's quantitative acne scar grading system (b) assessment of improvement using goodman and baron 's quantitative acne scar grading system objective assessment of physician scores of improvement was determined by global acne scarring classification of goodman & baron [tables 1 and 2a and b ]. goodman and baron 's qualitative acne scar grading system (a) goodman and baron 's quantitative acne scar grading system (b) assessment of improvement using goodman and baron 's quantitative acne scar grading system most patients had mixed types of atrophic acne scars, including ice pick, boxcar and rolling scars. mfr was associated with substantial improvement in the appearance of all types of acne scars, which included the softening of scar contours as well as reduction in scar depth. estimation of improvement with goodman and baron 's global qualitative acne scarring system was done. out of 31 patients who completed the treatment, 14 patients had grade 4, 17 patients had grade 3 before treatment. the physician 's assessment of response to treatment based on goodman and baron qualitative scar grading system is summarised in table 3. in patients with grade 4 scars, 12 patients (85.71%) showed improvement by 2 grades, i.e. their scars improved from grade 4 to grade 2 of goodman and baron scale [figure 1a and b ]. two patients (14.28%) with grade 4 scars showed improvement by 1 grade with scars being obvious at social distances of 50 cm or greater. in 17 patients with grade 3 scars, 13 patients (76.47%) improved by 2 grades [figure 2a and b ] and 4 patients (23.52%) showed improvement by 1 grade [figure 3a and b ]. physician assessment response based on goodman and baron 's qualitative acne scar grading (a) grade 4 acne scars, (b) improvement in acne scars from grade 4 to grade 2 after treatment (a) grade 3 acne scars, (b) improvement in acne scars from grade 3 to grade 1 after treatment (a) grade 3 acne scars, (b) improvement in acne scars from grade 3 to grade 2 after treatment estimation of improvement with goodman and baron 's global quantitative acne scarring system showed that 58% of the patients had moderate improvement, 29% had minimal improvement, 9% had good improvement and 3% showed very good improvement [figure 4 ]. bar graph representing improvement in acne scars by goodman and baron 's quantitative acne scar grading system the treatment was generally well tolerated. all patients had reported mild erythema for two days, two patients had oedema for more than three days, five patients reported post inflammatory hyperpigmentation and two patients had track marks of the device probe [figure 5 ]. although acne scarring is likely to be associated more often with nodulocystic acne, it may occur in cases with only superficial forms of acne as well, especially when effective treatment is delayed. a study showed that approximately 16% of patients with acne seek proper treatment, and among those seeking such help, 74% wait greater than 12 months, 12% wait for 6 to 12 months, 6% wait for 6 months and only 7% wait for less than 3 months to be seen professionally for therapy of their acne. the major clinical types of atrophic scars are ice pick, rolling or superficial and deep soft scars, and boxcar or depressed fibrotic scars. although ablative and non - ablative laser skin resurfacing has greatly improved the treatment of atrophic acne scars, they are not without disadvantages. ablative lasers such as co2 and er : yag laser have efficacy of 25 - 90% for treatment of acne scars but are associated with erythema for more than 3 months, dyspigmentation and scarring. non - ablative lasers such as 1064 nm nd yag and 1450 nm diode lasers have an efficacy of 40 - 50% after a series of treatments, with effect only on shallow box scars with no significant epidermal improvement. in contrast to ablative and non ablative lasers, treatment with the mfr device can be controlled by varying the depth. a microneedling fractional radiofrequency (rf) device is available for commercial use (lutronic corporation usa) with a maximum energy output of 50 w and capable of delivering energy in increments of 2.5 w in 20 equally graded energy level settings (level 1 - 2.5 w to level 20 - 50 w).. a good control over the tissue damage can be achieved by changing the exposure time rather than altering the power level. although the maximum power is higher than many other devices, the large range of exposure time enables the user to apply safe and consistent levels of coagulation in the dermis to achieve the desired effect. the energy delivery system consists of a disposable tip with 49 gold - plated needles. the entire length of the needle is insulated and it delivers bursts of rf energy through the tip. the depth of the needles can be adjusted from a minimum of 0.5 mm to a maximum of 3.5 mm. the ability to set multiple needle depths per pass is an advantage, allowing discrete electrothermal coagulation at different layers of the dermis. the insulated needles prevent electrothermal damage from occurring anywhere in the dermis but at the very tip of the needle and never in the epidermis. the mechanisms involved are neo - collagenogenesis by needle penetration stimulating the release of growth factors and relative sparing of epidermis and adnexal structures which contribute to rapid healing. ramesh. treated facial acne scars of 30 subjects with a matrix tunable radiofrequency device pretreated with oral antibiotics, topical tretinoin and subcision. the visual analog scale of improvement in scars ranged from 10 - 50% at end of 2 months to 20 - 70% at the end of 6 months. despite these differences both studies show that fractional radiofrequency is both safe and effective for treatment of acne scars in skin types 3, 4 and 5. gold., conducted a study where in 13 patients with mild to moderate acne scars were treated with bipolar fractional radiofrequency and concluded that fractional bipolar radiofrequency is safe and an effective treatment for acne scars with 67 - 92% patients satisfied with the results. cho. evaluated efficacy of fractional radiofrequency in treatment of 30 patients with mild to moderate acne scars and large facial pores. the grade of acne scars and investigator global assessment of large pores improved in more than 70% of the patients. the encouraging results prompted us to conduct retrospective analysis of efficacy and safety of mfr to treat atrophic acne scars in patients of indian ethnicity, skin type 4 and 5. estimation of improvement with goodman and baron 's global qualitative acne scarring system showed that in 14 patients with grade 4 scars, 85.71% showed improvement by 2 grades, 14.28% showed improvement by 1 grade. in 17 patients with grade 3 scars, 76.47% improved by 2 grades and 23.52% showed improvement by 1 grade. of the 31 patients with grade 3 and grade 4 acne scars, 80.64% showed improvement by 2 grades and 19.35% showed improvement by 1 grade. estimation of improvement with goodman and baron 's global quantitative acne scarring system showed that 58% of the patients had moderate improvement, 29% had minimal improvement, 9% had good improvement and 3% showed very good improvement hence, all 31 patients (100%) showed improvement in their scars with no failure rate. the treatment was well tolerated with transient side effects such as mild erythema, post - inflammatory hyperpigmentation and track marks of the device. a microneedling fractional radiofrequency (rf) device is available for commercial use (lutronic corporation usa) with a maximum energy output of 50 w and capable of delivering energy in increments of 2.5 w in 20 equally graded energy level settings (level 1 - 2.5 w to level 20 - 50 w). the duration of each energy pulse can be set from 10 ms to 1,000 ms. a good control over the tissue damage can be achieved by changing the exposure time rather than altering the power level. although the maximum power is higher than many other devices, the large range of exposure time enables the user to apply safe and consistent levels of coagulation in the dermis to achieve the desired effect. the energy delivery system consists of a disposable tip with 49 gold - plated needles. the entire length of the needle is insulated and it delivers bursts of rf energy through the tip. the depth of the needles can be adjusted from a minimum of 0.5 mm to a maximum of 3.5 mm. the ability to set multiple needle depths per pass is an advantage, allowing discrete electrothermal coagulation at different layers of the dermis. the insulated needles prevent electrothermal damage from occurring anywhere in the dermis but at the very tip of the needle and never in the epidermis. the mechanisms involved are neo - collagenogenesis by needle penetration stimulating the release of growth factors and relative sparing of epidermis and adnexal structures which contribute to rapid healing. ramesh. treated facial acne scars of 30 subjects with a matrix tunable radiofrequency device pretreated with oral antibiotics, topical tretinoin and subcision. the visual analog scale of improvement in scars ranged from 10 - 50% at end of 2 months to 20 - 70% at the end of 6 months. despite these differences both studies show that fractional radiofrequency is both safe and effective for treatment of acne scars in skin types 3, 4 and 5. gold., conducted a study where in 13 patients with mild to moderate acne scars were treated with bipolar fractional radiofrequency and concluded that fractional bipolar radiofrequency is safe and an effective treatment for acne scars with 67 - 92% patients satisfied with the results. cho. evaluated efficacy of fractional radiofrequency in treatment of 30 patients with mild to moderate acne scars and large facial pores. the grade of acne scars and investigator global assessment of large pores improved in more than 70% of the patients. the encouraging results prompted us to conduct retrospective analysis of efficacy and safety of mfr to treat atrophic acne scars in patients of indian ethnicity, skin type 4 and 5. estimation of improvement with goodman and baron 's global qualitative acne scarring system showed that in 14 patients with grade 4 scars, 85.71% showed improvement by 2 grades, 14.28% showed improvement by 1 grade. in 17 patients with grade 3 scars, 76.47% of the 31 patients with grade 3 and grade 4 acne scars, 80.64% showed improvement by 2 grades and 19.35% showed improvement by 1 grade. rolling and estimation of improvement with goodman and baron 's global quantitative acne scarring system showed that 58% of the patients had moderate improvement, 29% had minimal improvement, 9% had good improvement and 3% showed very good improvement hence, all 31 patients (100%) showed improvement in their scars with no failure rate. the treatment was well tolerated with transient side effects such as mild erythema, post - inflammatory hyperpigmentation and track marks of the device. mfr treatment can be considered as an effective modality of treatment for moderate to severe acne scars in patients with an added advantage of minimal downtime and effective improvement. | background : various treatment modalities including non - invasive methods such as chemical peels, topical retinoids, microdermabrasion, minimally invasive techniques such as microneedling, fractional lasers, microneedling radiofrequency devices and invasive procedures such as acne scar surgeries and ablative lasers are used for acne scars, each with its own unique advantages and disadvantages. this study is a retrospective assessment of efficacy and safety of microneedling fractional radiofrequency in the treatment of acne scars.methods:thirty one patients of skin types iii - v with moderate and severe facial acne scarring received four sequential fractional radiofrequency treatments over a period of 6 months with an interval of 6 weeks between each session. goodman & baron 's acne scar grading system was used for assessment by a side by side comparison of preoperative and post- operative photographs taken at their first visit and at the end of 3 months after the last session.results:estimation of improvement with goodman and baron 's global acne scarring system showed that by qualitative assessment of 31 patients with grade 3 and grade 4 acne scars, 80.64% showed improvement by 2 grades and 19.35% showed improvement by 1 grade. quantitative assessment showed that 58% of the patients had moderate, 29% had minimal, 9% had good and 3% showed very good improvement. adverse effects were limited to transient pain, erythema, edema and hyperpigmentation.conclusion:microneedling fractional radiofrequency is efficacious for the treatment of moderate and severe acne scars. |
with the increase in international travels and multiracial communities in the united states, non - rubella immune (nri) pregnant women as well as nonimmune individuals are at risk of rubella infection. a study in 1988 suggested that between 7.5 and 17.4% of pregnant women in the united states lack immunity to rubella. similarly, a prevalence rate of 15.1% among pregnant women was reported in 1999 by investigators in michigan. in addition, a rate of 9.1% was found among women who attended prenatal care at lejeune nc in 2004. in view of the recent report of two adult cases of rubella infection in the united states, the importance of identifying populations at risk for rubella infection can not be over emphasized. this may result in miscarriage, fetal death, or severe anomalies in the infant with crs. infection during the first trimester of pregnancy is associated with worst outcomes and development of multiple organ anomalies associated with crs. some of the effects of crs may not be apparent at birth and may manifest as a chronic disease capable of producing ongoing organ damage throughout the life of an infected child. although the prevalence of crs and adult rubella infection declined remarkably following the introduction of rubella vaccine in 1969 in the united states [8, 9 ], the disease is still endemic in many developing countries. in many developing countries such as sub - saharan africa, there is no existing national vaccination program against rubella, and surveillance data is limited [10, 11 ]. these developing countries are responsible for most of the estimated 238,000 global cases of children born annually with crs. in the united states, the last major epidemic of the disease resulted in about 12.5 million cases of infection, 20 000 cases of crs and 11,000 fetal deaths. sporadic cases of the disease still occur in the united states [14, 15 ] because of lack of universal immunization, primary and secondary vaccine failure and reinfections [16, 17 ]. some sporadic cases in the united states have led to the association of race with rubella infection. for instance, rangel and colleagues reported outbreak of rubella infection in a hispanic community in north carolina. in addition, another outbreak was reported in meat processing plants that employed many hispanics and other foreign nationals in kansas and nebraska. similarly, plotinsky and colleagues reported a case of crs in an infant born to a liberian refugee living in new hampshire. furthermore, during 1997 to 1999, 81% of reported crs cases were hispanics and 92% of the infants were born to foreign mothers. apart from the numerous medical consequences of the disease [2124 ], the economic cost of the disease is also enormous. identification and protection of nri women of child bearing age against rubella will prevent crs and its associated morbidity, mortality, and economic health burden. the objectives of this study were to evaluate the prevalence and distribution of nri among pregnant women who attended multiracial high - risk prenatal clinic in 2007. findings from the study may provide the rationale for targeted public health intervention that may prevent reemergence of rubella. this is a retrospective, chart review study involving pregnant women who attended high - risk prenatal clinic in northwestern iowa in 2007. this study was part of a routine evaluation of prenatal care in the clinic and approved by sioux city institutional review board, iowa, united states. the clinic serves a diverse population of low - income and multiracial groups including a large hispanic population, non - hispanic whites, native americans, african americans, asians, and african immigrants living in the tri - state area of nebraska, iowa, and south dakota. during their initial prenatal visit, all patients gave blood samples for routine prenatal laboratory screening. rubella screening was conducted by evaluating serum rubella igg antibody titer using enzyme linked immunosorbent assay (elisa) (wampole laboratories, princeton, nj) as described previously. individuals with equivocal results and those with no rubella igg antibody were regarded as nonimmune. single researcher extracted the data in microsoft excel (microsoft corp., redmond, wa) for analysis. prevalence rate in the study population was calculated by dividing the number of nri women with the total number of women screened during the study period. these include less than 20 years of age, or adolescent, 2029 years of age and 30 or more years of age. nri prevalence rates in these age groups were calculated by dividing the number of nri in the age group by the total number of women screened in that age group. furthermore, we evaluated the prevalence rates in four major study populations, namely, hispanics, whites, native americans, and african americans. data was analyzed using sigma stat software (jandel scientific, san rafael, ca). statistical significance was established using chi square or fisher 's exact test. to control for possible differences in age distribution across race / ethnic groups, race / ethnic group was the primary explanatory variable, and whites were selected as the reference category for comparison purposes. age was added to the unadjusted logistic model to determine the relationship between race / ethnicity and the presence or absence of rubella immunity while holding constant the influence of age. non - hispanic population comprised of whites or caucasians (180), african americans (34), native americans (52), asians (21), and others (7). the asians, biracial (3), and africans from somalia (4) were in the group classified as women aged 2029 years of age constituted the highest number of subjects and accounted for 57.9% of the study population. adolescents and women 30 or more years of age accounted for 18.4% and 23.7% of the study population, respectively. the prevalence rate among native americans was highest at 17.3%, compared to whites 7.3%, blacks 5.9%, and hispanics 4.6% (see figure 1). in the study population, prevalence rate among adolescents was 10.2% compared to 6.2% and 5.9% among women aged 2029 and 30 or more years of age, respectively (see figure 2). analysis of the trend in three major racial groups demonstrated a high rate among native american teenagers at 18.2% compared to whites and hispanics at 10.8% and 8.5%, respectively. in women aged 2029 years of age, the rate among native americans was 11.5% compared to 7.4% and 3.2% of whites and hispanics, respectively. among older women (30 years or more), the prevalence rate among native americans was 26.7% compared to 0% and 4.9% of whites and hispanics, respectively. the overall trend in nri in the three main racial groups demonstrated persistence of nri at a higher rate among native americans compared to whites and hispanics (see figure 3). crude and adjusted multivariate analysis demonstrated that native americans were more than two and a half times more likely not to have rubella immunity than whites (or 2.7 ; 95% ci : 1.1, 6.6). once we control for suspected differences in age distribution, the association remained (or 2.7 ; 95% ci : 1.1, 6.7). this study evaluated nri among women attending high - risk prenatal care in iowa, united states. the prevalence rate of nri demonstrated in this study appeared lower compared to previous studies in 1988 (7.5%17.4%), 1999 (15.4%), and 2004 (9.1%). one of the important findings of this study is the presence of comparatively higher nri among adolescents in the study population (see figure 2). this finding supports rubella booster vaccination for nonpregnant women such as high school female teenagers. secondly, booster vaccination may also prevent undiagnosed cases of rubella that resulted in congenital anomalies and first trimester loss of pregnancy. since there is no effective treatment of infection during pregnancy that will prevent crs, protecting women before pregnancy is therefore an attractive public health intervention against crs. another important implication of this study is the finding of significant prevalence of nri across all age groups among the native american women. compared to whites, native americans are more likely to be non - immune to rubella. this finding calls for further studies and evaluation of mmr vaccination programs existing in native american communities. replication of the findings in this study may warrant public health interventions aimed at protecting these communities from rubella epidemic. despite the important findings of this study, it should be seen as a pilot study because of the imbalance in the study population. however, the study may provide the basis for evaluation of longevity of immunity derived from rubella vaccine currently administered to children in the united states as part of mmr vaccine. similarly, this paper may provide the rationale for further studies in native american communities targeted at elucidating factors that foster decreased immunity to rubella. | since the introduction of the rubella vaccine in 1969, prevalence of congenital rubella syndrome (crs) has greatly declined in the united states. however, reports of sporadic adult cases of the disease and frequent identification of non - rubella immune (nri) women in prenatal units may result in outbreak of crs in susceptible communities. identifying populations with high rates of nri will assist in evidence - based public health intervention that may prevent epidemic of crs in the united states. method. this is a retrospective, cross - sectional study involving chart audit of rubella screening results of 642 women who attended a high - risk prenatal care at a northwestern iowa clinic between january 1 and december 31, 2007. results. nri was found in 6.9% of the study population. the highest prevalence rate of 10.2% was found among adolescents. nri was highest among native american women at 17.3%, compared to whites 7.3%, african americans 5.9%, and hispanics 4.6%. multivariate analysis demonstrated that native americans were 2.5 times more likely to be nri compared to whites (or 2.7 ; 95% ci : 1.1, 6.6). conclusion. this study demonstrated higher rate of non - rubella immunity among adolescent pregnant women and supports rubella booster immunization for all non - pregnant teenage women. the observed high rate of nri among native americans may require further studies and evaluation of rubella vaccination programs in tribal communities. |
with the exponential rise in health care costs, health care authorities worldwide are expressing the urgent need to obtain information on health care performance. evidence has suggested that the dissemination of data on performance can lead to improvements in the quality and efficiency of health care services. the most widely used conceptual model for health care performance evaluation, proposed by donabedian, describes performance according to three domains : structure, process, and outcome. process indicators refer to clinical processes performed in the health care setting and should be relevant, reliable, accessible, and clear. accessibility implies that they can be evaluated at low cost with data that are easy to obtain on a routine basis. according to the us agency for healthcare quality, performance indicators should be evaluated using measures of discrimination, validity, and forecasting. currently, trauma quality assurance activities vary greatly across trauma systems and are often limited to hospital - based audit of adverse patient outcomes despite the availability of clinical data in trauma registries. in addition, while numerous process indicators have been suggested in the literature, many can not be applied using registry data, and evidence of their validity is scarce. the objectives of this study were to (1) identify a series of process performance indicators (ppi) supported by literature review and/or expert consensus that can be calculated using trauma registry data and (2) evaluate selected ppi in terms of discrimination, construct validity, and forecasting. first, a review of the literature was performed to identify which of these ppi were supported by literature published between 1985 and 2008 using pubmed, embase, cinahl, cochrane, and proquest. second, a review of websites of state / provincial authorities, professional associations, and trauma centers from the usa, canada, and australia was performed to identify ppi that were used in practice. third, a multidisciplinary group of clinical experts serving as a steering committee for the quebec provincial trauma system had already established 14 ppi they intended to follow. ppi were selected if they met any of the following three criteria : supported by the literature, used by at least two systems without literature support, or suggested by the group of experts. ppi definitions that varied across systems for the same indicator (e.g., delays to operate) were refined by the steering committee. ppi that could be measured using the quebec trauma registry were then identified (and calculated for each of the 59 designated trauma centers. this multicenter retrospective cohort study was based on the inclusive trauma system of the province of quebec, canada. the quebec trauma system was instated in 1993 and involves regionalized care from urban level i trauma centers through to rural community hospitals. trauma level designations are based on american college of surgeons criteria and are revised periodically with on - site visits. during the study period, the system included 6 level i (including 2 pediatric), 4 level ii, 21 level iii, and 28 level iv trauma centers. standardized pre - hospital protocols ensure that major trauma cases are taken to these hospitals and standing agreements regulate between - center transfers within the system. data were drawn from the quebec trauma registry, which is mandatory for all 59 designated trauma centers and includes all deaths following injury, intensive care unit admissions, hospital stays > 2 days, and between - center transfers. the province of quebec, canada, has universal health coverage, and linkage with hospital discharge data has shown that the trauma registry captures approximately 75% of all trauma patients who meet these inclusion criteria and more than 85% of the most severe pathologies (i.e., traumatic brain injuries, thoracic and abdominal injuries). registry data are extracted from patient files by medical archivists who use standardized coding protocols. anatomic injury is coded with the abbreviated injury scale (ais) according to the guidelines published by the association for the advancement of automotive medicine. the registry is centralized at the quebec ministry of health and is subject to both systematic and periodic validation to identify and correct aberrant data values in all relevant data fields and to verify date and time chronology. supervision by a data coordinator, yearly on - going training, an electronic forum of coding queries, and thrice - yearly meetings with key stakeholders (e.g., trauma physicians, researchers, administrators) are used to improve data reliability and validity. this study was based on data collected during eight administrative years, i.e., between april 1998 and march 2006. deaths on arrival and patients who arrived with no vital signs and expired within 30 min of arrival were considered inevitable in the context of trauma center evaluation and were thus excluded from the study population. patients with an isolated hip fracture were also excluded because this pathology is commonly considered to be the consequence of a chronic disease rather than a traumatic event. hospital readmissions are not included in the trauma registry. if patients are entered twice for the same injury due to transfer, only information from the definitive acute care hospital was retained. only 2% of patients in the study sample were included more than once in the registry for repeated traumatic events. the observed proportion of conformity, calculated as the ratio of patients whose care conforms to the ppi divided by all patients eligible for the ppi, is subject to regression to the mean bias whereby it is more extreme than the true proportion, particularly for low - volume centers. we therefore used shrinkage techniques that estimate the true proportion using information from all centers rather than just the center under evaluation estimates are shrunk toward the global mean by a factor that is inversely proportional to the sample size. these shrinkage estimates not only account for regression - to - the - mean bias, but also improve the precision of estimates for low - volume centers and account for inflation of the type i error due to multiple comparisons, which otherwise leads to the detection of too many outliers. efron and morris argue that estimates derived through shrinkage are more suitable for policy making, for ordering (i.e., ranking), and for group comparisons (i.e., between - center comparisons) than conventional estimates and they have become standard for health care performance evaluation. the true proportion of conformity to each ppi along with 95% confidence intervals (ci) for each of the 59 trauma centers was calculated using a random - intercept multilevel model. conformity to each ppi is presented using a modified caterpillar plot where centers are ordered by designation level and volume to avoid ranking and to conserve the order of centers across ppi. ppi were evaluated using measures of discrimination, construct validity, and forecasting, according to us agency for healthcare quality recommendations. discrimination was defined as the ability of ppi to differentiate performance and was evaluated using between - center variance estimates along with 95% ci. ci that exclude 0 are considered to be consistent with significant deviations across trauma centers. construct validity was defined as the degree of association between specific ppi and other indicators of quality and was assessed by evaluating the correlation between each indicator and two hospital characteristics that have been shown to be related to performance : (i) designation level and (ii) volume. forecasting was defined as the ability of ppi to predict future performance and was assessed by evaluating the correlation within indicators over time ; indicators derived from data collected in the first 4 years of the study were compared to the same indicators derived from data collected in the last 4 years. correlation was assessed with pearson 's correlation coefficient and asymptotic 95% ci on true proportions (shrinkage estimates). these proportions were first transformed using a square - root arcsine transformation to normalize their distribution and were then weighted with the median number of eligible patients across ppi for each center. ethical approval was obtained from institutional ethics committees and the commision de laccs linformation du qubec. first, a review of the literature was performed to identify which of these ppi were supported by literature published between 1985 and 2008 using pubmed, embase, cinahl, cochrane, and proquest. second, a review of websites of state / provincial authorities, professional associations, and trauma centers from the usa, canada, and australia was performed to identify ppi that were used in practice. third, a multidisciplinary group of clinical experts serving as a steering committee for the quebec provincial trauma system had already established 14 ppi they intended to follow. ppi were selected if they met any of the following three criteria : supported by the literature, used by at least two systems without literature support, or suggested by the group of experts. ppi definitions that varied across systems for the same indicator (e.g., delays to operate) were refined by the steering committee. ppi that could be measured using the quebec trauma registry were then identified (and calculated for each of the 59 designated trauma centers. this multicenter retrospective cohort study was based on the inclusive trauma system of the province of quebec, canada. the quebec trauma system was instated in 1993 and involves regionalized care from urban level i trauma centers through to rural community hospitals. trauma level designations are based on american college of surgeons criteria and are revised periodically with on - site visits. during the study period, the system included 6 level i (including 2 pediatric), 4 level ii, 21 level iii, and 28 level iv trauma centers. standardized pre - hospital protocols ensure that major trauma cases are taken to these hospitals and standing agreements regulate between - center transfers within the system. data were drawn from the quebec trauma registry, which is mandatory for all 59 designated trauma centers and includes all deaths following injury, intensive care unit admissions, hospital stays > 2 days, and between - center transfers. the province of quebec, canada, has universal health coverage, and linkage with hospital discharge data has shown that the trauma registry captures approximately 75% of all trauma patients who meet these inclusion criteria and more than 85% of the most severe pathologies (i.e., traumatic brain injuries, thoracic and abdominal injuries). registry data are extracted from patient files by medical archivists who use standardized coding protocols. anatomic injury is coded with the abbreviated injury scale (ais) according to the guidelines published by the association for the advancement of automotive medicine. the registry is centralized at the quebec ministry of health and is subject to both systematic and periodic validation to identify and correct aberrant data values in all relevant data fields and to verify date and time chronology. supervision by a data coordinator, yearly on - going training, an electronic forum of coding queries, and thrice - yearly meetings with key stakeholders (e.g., trauma physicians, researchers, administrators) are used to improve data reliability and validity. this study was based on data collected during eight administrative years, i.e., between april 1998 and march 2006. deaths on arrival and patients who arrived with no vital signs and expired within 30 min of arrival were considered inevitable in the context of trauma center evaluation and were thus excluded from the study population. patients with an isolated hip fracture were also excluded because this pathology is commonly considered to be the consequence of a chronic disease rather than a traumatic event. hospital readmissions are not included in the trauma registry. if patients are entered twice for the same injury due to transfer, only information from the definitive acute care hospital was retained. only 2% of patients in the study sample were included more than once in the registry for repeated traumatic events. the observed proportion of conformity, calculated as the ratio of patients whose care conforms to the ppi divided by all patients eligible for the ppi, is subject to regression to the mean bias whereby it is more extreme than the true proportion, particularly for low - volume centers. we therefore used shrinkage techniques that estimate the true proportion using information from all centers rather than just the center under evaluation estimates are shrunk toward the global mean by a factor that is inversely proportional to the sample size. these shrinkage estimates not only account for regression - to - the - mean bias, but also improve the precision of estimates for low - volume centers and account for inflation of the type i error due to multiple comparisons, which otherwise leads to the detection of too many outliers. efron and morris argue that estimates derived through shrinkage are more suitable for policy making, for ordering (i.e., ranking), and for group comparisons (i.e., between - center comparisons) than conventional estimates and they have become standard for health care performance evaluation. the true proportion of conformity to each ppi along with 95% confidence intervals (ci) for each of the 59 trauma centers was calculated using a random - intercept multilevel model. conformity to each ppi is presented using a modified caterpillar plot where centers are ordered by designation level and volume to avoid ranking and to conserve the order of centers across ppi. ppi were evaluated using measures of discrimination, construct validity, and forecasting, according to us agency for healthcare quality recommendations. discrimination was defined as the ability of ppi to differentiate performance and was evaluated using between - center variance estimates along with 95% ci. ci that exclude 0 are considered to be consistent with significant deviations across trauma centers. construct validity was defined as the degree of association between specific ppi and other indicators of quality and was assessed by evaluating the correlation between each indicator and two hospital characteristics that have been shown to be related to performance : (i) designation level and (ii) volume. forecasting was defined as the ability of ppi to predict future performance and was assessed by evaluating the correlation within indicators over time ; indicators derived from data collected in the first 4 years of the study were compared to the same indicators derived from data collected in the last 4 years. correlation was assessed with pearson 's correlation coefficient and asymptotic 95% ci on true proportions (shrinkage estimates). these proportions were first transformed using a square - root arcsine transformation to normalize their distribution and were then weighted with the median number of eligible patients across ppi for each center. ethical approval was obtained from institutional ethics committees and the commision de laccs linformation du qubec. we identified 130 articles in peer - reviewed journals as well as 60 documents from websites of trauma centers, health authorities, and professional associations, which led to the identification of 137 ppi. the three selection criteria further reduced the list to 32 indicators (listed in the appendix). twenty - three were backed up by literature published in peer - reviewed journals, five were used by at least two trauma systems without literature support, and four were identified by the quebec steering committee. of the 32 ppi, 15 were obtainable from quebec trauma registry data listed in table 1. process performance indicators the quebec trauma registry contains information on 125,907 patients admitted between april 1998 and march 2006. the exclusion of deaths on arrival and deaths occurring within 30 min of arrival in patients without vital signs (n = 4837) and isolated hip fractures (n = 21,626) resulted in a sample of 99,444 patients from 59 centers available for analyses. mean age (standard deviation) was 48.5 years (25.2), 30.7% of patients were 65 years of age or over, 58.4% were men, 20% had an injury severity score (iss) > 15, and 29% were injured in a motor vehicle collision. penetrating trauma center average yearly volume of patients respecting the study inclusion criteria was 218 - 1313 for level i centers, 341 - 605 for level ii centers, 100 - 541 for level iii centers, and 5 - 118 for level iv centers. overall conformity to ppi related to transfer of patients to level i / ii trauma centers (ppi # 1-#3) was high, whereas conformity to ppi associated with a delay of 1 h (# 4, # 8, # 10) was low [table 1 ]. a wide range of conformity across trauma centers (min - max) was observed for all ppi except # 6, # 8, and # 10, and trauma center outliers were detected for all but two ppi. figures 1 - 3 show between - center performance for three ppi (three examples were selected as space constraints precluded presentation of all 15). only level iii / iv centers were evaluated for ppi # 1 transfer of moderate - severe traumatic brain injury patients to a level i / ii center and overall conformity for this ppi was over 80% [figure 1 ]. seven centers had higher than average conformity, whereas five centers had lower than average conformity. overall conformity for ppi # 5, securing patients airway in the emergency department (ed), was only 64% [figure 2 ]. eight of the 10 level i / ii centers had higher than average conformity, whereas 3 out of 21 level iii centers had lower than average conformity. global conformity to ppi # 12, ed stay 15, and 29% were injured in a motor vehicle collision. penetrating trauma trauma center average yearly volume of patients respecting the study inclusion criteria was 218 - 1313 for level i centers, 341 - 605 for level ii centers, 100 - 541 for level iii centers, and 5 - 118 for level iv centers. overall conformity to ppi related to transfer of patients to level i / ii trauma centers (ppi # 1-#3) was high, whereas conformity to ppi associated with a delay of 1 h (# 4, # 8, # 10) was low [table 1 ]. a wide range of conformity across trauma centers (min - max) was observed for all ppi except # 6, # 8, and # 10, and trauma center outliers were detected for all but two ppi. figures 1 - 3 show between - center performance for three ppi (three examples were selected as space constraints precluded presentation of all 15). only level iii / iv centers were evaluated for ppi # 1 transfer of moderate - severe traumatic brain injury patients to a level i / ii center and overall conformity for this ppi was over 80% [figure 1 ]. seven centers had higher than average conformity, whereas five centers had lower than average conformity. overall conformity for ppi # 5, securing patients airway in the emergency department (ed), was only 64% [figure 2 ]. eight of the 10 level i / ii centers had higher than average conformity, whereas 3 out of 21 level iii centers had lower than average conformity. global conformity to ppi # 12, ed stay 1 h after arrival occur on ward) had statistically significant positive associations with designation level and volume. these results partially support their construct validity ; level i / ii trauma centers may be expected to show higher conformity to standards of care than level iii / iv centers. in addition, higher levels of care and increased patient volume have been reported to be associated with improved patient outcome. however, level i / ii centers showed lower conformity to ppi # 3 (transfer of spinal cord injury) and ppi # 15 (no reintubation within 48 h of extubation) than lower level centers. for ppi # 3, this situation is well documented in our system where a certain reluctance to transfer spinal cord injuries has been identified. according to a recent systematic review published by stelfox and colleagues, only four multicenter studies based on global adult trauma populations have described the implementation of a series of ppi using trauma registry data.[1821 ] none were implemented across all levels of trauma care. in addition, all were based on american college of surgeons committee on trauma (ascot) audit filters proposed in 1993 despite the fact that only 19% of all ppi identified in the systematic review were ascot based. results of these studies suggest that only 9 of the 22 ascot filters are applicable with regular trauma registry data. evidence for reliability is mostly limited to preventable death classification and no information is available on the reliability of ppi derived from trauma registry data. work by stelfox and colleagues suggests that there is no evidence of content validity or construct validity on trauma care process indicators derived from trauma registry data in the literature and we found no study evaluating forecasting properties. predictive criterion validity of certain ppi has been evaluated by assessing associations with outcomes such as mortality, morbidity, length of stay, costs, and complications.[1821 ] however, results are contradictory and suggest that as many ppi are associated with favorable outcomes as with poor outcomes. however, few of these studies used robust risk adjustment techniques and many were based on patient - level rather than hospital - level data which is subject to confounding by indication. this study was based on a trauma registry with excellent population coverage of moderate to major trauma and rigorous data quality control mechanisms. in addition, the trauma registry used for analyses is based on uniform inclusion criteria with standardized prospective data collection procedures and represents an inclusive trauma system where designation is conducted according to american college of surgeons committee on trauma criteria. ppi were selected using a review of trauma system documents and peer - reviewed articles and the validity of indicators was partly addressed in analyses. potential limitations which may affect the interpretation of results include data quality, low volumes, and the generalizability of results. the validity of ppi relies on the reliability, validity, and completeness of trauma registry data, and data quality control measures are an essential part of any trauma system data collection effort. the quebec trauma registry uses standardized coding procedures and rigorous data quality control mechanisms to improve data validity and reliability, and ppi were retained based on data quality issues as well as feasibility. however, as is common in trauma registries, a high proportion of patients had missing data on physiological status. multiple imputation procedures, widely used to address missing data in group comparisons, are not suitable for flagging individuals. missing physiological data, specifically the glasgow coma score, was an issue for ppi # 1, # 5, and # 10. this and other data quality issues may generate misleading results if data quality and completeness vary across trauma centers. some ppi are based on low numbers of eligible patients, particularly for low - volume centers. stabilize / embolize unstable pelvic fracture and epidural hematoma surgery < 1 h only had 40 and 254 eligible patients over the entire study period, respectively. this problem is partly addressed by multilevel modeling which shrinks estimates based on low sample sizes toward the global mean to improve precision. indeed, in the study population, no outliers were detected, indicating that these ppi do not discriminate across centers. despite this, experts tend to agree that indicators should not be discarded based on low sample sizes alone because they may be flagged for high - volume centers and they can be useful for the calculation of composite performance measures. the quebec trauma registry is based on american college of surgeons criteria, but can not directly replicate all trauma registries. therefore, the ppi used here will not be integrally applicable across all trauma systems. in addition, ppi that can currently be evaluated using data collected in most trauma systems are unlikely to be the only ppi of interest. indeed, out of 32 ppi that we identified from literature review and expert opinion, 17 were rejected because they could not be calculated (accurately) using quebec trauma registry data. in addition, certain ppi could not be refined optimally due to lack of information in the trauma registry (e.g., taking account of non - surgical management decisions). in the long term, trauma registries should be adapted to a series of consensus - based ppi that have demonstrated not only discrimination, construct validity, and forecasting, but also reliability and predictive criterion validity on outcomes that may be more meaningful than mortality. however, feasibility and the cost of data collection should be part of the selection process. in any event, process indicators are not static and will need to be adapted to local clinical contexts and be revised over time according to evidence - based clinical practice. this study was based on a trauma registry with excellent population coverage of moderate to major trauma and rigorous data quality control mechanisms. in addition, the trauma registry used for analyses is based on uniform inclusion criteria with standardized prospective data collection procedures and represents an inclusive trauma system where designation is conducted according to american college of surgeons committee on trauma criteria. ppi were selected using a review of trauma system documents and peer - reviewed articles and the validity of indicators was partly addressed in analyses. potential limitations which may affect the interpretation of results include data quality, low volumes, and the generalizability of results. the validity of ppi relies on the reliability, validity, and completeness of trauma registry data, and data quality control measures are an essential part of any trauma system data collection effort. the quebec trauma registry uses standardized coding procedures and rigorous data quality control mechanisms to improve data validity and reliability, and ppi were retained based on data quality issues as well as feasibility. however, as is common in trauma registries, a high proportion of patients had missing data on physiological status. multiple imputation procedures, widely used to address missing data in group comparisons, are not suitable for flagging individuals. missing physiological data, specifically the glasgow coma score, was an issue for ppi # 1, # 5, and # 10. this and other data quality issues may generate misleading results if data quality and completeness vary across trauma centers. some ppi are based on low numbers of eligible patients, particularly for low - volume centers. for example, stabilize / embolize unstable pelvic fracture and epidural hematoma surgery < 1 h only had 40 and 254 eligible patients over the entire study period, respectively. this problem is partly addressed by multilevel modeling which shrinks estimates based on low sample sizes toward the global mean to improve precision. indeed, in the study population, no outliers were detected, indicating that these ppi do not discriminate across centers. despite this, experts tend to agree that indicators should not be discarded based on low sample sizes alone because they may be flagged for high - volume centers and they can be useful for the calculation of composite performance measures. the quebec trauma registry is based on american college of surgeons criteria, but can not directly replicate all trauma registries. therefore, the ppi used here will not be integrally applicable across all trauma systems. in addition, ppi that can currently be evaluated using data collected in most trauma systems are unlikely to be the only ppi of interest. indeed, out of 32 ppi that we identified from literature review and expert opinion, 17 were rejected because they could not be calculated (accurately) using quebec trauma registry data. in addition, certain ppi could not be refined optimally due to lack of information in the trauma registry (e.g., taking account of non - surgical management decisions). in the long term, trauma registries should be adapted to a series of consensus - based ppi that have demonstrated not only discrimination, construct validity, and forecasting, but also reliability and predictive criterion validity on outcomes that may be more meaningful than mortality. however, feasibility and the cost of data collection should be part of the selection process. in any event, process indicators are not static and will need to be adapted to local clinical contexts and be revised over time according to evidence - based clinical practice. this study provides evidence of the feasibility and importance of implementing ppi using trauma registry data and gives guidance on methodological issues and presentation of results. we have identified a series of 15 ppi that can be used to drive system - wide trauma care quality improvement efforts using routinely collected trauma registry data. however, future research should evaluate the association between ppi and indicators of structure and outcome performance using hospital - level data as well as the influence of data quality. in addition, efforts should be invested into developing a composite measure of process performance. interfacility transfer of injured patients : guidelines for rural communities ; 2002.royal college of surgeons of england. report of the working party on the management of patients with head injuries ; 1999.hedges jr, adams al, gunnels md. prehosp emerg care 2002;6:299 - 305.tator ch, duncan eg, edmonds ve, lapczak li, andrews df. neurological recovery, mortality and length of stay after acute spinal cord injury associated with changes in management. paraplegia 1995;33:254 - 62.heinemann aw, yarkony gm, roth ej, lovell l, hamilton b, ginsburg k,. a comparison of specialized spinal cord injury center vs general hospital short - term care. arch neurol 1989;46:1098 - 102.scivoletto g, morganti b, molinari m. early versus delayed inpatient spinal cord injury rehabilitation : an italian study. arch phys medrehabil 2005;86:512 - 6.oakes dd, wilmot cb, hall km, sherck jp. benefits of early admission to a comprehensive trauma center for patients with spinal cord injury. arch phys med rehabil 1990;71:637 - 43.devivo mj, kartus pl, stover sl, fine pr. benefits of early admission to an organised spinal cord injury care system. spinal cord 1997;35:147 - 50.smith m. efficacy of specialist versus non - specialist management of spinal cord injury within the uk. spinal cord 2002;40:10 - 6.amin a, bernard j, nadarajah r, davies n, gow f, tucker s. spinal injuries admitted to a specialist centre over a 5-year period : a study to evaluate delayed admission. regional trauma services : annual report 2004-2005.south western sydney regional trauma registry : trauma 10-year report 1995-2004.available from : www.oregon.gov/dhs/ph/ems/trauma/docs/9qiic.pdf [last accessed on 2012 dec 24].performance improvement guidelines for north carolina trauma centers. april1, 2002 (with revised monitor / indicator filters of 2003).utah trauma system performance improvement guide. [last accessed on 2012 dec 24].available from : http://www.health.state.mn.us/traumasystem/hospresources/resourcemanual/index.html [last accessed on 2012 dec 24].available from : http://www.texinfo.library.unt.edu/texasregister/html/2006/jun-09/tables-and-graphics/200602913-2.pdf [last accessed on 2012 apr 21].eastern association for the surgery of trauma : clinical guidelines, available from : www.east.org [last accessed on 2012 dec 24].hicks ir, hedley rm, razis p. audit of transfer of head - injured patients to a stand - alone neurosurgical unit. endotracheal intubation in the field improves survival in patients with severe head injury. trauma research and education foundation of san diego. chest 1983;84:29 - 35.riemer bl, butterfield sl, diamond dl, young jc, raves jj, cottington e,. acute mortality associated with injuries to the pelvic ring : the role of early patient mobilization and external fixation. j trauma 1993;35:671 - 5 ; discussion 676-7.latenser ba, gentilello lm, tarver aa, thalgott js, batdorf jw. improved outcome with early fixation of skeletally unstable pelvic fractures. j trauma 1991;31:28 - 31.matalon ts, athanasoulis ca, margolies mn, waltman ac, novelline ra, greenfield aj,. ajr am j roentgenol 1979;133:859 - 64.panetta t, sclafani sj, goldstein as, phillips tf, shaftan gw. j trauma 1985;25:1021 - 9.agolini sf, shah k, jaffe j, newcomb j, rhodes m, reed jf 3rd. j trauma 1997;43:395 - 9.bassam d, cephas ga, ferguson ka, beard ln, young js. a protocol for the initial management of unstable pelvic fractures. am surg 1998;64:862 - 7.wong yc, wang lj, ng cj, tseng ic, see lc. mortality after successful transcatheter arterial embolization in patients with unstable pelvic fractures : rate of blood transfusion as a predictive factor. j trauma 2000;49:71 - 5.hamill j, holden a, paice r, civil i. pelvic fracture pattern predicts pelvic arterial haemorrhage. aust n z j surg 2000;70:338 - 43.miller pr, moore ps, mansell e, meredith jw, chang mc. external fixation or arteriogram in bleeding pelvic fracture : initial therapy guided by markers of arterial hemorrhage. j trauma 2003;54:437 - 43.shapiro m, mcdonald aa, knight d, johannigman ja, cuschieri j. the role of repeat angiography in the management of pelvic fractures. j trauma 2005;58:227 - 31.sarin el, moore jb, moore ee, shannon mr, ray ce, morgan sj,. j trauma 2005;58:973 - 7.sadri h, nguyen - tang t, stern r, hoffmeyer p, peter r. control of severe hemorrhage using c - clamp and arterial embolization in hemodynamically unstable patients with pelvic ring disruption. arch orthop trauma surg 2005;125:443 - 7.fangio p, asehnoune k, edouard a, smail n, benhamou d. early embolization and vasopressor administration for management of life - threatening hemorrhage from pelvic fracture. j orthop trauma 1995;9:121 - 7.kreder hj, armstrong p. a review of open tibia fractures in children. comparison of management outcome of primary and secondary referred patients with traumatic extradural haematoma in a neurosurgical unit. je, montero a, israel zh. prognosis and clinical relevance of anisocoria - craniotomy latency for epidural hematoma in comatose patients. j trauma 1996;41:120 - 2.mendelow ad, karmi mz, paul ks, fuller ga, gillingham fj. acta neurochir (wien) 1988;90:111 - 6.goris rj, gimbrere js, van niekerk jl, schoots fj, booy lh. incidence of adult respiratory distress syndrome in patients with multiple musculoskeletal injuries : effect of early operative stabilization of fractures. j trauma 1985;25:375 - 84.svenningsen s, nesse o, finsen v, hole a, benum p. prevention of fat embolism syndrome in patients with femoral fractures - immediate or delayed operative fixation ? ann chir gynaecol 1987;76:163 - 6.bone lb, johnson kd, weigelt j, scheinberg r. early versus delayed stabilization of femoral fractures. a prospective randomized study. j trauma 1991;31:261 - 3.poole gv, miller jd, agnew sg, griswold ja. j trauma 1992;32:654 - 9.charash we, fabian tc, croce ma. delayed surgical fixation of femur fractures is a risk factor for pulmonary failure independent of thoracic trauma. j trauma 1994;37:667 - 72.starr aj, hunt jl, chason dp, reinert cm, walker j. treatment of femur fracture with associated head injury. j orthop trauma 1998;12:38 - 45.brundage si, mcghan r, jurkovich gj, mack cd, maier rv. timing of femur fracture fixation : effect on outcome in patients with thoracic and head injuries. j trauma 2002;52:299 - 307.pape hc, auf'm'kolk m, paffrath t, regel g, sturm ja, tscherne h. primary intramedullary femur fixation in multiple trauma patients with associated lung contusion - a cause of posttraumatic ards ? j trauma 1993;34:540 - 78.fakhry sm, rutledge r, dahners le, kessler d. incidence, management, and outcome of femoral shaft fracture : a statewide population - based analysis of 2805 adult patients in a rural state. j trauma 1997;42:1 - 6.pape hc, rixen d, morley j, husebye ee, mueller m, dumont c,. impact of the method of initial stabilization for femoral shaft fractures in patients with multiple injuries at risk for complications (borderline patients). ann surg 2007;246:491 - 501.talucci rc, manning j, lampard s, bach a, carrico cj. am jsurg 1983;146:107 - 11.reynolds ma, richardson jd, spain da, seligson d, wilson ma, miller fb. ann surg 1995;222:470 - 8 ; discussion 478-81.velmahos gc, arroyo h, ramicone e, cornwell ee 3, murray ja, asensio ja,. am j surg 1998;176:324 - 30.nair r, abdool - carrim at, robbs jv. br j surg 2000;87:602 - 7.hossny a. blunt popliteal artery injury with complete lower limb ischemia : is routine use of temporary intraluminal arterial shunt justified ? vascular injuries associated with dislocation of the knee. j bone joint surg am 1977;59:236 - 9.patterson bm, agel j, swiontkowski mf, mackenzie ej, bosse mj. knee dislocations with vascular injury : outcomes in the lower extremity assessment project (leap) study. j trauma 2007;63:855 - 8.nathens ab, mcmurray mk, cuschieri j, durr ea, moore ee, bankey pe,. the practice of venous thromboembolism prophylaxis in the major trauma patient. j trauma 2007;62:557 - 63.steele n, dodenhoff rm, ward aj, morse mh. pagename = guidelinesperel p, yanagawa t, bunn f, roberts i, wentz r, pierro a. nutritional support for head - injured patients. cochrane database syst rev 2006;(4):cd001530.haller g, myles ps, wolfe r, weeks am, stoelwinder j, mcneil j. validity of unplanned admission to an intensive care unit as a measure of patient safety in surgical patients. j trauma 1995;38:432 - 8.birkmeyer jd, hamby ls, birkmeyer cm, decker mv, karon nm, dow rw. can the incidence of unplanned reoperations be used as an indicator of quality of care in surgery ? am j med qual 2007;22:198 - 202.american college of surgeons, committee on trauma. j trauma 1998;44:433 - 9.sakles jc, sena mj, knight da, davis jm. effect of immediate fluid resuscitation on the rate, volume, and duration of pulmonary vascular hemorrhage in a sheep model of penetrating thoracic trauma. ann emerg med 1997;29:392 - 9.stern sa, dronen sc, birrer p, wang x. effect of blood pressure on hemorrhage volume and survival in a near - fatal hemorrhage model incorporating a vascular injury. ann emerg med 1993;22:155 - 63.kowalenko t, stern s, dronen s, wang x. improved outcome with hypotensive resuscitation of uncontrolled hemorrhagic shock in a swine model. j trauma 1992;33:349 - 53 ; discussion 361-2.bickell wh, bruttig sp, millnamow ga, o'benar j, wade ce. surgery 1991;110:529 - 36.abu - hatoum o, bashenko y, hirsh m, krausz mm. continuous fluid resuscitation and splenectomy for treatment of uncontrolled hemorrhagic shock after massive splenic injury. j trauma 1996;40:915 - 22.bickell wh, wall mjjr, pepe pe, martin rr, ginger vf, allen mk,. n engl j med 1994;331:1105 - 9.kashuk jl, moore ee, millikan js, moore jb. j trauma 1982;22:672 - 9.jurkovich gj, greiser wb, luterman a, curreri pw. j trauma 1990;30:200 - 2.ferrara a, macarthur jd, wright hk, modlin i m, mcmillen ma. j trauma 1992;33:835 - 9.gunning ka, sugrue m, sloane d, deane sa. n z j surg 1995;65:80 - 2.cosgriff n, moore ee, sauaia a, kenny - moynihan m, burch jm, galloway b. predicting life - threatening coagulopathy in the massively transfused trauma patient : hypothermia and acidoses revisited. j trauma 1997;42:857 - 62.gentilello lm, jurkovich gj, stark ms, hassantash sa, o'keefe ge. is hypothermia in the victim of major trauma protective or harmful ? ann surg 1997;226:439 - 49.krishna g, sleigh jw, rahman h. physiological predictors of death in exsanguinating trauma patients undergoing conventional trauma surgery. aust n z j surg 1998;68:826 - 9.shafi s, elliott ac, gentilello l. is hypothermia simply a marker of shock and injury severity or an independent risk factor for mortality in trauma patients ? j trauma 2005;59:1081 - 5.wang he, callaway cw, peitzman ab, tisherman sa. crit care med 2005;33:1296 - 301.martin rs, kilgo pd, miller pr, hoth jj, meredith jw, chang mc. hypothermia and associated outcomes in seriously injured trauma patients in a predominantly sub - tropical climate. resuscitation 2009;80:217 - 23.inaba k, teixeira pg, rhee p, brown c, salim a, dubose j,. world j surg 2009;33:864 - 9.beilman gj, blondet jj, nelson tr, nathens ab, moore fa, rhee p,. early hypothermia in severely injured trauma patients is a significant risk factor for multiple organ dysfunction syndrome but not mortality. ann surg 2009;249:845 - 50.carr bg, kaye aj, wiebe dj, gracias vh, schwab cw, reilly pm. emergency department length of stay : a major risk factor for pneumonia in intubated blunt trauma patients. j trauma 2007;63:9 - 12.richardson jd, franklin g, santos a, harbrecht b, danzl d, coleman r,. effective triage can ameliorate the deleterious effects of delayed transfer of trauma patients from the emergency department to the icu. j am coll surg 2009;208:671 - 81.nayduch d, moylan j, snyder bl, andrews l, rutledge r, cunningham p. american college of surgeons trauma quality indicators : an analysis of outcome in a statewide trauma registry. j trauma 1994;37:565 - 75.clarke jr, trooskin sz, doshi pj, greenwald l, mode cj. time to laparotomy for intra - abdominal bleeding from trauma does affect survival for delays up to 90 minutes. j trauma 2002;52:420 - 5.choi kc, peek - asa c, lovell m, torner jc, zwerling c, kealey gp. j am coll surg 2005;201:546 - 53.sorensen vj, mikhail jn, karmy - jones rc. is delayed laparotomy for blunt abdominal trauma a valid quality improvement measure in the era of nonoperative management of abdominal injuries ? aust n z j surg 1994;64:484 - 7.inaba k, demetriades d. the nonoperative management of penetrating abdominal trauma. the length of hospital stay after an unnecessary laparotomy for trauma : a prospective study. j trauma 1996;40:187 - 90.niederee mj, byrnes mc, helmer sd, smith rs. am surg 2003;69:293 - 9.fakhry sm, brownstein m, watts dd, baker cc, oller d. relatively short diagnostic delays (< 8 hours) produce morbidity and mortality in blunt small bowel injury : an analysis of time to operative intervention in 198 patients from a multicenter experience. j trauma 2000;48:408 - 15.fang jf, chen rj, lin bc, hsu yb, kao jl, kao yc, chen mf. j trauma 1999;47:515 - 20.willis cd, stoelwinder ju, cameron pa. interpreting process indicators in trauma care : int j qual health care 2008;20:331 - 8.demetriades d, velmahos gc, scalea tm, jurkovich gj, karmy - jones r, teixeira pg,. blunt traumatic thoracic aortic injuries : early or delayed repair -- results of an american association for the surgery of trauma prospective study. injury 2007;38:1098 - 101.pfeifer r, pape hc. missed injuries in trauma patients : a literature review. patient saf surg 2008;2:20.enderson bl, reath db, meadors j, dallas w, deboo jm, maull ki. j trauma 1990;30:666 - 9 ; discussion 669-70.aaland mo, smith k. delayed diagnosis in a rural trauma center. j trauma 1998;44:1000 - 7.vles wj, veen ej, roukema ja, meeuwis jd, leenen lp. aust n z j surg 1993;63:935 - 9.rizoli sb, boulanger br, mclellan ba, sharkey pw. accid anal prev 1994;26:681 - 6.robertson r, mattox r, collins t, parks - miller c, eidt j, cone j. missed injuries in a rural area trauma center. am j surg 1996;172:564 - 8.furnival ra, woodward ga, schunk je. delayed diagnosis of injury in pediatric trauma. pediatrics 1996;98:56 - 62.peery cl, chendrasekhar a, paradise nf, moorman dw, timberlake ga. am surg 1999;65:1067 - 9.buduhan g, mcritchie di. missed injuries in patients with multiple trauma. j trauma 2000;49:600 - 5.connors jm, ruddy rm, mccall j, garcia vf. pediatr emerg care 2001;17:1 - 4.houshian s, larsen ms, holm c. missed injuries in a level i trauma center. j trauma 2002;52:715 - 9.brooks a, holroyd b, riley b. missed injury in major trauma patients. pediatr emerg care 2005;21:367 - 71.kalemoglu m, demirbas s, akin ml, yildirim i, kurt y, uluutku h,. missed injuries in military patients with major trauma : original study. mil med 2006;171:598 - 602.esteban a, alia i, gordo f, fernndez r, solsona jf, vallverd i,. am j respir crit care med 1997;156:459 - 65.gowardman jr, huntington d, whiting j. the effect of extubation failure on outcome in a multidisciplinary australian intensive care unit. crit care resusc 2006;8:328 - 33.nisim aa, margulies dr, wilson mt, alban rf, dang cm, allins ad,. a 2-minute pre - extubation protocol for ventilated intensive care unit patients. am j surg 2008;196:890 - 5. american college of surgeons committee on trauma. report of the working party on the management of patients with head injuries ; 1999. neurological recovery, mortality and length of stay after acute spinal cord injury associated with changes in management. heinemann aw, yarkony gm, roth ej, lovell l, hamilton b, ginsburg k,. a comparison of specialized spinal cord injury center vs general hospital short - term care. scivoletto g, morganti b, molinari m. early versus delayed inpatient spinal cord injury rehabilitation : an italian study. benefits of early admission to a comprehensive trauma center for patients with spinal cord injury. smith m. efficacy of specialist versus non - specialist management of spinal cord injury within the uk. amin a, bernard j, nadarajah r, davies n, gow f, tucker s. spinal injuries admitted to a specialist centre over a 5-year period : a study to evaluate delayed admission. eastern association for the surgery of trauma : clinical guidelines, available from : www.east.org [last accessed on 2012 dec 24 ]. hicks ir, hedley rm, razis p. audit of transfer of head - injured patients to a stand - alone neurosurgical unit. endotracheal intubation in the field improves survival in patients with severe head injury. trauma research and education foundation of san diego. riemer bl, butterfield sl, diamond dl, young jc, raves jj, cottington e,. acute mortality associated with injuries to the pelvic ring : the role of early patient mobilization and external fixation. latenser ba, gentilello lm, tarver aa, thalgott js, batdorf jw. improved outcome with early fixation of skeletally unstable pelvic fractures. matalon ts, athanasoulis ca, margolies mn, waltman ac, novelline ra, greenfield aj,. hemorrhage with pelvic fractures : efficacy of transcatheter embolization. agolini sf, shah k, jaffe j, newcomb j, rhodes m, reed jf 3rd. bassam d, cephas ga, ferguson ka, beard ln, young js. a protocol for the initial management of unstable pelvic fractures. mortality after successful transcatheter arterial embolization in patients with unstable pelvic fractures : rate of blood transfusion as a predictive factor. hamill j, holden a, paice r, civil i. pelvic fracture pattern predicts pelvic arterial haemorrhage. miller pr, moore ps, mansell e, meredith jw, chang mc. external fixation or arteriogram in bleeding pelvic fracture : initial therapy guided by markers of arterial hemorrhage. shapiro m, mcdonald aa, knight d, johannigman ja, cuschieri j. the role of repeat angiography in the management of pelvic fractures. sarin el, moore jb, moore ee, shannon mr, ray ce, morgan sj,. sadri h, nguyen - tang t, stern r, hoffmeyer p, peter r. control of severe hemorrhage using c - clamp and arterial embolization in hemodynamically unstable patients with pelvic ring disruption. fangio p, asehnoune k, edouard a, smail n, benhamou d. early embolization and vasopressor administration for management of life - threatening hemorrhage from pelvic fracture. comparison of management outcome of primary and secondary referred patients with traumatic extradural haematoma in a neurosurgical unit. je, montero a, israel zh. prognosis and clinical relevance of anisocoria - craniotomy latency for epidural hematoma in comatose patients. goris rj, gimbrere js, van niekerk jl, schoots fj, booy lh. incidence of adult respiratory distress syndrome in patients with multiple musculoskeletal injuries : effect of early operative stabilization of fractures. svenningsen s, nesse o, finsen v, hole a, benum p. prevention of fat embolism syndrome in patients with femoral fractures - immediate or delayed operative fixation ? bone lb, johnson kd, weigelt j, scheinberg r. early versus delayed stabilization of femoral fractures. a prospective randomized study. charash we, fabian tc, croce ma. delayed surgical fixation of femur fractures is a risk factor for pulmonary failure independent of thoracic trauma. starr aj, hunt jl, chason dp, reinert cm, walker j. treatment of femur fracture with associated head injury. timing of femur fracture fixation : effect on outcome in patients with thoracic and head injuries. pape hc, auf'm'kolk m, paffrath t, regel g, sturm ja, tscherne h. primary intramedullary femur fixation in multiple trauma patients with associated lung contusion - a cause of posttraumatic ards ? fakhry sm, rutledge r, dahners le, kessler d. incidence, management, and outcome of femoral shaft fracture : a statewide population - based analysis of 2805 adult patients in a rural state. pape hc, rixen d, morley j, husebye ee, mueller m, dumont c,. impact of the method of initial stabilization for femoral shaft fractures in patients with multiple injuries at risk for complications (borderline patients). talucci rc, manning j, lampard s, bach a, carrico cj. early intramedullary reynolds ma, richardson jd, spain da, seligson d, wilson ma, miller fb. is the timing of fracture fixation important for the patient with multiple trauma ? velmahos gc, arroyo h, ramicone e, cornwell ee 3, murray ja, asensio ja,. hossny a. blunt popliteal artery injury with complete lower limb ischemia : is routine use of temporary intraluminal arterial shunt justified ? knee dislocations with vascular injury : outcomes in the lower extremity assessment project (leap) study. nathens ab, mcmurray mk, cuschieri j, durr ea, moore ee, bankey pe,. pagename = guidelines perel p, yanagawa t, bunn f, roberts i, wentz r, pierro a. nutritional support for head - injured patients. haller g, myles ps, wolfe r, weeks am, stoelwinder j, mcneil j. validity of unplanned admission to an intensive care unit as a measure of patient safety in surgical patients. birkmeyer jd, hamby ls, birkmeyer cm, decker mv, karon nm, dow rw. can the incidence of unplanned reoperations be used as an indicator of quality of care in surgery ? am j med qual 2007;22:198 - 202. effect of immediate fluid resuscitation on the rate, volume, and duration of pulmonary vascular hemorrhage in a sheep model of penetrating thoracic trauma. stern sa, dronen sc, birrer p, wang x. effect of blood pressure on hemorrhage volume and survival in a near - fatal hemorrhage model incorporating a vascular injury. kowalenko t, stern s, dronen s, wang x. improved outcome with hypotensive resuscitation of uncontrolled hemorrhagic shock in a swine model. abu - hatoum o, bashenko y, hirsh m, krausz mm. continuous fluid resuscitation and splenectomy for treatment of uncontrolled hemorrhagic shock after massive splenic injury. bickell wh, wall mjjr, pepe pe, martin rr, ginger vf, allen mk,. ferrara a, macarthur jd, wright hk, modlin i m, mcmillen ma. hypothermia and acidosis worsen coagulopathy in the patient requiring massive transfusion. am j surg 1990;160:515 - 8. j trauma 1992;33:835 - 9. gunning ka, sugrue m, sloane d, deane sa. cosgriff n, moore ee, sauaia a, kenny - moynihan m, burch jm, galloway b. predicting life - threatening coagulopathy in the massively transfused trauma patient : hypothermia and acidoses revisited. gentilello lm, jurkovich gj, stark ms, hassantash sa, o'keefe ge. is hypothermia in the victim of major trauma protective or harmful ? krishna g, sleigh jw, rahman h. physiological predictors of death in exsanguinating trauma patients undergoing conventional trauma surgery. shafi s, elliott ac, gentilello l. is hypothermia simply a marker of shock and injury severity or an independent risk factor for mortality in trauma patients ? martin rs, kilgo pd, miller pr, hoth jj, meredith jw, chang mc. hypothermia and associated outcomes in seriously injured trauma patients in a predominantly sub - tropical climate. inaba k, teixeira pg, rhee p, brown c, salim a, dubose j,. beilman gj, blondet jj, nelson tr, nathens ab, moore fa, rhee p,. early hypothermia in severely injured trauma patients is a significant risk factor for multiple organ dysfunction syndrome but not mortality. carr bg, kaye aj, wiebe dj, gracias vh, schwab cw, reilly pm. emergency department length of stay : a major risk factor for pneumonia in intubated blunt trauma patients. richardson jd, franklin g, santos a, harbrecht b, danzl d, coleman r,. effective triage can ameliorate the deleterious effects of delayed transfer of trauma patients from the emergency department to the icu. nayduch d, moylan j, snyder bl, andrews l, rutledge r, cunningham p. american college of surgeons trauma quality indicators : an analysis of outcome in a statewide trauma registry. time to laparotomy for intra - abdominal bleeding from trauma does affect survival for delays up to 90 minutes. choi kc, peek - asa c, lovell m, torner jc, zwerling c, kealey gp. is delayed laparotomy for blunt abdominal trauma a valid quality improvement measure in the era of nonoperative management of abdominal injuries ? the length of hospital stay after an unnecessary laparotomy for trauma : a prospective study. fakhry sm, brownstein m, watts dd, baker cc, oller d. relatively short diagnostic delays (< 8 hours) produce morbidity and mortality in blunt small bowel injury : an analysis of time to operative intervention in 198 patients from a multicenter experience. fang jf, chen rj, lin bc, hsu yb, kao jl, kao yc, chen mf. demetriades d, velmahos gc, scalea tm, jurkovich gj, karmy - jones r, teixeira pg,. blunt traumatic thoracic aortic injuries : early or delayed repair -- results of an american association for the surgery of trauma prospective study. pfeifer r, pape hc. missed injuries in trauma patients : a literature review. enderson bl, reath db, meadors j, dallas w, deboo jm, maull ki. janjua kj, sugrue m, deane sa. prospective evaluation of early missed injuries and the role of tertiary trauma survey. robertson r, mattox r, collins t, parks - miller c, eidt j, cone j. missed injuries in a rural area trauma center. furnival ra, woodward ga, schunk je. delayed diagnosis of injury in pediatric trauma. connors jm, ruddy rm, mccall j, garcia vf. delayed diagnosis in pediatric blunt trauma. houshian s, larsen ms, holm c. missed injuries in a level i trauma center. j trauma 2002;52:715 - 9. brooks a, holroyd b, riley b. missed injury in major trauma patients. kalemoglu m, demirbas s, akin ml, yildirim i, kurt y, uluutku h,. missed injuries in military patients with major trauma : original study esteban a, alia i, gordo f, fernndez r, solsona jf, vallverd i,. gowardman jr, huntington d, whiting j. the effect of extubation failure on outcome in a multidisciplinary australian intensive care unit. nisim aa, margulies dr, wilson mt, alban rf, dang cm, allins ad,. a 2-minute pre - extubation protocol for ventilated intensive care unit patients. | background : the evaluation of trauma center performance implies the use of indicators that evaluate clinical processes. despite the availability of routinely collected clinical data in most trauma systems, quality improvement efforts are often limited to hospital - based audit of adverse patient outcomes.objective:to identify and evaluate a series of process performance indicators (ppi) that can be calculated using routinely collected trauma registry data.materials and methods : ppi were identified using a review of published literature, trauma system documentation, and expert consensus. data from the 59 trauma centers of the quebec trauma system (1999, 2006 ; n = 99,444) were used to calculate estimates of conformity to each ppi for each trauma center. outliers were identified by comparing each center to the global mean. ppi were evaluated in terms of discrimination (between - center variance), construct validity (correlation with designation level and patient volume), and forecasting (correlation over time).results : fifteen ppi were retained. global proportions of conformity ranged between 6% for reduction of a major dislocation within 1 h and 97% for therapeutic laparotomy. between - center variance was statistically significant for 13 ppi. five ppi were significantly associated with designation level, 7 were associated with volume, and 11 were correlated over time.conclusion:in our trauma system, results suggest that a series of 15 ppi supported by literature review or expert opinion can be calculated using routinely collected trauma registry data. we have provided evidence of their discrimination, construct validity, and forecasting properties. the between - center variance observed in this study highlights the importance of evaluating process performance in integrated trauma systems. |
gene therapy for x - linked severe combined immunodeficiency (scid - x1) has been successfully employed in the clinic by restoration of c expression in bone - marrow - derived cd34 cells using integrating vectors.1, 2 in the earliest studies, using conventional -retroviral vectors, robust immune reconstitution was observed in the majority of infants, likely owing to the selective advantage of the transduced progenitors. however, despite successful phenotypic correction, 25% of treated infants developed t cell acute lymphoblastic leukemia (t - all) as a consequence of insertional mutagenesis. furthermore, patients acquired secondary genomic abnormalities including activating mutations in notch1.3, 4 although the role of insertional mutagenesis via the activation of proto - oncogenes such as lmo2 has been clearly implicated in the development of t - all in scid - x1 patients following gene therapy, the absence of adverse events in patients treated similarly for adenosine deaminase deficiency (ada - scid), despite also exhibiting integrations near these proto - oncogenes, remains incompletely understood. we have previously developed a mouse model of lentivirus - mediated correction of scid - x1 and observed lymphoid malignancies. crucially, the oncogenic events observed in mice receiving gene therapy were not attributable to insertional mutagenesis, suggesting alternative mechanisms for genotoxic risk in this model. one significant difference between positive control scid - x1 mice reconstituted with wild - type hematopoietic progenitor cells and scid - x1 mice receiving gene therapy with an equivalent number of vector - exposed c - deficient progenitor cells was the absolute number of cells received that were competent for lymphoid reconstitution. the gene therapy group received a lower dose on account of only a subset of vector - exposed c - deficient cells being transduced. we therefore hypothesized that reconstitution of scid - x1 mice with limiting numbers of hematopoietic progenitor cells might be a risk factor for lymphoid malignancy. in the current study, we sought to explore the relationship between hematopoietic progenitor cell dose and the incidence of lymphoid malignancy by transplanting sub - lethally irradiated crag mice with serially fewer wild - type sca1 progenitor cells, in the absence of gene transfer. the progenitor cell doses examined fell within a range that supported immunological reconstitution, and the resultant lymphoid compartment sizes varied by no more than 2-fold, despite up to 100-fold differences in hematopoietic progenitor cell dose. of greatest interest, however, was the observation of a robust inverse correlation between cell dose and the incidence of t - lymphoid malignancy, with progressively shorter disease latency at lower cell doses. all malignancies were wild - type donor cell - derived and carried activating notch1 mutations. replicative stress has been implicated in the development of b cell leukemia in mice and is a plausible antecedent to t - lymphoid oncogenesis in the current study. while encompassing this possibility, our findings fall within a conceptual framework provided by recent insights into murine thymocyte biology. most notable among these is the observation of sustained thymic output despite complete t cell progenitor deprivation (thymus autonomy), with autonomous t cell production being supported by induction of a thymocyte self - renewal phenotype.7, 8, 9, 10 this self - renewal phenotype, which arises in the double - negative (dn) 3 thymic niche and can also be induced by deliberate lmo2 overexpression, appears to carry an inherent risk of oncogenesis that is dependent upon acquisition of additional genetic lesions, such as notch1 mutations. moreover, competition from bone - marrow - derived progenitors has been shown to increase the turnover of thymocytes with a self - renewal phenotype, thereby reducing the probability of acquiring oncogenic mutations. directly relevant to the scid - x1 phenotype is the inability of c - deficient thymic progenitors to progress to the dn3 niche, thereby reducing their ability to provide competition to c - proficient progenitors. thus, data generated in our model are consistent with limiting thymic precursor supply, not only inducing a self - renewal phenotype in the murine thymus, but also simultaneously reducing competition in the dn3 niche with a resultant cell dose - dependent increase in oncogenic risk. there is currently no evidence that limiting thymic precursor supply is a risk factor for lymphoid malignancy in humans ; nevertheless, the possibility of cell competition acting as a tumor suppressor mechanism in the human thymus following vector - mediated insertional oncogene activation remains a compelling hypothesis. coupled with disease - specific differences in the progression of thymic precursors through t cell ontogeny, this hypothesis has the potential to help explain differing risks of oncogenesis. to explore the notion that limiting thymic precursor supply is a risk factor for oncogenesis, sub - lethally irradiated crag2 recipients were reconstituted with different doses of wild - type bone marrow hematopoietic progenitor cells (figure 1a). we chose to use crag2 recipients because il2rg mice have been shown to have a leaky t cell phenotype that manifests with age and would therefore not be suitable for longitudinal studies. importantly, however, the donor cells were il2rg. to ensure all mice received an equivalent cell dose, the total cell number was fixed at 5 10 per recipient animal, and, at the lower cell doses, sca1 progenitor cells from il2rg mice (c null) were combined with those expressing c ; 5 10 (high dose), 5 10 (mid dose) or 5 10 (low dose), with the latter two doses representing a phenocopy of 10% and 1% gene transfer, respectively. in this model, only wild - type cells are capable of progressing past the double - negative 2 (dn2) stage of thymic development. to investigate long - term oncogenic risk, mice reconstituted with a high, mid, or low dose of c - expressing progenitors were observed for up to 18 months. lymphoid malignancies were never observed in mice receiving the high dose, consistent with our previous study but detected exclusively in animals from the mid- and low - dose groups between 6.6 and 17.6 months post - transplantation (figure 1b). the latency for oncogenesis was also significantly longer in the mid - dose group compared with low - dose group (12.8 3.5 and 8.9 1.4 months, respectively ; p = 0.02). of the 31 mice that had received the mid cell dose, four developed malignancy, while the incidence of malignancy was not significantly greater than in mice transplanted with the high dose of progenitors, the survival rate was decreased (p = 0.03). in the low - dose group, both the incidence of malignancy and malignancy - free survival rates were significantly different when compared with the high - dose group (p = 0.0017 and p = 0.0001, respectively). of interest, the rate of malignancy in mice transplanted with the low dose of c - expressing cells (33.3%) was similar to that observed in our previous study (28.6%). necropsy showed hepatosplenomegaly with extensive blast infiltration, and histological analysis revealed marked disruption of tissue architecture in the liver, spleen, thymus (figure 1c), lung, and kidney (data not shown). interestingly, enlarged thymi containing malignant cells were almost exclusively present in mice transplanted with the lowest dose of c - expressing progenitors, which was in contrast to mice that developed malignancy from the mid dose group, where the thymus was small or, in most cases, not macroscopically visible (table 1). abnormal t cell populations in 12 of the 14 mice that developed malignancy were identified in the spleen, liver, thymus, bone marrow, and peripheral blood. the phenotypes of these tumors were diverse, with cells expressing immature, mature, and atypical combinations of surface markers (table 1). in addition, two of the 14 malignancies (14.3%) did not express the t cell markers cd3, cd4, or cd8 and were b220 positive (m249 and m250). peripheral blood assessed at 6 (data not shown) and 16 weeks post - transplantation (figure 2a) demonstrated lymphoid reconstitution with all three doses, with t, b, and natural killer (nk) cell compartments observed at the expected ratios. lymphoid reconstitution for mice receiving the mid dose of c - expressing cells was only approximately half (47%) that of animals receiving the high cell dose, despite receiving 10-fold fewer c - expressing cells. for mice receiving the lowest dose of c - expressing cells, lymphoid reconstitution was comparable to that of mice receiving the mid dose, and when compared to mice receiving the high dose of wild - type cells (i.e., 100-fold more c - expressing cells), the lymphoid compartment was reduced to only 43%. the level of bone marrow chimerism in mice reconstituted with either the high or low dose of wild - type (cd45.1 positive) progenitors was determined by flow cytometry. the contribution of wild - type cells was found to be 64.9% 3.0% (n = 8) in the high - dose group, indicating that the majority of cells engrafted in the bone marrow were derived from the wild - type c - expressing progenitors. for animals transplanted with the low dose of wild - type cells, the contribution was 3.4% 0.3% (n = 7), consistent with only 1% of the transplanted cells expressing c. to determine whether t cell receptor (tcr) diversity was affected by limiting thymic precursor supply, tcr v repertoire and spectratype analyses (on selected highly expressed tcr v families) analysis of the tcr v repertoire demonstrated that, for the majority of cases, both broad representation of all v families and the percentage of each v family was equivalent in peripheral blood samples taken from mice receiving each of the three c - expressing progenitor cell doses (figure 2b). spectratype analysis revealed normal gaussian distribution of peaks in mice receiving the high and mid dose of c - expressing progenitors for the majority of tcr v families investigated (figure 2c). for mice reconstituted with low cell numbers, the spectratypes appeared more restricted for some tcr v families. the observation of a relatively diverse tcr v repertoire for all cohorts is suggestive of increased expansion of immature t cells at the low compared with the high cell dose prior to tcr rearrangement. to assess the level of thymic t cell export occurring in vivo, the number of signal joint t cell receptor excision circles (sjtrecs), a by - product of tcr rearrangement, was quantified in sorted splenic t cell populations at 16 weeks post - transplantation (figure 2d). the numbers of sjtrecs isolated from mice receiving the high and mid doses were similar, implying that the transplanted cells had undergone comparable cell division after tcr rearrangement, which occurs at the double - positive (dp) stage in the thymus. in contrast, there was a modest, but statistically significant, reduction in the number of sjtrecs present in splenocytes from mice transplanted with the low dose of progenitors when compared with both the high and mid cell doses. this is indicative of increased t cell expansion in the cohort of mice receiving the low dose of c - expressing progenitors and is consistent with the observation of similar peripheral t cell reconstitution when compared with the mid dose group (figure 2a). we next sought to investigate the size and composition of the thymocyte population following transplantation. thymocytes are classified into distinct stages based on expression of cell - surface markers, the earliest of which are dn for both cd4 and cd8. this dn population contains four sub - stages (dn1dn4) identified by the level of cell - surface cd25 and cd44. thymocytes then enter the dp stage where they are positive for both cd4 and cd8 before becoming single positive (sp ; positive for either cd4 or cd8). at 6 weeks post - transplantation, for animals receiving either the high or low dose of wild - type progenitor cells, the total number of thymocytes was significantly reduced when compared to age - matched wild - type control animals not receiving bone marrow transplantation (figure 3a). this demonstrates that transplantation even of high doses of wild - type progenitors leads to sub - physiological levels of thymocyte reconstitution. the difference between the high and low wild - type treatment groups was also significant ; notably, however, the difference in the total number of thymocytes between these groups was only 7-fold, despite the 100-fold difference in the number of transplanted c - expressing cells capable of progressing past the dn2 stage, confirmed by flow cytometry using ly5.1 and ly5.2 labeling to identify the c - negative and c - positive populations, respectively (figure s1), indicating increased expansion in the low - dose cohort. the contribution of dn, dp, and sp cells in the thymus was examined by flow cytometry, which revealed a significant reduction of dp cells in transplanted animals, proportional to the number of available wild - type progenitors from the bone marrow (figures 3b and s2a). interestingly, this was concomitant with a significant increase in the proportion of mature cd4 and cd8 sp cells, that also expressed cd3, in transplanted animals compared with wild - type controls, potentially indicating an increased need for early t cells to transition through the thymus (p 2-fold when compared to wild - type thymocytes (brca2, card11, ccnd1, gnaq, hmga1, il21r, itk, jazf1, notch1, nr4a3, pdgfrb, recql4, rel, and tfrc). all sequenced samples except m313 (adoptive transfer recipient) showed evidence of substantial copy number decreases on the x chromosome, in comparison to sca1 bone marrow progenitors. also, substantial copy number gains on chromosome 15 were shown to be common for mice receiving the low dose of c - positive progenitors (m137, m189, m191, and m209). interestingly, one sample (m209) also displayed large copy number gains on chromosome 14 (figure 4). activating notch1 mutations were identified by wgs in each of the samples, comprising either a 5 deletion or mutations within the sequence encoding the proline, glutamate, serine, and threonine (pest) domain located in exon 34 (figure 5a). sanger sequencing across the affected regions confirmed these mutations and gene expression profiling by microarrays identified notch1 upregulation in malignant samples (3.5-fold, false discovery rate [fdr ] adjusted p value = 0.012). of the six samples investigated, five contained the 5 deletion and five contained a mutation in exon 34, with four of the six samples carrying both lesions. similar mutations have been identified in leukemia samples generated under conditions of thymic progenitor cell deprivation. to investigate the presence of activating mutations in the notch1 proto - oncogene in our other samples, dna sequence analysis was performed across the breakpoint of the 5 deletion as well as the pest, transactivation (tad), or heterodimerization (hd) domains. further, activating notch1 mutations (5 deletions and/or pest domain mutations) were identified in the remaining tumors (those not subjected to wgs) from mice transplanted with the low dose of c - expressing progenitors (table 2 ; figures 5b and 5c). the impact of activating mutations in notch1 was investigated by using qrt - pcr directed at the downstream targets, c - myc, dtx1, and hes1. in the malignant blasts examined (n = 5), elevated levels of these transcripts were observed when compared to normal wild - type thymocytes ; c - myc, dtx1, and hes1 were found to be upregulated by 6.85 1.80, 2.47 0.54, and 2.78 0.26-fold, respectively (data not shown). upregulation of hes1 (9.78-fold, fdr = 0.021) and c - myc (3.25-fold, fdr = 0.073) in malignant blasts was also detected by microarray analysis. we have identified limiting bone marrow progenitor supply to the thymus as an initiator of lymphoid malignancy in mice. importantly, this oncogenic risk is cell dose dependent, occurs within cell dose ranges that support immunological reconstitution, and does not require the complete absence of progenitor cell migration from the bone marrow as previously observed in thymic grafting studies,8, 10 making this feature of our model unique. based on existing evidence, the mechanism underlying oncogenesis is theorized to have two critical components. the first is the induction of a transformation - prone self - renewal phenotype in a subset of thymocytes as a homeostatic response to an inadequate supply of progenitors from the bone marrow.7, 8, 9 the second is reduced competitive pressure on this at - risk population for thymic niche space from differentiation - committed thymocytes progressing through lymphoid ontogeny. the proposed combined effect would be an increase in the number and residency time of transformation - prone thymocytes, leading to a correspondingly higher probability of cells within this population being subject to oncogenic second hit events, such as activating mutations in notch1. in an effort to phenocopy gene therapy for scid - x1 in our model system, mice were reconstituted with serially fewer wild - type bone marrow progenitor cells, used as surrogates for gene - corrected cells, against a background of c - deficient progenitors adjusted to maintain a constant total cell dose in all treatment groups. in this context, the inverse correlation observed between the incidence of t - lymphoid malignancy and wild - type progenitor cell dose is consistent with a failure of c - deficient cells to progress to the point in t cell ontogeny, the dn3 niche, where competitive pressure on tumor - prone self - renewing thymocytes has been hypothesized to exert a tumor - suppressive effect. when we initially observed t - lymphoid oncogenesis, independent of insertional mutagenesis in our earlier gene therapy study in scid - x1 mice, we favored replicative stress as a possible tumorigenic mechanism. for this reason, an effort was made to examine the differing effects of limiting progenitor cell doses on the extent and location of the homeostatic cellular expansion during t cell ontogeny by assessing tcr diversity and number sjtrec in peripheral blood t cells, although an analysis of whether there were differences in the percentages of naive and memory peripheral t cells, with an increase in the latter indicative of homeostatic proliferation under conditions of lymphopenia, was not performed. despite 100-fold fewer cells capable of progression past the dn2 stage of thymic ontogeny, and competent for lymphoid ontogeny in the low - dose wild - type progenitor cell treatment group, reduction in the resultant peripheral t cell compartment size this is clearly indicative of higher levels of cellular replication during t cell ontogeny in these animals. while this represents a 50-fold change in the relative size of the input progenitor and output peripheral t cell populations, the relative difference in the absolute number of cell divisions required to achieve this, in an exponentially expanding population, is much smaller. accepting that the dynamics of thymic homeostasis are complex,14, 15 this argues against the oncogenic risk observed at limiting progenitor cell doses being a simple function of the cumulative burden of somatic mutations acquired during individual cell division events. data from tcr diversity and sjtrec analysis in peripheral blood and splenic t cells, respectively, also provide similar arguments supporting this point. relatively well - preserved tcr diversity, in concert with trec - based evidence for a 2-fold replicative expansion of t cells following tcr rearrangement in mice receiving 100-fold fewer c - expressing progenitors, provides evidence of homeostatic expansion both before and after the dp stage of t cell ontogeny. while this supports a 50-fold relative expansion prior to, and a 2-fold expansion after the dp stage, in an exponentially growing population, the difference in the absolute number of cell divisions occurring before and after the dp stage is likely to be relatively small. further analyses, including whether there is increased proliferation of wild - type progenitors, compared to the immunodeficient populations, or a greater number of early thymic progenitors (etps) would contribute to the understanding of the extent and location of the homeostatic cellular expansion during t cell ontogeny in our model. early thymic progenitors, identified by high levels of ckit on their surface (ckit cells), have been shown to support long - term thymopoiesis in intrathymic transplantation studies.13, 16 if cell division itself was a strong risk factor for transformation, then one would expect a high proportion of such events to occur in more mature t cells, which is unsupported by existing evidence.7, 8, 9, 10, 11 when considering the possible relevance of these murine data to the oncogenic mechanisms operative in early human scid - x1 gene therapy trials, it is important to emphasize that murine cells are inherently more transformation - prone than human cells, and to our knowledge there is no evidence to suggest that limiting thymic precursor supply in humans carries oncogenic risk through the induction of thymocyte self - renewal. indeed, based on clinical experience in allogeneic stem cell transplantation for scid phenotypes including scid - x1, qasim. have argued against oncogenic risk being associated with a lack of bone marrow progenitor supply to the human thymus. they point to the absence of reports of t cell malignancy in patients with long - term thymopoiesis, despite single - lineage donor t cell recovery, which is considered indicative of thymic, but not bone marrow engraftment. a further important point is that oncogenesis in early human clinical trials, using conventional -retroviral vectors to treat scid - x1, chronic granulomatous disease (cgd), and wiskott - aldrich syndrome (was) invariably involved insertional mutagenesis, while oncogenic adverse events have not subsequently been observed with sin -retroviral or sin lentiviral vectors lacking strong viral enhancer - promoter elements. nevertheless, we argue that insertional proto - oncogene activation in human hematopoietic progenitors, as reported in early scid - x1 trials, is likely capable of inducing transformation - prone thymocytes. this is supported by the observation that deliberate lmo2 overexpression in mice can induce thymocyte self - renewal without a homeostatic drive being exerted by a limiting or absent progenitor supply. once such cells arise in the human thymus, albeit by an iatrogenic mechanism, it is plausible that c - deficient human thymic progenitors, akin to their murine counterparts, also fail to exert a tumor suppressor effect through competitive pressure. thus, the parallels of our findings, and those of previously reported thymic transplant studies, to the human gene therapy experience occurs once the cells acquire a capacity for self - renewal, induced by either limiting precursor supply or by proto - oncogene activation. this also provides an alternative explanation for the suggested oncogenicity of c itself that has been the topic of much debate.21, 22 an intriguing question arising from the tumor suppressor hypothesis is whether there might be disease - specific differences among disorders affecting t cell ontogeny in the capacity of thymocytes to exert tumor - suppressive effects through cell competition. for example, in gene therapy trials for ada - scid, using conventional -retroviral vectors to transduce bone - marrow - derived cd34 cells, there have been no reports of t cell leukemia, despite the frequent observation of integration events in lmo2 and other proto - oncogene loci. unlike c - deficient thymocytes, which fail to progress beyond the dn2 thymic niche, ada - deficient thymocytes are able to progress through thymic ontogeny when the thymic microenvironment is sufficiently metabolically detoxified, thereby providing a possible tumor suppressor effect in more distal thymic niches by competing with transduced cells carrying insertional proto - oncogene activation events (figure 6). while alternative hypotheses exist to explain the differing risk of oncogenesis in early gene therapy trials for scid - x1 and ada - scid, none provide a unifying conceptual framework. for scid - x1 these include evidence for cooperativity between lmo2 and c expression in the thymus with double transgenic mice showing accelerated development of t cell malignancy, strikingly in association with notch1 mutations. for ada - scid, these include the possibility that the progenitors transduced in bulk cd34 populations might be more differentiated than for scid - x1, and that the level of vector - encoded ada expression might be insufficient to support the development of a t cell leukemic phenotype, which has been shown to be associated with increased ada expression. another notable difference between these two gene therapy trials was the use of sub - ablative busulfan conditioning in ada - scid patients, which is known to increase the level of bone marrow engraftment. it is therefore conceivable that increased bone marrow engraftment may lead to increased thymic seeding with a resultant reduction in oncogenic risk. increasing the level of myeloablative condition in our model might also reduce the incidence of malignancy for a given cell dose. a further challenge is to reconcile the concept of cell competition as a tumor suppressor mechanism in the thymus with the occurrence of t cell leukemias in a gene therapy trial for wiskott - aldrich syndrome (was) using a conventional -retroviral vector. six of ten treated patients developed t - all with dominant lmo2 clones identified in each case. several of the leukemias also had secondary mutations in the proto - oncogenes tal1 and lyl1, both of which are known to be associated with t - all. similar to ada - scid, there is no absolute block to t cell ontogeny in the thymus in was, although abnormalities of t cell development have been implicated in this condition.28, 29, 30 of particular relevance, the was protein (wasp) has been shown to be important for double - negative to double - positive cell transition that may partly be explained by reduced cycling of dn3 cells. further, it has been suggested that in the absence of wasp, the decreased migratory responses and increased percentage of single positive cells implies retention of these cells in the thymus. it therefore remains plausible that this could result in reduced competitive pressure on thymocytes rendered pre - leukemic by insertional proto - oncogene activation. data derived from our model are certainly consistent with this possibility given our demonstration that lymphoid oncogenesis does not require a complete block in bone marrow progenitor supply and, at least in mice, is observed at wild - type progenitor cell doses that are sufficiently high to reconstitute the peripheral t cell compartment. ultimately the hypothesis that ada and was protein - deficient thymocytes have differing capacities to act as tumor suppressors in the thymus, through cellular competition, requires experimental evaluation and could be addressed in the model system we describe in the current report using c - deficient cells. ultimately, despite evidence that insertional proto - oncogene activation was necessary, but not sufficient, for development of t cell leukemias in early gene therapy trials for scid - x1, the second hit events required for transformation, which we hypothesize are suppressed by cellular competition, show considerable similarity in mice and humans, most notably activating mutations in the pest domain of notch1.3, 4 these, predominantly frameshift, mutations result in the production of a truncated protein and persistent activation of notch1 downstream targets5, 31, 32 and are consistent with those identified in our previous gene therapy model. interestingly, in contrast to the findings of martins., mutations in the hd or tad domains were not present in our samples. this is likely due to the notch1 5 deletion being functionally similar to a hd mutation (see below) ; thus, the presence of a 5 deletion and hd mutation in the same cell would be mechanistically redundant. finally, consistent with the strong association of notch1 mutations and cases of t cell leukemia and lymphoma in the two malignancies not expressing t cell - surface markers (m249 and m250), notch1 mutations could not be detected by sequencing amplicon clones., where all leukemias had an immature cd8 single - positive (isp)/double - positive (dp)-like surface phenotype and possibly reflect inherent differences between these two models, notably the source of thymic progenitors being either whole thymus or, in our model, more immature bone marrow progenitor cells. in samples with the 5 deletion, an aberrant notch1 mrna initiated from a cryptic promoter in exon 25 produces an active intracellular notch1 protein that is independent of ligand binding and -secretase cleavage35, 36, 37 and therefore constitutively expressed (figure 5a). these mutations have been shown to result from illegitimate v(d)j recombination and, in our study, may have arisen from a failure of cells to exit the thymus as a result of reduced progenitor cell supply. notably, although 5 deletions in notch1 were not identified in scid - x1 patient samples, they did contain deletions in the tumor suppressor gene locus cyclin - dependent kinase inhibitor 2a (cdkn2a), also shown to be the consequence of aberrant v(d)j recombination ; however, similar cdkn2a deletions were not found in the six tumor genomes analyzed by wgs in this study. further evidence of illegitimate v(d)j recombination was identified in our model by whole - genome sequencing, where both / and / recombination events were present in all six tumor genomes analyzed (data not shown). this is in keeping with the observation that the t - all that developed in some patients in the scid - x1 trials arose from both the / and / t cell populations. in summary, our studies support the role of regenerating thymic precursors in the thymus leading to further genetic abnormalities that predispose to cancer. these findings help explain the differences in cancer risk in diseases treated with gene therapy based on the relative size of the thymic precursor pool and the need for regenerative thymic clones that are predisposed to malignant transformation. although there is currently no evidence that limiting thymic precursor supply is a risk factor for lymphoid malignancy in humans, our data provide a compelling conceptual framework that could explain why t cell leukemia was observed in early scid - x1 trials but not in ada - scid patients, despite both groups containing integrations near proto - oncogenes such as lmo2. il2rg mice were obtained from the jackson laboratory, crag2 mice were kindly provided by professor stephen nutt (walter and eliza hall institute, parkville, australia), and c57bl/6 mice were obtained from the animal resources centre (arc). all experimental procedures were approved by the animal ethics committee of the children s medical research institute and the children s hospital at westmead. recipient crag2 mice were exposed to sublethal (6 gy) irradiation using a gammacell 40 exactor (mds nordion). bone marrow was harvested from 8- to 10-week - old il2rg, c57bl/6, or c57bl/6 ly5.1 congenic mice, and sca1 progenitor cells were isolated using the easysep sca1 positive selection kit (stemcell technologies), resuspended in 200 l rpmi 1640 medium (life technologies) and injected intravenously into recipient mice via the tail vein. at 15 weeks post - transplantation, individual tcr v families in peripheral blood were detected using qrt - pcr and primers specific for the tcr chain. the tcrv repertoire diversity of the six most highly represented tcr v families was subsequently analyzed by cdr3 spectratyping as outlined previously. at 16 weeks post - transplantation, t cells from reconstituted mice were separated using the easysep mouse cd90.2/thy 1.2 positive selection kit (stemcell technologies) and genomic dna isolated using the gentra puregene cell kit (qiagen). signal joint t cell excision circles (sjtrec) were detected by using real - time qpcr with the following primer and probe set ; forward 5-cattgcctttgaaccaagctg-3 ; reverse, 5-ttatgcatagggtgcaggtg-3 ; probe 5-fam - cggcagggtttttgtaaaggtgctcactt - qsy-3. reactions were performed on a rotor - gene 6000 (qiagen), and the number of sjtrec within each sample was determined by using the comparative ct method and a sample containing a known number of sjtrec copies, diluted in murine 3t3 cell genomic dna. the constant gene segment of the tcra gene (c) was used to compensate for variations in input dna with the following primer and probe set : forward 5-tgactcccaaatcaatgtg-3 ; reverse, 5-gcaggtgaagcttgtctg-3 ; probe 5-fam - tgctggacatgaaagctatgga - qsy-3. cells from the bone marrow, thymus, spleen, liver, and peripheral blood were stained and analyzed on a facscanto (bd biosciences) running facsdiva (v.6.1.3) and flowjo (v.7.6.1, flowjo llc) software. lymphocytes were identified and gated based on their forward - scattered light (fsc) and side - scattered light (ssc) profiles. cell suspensions were treated with ack lysis buffer (150 mmol / l nh4cl, 10 mmol / l khco3, and 0.1 mmol / l disodium edta) and then stained with the following conjugated antibodies : b220-apc - cy7 (bd biosciences), cd2-fitc (bd biosciences), cd3-pe (bd biosciences), cd3-alexaflore 647 (bd biosciences), cd4-fitc (caltag laboratories), cd8a - apc (caltag laboratories), cd8a - alexaflore 647 (bd biosciences), cd25-fitc (bd biosciences), cd44-pe (bd biosciences), cd45-apc (bd biosciences), ki-67-fitc (bd biosciences), ly5.1-percp - cy5.5 (bd biosciences), ly5.2-percp - cy5.5 (bd biosciences), nk1.1-apc (caltag laboratories), and sca1-alexaflore 647 (bd biosciences). tissue was dissected from c57bl/6 control or transplanted crag2 recipient mice and fixed in 10% buffered formalin (sigma - aldrich). paraffin - embedded sections (5 m) were stained with h&e and evaluated by light microscopy. images were captured from a zeiss axio imager.a1 microscope (carl zeiss microimaging) using a spot enhanced camera (diagnostic instruments, scitech) running spot software (v.4.0.1). to determine whether malignancies were donor or recipient in origin, genomic dna was isolated using the gentra puregene cell kit and qpcr performed using primers to either the human c (5-ctttattgataacgatctatatccctcaccc-3 and 5-ctccactctgcagagtctatggaatcc-3) or bacterial neomycin phospho - transferase (5-cttgggtggagaggctattc-3 and 5-aggtgagatgacaggagatc-3) gene. reactions were performed on a rotorgene 6000 (qiagen) using the quantitect sybr green pcr kit (qiagen) and standardized using primers to the murine titin gene (5-aaaacgagcagtgacgtgagc-3 and 5-ttcagtcatgctgctagcgc-3) by the comparative ct method. genomic dna from six lymphoid tumors and one control sample of c57bl/6 sca1 progenitor cells were sequenced at the beijing genomics institute (bgi), using hiseq2000. whole - genome sequencing was achieved to 30 times coverage and a comparative analysis between the control sample and the tumors, to call tumor - specific somatic single nucleotide variants (snvs), somatic copy number variations (cnvs), short insertions / deletions (indels), and structure variant (sv) mutations, was performed. bgi s cancer genomics bioinformatics pipeline was applied for sequencing analysis and variation detection (http://www.bgitechsolutions.com/). paired - end reads were aligned by burrows - wheeler aligner (bwa) to the mouse mm9 reference genome. all bam files were processed to identify duplicates using the picard markduplicates tool from the broad institute. snvs were detected using varscan, indels were called by samtools, cnvs were called by bgi s proprietary method cnv_detection, and svs were called by crest. the integrative genomics viewer (igv) 2.3 was used to visually inspect sequence reads. bam files and associated metadata in xml format have been uploaded to the european nucleotide archive (ena ; http://www.ebi.ac.uk/ena) under the study identification number prjeb8006. total rna for expression analysis was isolated using the rneasy mini kit (qiagen), and transcriptome profiling was performed by the ramaciotti centre for gene function analysis (university of new south wales). briefly, total rna samples (500 ng / sample) were amplified and labeled according to the manufacturer s instructions (affymetrix). amplified rna was quantified using a nanodrop (thermo scientific) and distribution of the amplified material was analyzed in a 2100 bioanalyzer (agilent). amplified crna was hybridized onto affymetrix mouse 2.1 gene arrays ; the arrays were scanned and expression measurements extracted using the affymetrix expression console v.1.3 software. microarray data have been deposited at arrayexpress (http://www.ebi.ac.uk/arrayexpress/) under the accession number e - mtab-3159. robust multi - array average (rma) was applied to normalize the expression data, and the remaining analysis was carried out using bioconductor package in the r statistical language 3.01. p values were adjusted by benjamini & hochberg s method to account for multiple test correction. genes with expression change 2-fold and adjusted p value (fdr) 0.05 were considered as differentially expressed. mutations within the pest, tad, or hd domains of notch1 were identified by sequencing pcr products amplified using pfu dna polymerase (promega). primers spanning exons 26, 27, and 34, where the hd, tad, and pest domains are located, are described elsewhere. the presence of structural variations in notch1 identified by was was confirmed by pcr amplification using phusion high - fidelity dna polymerase (new england biolabs) and primers adjacent to the 5 and 3 break points (5- cagtcaggagtggtggatcc-3 and 5-ggcttggtctagtgctcctg-3). in cases where the pcr product contained more than one amplicon, the pcr product was cloned into pgem - t easy (promega), and the sequence of individual clones was determined. total rna was extracted using the rneasy mini kit (qiagen) from lymphoblastic cells or from wild - type thymocytes and cdna synthesized from 1 g total rna by using the superscript iii first - strand synthesis supermix kit (life technologies). to determine whether mutations in notch1 affected expression of downstream target genes, qrt - pcr was performed on a rotorgene 6000 using c - myc (5-ctgtttgaaggctggatttcct-3 and 5-cagcaccgacagacgcc-3), dtx1 (5-tgcctggtggccatgtact-3 and 5-gacactgcaggctgccatc-3), and hes1 (5-aagacggcctctgagcaca-3 and 5-ccttcgcctcttctccatgat-3) primers using the brilliant iii ultrafast sybr green qpcr master mix (agilent technologies). expression levels were standardized using primers to the -actin gene (5- ctagacttcgagcaggagatggc-3 and 5- tctgcatcctgtcagcaatgcc-3) by the comparative ct method. results were analyzed by the wilcoxon rank - sum (mann - whitney) (http://www.socscistatistics.com/tests/mannwhitney/default2.aspx) or fisher s exact test (http://www.graphpad.com/quickcalcs/contingency1.cfm). for comparison of population survival, cohorts of mice were evaluated using kaplan - meier analysis (graphpad prism v.5.04). values represent the mean sem and results considered significant when p < 0.05. | in early gene therapy trials for scid - x1, using -retroviral vectors, t cell leukemias developed in a subset of patients secondary to insertional proto - oncogene activation. in contrast, we have reported development of t cell leukemias in scid - x1 mice following lentivirus - mediated gene therapy independent of insertional mutagenesis. a distinguishing feature in our study was that only a proportion of transplanted c - deficient progenitors were transduced and therefore competent for reconstitution. we hypothesized that reconstitution of scid - x1 mice with limiting numbers of hematopoietic progenitors might be a risk factor for lymphoid malignancy. to test this hypothesis, in the absence of transduction, scid - x1 mice were reconstituted with serially fewer wild - type hematopoietic progenitors. a robust inverse correlation between hematopoietic progenitor cell dose and t - lymphoid malignancy was observed, with earlier disease onset at lower cell doses. malignancies were of donor origin and carried activating notch1 mutations. these findings align with emerging evidence that thymocyte self - renewal induced by progenitor deprivation carries an oncogenic risk that is modulated by intra - thymic competition from differentiation - committed cells. although insertional proto - oncogene activation is required for the development of malignancy in humans, failure of c - deficient thymocytes to effectively compete with this at - risk cell population may have also contributed to oncogenesis observed in early scid - x1 trials. |
uterine cervical cancer is one of the most common cancers diagnosed in women of reproductive age. thanks to the progress of the cervical cancer screening system, the mortality rate of patients with cervical cancer has decreased in japan over the past twenty years1. however, the number of patients with early invasive cervical cancer during reproductive age is increasing., radical trachelectomy (rt) with pelvic lymphadenctomy has become a valuable fertility - preserving treatment option for these patients in japan2 - 4. we have already performed 20 vaginal rts with laparoscopic lymphadenectomy, and have experienced five pregnancies and four deliveries so far. as we reported before, in pregnant patients who undergo this operation, premature labor and the following occurrence of preterm premature rupture of the membrane (pprom) various factors such as lack of a protective effect against vaginal infection or the lack of mechanical support of the residual cervix due to the dissection of the uterine cervix and the division of supplying arteries might induce such complications. on the basis of these complications, there might be reduced blood supply to the remaining uterus. furthermore, if the blood supply to the uterus is reduced, it could be a cause of intrauterine growth retardation (iugr) or intrauterine fetal death (iufd)5. in this report, we studied changes of the blood supply to the uterus in two patients who experienced pregnancy and delivery. in the period from january 2003 through december 2009, a total of 20 women with early - stage invasive uterine cancer underwent vaginal rt with lymphadenectomy in sapporo medical university hospital. among them, five patients became pregnant, and four of them delivered by cesarean section. in this study, we performed 3-d ct scanning for assessment of the blood supply to the uterus in two patients who had undergone vaginal rt with pelvic lymphadenectomy after delivery. 3-d ct scanning was also performed in a woman with normal uterus after the delivery for the assessment of an intra - abdominal disease, and her picture was used as a control. the clinical courses of pregnancy, fetal growth measured by ultrasonography, and results of histopathological examination of the placenta were also compared between the two patients. as a pap smear at a local clinic showed atypical squamous cells corresponding to cervical intraepithelial neoplasia (cin) 3, she was referred to our hospital. she received diagnostic laser conization, and she was diagnosed as having stage ib1 squamous cell carcinoma. then she underwent vaginal rt and laparoscopic lymphadenectomy, and she became pregnant six months after the operation by artificial intrauterine insemination. she was admitted to our hospital with a diagnosis of threatened abortion at 17 weeks of gestation. in spite of bed rest, disinfection therapy, and the administration of ritodrine she was diagnosed as having stage ib1 cervical squamous cell carcinoma by diagnostic laser conization at a local hospital. she also underwent vaginal rt and laparoscopic lymphadenectomy. at 14 months after the operation, she became pregnant without any artificial reproductive techniques. we recommended her to enter our hospital early in the second trimester in spite of no signs of threatened abortion. daily vaginal disinfection with popidone iodine, bed rest, and administration of ritodrine and an ulinastatin vaginal suppository were continued as a new follow - up modality for pregnant patients who received rt. finally, at 35 weeks of gestation, scheduled cesarean section was performed for her. the postpartum courses of the patients were not remarkable, and no signs of recurrence have been seen for either patient up to now. briefly, a rim of vaginal mucosa was delineated circumferentially and excised so that the anterior and posterior mucosae could cover the cervix. after these procedures, the cervix was amputated approximately 10 mm below the isthmus, a nylon suture was placed around the cervix, and a sturumdorf suture was placed to cover the surface of the cervix. figures 1 and 2 show the blood vessel distribution in the uterus for both patients. identification of blood vessels was performed by a radiologist (m.t). in vaginal rt, we usually amputate the cervix at the level of the uterine artery, which corresponds to approximately 10 mm below the isthmus. in this procedure, we usually ligate and cut the descending branches of the uterine arteries and vaginal arteries 2 show that the descending branches of uterine arteries and vaginal arteries could not be seen in either patient. new arterial vascularization from the ascending branches of uterine arteries arose, and these new vessels seemed to supply blood to the remaining cervix, including the neo - cervix. on the 3-d ct scan, no ischemic areas were seen in the remaining uterus. patient 1 received emergent cesarean section at 24 weeks of gestation because of sudden premature rupture of the membrane. therefore the birth weight of the child of patient 1 was 588 g, though she survived thanks to the efforts of neonatologists and co - workers. fetal growth of patient 2 was also within the normal range over the pregnancy period. 4 shows changes of cervical length as measured by transvaginal ultrasonography in the both patients. the remaining cervix of patient 1 was shorter than that of patient 2 over the pregnancy period. furthermore as shown in table 1, the placenta from patient 1 showed the existence of severe chorioamionitis, which might have been a cause of pprom ; however, no ischemic changes of the placenta were detected histopathologically. the placenta of patient 2, who delivered at 35 weeks of gestation, did not show ischemic changes either. in this study, we looked at changes of blood supply to the uterus after vaginal rt in two patients who experienced pregnancy. the effects of blood supply on the fetal growth and the placental changes were also studied. rt removes the cervix of the uterus, parametrium, and upper vagina through a vaginal approach and is designed to preserve childbearing potential in young patients with cervical cancer. this procedure requires ligation and cutting the descending branches of uterine arteries as well as the division of vaginal arteries. the uterus has six main supplying arteries : two ovarian, two uterine, and two vaginal arteries. it is said that four of the six arteries are required to ensure uterine viability5. however, almost half of the supplying arteries are cut after vaginal rt. reported that the blood flow reduction after ovarian artery ligation was more pronounced than after uterine artery ligation in rats, which means that the ovarian artery might be the major contributor of blood flow to the uterus. in this study, 3d ct scans also showed sufficient blood flow to the uterine body through both ovarian arteries, the remaining ascending branches of uterine arteries, and a new network of vessels. a decrease of blood supply to the uterus can cause abortion or intrauterine growth retardation (iugr) of the fetus 6. in these conditions, ischemic changes of the placenta include an increase of avascular villi, syncytial knots, and an immature syncytial sprout, or increased lesions of placental infarction6,7. furthermore, as we reported before, molecular biological changes such as increased expression of apoptosis - related genes are also seen8. however, the placentas of the both patients in this study showed no such ischemic changes. furthermore, fetal growth of both patients up to delivery was within the normal range. these results suggest that division of the descending branches of uterine arteries and vaginal arteries does not seem to affect fetal growth. does division of descending branches of uterine arteries and vaginal arteries affect the function of the neo - cervix ? lack of mechanical support of the residual cervix, ascending infection and chorioamnonitis, caused by disruption of the endocervical glands and reduced secretion of mucus, have been thought be causes of pprom. as we have shown in this study, the remaining cervix of patient 1 after vaginal rt was found to be shorter than that of patient 2 by transvaginal ultrasonographic assessment over the pregnancy period. although patient 1 suffered from pprom at 23 weeks of gestation, the blood supply to the lower segment of the uterus did not show any differences between the two patients. for this patient, the cause of pprom might have been chorioamnionitis caused by the reasons described above. rt now has become an acceptable treatment modality in patients with early invasive uterine cancer who hope for preservation of fertility. however, vaginal rt is completely different from laser conization from the point of view of targeting lesions and postoperative invasiveness. although more than 300 pregnancies have been reported since dargent reported his first series of radical trachelectomies in 1994 9,10,11, there are still few reports on pregnancy complications after rt. it is known that lack of a protective effect against vaginal infection or the lack of mechanical support of the residual cervix due to the dissection of the uterine cervix might be a cause of pprom, and the following occurrence of preterm premature delivery. furthermore, as martin. reported, in patients with high risk of recurrence, adjuvant therapies such as radiation therapy or chemotherapy might be necessary after rt. however, as far as we know, effects of changes of blood supply to the uterus after rt have never been discussed. in this report, we looked at changes of the blood supply to the uterus in two patients who experienced pregnancy and delivery. however, we believe that the division of the descending branches of uterine arteries and vaginal arteries leads neither to a decrease of blood supply to, nor to the dysfunction of, the neo - cervix. and these procedures also do not affect the fetal growth and the placental growth. furthermore, neovascularisation of the remaining uterine cervix would have been completed relatively early after the operation because both patients became pregnant within two years. thus effects of changes of uterine blood flow on pregnancy courses seemed to be minimal. however, the following up of pregnancy in patients who underwent rt is still a challenge for obstetrician. further clinical investigation to prevent pregnancy - related complications in patients who underwent rt would improve the pregnancy outcome of these patients. | background. vaginal radical trachectomy (rt) ligates and cuts several arteries supplying the uterus. changes of blood supply to the uterus in two patients who experienced pregnancy and delivery were studied by using 3-d ct scanning. effects of changes of blood supply to the uterus on the pregnancy courses were also examined.methods. vascular distribution in the uterus was studied in two patients who received vaginal rt after delivery. effects of changes of vascular distribution after vaginal rt were studied with respect to pregnancy courses and cervical functions.results. new arterial vascularization from the ascending branches of uterine arteries or other arteries occurred, and these new vessels seemed to supply blood to the remaining cervix. differences of fetal growth and histopathological changes in the placenta between the two patients could not be detected.conclusion. ligation and cutting of several supplying arteries by rt induces new areterial vascularization and it does not seem to affect fetal growth and placental function. |
end - stage renal disease (esrd) is a growing public health problem and one that has a significant impact on the lives of patients. there are multiple sources of stress associated with the loss of kidney function and reliance on a multifaceted treatment regime. the reliance upon dialysis is one of these stressors, with other adjustments including changes in family roles, mobility, dietary constraints, medication effects, worry over the dependency on treatment and fear of death [3, 4, 5 ]. the diagnostic and statistical manual of mental disorders 4th edition (dsm - iv) defines major depressive disorder as the loss of interest or pleasure for weeks accompanied by a constellation of 5 or more psychological, behavioural and somatic symptoms, and classifies depression as a disease which is primarily generic or neurochemical in aetiology. the symptoms of depression include depressed mood, sleep disturbances, fatigue, reoccurring thoughts of death or suicide and a lack of energy. in chronically ill populations, it is estimated that depression accounts for half of the identified psychopathology, which can lead to increased clinical and psychological morbidity due to reduced compliance with treatment and reduced functional levels. indeed, in esrd, several studies have demonstrated the association between depression symptoms, quality of life (qol) [9, 10 ] and survival [11, 12, 13, 14, 15 ]. although the prevalence of depression in esrd is largely unknown, its impact on treatment outcomes has made it critical to advance the psychological assessment of patients. the assessment of depression typically involves self - complete screening instruments and the use of clinical diagnostic interviews, either of which are administered according to diagnostic classification systems such as the dsm - iv or the international classification of diseases (icd-10). screening instruments typically employ cut - off scores which can be used to characterize a patient 's symptoms as mild, moderate or severe in terms of depressive symptomatology. in chronically ill populations, the accuracy of screening instruments is, however, limited due to criterion contamination, which is the overlap of somatic symptoms associated with the underlying medical illness and depressive symptomatology [2, 8 ]. whether or not screening and diagnostic schemes should remove overlapping symptoms is a topic of much debate, and there is limited evidence to suggest that the cognitive and somatic symptoms associated with depression can be separated from affective and behavioural components [16, 17, 18 ] nonetheless, several studies in the renal field have now reported on the clinical diagnostic accuracy of screening instruments such as the beck depression inventory (bdi - ii) for this patient group, finding that the prevalence of depression in esrd ranges from 20 to 30% and indeed contributes to adverse clinical outcomes, although precise measurement remains a pertinent issue. the advances made in the clinical understanding of depression symptoms in esrd will, however, benefit some patients more than others. research in this area has, in the main, focused on the experiences and development of screening practices for patients from white euro - american backgrounds, which remains a significant issue in terms of generalizability. this may be because there are unique barriers that prevent clinicians from exploring the concerns and symptoms of patients from other cultural and ethnic groups. the aim of this article is to discuss the issues surrounding screening and diagnosis of depression in south asian patients (patients originating from the indian subcontinent including india, pakistan, bangladesh and sri lanka) with esrd. whilst esrd is a recognized health problem across the world, its prevalence in south asian populations is unknown because of insufficient national and international registries and poor government policies to support patients from developing countries. it is however clear that within the united kingdom (uk), there is a significantly higher incidence of esrd in south asians [21, 22 ]. it is estimated that south asians are 3 to 5 times more likely to develop esrd when compared to white europeans [23, 24, 25, 26 ]. this has often been explained in terms of the greater prevalence of diabetes in south asians, which is the most common cause of esrd, making this group more vulnerable to diabetic nephropathy than other minority and european groups, often despite uniform medical care [25, 28, 29 ]. consequently, there is a high demand for renal transplants amongst south asians in the uk, although the supply of suitable kidneys is low, as is the rate of transplantation. it is however encouraging that studies conducted in both the uk and the united states report that survival rates in esrd are not compromised due to ethnicity. in fact, several studies have reported better survival rates in south asian dialysis patients [31, 32, 33, 34 ]. although the determinants of better survival in south asians are not fully understood, factors such as higher mean kt / v have been associated with more favourable outcomes. to our knowledge, there are no published studies on the prevalence of depression in haemodialysis patients of south asian origin. a study carried out with patients receiving peritoneal dialysis in india reported that 65% of patients experienced some depressive symptoms, and that 19% of patients had severe depressive symptomatology. the dearth of research into the prevalence of depression in this patient group is coupled with few qualitative investigations into the attitudes, thoughts and feelings of south asian patients toward renal care, which makes it difficult to understand the range of factors that impact treatment adherence and outcomes, and to make selected comparisons with other groups. there is however evidence to suggest that qol, which is an important propensity of patient outcomes, is significantly lower in south asian patients receiving renal replacement therapy when compared to their caregivers, and other minority and white euro - american patients. specifically, south asian patients are more likely to view esrd as a social burden, even when successfully treated by transplantation. differences in qol appear to be unrelated to treatment modality, treatment adequacy and comorbidities. so whilst south asian patients may not be disadvantaged in treatment outcomes, as suggested by quantitative investigations, there may be differences in patient experiences that impact psychological well - being an area that has been largely ignored in the renal literature. there are several reasons for the scarcity of research into the psychological well - being of south asian patients with esrd. first, there are often language barriers which make it difficult for clinicians and researchers alike to explore the concerns and symptoms of patients, and may indeed lead to misinterpretations of patient complaints [38, 39 ]. of course, one way to advance screening of depression symptoms would be to undertake the translation of validated instruments to meet the linguistic needs of the south asian community within the uk. propose that studies utilizing translation and interpretation are often expensive and time - consuming, making them less attractive for funding. where translation and interpretation is available, accurate exploration of experiences may be limited by several factors, including culture - specific idioms of distress. this may result in patients endorsing certain items less frequently because they can not relate to the language used, which is not the same as being symptom free. krause reported on a group of south asians in bedford, uk, originating from punjab in india and described the occurrence of the sinking heart was seen as a culture - bound syndrome that resulted from a combination of social, physical and emotional factors. consequently, bhui. suggest that translators and interpreters must be equally competent in both the source and second language and understand the semantic range of both languages, whilst being sensitive to variations in cultural understandings of distress. edwards further suggests that translation can be facilitated by the translator being a native speaker in the target language and fluent in the language of the text to be translated. there are also disparities in the quality of translation undertaken in studies where scales have been used across cultural and ethnic groups. translation should be an iterative process, involving both forward and back translation to ensure face and content validity. however, there are marked differences in the use of forward- or backward - only translation with mono- or bilingual tests of accuracy. poor translation methods are often accompanied by a lack of reporting on the validity of translations, with sensitivity and reliability analyses being undertaken without confidence in the conceptual equivalence of scales for use across cultures. this results in the limitations of measures being advanced without providing confidence in the validity of the translated scales. different constructions of psychological distress across cultures may well have clinical implications which undermine the precise assessment of conditions such as depression. conducting and evaluating the process of translation needs to be the core aspect of the research design and reporting, without which it will be difficult for professionals to select appropriate instruments to screen for distress in different patient groups. for a vast number of patients, translated scales, at least within their self - complete format, will not be suitable, and patients will require the use of interpreters in the completion of the scales. feehally, for example, states that 25% of south asians aged over 65 years living in leicester, uk, can not read or write in their native language or english. the use of interpreters to communicate with patients also requires a number of considerations. in a clinical setting, interpreters need to translate the patient 's narrative promptly, leaving little time for considering emotional components of language, attitudes and beliefs, which play a vital role in informing clinical interpretations and treatment of symptoms. furthermore, the presence of an interpreter may hinder the development of an empathic relationship between clinicians and patients, with the non - verbal aspects of communication often being lost when communicating through an interpreter. there may also be variations in how interpreters view their roles, with research suggesting that for some, the role is related solely to accurate communication of information, whilst others view cultural advocacy, sensitivity and social support as fundamental components and factors which influence the assessment of mood. it is also necessary to be aware of cultural tensions between patients and interpreters that influence willingness to disclose symptoms. so whilst translation and interpretation services are undoubtedly useful in clinical settings, research is still lacking in specifying the optimal conditions for ensuring that vital aspects of communication are not lost or misinterpreted through such modes of communication with patients. studies undertaking the task of translating screening instruments for use in the south asian esrd population need to pay due attention to the process of translation and on reporting key information that will allow professionals to make informed decisions in how best to assess the psychological requirements of patients. it is also highly plausible that there will be differences in the meaning attributed to symptoms of depression in cultures where there are no linguistic equivalents for the term. indeed, the way patients conceptualize their distress is predicative of not only symptom presentation, but also help seeking behaviour [49, 50 ]. whilst the beliefs of south asians within the uk may be influenced by the host society, several studies have found that although south asians may be aware of the so - called psychosocial features of depression, they do not favour a biological model of mental illness, which is the core of the dsm - iv and icd-10 criteria [51, 52, 53, 54, 55 ]. furthermore, south asians are more likely to see depression as the result of worry, whereas white euro - americans have been found to attribute depression to hopelessness and low mood. karma and god 's will are often advanced to help explain medical and psychiatric illness [39, 53, 56, 57 ]. in a clinical study of canadian south asian punjabi - speaking women with breast cancer, gurm. found that patients predominantly made sense of illness in the context of spirituality. spirituality provided meaning to illness, often in light of cancer being seen as part of a person 's karma or punishment for sins. these findings have been replicated with other clinical groups including patients with coronary heart disease (chd). south asian patients with chd encompass biological causes in their explanations of chd, but spiritual factors also form a core part of illness attributions. more recently, a survey of south asians in the united states found that whilst 88% of respondents favoured the belief that mental illness is a medical problem, there was stigma attached to seeking professional help, with south asian patients preferring to turn to close family and friends for support. seeking help for psychiatric issues can be seen as a sign of weakness or as going against god 's will, and openly disclosing illness may have broader social consequences for the family. the meaning attributed to psychiatric symptoms thus varies across different cultural and ethnic groups, and many authors have expressed concern over the universal applicability of the western model of mental conditions [62, 63, 64 ]. in practice, this means that screening instruments must capture culture - specific idioms of distress, and clinicians need to be aware of barriers that inhibit patients from freely disclosing their symptoms. a further challenge for clinicians in identifying psychiatric comorbidities pertains to differences in symptom presentation. due to multiple cultural variants in the expression of distress, a topic that has attracted much attention across disciplines is the increased prevalence of somatic complaints amongst south asians, which have often been labeled idioms of emotional distress [39, 65, 66, 67, 68 ]. somatic complaints occur across all cultural groups, although there are marked differences in prevalence and features. kirmayer and young caution against the belief that excess somatization in non - western cultures represents an apparent primitiveness or inability to express psychological distress. psychological and somatic symptoms may be just as valid in the expression of distress, and the clinical significance of different symptoms remains unclear. for some cultural groups, expressing distress through physical complaints however, established scales such as the bdi - ii and the hospital anxiety and depression scale contain limited or no items related to the somatic features of psychological conditions. this helpfully prevents the risk of items being endorsed due to an underlying medical reason but perhaps makes the scales less relevant for other cultural groups where somatic and psychological complaints co - exist or where somatic complaints dominate and obscure psychological expressions of distress. indeed, beliappa proposes that in non - western cultures where the mind and body are not viewed as distinct entities or compartmentalized, the distinction between psychological and somatic complaints may be less meaningful. the accurate screening and diagnosis of depression must therefore take account of cultural variations in both the conceptualization and expression of distress. culture undoubtedly influences the expression of psychological distress, and health professionals are aware of the challenges in providing care for patients from diverse cultural and ethnic backgrounds. in light of the issues related to differing conceptualizations, symptom presentation, and the complexities involved in utilizing translation and interpretation, it may seem sensible to employ culture - specific measures of depression, developed within the indian subcontinent. such a stance is perhaps best understood by considering the distinction made in cross - cultural research between the emic and etic approaches. the emic approach focuses on culturally bound constructs and culture - specific measurement of a phenomenon. an emic measure would seek to capture the unique features of distress, as experienced by a particular ethnic group. for example, using this approach, researchers have identified culture - bound somatic complaints, which act as idioms of distress. sinking heart in punjabis in bedford, uk, which most closely resembled the western conceptualization of stress. exploration of culture - bound syndromes has also led to the development of a number of indigenous instruments for the measurement of psychological distress. for example, the primary care psychiatric questionnaire was developed to measure non - psychotic features of distress in india. there are numerous other examples of screening instruments developed locally to meet the linguistic needs and capture the unique features of distress, as experienced by members of a given ethnic group [67, 75, 76 ]. the etic approach, on the other hand, seeks to identify features of distress that are culture - general [72, 77 ]. this approach assumes that the aetiology of distress is universal and emphasizes equivalence in the measurement of distress cross - culturally. such an approach is advanced by studies utilizing measures developed in the west, such as the bdi - ii, with other ethnic groups. at present, there is limited evidence to aid clinicians in making informed decisions about whether to employ an emic or etic approach to screen for distress in south asian patients. describe a study in which the screening accuracy of the amritsar depression inventory (adi), an instrument developed and validated in punjab in india, and the general health questionnaire (ghq-12) was compared against a clinical diagnostic interview for primary care attenders originating from punjab in india. the study found that for punjabis who had lived in the uk for over 30 years, the adi was no better than chance at detecting depression symptoms, although the scale functioned as well as the ghq-12 in english subjects. the ghq-12 was more accurate overall in the detection of depression symptoms in english and punjabi primary care attenders. more recently, stahl. suggested that western screening instruments such as the centre for epidemiological studies depression scale (ces - d) achieve sufficient sensitivity and specificity in identifying significant depressive symptoms in south asian patients with diabetes in singapore, although the results need to be interpreted with caution in light of the statistical power of the study. a review of depression screening instruments available in urdu, on the other hand, concluded that there is insufficient evidence to advance the use of western translated scales over measures developed in indigenous languages, primarily due to a lack of reporting on cross - cultural validity and criterion reliability. both emic (culture - specific) and etic (universal or culture - general) depression screening tools are currently employed across studies with both clinical and non - clinical groups of south asians. however, many of the scales are employed without adequate testing of the validity of the scales in the population of interest, and indeed bhui. suggest that expressions of distress may vary between sub - groups of a broad ethnic group, especially due to the process of acculturation, i.e. the process through which members of a minority group adopt the beliefs and behaviours of the majority. depression screening and diagnosis needs to be mindful of the complexities highlighted above both in the reliance on translation and interpretation, and the use of emic and etic screening instruments. for emic screening instruments, there needs to be careful consideration on how to assess the diagnostic accuracy of scales. the use of emic measures assumes that the experience of depression is culture - specific and so it may not, for example, be appropriate to compare such instruments with western diagnostic criteria, such as those of the dsm - iv, which assume that depression is a universal phenomenon, the subjective experience of which is culture - general. there are several reasons for the scarcity of research into the psychological well - being of south asian patients with esrd. first, there are often language barriers which make it difficult for clinicians and researchers alike to explore the concerns and symptoms of patients, and may indeed lead to misinterpretations of patient complaints [38, 39 ]. of course, one way to advance screening of depression symptoms would be to undertake the translation of validated instruments to meet the linguistic needs of the south asian community within the uk. propose that studies utilizing translation and interpretation are often expensive and time - consuming, making them less attractive for funding. where translation and interpretation is available, accurate exploration of experiences may be limited by several factors, including culture - specific idioms of distress. this may result in patients endorsing certain items less frequently because they can not relate to the language used, which is not the same as being symptom free. krause reported on a group of south asians in bedford, uk, originating from punjab in india and described the occurrence of the sinking heart was seen as a culture - bound syndrome that resulted from a combination of social, physical and emotional factors. consequently, bhui. suggest that translators and interpreters must be equally competent in both the source and second language and understand the semantic range of both languages, whilst being sensitive to variations in cultural understandings of distress. edwards further suggests that translation can be facilitated by the translator being a native speaker in the target language and fluent in the language of the text to be translated. there are also disparities in the quality of translation undertaken in studies where scales have been used across cultural and ethnic groups. translation should be an iterative process, involving both forward and back translation to ensure face and content validity. however, there are marked differences in the use of forward- or backward - only translation with mono- or bilingual tests of accuracy. poor translation methods are often accompanied by a lack of reporting on the validity of translations, with sensitivity and reliability analyses being undertaken without confidence in the conceptual equivalence of scales for use across cultures. this results in the limitations of measures being advanced without providing confidence in the validity of the translated scales. different constructions of psychological distress across cultures may well have clinical implications which undermine the precise assessment of conditions such as depression. conducting and evaluating the process of translation needs to be the core aspect of the research design and reporting, without which it will be difficult for professionals to select appropriate instruments to screen for distress in different patient groups. for a vast number of patients, translated scales, at least within their self - complete format, will not be suitable, and patients will require the use of interpreters in the completion of the scales. feehally, for example, states that 25% of south asians aged over 65 years living in leicester, uk, can not read or write in their native language or english. the use of interpreters to communicate with patients also requires a number of considerations. in a clinical setting, interpreters need to translate the patient 's narrative promptly, leaving little time for considering emotional components of language, attitudes and beliefs, which play a vital role in informing clinical interpretations and treatment of symptoms. furthermore, the presence of an interpreter may hinder the development of an empathic relationship between clinicians and patients, with the non - verbal aspects of communication often being lost when communicating through an interpreter. there may also be variations in how interpreters view their roles, with research suggesting that for some, the role is related solely to accurate communication of information, whilst others view cultural advocacy, sensitivity and social support as fundamental components and factors which influence the assessment of mood. it is also necessary to be aware of cultural tensions between patients and interpreters that influence willingness to disclose symptoms. so whilst translation and interpretation services are undoubtedly useful in clinical settings, research is still lacking in specifying the optimal conditions for ensuring that vital aspects of communication are not lost or misinterpreted through such modes of communication with patients. studies undertaking the task of translating screening instruments for use in the south asian esrd population need to pay due attention to the process of translation and on reporting key information that will allow professionals to make informed decisions in how best to assess the psychological requirements of patients. it is also highly plausible that there will be differences in the meaning attributed to symptoms of depression in cultures where there are no linguistic equivalents for the term. indeed, the way patients conceptualize their distress is predicative of not only symptom presentation, but also help seeking behaviour [49, 50 ]. whilst the beliefs of south asians within the uk may be influenced by the host society, culture - specific beliefs are also important in understanding physical and mental illnesses. several studies have found that although south asians may be aware of the so - called psychosocial features of depression, they do not favour a biological model of mental illness, which is the core of the dsm - iv and icd-10 criteria [51, 52, 53, 54, 55 ]. furthermore, south asians are more likely to see depression as the result of worry, whereas white euro - americans have been found to attribute depression to hopelessness and low mood. spirituality, karma and god 's will are often advanced to help explain medical and psychiatric illness [39, 53, 56, 57 ]. in a clinical study of canadian south asian punjabi - speaking women with breast cancer, gurm. found that patients predominantly made sense of illness in the context of spirituality. spirituality provided meaning to illness, often in light of cancer being seen as part of a person 's karma or punishment for sins. these findings have been replicated with other clinical groups including patients with coronary heart disease (chd). south asian patients with chd encompass biological causes in their explanations of chd, but spiritual factors also form a core part of illness attributions. more recently, a survey of south asians in the united states found that whilst 88% of respondents favoured the belief that mental illness is a medical problem, there was stigma attached to seeking professional help, with south asian patients preferring to turn to close family and friends for support. seeking help for psychiatric issues can be seen as a sign of weakness or as going against god 's will, and openly disclosing illness may have broader social consequences for the family. the meaning attributed to psychiatric symptoms thus varies across different cultural and ethnic groups, and many authors have expressed concern over the universal applicability of the western model of mental conditions [62, 63, 64 ]. in practice, this means that screening instruments must capture culture - specific idioms of distress, and clinicians need to be aware of barriers that inhibit patients from freely disclosing their symptoms. a further challenge for clinicians in identifying psychiatric comorbidities pertains to differences in symptom presentation. due to multiple cultural variants in the expression of distress, a topic that has attracted much attention across disciplines is the increased prevalence of somatic complaints amongst south asians, which have often been labeled idioms of emotional distress [39, 65, 66, 67, 68 ]. somatic complaints occur across all cultural groups, although there are marked differences in prevalence and features. kirmayer and young caution against the belief that excess somatization in non - western cultures represents an apparent primitiveness or inability to express psychological distress. psychological and somatic symptoms may be just as valid in the expression of distress, and the clinical significance of different symptoms remains unclear. for some cultural groups, expressing distress through physical complaints is likely to offer a socially acceptable route to disclosure. however, established scales such as the bdi - ii and the hospital anxiety and depression scale contain limited or no items related to the somatic features of psychological conditions. this helpfully prevents the risk of items being endorsed due to an underlying medical reason but perhaps makes the scales less relevant for other cultural groups where somatic and psychological complaints co - exist or where somatic complaints dominate and obscure psychological expressions of distress. indeed, beliappa proposes that in non - western cultures where the mind and body are not viewed as distinct entities or compartmentalized, the distinction between psychological and somatic complaints may be less meaningful. the accurate screening and diagnosis of depression must therefore take account of cultural variations in both the conceptualization and expression of distress. culture undoubtedly influences the expression of psychological distress, and health professionals are aware of the challenges in providing care for patients from diverse cultural and ethnic backgrounds. in light of the issues related to differing conceptualizations, symptom presentation, and the complexities involved in utilizing translation and interpretation, it may seem sensible to employ culture - specific measures of depression, developed within the indian subcontinent. such a stance is perhaps best understood by considering the distinction made in cross - cultural research between the emic and etic approaches. the emic approach focuses on culturally bound constructs and culture - specific measurement of a phenomenon. an emic measure would seek to capture the unique features of distress, as experienced by a particular ethnic group. for example, using this approach, researchers have identified culture - bound somatic complaints, which act as idioms of distress. krause identified the sinking heart in punjabis in bedford, uk, which most closely resembled the western conceptualization of stress. exploration of culture - bound syndromes has also led to the development of a number of indigenous instruments for the measurement of psychological distress. for example, the primary care psychiatric questionnaire was developed to measure non - psychotic features of distress in india. there are numerous other examples of screening instruments developed locally to meet the linguistic needs and capture the unique features of distress, as experienced by members of a given ethnic group [67, 75, 76 ]. the etic approach, on the other hand, seeks to identify features of distress that are culture - general [72, 77 ]. this approach assumes that the aetiology of distress is universal and emphasizes equivalence in the measurement of distress cross - culturally. such an approach is advanced by studies utilizing measures developed in the west, such as the bdi - ii, with other ethnic groups. at present, there is limited evidence to aid clinicians in making informed decisions about whether to employ an emic or etic approach to screen for distress in south asian patients. describe a study in which the screening accuracy of the amritsar depression inventory (adi), an instrument developed and validated in punjab in india, and the general health questionnaire (ghq-12) was compared against a clinical diagnostic interview for primary care attenders originating from punjab in india. the study found that for punjabis who had lived in the uk for over 30 years, the adi was no better than chance at detecting depression symptoms, although the scale functioned as well as the ghq-12 in english subjects. the ghq-12 was more accurate overall in the detection of depression symptoms in english and punjabi primary care attenders. more recently, stahl. suggested that western screening instruments such as the centre for epidemiological studies depression scale (ces - d) achieve sufficient sensitivity and specificity in identifying significant depressive symptoms in south asian patients with diabetes in singapore, although the results need to be interpreted with caution in light of the statistical power of the study. a review of depression screening instruments available in urdu, on the other hand, concluded that there is insufficient evidence to advance the use of western translated scales over measures developed in indigenous languages, primarily due to a lack of reporting on cross - cultural validity and criterion reliability. both emic (culture - specific) and etic (universal or culture - general) depression screening tools are currently employed across studies with both clinical and non - clinical groups of south asians. however, many of the scales are employed without adequate testing of the validity of the scales in the population of interest, and indeed bhui. suggest that expressions of distress may vary between sub - groups of a broad ethnic group, especially due to the process of acculturation, i.e. the process through which members of a minority group adopt the beliefs and behaviours of the majority. depression screening and diagnosis needs to be mindful of the complexities highlighted above both in the reliance on translation and interpretation, and the use of emic and etic screening instruments. for emic screening instruments, there needs to be careful consideration on how to assess the diagnostic accuracy of scales. the use of emic measures assumes that the experience of depression is culture - specific and so it may not, for example, be appropriate to compare such instruments with western diagnostic criteria, such as those of the dsm - iv, which assume that depression is a universal phenomenon, the subjective experience of which is culture - general. the consequences of the under - representation of south asian patients in research into the experience, measurement, diagnosis and treatment of depression in esrd are far - reaching, preventing benefits from being generalized across patient groups. such practice also undermines the agenda of the uk national health service to reduce inequalities in health care provision. depression screening and diagnostic schemes are limited by the assumption that depression, as defined by the western biopsychiatric model, is a universal phenomenon, the subjective experience and expression of which is common across different cultural and ethnic groups. renal health professionals need to be mindful of the issues outlined in this article when assessing a patient 's psychological well - being. information from interpreters should be used in conjunction with discussion with the patient 's family and assessment from bilingual mental health professionals. research into the thoughts and feelings of south asian patients with esrd, the evaluation of emic measures of psychological distress or the adaptation of etic scales is encouraged and should be based on sound evaluation of both the process of scale construction / translation and reporting on validity. | depression is a prevalent burden for patients with end - stage renal disease (esrd) and one that is under - recognized and consequently under - treated. although several studies have explored the association between depression symptoms, treatment adherence and outcomes in euro - american patient groups, quantitative and qualitative exploration of these issues in patients from different cultural and ethnic backgrounds has been lacking. this review discusses the methodological issues associated with measuring depression in patients of south asian origin who have a 3- to 5-fold greater risk of developing esrd. there is a need to advance research into the development of accurate screening practices for this patient group, with an emphasis on studies utilizing rigorous approaches to evaluating the use of both emic (culture - specific) and etic (universal or culture - general) screening instruments. |
bacteria were found in dentinal tubules of root canal dentine in histological sections of infected teeth and apical portion of root canal is an area of interest that may harbor a critical level of microorganisms, which is effective on apical periodontitis. although cleaning of recessed surfaces is based more on irrigation, mechanical debridement at all circumferences of the apical root canal region is an important goal for endodontic instrumentation. horizontal dimension of the preparation at its most apical extend is a critical parameter that the clinician must determine for preparation. in early literature ; according to recommendations of weine, enlargement of canals three sizes larger than the first file to bind was enough for apical preparation. the aim of this procedure was making up an apical stop to reduce the leakage and material extrusion. however, morphologic analyses have shown that apical foramen often does not have a round shape and to achieve a more accurate estimate of the apical diameter, removal of the interferences along the coronal and middle thirds of the root canal is necessary. coronal flaring may eliminate the coronal interferences of the narrow and irregular canals and provide a reliable apical adaptation to instruments. recently, rotary ni - ti instrumentation systems are popular for the preparation of root canals and most of these systems suggest coronal flaring before apical shaping with finisher instruments. apical adaptation of the first instrument can be a reference for determining the apical preparation size and it is important in terms of best possible debridement of the infected root canals. the aim of this study was to evaluate the adaptation of first hand files (k, h file) that bind at working lengths (wls) and first finisher rotary instruments (protaper, profile) that reach to wl after coronal flaring. a total of 40 freshly extracted single - rooted mandibular incisors were selected for the study. teeth, which have complicated anatomy, external resorption or canal curvature more than 10 were excluded. the crowns of all teeth were removed from cemento - enamel junction to get an easy access and flat reliable reference point for length measurements. pulp tissues were removed with barbed broaches and root canal of each tooth was explored with a size 8 k - file until the tip of the file was just visible at the apical foramen. protaper (dentsply maillefer, ballaigues, switzerland), profile (dentsply maillefer), k - file (mani, tokyo, japan) and hedstroem (mani) files were used to evaluate apical binding. 2 and 1 gates - glidden burs for hedstroem (h - file) and k - files. after irrigation of the canals with 5 ml naocl one investigator passively inserted increasing sizes of files started with size 10 until sense of binding. when binding was occurred only a bit short of wl one balanced force motion performed without apical pressure to reach to wl. protaper rotary instrumentation group : sx, s1 and s2 files were used to the wl respectively and f1 or f2 files were the first finisher files that reached the wl with a sense of apical resistance. apical stop preparation was checked by the sense of apical resistance with hand usage of the last file at wl to see apical binding of the last former instrument. for profile group 6% tapered no. 30 and 25 sequence was followed with a crown down manner according to manufacturers recommendations. apical stop preparation was checked with the hand usage of the last file and if there was no apical resistance sense aforementioned profile sequence was used backwards until sense of binding with hand usage. each canal was irrigated with 2 ml of 2.5% naocl after each instrument for the rotary instrumentations. the apical 1 mm of each root tip was ground on wet sandpaper in order to expose the canal and the instrument at the wl. apical debris was removed with an ultrasonic cleaner (e15h, elmasonic, elma hans schmidbauer co., singen germany) and the apical region of each tooth was examined under stereomicroscope (leica m60, leica microsystems gmbh, wetzlar, germany) at a 40 magnification [figure 1 ]. the pixel counts of the apical images were used for calculations on adobe photoshop image analyzing program (cs2 version 9.0 ; adobe systems, san jose, ca, usa). the differences between the area of root canals and file tips were described as gap areas and calculated with subtraction of the file area from root canal area. the discrepancy between mean gap areas were analyzed using one - way analysis of variance test (p = 0.05). samples from stereoscopic images, (a) k - file, (b) hedstroemem, (c) profile, (d) protaper apical areas of the first files to bind and surrounding gap areas are shown in table 1. there were big gap areas (78.23%) on apical image sections for total of the evaluated apical stereoscopic images. the mean gap areas and gap percentages for the instrument groups were as follows ; k - file : 9999, 4 3176, 537 (76.53%), h - file : 12260, 6 4795 (81.25%), profile : 10045, 5 4409, 256 (80.25%), protaper : 8883, 3 3215, 342 (74.91%). protaper showed the lowest mean gap area rate between evaluated instruments ; however, the differences were not statistically significant (p > 0.05). mandibular incisors have a high incidence of isthmuses and are narrow in the proximal direction. furthermore, apical root canals of mandibular incisors are oval and irregular shaped. this was the main reason that mandibular incisor teeth have been chosen in this study. the root canal curvature controls the direction of the file and avoids a sufficient preparation of the apical part of the canal. canal curvature beyond 10 is classified as moderate (10 - 20) or aggressive (20 - 75) according to schneider. preflaring of the coronal and middle - thirds of the root canal has been recommended prior to determining the initial file that binds. the dentine layer surrounding the apex and the root canal surfaces probably have been infected and must be instrumented after determination of the first binding file. however, the first file that binds at the root apex not properly reflects the diameter of the apical canal. in an experimental study weiger. some other experimental studies determined wl by subtracting 1 mm of the length of a small file whose tip was just visible at the apical foramen. the aim of canal preparation is to widen the apical canal enough for irrigation and obturation procedures. however, widening and shaping processes are crucial steps for endodontic treatments because excess instrumentation can easily weaken the root and increase the risk of fracture as well as insufficient instrumentation can cause reinfection. the first binding file generally adapted to one side of the apical root canal, therefore apical stop may be formed only at one side. this one sided shelf may prevent the first binding file from apical movement, but it is uncertain that it can reduce leakage and material extrusion. using this information, the decision should be made respecting shape and diameter of the apical foramen and root canal anatomy for a successful endodontic treatment. if the apical region is round, the first file that binds at the wl will most likely wear the entire canal perimeter with three more file diameters. consequently, the objective of removing the infected dentin layer and preparing a round regular shaped apical stop might not be accomplished. considering the fact that the first file to bind frequently bound at one side of canal wall, the apical stop may be created only on one side. however, the results of this study have shown that even the first file binds the apical foramen did not reflect the apical diameter and the size of the file was relatively smaller than the exact size of apical foramen. therefore, removing the infected dentine layer at the apical third of the root canal and preparing a round regular shaped apical stop might not be achieved without reshaping the apex. the similar and statistically insignificant results could be explained because of the non - circular and irregular shapes of the mandibular incisors root canals and the discrepancy between root canals of the mandibular incisors. | objective : the aim of this study was to evaluate the apical root canal adaptation performance of various root canal instruments.materials and methods : a total of 40 freshly extracted single - rooted mandibular incisors were used in this study. coroner parts of all teeth were removed from cemento - enamel junction and root canal of each tooth was explored with a size 8 k - file until the tip of the file was just visible at the apex. working lengths (wls) were determined as 1 mm short of these measurements. protaper, k - file, profile and hedstroem files were inserted into the root canals of 10 teeth to the wl following the flaring of the coronal and middle thirds. instruments were fixed in the root canals with acrylic resin. the apical 1 mm of each root tip was ground on wet sandpaper to expose the canal and the instrument at the wl and the apical region of each tooth was examined under stereomicroscope. the stereoscopic images of the teeth were digitized and analyzed with software in order to determine the differences between the areas of root canals and file tips. result data were analyzed using the one - way analysis of variance test (p = 0.05).results : there were no significant differences between apical file / root canal areas of the evaluated instruments (p > 0.05).conclusions : none of the evaluated instruments performed a perfect adaptation with the apical root canal surface at the wl in mandibular incisors. therefore, total removal of the debris from the apical canal surface may not be achieved when these filing instruments are used. |
the advent of a biological marker that reliably indicates the presence of alzheimer disease (ad) and distinguishes the latter from other dementing disorders would greatly assist the medical management of this common neurodegenerative condition. the successful integration of such a marker in routine clinical practice would confer the following benefits : (1) the accurate and expeditious diagnosis of sporadic ad, (2) curtailment of ancillary biochemical and imaging studies currently employed to exclude other causes of dementia, (3) the capacity to recognize ad in subjects with major affective disorders, clouded sensorium, depressed levels of consciousness, and other illnesses that often preclude assignment of a dementia diagnosis by conventional means, (4) possible surveillance of ad severity, progression, and impact of therapeutic interventions, (5) prognostication of conversion to incipient ad in individuals with mild cognitive impairment (mci), and (6) treatment arm assignment and stratification of volunteers enrolled in clinical trials. in this paper, we review criteria for ideal biomarkers of sporadic ad, chemical biomarkers currently in vogue, and a national perspective on the clinical use of ad biomarkers in canada based on the third canadian consensus conference on the diagnosis and treatment of dementia. a biological marker of disease may be defined as a measurable change in the physical composition of an organism that indicates the presence of the illness. biomarkers currently under investigation for the early diagnosis of ad include brain volume or activity measurements derived from neuroimaging techniques, such as positron emission tomography (pet) or magnetic resonance imaging (mri) and chemical indices detected in various body fluids. neuroimaging modalities are labor - intensive, expensive, and not universally available, prompting intense research efforts towards the development of effective chemical biomarkers and other practical neurodiagnostic tools. chemical markers of ad fall within three general categories : (i) genetic markers, (ii) genetic modifiers, and (iii) biological markers. mutant forms of amyloid precursor protein, presenilin-1, and presenilin-2 are proven genetic markers of ad. while useful for predicting disease in rare kindreds with familial ad (800 rigorously - ascertained subjects with normal cognition, mci, and ad. a first such report confirmed the stratification of cognitively normal, mci and ad subjects based on declines in csf a 142 levels (205.6 55.1, 162.8 56.0, and 143.0 40.8 moreover, baseline csf a 142 concentrations successfully predicted the deterioration of neuropsychological measures in the normal and mci cohorts (but not ad persons) over an ensuing 12-month period. plasma amyloid : augmented plasma -amyloid142 (a 142) concentrations have been reported in several kindreds with familial ad, but these families comprise a very small proportion of the entire ad population. measurements of csf or blood total a peptide, a 1 - 40 or soluble app/ concentrations have thus far not proven useful in the diagnosis of sporadic ad [20, 22, 3335 ] although identification of novel amyloid peptide fragments in ad biofluids using mass spectrometry techniques may still yield markers of diagnostic significance [19, 36 ]. (ii) csf total tau : csf total (t) tau reflects neurofibrillary tangle formation in the ad brain but is also a fairly nonspecific marker for neuronal destruction in a wide range of degenerative and nondegenerative cns disorders. elevated levels of total tau protein (t - tau) have been consistently encountered in ad csf. an effect size of 1.31 (95% ci : 1.231.39) for csf tau as an ad diagnostic was disclosed in a meta - analysis involving 35 studies. in 2003, a review of csf t - tau data from 41 studies (over 4000 ad and control subjects) that used either the innogenetics or athena elisa disclosed a sensitivity and specificity for the diagnosis of ad of 80% and 90%, respectively (akin to the meta - analysis of csf a 142). in the robust adni study, csf t - tau increased progressively from 69.7 30.4 to 101.4 62.2 to 119.1 59.6 pg / ml in normal, mci, and ad subjects, respectively (p <.001). as in the case of csf a 142, csf t - tau is less effective in discriminating ad from other dementias, with specificities of 57% for suspected non - ad dementias and 69% for autopsy - confirmed cases. elevated concentrations of csf t - tau may also predict progression of cognitive deterioration in mci, especially in patients without extensive periventricular white matter lesions. high levels of csf t - tau may also arise in fronto - temporal dementia (ftd), vascular dementia, cjd, and (transiently) in acute ischemic stroke. csf t - tau values in lbd and vascular dementia may be intermediate between those of the cognitively - normal elderly and subjects with ad. interestingly, 34% of individuals with ftd in one study exhibited significantly suppressed levels of csf tau, a finding not seen in the ad cohort. (iii) csf phospho - tau : phospho - tau isoforms are tenable ad biomarkers because they reflect a known pathophysiological process in ad brain (neurofibrillary tangle formation). a number of laboratories have documented significant increases in levels of hyperphosphorylated tau in ad csf relative to cognitively - intact controls using antibodies against various phosphorylated epitopes of tau (p - tau). csf p - tau is elevated in incipient ad and mci [44, 45 ] and is therefore a relatively early biomarker of the disease. in the aforecited adni report, levels of threonine 181 p - tau in the csf of persons with normal cognition, mci, and ad were, respectively, 24.9 14.6, 35.5 18.0, and 41.6 19.8 pg / ml (p <.001). use of csf p - tau to monitor disease progression may be limited by dilutional factors unless combined with mri measurements of hippocampal atrophy. of note, p - tau levels in ad csf are reportedly elevated relative to other dementing and nondementing neurological disorders [22, 47, 48 ]. as such, and in contradistinction to t - tau, enhanced csf p - tau levels may differentiate ad from ftd [49, 50 ], lewy body dementia, vascular dementia, pd, als, acute stroke, schizophrenia, and major depression. despite a previous report to the contrary, csf concentrations of threonine 181 p - tau (iv) csf a 142 and p - tau combined : csf a 142 and p - tau, when measured together, exhibit sensitivities and specificities (versus other dementing disorders) in the range of 80%90%. the positive and negative predictive values of the combined test are 90% and 95%, respectively, assuming a prevalence rate of 45%. this biomarker combination reflects disease pathophysiology (vide supra), identifies ad in early stages (e.g., mci), and is relatively inexpensive. some posit that csf a 142 represents the stage of ad (with concentrations diminishing progressively as a function of disease duration), while t - tau and p - tau are indicators of disease intensity (with higher csf levels connoting more rapid progression). it has been suggested that the extent of csf tau elevation and a 142 suppression may correlate with the apoe 4 allele burden although the extent to which genetic factors impact csf biomarker levels remains uncertain. in patients with mci, the biomarker combination may prognosticate for imminent conversion to ad with sensitivities / specificities in the range of 83%90% [61, 62 ]. amnestic and nonamnestic) mci over a 3-year median follow - up period and may assist in distinguishing mci from anxiety and depression. a large european - american multi - institutional trial employed a cutoff csf a 142/p - tau ratio predetermined from an established ad cohort (at 85% sensitivity) to detect ad in 750 mci individuals followed longitudinally for at least two years or until dementia intervened. the investigators identified incipient ad in the mci subjects with 83% sensitivity, 72% specificity, 62% positive predictive value, and 88% negative predictive value. the authors concluded that although the test was accurate in identifying incipient ad, intersite assay variability limited its performance relative to previous results from single - centre studies, underscoring the need for standardization of clinical procedures and analytical techniques. in another recent multicentre study, ad - like csf biomarker ratios were noted to be more frequent among individuals with subjective (but no objective) cognitive impairment (sci ; 52%) than in healthy controls (31% ; p <.01), suggesting that ad may be the cause of sci (and not only mci) in a significant proportion of elderly subjects. to our knowledge, csf a 142 and tau determinations have not yet proven helpful as indices of therapeutic efficacy in ad. (v) csf biomarkers : further considerations : (a) in the majority of ad biomarker studies, the validity of the data were limited because receiver operating characteristic curves (plotting the relationship between sensitivities and specificities) were generated on the basis of clinical diagnoses without autopsy corroboration. while prospective ad biomarker studies are in principle more valuable than retrospective analyses, the former are less likely to include neuropathological diagnoses. (b) the immunoassay procedures invoked to measure csf a 142 and tau are not trivial, and interlaboratory variability is commonplace. (c) athena neurosciences charges us$905 to mds and $ 1,335 to insurance companies for the combined tau and csf a 142 assays per sample. it was announced this year that the cost of ad biomarkers would be defrayed by the canadian government pending documentation of need. regardless, the cost may not be prohibitive if it obviates the need for additional testing (e.g., neuroimaging). (d) in a study of 342 ad, mci, and cognitively normal individuals subjected to 428 research lumbar punctures, the adverse effect rate was low (e.g., post - lp headaches in 0.93%), and the procedure was generally well tolerated (low pain and anxiety scores in visual analog scales). yet, csf examination by lumbar puncture is more invasive than venipuncture or urine analysis and currently not suitable for mass screening of elderly persons with ad risk factors or mild memory impairment. the latter could warrant revisiting in the event that effective measures to prevent ad were to become available. canadian consensus conferences on the diagnosis and treatment of dementia were held in 1989, 1998 and, most recently, in march 2006 (montreal) in attempt to standardize the diagnostic and therapeutic management of ad and related dementias in our country. the project was funded by major government health institutes, geriatric and alzheimer societies, and unrestricted grants from the pharmaceutical industry. acknowledged leaders representing the disciplines of neurology, geriatric medicine, geriatric psychiatry, and neuropsychology, with liaisons from family practice, participated in the 3rd cccdtd. pubmed and embase electronic databases (supplemented by individual investigator files) spanning from january 1996 to december 2005 were surveyed for pertinent literature on nine designated topics. the strength of evidence was graded according to the canadian task force on preventive health care : (i) evidence obtained from at least one properly randomized controlled trial. (ii-1) evidence obtained from well - designed controlled trials without randomization, (ii-2) evidence obtained from well - designed cohort or case - control analytic studies preferably from more than one centre or research group, or (ii-3) evidence obtained from comparisons between times or places with or without the intervention. (iii) opinions of respected authorities based on clinical experience, descriptive studies, or reports of expert committees. the valence and strength of recommendations were assigned using the following grading system [73, 74 ]. (c) there is insufficient evidence to recommend for or against this maneuver, but recommendations might be made on other grounds. background papers and sets of recommendations for each topic were posted online and voted upon by all conferees. the full list of approved recommendations is available on the websites of the 3rd cccdtd (http://www.cccdtd.ca/) and the alzheimer society of canada (http://www.alzheimer.ca/). eighteen background articles accruing from this exercise were published in the october 2007 issue of alzheimer 's & dementia. to ascertain the role of biomarkers in ad for the 3rd cccdtd, the author reviewed a total of 186 papers : 137 generated from surveillance of the electronic literature (see section 5) using the search terms alzheimer disease and (biological marker or biomarker), and an additional 49 articles from the author 's files. the analysis led to the following conclusions : (i) ad is a public health concern of epidemic proportions for which current diagnostic (and therapeutic) (ii) the advent of a biological marker that differentiates early, sporadic ad from normal aging and other dementing disorders would represent a significant advance in the evaluation and management of this neurodegenerative disorder. an accurate, minimally invasive biological marker of early sporadic ad would serve the public interest by facilitating patient and family counselling, enabling stratification of subgroups for enrolment in clinical drug trials, and improving the interpretation of treatment outcomes. the introduction of a chemical marker that differentiates malignant mci cases at high risk for deterioration to ad from neuropsychologically similar cases destined to manifest biomarkers may also prove helpful in situations where concomitant medical or psychiatric conditions confound or preclude neuropsychological testing, for example, major depression, delirium, suppressed consciousness, or individuals who are otherwise uncooperative for detailed cognitive testing. (although conjectural and not listed among the published conclusions of the 3rd cccdtd, it should prove interesting to determine whether measurement of ad biomarkers in patients with normal pressure hydrocephalus assists in the selection of appropriate candidates for (and improves the success rate of) surgical shunting.) (iii) although several candidate biomarkers of sporadic ad have been identified and commercialized, none currently fulfills criteria for an ideal test (see section 3). (iv) decreased a 142 and increased phospho - tau protein concentrations in the csf are currently the most accurate and reproducible chemical neurodiagnostics of sporadic ad. however, csf evaluation by spinal tap remains impractical for mass screening of elderly individuals with symptoms of memory impairment or ad risk factors. (v) platelet app isoform ratios, plasma or urinary f2-isoprostane levels, blood biospectroscopy, and other modalities under investigation may fulfil several criteria for an ideal biological marker of early sporadic ad (section 3). however, further experimentation and validation will be needed before these candidate biomarkers can be considered for clinical use. similarly, all ad biomarker candidates arising from mass spectrometry and other proteomic applications [19, 75, 76 ] will require stringent clinical evaluation for their suitability as bonafide diagnostic tools. (vi) given the complexity of ad pathology, it is likely that combinations of individual biomarkers will provide more accurate diagnostic and prognostic data that any single marker assayed in isolation (akin to use of multiple biochemical indices to characterize liver failure, cardiac ischemia, or connective tissue disease). on the basis of the literature analysis and aforementioned conclusions, the following recommendations reached consensus (see section 5) and were published by the 3rd cccdtd. (i) biological markers for the diagnosis of ad should not, at this juncture, be included in the battery of tests routinely used by primary care physicians to evaluate subjects with memory loss (grade c, level 3). consideration for such specialized testing in an individual case should prompt referral of the patient to a specialist engaged in dementia evaluations or a memory clinic. (i) although highly desirable, there currently exist no blood- or urine - based ad diagnostics that can be unequivocally endorsed for the routine evaluation of memory loss in the elderly (grade c, level 3). the non - invasiveness of such tests, if and when they become available, would be suitable for mass screening of subjects with memory loss presenting to specialists in their offices and memory clinics. (ii) due to their relative invasiveness and availability of other fairly accurate diagnostic modalities (clinical, neuropsychological and neuroimaging), csf biomarkers should not be routinely performed in all subjects undergoing evaluation for memory loss (grade d, level 2). (iii) csf biomarkers may be considered in cases where there are atypical features and diagnostic confusion. csf biomarkers may be useful in differentiating frontal variants of ad from ftd (grade b, level 2). (iv) when a decision to obtain csf biomarkers is made, combined a 142 and p - tau concentrations should be measured by validated elisa (grade a, level 1). it may be best to convey the csf samples to a centralized facility (commercial or academic) with a track record in generating high - quality, reproducible data. (v) csf biomarker data in isolation are insufficient to diagnose or exclude ad (grade c, level 3). they should be interpreted in light of clinical, neuropsychological, other laboratory and neuroimaging data available for the individual under investigation. howard chertkow (chair, 3rd cccdtd, personal communication) that developments reported in the field of ad biomarker discovery since publication of the 3rd cccdtd consensus data do not warrant revisal of the 2007 recommendations. however, this remains an area of intensive research worldwide and further insights from large - scale initiatives such as adni, or validation of blood- or urine - based markers of the disease, may prompt a sea - change in the way ad biomarkers are exploited in canadian clinics. hyman m. schipper has served as consultant to osta biotechnologies, molecular biometrics inc., | decreased -amyloid1 - 42 and increased phospho - tau protein levels in the cerebrospinal fluid (csf) are currently the most accurate chemical neurodiagnostics of sporadic alzheimer disease (ad). a report (2007) of the third canadian consensus conference on the diagnosis and treatment of dementia (2006) recommended that biological markers should not be currently requisitioned by primary care physicians in the routine investigation of subjects with memory complaints. consideration for such testing should prompt patient referral to a specialist engaged in dementia evaluations or a memory clinic. the specialist should consider having csf biomarkers (-amyloid1 - 42 and phospho - tau) measured at a reputable facility in restricted cases presenting with atypical features and diagnostic confusion, but not as a routine procedure in all individuals with typical sporadic ad phenotypes. we submit that developments in the field of ad biomarker discovery since publication of the 3rd cccdtd consensus data do not warrant revision of the 2007 recommendations. |
a 22 weeks pregnant woman came to us for advice regarding the chance of offspring getting retinoblastoma as her first child had bilateral retinoblastoma. the other offspring was 1 year and 9 months old at the time of presentation with a history of leukocoria in the left eye. she was diagnosed to have bilateral retinoblastoma ; group b in the right eye and group d in the left eye (international classification of retinoblastoma classification). systemic chemotherapy (four cycles) and external - beam radiation therapy failed to control the tumor in the left eye and hence the left eye underwent enucleation with ball implant, 8 months after presentation. the right eye was salvaged with good tumor control and the preservation of vision [fig. 1 ]. clinical findings in the sibling showing bilateral retinoblastoma (a) ultrasound b scan of the left eye showing large tumor in visit 1 (b) fundus drawing of the left eye showing tumor coded by yellow color (c) ultrasound b scan of the right eye showing tumor. (d) post treatment regressed tumor in the right eye at last follow up (7 years follow - up) a cytogenetic analysis done at that time revealed male karyotype with 13q14 deletion in the father, and the mother was normal. while the mother was found to be normal, the father revealed a retinoma in his right eye. as direct screening by mutational analysis is time - consuming and needs more sample, prenatal cord blood was taken for molecular linkage analysis for retinoblastoma. the fetus was found to have the defective rb1 allele inherited from the father [fig. 2 ] and gene tracking (predictive testing) in the case of familial retinoblastoma the child was born at 34 weeks and the first ophthalmic evaluation done on the 2 day of life was normal. the child underwent periodic monthly examination under anesthesia until 2 years of age. at 28 months of age, she developed a tumor (group a) in the inferonasal retinal periphery of the right eye that was treated with cryotherapy [fig. the child continued to be under bi - monthly clinical follow - up. visual assessment with lea symbol charts showed the visual acuity of 20/20 in both eyes. at a recent follow - up at 7 years of age, the fundus was stable, and visual acuity maintained in both the eyes. fundus photographs (retcam) of the child with defective allele detected on prenatal diagnosis (a) fundus photograph of the right eye at 2 days of birth. (c) fundus photograph of the right eye at 28 months showing tumor at inferonasal periphery (d) post treatment cryo, regressed tumor at 3 months follow - up prenatal diagnosis of retinoblastoma with clinical follow - up has been reported earlier, however, to the best of our knowledge, this is the first report from india to show the clinical correlate of genetic findings on a prenatal diagnosis. it is important for an ophthalmologist to determine the etiology of an unilateral case (whether it is hereditary or not) as the management of the patient (examination of fellow eye, frequency of follow - up and sometimes treatment which should be provided along with genetic counseling) may be different when compared to a bilateral case. in this case, already having a child with retinoblastoma (with one eye enucleated) prompted the mother to undergo a prenatal screening for the next offspring. even though primary prevention was not possible in this situation, prenatal diagnosis with serial ultrasound scans of the fetus could help look for a tumor in the fetal eye at an early stage. if detected in utero, a fetus with retinoblastoma can be delivered early to initiate early treatment and possibly reduce the morbidity and preserve the vision. though the child was identified to have the inherited paternal risk allele hence, it is likely that these children may develop tumor at a later stage of life alarming for careful and regular long - term surveillance. thus, prenatal diagnosis offers early detection of the tumors in the course of the disease and periodic examinations aid in eye salvage. | retinoblastoma is the most common malignant intraocular tumor in pediatric age group if undetected leads to ocular mortality. prenatal diagnosis is an emerging technology to detect fatal diseases in utero such that subsequent management is planned to reduce the ocular morbidity. we describe a case demonstrating the importance of prenatal diagnosis in a child with a strong family history of retinoblastoma and importance of a long - term clinical follow - up in these cases. |
strabismus is a very common eye disease characterized by abnormal eye movements. according to fu,1 the prevalence of strabismus was 108 out of 2,260 (5.0%) eligible students in the central china. strabismus is not only a cosmetic disease but also causes severe damages to visual acuity (va), binocular vision, and stereopsis.2 surgery is currently the main treatment for strabismus.3 strabismus demonstrates abnormal eye movements, which is accompanied by dysfunction of the cerebral cortex. a previous study showed that eye monosynaptic interhemisphere connections existed in strabismus cats.4 other studies reported the abnormalities of visual cortex structure in infantile esotropic macaque monkeys.5,6 another study demonstrated visual cortex suppression in patients with strabismus.7 diffusion tensor imaging (dti) is a widely used magnetic resonance imaging (mri) modality that depicts water diffusion directionality as mean diffusivity (md) and fractional anisotropy (fa).8 the md value measures the total amount of diffusion within a voxel and provides the overall magnitude of water diffusion, while the fa value is a scalar value between 0 and 1 calculated from the eigenvalues (1, 2, and 3) of the diffusion tensor. it measures the overall directionality of water diffusion and reflects the complexity of cytoskeleton architecture, which restricts the intra- and extracellular water movement.9 the direction of water diffusion can indicate myelin sheath damage and tissue changes. consequently, dti has been applied to study various diseases, such as schizophrenia10 and stroke.11 dti has also been used to evaluate brain microstructural changes of patients with strabismus amblyopia. duan found that md values were increased not only in optic radiation but also in certain brain regions of strabismus amblyopia patients with the dti method. however, very few studies used the dti strategy to investigate the microstructural changes in comitant strabismus. here, to our knowledge, our study is the first to explore whole - brain microstructural changes in patients with comitant strabismus. a total of 19 patients with comitant strabismus (nine males and ten females ; four esotropia ; and 15 exotropia) were recruited from the first affiliated hospital of university of south china and the department of ophthalmology, the first affiliated hospital of nanchang university. the diagnostic criteria for comitant strabismus were as follows : 1) strabismus starting from birth ; 2) stereovision defects (no visual fusion) ; 3) equal binocular corrected va ; and 4) with alternated cover, the experimental and strabismus angle were equal. patients were excluded if they met any one of the following conditions : 1) acquired strabismus, incomitant strabismus, and concealed oblique ; 2) eye diseases (infection, inflammation, and ischemic diseases) ; 3) history of eye surgeries (extraocular or intraocular surgeries) ; 4) psychiatric disorders (obsessive compulsive disorder, anxiety disorder, schizophrenia, depression, etc), diabetes, cardiovascular diseases, and cerebral infarction diseases ; and 5) addictions (eg, drugs and alcohol). nineteen healthy controls (hcs ; nine males and ten females) with similar age, sex, and education status were also recruited from healthy volunteers from citizens of nanchang, jiangxi, people s republic of china. all hcs met the following requirements : 1) no abnormalities in the brain parenchyma on cranial mri ; 2) no ocular diseases with uncorrected or corrected va > 1.0 ; 3) no psychiatric diseases (obsessive compulsive disorder, anxiety disorder, schizophrenia, depression, etc) ; and 4) able to undergo mri (eg, no cardiac pacemaker or implanted metal devices). all research methods followed the declaration of helsinki and were approved by the first affiliated hospital of nanchang university ethics committee. all subjects participated voluntarily and were informed of the purposes, methods, and potential risks before signing an informed consent form. mri scanning was performed using a 3 t mr scanner (trio, siemens, munich, germany). each subject underwent spin echo single - shot echo planar imaging with the following parameters : repetition time / echo time = 7,200/104 ms, number of excitations = 2, matrix = 128128, field of view = 230 230 mm, slice number = 49, slice thickness = 2.5 mm, axial orientation, 64 nonlinear diffusion - weighting gradient directions with b = 1,000 s / mm, and additional image without diffusion weighting (b = 0 s / mm). diffuse tensor images were analyzed with voxel - based analysis of dti13 and processed with statistic parametric mapping 2 (spm2 ; wellcome department of cognitive neurology, london, uk) and fmrib software library (fsl) (version 3.3 ; www.fmrib.ox.ac.uk/fsl) software. the analysis was performed according to a previous study.14 analyses were performed using the spss 13.0 statistical software (spss inc., two - sample t - tests were used to compare differences of the fa and md values between strabismus and hc groups in a voxel - based manner using the analysis of covariance, with age and sex as covariates to control the effect of age and sex. the cumulative clinical measurements including the duration of the onset of disease and best - corrected va were recorded. a total of 19 patients with comitant strabismus (nine males and ten females ; four esotropia ; and 15 exotropia) were recruited from the first affiliated hospital of university of south china and the department of ophthalmology, the first affiliated hospital of nanchang university. the diagnostic criteria for comitant strabismus were as follows : 1) strabismus starting from birth ; 2) stereovision defects (no visual fusion) ; 3) equal binocular corrected va ; and 4) with alternated cover, the experimental and strabismus angle were equal. patients were excluded if they met any one of the following conditions : 1) acquired strabismus, incomitant strabismus, and concealed oblique ; 2) eye diseases (infection, inflammation, and ischemic diseases) ; 3) history of eye surgeries (extraocular or intraocular surgeries) ; 4) psychiatric disorders (obsessive compulsive disorder, anxiety disorder, schizophrenia, depression, etc), diabetes, cardiovascular diseases, and cerebral infarction diseases ; and 5) addictions (eg, drugs and alcohol). nineteen healthy controls (hcs ; nine males and ten females) with similar age, sex, and education status were also recruited from healthy volunteers from citizens of nanchang, jiangxi, people s republic of china. all hcs met the following requirements : 1) no abnormalities in the brain parenchyma on cranial mri ; 2) no ocular diseases with uncorrected or corrected va > 1.0 ; 3) no psychiatric diseases (obsessive compulsive disorder, anxiety disorder, schizophrenia, depression, etc) ; and 4) able to undergo mri (eg, no cardiac pacemaker or implanted metal devices). all research methods followed the declaration of helsinki and were approved by the first affiliated hospital of nanchang university ethics committee. all subjects participated voluntarily and were informed of the purposes, methods, and potential risks before signing an informed consent form. mri scanning was performed using a 3 t mr scanner (trio, siemens, munich, germany). each subject underwent spin echo single - shot echo planar imaging with the following parameters : repetition time / echo time = 7,200/104 ms, number of excitations = 2, matrix = 128128, field of view = 230 230 mm, slice number = 49, slice thickness = 2.5 mm, axial orientation, 64 nonlinear diffusion - weighting gradient directions with b = 1,000 s / mm, and additional image without diffusion weighting (b = 0 s / mm). diffuse tensor images were analyzed with voxel - based analysis of dti13 and processed with statistic parametric mapping 2 (spm2 ; wellcome department of cognitive neurology, london, uk) and fmrib software library (fsl) (version 3.3 ; www.fmrib.ox.ac.uk/fsl) software. two - sample t - tests were used to compare differences of the fa and md values between strabismus and hc groups in a voxel - based manner using the analysis of covariance, with age and sex as covariates to control the effect of age and sex. the cumulative clinical measurements including the duration of the onset of disease and best - corrected va were recorded. there were no obvious differences in weight (p=0.958) and age (p=0.986) between the patients with comitant strabismus and the hcs. no significant differences were found in the best - corrected va - right (p=0.161) and the best - corrected va - left (p=0.750) (clinical data are shown in table 1). compared with the hc group, the fa values were significantly decreased in the brain regions of the left superior temporal gyrus (p<0.001) but increased in the areas of the bilateral medial frontal gyrus, right globus pallidus / brainstem, and bilateral precuneus in the comitant strabismus group (p<0.001 ; figure 1 and table 2). the mean values of altered fa values between the comitant strabismus and hc group are shown in figure 3a and table 3. compared to the hc group, the md values were significantly decreased in the brain regions of the bilateral cerebellum posterior lobe and left middle frontal gyrus (p<0.01) and increased in the brain regions of the right middle frontal gyrus and left anterior cingulate in the comitant strabismus group (p<0.01 ; figure 2 and table 4). the mean values of altered md values between the comitant strabismus and hc groups are shown in figure 3b and table 5. we proposed that the differences of the fa and md values between the strabismus and hc groups might be useful diagnostic markers. to test this possibility, mean values of the fa and md of different brain regions were extracted and used to analyze receiver operating characteristic (roc) curves. the areas under the roc curve for fa values were as follows : bilateral medial frontal gyrus (0.964), right globus pallidus / brainstem (0.939), and bilateral precuneus (0.958) (figure 4a). the areas under the roc curve for md values were as follows : right middle frontal gyrus (0.931) and left anterior cingulate (0.978) (figure 4b). there were no obvious differences in weight (p=0.958) and age (p=0.986) between the patients with comitant strabismus and the hcs. no significant differences were found in the best - corrected va - right (p=0.161) and the best - corrected va - left (p=0.750) (clinical data are shown in table 1). compared with the hc group, the fa values were significantly decreased in the brain regions of the left superior temporal gyrus (p<0.001) but increased in the areas of the bilateral medial frontal gyrus, right globus pallidus / brainstem, and bilateral precuneus in the comitant strabismus group (p<0.001 ; figure 1 and table 2). the mean values of altered fa values between the comitant strabismus and hc group are shown in figure 3a and table 3. compared to the hc group, the md values were significantly decreased in the brain regions of the bilateral cerebellum posterior lobe and left middle frontal gyrus (p<0.01) and increased in the brain regions of the right middle frontal gyrus and left anterior cingulate in the comitant strabismus group (p<0.01 ; figure 2 and table 4). the mean values of altered md values between the comitant strabismus and hc groups are shown in figure 3b and table 5. we proposed that the differences of the fa and md values between the strabismus and hc groups might be useful diagnostic markers. to test this possibility, mean values of the fa and md of different brain regions were extracted and used to analyze receiver operating characteristic (roc) curves. the areas under the roc curve for fa values were as follows : bilateral medial frontal gyrus (0.964), right globus pallidus / brainstem (0.939), and bilateral precuneus (0.958) (figure 4a). the areas under the roc curve for md values were as follows : right middle frontal gyrus (0.931) and left anterior cingulate (0.978) (figure 4b). our study is the first to evaluate whole - brain microstructural changes of fa and md values in patients with comitant strabismus using a dti approach. the fa is markedly sensitive to microstructural changes of white matter (wm), while the md may help to better understand how the diffusion tensor is changing. the reduction of the fa values indicates wm neuropathology. increased tissue water will lead to an increase in the md values, and the decreased md value may indicate cell proliferation.15 we found fa values remarkably decreased in the brain regions of the left superior temporal gyrus but increased in the areas of the bilateral medial frontal gyrus, right globus pallidus / brainstem, and bilateral precuneus. meanwhile, the md values were significantly decreased in the brain regions of the bilateral cerebellum posterior lobe and left middle frontal gyrus and increased in the brain regions of the right middle frontal gyrus and left anterior cingulate. the superior temporal gyrus located in the temporal lobe of the human brain is involved in the processing of language.16 a previous study has shown that the superior temporal area controls the representation of three - dimensional structures and shapes.17 it has been well known that patients with strabismus often manifest dysfunction of fusion and stereopsis.18 yan found that patients with comitant exotropia had smaller wm volumes in the right inferior temporal gyrus. in agreement with these findings, we found that the fa value was decreased in left superior temporal gyrus in comitant strabismus, which reflected abnormalities of wm fibers in these areas. these results suggest that comitant strabismus may cause dysfunction of the left superior temporal gyrus. the medial frontal cortex is involved in the control, monitor, and selection of behaviors. the supplementary eye field located in the medial frontal cortex is involved in the execution of ocular movements.19 a previous study demonstrated that the frontal eye field (fef) played an important role in controlling eye movements of monkeys.20 another research reported that the fef was responsible for rapid or saccadic ocular movements.21 moreover, the fef was shown to be in charge of sustained attention.22 yan found that patients with comitant exotropia had smaller wm volumes in right frontal lobe / sub - gyral. additionally, chan observed increased gray matter volume in the fef of adults strabismus. consistent with these findings, we found that the md values were significantly increased in the brain regions of the right middle frontal gyrus in patients with comitant strabismus, suggesting the dysfunction of wm fibers in these areas. furthermore, we found that the mean area of the md values of the right middle frontal gyrus was 0.931 in the roc curve. therefore, we speculated that comitant strabismus possibly caused abnormalities of wm fibers in right middle frontal gyrus, which may explain the impairment of regular eye movements in the patients with comitant strabismus. interestingly, we found that the fa values were markedly increased in the area of the bilateral medial frontal gyrus, and the md values were decreased in the left middle frontal gyrus in patients with comitant strabismus. an increase in the fa values in the bilateral medial frontal gyrus may reflect the wm alterations in these areas. the decreased md values in the left middle frontal gyrus may indicate cell proliferation defects in these areas. moreover, the mean area of the fa of the bilateral medial frontal gyrus was 0.964. these changes may suggest a functional reorganization in the fef in patients with comitant strabismus. the cerebellum is involved in the control of movements24 and the execution of cognition25 and language.26 moreover, a previous study demonstrated that the cerebellum was involved in the execution of eye and hand movements.27 another study reported that activation of cerebellar vermis was related to visually guided saccades.28 joshi and das29 found that the posterior interposed nucleus in the cerebellum participated in conjugating eye movements in strabismic monkeys. in our study, we observed that the md values were significantly decreased in the brain regions of the bilateral cerebellum posterior lobe in patients with comitant strabismus, which may reflect abnormalities of microstructural changes in these areas. we speculated that comitant strabismus possibly lead to pathological microstructural changes in the bilateral cerebellum posterior lobe, which manifested in the impairment of regular eye movements in the patients with comitant strabismus. the cingulate cortex, as a part of the limbic cortex, has many functions, such as pain,30 depression,31 and anxiety disorder.32 yan found that wm volumes were decreased in the right cingulate gyrus in patients with adult strabismus. in our study, we observed that the md values were significantly increased in the brain regions of the left anterior cingulate in patients with comitant strabismus, which suggested abnormal microstructural changes in the left anterior cingulate. furthermore, the mean area of the md values of the left anterior cingulate was 0.978 in the roc curve. therefore, we surmised that the comitant strabismus might lead to the dysfunction of the left anterior cingulate. our study showed that patients with comitant strabismus had microstructural changes of wm in many brain regions and provided important information to understand the underlying neural mechanisms of the fusion defects and ocular motility disorders in patients with comitant strabismus. first of all, the sample size is small, and we did not consider different clinical outcomes of the strabismus, such as exotropia and esotropia. future research should distinguish between different types of strabismus to more accurately assess brain activities and functional changes. | objectivethe aim of this study was to investigate the fractional anisotropy (fa) and mean diffusivity (md) using a diffusion tensor imaging technique and whole - brain voxel - based analysis in patients with comitant strabismus.patients and methodsa total of 19 (nine males and ten females) patients with comitant strabismus and 19 age-, sex-, and education - matched healthy controls (hcs) underwent magnetic resonance imaging examination. imaging data were analyzed using two - sample t - tests to identify group differences in fa and md values. patients with comitant strabismus were distinguishable from hcs by receiver operating characteristic curves.resultscompared with hcs, patients with comitant strabismus exhibited significantly decreased fa values in the brain regions of the left superior temporal gyrus and increased values in the bilateral medial frontal gyrus, right globus pallidus / brainstem, and bilateral precuneus. meanwhile, md value was significantly reduced in the brain regions of the bilateral cerebellum posterior lobe and left middle frontal gyrus but increased in the brain regions of the right middle frontal gyrus and left anterior cingulate.conclusionthese results suggest significant brain abnormalities in comitant strabismus, which may underlie the pathologic mechanisms of fusion defects and ocular motility disorders in patients with comitant strabismus. |
with recent trends and technology advancement in the development of converged broadband next generation networks (ngns) and advanced multimedia services, the potential has increased for delivering various e - health services to end users anywhere, anytime. the term e - health has been used to refer to the use of information and communication technology (ict) in delivering healthcare services. a wide variety of e - health services exist, including health information networks, electronic health record (ehr), telemedicine services, wearable and portable systems which communicate, health portals, and many other ict - based tools assisting disease prevention, diagnosis, treatment, health monitoring, and lifestyle management. a related term is m - health, referring to mobile computing, medical sensor, and communications technologies for health care. m - health services refer to e - health services in mobile environments, characterized by limited resource availability and changing network conditions. in general, a wide variety of services may be built on top of tools and applications that provide the necessary communications and computer - aided support (e.g., multimedia conferencing / streaming enablers, image analysis and visualization tools, immersive and collaborative virtual environments, etc.), as shown in figure 1. converged ngns are being designed to deliver different types of traffic across heterogeneous end - user environments. in order to meet the requirements of e - health service traffic delivered over networks in conjunction with other commercial traffic (e.g., voice calls, streaming multimedia, and internet traffic), qos mechanisms such as class - based traffic prioritization are necessary. the wide variety of e - health services impose different quality of service (qos) requirements on underlying networks. one aspect is delay tolerance, with service requirements ranging from strict real - time and delay - intolerant data transmission (e.g., tele - consultation services involving transmission of patient physiological parameters in emergency situations) to delay - tolerant services (e.g., access to a patient 's ehr ; home tele - monitoring). another aspect is application data sensitivity to loss, with conversational voice - based applications often tolerating a certain packet loss, while data transmission (e.g., transfer of medical images) being highly loss intolerant. a significant amount of related work deals with performance requirements of e - health services and evaluated network capabilities in meeting those requirements. in, the authors categorize the importance of various qos parameters for different fields of e - health. prioritization and resource allocation schemes for various types of telemedicine traffic delivered over wireless networks has been addressed in [5, 6 ]. further studies have more specifically focused on evaluating support for the delivery of emergency telemedicine services over high speed 3 g networks [3, 710 ] and other wireless networks [11, 12 ], with evaluation results showing generally reliable performance. apart from emergency scenarios, 3 g networks have been evaluated in the support of various tele - consultation services involving the delivery of high - definition images, such as the delivery of ultrasound still and streaming images in robotic tele - ultrasonography systems. projects such as mobihealth, healthservice24, and myheart have focused on developing systems for continuous tele - monitoring of patient vital signals and their transmission to healthcare institutes using 2.5/3 g networks. (it should also be noted that within the european seventh framework programme there are many more projects focusing on e - health services, but they do not specifically consider their provisioning and qos in 3 g networks.) while this list is by no means exhaustive, it demonstrates the emerging needs which the ngn aims to answer. limited research, however, has focused on evaluating support for e - health services in the context of the latest ngn standards. in order to support multimedia service delivery over a multiaccess converged all - ip core network, the third generation partnership project (3gpp) has finalized the release 8 specifications of the evolved packet system (eps), thus representing a milestone in the development of standards for the mobile broadband industry. for a detailed description of eps, an interested reader is referred to. the eps represents an evolution of the 3 g umts characterized by higher data rates, lower latency, and a packet - optimized system aimed to deal with the rapid growth in ip traffic. a key element of the eps is specification of a class - based qos control concept offering service and subscriber differentiation. the packet forwarding treatment received by a given session data flow is based on an assigned qos class identifier (qci) that serves as a standardized reference to node - specific treatment (e.g., scheduling weights, admission thresholds, queue management thresholds, etc.). the 3gpp specifications include nine qcis with corresponding standardized characteristics in terms of bearer type (guaranteed versus nonguaranteed bit rate), priority, packet delay, and packet - error - loss rate. in the context of delivering e - health services, a key issue for the eps qos control architecture will be the accurate mapping of service requirements to qcis. we emphasize that our focus in this paper is not on determining the actual network requirements of e - health services, as a significant amount of related work deals with this issue. rather, we aim to contribute to the ongoing research by proposing a mapping of requirements to 3gpp qcis, based on a classification of heterogeneous e - health service context and network qos requirements. the proposed mapping aims to provide network operators with valuable guidelines for enabling service prioritization and making necessary network resource authorization decisions. the paper is organized as follows. in section 2, we discuss the various requirements of e - health services and propose a service classification. a mapping of e - health service requirements to standardized qcis is given in section 4. section 5 presents an example involving a tele - consultation service between a patient and a doctor used to illustrate eps qos control procedures and use of the proposed mapping to qcis. among the numerous classifications of e - health services that may be found in literature, services are often broken down based on specific objectives into the following : tele - diagnosis, tele - consultation, tele - monitoring, tele - management, tele - education, and value - added services. tele - diagnosis services have been described as generally characterized by asynchronous point - to - point communication (e.g., specialists at a remote site review transmitted patient data and return a diagnosis report), while tele - consultation has been described as generally based on synchronous viewing and manipulation of medical multimedia data. tele - monitoring in most cases refers to transmission of a patient 's vital bio - signals and other related data, as in the case of home care telemedicine services. such services are often targeted at treating patients with chronic diseases or for posthospital home care, and may involve multiparametric monitoring including patient vital signs (e.g., electrocardiogram (ecg), blood pressure, saturation of peripheral oxygen (spo2), glucose level, etc.), physical sensors (monitoring patient activity), and environmental sensors (e.g., air temperature, humidity, and air pressure). the european commission funded mobihealth project has focused on mobile tele-monitoring.tele-monitoring may also involve an expert interacting with a remote examination site using audio / visual communication. for the purposes of this paper, we use the term tele - education as referring to any health - related education performed at a distance and in non - emergency situations. in, perakis and koutsouris use the term tele - management to refer to a combination of advanced tele - monitoring and tele - consultation services, such as those involving computer assisted medical interventions and automatic surgical tools (tele - surgery). a classification of e - health services based on qos requirements has been proposed in vouyioukas.. the authors state that applications may generally be classified as real - time applications and near real - time applications. we note, however, that in certain cases the instances of the same generic type of service (e.g., tele - diagnosis) may have very different qos requirements depending on actual context in which the service is invoked. for example, in an emergency situation, a remote specialist diagnosis may require near real - time transmission of medical data, while in a different, non - emergency situation, the patient medical data is transferred (with tolerance for delay) to a remote location to be analyzed by specialists. another example of a service with strict qos requirements and involving patient critical data transmission is tele - surgery. hence, determining service context in terms of emergency or patient critical versus non - emergency and noncritical service delivery is crucial in providing input for traffic scheduling mechanisms. context awareness with respect to qos has also been addressed for m - health services, where the authors use contextual information (information about the user environment) to adapt the service. table 1 illustrates the classification proposed in, extended by the notion of sensitivity to context, whereby context refers to the emergency nature of the service. all application types for which use in an emergency or patient critical context may be envisioned are marked as being sensitive to context. we build upon this idea later, in the proposed mapping of qos requirements to qcis. typical e - health applications may involve multimedia conferencing, transmission of patient physiological parameters, transfer of high resolution medical images, transmission of clinical / administrative data, and access to ehrs. such applications generate traffic with very diverse network requirements, differing in required bandwidth, real - time versus non - real - time interactivity, and tolerance for packet loss. often times, an e - health service will involve the simultaneous transmission of multiple media flows, such as for example a mobile emergency system including audio / video, medical images, and ecg signals. in this section, we present an overview of related work that has focused on specifying the requirements of such services. multimedia conferencing applications are often a key part of e - health services, as they may be used for various communication scenarios including patient - doctor, doctor - doctor (e.g., hospital specialists and general practitioners), and patient - patient scenarios (e.g., virtual support groups). furthermore, they may involve preorchestrated, as well as live conferencing. in general, voice and video transmission applications tolerate some packet loss as a tradeoff for achieving low - delay and real - time interactivity. the third generation partnership project (3gpp) specifies the requirements for conversational audio / video applications in umts networks as being highly delay and jitter sensitive, with one - way end - to - end (e2e) delay bounds being 150400 ms. with regards to loss, acceptable frame erasure rates (fers) furthermore, the international telecommunications union (itu) specifies objective values for ip packet transfer performance in ip networks, with bounds of 100400 ms for e2e delay and 1 10 packet loss ratio for real - time conversational services. the itu also specifies the model for end - user qos categories with respect to tolerance to information loss and delay tolerance, and provides indicative performance targets for audio and video applications as well as for data applications. the 3gpp has specified the quality of experience and related metrics of the end - to - end multimedia service performance in 3 g networks. for example, a service involving audio / video conferencing between a patient and a doctor for a routine checkup may be considered less critical with regards to qos guarantees (i.e., may tolerate increased degradation and delays of 150400 ms) as compared to an audio / video conferencing service employed in an emergency accident situation where visual communication with a remote specialist doctor is imperative (i.e., hard real - time interactivity with one - way delay 0150 ms). in, the authors note that it is important to distinguish between the requirements for : (a) real - time video transmission, (b) offline video transmission, (c) medical video and audio for diagnostic applications, and (d) nondiagnostic video and audio. real - time video transmission for diagnostic applications is stated as being the most demanding. real - time diagnostic audio applications include the transmission of stethoscope audio, or the transmission of the audio stream that accompanies the diagnostic video. the transmission of high definition still images is often a part of a tele - consultation service. examples of images include : dermatological images, x - rays, magnetic resonance images (mris), ultrasound images, and computed tomography (ct). with regards to bandwidth, there are no specific requirements other than the fact that low bandwidth leads to longer transmission times. an overview of image sizes and data rates corresponding to typical devices is given in table 2 (taken from). in general, an important issue in the transfer of medical data is reliable data delivery, with packet losses having potentially disastrous consequences in terms of patient diagnosis. tele - robotic systems, such as those used for tele - surgery and tele - ultrasonography, may involve the transmission of both still and streaming images. qos requirements are generally very strict in terms of delay and loss intolerance, with invasive robotic services (tele - surgery) being patient critical and thus having more stringent requirements than noninvasive robotic services (e.g., tele - ultrasonography). in the case of robotic tele - surgery, a key requirement is a minimal delay time from when a surgeon 's hand movement is initiated, the remote manipulator actually moves, and images are shown on the surgeon 's monitor. studies have shown that the limit of the acceptable time delay in terms of a surgeon 's perception of safety was roughly 330 ms. mechanisms for compensating delay include slowing surgeon hand movement and a remote surgeon performing tasks that require less precision, while a local surgeon performs precision - dependent tasks. furthermore, it has been noted that two - way video conferencing among members of the healthcare team greatly enhances robotic tele - surgery. with regards to reliability and error rate, relatively low data rates for transmission of robotic control data (< 20 kbps) allow for error - protection coding and the possibility for transmitting equipment to send commands more than once to the receiving end. the qos requirements of a robotic tele - ultrasonography system have been conducted in the scope of the end - to - end mobile tele - echography using an ultralight robot (otelo) project. the project developed a fully portable tele - operated robot allowing a specialist sonographer to perform a real - time robotized tele - echography (ultrasonography) to remote patients. three types of critical data are transmitted over the otelo system : (1) robotic control data, (2) ultrasound still images, and (3) medical ultrasound streaming data, with controlled ultrasound medical streams being the most demanding in terms of data rate (in that case qcif format and h.263 codec have been used). focusing on a umts network, the authors point out that for the exchange of medical image sequences with real - time requirements, a mapping to the umts conversational qos class would be necessary. a test carried out on the otelo system showed reliable functioning of the system with a minimum packet loss of less than 0.5 percent. furthermore, performance evaluation of the ultrasound streaming images showed that round trip delays (along the expert - patient - expert path) of up to 300 ms were within acceptable boundaries of maintaining high / quality real - time interaction of the system. the amount and frequency of information related to monitored patient vital signs that needs to be transmitted depends on patient needs. while for some patients it may be sufficient to transmit vital signs every few minutes, other patients (e.g., those considered high - risk) may require transmission every few seconds. in, the authors discuss the requirements of tele - monitoring systems for cardiac patients which consist of wearable and light - weight wireless biomedical sensors (for measuring 3 lead ecg, spo2, heartbeat, and blood pressure). sensors communicate with a signal processing module which further transmits physiological measurements (based on patient - specific thresholds, timing and frequency as specified by a healthcare provider) via various network interfaces to, for example, hospital servers, emergency stations, local physician clinic, and so forth. transmission requirements are mapped to the following categories based on the severity of the patient 's health condition (as specified by a health provider) : class 0 : highest priority requiring real - time monitoring (patients in emergency situations, or, with severe medical conditions) ; class 1 : requiring near real - time monitoring within a few hours ; class 2 : requiring periodic monitoring such as twice daily ; class 3 : requiring monitoring from time to time. the mobihealth project developed a system for the continuous monitoring of patient vital signals (using body area networks) and their transmission to healthcare institutes using gprs and umts. trials were conducted involving home care, high - risk patient monitoring, and emergency services, with the goal being to evaluate whether 2.5/3 g communications technologies can support the requirements of such systems. different trials were conducted to cover a range of bandwidth requirements (low : less than 12 kbps, medium : 1224 kbps, and high : greater than 24 kbps), and to address both non - real - time (e.g., periodic transmission of ecg) and real - time transmission requirements (e.g., alarms, transmission of vital signs in emergency situations). at the time the trials were run (2003), the identified network barriers included restricted available data bandwidth for uplinks (in tele - monitoring systems, high data rates generally originate at user side, not server), delay variation, delays in transmission (ranging from approximately 100 ms for packet sizes of 174 bytes, to 1200 ms for packet sizes of 8122 bytes), and handover (sometimes resulting in connection loss). one of the most important application areas for telemedicine that relies on broadband services has been recognized as tele - consultation and tele - diagnosis in emergency accident situations, where paramedics attending to accidents do not have the necessary expertise to handle such situations [8, 13 ]. this results in the need for real - time transmission of accident victim 's physiological parameters (e.g., ecg leads, oxygen saturation, and blood pressure) from an accident site or ambulance vehicle to a hospital / medical center. furthermore, the transmission of still images and video streaming of the victim to specialized doctors may be of critical importance for the doctor to obtain a thorough clinical image of the patient prior to arrival at the emergency room. the joint transmission of voice, real - time video, ecg signals, and medical scans from an ambulance to a hospital in a realistic cellular multiuser simulation environment based on umts is further considered in, with corresponding qos requirements summarized in table 3. a three - lead ecg signal is sampled at 250 hz and quantized with 12 bits per sample. while voice and video packets are considered error tolerant, ecg and file transmission require data integrity. in their simulations, the authors set a maximum allowed delay of 400 ms for voice and video traffic and a maximum delay of 300 ms for ecg traffic. similar research conducted in provides experimental evaluation of a mobile tele - trauma system capable of simultaneously transmitting video, medical images, and ecg signals in real 3 g network conditions. various stream parameters have been tested, including different sampling rates, frame rates, resolutions, and so forth. the authors note that trauma specialists have suggested that a resolution of 320 240 (tv resolution) is enough for trauma cases, while a lower resolution of 160 120 may be used in extreme bandwidth conditions. with regards to requirements and stream priorities, the authors conclude the following : video requirements : loss tolerant, delay intolerant, and low priority ; image requirements : loss intolerant, delay tolerant, and medium priority ; ecg requirements : loss and error intolerant, high priority. the same traffic priority order as used in has been used by the authors in, who present new scheduling ideas for the integration of telemedicine traffic with other traffic types in a high capacity cellular network, focusing on handling urgent telemedicine traffic transmission with full priority, while satisfying the qos requirements of regular traffic as well. the four types of telemedicine traffic that were considered by the authors in their simulations : ecg, x - ray files, medical images, and video. their corresponding characteristics are as follows : ecg data : sampled at 360 hz with 11 bits / sample precision. a strict upper bound of 1 channel frame (12 ms) is set for the transmission delay of an ecg packet. the upper bound for the transmission delay of an x - ray file is set to 1 minute. the upper bound for the transmission delay of an image is set to 5 seconds. video : h.263 is reported as the most widely used video - encoding scheme for telemedicine video. traces were used with mean bit rates of 91 kbps, peak rates of 500 kbps and standard deviation of 32.7 kbps. due to the need for very high - quality telemedicine video, the maximum allowed video packet dropping probability the performance obtained by using simulation, with telemedicine traffic set to 10% of total channel capacity, showed delay and loss values far below the upper bounds set for the particular data type. in related work, the authors studied the capabilities of a high - speed packet access (hspa) 3 g network in meeting the qos requirements of emergency situations involving the joint transmission of voice, real - time video, medical data such as ecg and other vital signals, heart sound, and file transfer. their results showed that in the case of congestion, congestion control and service prioritization may be used based on modifications in the operation of the hsdpa scheduler (critical e - health services are treated favorably in comparison with all other kinds of calls). by prioritizing emergency e - health services, the authors show that delay is constrained within acceptable values ranging from 150 ms to 240 ms in the downlink (for voip and video, resp.), and approximately 200 ms, 500 ms, and 800 ms in the uplink (for voip, medical data, and video, resp.). in, the authors study the qos requirements of a patient tele - monitoring system for emergency vehicles using 3 g umts access and propose adaptive qos decision mechanisms in light of varying network resources. they identify different types of services (audio, video, biomedical signals, transmission of high resolution images, transmission of administrative data, and remote ehr access) which can be combined in different ways based on resource availability to deliver an optimal tele - monitoring service. combined service qos (corresponding to simultaneous transmission of different service types in real time) is evaluated against the following thresholds (determined based on itu standards and additional referenced work) : e2e delay threshold for audio as 150 ms and video 250 ms, and packet loss rate as less than 12% audio and less than 10% video. in their previous work, the authors have developed an automated tool to model e - health service requirements, and optimize application design regarding available network resources. in, the author presents a resource allocation model for wireless healthcare information systems which maps e - health applications to three different service classes based on the emergency nature and degree of interactivity (real time versus nonreal time). the classes include : (1) highest priority class incorporating life - threatening situations, characterized by very low blocking probability ; (2) medium priority class representing real - time e - health applications which are not life - critical, with the possibility of qos degradation in order to meet the high priority class requirements ; and (3) low - priority class representing non - real - time applications whose qos requirements are met when given resources are not required by the other two classes. simulation results serve to illustrate the benefits of assigning different priority levels to traffic based on the specific medical application requirements. existing and emerging hospital and primary health care information systems an ehr is designed to contain all possible health relevant data of a person. over the past years, european governments have identified the ehr as the basis for nation - wide exchange and seamless integration of patient data. access to and management of ehrs may occur in both emergency and non - emergency situations. however, a key requirement is reliable transmission with zero packet loss. a wide variety of applications support health related education, such as distance learning for health professionals located in rural and remote areas. examples of applications include interactive collaborative tools and tele - conferencing, streaming audio / video, virtual classrooms, and interactive surgical simulations. such applications are generally not considered to be as time - critical as those involving patient care, and may tolerate low delay, data loss, and unavailability. furthermore, biomedical research may involve the transmission of high - resolution images from remote databases. in the case of remote instrument manipulation for research purposes, low - delay requirements may result from the need to position samples or adjust instrument settings. a summary of findings related to the qos requirements for e - health services is given in table 4. we group together services based on delivery requirements (real time or nonreal time) and transmission type (two - way conversational communication, unidirectional streaming, interactive request - response, and background data retrieval). for certain services, delay requirements are indicated as not available since no specific requirements have been found. for example, in the case of image transfer, delay will depend on image size and available bandwidth. it is clear that for emergency services, such transfer should be completed within a few seconds. a general conclusion based on referenced work is that qos mechanisms in ngns are necessary in order to be able to guarantee that the requirements of e - health services will be met, in particular for emergency and patient critical services. in the following sections, we describe the qos control architecture specified by 3gpp and map e - health services to standardized qos classes. in order to provide support for ip multimedia services in converged ngns, the 3gpp has specified the eps, comprised of both an evolved packet core (formerly known as service architecture evolution (sae)), together with an evolved radio access network (e - utra and e - utran, commonly associated with the long term evolution (lte) work item). the eps also supports non-3gpp access, wireline (e.g., xdsl, cable), as well as fixed and mobile wireless (e.g., wlan, wimax). the eps specifies class - based qos provisioning, allowing operators to differentiate the treatment received by different subscribers and services. functional network entities and interfaces responsible for providing service - aware qos control have been specified as a part of the overall 3gpp policy and charging control (pcc) architecture, illustrated in figure 2, and briefly summarized next. in general, the pcc architecture extends the architecture of an ip - can (ip connectivity access network), where the policy and charging enforcement function (pcef) is a functional entity in the gateway node implementing the ip access to a packet data network (pdn). an application function (af) located along the application - level signaling path interacts with end user applications, situated in the user equipment (ue), and extracts session information from signaling flows. an example of an af is the proxy - call session control function (p - cscf) in the ip multimedia subsystem (ims). the ims has been specified by the 3gpp (and further adopted by other standardization bodies) as a multimedia session control subsystem comprised of core network elements for the provision of multimedia services. in ims, session qos negotiation procedures are based on an end - to - end message exchange using the session initiation protocol (sip) in combination with the session description protocol (sdp). an enhancement involving negotiable qos based on advanced qos parameter matching and optimization functionality to be included along the signaling path in the ims has been proposed in. once the ue is switched on, a default bearer is established, based on subscribed qos profile. as shown in figure 2, the session information is extracted by the af (1), and is further passed to a policy control and charging rules function (pcrf) (2), which is the policy engine of the pcc architecture. the pcrf makes session - level policy decisions to determine whether the user session can have access to requested services and, if yes, under what constraints. decision - making is based on the session information received from the af (2), combined with the subscription information / policies for a given user received from a subscription profile repository (3), and the information about access network technology (received from the access network ; not shown in the figure). the pcrf then provides session - level policy decisions to the pcef (4) in the access gateway, where the policy decisions are enforced and used to establish a new bearer or modify an existing bearer (5). detailed qos signaling procedures are specified for establishing and modifying bearers. in the scope of the eps, a particular bearer is used to uniquely identify packet data flows belonging to a logical ip transmission path that receive a common qos treatment between the terminal and the gateway at the edge of the access network. hence, the bearer is the basic enabler for providing differential treatment for traffic with differing qos requirements. according to standards, it shall be possible to apply qos control on a per service data flow basis. the two types of bearers that have been defined are guaranteed bit - rate (gbr) and non guaranteed bit - rate (non - gbr). in the case of a gbr bearer establishment, network resources are reserved in the network (e.g., by an admission control function in a radio base station), and as long as traffic along such a bearer conforms to the reserved gbr, it is assumed that no congestion - related packet loss will occur. on the other hand, services delivered over a non - gbr bearer may experience congestion - related packet loss. furthermore, a non - gbr bearer may be established for a longer period of time as it does not block transmission resources. a maximum bit rate (mbr), defined as the upper limit for allowed bit rate on a given bearer, may be defined only for gbr bearers. an aggregate mbr (ambr) values may also be defined for a group of non - gbr bearers (for uplink and downlink separately), thus enabling operators to limit the total amount of bit rate consumed by a single subscriber. figure 2 shows an example how different bearers correspond to different packet flows for the given ip address of the end user terminal (one bearer may be established per combination of ip address and qos class). each established bearer is assigned one and only one qos class identifier (qci). a qci is defined as a scalar value that represents a standardized reference to specific packet forwarding behavior to be provided to a service data flow on the path between a user equipment and access gateway. (the parameters that control the forwarding behavior are preconfigured by the operator owning the node.) the goal of standardizing qci characteristics is to ensure that applications and services mapped to that particular qci receive the same minimum level of qos across multivendor networks, in multioperator environment, and in case of roaming. the 3gpp specifications include nine qcis with corresponding standardized characteristics in terms of bearer type (also referred to as resource type), priority, packet delay budget, and packet - error - loss rate (given in table 5). a primary difference between qci 14 and qci 59 is the bearer type (gbr versus non - gbr). the specified packet delay budget defines an upper bound for the time that a packet may be delayed between a user equipment and the access gateway, with actual packet delays in particular for gbr traffic - expected to be typically lower as long as the end user has sufficient radio channel quality. the packet error loss rate defines an upper bound for a rate of noncongestion related packet losses. each qci is further associated with a priority level (from 1 to 9, with priority level 1 being the highest). priority levels are used to differentiate between service data flow aggregates of the same ue and also to differentiate between flow aggregates from different ues (i.e., a scheduler shall meet the packet delay budget requirements of flows on priority level n in preference to meeting the packet delay budget of flows on priority level n + 1). while a qci specifies user - plane treatment for associated bearers, the qos parameter allocation and retention priority (arp) (also signaled by the pcrf to the access gateway) specifies control plane - treatment for bearers, that is, it may be used to decide whether a bearer establishment or modification request should be accepted or rejected due to resource limitations. the arp parameter contains information about the priority level, the pre - emption capability and the preemption vulnerability of a resource request. the range of the arp priority level is 1 to 15, with 1 as the highest level of priority. values reserved for intraoperator use (priority levels 18) may be used to prioritize ims emergency calls. the pre - emption capability information defines whether a service data flow can get resources that were already assigned to another service data flow with a lower priority level. the pre - emption vulnerability information defines whether a service data flow can lose the resources assigned to it in order to admit a service data flow with a higher priority level. when the system is overloaded, or, when resources must be freed up for other purposes (e.g., an incoming emergency call), bearers associated with a low arp are released. for example, for video telephony, the operator may map video to a bearer with a lower arp and voice to a bearer with a higher arp, and thus have the option to drop only the video bearer if needed, while keeping the voice bearer unaffected. in normal circumstances each eps bearer qos profile comprises the parameters qci and arp ; and for gbr bearers also gbr and mbr. for aggregate (set of) eps non - gbr bearers, a mapping of authorized ip qos parameters received from the pcrf to authorized umts qos parameters is performed by the translation / mapping function in the packet gateway. the rules for this mapping with regards to the qci parameter are specified in and summarized in table 6. for the purposes of this paper, we assume that the eps as such can provide the performance as specified and we use these values as a basis for our mapping. in the context of delivering e - health services over an ngn architecture based on the eps, a key issue for operators will be the accurate mapping of service requirements at session establishment / modification time to standardized qcis. a particular service may comprise multiple media types and traffic flows that may need to be mapped to different qcis. (an example of such a situation is shown in an illustrative example later in this paper.) using as a basis the analysis of referenced work which has addressed the qos requirements of heterogeneous e - health services (summarized in table 4), we explored the idea of mapping the previously defined types of e - health services to qcis. while for some types of e - health services this mapping turned out to be rather straightforward, the question of context, as well as relative importance between flows belonging to different services within the same qci, proved to be more difficult, as will be explained in more detail shortly. in order to address the requirements of e - health in different contexts, we find it necessary to break down existing classifications as proposed in [7, 13 ] by considering service delivery requirements (real time or nonreal time) and transmission type (two - way conversational communication, unidirectional streaming, interactive request - response, and background data retrieval). furthermore, certain types of e - health services mentioned in table 4 are broken down into multiple e - health classes based on service prioritization (emergency versus non - emergency). in the case of emergency situations (e.g., medical data transmission from ambulance or accident site to a hospital), data streams should be treated as parts of an emergency session, implying specific call - handling mechanisms and guaranteed qos support. emergency service support available in current networks generally refers to emergency calls established in the circuit switched domain, such as 112 or 911 voice calls. with regards to the packet switched domain, emergency ip flows need to be identified by the p - cscf and signaled to the pcrf (using an emergency indicator) to allow the pcrf to prioritize emergency service data flows over non - emergency service data flows within the access network. in addition to assigning a qci value, an arp value may be specified that is reserved for intra - operator use of emergency calls. in general (not only for emergency services) during congestion times the arp parameter may be used to assign greater priority to bearer establishment / modification for e - health services, as compared to other typical commercial services (e.g., non - health related calls, networked games, iptv, etc.). we assume tele - consultation services to be based on synchronous two - way communication between involved parties based on conversational audio and/or video. such services generally impose large bandwidth requirements and are delay - intolerant and loss - tolerant. we therefore map real - time conversational voice - based tele - consultation and real - time conversational video - based tele - consultation to qcis 1 and 2 respectively, with the resource type corresponding to gbr. as the timely and reliable delivery of e - health services may in certain cases be considered of critical importance (i.e., a patient 's well being or life is endangered), it is imperative that the top priority be assigned to corresponding traffic flows. we argue that in order to support e - health services, particular classes need to be further broken down with regards to the assigned priority level. we therefore propose for qci 2 to be broken down with respect to priority level into priority level 2 (for higher priority conversational video - based services) and priority level 4 (standard 3gpp priority level for qci 2). since qci 3 specifies a gbr and very strict delay bounds (50 ms), we map hard real - time interactive services to this class. we identify the requirements of invasive real - time robotic services (e.g., tele - surgery involving the transfer of robotic control data and streaming medical images) as corresponding to qci 3 characteristics, but distinguish such services from non - invasive real - time robotic services (e.g., ultrasound examination) in terms of priority. we therefore break down qci 3 in two classes corresponding to priority levels 1 and 3. first priority application data, not the overall first priority which is reserved for ims signaling. in table 7, this is denoted as priority level 1.) a potential problem with mapping real - time interactive services to qci 3 is that the specified packet error loss rate (pelr) for qci 3 is 10, which is considered too high for critical services such as tele - surgery. it is interesting to note that in the case where more strict loss requirements must be met, the only mapping that fits in terms of both delay and loss is that to qci 5. considering that qci 5 is normally used for ims signaling (signaling indication yes), the operator would need to implement a special policy and resource dimensioning to secure the network resources necessary to accommodate both the signaling and emergency application traffic. (the application traffic can be distinguished from the signaling traffic by setting the signaling indication to no). tele - monitoring services generally refer to services involving the transmission of a patient 's vital biosignals and other related data. we distinguish between three types of tele - monitoring services based on delay, loss, and bit rate (gbr versus non - gbr) requirements. we map emergency real - time tele - monitoring services to qci 4 and priority level 1 (1, as noted above), assuming applications involving the streaming of patient vital signs in emergency situations and with very strict loss bounds. non - emergency real - time tele - monitoring services are mapped to qci 4 and priority level 5 and refer to tele - monitoring services that are not of an emergency nature, but that involve a doctor viewing the patient data in real time. finally, non - real - time tele - monitoring services that are based on patient data which do not involve real - time viewing being delivered to a remote location are mapped to qci 8 because they are delay tolerant and may be assigned a non - gbr bearer. an example of such a service is patient care, for example, for people with special needs, involving the continuous monitoring of patients at their point of need (e.g., home, work, and on the move). we map real - time ehr data access, real - time tele - diagnosis, and real - time messaging services to the equivalent of qci 5 (with same arguments regarding ims signaling as above) due to sensitivity to loss, as well as a generally interactive (request - response pattern of the end user, rather than conversational or one - way streaming) and high - priority nature of such services. such services do not require for bearer resources to be blocked for an extended period of time (as is the case with gbr bearers) and as such are mapped onto a non - gbr bearer type. however, due to high - priority, an operator may use the arp parameter to specify the pre - emption capability that allows for the service data flow to be assigned resources that have previously been assigned to another service data flow with a lower priority level. while real - time messaging services representing emergency alarms sent to care givers are assigned a priority level of 1 (1, as noted above), we assign a priority level of 2 to real - time ehr data access and real - time tele - diagnosis (generally characterized by data and image transfer) in order to distinguish from the priority level assigned to ims signaling. on the other hand, we map non - real - time ehr data access / storage, non - real - time tele - diagnosis, and non - real - time messaging services to qci 6, as such services may be considered more delay tolerant, while being loss - intolerant. while tele - diagnosis services may have high bandwidth requirements due to the transfer of potentially very large medical images, messaging services generally refer to typically low - bandwidth consuming alarms or reminders. in the case of e - health services based on research and education, meeting qos requirements may be considered less critical then in the case of patient care services. with regards to delay requirements and degree of interactivity, we distinguish between the following : conversational research and education services mapped to qci 2 and priority level 4, streaming research and education services mapped to qci 4 (primarily unidirectional data transfer), and interactive research and education services mapped to qci 7 (characterized by a request - response pattern). in the case of services involving the retrieval of health - related information, we distinguish between interactive health information data exchange mapped to qci 8 (e.g., health related web sites involving web browsing), and non - interactive health information data exchange mapped to qci 9 (e.g., background download of health related data). both qci 8 and 9 are characterized by loss - intolerance and delay - tolerance, with qci 8 generally referring to low - priority interactive services and qci 9 referring to low - priority background services (i.e., are the most delay tolerant). finally, we identify a class of e - health services referred to as administrative and financial transactions that are mapped to qci 9 and have generally low bandwidth requirements. examples include patient referrals, appointment scheduling, charging and billing applications, and transfer of prescription orders. a proposed scheme for assigning qcis and priority levels to e - health service data flows is given in figure 3. while standards specify performance requirements for each qci, actual performance that will result if multiple services with a given qci coexist in the network at the same time will depend on operator dimensioning of network resources for each class, as well as specification of arp values including pre - emption capability and vulnerability. in that respect e - health services do not differ from other active services in the network. in order to illustrate eps qos control procedures and the proposed mapping of e - health service requirements to standardized qcis, we present a use case involving a tele - consultation service. for the purposes of this paper, the service is referred to as e - consult and it involves real - time video conferencing and streaming of ecg signals between a patient and a doctor. the service enables a patient or doctor to initiate an e - consult session using an early research prototype client application (figure 4 shows the makeshift gui). the main e - consult console offers the choice of media components to include in the session (audio / video, audio only, and ecg). in case audio / video is selected, two windows with camera views of the patient and the doctor, respectively, are shown. there is also a user - friendly streaming control panel for selecting audio / video quality and starting and stopping the media flows., audio and video streaming corresponds to bidirectional conversational streaming, and it has been implemented using the java media framework (jmf) api, which enables the capture, streaming, and transcoding of multiple media formats. we simulate a scenario whereby the patient has access to a remote ecg sensor unit and may choose to transmit ecg signal data to the doctor during the active session. in order to simulate streaming ecg data, we used data available from physiobank, a freely available archive of digital recordings of physiological signals to be used for research purposes. the recorded ecg files in physiobank used 2-, 3-, and 12-lead ecg records sampled at 500 hz with 16-bit resolution over a 32 mv amplitude range. for the purpose of our ecg visualization, a small sample of data extracted from ecg recording was stored in a text file in a numerical format. the network requirements for audio / video correspond to standard requirements for audio and video streaming, with exact values for network parameters depending on the specific type of codec. a streaming control panel included in the e - consult application enables end users to configure preferences with regards to audio and video quality (different chosen quality levels will results in different codecs). audio quality levels correspond to the following jmf codec settings : (1) low - quality gsm, (2) medium - quality ulaw, and (3) high quality mpeg audio. video quality levels and jmf settings were specified as follows : (1) low - quality h.263, and (2) high - quality motion jpeg. a view of the network architecture used for service delivery and a session establishment signaling diagram are given in figure 5. in the use case involving ims, both the doctor and the patient would access the e - consult service via their respective access networks and home ims networks. (we selected this use case since the focus of the paper is on eps, but in a more general case of end users connecting through their respective access networks through a common core network, qos agreements among the providers involved in the service delivery chain should exist in order to provide end - to - end qos.) service establishment and modification is based on an end - to - end sip / sdp message exchange via ims control nodes. service requirements in terms of media types and bandwidth requirements are specified by the end user application and signaled by using sip / sdp. the signaling diagram depicts the patient application as initiating the session by sending a sip invite message including a session description offer specified using sdp. the doctor application replies with a 200 ok message including a subset of supported media types and codecs. in this case, we assume that both end users support specified audio, video, and data formats / codecs. as described in section 3, the p - cscf nodes are responsible for extracting session information and invoking authentication and network resource authorization procedures. the pcrf nodes are the functional entities responsible for making session - aware policy decisions and signaling bearer establishment / modification rules to the access network (referred to provisioning of pcc rules in the diagram). this interaction is performed by using an appropriate diameter application protocol (as defined by the 3gpp). step 7 illustrated in figure 5 may be executed in parallel with steps 8 and 9, and step 10 in parallel with steps 13 and 14. in the case of e - consult, the different media flows established as part of the session are mapped to different qcis due to different qos requirements. we assume the following mappings : (1) audio stream to qci 1, (2) video stream to qci 2, and (3) ecg signal stream to qci 4. considering that the example service is not of an emergency nature, there is no need to assign arp values corresponding to emergency services. on the other hand, if this were to be treated as an emergency situation, then the ecg signal stream would be mapped to qci 3, and operator policies would determine what arp values to assign. since qci characteristics are specified for the access network (ue to access gateway / pcef), in the case of two access networks along the end - to - end path, delay values should be summed, and a value for delay in the core network (likely to be much lower) added to it. based on the findings described earlier, and considering that delay values specified for qcis represent upper bounds, it may be concluded that the required end - to - end values could be met. further research and concrete case studies would be needed to validate these conclusions in practice. due to a possibly high impact on human life and well - being, e - health services represent a category of services for which the research on qos requirements has moved beyond the well - known properties of individual media flows. it has been shown that the context in which the service is invoked may determine the actual classification and prioritization of flows. our work provides some general guidelines and proposes a mapping of e - health service types to standardized qcis in eps as a next - generation communication technology. a use case of the e - consult service illustrates how the mapping can be applied. | e - health services comprise a broad range of healthcare services delivered by using information and communication technology. in order to support existing as well as emerging e - health services over converged next generation network (ngn) architectures, there is a need for network qos control mechanisms that meet the often stringent requirements of such services. in this paper, we evaluate the qos support for e - health services in the context of the evolved packet system (eps), specified by the third generation partnership project (3gpp) as a multi - access all - ip ngn. we classify heterogeneous e - health services based on context and network qos requirements and propose a mapping to existing 3gpp qos class identifiers (qcis) that serve as a basis for the class - based qos concept of the eps. the proposed mapping aims to provide network operators with guidelines for meeting heterogeneous e - health service requirements. as an example, we present the qos requirements for a prototype e - health service supporting tele - consultation between a patient and a doctor and illustrate the use of the proposed mapping to qcis in standardized qos control procedures. |
negative pressure pulmonary edema (nppe) is an uncommon, but potentially life - threatening complication of general anesthesia. it is usually seen during emergence from anesthesia. in healthy adults undergoing general anesthesia, the incidence of nppe is 0.05 to 0.1%.[13 ] it is even less common with the use of a laryngeal mask airway (lma).[48 ] the sequelae of acute nppe can be devastating with mortality as high as 11 40%. nppe can complicate the clinical course and outcome of otherwise healthy patients undergoing simple surgical procedures. early recognition and institution of appropriate positive pressure ventilation is important to ensuring successful outcomes. an unusual case of acute nppe associated with a patient forcefully biting down on the lma during emergence is presented. a review of pathophysiology, risk factors, and management strategies for nppe then follows. a 58-year - old male presented to the emergency department with a three - day history of fever, worsening perineal erythema, and pain. his medical history revealed only mild seasonal allergies ; his functional status was very good. his surgical history was significant for an inguinal herniorrhaphy three years prior to his current presentation. he was noted to have significant perineal cellulitis and pain. his preoperative chest x - ray revealed no infiltrates, pulmonary edema or cardiomegaly. computed tomography (ct) demonstrated extensive inflammation of the perineum and scrotum as well as subcutaneous air, consistent with the diagnosis of fournier 's gangrene. preoperatively the patient was normotensive, but tachycardic (heart rate 110 120 beats / minute). his electrocardiogram on admission to the intensive care unit (icu) did not show any st, t - wave changes. he did not demonstrate a third heart sound, peripheral edema, or jugular venous distention. his hemoglobin and hematocrit were 14.9 g / dl and 44%, white blood cell count was 12.7 10 / ml, and platelet count was 146,000 / ml. his electrolyte panel featured sodium of 135 mmol / l, potassium 4.3 mmol / l, chloride 99 mmol / l, hco3 26 mmol / l, blood urea nitrogen 16 mg / dl, and creatinine 1.14 mg / dl the patient was taken to the operating room for emergency surgical debridement of the fournier 's gangrene. he was premedicated with 2 milligrams (mg) of midazolam intravenously (iv) and anesthesia was induced with iv propofol (200 mg) and fentanyl (100 micrograms [mcg ]). a laryngeal mask airway (lma, size number 4) was placed without difficulty. he remained hemodynamically stable throughout, but was tachypneic, with a respiratory rate of 35 breaths / minute. surgical blood loss was ~200 ml and the procedure was otherwise uneventful. at the conclusion of surgery immediately after lma removal, a laryngospasm was noted, with concurrent tachycardia and hypertension. application of positive pressure via face mask (fio2 100%) was unsuccessful in providing effective ventilation. intravenous propofol and succinylcholine were administered to facilitate orotracheal intubation with a 7.5 endotracheal tube (ett). he did develop a brief episode of tachycardia (120 130 beats per minute) and hypertension (170 180 / 90 100 mmhg) on extubation. his arterial blood gas (abg) in the operating room showed ph 7.27, paco2 59 mmhg, pao2 46 mmhg, hco3 of 16 mmol / l, base excess of 1.9, and oxygen saturation of 75%, with a lactate of 1.27 mmol / l. he was on synchronized intermittent mechanical ventilation (simv) at 12 cycles / minute, tidal volume 750 ml, pressure support 10 cm h2o, with positive end - expiratory pressure (peep) of 10 cm h2o. after peep was increased to 12 cm h2o, his spo2 recovered to > 90%. of note, his peak and plateau pressures were only minimally elevated and his ability to generate a negative pressure was adequate (> 25 cm h2o). he was transferred to the intensive care unit (icu) where he was continued on simv, with a tidal volume of 580 ml, fio2 100%, pressure support 15 cm h2o, and peep of 12 cm h2o. his initial abg in the icu showed ph 7.6, paco2 25 mmhg, pao2 165 mmhg, hco3 27 mmol / l, and spo2 99% (fio2 of 80%). an icu admission chest radiograph demonstrated bilateral patchy infiltrates, no pneumothoraces or effusions, and a normal heart size ; these changes were central and peripheral and not in the dependent areas of the lung [figure 1 ]. over the subsequent 12 hours his fio2 was weaned to 40%, and his abg showed ph 7.45, pco2 41 mmhg, pao2 78 mmhg, hco3 28 mmol / l, base excess 3.8, and oxygen saturation 96%. postoperatively, during the first few days he was in positive fluid balance, however, he was in a negative fluid balance thereafter. chest x - ray one hour postoperatively the patient was taken for a planned re - debridement on postoperative day # 2 and was not extubated until postoperative day # 3. shortly after extubation, he complained of acute shortness of breath, with an abg showing ph 7.49, pco2 39 mmhg, pao2 62 mmhg, hco3 29 mmol / l, and spo2 93% (fio2 of 80%). he was placed on intermittent continuous positive airway pressure (cpap, 10 cm h2o) via full face mask. although the chest radiogram showed an improvement from the index postoperative film, the patchy infiltrates persisted [figure 2 ]. after ensuring adequate volume status, furosemide (40 mg intravenous) was administered, with resultant improvement in oxygenation, shortness of breath, and subsequent roentgenographic examination the patient received two additional doses of furosemide (20 mg intravenous) over the next 24 hours, as determined on the basis of clinical re - evaluation. he was weaned off oxygen on postoperative day six as his chest radiogram showed near complete resolution of the pulmonary edema and his oxygenation was appropriate [figure 3 ]. the patient was doing well on follow - up at three months, and underwent uneventful skin grafting of the residual perineal wound without any general anesthesia - related complications. ezri., first reported the possible association of lma use and pulmonary edema. shankar. suggested that forceful inspiration against an lma could lead to large subatmospheric pressure changes, resulting in a clinical appearance similar to that of pulmonary edema. nppe has been previously reported after biting on an lma during emergence that resulted in dyspnea and hemoptysis. the proseal lma has also been associated with airway obstruction and the potential for nppe. unilateral nppe has also been reported with lma use in a patient in the lateral position. in this report, acute obstruction associated with forceful inspiration after biting of the lma was the most likely trigger event for nppe. negative pressure pulmonary edema was first described in 1927, when researchers noted that prolonged inspiration against fixed airway obstruction resulted in pulmonary edema in the canine model., in three adult patients who experienced acute onset of pulmonary edema minutes to hours after severe acute upper airway obstruction. since then, only a few case reports / series of nppe were published, and our understanding of the pathogenesis and treatment of nppe remains limited.[1221 ] negative pressure pulmonary edema has been subdivided by guffin. into two distinct classes. type i, associated with forceful inspiratory effort in the context of an acute upper airway obstruction, and type ii, which occurs after the relief of chronic partial airway obstruction. common etiologies for type i nppe include laryngospasm, epiglottitis, croup, choking / foreign body aspiration, strangulation, hanging, endotracheal tube obstruction, laryngeal tumor, goiter, postoperative vocal cord paralysis, and near drowning. of these, the laryngospasm remains the most common cause, accounting for ~50% of the reported cases. type ii nppe can be seen after adenoidectomy / tonsillectomy, laryngeal mass resection, correction of choanal stenosis or reduction of a hypertrophic redundant uvula. the most common clinical setting for nppe is during emergence from general anesthesia. during this critical period, upper airway obstruction is usually followed by the rapid onset of respiratory distress, with or without hemoptysis, and clinical / radiological features consistent with bilateral pulmonary edema. however, in some patients, the onset may be considerably delayed, up to a few hours. therefore, close postoperative observation must be considered for an extended period of time in patients experiencing respiratory difficulty or laryngospasm. patients with a short neck, difficult intubation, endotracheal tube obstruction, history of obstructive sleep apnea, obesity, acromegaly, and upper aerodigestive tract surgery have increased susceptibility to this condition. this syndrome is also noticed more frequently in young healthy, and muscular patients, because of their ability to generate high amounts of negative intrathoracic pressures during an obstructing event. the pathogenesis of type 1 nppe is multifactorial.[10122128 ] the mechanism revolves around a large inspiratory force generated against an obstructed upper airway (modified mueller maneuver) that leads to an acute and unusual elevation of negative intrathoracic pressure. healthy human subjects can generate very high levels of negative inspiratory pressure with a reported maximum of 140 cm h2o from a baseline of 4 cm h2o. the first of the two proposed pathophysiological mechanisms is that nppe is a type of hydrostatic pulmonary edema caused by the significant fluid shifts from the microvasculature to the peri - microvascular interstitium. there is alteration in the starling forces (i.e., intra- / extracapillary hydrostatic and oncotic pressures) that influence the movement of fluid across the pulmonary capillaries. negative intrathoracic pressure will be transmitted to the interstitial space and alveoli, causing an increase in the hydrostatic pressure gradient favoring transudation of the fluid from the pulmonary capillary to the pulmonary interstitial space. it also causes an increase in the venous return to the heart resulting in an increase in the pulmonary blood volume, pulmonary venous pressures again causing an increase in the hydrostatic pressure gradient, and edema formation. the legitimate question of whether our patient had a history of underlying heart or lung disease may arise. he denied any history of heart or lung disease, and as mentioned previously, he had a very good functional status. the acute onset of airway obstruction at the time of extubation, followed by desaturation, was more consistent with the clinical picture of nppe. the concurrent development of hypoxemia during nppe triggers hypoxic pulmonary vasoconstriction and raises pulmonary vascular resistance, thus increasing transmural hydrostatic pressures. as the right ventricular volume increases, the interventricular septum may shift leftward, indicative of reduced left ventricular diastolic compliance. simultaneously, this negative intra - pleural pressure also has a direct depressing effect on the cardiac output by increasing the cardiac afterload. the cardiac afterload is also increased secondary to hypoxia - induced systemic and pulmonary vasoconstriction. the increase in afterload, in combination with hypoxemia of the myocardial muscle, leads to a decrease in the left ventricular function, which in turn increases pulmonary venous pressure and further aggravates the pulmonary edema. the second theoretical mechanism of pathogenesis involves the loss of capillary integrity, leading to increased capillary permeability and edema formation. the extreme elevation in transmural pressure causes mechanical stress on the alveolar capillary membrane, leading to the transudation of erythrocytes into the alveoli, a process termed as stress failure.[2830 ] alveolar hemorrhage, the hallmark of capillary failure has been documented by bronchoscopy and bronchoalveolar lavage during the episodes of nppe. the classic descriptions of serosanguinous or pink frothy secretion observed in our case as well as several other case reports, indicate that this mechanism may be important in the pathogenesis of nppe. negative pressure pulmonary edema is characterized by a rapid onset (within minutes) and a relatively quick resolution, with significant clinical and radiographic improvement in 12 to 24 hours. nppe, if recognized and treated early, is usually a self - limited condition and is reversible. removal of the obstructive event and maintaining patent airway and oxygenation should be the initial steps. nasal bi - level positive airway pressure, mask continuous positive airway pressure (cpap), and intubation and ventilation with positive end - expiratory pressure (peep) have been used successfully. in this case we chose cpap because the patient did not fail to ventilate, but was hypoxemic. however, it has been demonstrated that both biphasic intermittent positive airway pressure (bipap) and cpap are effective modalities for treating patients with acute pulmonary edema associated with hypercapnea. this was because the primary problem was not fluid overload, but interstitial fluid shifts, induced by the negative intrathoracic pressure. if the patient was euvolemic, diuretic treatment was usually not required and most patients recovered quickly after the airway obstruction was resolved. diuretic therapy was an essential component in treating hydrostatic pulmonary edema, and it was also used in some patients with acute lung injury. another complicating factor in our patient was that he had a septic focus, and therefore, had an increased risk for septic shock and had just undergone surgery. as his chest radiogram failed to improve as expected, and the patient was still requiring cpap support on postoperative day three, furosemide was cautiously given. it did improve his oxygenation, and was therefore continued for an additional 24 hours. bronchodilators were often used and were shown to be beneficial (our patient was treated with albuterol nebulization). patients with nppe could have wheezing secondary to interstitial edema - induced narrowing of the bronchial lumina. in vitro and in vivo studies in human and animal models had shown that beta agonists could increase the rate of alveolar fluid clearance via increased active cation transport, which accelerated the regression of symptoms of pulmonary edema. the theory of vascular leak and the use of diuresis in patients with acute lung injury was tied to this case. demonstrated that when a critical volume of fluid collected interstitially, alveolar flooding commenced. here, we administered a diuretic on the third day to improve oxygenation, with good result, after three days of cautious observation. in a patient developing acute onset of perioperative pulmonary edema, other causes of pulmonary edema should be considered. the differential diagnosis should include cardiogenic edema, neurogenic edema, aspiration pneumonitis, acute respiratory distress syndrome (ards), pulmonary embolism, anaphylaxis, drug - induced non - cardiogenic pulmonary edema, and postoperative residual curarization. in nppe, an increase in extravascular lung water decreased the compliance and increased shunting. our patient was on a spontaneous mode of ventilation, and prior to that had received high doses of narcotics intraoperatively. he had no history of cardiac pathology in the past and had a good functional status, and his electrocardiogram was normal. there were no other features of anaphylaxis. as he had a rapid onset of bilateral diffuse infiltrates on chest x - ray, aspiration pneumonitis was unlikely. postoperative residual curarization was also identified as one of the risk factors for upper airway obstruction, as it typically impaired the upper airway dilator muscle strength, while preserving inspiratory muscle function. this patient did have an increased risk for acute lung injury (ali) or ards, secondary to his underlying infectious process. patients with nppe can develop diffuse alveolar injury through damage to the pulmonary capillaries by mechanical disruption of the alveolar - capillary membrane. many of these patients may fulfill the clinical, physiological, and radiographic criteria for ali / ards. his pao2/ fio2 was indeed < 200 and his chest x - ray did show bilateral infiltrates. however, he did not develop bacteremia, he did not develop septic shock, and he was oxygenating adequately throughout the case. the current case illustrates the development of nppe as a complication of intermittent obstruction of lma upon emergence from general anesthesia. the favorable outcome was likely due to early recognition and appropriate nppe - directed therapy. the majority of the cases of nppe in the literature are in association with endotracheal tube use, and the incidence in association with lmas seems low. however, some patients emerging from anesthesia (especially in the second stage) have a tendency to bite on the airway, and if this obstruction is not relieved promptly, nppe may develop. the increasing use of lmas in the administration of anesthetics will provide more scenarios where nppe can manifest. we encourage our colleagues to be vigilant in the recognition of nppe, while using an lma, and to be aware of the treatment modalities available to them, as well as the differential diagnoses involved when such a scenario is encountered. | negative pressure pulmonary edema (nppe) following the use of the laryngeal mask airway (lma) is an uncommon and under - reported event. we present a case of a 58-year - old male, who developed nppe following lma use. after biting vigorously on his lma, the patient developed stridor upon emergence, with concurrent appearance of blood - tinged, frothy sputum and pulmonary edema. he subsequently required three days of mechanical ventilation. after discontinuation of mechanical ventilation the patient continued to require additional pulmonary support using continuous positive airway pressure, with a full facemask, to correct the persistent hypoxemia. his roentgenographic findings demonstrated an accelerated improvement with judicious administration of intravenous furosemide. |
about a decade ago most healthcare professionals had never heard the term human factors. even today it is still not as familiar to many clinicians as most human factors experts would like to think. nevertheless significant progress has been made in human factors science as well as in applications of human factors concepts aimed at healthcare improvement. but, as russ and colleagues suggest in a recent article, this may be based on widely held misconceptions of human factors concepts and approaches. russ and colleagues discuss a number of fictions about human factors some of which may arise from the channels through which human factors science was introduced to healthcare (e.g. frequently using experts working in an environment heavily influenced by human factors research such as aviation to teach healthcare providers about human factors concepts rather than human factors scientists). stepping back, these misconceptions may also signal some of the specific challenges that will have to be addressed in taking human factors expertise forward in healthcare and they may provide learning opportunities for human factors experts. in his editorial to the article by russ and colleagues, catchpole puts his finger on a sore spot for many human factors experts by stating : if we wish healthcare to be fundamentally changed by hf (human factors), we must also expect hf to be changed by healthcare. collaboration between clinicians and hf professionals, with each shaping the views of the other, will develop and extend the use of hf for the unique demands of healthcare. following up on this thought of how key characteristics of healthcare might inspire change in human factors science this paper discusses the challenges of overcoming fragmentation of care. research and intervention efforts aiming to understand and mitigate the effects of fragmentation of care on patient safety frequently focus on patient handover. using examples of recent handover research we argue that the predominant research strategy is to focus on isolated handover episodes. this approach may actually hinder the development of an integrative framework that is urgently needed to effectively manage the risks associated with today s fragmentation of care. instead it is a call to start a discussion of current areas of healthcare human factors that might benefit from a critical reflection of the predominant approach to research and improvement. because the examples used to illustrate the need for such a discussion are drawn from handover research, the discussion will only cover selected aspects of fragmentation and additional or different challenges may be present in other areas of healthcare human factors. nevertheless, we believe that this paper may inspire critical reflections of the blind spots inherent in certain research approaches used when addressing patient safety problems. in the future, these reflections might make a unique contribution to moving the field forward. healthcare organisations around the world manifest striking fragmentation and turbulence that impede their capacity to provide high quality care, to assure and improve patient safety, and retain the skilled professionals critical to both. within hospitals, where the most acutely ill patients are treated and the greatest portion of healthcare costs are accrued, communication issues are among the most frequent contributory factors of adverse events. it has consistently been shown that communication is particularly vulnerable at organisational interfaces where handover occurs. handovers permeate the healthcare system and can occur at shift changes, when clinicians take breaks, when patients are transferred within or between hospitals, and during admission, referral or discharge (figure 1). one study estimated that approximately 1.6 million handovers occur per year in a typical teaching hospital. thus, handover communication at different levels of the organisation presents a major challenge for human factors research and interventions aiming at improved patient safety. in terms of the organisational interfaces where handovers have been studied, most studies have investigated care transitions between healthcare organisations (admission and discharge), handovers during shift changes of nurses or physicians handovers in hospital settings where multiple patients are handed over within the same profession., intra - hospital transitions, or handovers of single patients between departments / units frequently involving different specialties and/or professions, have received far less research attention. however, these interfaces also contribute significantly to the fragmentation of care because the responsibility for the patient and for the continuity of care is shared by many healthcare providers. handover is defined as the transfer of professional responsibility and accountability for some or all aspects of care for a patient, or groups of patients, to another person or professional group on a temporary or permanent basis aiming at informational, relational and management continuity in patient care. with an increasing number of studies tracing the causes of adverse events and delays in treatment to inadequate handover and coordination of care,, thus, handover has repeatedly been identified as a priority area for patient safety research and improvement., this has led to an increase in initiatives aimed at raising awareness and political commitment to improve handover. for example, effective handover is a patient safety goal that has recently been included in hospital accreditation in australia. also, prevention of handover error is one of the five solution areas of the high 5s initiative, a mechanism established in 2006 through collaboration between the commonwealth fund, the who world alliance for patient safety and the who collaborating centre for patient safety, to implement innovative patient safety solutions over five years. as a consequence, handover research in healthcare in fact, the claim that healthcare is lagging behind other high - risk industries in which handover has received considerable attention from human factors research for many years can no longer be made. recent research in healthcare has highlighted the complexities of handover that have not yet been acknowledged by other industries. now may be the time to pause and consider if the approaches applied by human factors researchers may have missed a critical element. the goal of any handover is the transfer of primary responsibility for the patient and of information necessary for continuing safe patient care across organisational interfaces., this may include information that is not needed immediately but at a later stage in the care process and thus needs to be remembered and transmitted when required. the handover can occur written, verbally or both and should ideally be a moment of shared cognition between clinicians providing opportunities for collaborative cross - checking., handover research usually focuses on the information transfer aspect and investigates a single type of handover occurring at a specific interface within the care process. in so doing, studies mostly use idiosyncratic measures limiting the comparability of findings and the generalizability of recommendations for improvement. thus, while the research activity on handover has increased significantly in healthcare, it seems that the methodological approaches taken so far replicate the problem of fragmentation of care rather than solve it. in reviewing the handover literature for research methods, six frequently used approaches can be identified across various clinical settings and sometimes combined in a single study : general clinician self - assessment of handover practice using surveys, interviews or focus groups, clinician self - assessment after a specific handover episode, behavioural observation during handover,, including ethnographic field - study approaches, retrospective adverse event studies and observational and experimental effect studies. while the studies using this rather broad range of methodological approaches have significantly contributed to an improved understanding of factors impacting on safe handover, there is a lack of a common framework integrating these approaches into a coherent set of analytical techniques. firstly, studies using different methods for investigating handovers at the same organisational interface have often generated contradictory results. a common framework would facilitate the detection and interpretation of such contradictions and potentially allow for choosing the analytical techniques most appropriate for a particular type of handover occurring at a particular organisational interface. secondly, handover occurs many different forms at many different times during a patient s journey through the hospital (figure 1). therefore, measurement approaches need to reflect the interrelatedness of handover episodes throughout the continuum of care. in recent years, first studies have attempted to incorporate a more process - oriented approach to handover., these attempts can be broken down into a clinician centred approach and a process- or patient - oriented approach. the clinician centred approach was used in a study of clinician workflow surrounding the handover in a medical intensive care unit. the focus here was on the preparatory tasks by the outgoing staff before the handover and the tasks to be done by the receiving staff after the handover. focusing on the continuum of surgical care, another study followed patients throughout the perioperative setting and recorded all handovers during that period. although this study covered only a limited period of the care process and was narrowly focused on completeness and accuracy of information transmission, it can serve as a basic model for a more comprehensive analysis of safe handover along the care path. based on the evidence of information loss and idiosyncratic handover practices at many organisational interfaces within healthcare, handover improvements have been suggested that focus on a standardisation of handover content and sometimes provide procedural support using a basic handover structure.,21, despite the widespread use and the intuitive plausibility of standardised handover protocols, for example, the empirical evidence on their effects beyond mere adherence to the protocol (i.e. effects on subsequent patient care) is scarce. while medical research relies heavily on randomized controlled trials to establish scientific evidence, it is surprisingly uncommon to test and refine organisational interventions systematically before implementing them in the clinical setting. few studies have tried to link process characteristics such as handover structure with outcome measures such as retention of patient care information, uncertainty during patient care decisions, a need to obtain information from other sources and repetition of clinical tasks. overall, the available evidence is not sufficient to draw reliable, valid conclusions because of the heterogeneity of organisational interfaces and handover protocols used in these studies. more specifically, it is unknown which component of standardisation efforts (e.g. clear distribution of roles, separation of clinical tasks and handover communication, checklist of items to be discussed, general structure of the handover communication) has which effect. moreover, dismissing other interventions that have not been studied extensively prematurely may be a missed opportunity for patient safety improvement. the scientific discipline of human factors strives for a holistic approach to understanding and solving problems that highlights relationships and interactions and thus departs from the out - dated reductionism that decomposes wholes into individual elements. but do we really walk the talk ? while there is much rhetoric about the importance of handover for the continuity of care, handover research has mainly focused on isolated handover episodes at single organisational interfaces. the limited consideration of the embeddedness of handover in the overall process of patient care has led to problems concerning : i) idiosyncratic measurement approaches, i.e. measures that are tailored towards a specific handover episode and do not necessarily allow for comparison across different organisational interfaces that may involve handover of individual or multiple patients ; ii) fragmented research evidence, i.e. descriptions of a heterogeneous spectrum of handover episodes without systematic characterisation of the handover context that could provide a frame of reference for comparing and integrating research evidence, and iii) narrowly focused intervention strategies, i.e. strong push towards standardisation of handover communication without convincing evidence or scientific understanding of the contribution of the individual components of a standardisation effort. in summary, the focus of current handover research on isolated handover episodes is too narrow to truly understand the impact of handover on the continuation of safe patient care while the patient transitions a series of organisational interfaces. thus, the current research strategy may even reinforce a fragmented view of patient care instead of providing scientific evidence to effectively bridge the potential gaps along the care path. if we design handover episodes based on studies that did not consider the embeddedness of this specific handover in the process of care and in the associated succession of handovers, the impact of this intervention is bound to be very limited. there are several ways in which a patient - centred research strategy might change the study of patient handover. for example, extending the focus of analysis beyond the actual handover meeting can provide additional information on factors contributing to safe care. currently, the evaluation of handover quality defined as complete and accurate transfer of information occurs immediately after the handover is complete. but two hours later or at the end of the shift the evaluation of that very handover might generate different evaluations. also, if the handover and the corresponding evaluation of handover quality was tailored to the goal of transferring the information required by the next care provider for effectively and safely carrying out their tasks, it may not address the needs of the clinicians involved in later stages of the care process. one possible way to overcome this fragmentation is to develop a patient - centred research strategy focussing on the interdependencies of handover episodes during a series of transitions occurring along the typical care path. such a framework would facilitate an exploration of issues concerning the timing and synchronisation of various handover channels at interfaces. it could also serve as a foundation for a methodological approach for assessing handover systematically along the care path as well as for an integrative strategy to develop and test interventions spanning across organisational boundaries. if we consider the simplified overview of handers occurring along typical care paths in figure 1, a multitude of methodological and practical challenges come to mind. collecting information on a series of handovers related to a single patient using a combination of methods such as chart reviews, observations, clinician self- and peer - assessments will generate huge amounts of data that need to be interpreted within a common framework. moreover, designing the instruments for data collection and deciding on the timing of data collection and the allocation of researchers for collecting data requires a high level of pre - existing understanding of each handover episode. last but not least, the feasibility of such a study design will depend on balancing researcher availability at the time and location of a given handover and the need for knowledge about previous handovers (e.g. to detect omissions of previously discussed items). despite the challenges associated with developing and implementing such a framework, the development of a patient - centred research strategy has the potential to significantly influence future handover research. in addition to large scale projects aiming at understanding the interdependencies of handover episodes along the care path, an overarching framework can also be applied when isolating research questions for small scale projects and allows for acknowledging the wider system when interpreting the results of these more focused studies and when designing interventions. an integrative framework of handover episodes along the care path is urgently needed to effectively manage the risks associated with today s fragmentation of care and to develop scientific methods for systematically assessing the needs for, and the effects of, patient safety solutions. this will result in novel insights into safe handover that will lay the foundation for optimising the continuum of care across the multiple organisational interfaces patients encounter, as part of their journey through a hospital. | the integration of human factors science in research and interventions aimed at increased patient safety has led to considerable improvements. however, some challenges to patient safety persist and may require human factors experts to critically reflect upon their predominant approaches to research and improvement. this paper is a call to start a discussion of these issues in the area of patient handover. briefly reviewing recent handover research shows that while these studies have provided valuable insights into the communication practices for a range of handover situations, the predominant research strategy of studying isolated handover episodes replicates the very problem of fragmentation of care that the studies aim to overcome. thus, there seems to be a need for a patient - centred approach to handover research that aims to investigate the interdependencies of handover episodes during a series of transitions occurring along the care path. such an approach may contribute to novel insights and help to increase the effectiveness and sustainability of interventions to improve handover.significance for public healthwhile much of public health research has a preventive focus, health services research is generally concerned with the ways in which care is provided to those requiring treatment. this paper calls for a patient - centred approach to research on patient handover ; a significant contributor to adverse events in healthcare. it is argued that this approach has the potential to improve our understanding of handover processes along the continuum of care. thus, it can provide a scientific foundation for effective improvements in handover that are likely to reduce patient harm and help to maintain patient safety. |
it is acquired by the consumption of raw or uncooked pork products containing encysted larva. arthralgias and cardioneurological symptoms occur rarely, but the parasite has not been known to directly infect the bone. pyomyositis is primary infection of the skeletal muscle, usually caused by staphylococcus aureus, and is endemic in tropical areas. to our knowledge, this article presents a rare case of human trichinellosis in india, which predisposed to pyomyositis and secondary osteomyelitis. we also discuss in detail the pathogenesis of such a condition and discuss the role of imaging modalities and an early magnetic resonance imaging (mri) to diagnose the condition and start an early treatment. a 12-year - old female child from indian gangetic belt presented with complaints of fever and pain in right thigh since 3 weeks. fever which responded to antipyretics was of moderate degree with documentation not more than 101f. two days after the onset of fever, the patient had reported pain and swelling in right distal thigh, with restricted movement of right knee due to pain. on further direct questioning, the patient gave a history of patchy red rash over the front and medial aspects of thigh on the 2 day that lasted for around 68 hours. there was neither a history of trauma or photosensitivity nor any symptomatology localizing to respiratory, urinary or central nervous system. further probing confirmed absence of any antibiotic treatment for fever till the time of admission. the patient hailed from a low socioeconomic background, was a non - vegetarian and occasionally used to consume pork. the patient had consumed hamburger in the past 1 month, following which she had an episode of diarrhea, dyspepsia and myalgia for 4 days. but the episode was self - limiting and the patient improved on her own without taking any medications. however, none of the relatives of the patient or any other person in the region had reported similar complaints. on examination, tenderness in the right thigh reaching up to the knee joint with a mild local rise in temperature was found. however, systemic examination including examination of other joints was found to be within normal limits. x - rays of the right femur revealed grossly normal bony architecture but altered soft tissue shadows in the surrounding thigh musculature [figure 1 ]. a finding of eosinophilia led us to investigate for the serological markers of various parasitic infections. an ultrasound done at the same time revealed bulky and heterogeneous deep muscles of the posterolateral aspect of mid and lower thigh with a multiloculated fluid collection suggestive of myositis. this was followed by an mri [figure 2 ] that was done 2 weeks later which highlighted signs of acute osteomyelitis of lower end of femur with large collection of abscess in deep posterolateral aspect of thigh along with infiltration of adjacent muscles. x - rays of the patient at presentation, showing grossly normal bony architecture mri of lower end of femur suggestive of acute osteomyelitis with large collection of abscess in deep posterolateral aspect of thigh along with infiltration of adjacent muscles a serous discharge was obtained on needle aspiration, which on microscopy showed occasional pus cells ; however, gram stain, acid - fast bacilli (afb) and culture sensitivity were found to be negative. nevertheless, a provisional diagnosis of acute osteomyelitis was kept and the patient was taken up for debridement and corticotomy. intraoperatively, the muscles appeared to be edematous, bulky and unhealthy with minimal seropurulent discharge. the entire area was drained and tissue specimens were harvested intraoperatively for histological and microbial evaluation. a detailed microbial workup revealed findings summarised in table 1 : results of microbiological work - up histopathologic examination of muscle biopsy revealed parasitic infection with esosinophilic infiltrates, and a possibility of parasitic cyst was kept on the basis of histological findings [figures 3a c ]. considering the isolation of trichinella larvae as reported by the pepsin digest muscle biopsy study and a histological and laboratory picture suggestive of parasitic infestation, a diagnosis of trichinella predisposing to bacterial pyomyositis was made.considering the high prevalence of staphylococcal pyomyositis and osteomyelitis, the patient received 4 weeks of empirical intravenous cloxacillin along with ceftriaxone following surgical drainage and debridement. oral mebendazole in a divided total dosage of 600 mg per day was given for a period of 14 days to cover for the trichinella infection.the patient 's general condition improved and fever subsided gradually over 1 week. early range of motion at knee and mobilization with full weight bearing was initiated immediately after the surgery. follow - up after 6 months showed the patient to be disease free with no complaints in playing or carrying out her day - to - day activities. histopathologic examination of muscle biopsy revealed parasitic infection with esosinophilic infiltrates, and a possibility of parasitic cyst was kept on the basis of histological findings [figures 3a c ]. considering the isolation of trichinella larvae as reported by the pepsin digest muscle biopsy study and a histological and laboratory picture suggestive of parasitic infestation, a diagnosis of trichinella predisposing to bacterial pyomyositis was made. considering the high prevalence of staphylococcal pyomyositis and osteomyelitis, the patient received 4 weeks of empirical intravenous cloxacillin along with ceftriaxone following surgical drainage and debridement. oral mebendazole in a divided total dosage of 600 mg per day was given for a period of 14 days to cover for the trichinella infection. early range of motion at knee and mobilization with full weight bearing was initiated immediately after the surgery. follow - up after 6 months showed the patient to be disease free with no complaints in playing or carrying out her day - to - day activities. (a) the microphotograph showing a fibrocollagenous tissue with extensive small blood vessel and capillary dilatation as well as congestion. (b) one of the portions of the same tissue showing predominantly a lymphomononuclear inflammation admixed with some polymorphs and debris. after an extensive workup, our case was narrowed to a differential diagnosis of either acute hematogenous osteomyelitis with secondary pyomyositis or an unusual manifestation of trichinella predisposing to pyomyositis and secondary osteomyelitis. the prevalence of staphylococcal osteomyelitis in children in tropical countries points toward bacterial etiology. however, in our case, the child never received any antibiotics prior to admission and neither were we able to isolate any bacteria in culture studies. the serous nature of the pus drained in this case was also not typical of bacterial pathology which presents with frank pus. studies have reported that in almost 30% of cases of osteomyelitis with secondary abscess, no organism is isolated on cultures, and the likely reason for this is believed to be the low standards of laboratory facilities in tropical areas. however, our patient presented to a tertiary center institute with state - of - the art laboratory facilities and isolation techniques. this led us to postulate trichinella as one of the possible etiologies in the case. although a western blot analysis performed at this stage could have been confirmatory, this was not done by us and our diagnosis primarily rested on the isolation of trichinella larvae in the pepsin digested muscle biopsy study. we believe that this is one of the very rare instances when such an atypical presentation of trichinellosis causing pyomyositis with secondary osteomyelitis has been reported. bennet. in 1928 reported a case of sclerosing osteomyelitis caused by trichinellosis, while steel. in 1964 reported osseous complaints and myoperiosteal larval infiltration by trichinella. trichinellosis, also called trichinosis or trichiniasis (trich from greek thrix meaning hair), is an infestation caused by nematodes of the genus trichinella, most commonly t. spiralis. newborn larvae penetrate the intestinal wall, enter the lymphatic system, and move via the bloodstream to areas of implantation. the larvae travel by capillaries to various organs such as the retina, myocardium, or lymph nodes ; however, only larvae that migrate to skeletal muscle cells survive and are encysted. once in the cell the development of a capillary network around the nurse cell completes the encystation of the larvae. the symptoms in the enteric phase include those of dyspepsia, diarrhea, nausea, and heartburn. in the parenteral phase, the body 's inflammatory response results in edema, muscle pain, fever, and weakness. cardioneurologic symptoms consisting of encephalopathy, focal deficits and myocarditis represent the severe life - threatening forms which occur very rarely. in the heart, acute inflammatory changes are found during the early stages in the form of a patchy but scattered interstitial myocarditis ; however, the larvae do not encyst within the myocytes. invasion of cns is reflected by a diffuse lymphocytic and monocytic infiltration in leptomeninges and development of focal gliosis. diagnosis of trichinellosis in a person assumes high significance considering the potential of the parasite to cause multiple outbreaks and epidemics. it is very important to be sure that the patient is the single human case reported. also, it is equally important to trace the origin of infected meat and possible worm burden. to our knowledge, our patient was the only case of trichinellosis reported in the area during that time interval. considering that the diagnosis of trichinellosis was delayed, it was not possible for us to trace the source of infected meat. pyomyositis denotes an abscess of skeletal muscle that occurs either spontaneously, as in primary pyomyositis, or secondary to a penetrating injury or local spread from an adjacent soft tissue or bone. primary myositis is also termed tropical pyomyositis, myositis tropicans, tropical skeletal muscle abscess, and tropical myositis. although the classical presentation is with muscle abscess, the hallmark of the disease is not an abscess but a finding of myositis on the biopsy specimen of involved muscle. trauma, immunological disorders and parasitic infestation have all been postulated to favor primary pyomyositis. less common causes include groups b, c, and g streptococci, pneumococci, haemophilus influenzae, aeromonas hydrophila, fusobacterium sp., bartonella sp., gram - negative enteric flora, and anaerobes. although rare, tuberculous and nontuberculous mycobacterial pyomyositis has also been described in individuals who are immunocompromised. there are also occasional reports of salmonella and gonococci as causative organisms, usually secondary to disseminated infections with these bacteria. parasitic (filaria, nematodes) and viral causes (hiv, herpes, picorna virus, arena virus, arbo virus) have also been reported. human trichinellosis has been rarely reported from india. a review of literature revealed only two such case reports from india. in fact, we believe that most of the physicians in india are practically unaware of the condition due to its rarity. as such the aim of our report is to spread awareness amongst the indian physicians regarding the existence of this entity. in our patient, trichinellosis with pyomyositis followed by secondary involvement of bone seems to be a logical explanation for the order of events. the child presented to us late and hence we do not have initial imaging to suggest any such evolution. but considering that the primary predilection for trichinella is muscle tissue and that presentation was delayed by almost 3 weeks, osteomyelitis seems secondary to pyomyositis. there are varying reports in the literature where osteomyelitis had evolved as a complication of pyomyositis. the underlying causes for such an association might include a delay in treatment, immunosuppression and atypical organisms causing the disease. in our patient, x - rays obtained around 3 weeks after the onset of symptoms failed to show any features of osteomyelitis, although soft tissue changes suggestive of pyomyositis were present. however, after another 10 days, the mri showed acute osteomyelitis with pus collection in muscles. this further points toward secondary involvement of bone in our patient as initially the x - rays were normal. if pus was secondary to osteomyelitis, the x - rays would have shown signs of osteomyelitis. osteomyelitis as a differential diagnosis for pyomyositis is often described in literature, but there are very few reports of pyomyositis leading to secondary osteomyelitis. in one study by block., 8 of the 11 patients with staphylococcal pyomyositis developed osteomyelitis as a complication. in another study by chiu., 5 out of 24 patients with bacterial pyomyositis were seen to develop secondary osteomyelitis. first, osteomyelitis developed as a complication of pyomyositis, and second, trichinellosis appeared to be a predisposing factor to primary pyomyositis. it is well documented that parasitic infestations with filaria and toxocara predispose to pyomyositis, but trichinella infection predisposing to primary pyomyositis is being reported for the first time. the diagnosis of trichinellosis is supported by the positive serology for igm and the larval findings in pepsin digested muscle specimen. since we did not do the western blot analysis, we believe that the diagnosis was only highly suggestive and not fully proven. however, there is no microbiological evidence for the etiological agent for pyomyositis in our case as bacteriological workup was inconclusive. although primary trichinella pyomyositis could be considered as a possible diagnosis, such a condition seems highly unlikely considering the fact that pus formation is unusual in the course of trichinellosis. moreover, we do not have an evidence to demonstrate trichinella in bone specimen as causative for osteomyelitis. in the literature, baring a few isolated cases, secondary bone involvement by trichinella has not been reported in detail. usually, x - ray features of osteomyelitis appear by the 2 week of onset of complaints. we believe that mri is an important modality that helps in picking up early involvement of bone secondary to pyomyositis. in fact, serial mri would be an ideal way to see for any evolution of pyomyositis into osteomyelitis. from our experience, we advocate the use of mri in cases where an abscess is located adjacent to bone. isotope bone scans may be performed if mri is not available. however, mri is more sensitive and is also a superior imaging modality for showing the anatomical details. human trichinellosis has been reported very rarely from india and many physicians in the region are practically unaware of this entity. further, trichinella predisposing to pyomyositis and then evolving into secondary osteomyelitis is a rare atypical presentation not described much in the literature. negligence and late presentation in our patient led to the development of osteomyelitis secondary to pyomyositis. we believe that an initial mri is the diagnostic modality of choice to make an accurate diagnosis at an early stage. an early diagnosis will in turn avoid progression of the disease and reduce the associated morbidity due to further complications. | trichinellosis is a parasitic infestation affecting the skeletal muscles. cases of trichinellosis in humans have been reported from most regions of the world. however, a review of literature revealed only two reported cases of human trichinellosis in india. further, a diagnosis of superimposed pyomyositis in trichinellosis with secondary osteomyelitis has not been reported to our knowledge. this article reports this rare case presentation in a 12-year - old child. timely intervention helped prevent long - term morbidity in our patient. in our case report, we also discuss in detail the pathogenesis of such a condition and discuss the role of imaging modalities and an early magnetic resonance imaging (mri) to diagnose the condition and start an early treatment. |
the intermolecular amidoalkylation reaction is a very useful carbon carbon bondforming process in organic chemistry.1 it has been widely applied to the stereocontrolled functionalization of nitrogen heterocycles, as the reaction of the cyclic nacyliminium ion intermediates, generated in situ, is usually highly diastereoselective.2 the possibility of using a broad variety of nucleophiles3 confers upon the reaction a very wide scope, and it has been employed in natural product and pharmaceutical syntheses.4 in recent years, the enantioselective amidoalkylation reaction using organocatalysis has emerged as a powerful method for the synthesis of enantioenriched compounds possessing tertiary or quaternary stereogenic centers.5 the most important developments in this area have focused on enantioselective friedel craftstype reactions.6 in particular, a number of reports have addressed the application of chiral hydrogenbond donors (ureas and thioureas)7 and chiral brnsted acids (cbas) (binolderived phosphoric acids)8 to the asymmetric intermolecular amidoalkylation reaction9 of nucleophiles, mainly electronrich heteroaromatics such as indoles and pyrroles10 with cyclic nacyliminium ions. however, limitations remain on the applicability for tertiary nacyliminium ions (i.e. ketonederived iminium ions), which can lead to synthetically important derivatives with chiral quaternary carbon centers, presumably owing to the low reactivity of ketimines and the more difficult control of facial selectivity.11 in this context, we have reported12 the first example of an enantioselective amidoalkylation of indoles with bicyclic hydroxylactams for the generation of a quaternary stereocenter in the preparation of 12 bsubstituted isoindoloisoquinolines (ee up to 95 %) by using binolderived brnsted acids. the amidoalkylation reaction occurs through the formation of a chiral phosphate / bicyclic quaternary nacyliminium ion pair. there was experimental evidence to propose that hydrogenbonding interactions of the phosphateionpaired intermediate to the indole nh could potentially be involved. hence, the binolderived phosphoric acid would be acting as a bifunctional catalyst,13 interacting also with the nucleophile. more recently, the same methodology has been applied by li and coworkers14 to the functionalization and preparation of isoindolocarbolines, generally with high enantioselectivities (up to>99 % ee). the potential of this type of hydroxylactam in stereochemical control has previously been demonstrated in transfer hydrogenation15 and alkenylation16 reactions. in the latter case, the presence of a hydroxyl group in the nucleophile, an ohydroxystyrene, was crucial for the generation of a hydrogen bond with the chiral phosphoric acid catalyst. in a similar way, in the asymmetric organocatalytic azafriedel crafts reaction of ketimines with naphthols / phenols catalyzed by quininesquaramide catalysts, the formation of a hydrogen bond between the phenolic oh and the tertiary amine moiety of catalyst is proposed to explain the stereochemical outcome of the reaction.17 on the other hand, a chiral phosphoric acidcatalyzed enantioselective alkylation of enamides with indolyl methanols18 and 3hydroxyoxindoles19 has been reported, and its utility demonstrated in the total synthesis of ()folicanthine. in this context, we decided to evaluate enamides 2 with a free nh group in the enantioselective amidoalkylation reaction with bicyclic hydroxylactams 1 derived from phthalimides, using chiral phosphoric acids as brnsted acid catalysts (scheme 1). this would allow the enantioselective formation of a quaternary stereocenter at the c1 position of the tetrahydroisoquinoline unit of the isoindoloisoquinoline skeleton. it should be pointed out that tetrahydroisoquinoline is a privileged heterocyclic core present in many biologically active natural products and pharmaceutical drugs.20 for example, c1 indol3yl substituted 1,2,3,4tetrahydroisoquinoline isa2011b (figure 1) was found to have a potent inhibitory effect on proliferation in various types of aggressive cancer cell lines (for the treatment of advanced prostate cancer).21 the isoindole motif is also a crucial structure in a number of molecules with pharmaceutical properties,22 such as (s)pazinaclone or (s)pagoclone, and c(3)substituted isoindolinones that are central nervous system (cns) active drug candidates.23 therefore, the development of new synthetic methods for the asymmetric synthesis of these heterocycles continues to be an intensely investigated field.24 besides, alkaloids with the isoindolo[2,1a]isoquinoline skeleton, such as hirsutine, jamtine, and nuevamine,25 combine the structural features of both skeletons and also display a wide spectrum of biological activities. in fact, isoindoloisoquinolinone crr271 has been reported to inhibit parp1 activity and protect cells against oxidative dna damage, which could be implemented in the treatment of inflammatory diseases.26 catalytic enantioselective intermolecular amidoalkylation reactions on the basis of our previous report, we initiated this study by evaluating the reaction of hydroxylactam 1 a with enamide 2 a to obtain enantioenriched 3 aa (table 1). phosphoric acids 4 a e and ntriflylphosphoramides 5 a h were tested at room temperature in thf.12 significant differences in both reactivity and enantioselectivity were observed. phosphoric acid 4 a was the most reactive, affording 3 aa in good yield (70 %) after 24 h, but with no enantioselectivity (table 1, entry 1). on the contrary, no reaction was observed with 4 b after 72 h (table 1, entry 2). the best enantioselectivity was observed when 4 d was used, although the yield was poor (table 1, entry 4). ntriflylphosphoramides are known to have an increased acidity, and may lead to the formation of tighter ion pairs.27 indeed, 5 a h proved to be more reactive, affording significantly higher yields and reducing the reaction time to 5 h in most cases (table 1, entries 613). the reaction time was extended, with no significant improvement in enantioselectivity (table 1, entry 9). it is important to note the different performances of catalysts 4 d and 5 d, which have the same substitution pattern on the aromatic backbones. although 5 d was more reactive, an unexpected drop in the enantioselectivity (49 vs. 4 %) was observed. highly hindered (r)vapolderived phosphoric acid 6 28 or multidentate disulfonimide 7 29 afforded good reactivity, but low enantioselectivity (entries 15 and 16), whereas taddolderived phosphoric acid 8 30 was not reactive (entry 17). a subsequent optimization of the reaction conditions was carried out by using catalyst 4 d, which had afforded the highest ee (49 %). both the reactivity and the enantioselectivity were improved when the reaction was performed at 40 c (table 2, entry 1). besides, this enantioselectivity could be improved through a single crystallization to 84 % ee. the use of an excess (3 equiv) of 2 a significantly lowered the yield and enantioselectivity (entry 2), probably owing to selfcondensation of the enamide,31 whereas the use of molecular sieves to remove the water formed in the reaction did not improve the results (entry 3). at higher temperature, the results were similar, but the reaction time was reduced (entry 4). the change of the solvent to dioxane afforded 3 aa with similar enantioselectivity, but lower yield (entry 5). the best yield was obtained when the reaction was performed in dichloromethane at reflux (95 %, entry 7). in related chiral phosphoric acidcatalyzed reactions, it has been shown that the formation of ion pairs is favored in ch2cl2 over thf, although it was found that the degree of ionpair formation does not correlate with the enantioselectivity.32 the use of toluene provided similar results to those obtained in thf (entry 9), and again further increase of the temperature was detrimental (entry 10). thus, enamides 2 b d were prepared33 and reacted with hydroxylactam 1 a by using phosphoric acid 4 d or triflamide 5 c as catalysts in thf (table 3). the electronic nature of the aromatic ring had a strong influence on the reactivity, as no reaction was observed with 2 b (entry 1), whereas a good yield was obtained with electronrich 2 c, although with no increase in the enantiomeric purity (entry 2). the effect of the acyl terminus of the enamide was also checked, but the corresponding benzamide 2 d did not improve the enantioselectivity when using 4 d or 5 c (table 3, entries 4 and 5 vs. table 2, entry 9 and table 1, entry 8). [b ] determined by chiral stationary phase hplc. [c ] 3 equiv of 2 a were used. [b ] determined by chiral stationary phase hplc. [c ] no reaction. thus, the absolute configuration was unambiguously assigned by singlecrystal xray analysis of 3 aa as r (see the supporting information).34 the formation of the r isomer in the reaction of 1 a with enamides is in consonance with our previous results for the amidoalkylation of indoles.12 thus, the sense of induction would be explained by the formation of an nacyliminium intermediate / chiral conjugatebase ion pair,35 as depicted in figure 2. thus, the chiral ion pair would be generated by protonation of the hydroxylactam. according to previously reported models,36 the acyliminium intermediate would be oriented avoiding the steric interactions with the catalyst 3 and 3substituents (r). on the other hand, a hydrogen bond with the enamide nh moiety could be proposed, which would orient the phenyl ring away from the catalyst, favoring the si attack of the nucleophile. we next studied the use of indolederived hydroxylactam 1 b in the reaction with enamide 2 a (scheme 2). the reaction of hydroxylactam 1 b under chiral phosphoric acid catalysis with different nucleophiles has been described previously.14, 15, 16 we thought that the chiral phosphoric acid may act as a bifunctional catalyst, coordinating not only to the enamide but also to the indole nh.37 indeed, when hydroxylactam 1 b was treated with enamide 2 a and phosphoric acid 4 d in thf at room temperature, the reaction was much faster, leading to a good yield of carboline 3 ba in just 5 h. unfortunately, the enantioselectivity was in the same range to that observed for 1 a. similar results were obtained when a catalyst with the opposite configuration [(s)4 d ] was used in dioxane.38 to check if the interaction of the enamide with the catalyst is really determinant, related reactions of hydroxylactams 1 a and 1 b were carried out using enol ethers 9 a and 9 b as nucleophiles (table 4). reaction with enol ethers 9 a and 9 b. [a ] yield of isolated product. [b ] determined by chiral stationary phase hplc. [c ] no reaction. [d ] (s) 4 d was used as the catalyst. enol ether 9 a was unreactive towards 1 a in thf and provided a very low conversion in dichloromethane (table 4, entries 1 and 2). in contrast, 1 b reacted with 9 a (table 4, entry 3), but the reaction was slower and less efficient than the reaction with the corresponding enamide 2 a, as depicted in scheme 2, though with the same degree of enantioselectivity (51 % ee). when enol ether 9 b was used, 3 bb was obtained with good enantioselectivity in toluene (86 % ee), though with a low conversion. these results show that, although coordination with the catalyst seems to be crucial for reactivity, there is not a direct effect on the enantioselectivity. as noted above, the enantioselectivity is especially sensitive to the nature of the nucleophile and the catalyst, as well as the experimental conditions. as shown, the introduction of a chlorine atom into the aromatic ring of acetamide 2 b precluded the reaction, whereas the use of benzamide 2 d reduced the enantioselectivity as compared to the acetamides. unfortunately, the optimal catalyst for 2 a led to poor enantioselectivities with the other enamides or enol ethers, and no obvious trends to improve the performance of these nucleophiles were qualitatively observed. the general catalytic cycle for this type of amidoalkylation reaction is now reasonably well established ; however, the key catalyst features and experimental conditions responsible for enantioselection remain challenging. thus, although there are detailed studies of the chiral phosphoric acidcatalyzed reduction of ketimines,39 the origin of the stereochemical outcome in the carbon carbon bondforming reaction of ketimine has scarcely been investigated.39b in fact, it was not until very recently that the friedel crafts reaction of 2methoxyfuran with aliphatic ketimines was studied theoretically by using dft calculations to assess the key factors governing the stereoselectivity. thus, terada and coworkers40 analyzed the plausible transition states of the stereodetermining cc bondforming step, proposing that enantioselectivity stems from the formation of the hydrogenbond network among the triad of components (catalyst, substrate, and nucleophile). although computational chemistry has helped us to understand the mechanism of these amidoalkylation reactions, understanding how the different parameters affect its stereochemical outcome is still difficult to rationalize. this is one of the underlying challenges in the field of asymmetric catalysis : to design or choose the adequate catalyst or experimental conditions for a given reaction type without engaging in a longterm, empirical investigation. therefore, we sought to use chemoinformatic tools to predict the enantioselectivity of this type of intermolecular amidoalkylation reaction. we decided to use quantitative structure reactivity relationship (qsrr) methods.41 at this point, the pioneering work of sigman and coworkers42 should be pointed out, who demonstrated that a qsrr model between steric parameters of chiral ligand substituents and enantiomeric ratios of the products could be established. since then, methodologies based on qsrr modeling have been applied to predict the enantioselectivity of different types of reactions, such as allylation43 and propargylation44 of carbonyl compounds, dehydrogenative hecktype45 reactions, asymmetric coppercatalyzed cyclopropanation of alkenes,46 and the henry reaction.47 recently, a dataintensive approach has also been reported for mechanistic elucidation applied to chiral anion catalysis in intramolecular dehydrogenative cn coupling.48 in this case, catalyst substrate association involves weak, noncovalent interactions similar to those involved in the amidoalkylation reactions. we have previously developed a ptqspr approach, which combines perturbation theory (pt) and qsrr ideas, to correlate and predict different outputs (activity, property) in complex molecular systems (metabolic reactions),49 nanoparticles,50 and so forth. the method has also been extended to predict the enantioselectivity and/or yield of intramolecular carbolithiation51 and heck heck cascade reactions.52 in some cases, the developed ptqsrr models use trace operators, like spectral moments, or eigenvalues of chemical structure matrices, like bond adjacency matrix, as the inputs.51, 53 now, we intend to use this correlative ptqsrr approach to predict the effect of the structures of the substrate, nucleophile, and catalyst, as well as the experimental conditions, on the enantioselectivity of intermolecular amidoalkylation reactions. the model predicts the enantiomeric excess ee(%)nr of a new reaction (nr) by comparison to a reaction of a reference (rr) with known enantiomeric excess ee(%)rr that involves a set of molecules (mq), which play different roles (substrate, catalyst, etc.) our goal is to find a useful tool to rationalize the enantioselectivity in this and related processes and to orient the catalyst choice. in this way, trends to improve the experimental results could be found. to accomplish this, this dataset included the abovedescribed reactions and literature data for related reactions with different types of substrates (cyclic and bicyclic hydroxylactams), nucleophiles (enamides, indoles, etc.), and chiral catalysts (phosphoric acids, phosphoramides, etc.) under different experimental conditions.12, 15, 18, 19, 54 the molecular descriptors v(mq) used to quantify the chemical structure of all the molecules involved in the reaction were calculated with the software dragon.55 these molecular descriptors were the absolute eigenvalues of the matrix of topological distance weighted with atomic polarizabilities v(mq)=aeigpq. to find the qsrr model, a multivariate linear regression (mlr) analysis was performed with the software statistica,56 combining forward stepwise and standard procedures of variable selections (see the supporting information). then, we initiated the study with the training and validation of the new ptqsrr model for the enantioselectivity of the reactions under study. we found a model useful to predict the efficiency of the new reaction ee(%)new, given the expected value of efficiency ee(%)expected=new for any new reaction in the solvent used and the values of the perturbation terms. the equation of this model is the correlation function shown in [equation (1)]:(1)ee%new=0.558333 + 0.316901g0newee%new-0.000699g0newg4new+0.132149g0newysubvsub-0.001459g0newyprodvprod-0.011935g0newycatvcat-0.136922g0newynucvnuc-0.000373g0newysolvvsolvn=38419_r=0.93_f=36394.0_pnew for any new reaction in the solvent used and the values of the perturbation terms. the equation of this model is the correlation function shown in [equation (1)]:(1)ee%new=0.558333 + 0.316901g0newee%new-0.000699g0newg4new+0.132149g0newysubvsub-0.001459g0newyprodvprod-0.011935g0newycatvcat-0.136922g0newynucvnuc-0.000373g0newysolvvsolvn=38419_r=0.93_f=36394.0_p<0.005 all of the variables of the model (table 5) are statistically significant, according to student test (see values of t and the plevel in table 6). a notable feature of this model is its ability to predict a high number of perturbations in intermolecular amidoalkylation reactions (n=38 419) with high goodnessoffit r=0.93 (86.5 % of variance of data explained). the model was validated with an external validation series of a large dataset of perturbations in intermolecular amidoalkylation reactions (n=12 806). notably, the goodnessoffit for the external validation series was also high r=0.93 (table 6). the chemical data associated with this ptqsrr model, as well as the observed and predicted values of ee(%), are listed in the supporting information. the new ptqsrr model reported here allows both the computational screening of a very large set of reactions with different substrates, nucleophiles, and catalysts and the scanning of experimental conditions (solvents, temperature, etc.).57 definition of all the terms used in the model. [a ] dragon variables (v) v q = v(q)nrv(q)rr, with q = substrate (sub), product (prod), etc. [i ] fisher ratio. to illustrate the practical use of the model in our experimental problem, thus, computational screening of the effect of structural changes of the nucleophiles and catalysts on the enantioselectivity of amidoalkylation reactions was carried out. first, bicyclic hydroxylactam 1 a was selected as the model substrate under the optimized experimental conditions, that is, thf as the solvent, 40 c, and 96 h (table 2). as the training set (data points used for model development) was limited to a series of enamides, an expanded library of computationally designed enamides and carbamates bearing steric and electronic variations at the nitrogen atom and the aromatic ring was built. it was hypothesized that both positions may contribute synergistically to the selectivity of the system, either by changing the acidity of the nh hydrogen atom and/or the alkene nucleophilicity, which likely modulates the early or late nature of the corresponding transition states involved in the selectivitydetermining step (see figure 2). regarding the catalyst, a series of chiral brnsted acids with strong acidic functionalities, such as binolderived phosphoric acids, phosphoramides, and so on, were also computationally designed. in addition, the chiral binol framework has been modified, as it has been shown to be crucial in improving the catalyst performance (figure 3). then, this large library of nucleophiles and catalysts was evaluated with the developed ptqsrr model for the above amidoalkylation reaction. a selection of the simulation of the enantioselectivity on a set of 212 catalysts versus 88 nucleophiles is depicted in figure 4 by using an image with gradient color, which is related to higher (green) or lower (red) ee(%), in order to achieve the best visual result. selected ee(%) predicted for intermolecular amidoalkylation reaction.58 according to the model, the best results would be expected with obenzyl carbamates 2 o q, instead of their acetamide counterparts, under the above indicated experimental conditions, with almost all catalysts tested. besides, the predictions indicated that high enantioselectivities would be obtained if these types of carbamates had an electrondonor substituent (och3, nhcoch3) in the para position, whereas the presence of a chlorine atom would lead to a decrease in the predicted ee(%), in agreement with our experimental results. interestingly, the screening revealed that the best ee(%) would be obtained by employing chiral brnsted acids 1315 and incorporating a sterically demanding h8binaphthyl moiety instead of the unsaturated analogues, in particular, phosphoramides (ro)2ponhso2c8h17 14 e h with the bulkiest aromatic substituents in the binol framework (figure 4). on the other hand, the use of atom stochastic moments enables backprojection of the model onto the enantioselectivity,59 that is, a map projecting the contribution of each atom or group of atoms to the enantioselectivity can be drawn. the backprojection map of the catalytic activity of the biphenylsubstituted phosphoramide 14 h is depicted in table 7, showing how the different electronic and steric variations on the catalyst affect the predicted ee(%) values. thus, the presence of the substituted biphenyl system on the binol framework is crucial to obtain high levels of enantioselectivity. backprojection map analysis of the catalytic activity of the biphenyl substituted phosphoramide 14 h. another important application of the developed model lies with its potential to predict the enantioselectivity outcomes of new hydroxylactam substrates. to define the substrate scope, acetamide 2 a was selected as the nucleophile and a similar study of substrates versus catalysts was carried out. as in the previous case, we first selected a series of wellknown substrates and catalysts from the literature. then, the library was expanded with the computationally designed chiral brnsted acids and a series of hydroxylactams (cyclic and bicyclic cores with different substitution patterns). next, the ee(%) values were predicted with the model for the standard amidoalkylation reaction conditions (thf as the solvent, 40 c, 96 h) of these new hydroxylactams. as an example, table 8 shows the backprojection map analysis of the enantioselectivity for substrates 1 a and 1 c. the model predicts that benzofused hydroxylactams would lead to lower ee(%) values in the amidoalkylation reactions. besides, the substituents on the aromatic ring of the isoquinoline moiety seem to play an important role. backprojection map analysis of the enantioselectivity of substrates 1 a and 1 c. in view of these results, we decided to study the effect of physicochemical parameters of substituents in different positions (ortho, para, and meta) of the benzene rings, both on the isoquinoline and isoindole moieties, on the enantioselectivity. for this purpose, one of the reactions that provided a higher ee(%) in our experimental study (table 2, entry 1) was selected as the reaction of reference. then, different derivatives of the substrate introducing both electrondonating and electronwithdrawing substituents in those positions were computationally created. next, the eigenvalues of these derivatives were calculated and introduced into equation (1) to predict the new ee(%) values. finally, a simple linear regression analysis of the ee(%) versus different constants of the substituents was carried out. specifically, the hammett parameters (p and p) to measure electronic effects with and without the creation of electrostatic charge in the center of reaction60 were selected. in addition, the charton constants ()61 to measure steric effects on ortho positions were used. the hammet constants did not show significant correlations with the ee(%) values (see the supporting information). in contrast, the values showed a significant negative correlation r = 0.89 p<0.05 with ee(%) in different positions of both rings, as shown in figure 5, which indicates that the steric hindrance of the substituents of the substrate would hinder the arrangement of the substrate in the chiral pocket of the catalyst. these predictions are in agreement with the proposed model (see figure 2).62 predicted ee(%) versus charton parameter values. enantioselective amidoalkylation reaction of enamides with bicyclic hydroxylactams catalyzed by chiral binolderived phosphoric acids allows the introduction of new functionality (an acylmethyl group) in the new generated quaternary stereocenter at the c1 position of the tetrahydroisoquinoline unit of the isoindoloisoquinoline skeleton. to achieve reasonable levels of enantioselectivity, either the enamides used as nucleophiles or the substrates should have a free nh group, which would indicate that hydrogenbonding interactions of the phosphate ionpaired intermediate to the nh bonds could potentially be involved. as the understanding of how the different parameters affect the stereochemical outcomes of these reactions is still difficult to rationalize, a correlative ptqsrr model has been developed to find trends that improve the experiment without engaging in a longterm empirical investigation. the qsrr model predicts the effect of the substituents on the aromatic rings of the enamides or hydroxylactams, as well as the substitution pattern of the catalysts. for example, a relationship between steric parameters (charton parameters) of substrate substituents and enantiomeric ratios of the products could be established. besides, the best ee would be expected with obenzyl carbamates with an electrondonor substituent (och3, nhcoch3) in the para position, with chiral phosphoramides incorporating a sterically demanding h8binaphthyl moiety, in particular, (ro)2ponhso2c8h17 14 e h with the bulkiest aromatic substituents in the binol framework. therefore, the developed model is expected to be useful as a reference tool to choose the adequate catalyst or experimental conditions for enantioselective amidoalkylation reactions. one type is the intensity factors g q that accounts only for nonstructural intensity factors f q (temperature, time, solvent dipole, etc.) in the new reaction. we calculated the g q as products of all factors considered to affect the molecules of class q. the second type of perturbation factor is the qv(m q) terms. consequently, they are the product of the switching functions q = g 0new(g qnew / g qref) used to quantify the changes on intensity factors and shifting functions v(m the five classes of molecules are, according to their different roles in the reaction, m 0=substrate (sub), m 1=product (prod), m 2=catalyst (cat), m 3=nucleophile (nuc), and m 4=solvent (solv). this second set of functions involves molecular descriptors of chemical structures calculated with the software dragon.55 the molecular descriptors used in this study were the absolute eigenvalues of the matrix of topological distance weighted with atomic polarizabilities v(mq)=ae igpq. the final formula of the model considered an initial term ee(%)expected, additive terms for the conditions of the new reaction, and multiplicative terms for the intensity factors and structural changes. the formula of the model used is given in equation (2):(2)ee%new = a0+a1g0newee%new+q=2q=6aqg0newgqnewq=1q=6aqqvmq a solution of 12bhidroxyisoindoloisoquinolone 1 a (0.2 mmol), enamides 2 a c (0.4 mmol) and catalyst 4 d in dry thf (5 ml) was stirred during 96 h at 40 c. the reaction was quenched by addition of hcl (1 m, 1 ml) and then satuarated nahco3 (1 ml). the crude reaction mixture was purified by column chromatography (alumina) to afford the corresponding enantioenriched isoindolo[1,2a]isoquinolones 3 aa ac. one type is the intensity factors g q that accounts only for nonstructural intensity factors f q (temperature, time, solvent dipole, etc.) in the new reaction. we calculated the g q as products of all factors considered to affect the molecules of class q. the second type of perturbation factor is the qv(m q) terms. consequently, they are the product of the switching functions q = g 0new(g qnew / g qref) used to quantify the changes on intensity factors and shifting functions v(m the five classes of molecules are, according to their different roles in the reaction, m 0=substrate (sub), m 1=product (prod), m 2=catalyst (cat), m 3=nucleophile (nuc), and m 4=solvent (solv). this second set of functions involves molecular descriptors of chemical structures calculated with the software dragon.55 the molecular descriptors used in this study were the absolute eigenvalues of the matrix of topological distance weighted with atomic polarizabilities v(mq)=ae igpq. the final formula of the model considered an initial term ee(%)expected, additive terms for the conditions of the new reaction, and multiplicative terms for the intensity factors and structural changes. the formula of the model used is given in equation (2):(2)ee%new = a0+a1g0newee%new+q=2q=6aqg0newgqnewq=1q=6aqqvmq a solution of 12bhidroxyisoindoloisoquinolone 1 a (0.2 mmol), enamides 2 a c (0.4 mmol) and catalyst 4 d in dry thf (5 ml) was stirred during 96 h at 40 c. the reaction was quenched by addition of hcl (1 m, 1 ml) and then satuarated nahco3 (1 ml). the crude reaction mixture was purified by column chromatography (alumina) to afford the corresponding enantioenriched isoindolo[1,2a]isoquinolones 3 aa ac. as a service to our authors and readers, this journal provides supporting information supplied by the authors. such materials are peer reviewed and may be reorganized for online delivery, but are not copyedited or typeset. technical support issues arising from supporting information (other than missing files) should be addressed to the authors. | abstractenamides with a free nh group have been evaluated as nucleophiles in chiral brnsted acidcatalyzed enantioselective amidoalkylation reactions of bicyclic hydroxylactams for the generation of quaternary stereocenters. a quantitative structure reactivity relationship (qsrr) method has been developed to find a useful tool to rationalize the enantioselectivity in this and related processes and to orient the catalyst choice. this correlative perturbation theory (pt)qsrr approach has been used to predict the effect of the structure of the substrate, nucleophile, and catalyst, as well as the experimental conditions, on the enantioselectivity. in this way, trends to improve the experimental results could be found without engaging in a longterm empirical investigation. |
malaria, caused by protozoan parasites of the genus plasmodium, is one of the leading causes of illness and death worldwide. its effects are exacerbated by its ability to modulate immune responses, which not only impairs the patient 's ability to fight the malarial infection, but can leave them vulnerable to some secondary infections and reduce the immune response to certain vaccines. although this partial immunosuppression has been recognized for many years, the underlying mechanisms are not well understood, and the results of studies in both humans and animals have sometimes been contradictory. in recent years, attention has focused on interference of parasites with the myeloid cells of the immune system, in particular the antigen - presenting dendritic cells that are essential for the initiation of almost all adaptive immune responses. one consequence of malarial infection is the production of the so - called ' malaria pigment ' from the breakdown of hemoglobin by the parasite in infected red blood cells. malaria pigment is a polymerized form of heme also known as hemozoin and has long been suspected to affect the function of myeloid cells. in this issue of journal of biology, millington and colleagues show how ingestion of malaria pigment by dendritic cells alters their function over the course of the infection, with consequences for the adaptive immune response to different asexual blood stages of the parasite. immature phagocytic dendritic cells reside in most tissues and constantly sample their environment by phagocytosis and pinocytosis, surveying for invading pathogens. when pathogens enter a tissue or the blood stream, they are usually first recognized by pattern recognition receptors (prrs) on the surface of dendritic cells, which recognize molecules common to different classes of pathogen. binding of pathogens or their products to the prrs triggers the migration of the dendritic cell into lymphoid tissues and its maturation into a powerful antigen - presenting cell. activated dendritic cells migrate to a draining lymph node or to the spleen, where they initiate an adaptive immune response by presenting pathogen antigens to t lymphocytes (t cells). as they mature, their phagocytic activity decreases, but they increase expression of the cell - surface major histocompatibility complex (mhc) molecules that bind processed pathogen - derived peptides and display them on the dendritic - cell surface. at the same time the maturing dendritic cell starts to increase the expression of cell - surface proteins known as co - stimulatory molecules, which together with mhc - peptide complexes enable dendritic cells to activate any t cells that bind to the antigens displayed on its surface. as in many other infectious diseases, dendritic - cell function in plasmodium infections has been studied extensively in vivo and in vitro, but results have been contradictory, depending on the plasmodium species, the inoculation dose and the type of dendritic cells under investigation. mice, in which most work has been done, are susceptible to infection with the species plasmodium chabaudi chabaudi, p. yoeli, and p. berghei. a number of studies have shown that dendritic cells can mature in response to plasmodium infection and induce a powerful t - cell response. in one example, the culture of immature bone - marrow - derived dendritic cells with mouse red blood cells infected with p. chabaudi chabaudi resulted in limited maturation of the dendritic cells, which could be enhanced by external maturational stimuli such as bacterial lipopolysaccharide (lps), tumor necrosis factor- (tnf-) or cd40 ligand. in a different study covering the first four days of a p. chabaudi chabaudi infection, a subset of splenic dendritic cells found in the marginal zone of the spleen and characterized by the cell - surface marker protein cd11c were observed to migrate from the marginal zone into the t - cell rich periarteriolar sheath, the area in which immune t - cell responses are initiated. these dendritic cells showed enhanced expression of mhc class ii molecules and co - stimulatory molecules typical of mature dendritic cells. in yet another study, splenic cd11cdendritic cells isolated at the peak of a p. yoeli infection were able to activate antigen - specific t cells and induce secretion by the t cells of the cytokines interleukin 2 (il-2), interferon- (ifn-) and tnf-, a cytokine profile characteristic of the th1 class of differentiated effector t cells. in contrast, other studies have reported that dendritic cells failed to mature when co - cultured with red blood cells infected with p. chabaudi chabaudi or p. yoeli, even though the dendritic cells were subsequently capable of inducing t - cell responses in vivo when transferred into uninfected mice. in one study, at the peak of blood - stage infection (the stage at which the parasite infects red blood cells) the response of cd8 cytotoxic t cells (the killer subset of t lymphocytes) to liver - stage parasites was inhibited in vivo, most probably as a result of cytokines secreted by dendritic cells. more recently, wilson and colleagues showed that inoculation of mice with p. berghei induced a systemic activation of splenic dendritic cells similar to that observed after administration of dna containing unmethylated cpg, which is a ligand for a type of prr known as toll - like receptor 9 (tlr-9). as with activation by cpg, however, if another antigen was administered on day 3 or 4 of a p. berghei infection, the dendritic cells proved unable to cross - present this exogenous anitgen and activate cd8 t cells. at this stage of infection, the defect in antigen presentation appeared to be due to reduced dendritic - cell phagocytic activity. these studies used a wide variety of in vitro cell culture systems, functional read outs, plasmodium species and mouse strains. a general trend emerges, however, suggesting that there is a dual response of dendritic cells to plasmodium blood - stage infection, with an early phase of activation, in conditions of low parasitemia, and a late phase of functional inhibition, in conditions of high parasitemia. the study by millington and colleagues now not only reconciles the disparate results on dendritic - cell function in rodent malaria, but also provides novel insights into the consequences of dendritic - cell modulation in vivo. their careful studies demonstrated an unambiguous biphasic response of dendritic cells to p. chabaudi chabaudi blood - stage infection in mice in vivo. they began their investigations with a simple question : at which stage during the course of a blood - stage infection does suppression of immune responses occur ? to answer this question they immunized mice with the protein antigen ovalbumin (ova) and bacterial lps (which provides a nonspecific stimulus for an immune response) at different time points during a p. chabaudi chabaudi infection and monitored the antibody response to ova. only during the late stages of the infection, when most parasites had been cleared, did the mice show greatly reduced ova - specific igg responses.. then demonstrated, through a series of carefully controlled experiments, that hemozoin acts directly on the dendritic cells and inhibits their maturation in response to maturational stimuli such as lps or the cell - surface protein cd40 ligand (cd40l). likewise, cd11c dendritic cells isolated from the spleens of infected mice were activated early but not late during infection, and at the later stage were refractory to subsequent stimulation with lps. inhibition of dendritic - cell maturation during the late stages of infection had consequences for the initiation of adaptive immune responses : antigen - specific t cells were activated by dendritic cells but failed to proliferate and secrete cytokines. of particular importance, these t cells did not migrate into b - cell follicles in the spleen to provide the required help to b cells, and so there was also a failure to mount a specific antibody response (figure 1). hemozoin is released together with other cell debris when the mature blood - stage forms of the parasite cause red blood cells to rupture, and it is rapidly taken up by monocytes (immature precursors of macrophages and dendritic cells) and dendritic cells. hemozoin reacts with membrane phospholipids, generating hydroxy - polyunsaturated fatty acids that cause membrane peroxidation. hydroxy - polyunsaturated fatty acids inhibit monocyte functions such as phagocytosis, activation by inflammatory cytokines, and generation of the oxidative burst. it has been shown to bind to tlr-9 on the myeloid and plasmacytoid subsets of dendritic cells in rodents, although this observation was not confirmed in another study. however, activation of dendritic cells via tlr-9 early during infection, but paralysis of dendritic cells via ingested hemozoin during the late stage of infection would agree with the results of millington.. thus, hemozoin is directly associated with the alteration of cellular responses observed during acute malaria in mice and humans. in humans, modulation of dendritic - cell function might be caused by adhesion of infected erythrocytes to the adhesive cell - surface protein cd36 expressed on dendritic cells. adhesion of p. falciparum - infected erythrocytes to cd36 is mediated by the p. falciparum erythrocyte membrane protein 1 (pfemp-1). does the work of millington. rule out a role for cd36 in the modulation of dendritic - cell function ? pfemp-1 is not produced by the plasmodium species that infect mice, and although rodent plasmodium species can adhere to cd36 to a certain extent, the ligand (or ligands) mediating cd36 adhesion in rodents are not known, and expression of adhesion ligand occurs much later, during the asexual blood - stage phase. in addition, the expression pattern of cd36 on human and mouse dendritic cells is fundamentally different : only cd8 dendritic cells in the periarteriolar lymphatic sheath express cd36. nevertheless, work by arese and colleagues has shown that monocyte function, differentiation to dendritic cells, and dendritic - cell maturation were impaired in vitro after ingestion of hemozoin by human monocytes. unlike pfemp-1, hemozoin is present in both human and rodent plasmodium species, yet both mechanisms can contribute to the modulation of dendritic - cell function in humans. the seminal in vivo studies presented here in journal of biology by millington. convincingly show that hemozoin impairs dendritic - cell function in vivo in a rodent model of malaria, and that it significantly contributes to immune suppression during acute blood - stage malaria. the deleterious effects of dendritic - cell paralysis on humans infected with p. falciparum in endemic malaria areas is easy to envisage. if immune suppression is induced, adaptive immune responses to variant antigens expressed during later stages of an infection or to super - infecting parasites may not be induced efficiently. (a) early on during infection, engagement of tlr-9 by hemozoin and interaction with infected red blood cells may result in dendritic - cell maturation. activated t cells proliferate and migrate into primary b - cell follicles where they provide help for antibody production by b cells. (b) with increasing parasitemia, more and more myeloid dendritic cells in the spleen are paralyzed through ingestion of increasing amounts of hemozoin, with negative effects on downstream t - cell and b - cell responses. | the capacity of malarial infection to suppress the patient 's immune responses both to the parasite and to other antigens has long puzzled researchers. a prime suspect, the parasite - produced pigment hemozoin, has now been clearly shown to mediate immunosuppression by inhibiting dendritic cell activity. |
the most common serious pneumococcal disease is pneumonia, an infection of the tissues of the lungs. pneumococci may also cause infections in the ear (otitis media), para nasal sinuses (sinusitis), the tissues covering the brain and spinal cord (meningitis), and, less often, the heart valves, joints, and abdominal cavity. the capsular polysaccharide is the main virulence factor that protects pneumococci against the action of host defense mechanisms. at least one million children die annually from pneumococcal diseases, and most of them are young children in developing countries. several risk factors for pneumococcal infections, such as age, race, immunodeficiency, other illness, socio - economic status, previous antibiotic therapy and day care attendance have been reported. streptococcus pneumoniae is facultative anaerobe, gram positive, capsulated organism that usually grows in pairs or short chain. molecular techniques have significantly improved the diagnostic yield and decreased the time for pathogen identification. these techniques are helpful in the determination of drug sensitivity and the understanding of transmission and outbreaks. the effect of swab composition and compared the sensitivities of detection of s. pneumoniae in simulated and clinical respiratory specimens by culture and pcr - based methods have been evaluated. this work aims to evaluate the sensitivity of pneumolysin - targeted nested - pcr for the detection of s. pneumonae and its comparison with routine clinical methods. pediatric patients with age 1 - 6 months (group a) and up to 5 years (group b) admitted to mayo hospital, children hospital and services hospital, lahore, pakistan with a clinical and radiological picture suggestive of pneumonia were enrolled in the study. they had fever of 39c and a leukocyte (wbc) count of 1510/liter suspected to have invasive bacterial infection. in group a, 98 patients and 145 in group b fulfilled the criteria for suspected invasive pneumococcal infection. blood samples from 60 healthy persons were also collected to test the specificity of the pcr assay. in other study, middle ear fluid (mef) samples were taken from the acute otitis media (aom) patients from the ent department of mayo hospital. aom was defined by the otoscopic examination suggesting mef and at least one of the symptoms : rubbing of the ear, runny nose, cough, ear pain or temperature of at least 38c. the blood samples were collected in tubes containing edta from each patient during his / her initial visit. middle ear fluid samples were taken from the acute otitis media patients in sterilized cotton swabs. cotton tipped swab was inserted into the ear, aspirated and the secretion was rinsed out with 0.5 ml of phosphate buffered saline. mef bacterial culture was inoculated on selective blood agar media containing 5 g / ml gentamicin and incubated at 37c for 72 h in a 5% co2 atmosphere. blood samples (300 l) were resuspended in a 1.5 ml microfuge tube containing 900 l rbc lysis solution (10 mm tris - hcl, 400 mm nacl and 2 mm na2 edta, ph 8.2). the cell suspension was digested with 0.2 ml of 10% sds and 0.5 ml of a proteinase k solution (1 mg proteinase k in 1% sds and 2 mm na2 edta) at 37c for overnight. one ml of 6 m nacl was added and shaken vigorously for 15 sec, followed by centrifugation at 13,000 g for 15 min. the supernatant containing dna was transferred to another tube, added double volume of absolute ethanol and inverted several times until the dna precipitated. dna was washed three times with 70% ethanol and centrifuged at 13,000 g for 1 min. pneumococcal cells from mef samples were suspended in the phosphate buffer saline by rubbing each swab against the wall of tube and centrifuged at 12,000 g for 10 min. the pellet was suspended in a buffer containing 10 mm tris, 0.14 m nacl, 0.1 m sodium citrate and 10 mm na2 edta and incubated at 80c for 10 min. the selection of the primers was based on the published sequence of the pneumolysin gene. pcr amplification of a 50 l reaction mixture containing pneumolysin specific primers was performed in a programmable thermal cycler (eppendorf). the outer primers (5-atttctgtaacagctaccaacga-3) and (5-gaattccctgtcttttcaaagtc-3) amplified a 348-bp region of the pneumolysin gene, and the inner primers (5-cccacttcttcttgcggttga-3) and (5-tgagccgttattttttcatactg-3) amplified 208-bp region. the reaction mixture contained 10 mm tris - hcl (ph 8.8), 1.5 mm mgcl2, 50 mm kcl, 200 m deoxyribonucleotides, 50 pmol of primers, 1u of taq dna polymerase (fermantas) and 2 l of dna (250 ng) extracted from whole blood and mef fractions. the amplifications were repeated 35 times as follows : denaturation at 94c for 45 sec, annealing at 50c for 30 sec, and extension at 72c for 30 sec. after 35 cycles, the samples were incubated for a further 6 min at 72c and stored at 4c until analyzed. amplifications were carried out as for the first - round pcr, autoclaved double distilled water and dna of healthy volunteers used as negative control. pcr amplified products mixed with 6 bromophenol blue loading dye were run in a 2% agarose gel, stained with ethidium bromide and visualized under uv light gel documentation system. spss version 17.0 was used to perform binomial test to demonstrate the statistical significance of pcr for diagnosis of pneumococcal infections. pediatric patients with age 1 - 6 months (group a) and up to 5 years (group b) admitted to mayo hospital, children hospital and services hospital, lahore, pakistan with a clinical and radiological picture suggestive of pneumonia were enrolled in the study. they had fever of 39c and a leukocyte (wbc) count of 1510/liter suspected to have invasive bacterial infection. in group a, 98 patients and 145 in group b fulfilled the criteria for suspected invasive pneumococcal infection. blood samples from 60 healthy persons were also collected to test the specificity of the pcr assay. in other study, middle ear fluid (mef) samples were taken from the acute otitis media (aom) patients from the ent department of mayo hospital. aom was defined by the otoscopic examination suggesting mef and at least one of the symptoms : rubbing of the ear, runny nose, cough, ear pain or temperature of at least 38c. the blood samples were collected in tubes containing edta from each patient during his / her initial visit. middle ear fluid samples were taken from the acute otitis media patients in sterilized cotton swabs. cotton tipped swab was inserted into the ear, aspirated and the secretion was rinsed out with 0.5 ml of phosphate buffered saline. mef bacterial culture was inoculated on selective blood agar media containing 5 g / ml gentamicin and incubated at 37c for 72 h in a 5% co2 atmosphere. blood samples (300 l) were resuspended in a 1.5 ml microfuge tube containing 900 l rbc lysis solution (10 mm tris - hcl, 400 mm nacl and 2 mm na2 edta, ph 8.2). the cell suspension was digested with 0.2 ml of 10% sds and 0.5 ml of a proteinase k solution (1 mg proteinase k in 1% sds and 2 mm na2 edta) at 37c for overnight. one ml of 6 m nacl was added and shaken vigorously for 15 sec, followed by centrifugation at 13,000 g for 15 min. the supernatant containing dna was transferred to another tube, added double volume of absolute ethanol and inverted several times until the dna precipitated. dna was washed three times with 70% ethanol and centrifuged at 13,000 g for 1 min. pneumococcal cells from mef samples were suspended in the phosphate buffer saline by rubbing each swab against the wall of tube and centrifuged at 12,000 g for 10 min. the pellet was suspended in a buffer containing 10 mm tris, 0.14 m nacl, 0.1 m sodium citrate and 10 mm na2 edta and incubated at 80c for 10 min. the selection of the primers was based on the published sequence of the pneumolysin gene. pcr amplification of a 50 l reaction mixture containing pneumolysin specific primers was performed in a programmable thermal cycler (eppendorf). the outer primers (5-atttctgtaacagctaccaacga-3) and (5-gaattccctgtcttttcaaagtc-3) amplified a 348-bp region of the pneumolysin gene, and the inner primers (5-cccacttcttcttgcggttga-3) and (5-tgagccgttattttttcatactg-3) amplified 208-bp region. the reaction mixture contained 10 mm tris - hcl (ph 8.8), 1.5 mm mgcl2, 50 mm kcl, 200 m deoxyribonucleotides, 50 pmol of primers, 1u of taq dna polymerase (fermantas) and 2 l of dna (250 ng) extracted from whole blood and mef fractions. the amplifications were repeated 35 times as follows : denaturation at 94c for 45 sec, annealing at 50c for 30 sec, and extension at 72c for 30 sec. after 35 cycles, the samples were incubated for a further 6 min at 72c and stored at 4c until analyzed. amplifications were carried out as for the first - round pcr, autoclaved double distilled water and dna of healthy volunteers used as negative control. pcr amplified products mixed with 6 bromophenol blue loading dye were run in a 2% agarose gel, stained with ethidium bromide and visualized under uv light gel documentation system. spss version 17.0 was used to perform binomial test to demonstrate the statistical significance of pcr for diagnosis of pneumococcal infections. the age of the children was 1 - 6 months (group a) and above one year (group b). the clinical diagnosis and numbers of pediatric patients in the group a, fulfilling the study inclusion criteria (n=98) were as follows : pneumonia 44 ; acute respiratory tract infection 30 ; pneumococcemia 24. the study inclusion criteria in group b (n=145) were as follows : pneumonia 80 ; fever without infection focus 8 ; acute respiratory tract infection 28 ; pneumococcemia 22 ; gastroenteristis 3 and acute tonsillitis 4. a, the highest wbc count values were 23 x 10 to 15 x 10/l and the highest body temperatures 45 1.1 and 38.8 1.2c, respectively. in group b, the highest wbc count values were 20.210 to 15.510/l and the highest body temperatures 451.0 and 381.1c, respectively. the study group of otitis media subjects (up to 5 years) were distributed into two groups, group i, mef pneumococcal culture negative (90 samples) and group ii culture positive (60 samples). among pneumonia patients of group a, pcr gave a clear band of the expected molecular size in the nested - pcr (fig. the specificity of the pcr assay was demonstrated by its negative results for normal healthy persons. the sensitivity of the assay was evaluated with about 0.06 pg of purified s. pneumoniae genomic dna. amongst 44 pneumonia patient samples, 86.4% showed pcr positive results while 6.6% and 8.3% positive results were obtained in acute respiratory tract infection and pneumococcemia, respectively (table 1). none of the samples of the controls was found to be positive by pcr and blood culture. amplification of 208-bp fragment by pcr of dna extracted from peripheral blood of pneumonia pediatric patients (group a). lane m, molecular size marker ; lane 1 and 5 pcr positive samples and lane 2, 3, 4, 6, 7, 8, 9 pcr negative s. pneumoniae patients blood samples pcr results for peripheral blood samples from patients with clinical symptoms arti : acute respiratory tract infection in group b, nested - pcr protocol was found to be positive in 62 of the 80 pneumonia cases. four (18%) patients with pneumococcemia and four (14.2%) with acute respiratory tract infection were positive for pneumolysin gene (fig. pcr amplification results of group b. lane m, dna size marker ; lane 1, 3 - 6 are positive s. pneumoniae patient 's blood samples. in other study, the results of pcr based amplification of the pneumolysin gene were compared with those obtained from culture method. among 60 mef culture positive samples (group ii), 52 showed the evidence of pneumolysin by nested - pcr. on the other hand, among 90 s. pneumoniae culture - negative mef samples (group i) comparison of s. pneumoniae culture and pneumolysin pcr results for mef samples mef : middle ear fluid ; pcr : polymerase chain reaction the age of the children was 1 - 6 months (group a) and above one year (group b). the clinical diagnosis and numbers of pediatric patients in the group a, fulfilling the study inclusion criteria (n=98) were as follows : pneumonia 44 ; acute respiratory tract infection 30 ; pneumococcemia 24. the study inclusion criteria in group b (n=145) were as follows : pneumonia 80 ; fever without infection focus 8 ; acute respiratory tract infection 28 ; pneumococcemia 22 ; gastroenteristis 3 and acute tonsillitis 4. a, the highest wbc count values were 23 x 10 to 15 x 10/l and the highest body temperatures 45 1.1 and 38.8 1.2c, respectively. in group b, the highest wbc count values were 20.210 to 15.510/l and the highest body temperatures 451.0 and 381.1c, respectively. the study group of otitis media subjects (up to 5 years) were distributed into two groups, group i, mef pneumococcal culture negative (90 samples) and group ii culture positive (60 samples). among pneumonia patients of group a, pcr gave a clear band of the expected molecular size in the nested - pcr (fig. the specificity of the pcr assay was demonstrated by its negative results for normal healthy persons. the sensitivity of the assay was evaluated with about 0.06 pg of purified s. pneumoniae genomic dna. amongst 44 pneumonia patient samples, 86.4% showed pcr positive results while 6.6% and 8.3% positive results were obtained in acute respiratory tract infection and pneumococcemia, respectively (table 1). none of the samples of the controls was found to be positive by pcr and blood culture. amplification of 208-bp fragment by pcr of dna extracted from peripheral blood of pneumonia pediatric patients (group a). lane m, molecular size marker ; lane 1 and 5 pcr positive samples and lane 2, 3, 4, 6, 7, 8, 9 pcr negative s. pneumoniae patients blood samples pcr results for peripheral blood samples from patients with clinical symptoms arti : acute respiratory tract infection in group b, nested - pcr protocol was found to be positive in 62 of the 80 pneumonia cases. four (18%) patients with pneumococcemia and four (14.2%) with acute respiratory tract infection were positive for pneumolysin gene (fig. pcr amplification results of group b. lane m, dna size marker ; lane 1, 3 - 6 are positive s. pneumoniae patient 's blood samples. in other study, the results of pcr based amplification of the pneumolysin gene were compared with those obtained from culture method. among 60 mef culture positive samples (group ii), 52 showed the evidence of pneumolysin by nested - pcr. on the other hand, among 90 s. pneumoniae culture - negative mef samples (group i) comparison of s. pneumoniae culture and pneumolysin pcr results for mef samples mef : middle ear fluid ; pcr : polymerase chain reaction s. pneumoniae is a common human pathogen that may be considered as a part of normal flora of the upper respiratory tract, however, infants, elderly and deliberate patients with other compromising medical conditions of the respiratory tract, or decreased immunological infections are at great risk of acquiring pneumococcal disease. the spectrum of pneumococcal diseases changes in various age groups and different populations[4, 11 ]. the diagnosis of pneumococcal infection requires s. pneumoniae isolation from infection sites by using insidious procedures such as lung puncture, pleural fluid aspiration, and middle ear fluid (mef) aspiration ; however, their presence in peripheral blood is an indirect confirmation. 20 to 30% of adults and 10% of children blood cultures pneumolysin is a species - specific protein toxin produced intracellularly by all clinically relevant pneumococcal strains. the expression of pneumolysin gene is anticipated to specify pneumococcal involvement in the disease, without considering the pneumococcal serotype. therefore, pneumolysin is a good target for diagnosis since it is produced by all pneumococcal strains isolated from clinical samples and its virulence properties are well known. molecular methods have been widely used for the diagnosis of several infectious diseases, including pneumococcal pneumonia, due to their high sensitivity, specificity and speed. the purpose of this study was to develop a simplified molecular strategy for s. pneumoniae detection by dna amplification in clinical specimens of children visiting different hospitals. in group a, among 44 pneumonia patient samples, 86.4% showed pcr positive results and only 2 positive results obtained in 30 acute respiratory tract infection samples. in group b, 62 out of 80 pneumonia patients and 4 out of 28 acute respiratory tract infection patients were found to be pneumolysin positive (table 1). toikka have described 44% pneumolysin pcr positive results out of 25 pneumococcal infected patients. mayoral reported that 10/24 serum samples of a group (children with definitive diagnosis of pneumococcal pneumonia confirmed by blood - culture) were positive when subjected to first round pcr. however, when the second round of nested - pcr was applied to the same samples, 20/24 (83.3%) were found to be positive. in our study, none of 60 healthy controls when analyzed by pcr, was found to be positive, indicating a good specificity and sensitivity of the pcr procedure. peripheral blood samples from pcr positive pneumonia patients (group a and b) were collected prior and subsequent to antibiotic administration. out of 100 patients under antibiotic treatment for less than 48 h, however, after antibiotic treatment for more than three days, pneumococcal dna could not be detected. even after 48 h antibiotic treatment, dagan did not detect pneumococcal dna in the serum samples of the patients. lane m, 50bp dna size marker ; lane 2, 4 and 5 are pneumolysin positive samples the diagnosis of acute otitis media (aom) requires a sensitive and consistent method for deterrence of the disease. bacterial culture and pcr - based assay was used to study the presence of s. pneumoniae in middle ear fluid samples from patients with aom. out of total 150 mef culture samples, 60 cases were s. pneumoniae culture - positive and among them 52 samples exhibited the presence of pneumolysin gene by nested - pcr. on the other hand, out of 90 mef culture - negative cases, 8 confirmed pcr positive results demonstrating the sensitivity and specificity of the molecular method to establish the involvement of pneumococcal pathogens in mef samples of children with acute otitis media (table 2). in other study, 47.1% pcr positive results for pneumolysin gene in mef samples while 27.3% culture positive results for the same samples are reported. virolainen have described s. pneumoniae culture positivity in 33 (18%) and pneumolysin gene amplification in 51 out of 180 (28%) mef clinical specimens. only 2 out of 21 pcr - positives, s. pneumoniae culture - negative samples were positive for other otitis pathogens. binomial test of proportionality performed on (spss 17) showed low p values (< 0.05) that suggests pneumolysin gene to be a significant diagnostic genomic marker particular to s. pneumoniae using the pcr technique. the diagnosis of pneumococcal contagion in children has been a challenge for years and largely relying on traditional culture techniques. in recent years to improve the analytic sensitivity and specificity of the diagnostic methods, numerous nucleic acid amplification technologies are developed for the rapid detection of widespread bacterial pathogens. polymerase chain reaction based assessment of pneumococcal pneumonia as compared to conventional methods, has made it a valuable tool in the etiologic diagnosis of pneumonia in the children visiting hospitals of lahore. there are several factors that appreciate using the sophisticated, rapid and accurate diagnostic tools and specifically the methods designed for keeping economic and financial considerations of the developing country like pakistan. the present study describes a comparative analysis of sensitive nested - pcr and bacterial culture in pediatric patients with clinical and radiological indication of s. pneumoniae infection. binomial test of proportionality demonstrate the sensitivity and reliability of pcr for rapid pneumonia evaluation. | objective streptococcus pneumoniae is a common worldwide potential pathogen causing pneumonia among children and the detection of pneumococcal infections by conventional culturing techniques is cumbersome. the present study describes a comparative analysis of sensitive nested - pcr and bacterial culture in pediatric patients with clinical and radiological indication of s. pneumoniae infection.methodspcr was performed using outer primers to amplify a 348-bp region and inner primers a 208-bp region of the pneumolysin gene. for pneumolysin pcr assay, dna from peripheral blood and middle ear fluid (mef) samples was extracted by salting out method. the sensitivity of the assay was evaluated with about 0.06 pg of purified s. pneumoniae genomic dna.findingsamong 90 mef culture negative samples from acute otitis media pediatric patients, 8.8% pneumolysin - pcr positivity was detected, demonstrating the sensitivity and reliability of pcr for rapid pneumonia evaluation. binomial test of proportionality performed on (spss 17) gives p < 0.05 indicating that pcr technique is statistically significant and sensitive in the diagnosis of s. pneumoniae infection.conclusionthe research work evaluated the effectiveness and efficacy of nested - pcr for detecting s. pneumoniae in pediatric patients with clinical and radiological confirmation of bacterial infection. this simplified method permitted quick selection of the patients and played a significant role in preliminary management of pneumococcal infections. |
iron metabolism is implicated in the incidence of diabetes and associated atherosclerotic disease [13 ]. this causative relationship is underlined by reports of an improvement of glycaemic control in response to a reduction in body iron [4, 5 ]. body iron stores accumulate by dietary factors that include vitamin c and alcohol intake as well as dietary iron, which in turn is a public health anxiety given that this essential nutrient influences the development of vascular disease. diabetes is particularly concentrated on the indian subcontinent whose dispersed migrant populations have a higher prevalence compared to various indigenous populations [914 ]. while studies show that established risk factors such as obesity and urbanised lifestyle operate amongst south asians, it remains unclear as to how far they explain an increased susceptibility to diabetes and glucose intolerance for this group. we and others have reported the preservation of high rates of glucose intolerance amongst indian populations both overseas and in india itself [10, 13, 14 ]. while levels of ferritin and other markers of body iron status are shown to be predictive of diabetes in other populations, given that the improvement of body iron status to combat anaemia is a common primary healthcare concern among indian - origin populations, we determined whether serum ferritin was associated with diabetes in this group. we tested the hypothesis that serum ferritin would reflect glucose tolerance and metabolic features of diabetogenesis amongst randomly selected gujaratis living in rural india and their contemporaries living in the uk. we examined whether the magnitude of diabetes risk from serum ferritin was independent of obesity and lifestyle factors, which included nutritional intake, physical activity, and country of residence. methodology of this migration study is described in more detail elsewhere. we compared gujarati indians living in sandwell (uk) who had migrated from rural villages in navsari (gujarat, india) with contemporaries still living in those villages of origin. ethical approval for the study was obtained in sandwell and gujarat by the respective local research ethics committees. participants who were invited to the clinic sessions fasted and had 75 g oral - glucose - tolerance tests (ogtt). blood samples were taken fasting and at 30 and 120 min after glucose challenge (based on the who criteria). identical procedures for anthropometry in each site included the leicester height measure (seca ltd., birmingham, uk), weight (seca ltd.), waist, and hip (metal tapes). the hip circumference was measured over thin clothing as the widest horizontal circumference around the buttocks. blood pressure was measured 3 times (using the mean of the last 2 for analysis), with a validated semiautomatic monitor, after > 5 min sitting. measures were rigorously standardised, with fieldworkers locally revalidated monthly, internationally every 4 months. dietary analysis proceeded with completion of food diaries for four consecutive days ' intake and was done using wisp (weighed intake software program) version 1.23, tinuveil software, llanfechell, uk. physical activity was monitored using a validated accelerometer caltrac (muscle dynamics, torrance, ca, usa) worn continuously for 48 hours. details of separation, storage, and transport of blood and the analysis of lipids, lipoproteins, glucose, insulin, vitamin b12, serum folate, and c - reactive protein (crp) are available elsewhere. venous blood collected in edta blood bottles was analysed for a full blood count using haematology analysers at either the clinical haematology department, sandwell hospital, uk (stak s, beckman coulter corp., hialeah, florida), or the mankodi laboratory, india (bayer advia, bayer diagnostics, baroda, india). ferritin was measured on frozen serum using an automated assay on the roche integra 400 + (basel, switzerland). given the influence of systemic inflammation on serum ferritin levels, subjects with crp concentrations above 5 mg / l, or males with ferritin > 300 ng / ml, or females with ferritin > 200 ng / ml were excluded from these post hoc analyses. anaemia was defined as a haemoglobin of < 11.5 g / dl in females and < 13.5 g / dl in males. folate deficiency was defined as a serum folate <3 ng / ml and vitamin b12 deficiency as < 200 pg / ml. for a statistically significant (p < 0.05, 2-sided) correlation coefficient r (at least 0.20), with a power of 80%, 193 subjects were needed., chicago, il) using standard and nonparametric tests (as determined by kolmogorov - smirnov normality plots) amongst men and women. central tendencies and variation for parametric data are presented as mean (standard deviation (sd)) or geometric means (95% ci) for nonparametric data. comparisons were made by t - test, mann whitney test, or chi square tests. partial correlation analysis (two - tailed) was used to adjust the effects of gender and site. linear regression models and binary logistic models were developed to test the strength of association, beta (95% ci) of potential independent predictors of glucose intolerance. the standardised beta coefficients presented allowed direct comparison (along a scale of 0 - 1) of the strength of each association within the model. the percentage prevalence of diabetes (known and newly detected) was similar across sites (7.7%, and 10.7%), respectively, for india and the uk. with respect to impaired glucose tolerance, in navsari (india) it was 20.4% and in the sandwell (uk) it was 5.4%. overall, the percentage of indians with normal glucose tolerance in navsari was 71.9% and in sandwell it was 83.9%. thirty - three subjects from sandwell and 29 subjects from navsari were excluded due to either high crp or ferritin, leaving 114 men and 163 women from navsari and 109 men and 118 women in sandwell. of subjects with high crp or ferritin, 41% had either diabetes (all newly detected) or impaired glucose tolerance during ogtt (a higher proportion than those with normal crp or ferritin, p < 0.001). amongst subjects with normal crp or ferritin, levels of ferritin were higher amongst diabetics (p = 0.005) irrespective of site (figure 1). levels of ferritin were higher amongst those with glucose intolerance, both in the presence (p = 0.04) or in the absence of central obesity (p = 0.02) (figure 2). across a gradient of deteriorating glucose tolerance (normal to impaired glucose to frank diabetes), levels of ferritin increased ordinally independently of gender and migration status (pseudo r = 0.04, p < 0.008). the age - adjusted prevalence of iron deficiency was greater amongst women (p < 0.01) at 79.6 (72.786.5)% in navsari women and 49.5 (39.659.4)% in sandwell women, compared to 25.7 (17.733.7)% in navsari men and 17.6 (9.825.3)% in sandwell men. measures of anthropometry and blood pressure were significantly lower amongst those with low levels of ferritin (< 20 ng / ml), compared to normal ferritin, (for both men and women, table 1). metabolic factors such as glucose during ogtt, fasting nonesterified fatty acids (nefa), insulin, hdl cholesterol, and triglycerides were also lower amongst those with low ferritin, significantly so for fasting triglycerides and nefa. diabetes was less common amongst those with low ferritin (p = 0.008), where the risk estimate was 0.35 (0.150.81). on univariate analysis, levels of ferritin were associated with a range of metabolic factors, including fasting glucose (r = 0.114, p < 0.001), serum triglycerides (0.270, p < 0.001), apolipoprotein b (0.189, p < 0.001), insulin levels (0.113, p < 0.04), nefa concentrations (0.238, p < 0.001), waist (0.318, p < 0.001) and hip circumferences (0.148, p < 0.001), waist to hip ratio (0.424, p < 0.001), and bmi (0.190, p < 0.001). these associations remained unchanged on separate analysis of gujaratis at each site, except for insulin level, waist and hip circumferences, and bmi, which were no longer related to ferritin. to control confounding from central obesity, on a subgroup analysis of nonobese gujaratis (excluding men with a waist girth 94 cm and women 80 cm), associations between ferritin and fasting glucose (p = 0.03), blood pressure (p < 0.002), and triglycerides (p < 0.01) were conserved. the magnitude of the relationship between ferritin and serum triglyceride levels was stronger in those with diabetes (r = 0.13, p < 0.001) and impaired glucose tolerance (r = 0.20, p < 0.001) compared to normal glucose (r = 0.05, p < 0.001). the age - adjusted prevalence of anaemia was significantly less common in sandwell (p < 0.01) and greater amongst women compared to men. iron deficiency anaemia was more common amongst those in navsari, particularly the women (table 2). using various categories of anaemia, there was no influence of these exposures on diabetes status save iron deficiency anaemia (p = 0.01), which had a modest protective influence. on partial correlation analysis (controlling for the effects of gender and country of residence), levels of ferritin were positively related to total calorie intake (0.49, p < 0.001), energy derived from fat (0.50, p < 0.001), dietary iron (0.32, p < 0.001), and alcohol intake (0.26, p < 0.001) and negatively related to energy derived from carbohydrate (0.39, p < 0.001). levels of ferritin were unrelated to energy derived from protein (p = 0.64) and showed modest association with energy expenditure from caltrac (0.17, p = 0.04) and vitamin c intake (0.16, p = 0.06). on linear regression analysis, ferritin levels were independently associated with residence in india (beta (95% ci) 0.78 (1.040.52)), male gender (1.16 (1.380.93)), anaemia (0.434 (0.1930.676)), age (0.015 (0.0060.024)), and serum triglycerides (0.258 (0.0640.451)) (or apolipoprotein b), all p < 0.001, in models that also included waist to hip ratio, fasting plasma glucose, and systolic blood pressure. fasting glucose was also predictive of ferritin (p = 0.02) independently of gender, site, and waist to hip ratio, but not when measures of triglycerides or apolipoprotein b were added to regression models. on multivariate logistic analysis, the presence of diabetes was independently associated with age (beta = 1.06 (1.021.10), p < 0.001) and serum ferritin levels (2.11 (1.343.12), p = 0.001) in a model that included migration status, gender, waist to hip ratio, anaemia, serum triglycerides, serum insulin, hdl cholesterol, and systolic blood pressure. within indian gujarati men and women, serum ferritin, a marker of body iron status and inflammation, was consistently associated with glucose intolerance and indices of diabetes independently of lifestyle and metabolic risk factors. serum ferritin concentrations may reflect an increased risk of diabetes amongst populations originating from the indian subcontinent, and it is an important consideration, given the heightened prevalence of anaemia in this group. ferritin is an acute phase reactant, and inflammation may play a role in the inferred relationship between body iron stores and the risk of diabetes [18, 19 ]. potentially, chronic inflammation is associated with diabetogenic risk factors such as obesity. however, in our study, lean gujaratis with raised ferritin were still more likely to have diabetes than obese gujaratis with normal ferritin, and obesity per se was not associated with ferritin. in a white european population, the predictive value of ferritin with respect to diabetes disappeared once other metabolic risk factors were adjusted for. the cross - sectional nature of our study may limit our interpretation of an independent relationship between ferritin and glucose intolerance. our inclusion of participants with only normal crp and ferritin levels was an attempt to control for confounding from inflammation, but residual confounding from other inflammatory pathways or markers could persist. the measurement of soluble transferrin receptor, the expression of which is interpreted as a demand for cellular iron, is a more accurate measure of body iron status than serum ferritin alone. as such, while high levels of ferritin may reflect a predisposition to diabetes in this population, the converse may also be true (a susceptibility to glucose intolerance results in higher ferritin). however, due to the cross - sectional nature of our study, the possibility of the raised serum ferritin levels caused by insulin intolerance or type 2 diabetes mellitus (reverse causation) can not be ruled out. we found that high levels of ferritin are associated with insulin resistance independent of lifestyle changes and gender. however, studies in other populations show that the development of type 2 diabetes mellitus is associated with dietary heme - iron intake [3, 20 ]. similarly, people with a family history of diabetes exhibit high levels of ferritin irrespective of glucose tolerance status. in a cross - sectional study of 12 090 korean subjects, however, they observed that raised serum ferritin concentrations were associated with type 2 diabetes mellitus, ifg, insulin resistance, and metabolic syndrome in men, yet only with ifg in women. iron is a potent metal, which could potentially interfere with insulin synthesis and secretion in the pancreas, leading to insulin resistance or reduced insulin secretion [23, 24 ]. for example, amongst patients with haemochromatosis undergoing ogtt, hepatic iron overload is reported to result in impaired insulin extraction. while the pathophysiological mechanism is unclear, levels of triglycerides and dietary fat in this study were closely related to ferritin. a potential pathway for the intersection of body iron status and dietary fat metabolism is that ferritin can regulate the secretion of apo b. the porphyrin ring structure of apo b allows the direct binding of ferritin proteins and we are tempted to speculate that iron delivery is a normal physiological outcome of lipoprotein metabolism, which is moderated by the action of insulin. the restriction of dietary iron and fat improves pathological states such as nonalcoholic fatty liver, which in itself is a risk factor for diabetes. elsewhere, we have reported that insulin resistance is related to the suppression of nefa during ogtt in this gujarati indian population. in the present analysis, the relationship between ferritin and absolute measures of nefa and insulin during ogtt was greater in magnitude than the association between ferritin and nefa suppression. another possible mechanism is proposed in a recent spanish - population based cross - sectional study, suggesting that iron metabolism may contribute to the initiation of insulin resistance through inhibition of adiponectin and osteocalcin proteins involved in body glucose level regulation. our results show that when compared with the nonmigrant population (living in gujarati villages of india), the gujarati people who have immigrated to the uk have a higher ferritin level and less anaemia, but similar rates of diabetes. firstly, the migration to the uk is more likely to involve a greater likelihood of nonvegetarianism, as opposed to the traditional gujarati vegetarian diet. secondly, a nonspecific marker like ferritin could be linked to the chronic inflammatory states that are associated with obesity, which would also be exacerbated by dietary changes. finally, the changes in prevalence could be due to a higher availability of medical resources in sandwell (compared to gujarati villages), so more routine blood counts have been undertaken. this may therefore result in more patients being treated for anaemia diagnosed on the serum results rather than on clinical presentation alone, thus more ferrous sulphate prescribed to the population. this would result in a higher serum ferritin and lower prevalence of anaemia in this group of people. the implication of these findings is that the interpretation of serum ferritin amongst people from the indian subcontinent is an important concern, not only for the treatment of anaemia but also for the paradoxical risk of diabetes. according to a study done on -thalassaemia major patients, which investigated the effects of chelation therapy on glucose levels, treating patients with deferoxamine and deferiprone (combined chelation for lowering ferritin levels) resulted in an improvement of glucose metabolism disorders in -thalassaemia major patients. the increased risk of diabetes is potentially a consideration for clinician treating particular ethnic groups with iron replacement therapy. this study raises concerns as to whether reference ranges for serum ferritin in south asians are sensitive to a potential risk of diabetes. however, the present study design would be unsuitable and underpowered to answer such questions. in summary, levels of ferritin are associated with diabetes and metabolic factors amongst indian gujaratis, and this relationship is independent of site and gender and remains independent of the effects on obesity. further work is warranted to determine the prognostic and diagnostic implications of body iron status within this population. | background. serum ferritin predicts the onset of diabetes ; however, this relationship is not clear amongst south asians, a population susceptible to glucose intolerance and anaemia. objective. this study tests whether ferritin levels reflect glucose tolerance in south asians, independent of lifestyle exposures associated with indian or british residence. methods. we randomly sampled 227 gujaratis in britain (49.8 (14.4) years, 50% men) and 277 contemporaries living in gujarati villages (47.6 (11.8) years, 41% men). both groups underwent a 75 g oral - glucose - tolerance test. we evaluated lifestyle parameters with standardised questionnaires and conducted comprehensive clinical and lab measurements. results. across sites, the age - adjusted prevalence of diabetes was 9.8%. serum ferritin was higher amongst diabetics (p = 0.005), irrespective of site, gender, and central obesity (p 0.02), and was associated with fasting and postchallenge glucose, anthropometry, blood pressure, triglycerides, and nonesterified fatty acids (p < 0.001). diabetes was less in those with low ferritin (< 20 mg / ml), p < 0.008, and risk estimate = 0.35 (95% ci 0.150.81), as were blood pressure and metabolic risk factors. on multivariate analysis, diabetes was independently associated with ferritin (p = 0.001) and age (p < 0.001). conclusion. ferritin levels are positively associated with glucose intolerance in our test groups, independent of gender and indian or uk lifestyle factors. |
caring for children with special health care needs (shcn) may take a toll on parental health, divert attention from typical aspects of family functioning, and can also influence possibilities for participation in paid employment (derigne, 2012 ; hauge. children with shcn often have a substantial need for professional medical care and are typically at risk of having chronic physical, developmental, behavioral, or emotional conditions that require health - related services of a type or amount beyond that required by typically developing children of similar age (mcpherson., 1998 ; perrin, 2002). caring for a child with shcn can be an enormous responsibility and can far exceed the demands of the typical caregiver role (raina., 2004). this caregiver role is typically also not chosen or planned, and preparation for and adjustment to the role will most often need to occur once it has already been acquired. the care demands associated with raising a child with shcn are typically both highly intensive and long - lasting, and tend to fall more heavily on mothers as compared with fathers (crowe & michael, 2011 ; curran, sharples, white, & knapp, 2001 ; tadema & vlaskamp, 2010). high levels of child - related stress, constant or returning worries about the child s condition, and sorrow arising from the loss of an expected healthy child may also compromise the caregiver s health. in terms of mental health, mothers of children with shcn have been found to display elevated levels of depressive symptoms as compared with both fathers and mothers raising children without shcn, with symptom levels often remaining high over time (brehaut., 2009 ; kuhlthau, kahn, hill, gnanasekaran, & ettner, 2010 ; nes., 2014 ; olsson & hwang, 2001, 2006 ; resch, elliott, & benz, 2012). such mental health impairments often arise from the chronic strains involved in the caregiver role, as well as from emotional reactions evoked and sustained by the child s condition (raina., 2004). as such, mothers caring for children with the most severe conditions are commonly also those most affected (churchill, villareale, monaghan, sharp, & kieckhefer, 2010). the additional care demands associated with raising a child with shcn may influence parents in other vital areas as well. in terms of work participation following the birth of a child with shcn, participation levels among mothers are commonly more affected than those of fathers (parish & cloud, 2006). early parenthood and the responsibility of caring for young children in general may require adjustments to parental work participation, and women especially tend to reduce work hours or temporarily stop working when their children are young (b, kitterd, kber, nerland, & skoglund, 2008). implementation of comprehensive family and equality policies, such as the norwegian kindergarten act, has enabled women especially to continue participation in paid work and to pursue their occupational careers during the early years of motherhood (norwegian ministry of education and research, 2005). with close to 90% of children attending kindergarten (statistics norway, 2011), women with young children have steadily increased their employment levels since the 1990s to a current rate of about 73%, a rate increasing further as their children age (b., 2008). moreover, with an employment rate exceeding 80% for women aged 25 years, the overall employment levels among norwegian women of childbearing age is high and higher than in most the organisation for economic co - operation and development (oecd) countries (statistics norway, 2011). as unemployment is low in norway, well below the oecd average (oecd, 2011), most nonemployed women are out of paid work due to other reasons than unemployment or lack of available child care. despite work participation being high in norway, maternal employment opportunities appear rather restricted when caring for children with shcn (hauge., 2013). many mothers of children with shcn report having missed days from work, having cut work hours, or having left employment altogether, due to their children s additional health care needs (derigne & porterfield, 2010 ; hedov, wikblad, & anneren, 2006 ; porterfield, 2002). apart from its obvious financial aspects, employment provides additional benefits such as social inclusion and appreciation by others, and may also reduce feelings of isolation and peripherality (shearn & todd, 2000). however, the inability to properly meet employment demands while providing optimal care for their children may necessitate shorter or longer employment adjustments for many mothers. the additional care demands associated with raising a child with shcn may thus prevent mothers at risk of mental health problems from using the likely beneficial respite effects of employment (morris, 2012). work impairment due to mental health problems in general is a considerable and increasing public health problem in many western countries. after musculoskeletal disorders, psychiatric disorders (pd) are now the most common diagnostic group reported by physicians on sick leave certificates (hensing & wahlstrm, 2004). recovery and return to work after a sick leave due to pd generally takes longer than absence due to other conditions, and many long - term absentees do not recover and end up on permanent disability pensions (bratberg, gjesdal, & mland, 2009 ; henderson, glozier, & holland elliott, 2005). apart from studies showing elevated levels of depressive symptoms and an increased risk of reducing or leaving employment altogether, little is known about how the additional care demands associated with raising a child with shcn may impact on shorter or longer work absences due to pd among mothers who remain in the work force. population - based research on employment - related consequences of caring for children with shcn is scant, and longitudinal research based on data other than parental report is needed (reichman., 2008). in addition, most studies on mental health problems in caregivers of children with shcn rely on small samples, are often recruited in clinical settings, and may thus lack generalizability to the wider population (resch., 2012). to address some of the abovementioned shortcomings, this study aimed to explore associations between caring for a child with shcn and sick leave due to pd during the early years of motherhood. self - report data from a large norwegian population - based birth cohort was applied and linked with national registry - based data on physician - certified sick leave and relevant background factors associated with both sick leave and maternal employment status more generally. based on the previous literature, we expected the risk of sick leave due to pd in general and due to depression more specifically to be higher among mothers of children with shcn as compared with mothers of typically developing children during early motherhood. we further hypothesized that the mothers risk of sick leave due to pd would increase with the severity of the child s care needs. the study population included participants in the population - based norwegian mother and child cohort study (moba), conducted by the norwegian institute of public health (magnus., 2006). pregnant women were recruited at their first routine ultrasound examination at weeks 1718 of gestation between 1999 and 2008 (response rate 40.6%), and the cohort includes approximately 90,000 unique observations of expectant mothers, as participants with about 107,000 pregnancies in total among them (nilsen., 2009). the moba cohort is linked to the medical birth registry of norway (irgens, 2000), which contains the national identification number for all participants in the study, allowing linkage with the central population register, benefit registries from the norwegian labour and welfare administration, and the education and income registries of statistics norway. this linkage provided longitudinal data with annual updates for both mothers and their children throughout 2010. for the present study, only mothers with children aged 4 years by the end of 2010 were considered for inclusion and a total of 66,211 cases were found eligible. among eligible cases, we excluded cases where the mother had emigrated or where either the mother or the child had died by the time of follow - up. norwegian sick leave regulations are complex and dependent on employment status, income level, as well as receipt of other social benefits (norwegian labour and welfare administration, 2015). therefore, as sickness benefit is granted to compensate for a temporary loss of income from employment while on sick leave, we also excluded cases for which the mothers were not considered to be at risk of sick leave 1 year after childbirth, that is, participants not active in the work force at the time of childbirth. this latter group included mothers with an income from employment below the limit entitling them to sickness benefit, in addition to mothers granted disability pension before the start of follow - up, leaving a sample of 58,532 mothers and children for the analyses. the study was approved by the regional committee for medical research ethics in south - eastern norway., sickness benefit is granted to compensate for loss of income for employed members of the national insurance scheme who are temporarily occupationally disabled due to an illness or injury. the benefit is connected to employment status, and economic compensation equivalent to the individual s employment income is given from the first day of a sick leave period to all employees with an income exceeding the limit entitling them to sickness benefit (i.e., approximately 4,600 in 2010). employers are obliged to compensate for the first 16 days of a sick leave period, and a certificate from a physician evaluating whether there are significant medical reasons for an absence from work is required after 3 days of absence. all periods of sick leave exceeding 16 days for up to 1 year are compensated for and recorded, including the main diagnosis, by the norwegian labour and welfare administration, with diagnostic information according to the international classification of primary care (icpc-2). based on information on sickness benefit obtained from the registry, three measures reflecting sick leave due to pd during follow - up were constructed. first, an indicator for any sick leave exceeding 16 days with the icpc codes p01p99 was constructed (i.e., any psychiatric disorder). second, an indicator for a long - term leave (i.e., continuous absence exceeding 8 weeks) with the icpc codes p01p99 was constructed, and third, an indicator reflecting a long - term leave due to depression (i.e., icpc p03 or p76) was constructed. any sick leave for conditions other than the icpc codes p01p99 the main exposure was early childhood shcn, assessed as receipt of attendance benefit by the age of 3 years. attendance benefit is a universally accessible benefit provided by the norwegian labour and welfare administration to compensate for domestic care - related expenses. the benefit may be granted to children with a medically documented need for special care and supervision due to illness, injury, or congenital disabilities. to be eligible for the benefit, the care has to be provided in a private care setting and is granted for persons who are not able to cope without supervision or who need help in performing activities of daily living. attendance benefit is granted solely based on the health care needs of the recipient and is not dependent on the financial situation of the recipient or the family. the benefit is granted to children who have care needs well exceeding those common to otherwise healthy children of comparable age, and about 24% of children 2.0 was used as a clinical cutoff for psychological distress according to convention (strand, dalgard, tambs, & rognerud, 2003). to take into account variation in the year and month of childbirth among participants in the moba cohort and to ensure equal and comparable time at risk for all participants in the study, all periods of sick leave due to pd were rescaled into its corresponding month following childbirth. in norway, parental leave is connected to employment and a parent is entitled to parental benefit and leave from work during the child s first year of life if he or she has been gainfully employed with a pensionable income for at least 6 of the 10 months before the benefit period (nordic council of ministers, 2011). the start of follow - up was thus set to the month the child turned 1 year of age for all participants, and in cases of no sick leave due to pd, follow - up lasted until the month the child turned 4 years of age. for cases with a sick leave due to pd, censoring occurred (i.e., participants left the risk pool) at the respective month of any first sick leave due to pd, a long - term leave due to pd, or a long - term leave due to depression. in addition, mothers being granted disability pension, and who therefore left the work force during the follow - up period, were no longer considered to be at risk of sick leave and were censored at the respective month of receipt of disability pension (equalling 0.6% of the sample). descriptive analyses were performed to assess demographic differences between mothers of children with and without shcn on the covariate factors included in all models estimated (i.e., maternal age, educational attainment, marital status, number of preschoolers, and psychological distress). hazard ratios (hr) with 95% confidence intervals (ci) to reflect participants risk of a sick leave due to pd were computed using the cox proportional hazard model, adjusted for the covariate factors listed above. the rate of sick leave among mothers of children without shcn was used as the reference for which to compare the rates of sick leave among mothers of children with mild and moderate / severe care needs, respectively. the hr is an outcome measure in time - to - event analysis, and an hr of 1 indicates that event rates are equal across respective groups, while for instance an hr of 2 indicates that twice as many in the group in question experience the event as in the reference group. if the range of the corresponding 95% ci does not contain the value 1, there is a significant difference in risk at the p 2.0 was used as a clinical cutoff for psychological distress according to convention (strand, dalgard, tambs, & rognerud, 2003). to take into account variation in the year and month of childbirth among participants in the moba cohort and to ensure equal and comparable time at risk for all participants in the study, all periods of sick leave due to pd were rescaled into its corresponding month following childbirth. in norway, parental leave is connected to employment and a parent is entitled to parental benefit and leave from work during the child s first year of life if he or she has been gainfully employed with a pensionable income for at least 6 of the 10 months before the benefit period (nordic council of ministers, 2011). the start of follow - up was thus set to the month the child turned 1 year of age for all participants, and in cases of no sick leave due to pd, follow - up lasted until the month the child turned 4 years of age. for cases with a sick leave due to pd, censoring occurred (i.e., participants left the risk pool) at the respective month of any first sick leave due to pd, a long - term leave due to pd, or a long - term leave due to depression. in addition, mothers being granted disability pension, and who therefore left the work force during the follow - up period, were no longer considered to be at risk of sick leave and were censored at the respective month of receipt of disability pension (equalling 0.6% of the sample). descriptive analyses were performed to assess demographic differences between mothers of children with and without shcn on the covariate factors included in all models estimated (i.e., maternal age, educational attainment, marital status, number of preschoolers, and psychological distress). hazard ratios (hr) with 95% confidence intervals (ci) to reflect participants risk of a sick leave due to pd were computed using the cox proportional hazard model, adjusted for the covariate factors listed above. the rate of sick leave among mothers of children without shcn was used as the reference for which to compare the rates of sick leave among mothers of children with mild and moderate / severe care needs, respectively. the hr is an outcome measure in time - to - event analysis, and an hr of 1 indicates that event rates are equal across respective groups, while for instance an hr of 2 indicates that twice as many in the group in question experience the event as in the reference group. if the range of the corresponding 95% ci does not contain the value 1, there is a significant difference in risk at the p <.05 level between the reference group and the comparison group in question. assessed as receipt of attendance benefit by 3 years of age, a total of 1.7% of the women in this population - based sample were mothers of children with medically documented shcn, of whom approximately half were mothers of children with mild care needs, while the other half were mothers of children with moderate and severe care needs. close to 50% of the children were granted attendance benefit already by 1 year of age, and close to 80% were granted the benefit by 2 years of age. receipt of attendance benefit at an early age was most common among children with moderate and severe care needs. descriptive analyses were performed to examine demographic differences between mothers of children with and without shcn on the covariate adjustment factors, all assessed before the start of follow - up. no significant differences were found for either maternal age or marital status at the time of childbirth, while a significantly larger proportion of mothers of children without shcn had completed education at a college or university level (68.7%) and were having their first child (60.7%) as compared with mothers of children with shcn (62.3% [18.8 ; p <.01 ] and 56.7% [6.4 ; p <.01 ], respectively). in addition, a somewhat larger proportion of mothers of children with shcn reported psychological distress during early pregnancy (15.1%) as did mothers of children without shcn (10.2% [25.4 ; p <.01 ]). a considerable proportion of the mothers in this population - based sample had at least one sick leave due to pd during 14 years after childbirth. moreover, a consistent association between the severity of the child s health care needs and the mother s risk of being absent from work due to pd was evident. whereas close to 11% of mothers of children without any documented shcn had a sick leave due to pd during the follow - up period, the corresponding proportions among mothers of children with mild and moderate / severe care needs were about 16% and 21%, respectively (table i). this trend was even more evident for long - term sick leaves due to pd in general and due to depression more specifically. mothers of children with mild and moderate / severe care needs had approximately twice the amount of physician - certified sick leave lasting for 8 weeks as compared with mothers of children without shcn for both long - term measures. table i. percentages and adjusted hazard ratios for maternal sick leave due to psychiatric disorders 14 years following childbirthnumber of observationsshort - term sick leave (< 8 weeks)long - term sick leave (8 weeks)any psychiatric disorder (icpc p01p99)any psychiatric disorder (icpc p01p99)depression (icpc p03 or p76)% sick leavehazard ratio95% confidence interval% sick leavehazard ratio95% confidence interval% sick leavehazard ratio95% confidence intervaltotal58,53210.96.63.2child shcn none57,35410.71.00reference6.51.00reference3.11.00reference mild49516.21.47[1.181.83]11.51.71[1.312.22]6.51.93[1.362.74 ] moderate / severe50321.11.99[1.642.41]13.52.05[1.622.61]6.82.05[1.462.88]maternal age 24 years5,71911.41.00reference6.31.00reference3.41.00reference 2529 years19,79910.91.07[0.971.17]6.41.16[1.031.31]3.11.12[0.951.33 ] 3034 years23,04710.51.04[0.951.14]6.51.21[1.071.37]3.01.12[0.941.32 ] 35 years9,96711.31.12[1.011.24]7.31.35[1.191.54]3.51.30[1.081.56]educational attainment < high school graduate4,25213.11.42[1.271.59]8.11.44[1.251.66]4.11.62[1.321.99 ] high school graduate14,10811.91.33[1.221.45]7.31.39[1.241.55]3.91.64[1.391.93 ] lower college / university31,39110.71.22[1.131.32]6.41.22[1.111.35]3.01.30[1.121.51 ] higher college / university8,7818.81.00reference5.41.00reference2.31.00referencemarital status married / cohabiting56,76210.81.00reference6.51.00reference3.11.00reference single1,77013.91.13[0.991.29]9.31.24[1.051.45]5.01.30[1.041.61]number of preschoolers one35,46310.61.00reference6.41.00reference3.11.00reference two20,94011.21.08[1.021.13]6.81.05[0.991.13]3.21.04[0.941.14 ] three or more2,12911.91.16[1.021.32]7.41.16[0.991.37]3.51.17[0.921.48]psychological distress no52,4929.81.00reference5.91.00reference2.71.00reference yes6,04019.72.08[1.952.22]12.82.23[2.062.41]7.12.55[2.282.84]note. all estimates adjusted for other variables in respective models.icpc = international classification of primary care ; shcn = special health care needs. percentages and adjusted hazard ratios for maternal sick leave due to psychiatric disorders 14 years following childbirth note. icpc = international classification of primary care ; shcn = special health care needs. after adjustment for factors commonly associated with sick leave and maternal employment status more generally, the mothers risks of being absent from work due to pd were strong and consistent for both short - term and long - term absences. apart from the effects of educational attainment and self - reported psychological distress, which were both associated with a substantial increased risk of sick leave, the mothers age, marital status, and number of preschoolers had only limited effects on their risk of being absent from work due to pd. in addition to an increased risk of sick leave due to any pd (hr : 1.47 ; 95% ci : 1.181.83 ; hr : 1.99 ; 95% ci : 1.642.41, respectively), mothers of children with mild (hr : 1.71 ; 95% ci : 1.312.22) and moderate / severe care needs (hr : 2.05 ; 95% ci : 1.622.61) both had a substantial risk of being long - term absent from work due to any pd in general and due to depression more specifically (hr : 1.93 ; 95% ci : 1.362.74 ; hr : 2.05 ; 95% ci : 1.462.88, respectively) compared with mothers of children without shcn. thus, the risk of sick leave due to pd following the birth of a child with shcn was substantial and demonstrates that children s shcn constitute an important prospective factor for mental health problems in maternal caregivers during the early years of motherhood. the findings of this population - based study show that mental health impairments are common among mothers of children with shcn. assessed as being granted sickness benefit due to pd during early motherhood, their mental health was significantly poorer than that of mothers of healthy children of similar age for all outcomes examined. additional childhood care needs were related to an increased risk of both short - term and long - term sick leave due to pd, evident for mothers of children with mild and moderate / severe care needs alike. the risk of sick leave was strong also after adjustment for important factors such as self - reported susceptibility to anxiety and depression, in this study assessed before any knowledge of children s shcn. self - reported susceptibility to psychological distress has previously been shown to be strongly related to long - term sick leave due to pd in both men and women (foss., 2010). the finding that the excess risk of being absent from work due to pd remained strong in the adjusted models indicates that the care demands and child - related stress experienced by many mothers of children with shcn may have a profound impact on their mental health. our findings thus concur with findings from previous studies on caregiver health following the birth of a child with shcn (brehaut. as children with additional needs often require care and assistance over an extended period of time in which otherwise healthy children become gradually more independent, their mothers may therefore be at prolonged risk of mental health problems. the often long - lasting care responsibilities associated with raising children with shcn have been associated with depressive symptoms in caregivers well beyond the early years of motherhood (rosenthal, learned, liu, & weitzman, 2013). because recovery from psychiatric conditions generally takes longer than recovery from other conditions (henderson., 2005), many caregivers may thus be prevented from participating in regular employment and from using the possible respite effects of employment for a prolonged period of time (gordon, cuskelly, & rosenman, 2008 ; morris, 2012). to our knowledge, this is the first study to investigate associations between children s shcn and mothers risk of sick leave due to pd. application of a large population - based sample with longitudinal register - based data constitutes a major strength, and ensures complete follow - up of all eligible participants who were considered to be at risk of sick leave 1 year after childbirth (i.e., all gainfully employed with an income entitling them to sickness benefit). such register - based studies are a powerful alternative to traditional longitudinal approaches, which often suffer from a large loss to follow - up and of systematic attrition (wadsworth., 2003). moreover, the data obtained from national registers provide valid objective measurements of factors previously assessed mostly through parental self - report, evident for both sick leave and for children s shcn. as such, the use of data on sick leave with physician - certified diagnostic information in accordance with the established icpc-2 coding system constitutes a considerable strength. although sick leave with pd and its corresponding icpc-2 diagnoses reflect psychiatric health problems resulting in lowered work capacity only among those employed, work participation among norwegian women is high during early motherhood (b., 2008), including that of mothers of young children with shcn (hauge., 2013). still, it may be that the extent of sick leave due to pd is underestimated due to the stigma associated with pd in general. however, as diagnoses are confidential and as knowledge of pd has increased while the stigma associated with these conditions has decreased, physician - certified sick leave is likely a more valid measurement than traditional self - reports, which may be prone to both selection and reporting bias (bratberg., 2009 ; moreover, while parents know best the specific care needs of their children and parental report has been shown to be fairly reliable for severe conditions, parental report of children s shcn may be subject to both response and recall bias that can invalidate findings (brehaut., 2009). although several studies have investigated employment - related consequences of specific conditions such as asthma and autism, variation in severity among individual cases may be great and need not reflect the actual care burden for the parents (van dyck, kogan, mcpherson, weissman, & newacheck, 2004). applying a medically documented assessment of the extent of the child s health care needs, relative to healthy children of similar age, may therefore better reflect the additional parental care burden associated with raising a child with shcn. attendance benefit is universally accessible and no children with documented needs, cared for within a private care setting, are left out of the benefit. although attendance benefit is granted to compensate for domestic expenses related to the child s additional care needs, not even the maximum amount granted for the most severe conditions will compensate for a loss of regular income. as such, it is not likely that attendance benefit alone is an incentive for mothers to reduce work hours or leave paid work altogether. rather, it is likely that mothers who can not remain in regular employment due to children s shcn will gradually experience a more constrained economic situation. some limitations of the present study also need to be acknowledged. although not uncommon for large epidemiological studies (hartge, 2006), the response rate in the moba cohort is lower than optimal. self - selection to the study may thus result in deviations from the larger population from which the women were sampled. comparisons of cohort participants with all women giving birth in norway during the same period identified several deviations in prevalence estimates, notably the underrepresentation of women < 25 years of age (nilsen., 2009). however, as young women are less likely to be stably employed in the labor market (oecd, 2011), they are also less likely to have an income from employment exceeding the limit entitling them to sickness benefit and thus of being eligible for the present study. as we adjusted for age and as deviations between the moba cohort and the general population mostly reflect differences in prevalence estimates rather than exposure - outcome associations (nilsen., 2009), selection bias is not likely to have threatened the validity of associations reported herein. in addition, as consent to participate in the study was obtained during early pregnancy before any knowledge of children s shcn, and as the data obtained from national registries ensures complete follow - up of all participants considered eligible for sickness benefit, bias due to possible systematic attrition is also reduced. moreover, the study of mental health impairments following the birth of a child with shcn based on the mother s use of sick leave is restricted to those in employment only. consequently, we are not able to observe the mental health in mothers not participating in the labor market. although many mothers withdraw from the labor market following the birth of a child with shcn, most do not, and temporary withdrawal from the labor market during early motherhood is common among mothers of children without shcn alike (b. thus, our findings on mental health impairments following childbirth are not likely to be systematically biased based on the mothers withdrawal from the labor market. another potential limitation that deserves some attention is that our exposure measure of children s shcn yields receipt of attendance benefit by age 3 years only. as such, it is possible that some children are not identified as having shcn by the end of the follow - up period, while in reality having care needs well exceeding those of otherwise healthy children. however, as receipt of attendance benefit is based on a medically documented need for special care and supervision, the special needs of children that may affect their mothers risk of sick leave due to pd will likely precede being granted the benefit. as approximately 80% of the children receiving attendance benefit in this study were granted the benefit already by 2 years of age, children s shcn is likely to influence mothers mental health, necessitating prolonged work absences already from an early age. moreover, although the study included a sizeable sample of norwegian mothers, too few of their children were nonetheless identified as having moderate and severe care needs for them to be analyzed as distinct categories. as the severity of children s shcn has previously been shown to be associated with maternal employment - related outcomes (hauge., 2013), it is possible that its effect on mothers use of sick leave is somewhat attenuated for the most severe conditions. however, as mothers of children with mild and moderate / severe care needs had an increased risk of sick leave due to pd alike, their risk was nevertheless different from that of mothers of children without shcn during the early years of motherhood. notwithstanding the limitations outlined above, the present study provided reliable evidence that caring for children with shcn can indeed take a toll on the mental health of many caregivers. the consistent finding that mothers of children with both mild and more severe health care needs are more often long - term absent from work due to pd in general and due to depression more specifically, indicates that their often heavier - than - average caregiving burdens can severely impact their own health and may possibly impact on the overall welfare of the entire family in the long run (reichman., 2008). prolonged work absences due to their own or their children s health impairments can lead to feelings of isolation, erosion of qualifications, and lowered self - esteem for this group of mothers, making return to work increasingly more difficult and increasing the mothers risk of ending up on permanent disability pensions (bratberg. inclusion of employees faced by such challenges in more adapted and flexible work arrangements might hinder some mothers of children with shcn from dropping out of employment altogether. furthermore maternal depression has been shown to be related also to child adjustment problems across a wide age range (downey & coyne, 1990 ; goodman., 2011). children with shcn are likely to be particularly vulnerable to adverse effects of their mothers mental health impairments, with maternal depression constituting an additional source of disadvantage faced by this group of children who are already at risk. the psychological, behavioral, and economic implications outlined underscore the importance of early identification and intervention. services and support for mothers that address their emotional reactions and challenges are clearly needed. affected parents and appropriate health care services therefore need information relating to particular challenges and risks faced by families raising children with shcn. reducing parenting stress and alleviating their caregiving burdens can therefore serve as important targets for future prevention and intervention (cousino & hazen, 2013). this project was supported by a grant from the research council of norway (es-464464). the norwegian mother and child cohort study is supported by grants from the norwegian ministry of health and the ministry of education and research, nih / niehs (contract no. n01-es-75558), nih / ninds (grant nos uo1 ns 047537 - 01 and uo1 ns 047537 - 06a1), and the research council of norway / fuge (grant no. | objective child - related stress following the birth of a child with special health care needs (shcn) can take a toll on parental health. this study examined how the risk of sick leave due to psychiatric disorders (pd) among mothers of children with shcn compares with that of mothers of children without shcn during early motherhood. methods responses from 58,532 mothers participating in the norwegian mother and child cohort study were linked to national registries and monitored for physician - certified sick leave from the month of their child s first birthday until the month of their child s fourth birthday. results as compared with mothers of children without shcn, mothers of children with mild and moderate / severe care needs were at substantial risk of a long - term sick leave due to pd in general and due to depression more specifically. conclusions extensive childhood care needs are strongly associated with impaired mental health in maternal caregivers during early motherhood. |
gastric cancer is one of the most frequently diagnosed malignant neoplasms and has the second - highest cancer - related mortality rate in the world. in east asia especially, like china, japan, and korea, more than one million new cases are diagnosed each year. most patients with gastric cancer are diagnosed at advanced clinical stages with a high ratio of lymph node metastasis. despite a curative operation and postoperative adjuvant therapy, currently, the tumor (t) node (n) metastasis (m) stage is still the most important prognostic factor for gastric cancer. therefore, it is very important to find novel factors for the early diagnostic and prognostic evaluation of gastric cancer. human dickkopf-1 is a member of the dickkopf gene family, which is composed of dickkopf-1, dickkopf-2, dickkopf-3, and dickkopf-4, together with a unique dickkopf-3-related protein termed soggy. several recent studies have also implicated members of the dickkopf family of wnt inhibitors in suppression of human cancer. reduced levels of dickkopf-3 overexpression of dickkopf-1 or dickkopf-3 resulted in inhibition of cell tumorigenicity, cell motility, and invasiveness. recently it has been demonstrated that expression of dickkopf-1, -2, and -3 is reduced in most of melanoma cell lines and most of tumor samples. among the members of the dickkopf family, dickkopf-1 is a 35-kda secreted protein involved in embryonic development and known as a potent inhibitor of the wnt signaling pathway, which plays a critical role in cell patterning, proliferation, and fate determination during embryogenesis. it has been shown that the dickkopf-1 gene has a restricted expression in placenta and mesenchymal stem cells only, but not in other normal tissues. it has demonstrated that dickkopf-1 was downregulated in human tumors, indicating that it might act as a tumor suppressor. for example, mikheev. showed that dickkopf-1 activates cell death in melanoma cells. suggested that dickkopf-1 was responsible for the inhibition of cell growth and induction of apoptosis in human mesothelioma cells. demonstrated that dickkopf-1 suppressed the tumorigenicity of two human breast cancer cell lines that also lack an activated wnt signaling. dickkopf-1 was found in 26 out of 32 human hepatoblastomas and 5 out of 6 cases of wilms ' tumor. the expression of dickkopf-1 was also elevated in 21 out of 73 cases of breast cancer, in particular hormoneresistant breast tumors. additionally, gene expression profiles revealed that dickkopf-1 was overexpressed in prostatic, lung, esophageal, and hepatic carcinoma, serving as a serologic and prognostic biomarker. wang and zhang also reported that dickkopf-1 is frequently overexpressed in ovarian serous carcinoma and involved in tumor invasion. these studies suggested that dickkopf-1 is associated with the tumorigenesis and tumor progression. to our knowledge, the role of dickkopf-1 expression in gastric cancer was rarely studied. to address this problem, in this study, we examined the expression of dickkopf-1 in surgical specimens of gastric cancer to explore the possible correlation between dickkopf-1 expression and clinicopathological variables and to determine its prognostic value. this study was approved by the research ethics committee of huai'an no.1 hospital, china. gastric cancer tissues were collected from the gastrectomy specimens of 328 patients (235 male, 93 female ; median age = 60.0 years ; range = 28~92 years) treated at the department of surgery, huai'an no.1 hospital, between march 2000 and march 2005. tissues were formalin fixed, paraffin embedded, and clinically and histopathologically diagnosed at the departments of gastrointestinal surgery and pathology. the survival time was counted from the date of surgery to the follow - up deadline, or date of death (usually the result of cancer recurrence or metastasis). according to the who histological classification of gastric cancer formulated in 2002, there were 245 tubular adenocarcinomas, 12 papillary adenocarcinomas, 22 mucinous adenocarcinomas, and 49 signet - ring cell carcinomas. nine were highly differentiated adenocarcinomas, 96 were well- or moderately differentiated adenocarcinomas, 220 were poorly differentiated, and 3 were undifferentiated adenocarcinomas. sixty - eight cases were categorized as stage i, 78 as stage ii, 130 as stage iii, and 52 as stage iv. three hundred and twenty - eight noncancerous human gastric tissues were obtained from gastrectomy of adjacent gastric cancer margins (greater than 5 cm). routine chemotherapy was given after surgery to patients with advanced - stage disease, but none of the patients received radiation treatment. the clinical and pathologic parameters were obtained from the pathological reports and presented in table 1. real - time quantitative reverse transcriptase - polymerase chain reaction (qrt - pcr) was performed to detect the expression of dikkopf-1 mrna in 20 pairs of human gastric cancer and adjacent noncancerous human gastric tissues. total rna was isolated from human gastric cancer and adjacent noncancerous human gastric tissues by an rneasy mini kit (qiagen). random - primed cdna synthesis was performed using quantitect reverse transcription kit (qiagen). qrt - pcr was performed using a ptc-1000 programmable thermal controller (mj research, waltham, ma, usa) with quantitect sybr green pcr kit (qiagen, valencia, ca, usa) according to the manufacturer 's instructions. for amplifications, the following primers were designed : dikkopf-1 : forward, 5-aga cca ttg acaact acc agc cgt-3 ; reverse, 5-tct gga ata ccc atc caa ggt gct-3 and gapdh : forward, 5-cct ccg gga aac tgt ggc gtg atg g-3 ; reverse, 5-aga cgg cag gtc agg tcc acc act g-3. each sample was examined in triplicate, and the amounts of the pcr products were nonneoplasticized to gapdh which served as internal control. to confirm the specificity of the anti - dickkopf-1 antibody, western blotting test human gastric cancer tissues were lysed in 100 l lysis buffer (50 mm tris - hcl ph 7.4, 125 mm nacl, 0.1% (v / v) np-40, 5 mm ethylene diamine tetraacetic acid (edta), 50 mm naf, 50 g / ml phenylmethylsulfonyl fluoride (pmsf), 10 g / ml leupeptin, 10 g / ml soybean trypsin inhibitor, and 1 g / ml aprotinin ] on ice for 10 min). anti - dickkopf-1 polyclonal antibody (santa cruz biotechnology, santa cruz, ca, usa) was used in primary reaction. immunohistochemical study for dickkopf-1 was performed on formalin - fixed, paraffin - embedded, 4-m - thick tissue sections using the avidin - biotin - peroxidase complex method. in brief, the sections were deparaffinized and dehydrated using a graded series of ethanol solutions. endogenous peroxidase activity was halted through the administration of 0.3% hydrogen peroxidase and methanol for 20 min. after having been rinsed in phosphate - buffered saline (pbs), the tissue sections were processed in a 0.01 m citrate buffer (ph 6.0) inside a heat - resistant plastic container. after incubation with rabbit polyclonal primary antibody dickkopf-1 (santa cruz biotechnology, santa cruz, ca, usa, dilution 1 : 60), which was used in several previous studies [16, 1921 ], for 2 h at room air temperature, staining was performed by labeled streptavidin - biotin method. immunostaining was scored by two independent experienced pathologists, who were blinded to the clinicopathological parameters and clinical outcomes of the patients. the scores of the two pathologists were compared, and any discrepant scores were trained through reexamining the stainings by both pathologists to achieve a consensus score. the number of positive - staining cells showing immunoreactivity of dickkopf-1 in ten representative microscopic fields was counted, and the percentage of positive cells was calculated. the percentage scoring of immunoreactive tumor cells was as follows : 0 (0%), 1 (110%), 2 (1150%), and 3 (> 50%). the staining intensity was visually scored and stratified as follows : 0 (negative), 1 (weak), 2 (moderate), and 3 (strong). a final score was obtained for each case by multiplying the percentage and the intensity score. therefore, tumors with a multiplied score exceeding 4 (i.e., tumors with a moderate or strong staining intensity of > 10% of the tumor cells) were deemed to be showing high expression of dickkopf-1 ; all other scores were considered to be low expression. the software of spss version13.0 for windows (spss inc, il, usa) was used for statistical analysis. measurement data were analyzed using the student 's t - test, while categorical data were analyzed using or fisher 's exact tests. survival curves were estimated using the kaplan - meier method and the log - rank test was used to compute differences between the curves. multivariate analysis using the cox proportional hazards regression model was performed to assess the prognostic value of protein expression levels. correlation coefficients between dickkopf-1 protein expression and clinicopathological findings were estimated using the pearson correlation method. real - time quantitative rt - pcr was performed to detect the expression of dickkopf-1 mrna in 20 pairs of human gastric cancer and adjacent noncancerous human gastric tissues. the expression level of dickkopf-1 mrna showed significant difference between gastric cancer tissues and corresponding noncancerous gastric tissues (figure 1(a)). the average ratios of dickkopf-1 mrna to gapdh mrna in gastric cancer tissues and noncancerous gastric tissues were 0.68 0.18 and 0.09 0.05, respectively (figure 1(b)), which suggested that the expression of dickkopf-1 mrna was significantly higher in gastric cancer tissues than that in corresponding noncancerous gastric tissues (p 0.05) (table 1). this showed that the depth of invasion (p = 0.02), lymph node (p = 0.01) and distant metastasis (p = 0.008), tnm stage (p = 0.006), and the level of dickkopf-1 expression (p = 0.002) were all independent prognostic factors in patients with gastric cancer. however, the location of the tumor, tumor size, histological type, differentiation, and vessel invasion had no prognostic value. for patients with stage i, ii, or iii disease, the 5-year survival rate for those with high dickkopf-1 expression were significantly lower than in patients with low expression. for stage i, the cumulative 5-year survival rate was 90.7% in the low - expression group, but only 71.4% in the high - expression group (p = 0.001, figure 3(a)) ; for stage ii, the cumulative 5-year survival rate was 69.8% in the low - expression group, but only 54.3% in the high - expression group (p = 0.001, figure 3(b)) ; for stage iii, the cumulative 5-year survival rate was 55.2% in the low - expression group, but only 21.8% in the high - expression group (p = 0.0001, figure 3(c)). for stage iv the expression of dickkopf-1 did not correlate with the 5-year survival rate (14.3% in the low - expression group and 2.2% in the high - expression group ; p = 0.5). gastric cancer is associated with a much shorter time to recurrence and a shorter survival period after recurrence. because of the early metastasis and strong invasion, it is very important to estimate the malignant degree and invasion tendency of gastric cancer in order to guide clinical diagnosis and treatment of this disease. in the present study, immunohistochemistry was used to analyze the expression levels of dickkopf-1 in 328 clinicopathologically characterized gastric cancer patients. the results showed that dickkopf-1 protein was significantly upregulated in gastric cancer tissues compared with normal gastric tissues, which was confirmed by real - time qrt - pcr analysis on the expression of dickkopf-1 mrna. in addition, high levels of dickkopf-1 expression in gastric cancer lesions were associated with depth of invasion, vessel invasion, lymph node and distant metastasis, and tnm stage. furthermore, the up - regulation of dickkopf-1 was an independent prognostic indicator for gastric cancer. therefore, dickkopf-1 may be a valuable diagnostic marker and therapeutic target for gastric cancer. several recent studies have demonstrated that dickkopf-1 plays multiple biological roles in a variety of cancers. gene expression profile analysis revealed that dickkopf-1 was highly transactivated in the great majority of lung cancers and esophageal squamous cell carcinomas. in contrast, expression of the dickkopf-1 gene, a downstream target of -catenin / tcf, decreases in human colon tumors, indicating its tumor - suppressing role in this neoplasia. human dickkopf-1 was reported to be responsive to p53 although it has been shown to be induced by dna damage and to sensitize to apoptosis in a p53-independent manner. however, the involvement of dickkopf-1 in gastric cancers has not been defined. in 2007, sato. reported that dickkopf methylation was frequently observed in gastric cancer cell lines. but shi. in 2009 demonstrated that serum concentrations of dickkopf-1 were decreased significantly in groups of patients with gastric cancer compared with healthy controls. additionally, these previous studies could not clarify the clinical impact of dickkopf-1 expression or the prognostic value for gastric cancer. therefore, this is the first report to determine the correlation between dickkopf-1 expression and clinical factors in gastric cancer. our results showed that dickkopf-1 was upregulated in gastric cancer tissues compared with noncancerous tissues and the high or low expression of dickkopf-1 in gastric cancer directly affected clinical factors. this discrepancy with the previous study of shi. may be due to the small numbers used in their study. with respect to the results of survival analysis, in patients with stage i, ii, and iii gastric cancer, the 5-year survival rate for those with high dickkopf-1 expression was significantly lower than that of patients with low expression. however multivariate analysis suggested that the depth of invasion, lymph node and distant metastasis, tnm stage, and dickkopf-1 up - regulation were independent prognostic indicators for gastric cancer. it is known that dickkopf-1 expression correlates with a reduction in disease - free survival and is an independent predictor of poor prognosis in human esophageal squamous cell carcinoma. in ovarian serous carcinoma, wang and zhang also showed that the level of dickkopf-1 expression is associated with adverse outcomes. dickkopf-1, p - jnk1, and the coexpression of dickkopf-1 and p - jnk1 were all unfavorable prognosis factors for ovarian serous carcinoma patients. dickkopf-1, alone or combined with p - jnk1, was an independent predictor for the 5-year survival. additionally, dickkopf-1 secreted and stably expressed in cerebral fluids can also be applicable to detect presence of glioblastoma and to develop novel prognostic treatments. in conclusion, our data showed that a subset of patients with gastric cancer had overexpression of dickkopf-1, which was associated with an aggressive clinical course and poor overall survival. therefore, dickkopf-1 may play a significant role in the progression of gastric cancer, which was consistent with most other cancers. in addition, such information may direct us toward novel therapeutic and prognostic possibilities for treating gastric cancer and improving patient outcomes. this is the first report to suggest a relationship between dickkopf-1 and prognosis in patients with gastric cancer, and further prospective analysis would be worth doing. | aim. to investigate the involvement of dickkopf-1 expression in gastric cancer. methods. dickkopf-1 mrna and protein expression were determined by real - time quantitative reverse transcriptase - polymerase chain reaction (qrt - pcr) and immunohistochemistry in specimens of primary cancer and their adjacent noncancerous tissues in gastric cancer patients. results. dickkopf-1 mrna and protein expression levels were both significantly upregulated in gastric cancer lesions compared with adjacent noncancerous tissues. its positive expression was correlated with depth of invasion, vessel invasion, lymph node and distant metastasis, and tnm stage of tumors. additionally, in stages i, ii, and iii gastric cancers, the 5- year survival rate of patients with a high expression of dickkopf-1 was significantly lower than that in patients with low expression. in stage iv, dickkopf-1 expression did not correlate with the 5-year survival rate. further multivariate analysis suggested that the up - regulation of dickkopf-1 was an independent prognostic indicator for gastric cancer. conclusion. a subset of cases with gastric cancer revealed the up - regulation of dickkopf-1, which was associated with a progressive pathological feature and an aggressive clinical course. therefore, dickkopf-1 expression may be predictor for poor prognosis in patients with gastric cancer. this is the first report describing the involvement of dickkopf-1 in gastric cancer. |
leptomeningeal carcinomatosis is a rare but fatal manifestation of metastatic breast cancer, with limited treatment options. median overall survival of untreated patients with leptomeningeal carcinomatosis is only 4 - 6 weeks. although the prognosis for patients with breast cancer and leptomeningeal carcinomatosis is relatively good compared with that of patients with other solid tumors, overall survival is 3 - 5 months. investigation of intrathecal (it) treatment with trastuzumab for leptomeningeal carcinomatosis is currently underway ; however, there has been no consensus. we report on two cases of human epidermal growth factor receptor 2 positive (her2 +) breast cancer treated with it trastuzumab for leptomeningeal carcinomatosis. a 47-year - old woman presented with a palpable mass on the left breast in may 2003. a modified radical mastectomy was performed, and her2 + infiltrating ductal carcinoma (stage iiib, nuclear grade i, estrogen receptor [er]+, progesterone receptor [pr]+, her2 + [immunohistochemistry 2 + and fluorescence in situ hybridization+ ]) was confirmed by histopathological examination. metastasis to nine of 10 lymph nodes was detected, thus six cycles of adjuvant chemotherapy with cyclophosphamide, doxorubicin, and 5-fluorouracil (5-fu) were given, followed by adjuvant radiation therapy and hormonal therapy with toremifene. in february 2005, she developed symptoms of central nervous system (cns) involvement, including headache, nausea, and vomiting. contrast - enhanced magnetic resonance imaging (mri) of the brain showed multiple metastatic tumor masses in the cerebrum and cerebellum. she received whole brain radiotherapy for the brain metastases and started palliative hormone therapy with goserelin plus anastrozole. despite improvement in some brain metastatic lesions with therapy, in april 2007 the treatment was changed to goserelin plus tamoxifen and was continued until february 2010 when metastases to the right supraclavicular lymph node, right neck, and chest wall were noted at restaging. after she underwent navigation - guided tumor mass removal of brain metastases and excision of the right chest wall mass in april 2010, she received three cycles of chemotherapy with docetaxel plus doxorubidin. she was subsequently treated with four additional palliative lines of chemotherapy, including 14 cycles of intravenous (iv) trastuzumab (july 2010-april 2011), xeloda plus lapatinib (may 2011-december 2011), gemcitabine plus cisplatin (february 2012, 1 cycle), and cmf (cyclophosphamide, methotrexate plus 5-fu, march 2012-may 2012, 3 cycles). she underwent stereotatic radiosurgery (srs) twice for brain metastases in 2008 and 2011. in april 2012, the patient developed headache, vomiting, and gait disturbance. newly visible and increased multifocal enhancing nodules in both frontal, the right parietal, and metastases to the liver, common bile duct, lung, and right pleura were also confirmed by positron emission tomography - computed tomography. after srs for parenchymal metastases of the brain, weekly it 50 mg trastuzumab plus it 15-mg methotrexate through the ommaya reservoir was begun for the leptomeningeal nodules. although she presented with mild weakness of the lower extremities, brain mri showed remarkable improvement in the leptomeningeal nodules after 5 months of it chemotherapy (fig. in addition, csf cytology was free of malignant or atypical cells during it therapy, with com - plete resolution of symptoms in 2 days. the therapy was well tolerated, and she received 20 administrations of weekly it trastuzumab plus methotrexate over 7 months. the it methotrexate was stopped transiently due to gait disturbance, but no evidence of newly developed enhancing nodules was observed on brain mri until january 2013 (fig. she continued weekly it chemotherapy with a reduced dose of trastuzumab (25 mg) for maintenance therapy and received 59 administrations during 18 months, with complete response of the brain mass, indicating complete disappearance of the radiological findings compared to the baseline examination. unfortunately, in november 2013, she refused further treatment due to progression of systemic disease and poor performance status. she died 2 months after the last it trastuzumab administration in january 2014, after surviving more than 20 months since the diagnosis of leptomeningeal carcinomatosis. a 42-year - old woman presented with a palpable mass on the right breast in july 2008. histopathological examination of the specimens sampled by fine - needle biopsy revealed her2 amplified infiltrating ductal carcinoma (nuclear grade ii, intermediate, er, pr, her2 3 + ; clinical stage ct2n1m0, iib). after receiving four cycles of neoadjuvant chemotherapy with doxorubicin and docetaxel, she underwent a right half mastectomy with reconstruction in november 2008. metastasis to five of 11 axillary lymph nodes was confirmed, thus, two cycles of doxorubicin and docetaxel were administered, followed by adjuvant radiation therapy. in april 2010, she presented with headache, dizziness, nausea, dysarthria, and showed a tendency to fall to the right. contrast - enhanced brain mri showed a metastatic tumor mass on the cerebellar vermis, and local relapse was also detected in the right breast by restaging. the intratentorial supracerebellar tumor mass was removed, and a duroplasty was performed with a modified radical mastectomy in may 2010. however, she presented again in january 2012 with symptoms of increased intracranial pressure, including headache, nausea, and vomiting. 2a), and csf obtained by lumbar puncture showed a few atypical cells and a slightly elevated protein level (58.9 mg / dl). she started weekly it therapy with escalating doses of trastuzumab (25 mg > 50 mg) with iv trastuzumab (2 mg / kg) plus iv paclitaxel (80 mg / m). after eight cycles of chemotherapy, she was treated by whole brain radiotherapy, followed by weekly iv and it trastuzumab (50 mg) as maintenance therapy. in may 2012, after 16 cycles of therapy, her regimen was changed to three weekly iv trastuzumab plus it trastuzumab (50 mg) treatments. the csf remained free of malignant or even atypical cells during it therapy, and, compared with the brain mri at the beginning of the it trastuzumab cycle, the brain parenchymal metastatic mass and leptomeningeal nodules had decreased in size (fig. the patient received a total of 33 administrations of weekly and three weekly iv plus it trastuzumab treatments over 13 months with complete resolution of neurological symptoms(24 and 9 cycles, respectively). although it trastuzumab therapy was stopped due to dizziness, she remains alive, with survival of more than 29 months since being diagnosed with leptomeningeal carcinomatosis. a 47-year - old woman presented with a palpable mass on the left breast in may 2003. a modified radical mastectomy was performed, and her2 + infiltrating ductal carcinoma (stage iiib, nuclear grade i, estrogen receptor [er]+, progesterone receptor [pr]+, her2 + [immunohistochemistry 2 + and fluorescence in situ hybridization+ ]) was confirmed by histopathological examination. metastasis to nine of 10 lymph nodes was detected, thus six cycles of adjuvant chemotherapy with cyclophosphamide, doxorubicin, and 5-fluorouracil (5-fu) were given, followed by adjuvant radiation therapy and hormonal therapy with toremifene. in february 2005, she developed symptoms of central nervous system (cns) involvement, including headache, nausea, and vomiting. contrast - enhanced magnetic resonance imaging (mri) of the brain showed multiple metastatic tumor masses in the cerebrum and cerebellum. she received whole brain radiotherapy for the brain metastases and started palliative hormone therapy with goserelin plus anastrozole. despite improvement in some brain metastatic lesions with therapy, in april 2007 the treatment was changed to goserelin plus tamoxifen and was continued until february 2010 when metastases to the right supraclavicular lymph node, right neck, and chest wall were noted at restaging. after she underwent navigation - guided tumor mass removal of brain metastases and excision of the right chest wall mass in april 2010, she received three cycles of chemotherapy with docetaxel plus doxorubidin. she was subsequently treated with four additional palliative lines of chemotherapy, including 14 cycles of intravenous (iv) trastuzumab (july 2010-april 2011), xeloda plus lapatinib (may 2011-december 2011), gemcitabine plus cisplatin (february 2012, 1 cycle), and cmf (cyclophosphamide, methotrexate plus 5-fu, march 2012-may 2012, 3 cycles). she underwent stereotatic radiosurgery (srs) twice for brain metastases in 2008 and 2011. in april 2012, the patient developed headache, vomiting, and gait disturbance. newly visible and increased multifocal enhancing nodules in both frontal, the right parietal, and metastases to the liver, common bile duct, lung, and right pleura were also confirmed by positron emission tomography - computed tomography. after srs for parenchymal metastases of the brain, weekly it 50 mg trastuzumab plus it 15-mg methotrexate through the ommaya reservoir was begun for the leptomeningeal nodules. although she presented with mild weakness of the lower extremities, brain mri showed remarkable improvement in the leptomeningeal nodules after 5 months of it chemotherapy (fig. in addition, csf cytology was free of malignant or atypical cells during it therapy, with com - plete resolution of symptoms in 2 days. the therapy was well tolerated, and she received 20 administrations of weekly it trastuzumab plus methotrexate over 7 months. the it methotrexate was stopped transiently due to gait disturbance, but no evidence of newly developed enhancing nodules was observed on brain mri until january 2013 (fig. she continued weekly it chemotherapy with a reduced dose of trastuzumab (25 mg) for maintenance therapy and received 59 administrations during 18 months, with complete response of the brain mass, indicating complete disappearance of the radiological findings compared to the baseline examination. unfortunately, in november 2013, she refused further treatment due to progression of systemic disease and poor performance status. she died 2 months after the last it trastuzumab administration in january 2014, after surviving more than 20 months since the diagnosis of leptomeningeal carcinomatosis. a 42-year - old woman presented with a palpable mass on the right breast in july 2008. histopathological examination of the specimens sampled by fine - needle biopsy revealed her2 amplified infiltrating ductal carcinoma (nuclear grade ii, intermediate, er, pr, her2 3 + ; clinical stage ct2n1m0, iib). after receiving four cycles of neoadjuvant chemotherapy with doxorubicin and docetaxel, she underwent a right half mastectomy with reconstruction in november 2008. metastasis to five of 11 axillary lymph nodes was confirmed, thus, two cycles of doxorubicin and docetaxel were administered, followed by adjuvant radiation therapy. in april 2010, she presented with headache, dizziness, nausea, dysarthria, and showed a tendency to fall to the right. contrast - enhanced brain mri showed a metastatic tumor mass on the cerebellar vermis, and local relapse was also detected in the right breast by restaging. the intratentorial supracerebellar tumor mass was removed, and a duroplasty was performed with a modified radical mastectomy in may 2010. however, she presented again in january 2012 with symptoms of increased intracranial pressure, including headache, nausea, and vomiting. 2a), and csf obtained by lumbar puncture showed a few atypical cells and a slightly elevated protein level (58.9 mg / dl). she started weekly it therapy with escalating doses of trastuzumab (25 mg > 50 mg) with iv trastuzumab (2 mg / kg) plus iv paclitaxel (80 mg / m). after eight cycles of chemotherapy, she was treated by whole brain radiotherapy, followed by weekly iv and it trastuzumab (50 mg) as maintenance therapy. in may 2012, after 16 cycles of therapy, her regimen was changed to three weekly iv trastuzumab plus it trastuzumab (50 mg) treatments. the csf remained free of malignant or even atypical cells during it therapy, and, compared with the brain mri at the beginning of the it trastuzumab cycle, the brain parenchymal metastatic mass and leptomeningeal nodules had decreased in size (fig. the patient received a total of 33 administrations of weekly and three weekly iv plus it trastuzumab treatments over 13 months with complete resolution of neurological symptoms(24 and 9 cycles, respectively). although it trastuzumab therapy was stopped due to dizziness, she remains alive, with survival of more than 29 months since being diagnosed with leptomeningeal carcinomatosis. leptomeningeal carcinomatosis from her2 + breast cancer is rare but important because of its increasing incidence and devastating clinical course. advances in early diagnosis of cns diseases have been made in recent decades, and systemic chemotherapy, particularly with trastuzumab, has extended survival of patients with her2 + breast cancer, however, despite aggressive treatment, prognosis of leptomeningeal carcinomatosis is still poor. the blood brain barrier (bbb) limits penetration of > 200-kda - sized molecules into the cns. thus, systemically administered trastuzumab, a 185-kda monoclonal antibody, has only minimal infiltration into the csf through an intact bbb. pestalozzi and brignoli reported that the trastuzumab level in csf was 300-fold lower than that in serum of patients with leptomeningeal carcinomatosis receiving iv weekly trastuzumab therapy. a study by stemmler. also showed that the ratio of median serum trastuzumab level to median csf trastuzumab level was 420:1, although the ratio improved to 76:1 due to an impaired bbb after radiotherapy. therefore, it therapy with trastuzumab is an attractive therapeutic option for achievement of a high csf drug concentration with a smaller dose, while reducing systemic drug toxicity. in case studies reporting successful results of it therapy with trastuzumab in patients with leptomeningeal carcinomatosis from her2 + breast cancer, it trastuzumab was administered in various doses of 25 - 150 mg and using different schedules, including weekly to every 3 weeks. the case report by hofer. demonstrated the efficacy of it trastuzumab at a dose of 150 mg at 3 weekly intervals, but there is the question of whether long - term therapy over 6 months with such a high dose is safe and well - tolerable. according to a systematic review and pooled analysis by zagouri., a significant improvement in overall survival was observed in 68.8% of cases, but no evidence has shown that a particular method is superior to another. good control of leptomeningeal disease was achieved with it trastuzumab in both of our patients, even though the first patient was heavily treated with five lines of cytotoxic chemotherapy and three lines of hormonal therapy, with survival durations of 20 and 29 months, respectively. our report also demonstrates that long - term it therapy with relatively high trastuzumab doses (25 - 50 mg) for more than 1 year is safe and efficacious without severe disability of cognitive function. we suggest that it trastuzumab is a promising treatment for patients with her2 + breast cancer and leptomeningeal carcinomatosis. further studies are warranted in order to optimize dose, interval, maintenance duration, and combination drugs for treatment, and to standardize consensual response criteria. | leptomeningeal carcinomatosis is a fatal manifestation of metastatic breast cancer. investigation of intrathecal (it) trastuzumab for leptomeningeal carcinomatosis is currently underway ; however, there has been no consensus. we report on two cases of human epidermal growth factor receptor 2 positive (her2 +) breast cancer following it trastuzumab for leptomeningeal carcinomatosis. the first patient was treated with weekly it 15 mg methotrexate plus it 50 mg trastuzumab for 7 months, followed by it trastuzumab (50 mg > 25 mg) for 18 months. the other patient received it trastuzumab with systemic chemotherapy (trastuzumab and/or paclitaxel) for 13 months. good control of leptomeningeal disease was achieved with it trastuzumab in both patients, with survival durations of 20 and 29 months, respectively. we suggest that it trastuzumab is a promising treatment for patients with her2 + breast cancer and leptomeningeal carcinomatosis. |
sweat gland carcinoma (sgc) is a rare tumor particularly over scalp, which was reported first in 1865. the treatment of choice is wide excisional biopsy, with extensive excision and regional lymph node dissection. we report a case of 42-year - old female with ulcerative lesion over scalp since 6 months proved as sgc on histopathology with local spread to cervical lymph nodes without any bony infiltration. a 42-year - old female presented in skin out - patient department (opd) with history of (h / o) of pus filled lesions over scalp which ruptured leading to ulcer formation since almost 6 months. no h / o cough, cold, fever, vomiting, headache or hematuria present. no h / o weight loss, any git symptoms, breathlessness, chest pain or eye symptoms present. no h / o dm / ht / bt / tb / epilepsy / asthma / ihd / copd / thyroid disease. on examination single 4 5 cm non - tender ulcer with irregular and unhealthy margin, serous and foul - smelling discharge and slough, present over the occipital region of scalp [figure 1 ]. bilateral cervical lymph nodes enlarged and ruptured forming a well - defined round to oval ulcer of 2 - 3 cm in size with purulent discharge, rolled margin on left side and pus discharge with eschar formation on right side [figure 2 ]. ulcer with irregular and unhealthy margin, serous discharge and slough over the occipital region of scalp well - defined round to oval ulcer (a) with purulent discharge on left side (b) eschar formation on right side routine investigations, liver function test (lft) and renal function test (rft) were in normal range. chest x - ray / ecg / usg abdomen and computed tomography (ct) brain was normal. wedge shaped biopsy done from the ulcer over scalp by surgeon, showed epidermal ulceration, malignant epithelial cells arranged in cribriform pattern, nest, cords and in strands. the cells are pleomorphic with round to oval nuclei and dispersed chromatin, have eosinophilic and indistinct cytoplasm with nuclear and nucleolar pleomorphism. few cells have foamy vacuolated cytoplasm, zone of necrosis and abnormal mitotic figures. intraductal necrosis was also noted [figure 3 ]. changes were suggestive of adenocarcinoma of sweat gland over scalp. wide local excision of ulcer was done with rotational flap and regional lymph node dissection. epidermal ulceration, malignant epithelial cells arranged in cribriform pattern, nest, cords and in strands, h and e, (a) 4, (b) 10 (c) tumor island with central necrosis in strands. pleomorphic cells with round to oval nuclei, dispersed chromatin, eosinophilic and indistinct cytoplasm with nulear and nucleolar pleomorhism. sgc represents a rare group of tumors with potential for destructive local tissue infiltration and regional as well as distant metastasis. the sweat gland neoplasms comprised 0.05% of all surgical pathological specimens, and only 12% of these tumors are carcinomas. it is found frequently in the elderly with an average age of about 53 year. they have been reported to occur at various sites, including eyelids, scalp, foot digits, breast, axilla, and nose. the majority of the lesions start as painless red or violet papules slowly growing and progressing to form solid nodules infiltrating subcutaneous tissue. ulceration of skin is uncommon, occurring mainly in recurrent or large lesions at the back or gluteal region. increase in size, ulceration and bleeding following minor trauma prompts the patients to seek medical advice. a low incidence of loss of heterozygosity at chromosome 17p has been noticed along with p53 alterations. sgc are broadly divided into : tumors bearing resemblance to their benign counterpartsthose without or minimal resemblance to their benign counterparts are further classified in to : eccrine adenocarcinomasmucinous eccrine carcinomasadenoid cystic eccrine carcinomasaggressive digital papillary adenoma / carcinoma. tumors bearing resemblance to their benign counterparts those without or minimal resemblance to their benign counterparts are further classified in to : eccrine adenocarcinomasmucinous eccrine carcinomasadenoid cystic eccrine carcinomasaggressive digital papillary adenoma / carcinoma. eccrine adenocarcinomas mucinous eccrine carcinomas adenoid cystic eccrine carcinomas aggressive digital papillary adenoma / carcinoma. sweat gland adenocarcinoma belongs to the latter group and is defined as a tumor without any pathological characteristics. pathogenesis of this neoplasm is not precisely understood, mainly due to the limited number of case reports. it usually appears as a moderate to poorly differentiated adenocarcinoma with regional variation, ranging from true ductule formation to an infiltrative anaplastic cellular zone. the histological features of malignancy are the same as most epithelial tumors, i.e. increased cellularity, enlarged nuclei, cellular pleomorphism and presence of bizarre mitotic figures.. tumors like sweat gland adenocarcinoma invading bone that are extremely rare has been reported. tumors show an asymmetry with cords and lobules of polygonal cells, limited to epidermis or extend into dermis. there will be cystic lumina within tumor nests, nuclear atypia with frequent mitosis and necrosis. malignant cells have large hyperchromatic, irregularly shaped nuclei and may be multi - nucleated and are rich in glycogen. the recommended treatment of all subtypes of sweat gland carcinomas is wide surgical excision along with regional lymph node dissection in clinically positive nodes. prognostic factors for sgc are difficult to identify, again owing to the very small number of reported cases, but includes size, histological type, lymph node involvement, and distant metastasis. our patient was a middle - aged female, presented with ulcer over scalp which clinically caused confusion, as squamous or basal cell carcinoma ; but histopathology eliminated it to be adenocarinoma of sweat gland, which has spread to regional lymph nodes but not yet infiltrated the bone, with no metastasis elsewhere was present. adenoid sgc were reported over abdomen, chest, axilla vulva and forearm but not over scalp. a case of sweat gland tumor over arm two cases of metastatic sweat gland adenocarcinoma one of eccrine and the other one of apocrine origin) have been reported. sgc can be considered as clinico - pathological dilemmas with an unpredictable biological behavior, rarely diagnosed clinically. | sweat gland adenocarcinoma is a rare tumor particularly over scalp. they have potential to be benign as well as distant metastasis. usually presents with papules or nodules. ulcerative morphology is uncommon. wide surigical excision with regional lymph not dissection is the treatment of choice. a 42-year - old female with sweat gland adenocarcinoma of scalp is reported with cervical lymph node involvement. |
we evaluated 244 unrelated portuguese patients with symptoms of pd referred to our center for molecular study of park2. the mean age at onset was 34.3 years (range, 6 months to 64 years). we conducted mutation screening, performing pcr amplification of the entire park2-coding region and exon - intron boundaries, using the hotstartaq master mix kit (qiagen, venlo, the netherlands), followed by bidirectional direct sequencing with the bigdye terminator v1.1 cycle sequencing kit (applied biosystems, waltham, ma) and loaded on an abi - prism 3130xl genetic analyzer (applied biosystems). to detect large gene rearrangements, we performed multiplex ligation - dependent probe amplification (mlpa) using the salsa mlpa kit p051 (mrc holland) according to the manufacturer 's instructions and analyzed fragments on an abi - prism 3130xl genetic analyzer using 500-liz (applied biosystems), as a size standard, and genemarker v1.90 (softgenetics, state college, pa). we stored dna samples at the center for predictive and preventive genetics authorized biobank. because of the large size of park2 introns, we genotyped several single - nucleotide polymorphisms (snps), located in the introns flanking each deletion to narrow down their extension. for snps that seemed to be in the homozygous state using the snapshot technique and in patients with heterozygous deletions, we performed dosage analysis by quantitative real - time pcr to confirm or exclude homozygosity for that particular snp. after reducing the possible extension of these deletions, we used the primer pairs closest to the deletion breakpoint for long - range pcr amplification. because the predicted amplicons were larger than 2 kb, we performed pcr amplification using the expand long template pcr system (roche diagnostics, basel, switzerland) and/or ranger mix (bioline, taunton, ma). we separated dna fragments of interest on 0.8% agarose gels, excised and purified with the illustra gfx pcr dna and gel band purification kit (ge healthcare, little chalfont, united kingdom) according to the manufacturer 's instructions. isolated and purified fragments were sequenced with the bigdye terminator v1.1 cycle sequencing kit (applied biosystems) and loaded on an abi - prism 3130xl genetic analyzer (applied biosystems) ; deletion breakpoints were narrowed down by primer walking. the nucleotide sequence positions described are based on the human reference sequence (grch37). we evaluated sequence identities of nucleotide sequences encompassing each breakpoint using the national center for biotechnology information blastn tool and repeatmasker with default parameters to identify interspersed repeats. we evaluated 244 unrelated portuguese patients with symptoms of pd referred to our center for molecular study of park2. the mean age at onset was 34.3 years (range, 6 months to 64 years). we conducted mutation screening, performing pcr amplification of the entire park2-coding region and exon - intron boundaries, using the hotstartaq master mix kit (qiagen, venlo, the netherlands), followed by bidirectional direct sequencing with the bigdye terminator v1.1 cycle sequencing kit (applied biosystems, waltham, ma) and loaded on an abi - prism 3130xl genetic analyzer (applied biosystems). to detect large gene rearrangements, we performed multiplex ligation - dependent probe amplification (mlpa) using the salsa mlpa kit p051 (mrc holland) according to the manufacturer 's instructions and analyzed fragments on an abi - prism 3130xl genetic analyzer using 500-liz (applied biosystems), as a size standard, and genemarker v1.90 (softgenetics, state college, pa). we stored dna samples at the center for predictive and preventive genetics authorized biobank. because of the large size of park2 introns, we genotyped several single - nucleotide polymorphisms (snps), located in the introns flanking each deletion to narrow down their extension. we performed snp genotyping using snapshot. for snps that seemed to be in the homozygous state using the snapshot technique and in patients with heterozygous deletions, we performed dosage analysis by quantitative real - time pcr to confirm or exclude homozygosity for that particular snp. after reducing the possible extension of these deletions, we used the primer pairs closest to the deletion breakpoint for long - range pcr amplification. because the predicted amplicons were larger than 2 kb, we performed pcr amplification using the expand long template pcr system (roche diagnostics, basel, switzerland) and/or ranger mix (bioline, taunton, ma). we separated dna fragments of interest on 0.8% agarose gels, excised and purified with the illustra gfx pcr dna and gel band purification kit (ge healthcare, little chalfont, united kingdom) according to the manufacturer 's instructions. isolated and purified fragments were sequenced with the bigdye terminator v1.1 cycle sequencing kit (applied biosystems) and loaded on an abi - prism 3130xl genetic analyzer (applied biosystems) ; deletion breakpoints were narrowed down by primer walking. the nucleotide sequence positions described are based on the human reference sequence (grch37). we evaluated sequence identities of nucleotide sequences encompassing each breakpoint using the national center for biotechnology information blastn tool and repeatmasker with default parameters to identify interspersed repeats. this mutational analysis of 244 portuguese participants confirmed the pd clinical diagnosis in 16.4% (40/244) of the patients. we identified 18 different mutations, including missense mutations, small and large deletions, and a splicing mutation (table 1). we found homozygous parkin mutations in 67.5% of the patients, and large deletions were present in 42.5% of the cases. the most frequent mutation was a 1-base pair (bp) deletion, c.155dela, which was present in 62.5% of the patients. we observed 2 novel mutations, a 1-bp deletion (c.1030delg) and an indel (c.1072 - 1073delctinsa), both predicted to result in an altered reading frame and a premature stop codon (p. e344sfs91 and p. l358rfs77). overview of molecular and clinical information from 40 patients with a molecular diagnosis of autosomal recessive juvenile parkinson disease the most common mutation, c.155dela, is a small deletion that causes the alteration of the open reading frame starting in the amino acid asparagine in position 52 and results in a stop codon 29 amino acids later (p.n52mfs29), leading to loss of most of the protein. seventeen patients showed large gene rearrangements, and we observed at least 9 different deletions either in homozygosity or heterozygosity. the most common deletions were those of exon 4 and of exons 36 (table 1). to explore the mechanisms underlying these large rearrangements and to confirm mlpa results, we determined the exact breakpoints of 17 deletions using an snp approach to narrow down the deletion breakpoint. we describe localization of the breakpoints found in these patients and the responsible mechanisms in table 2. overview of 17 mapped deletions and responsible mechanisms we found that nonhomologous end joining (nhej) was the mechanism responsible for 76.5% of the large deletions. three cases presented with microhomology domains in the junctions, and the deletions resulted from microhomology - mediated end joining (mmej). only one of the deletions could be explained by nonallelic homologous recombination (nahr) mediated by alu sequences. we identified other repetitive elements (table 3) that were not present at both sides of the breakpoint, and thus, unlikely to be directly involved in the rearrangement. overview of repetitive elements found in breakpoint analysis examples of the mapped rearrangement for the exon 47 deletion, exon 4 deletion, and exon 10 deletion (figure, panels a, b, and c, respectively) represent 2 different responsible mechanisms (nhej and nahr) acting in 3 different ways. for the exon 4 deletion in patient 22 (figure, b) and patient 38, we can infer that the inserted region was because of a duplication of the immediately preceding region. the origin of the inserted regions for the other 6 deletions could not be identified because of their small size or, in the case of the sequence inserted in patients 2 and 17, because of their frequency in the genome. (a) nonhomologous end joining (nhej), mediated by the formation of a hairpin loop (deletion of exons 47 ; patient 5) and with the insertion of an adenine nucleotide. (b) nhej with the presence of a duplicated region and 2 motifs, complementary to immunoglobulin class switch repeats (deletion of exon 4 ; patient 22). (c) alu - mediated nonallelic homologous recombination (nahr) (deletion of exon 10 ; patient 20). this mutational analysis of 244 portuguese participants confirmed the pd clinical diagnosis in 16.4% (40/244) of the patients. we identified 18 different mutations, including missense mutations, small and large deletions, and a splicing mutation (table 1). we found homozygous parkin mutations in 67.5% of the patients, and large deletions were present in 42.5% of the cases. the most frequent mutation was a 1-base pair (bp) deletion, c.155dela, which was present in 62.5% of the patients. we observed 2 novel mutations, a 1-bp deletion (c.1030delg) and an indel (c.1072 - 1073delctinsa), both predicted to result in an altered reading frame and a premature stop codon (p. e344sfs91 and p. l358rfs77). overview of molecular and clinical information from 40 patients with a molecular diagnosis of autosomal recessive juvenile parkinson disease the most common mutation, c.155dela, is a small deletion that causes the alteration of the open reading frame starting in the amino acid asparagine in position 52 and results in a stop codon 29 amino acids later (p.n52mfs29), leading to loss of most of the protein. seventeen patients showed large gene rearrangements, and we observed at least 9 different deletions either in homozygosity or heterozygosity. the most common deletions were those of exon 4 and of exons 36 (table 1). to explore the mechanisms underlying these large rearrangements and to confirm mlpa results, we determined the exact breakpoints of 17 deletions using an snp approach to narrow down the deletion breakpoint. we describe localization of the breakpoints found in these patients and the responsible mechanisms in table 2. overview of 17 mapped deletions and responsible mechanisms we found that nonhomologous end joining (nhej) was the mechanism responsible for 76.5% of the large deletions. three cases presented with microhomology domains in the junctions, and the deletions resulted from microhomology - mediated end joining (mmej). only one of the deletions could be explained by nonallelic homologous recombination (nahr) mediated by alu sequences. we identified other repetitive elements (table 3) that were not present at both sides of the breakpoint, and thus, unlikely to be directly involved in the rearrangement. overview of repetitive elements found in breakpoint analysis examples of the mapped rearrangement for the exon 47 deletion, exon 4 deletion, and exon 10 deletion (figure, panels a, b, and c, respectively) represent 2 different responsible mechanisms (nhej and nahr) acting in 3 different ways. for the exon 4 deletion in patient 22 (figure, b) and patient 38, we can infer that the inserted region was because of a duplication of the immediately preceding region. the origin of the inserted regions for the other 6 deletions could not be identified because of their small size or, in the case of the sequence inserted in patients 2 and 17, because of their frequency in the genome. (a) nonhomologous end joining (nhej), mediated by the formation of a hairpin loop (deletion of exons 47 ; patient 5) and with the insertion of an adenine nucleotide. (b) nhej with the presence of a duplicated region and 2 motifs, complementary to immunoglobulin class switch repeats (deletion of exon 4 ; patient 22). (c) alu - mediated nonallelic homologous recombination (nahr) (deletion of exon 10 ; patient 20). pd, which affects almost 2% of the population above the age of 65 years, is the second most commonly occurring progressive neurodegenerative disorder after alzheimer disease. today, the lengthening lifespan and aging population has transformed neurodegenerative diseases into an economic and societal concern. mutations in the parkin coding gene are the predominant cause of monogenic forms of recessive pd with a frequency that varies across studies depending on the population, number of familial cases, age at onset, and consanguinity, among other factors. the study of these mutations is therefore of upmost importance for understanding the pathogenesis of this disease. our park2-positive cohort showed a mean age at onset of 30 years (range, 1255 years). this mutational study of the parkin coding gene revealed that 16.4% of these patients present with 2 mutations, thus confirming the pd clinical diagnosis. this is particularly interesting because we found several cases with parkin mutations with onset at more than 40 years of age. also, the mean age at onset for patients in this study is lower than that reported previously (mean age 36 years) in a study considering only familial cases and with at least one of the patients with onset before the age of 54 years. these findings show the importance of screening park2 for mutations in patients with a family history of pd with later disease onset. the mutations we identified are spread throughout the entire gene in almost every parkin domain. of the 18 different mutations found, 3 were small insertions or deletions, 5 were point mutations, 9 were large deletions, and 1 was a splice - site mutation. two were novel mutations predicted to be damaging to the protein : a small insertion (c.1030delg) and a splice - site mutation (c.1286 - 3c > g). the high frequency of this mutation in portugal and spain probably indicates a founder effect. this mutation is also commonly found in european patients along with the c.823c > t mutation. these 2 are the most common point mutations in our cohort and are located in exons 2 (ubiquitin - like domain) and 7 (ring1 domain). last, the splice - site mutation, c.1286 - 3c > g, is predicted to disrupt the acceptor splice site, resulting in the loss of the last exon. of the 9 identified deletions in our population, the most common were the exon 4 deletion (5 cases) and the exon 36 deletion (4 cases). the high frequency of these deletions is similar to the results of another study that showed rearrangements occurring frequently in introns 2 through 4. large deletions are responsible for juvenile pd in almost half of the studied patients, making mlpa an essential approach in molecular diagnosis, complementary to direct sequencing. large deletions account for approximately 50%60% of the park2 disease causing mutations and have been observed worldwide. this high frequency can be partially explained by the very large introns of park2 that span 1.4 mb, and with introns 1, 2, 6, and 7 as large as 180 kb. this gene is located within one of the 3 most frequently expressed cfs, namely fra6e. it is interesting to note that most of the rearrangements found in park2 are located between exons 3 and 8, which comprise the fra6e center, with exons 3 and 4 being among the most unstable regions and hotspots for deletion. the cause of this instability is not completely understood, although several studies show that many gross chromosomal rearrangements that accumulate in solid tumors may have originated in these fragile sites because of errors during dna replication that could be caused by intrinsic characteristics of cfs, such as their at sequence content and high flexibility, scarcity of replication origins, and difficulty in the transcription of long genes present in these sites. to date, only a small number of park2 deletion breakpoints have been mapped, probably because of the large gene size ; despite the fact that the exonic deletions described here have been previously identified, all the breakpoints present in these portuguese patients are different from those previously described. in the 4 patients who had an exon 36 deletion, only 2 share the same breakpoints. in addition, all breakpoints were different in the 5 patients who had an exon 4 deletion. thus, it seems that the same exon deletion is not necessarily a consequence of a similar rearrangement but may stem from independent events. this finding is in agreement with the ongoing hypothesis that rearrangements are independent and recurrent events. it is also in accordance with the notion that rearrangements recurring at the same breakpoint are less frequent than nonrecurring rearrangements. the high frequency of repetitive elements and instability in the park2 locus favor the occurrence of recurrent deletion events, especially in the large park2 introns. it is curious that all of our patients with recurring deletions in homozygosity present the same breakpoints. in 3 patients, two shared the same exon 36 deletion, which could indicate a recurrent event or a common founder mutation. there are 3 major mechanisms responsible for genomic rearrangements : nahr, nhej, and fork stalling and template switching. these 3 mechanisms account for the majority of genomic rearrangements in the human genome, and their distribution partially reflects the genomic architecture in the proximity of the breakpoint locus. our analysis showed that, although there are only 526 alu elements in park2, which is below the mean density of the human genome (1 per 3 kb), alu - mediated nahr seems to be the responsible mechanism for the exon 10 deletion described (figure, c) where the 2 junctions map to alu elements of the same family (alusx) in direct orientation. regions of microhomology often contribute to nhej, so it is common to find them at deletion breakpoints. nhej is the major pathway for restoring double - strand breaks in chromosomal dna and is a highly flexible mechanism that creates distinct breakpoint junctions, resulting in either short microhomologies (usually 14 bp) or inserted sequences without homology as a result of the nhej editing process. the presence of inserted sequences in the mapped deletions described here, namely a short duplication of the surrounding fragments and short sequences of unknown origin, is in agreement with features of the nhej mechanism. also, this repair mechanism has already been related to parkin deletions in previous studies. mmej is also a mechanism for double - strand break repair, which uses a sequence of 525 bp to align the broken ends ; mmej is frequently associated with complex rearrangements. although mmej is considered a secondary mechanism, used only when nhej and the other mechanisms fail, it has recently been reported that mmej can act even when nhej and homologous recombination are intact. as 3 of the deletions reported here present a microhomology region of 5, 6, and 7 bp, we propose that this was the responsible mechanism in these cases (table 2). recently, 5 park2 deletions were mapped in polish patients showing nhej and fork stalling and template switching as the responsible mechanisms. here we present a higher number of deletions mapped, all different from previously described reports, and expanded the mechanisms responsible for these large gene rearrangements to include mmej and alu - mediated nahr. these 3 mechanisms, nhej, mmej, and alu - mediated nahr, seem to explain the identified deletions ; nhej seems to be responsible for the majority of the deletions. we describe 40 patients with autosomal recessive pd who have novel and previously reported park2 mutations. we present the molecular characterization of 17 large park2 deletions and identify nhej as the most frequently occurring mechanism responsible for deletions in this gene. s. morais : acquisition of data, analysis and interpretation, drafting and revision of manuscript. r. bastos - ferreira : acquisition of data, analysis and interpretation, and revision of manuscript. i. alonso : primary investigator, study conceptualization and design, analysis and interpretation, and revision of manuscript. supported by fundao para a cincia e tecnologia cofunded by fundo europeu de desenvolvimento regional and compete (programa operacional factores de competitividade), grant number pic / ic/83232/2007. dr. sequeiros has received travel / speaker honoraria from fundacin jimenez diaz and pfizer ; has served on the editorial boards of clinical genetics and the journal of community genetics ; is an employee of the university of porto ; and has received research support from biomarin, pfizer, alexion, fct (fundao para a cincia e tecnologia), and the european commission (fp6 network of excellence). | objectives : to identify the genomic mechanisms that result in park2 large gene deletions.methods:we conducted mutation screening using pcr amplification of park2-coding regions and exon - intron boundaries, followed by sequencing to evaluate a large series of 244 unrelated portuguese patients with symptoms of parkinson disease. for the detection of large gene rearrangements, we performed multiplex ligation - dependent probe amplification, followed by long - range pcr and sequencing to map deletion breakpoints.results:we identified biallelic pathogenic parkin mutations in 40 of the 244 patients. there were 18 different mutations, some of them novel. this study included mapping of 17 deletion breakpoints showing that nonhomologous end joining is the most common mechanism responsible for these gene rearrangements. none of these deletion breakpoints were previously described, and only one was present in 2 unrelated families, indicating that most of the deletions result from independent events.conclusions:the c.155dela mutation is highly prevalent in the portuguese population (62.5% of the cases). large deletions were present in 42.5% of the patients. we present the largest study on the molecular mechanisms that mediate park2 deletions in a homogeneous population. |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.