article
stringlengths 0
682k
| abstract
stringlengths 146
3.69k
|
|---|---|
the need for better healthcare has grown significantly in recent years, which demands an increasing number of countries started promoting medical tourism (1). furthermore, the rising healthcare costs in the us and in many european countries have forced many patients from these countries to seek medical treatment abroad. there have been a number of published papers analyzing the travel motivation of the tourists, but most of these studies had focused at tourism in general (2, 3). there is very little literature that specifically looks at medical tourism. due to the limited literature and empirical evidence on the topic, this study believes that, other related studies focusing on the tourist s motivation and criteria of selecting the destination would offer some constructive insights and information on the factors influencing the patients perception in selecting their medical tourism destinations. moreover, the academic era still lacks in apparent idea and concrete definition of medical tourism. even though, few studies have proposed medical tourism framework (46), however, the evidence is not adequate. realizing the current need to examine closely the perception of medical tourists, this study aims to present the theoretical and empirical literature on medical tourists perception in selecting their medical tourism destinations. in addition, this study aims to propose a concrete framework for medical tourism, which will significantly contribute to the academic era. medical tourism may be defined as the deliberate attempt on the part of a tourist facility (e.g. hotels) or destination to attract tourists by promoting healthcare services and facilities in addition to regular tourist amenities (7). medical tourism is a form of cost - effective private medical care for patients mostly from developed countries who need surgical and other forms of specialized treatment (8). another study elucidated medical tourism as the combination of products and services intended to encourage patients in preserving and maintaining their health through a mixture of vacationing and other form of recreational activities in a different location other than home (9). one more study classified medical tourism as the movement of a patient for getting services that help in recovering his illness, outside his own country for a period of time not less than 24 hours and up to one year, and the patient has no intent to work or reside permanently (10). medical tourism usually describes the phenomenon of the people from different countries traveling for medical services to other countries (11). medical tourism refers to patients who travels abroad in order to obtain health services where the motives for going abroad range from lower cost, higher quality, or faster treatment as well as to receive services those are unavailable in their country of residence (12). thus, medical tourism can be defined as a way of obtaining quality treatment in a foreign country with an affordable cost while the patient may also get the pleasure from a beautiful holiday. further study suggested that, while planning for medical tourism, cost should be an important consideration (13). cost is the main motivating factor among others (e.g. long waiting time at home) while patients travel for medical care outside of their home country (14). cost is the only factor for the us patients for preferring medical tourism and the current economic recession has further fueled this escalation (15). as the cost of healthcare in the us is excessively soaring, many employers together with the insurance companies prefer medical tourism as an option in lowering healthcare costs (16). to be financially benefitted from this emerging market, a large number of countries around the globe are promoting medical tourism (11). most important thing for these countries involved in medical tourism is that, they offer premium medical services at significantly lower prices, which has become the major motivation for the patients in traveling abroad for the intention of treatment (1). a recent study have found that, surgery is 30% to 70% lower in the countries those are promoting medical tourism than in the us (4). in some cases, this is up to 80% (17)). a price comparison between u.s. and other selected countries are provided in table below : in this rapidly growing consumer - oriented health industry, quality has become the integral part. without providing quality services, people from rich countries are traveling to less developed countries because of less expensive but high quality medical care (18). one study focused on two major components of the service quality in the health care sector : one is technical or mechanical quality and another is serviceable or functional quality (19). in the healthcare industry, technical equipments and other related medical diagnoses systems are core for patients check up for their treatment and functional quality measured by the service offer by the healthcare centers such as services of staffs, nurses, administrations and most importantly the doctors towards the patient and their assistants. it has been found from different healthcare researches that, patients mostly give priority to the functional quality rather than the technical quality though the technical quality may not be satisfactory (20). however, for the medical patient, the technical quality should be a prime object because the proper treatment of patients largely depends upon the proper diagnoses of the diseases. service quality works as a suspension bridge, which hangs within customer, and organization, thus, shows the valuable exchange among them (21). service quality is a global judgment or attitude relating to the overall excellence or superiority of the service (22). understanding of the customer s requirements has become necessity as this helps the practitioners in developing new approaches to provide improved service quality (23). the service quality in healthcare industry is a vital part for attracting customer as in the healthcare industry, patient perceptions are measured through the quality of services provided by a healthcare centre (24, 25). thus, delivering quality services to the customers is necessary in order to meet customers perception (22). one of the fundamental barriers in medical tourism is the perception of inadequate quality (1). thus, employing proper marketing strategies and improvements in quality through accreditation from an internationally recognized institution is a key to overcoming this barrier. this confidence increases if accreditation is accompanied by an affiliation with prestigious hospitals or health care systems in industrial countries (26). the intending medical tourist should check whether or not a hospital is wholly accredited by an international accreditation group, or if it is only partly accredited (e.g. for infection control) (27). once healthcare providers are accredited and part of international referral networks, they can be properly rated for risks and consequently, helps in building confidence among the potential medical tourists (28). types and availability of various types of treatments are also an important factor in selection of medical tourism. medical tourism is a procedure that are routinely covered by health care benefits (e.g., knee replacement surgery) and elective cosmetic surgery (e.g., abdominoplasty), which includes unique travel opportunities (e.g., surgical safari), or cosmetic dentistry and reproductive tourism (e.g., in vitro fertilization) (29). however, medical tourism is not limited to few specific treatments as a wide range of treatments can be obtained through medical tourism (26). medical tourism involves a wide range of therapeutic treatments ranging from various essential treatments to different sorts of traditional and alternative treatments (1). further study have added that, a specialized subset of medical tourism is reproductive tourism and reproductive outsourcing, which is the practice of traveling abroad to undergo in - vitro fertilization, surrogate pregnancy and other assisted reproductive technology treatments including freezing embryos for retro - production (30). moreover, citizens of england and other european countries are traveling both within the european union and to asia for various medical and surgical procedures, which are not available in their home country (31). patients generally seek medical care abroad for one of two reasons : either they do not have access to a particular treatment, or they can not afford it, in their own country (11). american patients travel to foreign locations due to lack access to unproven medical therapies such as stem cell or cytoplasmic transfer therapy (32). access, rather than the cost has been the major factor for the increase of medical tourism (33). lack of access, either because the technology is not available, or is prohibited or illegal in the home country, can lead to medical tourism (34). study conducted on asia have found that, thailand has become increasingly popular destination for a wide range of medical procedures, such as cosmetic surgery, dental work, hip and knee replacements, back surgery and for some unproven medical surgery (e.g. sex change) (35). low cost compiled with other factors such as technological capability, government s inventiveness and promotional campaigns in developing healthcare facilities and qualified workforce coupled with the natural resources like beaches, greens have built the confidence of many developed world patients to visit foreign locations for medical procedures. the ever - increasing media coverage on the satisfaction of the patients who were treated outside the us in the last few years also attracted a large of us patients to seek treatments abroad (36). moreover, due to the tremendous development in ict, information regarding the medical procedures is now readily available and easily accessible. in addition, internet - based marketing and promotional campaigns by hospitals and travel agencies have boosted the confidence of the foreign patients as they can get their needed information much easily and quickly (13). thus, internet has enabled a significant cost savings for both the patients and the hospitals (33). from the above - discussed literature, this study has proposed the following conceptual framework. medical tourism may be defined as the deliberate attempt on the part of a tourist facility (e.g. hotels) or destination to attract tourists by promoting healthcare services and facilities in addition to regular tourist amenities (7). medical tourism is a form of cost - effective private medical care for patients mostly from developed countries who need surgical and other forms of specialized treatment (8). another study elucidated medical tourism as the combination of products and services intended to encourage patients in preserving and maintaining their health through a mixture of vacationing and other form of recreational activities in a different location other than home (9). one more study classified medical tourism as the movement of a patient for getting services that help in recovering his illness, outside his own country for a period of time not less than 24 hours and up to one year, and the patient has no intent to work or reside permanently (10). medical tourism usually describes the phenomenon of the people from different countries traveling for medical services to other countries (11). medical tourism refers to patients who travels abroad in order to obtain health services where the motives for going abroad range from lower cost, higher quality, or faster treatment as well as to receive services those are unavailable in their country of residence (12). thus, medical tourism can be defined as a way of obtaining quality treatment in a foreign country with an affordable cost while the patient may also get the pleasure from a beautiful holiday. further study suggested that, while planning for medical tourism, cost should be an important consideration (13). cost is the main motivating factor among others (e.g. long waiting time at home) while patients travel for medical care outside of their home country (14). cost is the only factor for the us patients for preferring medical tourism and the current economic recession has further fueled this escalation (15). as the cost of healthcare in the us is excessively soaring, many employers together with the insurance companies prefer medical tourism as an option in lowering healthcare costs (16). to be financially benefitted from this emerging market, a large number of countries around the globe are promoting medical tourism (11). most important thing for these countries involved in medical tourism is that, they offer premium medical services at significantly lower prices, which has become the major motivation for the patients in traveling abroad for the intention of treatment (1). a recent study have found that, surgery is 30% to 70% lower in the countries those are promoting medical tourism than in the us (4). in some cases, this is up to 80% (17)). a price comparison between u.s. and in this rapidly growing consumer - oriented health industry, quality has become the integral part. without providing quality services, people from rich countries are traveling to less developed countries because of less expensive but high quality medical care (18). one study focused on two major components of the service quality in the health care sector : one is technical or mechanical quality and another is serviceable or functional quality (19). in the healthcare industry, technical equipments and other related medical diagnoses systems are core for patients check up for their treatment and functional quality measured by the service offer by the healthcare centers such as services of staffs, nurses, administrations and most importantly the doctors towards the patient and their assistants. it has been found from different healthcare researches that, patients mostly give priority to the functional quality rather than the technical quality though the technical quality may not be satisfactory (20). however, for the medical patient, the technical quality should be a prime object because the proper treatment of patients largely depends upon the proper diagnoses of the diseases. service quality works as a suspension bridge, which hangs within customer, and organization, thus, shows the valuable exchange among them (21). service quality is a global judgment or attitude relating to the overall excellence or superiority of the service (22). understanding of the customer s requirements has become necessity as this helps the practitioners in developing new approaches to provide improved service quality (23). the service quality in healthcare industry is a vital part for attracting customer as in the healthcare industry, patient perceptions are measured through the quality of services provided by a healthcare centre (24, 25). thus, delivering quality services to the customers is necessary in order to meet customers perception (22). one of the fundamental barriers in medical tourism is the perception of inadequate quality (1). thus, employing proper marketing strategies and improvements in quality through accreditation from an internationally recognized institution is a key to overcoming this barrier. this confidence increases if accreditation is accompanied by an affiliation with prestigious hospitals or health care systems in industrial countries (26). the intending medical tourist should check whether or not a hospital is wholly accredited by an international accreditation group, or if it is only partly accredited (e.g. for infection control) (27). once healthcare providers are accredited and part of international referral networks, they can be properly rated for risks and consequently, helps in building confidence among the potential medical tourists (28). types and availability of various types of treatments are also an important factor in selection of medical tourism. medical tourism is a procedure that are routinely covered by health care benefits (e.g., knee replacement surgery) and elective cosmetic surgery (e.g., abdominoplasty), which includes unique travel opportunities (e.g., surgical safari), or cosmetic dentistry and reproductive tourism (e.g., in vitro fertilization) (29). however, medical tourism is not limited to few specific treatments as a wide range of treatments can be obtained through medical tourism (26). medical tourism involves a wide range of therapeutic treatments ranging from various essential treatments to different sorts of traditional and alternative treatments (1). further study have added that, a specialized subset of medical tourism is reproductive tourism and reproductive outsourcing, which is the practice of traveling abroad to undergo in - vitro fertilization, surrogate pregnancy and other assisted reproductive technology treatments including freezing embryos for retro - production (30). moreover, citizens of england and other european countries are traveling both within the european union and to asia for various medical and surgical procedures, which are not available in their home country (31). patients generally seek medical care abroad for one of two reasons : either they do not have access to a particular treatment, or they can not afford it, in their own country (11). american patients travel to foreign locations due to lack access to unproven medical therapies such as stem cell or cytoplasmic transfer therapy (32). access, rather than the cost has been the major factor for the increase of medical tourism (33). lack of access, either because the technology is not available, or is prohibited or illegal in the home country, can lead to medical tourism (34). study conducted on asia have found that, thailand has become increasingly popular destination for a wide range of medical procedures, such as cosmetic surgery, dental work, hip and knee replacements, back surgery and for some unproven medical surgery (e.g. sex change) (35). low cost compiled with other factors such as technological capability, government s inventiveness and promotional campaigns in developing healthcare facilities and qualified workforce coupled with the natural resources like beaches, greens have built the confidence of many developed world patients to visit foreign locations for medical procedures. the ever - increasing media coverage on the satisfaction of the patients who were treated outside the us in the last few years also attracted a large of us patients to seek treatments abroad (36). moreover, due to the tremendous development in ict, information regarding the medical procedures is now readily available and easily accessible. in addition, internet - based marketing and promotional campaigns by hospitals and travel agencies have boosted the confidence of the foreign patients as they can get their needed information much easily and quickly (13). thus, internet has enabled a significant cost savings for both the patients and the hospitals (33). from the above - discussed literature, this study has proposed the following conceptual framework. as this is solely a secondary based study, this study have accessed both online and print versions of various academic journals, online databases (e.g. scopus, directory of open access journals (doaj), econlit, proquest, ebscohost, science direct, web of science), newspapers, books and other related materials to collect data for assessing and identification of the main factors regarding the patient s perception and selection criteria by the medical tourists. however, few data were also considered from this exclusion criteria due to their enormous relativity to this study. grounded on extant literature, a conceptual model as well as a definition of medical tourism is proposed using data and information covering the main attributes of medical tourist s perception in selecting their medical tourism destination. this study examined the relations between the key elements of medical tourist s perception and its impact on destination selection. basing on the theories and other related studies on tourist s perception and motivation has confirmed that, cost, service quality, treatment types and availability ; lack of access to particular treatment and impact of marketing influence significantly the medical tourist s perceptions in selecting the destination. the findings also help in understanding the fundamental relationships among the variables and enhancing the knowledge for the hospital management to determine where they should concentrate to accomplish their business goals. to be competitive in an ever - increasing healthcare industry, hospitals those are promoting medical tourism, need to emphasis on the quality, marketing, and various treatment offerings with relatively lower costs for the procedures. it can be concluded that customers are the key for the business success of the hospitals. therefore, it can be suggested that, an effective marketing policy will influence the future customers that, in turn, will enhance the revenue of the hospitals. there is also an urgent need for quality healthcare for any citizens of the society. therefore, understanding this need of customers is crucial for the hospital management. failing to meet or exceed customers quality needs is not an option for any health service providers. therefore, developing a measure that systematically weighs health service quality could significantly contribute towards service improvement. therefore, further study need to be conducted to test and validate the proposed framework of this study. nevertheless, this study offers support for the proposed conceptual model and an empirical basis for comparison in future research. ethical issues (including plagiarism, informed consent, misconduct, data fabrication and/or falsification, double publication and/or submission, etc) have been completely observed by the authors. | background : the need for better healthcare has grown significantly in recent years. in addition, the rising healthcare costs in the u.s. and in many european countries have forced many patients to seek medical treatment abroad, which has created the demand for medical tourism. with little yet known as to the perception of a medical tourist s destination selection, this study aims to explore medical tourist s perception in selecting their destination while going for medical treatment.methods:realizing the current need to examine closely the perception of medical tourists, this study had conducted a secondary study to collect data for assessing and identification of the key factors on patient s perception and destination selection criteria.results:the result confirms the existence of a very strong relationship between cost, service quality, treatment types and availability and marketing impact on the perception of the medical tourists in selecting their medical tourism destination.conclusion:this study offers support for the proposed conceptual model and an empirical basis for comparison in future research. |
diabetes mellitus represents an extreme disturbance in glucose metabolism with severe hyperglycemia and insulin deficiency. diabetes mellitus is the fifth most common chronic condition and the sixth most frequent cause of death among the elderly. tissue repair is affected and dysfunction of the oral mucosa occurs due to alterations in salivary flow and constituents, changes in nutrition and reduced immune defenses leading to changes in microbial oral flora and a greater tendency to infections. as a result, xerostomia ; candidiasis ; increased incidence of dental caries, gingivitis and periodontitis ; periapical abscess ; parotid enlargement and burning mouth syndrome are prevalent in diabetics. therefore, early diagnosis of the diabetes mellitus is an important aspect of health care. glycogen fails to stain with conventional hematoxylin solutions and only stains weakly, if at all, with eosin. diastase is the commonly employed form of glycogen digestion enzyme as it is easy to use, stable and comparatively cheap. the aim of our study was to study the effects of diastase enzyme on the glycogen content of the epithelial cells of mucosa of normal and diabetic patients in exfoliative cytology and to compare the staining quality in mucosa of normal and diabetic patients using hematoxylin and eosin (h and e) stain ; papanicolaou (pap) stain, periodic acid schiff (pas) and pas - diastase (pas - d) stains, respectively. it is a case - control study involving a total of 20 subjects (10 cases and 10 controls). diagnosed cases of diabetes were selected. the method used to estimate the values of blood sugar levels (bsl) (fasting and postprandial [pp ]) was glucose oxidase method. patients with habits (tobacco chewing and smoking), other systemic diseases / malignancies / taking medications other than the diabetic medications were excluded. smears were taken from the mucosa of normal (control) and diabetic (study) patients using a wooden spatula and transferred onto clean glass slides. the glass slides (40) were then immediately fixed in 95% ethyl alcohol and stained using h and e (10 slides), pap (10 slides), pas (10 slides) and pas - d (10 slides) stains for both the groups. for pas - d, the slides were first incubated in diastase solution at 37c for 1-h, washed and then stained with pas stain. the staining quality in the cells and their glycogen content was studied in both the groups and then compared. it is used to detect both hypoglycemia and hyperglycemia and helps in diagnosis of diabetes. glucose oxidase is an enzyme highly specific for glucose and does not react with blood saccharides. the principle used in pas - d stain was that diastase (or -amylase) acts on glycogen to depolymerize it into smaller sugar units, maltose and glucose, that are washed out of the section. glycogen will be stained magenta on pas [figure 1 ] stained slide and will be absent on the pas - d [figure 2 ] stained slide because of glycogen digestion by the diastase enzyme. photomicrograph of buccal exfoliated cells (pas stain, 400) photomicrograph of buccal exfoliated cells (pas - d stain, 400) on comparison of the mean and standard deviation values during fasting and pp, we found that high bsls were seen in the study group as compared to that of the control group [table 1 ]. by applying student 's unpaired t - test, there was a highly significant difference between mean values of bsl when compared to control versus study group (i.e., p < 0.01). also, it was seen that the mean values of bsl both fasting and pp was more in the study group as compared to the control group [table 2 ]. by applying student 's unpaired t - test, there was a highly significant difference between mean values of bsl when compared to fasting versus pp in both control and study group (i.e., p < 0.01) [table 3 ]. mean and standard deviation values of blood sugar level in control and study group comparison of mean values of blood sugar level in control and study group comparison of mean values of both fasting and post - prandial blood sugar levels in control and study group the study group exhibited nuclear changes such as binucleation [figure 3 ], decreased cytoplasmic / nuclear ratio, nuclear enlargement [figure 4 ] and enucleation [figure 5 ] in pap stained slides as compared to that of control group. photomicrograph of exfoliated cells exhibiting binucleation (h&e stain, 400) photomicrograph of exfoliated cells exhibiting nuclear enlargement (pas stain, 400) photomicrograph of exfoliated cells exhibiting enucleation (h&e stain, 400) diabetes mellitus, a complex metabolic disorder, is a syndrome characterized by abnormalities in carbohydrates, lipid and protein metabolism that results either from a profound or an absolute deficiency of insulin (type i) or from target tissue resistance to its cellular metabolic effects (type ii). although many of the pathological processes affecting the oral mucosa are clinically distinguishable, most lesions require a definitive diagnosis before the appropriate therapy may be commenced. the most accepted clinical technique for the diagnosis of lesions of the oral mucosa is an incisional or excisional biopsy. in specific clinical conditions, such as diabetes, a great many invasive techniques lose viability as a result of variations in blood glucose and the disease itself. in these cases a cytologic smear is an advantageous diagnostic procedure because it is noninvasive, relatively painless, inexpensive and requires a minimum of technical skill. it is useful when a patient refuses to have a biopsy performed or when medically compromised patients would be exposed to unnecessary surgical risks and anxious patients can be reassured quickly about the nature of oral mucosal changes, especially when a fear of cancer or a family history of cancer accounts for their apprehension. in a study developed in sudan, the oral cytologic analysis is proposed as a useful early diagnostic method for epithelial atypia and therefore also for malignant oral lesions. in our study, we compared the slides of h and e, pap, pas, pas - d in both control and study group and found that the cells in the study group exhibited binucleation, decreased cytoplasmic / nuclear ratio, nuclear enlargement, enucleation and inflammation as compared to that of control group, which is similar to the findings of jajarm. alberti. who also found that diabetes mellitus can produce alterations in oral epithelial cells, detectable by microscopy and cytomorphometry, which can be used in evaluation of this disease. our study evaluated whether diabetes diagnosis can be made by analysis of the glycogen content of the oral epithelial cells in diabetics. we compared the mean values of bsl in control and study group and found that mean values of bsl fasting and pp is more in study group as compared control group which is highly significant with a p < 0.01. because of the increased glucose in diabetics, their epithelial cells showed less staining when stained with pas - d, since glycogen is digested by the diastase enzyme treatment prior to pas staining. in our study, the oral smears obtained from diabetic and control groups contained cellular representatives of all the epithelial strata, from nonkeratinized cells to the completely keratinized ones. these patients presented cellular alterations, both quantitative and qualitative, at all differentiation levels. we found that nuclear changes were significantly higher in the diabetic group than in the control group that was similar to the findings of jajarm. decreased cellular turnover might be a secondary reaction to ischemia caused by atherosclerosis in diabetic patients. thus as a result of ischemia, cellular turnover would decrease and limited production of young cells would mean that the majority of cells are old or aged. we found a significant increase in inflammation in the diabetic group in comparison with the control group. this might result from decreased salivary flow in diabetes, due to hypofunction of the salivary glands secondary to adverse hormonal, microvascular and neuronal changes. conner., reported a decrease in the salivary flow of diabetic patients, probably related to systemic dehydration (polyuria), medicament interference (diuretics) and/or membranopathy of the ducts. from our study, we can say that exfoliative cytology is useful as an additional tool to aid in the diagnosis of diabetes mellitus. furthermore, studies with greater sample size and comparison to other conditions causing similar cytomorphometric changes are needed to determine the predictive value of this method. thus, from our study, it can be said that exfoliative cytology can be used as a tool for diagnosis as well as for screening the patients for diabetes using pas - d stain. however, larger sample size studies should be performed to come to a definite conclusion. | background : diabetes mellitus is the fifth most common chronic condition and the sixth most frequent cause of death among the elderly. the objective of this research was to develop a new method for diabetes diagnosis by analysis of the glycogen content of the oral epithelial cells.materials and methods : ten control subjects and ten diabetic patients (study group) were taken, four oral smears for both control and study group from the buccal mucosa were taken and stained with hematoxylin and eosin stain, papanicolaou (pap) stain, periodic acid schiff (pas) stain and pas - diastase (pas - d) stain.results:the results showed that in the diabetic group : (i) the epithelial cells stained with pap stain exhibited figures of binucleation and occasional karyorrhexis, (ii) the epithelial cells treated with pas - d showed that glycogen containing cells did not take up the stain as compared to the other cells.conclusion:the results associated with clinical and histological observations suggest that diabetes mellitus can produce alterations of oral epithelial cells as well as in their glycogen content. |
mustard gas can cause numerous complications in the skin, eye, gastrointestinal, and respiratory systems (1). physical and psychological disabilities can establish limitations in usual activities, occupational tasks, social actions, and the quality of life in chemical victims (3). quality of life is a broad concept that involves all of aspects of life including physical, social, and spiritual (4). health - promoting lifestyle is closely related to veterans physical and psychological health status and, therefore, to their quality of life. health - promoting behaviors are defined as real human desires that propel individuals to maximize health, personal performance, and productive lives. according to pender., health promotion is a dynamic and positive process that encompasses behaviors supporting a healthy lifestyle, including physical activity, dieting, spiritual growth, interpersonal relationships, health responsibility, and stress management. they defined health - promoting behaviors as voluntary daily activities derived from environmental, demographical, and social variables and that such activities can affect one s health conditions. in other words, a health - promoting lifestyle is a multi - dimensional pattern of voluntary behaviors needed for promoting one s health conditions, self- growth, and perfection (5). health promotion theories and models can facilitate establishing, maintaining, and improving healthy behaviors by predicting factors influencing risky behaviors (6 - 8). penders health promotion model (hpm) is a comprehensive and predictive model that can provide a theoretical framework to explore the factors influencing health - promoting behaviors. the first version of hpm was used as a framework to testing its capabilities in predicting a health - promoting lifestyle, but several constructs such as importance of health, definition of health, and perceived control of health were deleted owing to lack of sufficient empirical evidence of predictive power and several constructs were added ; therefore, the model was revised (5). in the revised model, the included concepts of health - promoting behavior are individual characteristics and experiences, behavior - specific cognitions and affects, and behavioral outcomes. the concept of individual characteristics and experiences has direct and indirect effects (through cognition and affects factors) on behavior, and it includes personal factors and prior related behaviors. the concept of behavior - specific cognitions and affects has a direct effect on behavior, and it includes constructs such as perceived benefits and barriers, perceived self - efficacy, activity - related affect, interpersonal influences, and situational influences. pender tested his model in multiple studies and identified constructs such as personal factors (perceived health status), perceived benefits and barriers, perceived self - efficacy, and interpersonal influences (social support) as the best predictors a health - promoting lifestyle (5). however, existing evidences indicate that the factors influencing each specific behavior should be assessed independently (9). research in iranian elders with several disabilities showed that social support was the most important determinant factor in performing day - to - day activities (10). a study in persons with multiple sclerosis showed that enhancing social support, lowering barriers, and increasing specific self - efficacy for health behaviors results in improved health - promoting behaviors and quality of life (11). in diabetic females with physical disability, the perceived self - efficacy, perceived benefits, and perceived health status are effective factors on physical activity behaviors and the perceived health status construct is an effective indirect factor influencing physical activity (12). veterans with numerous disabilities need to change to a health - promoting lifestyle, and although hpm clearly identifies the constructs leading to health - promoting behaviors, the relationships among the constructs are less clear. therefore, the purpose of the current study was to investigate the direct and indirect relationships between hpm constructs and health - promoting behaviors in veterans, as well as the effectiveness of the model in predicting health - promoting behaviors. in this cross sectional study, 276 moderate - to - severely affected chemical veterans living in ilam province were recruited between july and november 2014 via census sampling. veterans more than 25 percent were categorized as moderate and severe based on the medical committee of department of veterans affairs (dva). the province has temperate climate in the north, and warm and semi - warm climate in the south. the inclusion criteria included having suffered from moderate - to - severe levels of injury and having adequate physical health. however, individuals who did not comply with the study procedures, not satisfied about participating in the study, or without permanent residence in ilam province were excluded from the study. for sampling, first, the complete list of chemicals veterans names and phone numbers was obtained from the department of veterans affairs (dva). then, through telephone contact, explanations regarding the targets, procedures, and confidential rules of the research were presented to potential study participants. thereafter, if a veteran expressed desire to participate in the investigation, the researcher would visit their home to collect data. then, they were requested to choose the best options as their answers to questions. of the 276 referred veterans, six died, three were not able to respond to the questions, 15 submitted incomplete questionnaires, and 13 moved out of ilam. therefore, finally, 239 veterans (86.6% response rate) entered into the study. a self - administered questionnaire, the health - promoting lifestyle profile ii (hplp ii) questionnaire, and five standard instruments regarding pender models constructs, including perceived health status, perceived benefits, perceived barriers, social support, and self - efficacy, were used to collect data. all instruments were first translated by the primary investigator and then a bilingual person translated them back to english ; all differences were improved. the translated instruments were reviewed by a group of iranian health education experts, and minor amendments were made to them. prior to data collection, the questionnaires were tested for reliability in a sample of 50 chemical veterans. in this study, all questionnaires were reliable and the ranges of cronbach s alpha coefficients were 0.82 (perceived health status)0.92 (hplp ii). the self - administered questionnaire queried age, gender, occupation, disability, type of injury, and militancy type. the hplp ii included 52 questions, and all items are scored using a likert scale ranging from 1 (never) to 4 (always). this standard questionnaire for measuring health - promoting behaviors includes six dimensions, namely, health responsibility, physical activity, nutrition, spiritual growth, interpersonal relations, and stress management. higher scores indicate more favorable conditions in veterans in terms of health - promoting behaviors. walker and collogues reported cronbach s alpha of 0.94 for this instrument (13 - 15). in this study, for this instrument, we obtained cronbach s alpha of 0.92, and content validity index (cvi) values in terms of simplicity, precision, and specificity were 0.91, 0.97, and 0.91, respectively. response categories for items vary from 2- to 6- point scales, and raw scores for items range from 1 to 6. physical domain scores range from 6 to 20, and mental domain scores range from 6 to 27. reported cronbach s alpha of 0.73 for the physical health subscale and 0.72 for the mental health subscale in iranian people. furthermore, explanatory factor analysis (16) and confirmatory factor analysis (cfa) indicated good fit validity for this tool (17). given these previous evaluations of this questionnaire in iran, we did not validate it in the present study. the standard multidimensional scale of perceived social support contains 12 items and assesses three subscales, namely, family, friends, and other significant individuals support. the items are scored on a 7-point likert scale ranging from strongly disagree (1 point) to strongly agree (7 points), and the total questionnaire score ranges from 12 to 84. psychometric studies have indicated good reliability (= 0.91). moreover, cronbach s alpha coefficient of this scale was 0.94, which indicates good internal consistency (18). in this study, the cvi values for simplicity, precision, and specificity were 0.93, 0.96, 0.91, respectively, and cronbach s alpha was 0.87, for this instrument. the scales regarding perceived benefits of and perceived barriers to health - promoting behaviors comprised 26 and 18 questions, respectively. alpha for the benefits and barriers scales were 0.82 and 0.60, respectively (10). the cvi values for simplicity, precision, and specificity for the perceived benefits questionnaire were 0.99, 0.96, and 0.99, respectively, while those for the perceived barriers questionnaire were 0.98, 0.98, and 0.91. furthermore, the reliability scores of the benefits and barriers scales were 0.91 and 0.88, respectively, in this study. perceived self- efficacy has been defined as people s judgments on their own possibilities for indulging in health - promoting behaviors. becker. designed this scale for measuring six dimensions of health - promoting behaviors. the 26 items comprising this questionnaire are scored on a 4- point likert scale from never (1 point) to always (4 points) with the total score ranging from 26 to 104. its cvi values for simplicity, precision, and specificity were 0.99, 0.98, and 0.98, respectively, which indicate its appropriateness of content validity. the collected data were coded and entered into statistical package for social sciences (spss) version 18.0. path analysis was used for studying the direct and indirect effects of variables and for estimating the values of coefficients in the underpinning linear model. this value was significant (p = 0.04) ; therefore, a few of the variables (such as age, social support, perceived benefits, and health status) were non - normal and we used the robust maximum likelihood estimation procedure. a correlation matrix and an asymptotic covariance matrix were applied for model estimation. chi - square (), the adjusted goodness - of - fit index (agfi), and root - mean - square error of approximation (rmsea) were used as model fit criteria. the comparative bentler - bonett non - normed fit index (nnfi) was selected. nnfi values equal to or greater than 0.90 are recommended as acceptable values for this measure. t value was used for elimination of parameters in the path analysis, and the modification index was used for inclusion of additional parameters. the aim of the study was verbally explained to the potential participants who met the inclusion criteria. the participants were told that all information (such as name, address, percentage of injury, etc.) would be kept secret and anonymous. the required permissions were obtained from the vice - chancellor of research, bushehr university of medical sciences, department of education in bushehr city, and department of veterans affairs. furthermore, the study was approved by the university ethics committee with ethics number 20.71.208. in this cross sectional study, 276 moderate - to - severely affected chemical veterans living in ilam province were recruited between july and november 2014 via census sampling. veterans more than 25 percent were categorized as moderate and severe based on the medical committee of department of veterans affairs (dva). the province has temperate climate in the north, and warm and semi - warm climate in the south. the inclusion criteria included having suffered from moderate - to - severe levels of injury and having adequate physical health. however, individuals who did not comply with the study procedures, not satisfied about participating in the study, or without permanent residence in ilam province were excluded from the study. for sampling, first, the complete list of chemicals veterans names and phone numbers was obtained from the department of veterans affairs (dva). then, through telephone contact, explanations regarding the targets, procedures, and confidential rules of the research were presented to potential study participants. thereafter, if a veteran expressed desire to participate in the investigation, the researcher would visit their home to collect data. then, they were requested to choose the best options as their answers to questions. of the 276 referred veterans, six died, three were not able to respond to the questions, 15 submitted incomplete questionnaires, and 13 moved out of ilam. therefore, finally, 239 veterans (86.6% response rate) entered into the study. a self - administered questionnaire, the health - promoting lifestyle profile ii (hplp ii) questionnaire, and five standard instruments regarding pender models constructs, including perceived health status, perceived benefits, perceived barriers, social support, and self - efficacy, were used to collect data. all instruments were first translated by the primary investigator and then a bilingual person translated them back to english ; all differences were improved. the translated instruments were reviewed by a group of iranian health education experts, and minor amendments were made to them. prior to data collection, the questionnaires were tested for reliability in a sample of 50 chemical veterans. in this study, all questionnaires were reliable and the ranges of cronbach s alpha coefficients were 0.82 (perceived health status)0.92 (hplp ii). the self - administered questionnaire queried age, gender, occupation, disability, type of injury, and militancy type. the hplp ii included 52 questions, and all items are scored using a likert scale ranging from 1 (never) to 4 (always). this standard questionnaire for measuring health - promoting behaviors includes six dimensions, namely, health responsibility, physical activity, nutrition, spiritual growth, interpersonal relations, and stress management. higher scores indicate more favorable conditions in veterans in terms of health - promoting behaviors. walker and collogues reported cronbach s alpha of 0.94 for this instrument (13 - 15). in this study, for this instrument, we obtained cronbach s alpha of 0.92, and content validity index (cvi) values in terms of simplicity, precision, and specificity were 0.91, 0.97, and 0.91, respectively. the perceived health status questionnaire is a 12-item scale covering physical and mental health. response categories for items vary from 2- to 6- point scales, and raw scores for items range from 1 to 6. physical domain scores range from 6 to 20, and mental domain scores range from 6 to 27. reported cronbach s alpha of 0.73 for the physical health subscale and 0.72 for the mental health subscale in iranian people. furthermore, explanatory factor analysis (16) and confirmatory factor analysis (cfa) indicated good fit validity for this tool (17). given these previous evaluations of this questionnaire in iran, we did not validate it in the present study. the standard multidimensional scale of perceived social support contains 12 items and assesses three subscales, namely, family, friends, and other significant individuals support. the items are scored on a 7-point likert scale ranging from strongly disagree (1 point) to strongly agree (7 points), and the total questionnaire score ranges from 12 to 84. moreover, cronbach s alpha coefficient of this scale was 0.94, which indicates good internal consistency (18). in this study, the cvi values for simplicity, precision, and specificity were 0.93, 0.96, 0.91, respectively, and cronbach s alpha was 0.87, for this instrument. the scales regarding perceived benefits of and perceived barriers to health - promoting behaviors comprised 26 and 18 questions, respectively. alpha for the benefits and barriers scales were 0.82 and 0.60, respectively (10). the cvi values for simplicity, precision, and specificity for the perceived benefits questionnaire were 0.99, 0.96, and 0.99, respectively, while those for the perceived barriers questionnaire were 0.98, 0.98, and 0.91. furthermore, the reliability scores of the benefits and barriers scales were 0.91 and 0.88, respectively, in this study. perceived self- efficacy has been defined as people s judgments on their own possibilities for indulging in health - promoting behaviors. becker. designed this scale for measuring six dimensions of health - promoting behaviors. the 26 items comprising this questionnaire are scored on a 4- point likert scale from never (1 point) to always (4 points) with the total score ranging from 26 to 104. its cvi values for simplicity, precision, and specificity were 0.99, 0.98, and 0.98, respectively, which indicate its appropriateness of content validity. the collected data were coded and entered into statistical package for social sciences (spss) version 18.0. path analysis was used for studying the direct and indirect effects of variables and for estimating the values of coefficients in the underpinning linear model. this value was significant (p = 0.04) ; therefore, a few of the variables (such as age, social support, perceived benefits, and health status) were non - normal and we used the robust maximum likelihood estimation procedure. a correlation matrix and an asymptotic covariance matrix were applied for model estimation. chi - square (), the adjusted goodness - of - fit index (agfi), and root - mean - square error of approximation (rmsea) were used as model fit criteria. the comparative bentler - bonett non - normed fit index (nnfi) was selected. nnfi values equal to or greater than 0.90 are recommended as acceptable values for this measure. t value was used for elimination of parameters in the path analysis, and the modification index was used for inclusion of additional parameters. the aim of the study was verbally explained to the potential participants who met the inclusion criteria. the participants were told that all information (such as name, address, percentage of injury, etc.) would be kept secret and anonymous. the required permissions were obtained from the vice - chancellor of research, bushehr university of medical sciences, department of education in bushehr city, and department of veterans affairs. furthermore, the study was approved by the university ethics committee with ethics number 20.71.208. in total, 239 chemical veterans entered into the study with mean age of 51.17 8.87 years. most veterans were 25% veteran (52.3%, n = 125), 27.6% (n = 66) were 30%, 9.6% (n = 23) were 35%, and 9.2% (n = 22) had 40% or higher percent of veteran. in this study, 43.9% (n = 105) of the subjects were chemical veterans, 13.4% (n = 32) were physico - chemical veterans, 37.7% (n = 90) were neuro - chemical veterans, and 4.6% (n = 12) had all aforementioned afflictions. of these, 44.4% (n = 106) were voluntary participants in combat situations, 32.6% (n = 78) were soldiers, and 23% (n = 51) were military personnel. of all the participants, 35.1% (n = 84) were employed, 34.7% (n = 83) were pensioners, and 29.8% (n = 109) had other jobs. average responses to the five constructs and the hplp ii are summarized in table 1. the results (according to mean values obtained) demonstrate that the participants in this study had poor of hplp. moreover, the veterans perceived medium levels of health status, self - efficacy, and perceived barriers related to hplp. accordingly, positive associations were found between hplp and all constructs, except perceived barriers. therefore, the veterans who had higher perceived barriers were reported to have poorer hplp. the original hypothesized model did not fit the data well (= 147.72, df = 6, p = 0.000, rmsea = 0.32 (0.28 - 0.36), nnfi = 0.44, gfi = 0.89, agfi = 0.17). path analysis revealed that some coefficients were significant and others were not. after considering the results of the original model and the related theoretical issues, the model was modified by removing non - significant coefficients one - by - one between demographic factors and model constructs. the fit indices indicated improvement of the modified model over the original model (= 13.78, df = 18, p = 0.743, rmsea = 0.00 (0.00 - 0.04), nnfi = 0.98, gfi = 0.94, agfi = 0.89). critical n (hoelter s index) in this model was 601.94, which suggests that sample size cutoff for testing the model was more than satisfied. the coefficients between the variables were improved, and all paths in the modified model were significant. fit indices such as gfi and agfi indicated good fit of the model (values > 0.9) (table 3). according the results, among personal factors, perceived health status had the most effect on hplp with factor loading of 0.15. the variables age and occupation did not have direct or indirect effects on hplp and were omitted from the model. in this study, among the model constructs, the factor with the most effect on hplp was social support with the highest factor loading of 0.382. the results indicate that all constructs, except perceived barriers, positively influenced hplp, and perceived benefit had no effect on hplp. the pathways across personal factors, constructs, and hplp are shown in figure 1. direct and indirect influences of the personal factors and model constructs on hplp are summarized in table 4. abbreviations : barr, barrier ; percent, disability percentage ; se, self - efficacy ; ss, social support ; veteran, militancy ; veteran type, type of injury. in this study, we aimed to identify the direct and indirect factors affecting health - promoting behaviors in chemical veterans based on the hpm. in this study, the mean scores of health - promoting behaviors in veterans was lower than that shown in harooni;s study, which was conducted among the elderly in dena province (20). the results of the present study are consistent with the findings of several studies (10, 21 - 24), indicating the inappropriate status of health - promoting behavior in veterans. the results show that hpm as a theoretical framework for this study is a poor predictor of health - promoting lifestyle in chemical veterans (r = 15%). in this study, no correlation was observed between the individual characteristics and experiences of veterans regarding health - promoting lifestyles. however, all demographic variables, except age and occupation, had indirect effects on health - promoting behaviors. one study showed only housing status was associated with quality of life (25). consistent with this study, other studies have shown personal factors have no significant direct effects on hplp subscales (26 - 28). similar to the findings of several studies (29, 30), our findings show that perceived health status was the most important predictor of hplp of veterans, so individuals with better perceived health indulged in more health - promoting behaviors. this study showed that all structures, except perceived barriers, had positive effects on health - promoting behaviors. in addition, among the model constructs, perceived benefits had no effect on health - promoting behaviors and this result is in contradiction with the findings of a few other studies. in an iranian study among elderly people, perceived benefits was shown to have a direct effect on health - promoting behaviors. moreover, this construct had direct effects on oral health behavior and on the use of hearing protection devices (31, 32). in the present study, the impact of perceived benefits was covered by other constructs, so it was removed from the model. in accordance with some studies perceived barrier constructhad negative and indirect effect on health - promoting behaviors through social support construct (10, 33). in other study, perceived barriers showed negative but direct effect on using of hearing protection behavior (12, 34). in this study, similar to the findings of a previous study (34), perceived self - efficacy had indirect effects on health - promoting behaviors through social support and perceived barriers, but in several other studies, self - efficacy had both direct and indirect effects (10, 11, 35), and in other studies, this construct had only direct effects (28, 32, 33). therefore, all studies showed a relationship between self - efficacy and health - promoting behaviors. as shown in the present study, perceived social support was the most powerful predictor of health - promoting behaviors. in several studies (11, 25, 28, 34 - 37), social support, too, had a direct effect on health - promoting behaviors and quality of life. however, in one study among pregnant women (38), social support was not a significant predictor of health - promoting behavior. this contradiction may be owing to women s condition, indicating that these people are influenced by other factors to improve their health - related behaviors. it can be concluded that to ensure the spread of health - promoting lifestyles in chemical veterans, it is necessary to increase social support. to this end, we should educate a variety of sources, including friends, family, and significant people to create support required to indulge in health - promoting behaviors. additionally, veterans should be educated about strategies for overcoming barriers by using a variety of promoting self - efficacy strategies. due to several problems and disabilities such as respiratory disorders in veterans, furthermore, similar studies on chemical veterans are limited, so comparing the findings of this study with those of other studies was difficult. further research on veterans should be conducted in the near future. despite the limitations of the present study, given that it was conducted only in ilam province, the same study can be conducted in other provinces. furthermore, in the present study, only veterans with moderate to severe disabilities were included to avoid bias in the results. nonetheless, the use of hpm as a theoretical framework and the census sampling procedure were strong points of this study. it can be concluded that to ensure the spread of health - promoting lifestyles in chemical veterans, it is necessary to increase social support. to this end, we should educate a variety of sources, including friends, family, and significant people to create support required to indulge in health - promoting behaviors. additionally, veterans should be educated about strategies for overcoming barriers by using a variety of promoting self - efficacy strategies. due to several problems and disabilities such as respiratory disorders in veterans, questionnaire fulfillment was difficult. furthermore, similar studies on chemical veterans are limited, so comparing the findings of this study with those of other studies was difficult. further research on veterans should be conducted in the near future. despite the limitations of the present study, given that it was conducted only in ilam province, the same study can be conducted in other provinces. furthermore, in the present study, only veterans with moderate to severe disabilities were included to avoid bias in the results. nonetheless, the use of hpm as a theoretical framework and the census sampling procedure were strong points of this study. | backgroundhealth - promoting behaviors can enhance physical and mental health among individuals with disability, particularly veterans.objectivesthe current study aimed to examine both one - way direct and indirect effects of the factors of the health promotion model (hpm) on health - promoting behaviors in chemical veterans from ilam province in iran.materials and methodsthis cross - sectional study was conducted in 2014. in this study, 239 moderate - to - severe chemical veterans from illam province supported by the veterans affairs department of ilam were evaluated via census sampling. data including health - promoting behaviors, perceived self - efficacy, perceived barriers and benefits, perceived social support, and perceived health status were collected using standard questionnaires.resultsthe results show that the hpm is a poor predictor of the health - promoting lifestyles of chemical veterans (r2 = 15%). social support (factor loading = 0.38) is the strongest predictor of health - promoting behaviors and it influences such behaviors directly, while perceived barriers (factor loading = -0.11) and perceived self - efficacy (factor loading = 0.02) indirectly predict behavior through social support.conclusionsperceived social support is the most important factor that influences health - promoting behaviors. increasing social support by enhancing self - efficacy and decreasing perceived barriers can improve health - promoting behaviors among veterans. |
controlled hypotension has an established role in reducing intra - articular bleed and thereby improving visualisation during shoulder arthroscopy. both these agents reduce mean arterial blood pressures (mbp) to an equivalent magnitude. the haemodynamic parameter which is directly linked to pump pressures, intra - articular bleed and clarity of vision is the systolic blood pressure (sbp). an agent which achieves low sbp with concomitant preservation of autoregulation of vital organ blood flow would be the anaesthetic of choice. while hunt continues for the ideal anaesthetic maintenance agent for shoulder surgery, medline search (ncbi database literature ; key words : volatile anaesthetic, isoflurane, sevoflurane, shoulder arthroscopy, controlled hypotension) revealed no study on shoulder arthroscopic surgeries till date comparing isoflurane and sevoflurane inhalational techniques employed with concomitant interscalene brachial plexus block. this study aims to compare the capability (to achieve and maintain the desired haemodynamic status, target, tsbp = 90 mmhg, sbp) and convenience (of manipulations performed by the anaesthesiologist for maintaining such a status) of these two inhalational agents in this subset of patients. considering the comparability of isoflurane at 1.21.5 mac to sevoflurane at equal mac, we investigated the hypothesis that both agents are similar to each other in their capability to achieve the desired haemodynamic status. we used the process capability indices (pcis) as an additional statistical tool in analysing our data, which we believe lends to more accurate conclusions. fifty - nine (among 64) randomly assigned (random number generator, random # generator, jess tucker, version 1.1.3, 2013 webberface, llc, ios application, category : utilities, [email protected]) patients belonging to the american society of anesthesiologists (asa) status 1 and 2, who underwent shoulder arthroscopic surgery over a 23-month period (january 2014 to november 2015) were included in the study. since an effective preliminary interscalene block formed an essential part of the anaesthetic procedure, patients, in whom the regional block was not performed (n = 4 ; 1 in isoflurane and 3 in sevoflurane group) or less than optimally effective before inhalational anaesthesia was instituted, were excluded from the study. likewise, patients with severe pain at the operative site immediately after termination of inhalational anaesthesia indicating ineffectiveness of the block were also excluded from the study (n = 1, sevoflurane, [consort chart 1 ]). all patients were anaesthetised by the same anaesthesiologist, the first author and operated by the same surgeon. after preoperative assessment and recording of baseline vitals, these hospital inpatients were premedicated with tablet ranitidine 150 mg, having fasted overnight before the surgical procedure. no sedatives or opioids were used for premedication. the distribution of patients in both groups. isb = interscalene block in the operating room, patients were administered intravenous (i.v.) ultrasound - guided (sonosite, high frequency, linear probe, 13 - 6 mhz) interscalene, in - plane block was performed in the supine position with a mixture of 6 ml lignocaine 2% and 25 ml levobupivacaine 0.25%. the effectiveness of the block was confirmed by the abolition of sensations (pinprick) over c4c7 dermatomes and/or free and painless (passive) abduction in patients with painful shoulders. injection vecuronium or rocuronium in 2 ed95 doses and ventilation was instituted to achieve normocarbia. three - lead electrocardiogram, spo2, non - invasive blood pressure (nibp), end - tidal carbon dioxide and inhalational agent monitoring were done during the entire procedure. nibp recording was done in 3 min intervals in the non - operative upper arm. with the patient in the lateral decubitus position, datumvaporizer, meditec england, queenborough, kent meii, 5el) or isoflurane (abbott loan vaporizer, abbott australasia pty. ltd, 32 - 34 lord street, botany nsw 2019, australia) at 1.21.5 mac dosages. age - related iso - mac inhalational concentrations (chronomac, application timeline, version 1.0 : ios application, 2011) were used to achieve the desired end - tidal concentrations (0.3%, 1.0% - minimum and 2%, 3.0% - maximum for isoflurane and sevoflurane, respectively) for maintenance of anaesthesia. muscle paralysis was achieved with bolus doses of injection vecuronium or rocuronium to obtain train - of - four counts 12 and controlled ventilation was carried out. sbp, diastolic blood pressure (dbp), mbp and heart rate were recorded every 3 min. the study period was considered from the time of insertion of the arthroscope to its removal. before inserting the arthroscope and during the maintenance of anaesthesia, efforts were made to attain the target (t) sbp of 90 mmhg using the following methods : method a- increasing the depth of anaesthesia by administering additional doses of fentanyl (1 g / kg) with propofol (1 mg / kg) and method b- pharmacological intervention using a /-blocker (labetalol, minimum 20 mg and maximum 40 mg). method b was followed only after failure of method a. any adverse events such as persistent hypotension (3 consecutive readings of sbps lower than target or mbp 0.05). the mean of mean heart rates achieved was significantly higher in the isoflurane group (p = 0.019 [table 1 ]). the comprehensive list of maximum and minimum blood pressure and heart rate averages is included in table 1. the derived pcis show higher values of cp, cpk and cpm for all blood pressures (sbp, dbp and mbp) at predefined usls and lsls for isoflurane patients compared to sevoflurane [table 2 and figures 1, 2 ] suggesting superior capability of maintaining blood pressures and in achieving target defined negative values for cpk derived for all bp recordings [tables 2 and 3 ] suggesting that the achieved bp parameters crossed the usls more frequently in this subset. process capability report for systolic blood pressures of both groups, for overall and within processes and for two different specification limits (specification limits and extended specification limits) the process capability reports of systolic blood pressures for assembly fit data. the graphs represent both for original (non - transformed) data and after box - cox transformation. the right corner minor images represent original data before transformation the process capability report of systolic blood pressures for means data. the lsl and usl lines represent sls process capability report for diastolic blood pressures and mean arterial blood pressures of both groups and for two different specification limits (specification limit and extended specification limits) probability plots distribution analysis revealed a higher percentage of patients outside the sls and esls for all blood pressure readings (sbp, dbp and mbp) for sevoflurane vis - a - vis isoflurane and higher 80 percentile values of blood pressures for sevoflurane [tables 2 and 3 ]. a comparable number of patients in both groups required either anaesthetic intervention, pharmacological manipulation or both to achieve the desired blood pressures [table 1 ]. while comparison of the efficacy of isoflurane vis - a - vis sevoflurane in hypotensive anaesthesia for shoulder arthroscopy formed the primary objective of our study, a new analytical approach, process capability indices (pcis), different from conventional statistical methodologies deriving significance from p values was additionally deployed to derive more practical and meaningful conclusions. for various reasons (refer flow chart), we felt that comparisons using conventional p values could highlight some but not all significant variations, and this could ultimately result in a divergence between for example, when the means (and sds) of the sbps in two groups (isoflurane and sevoflurane) were compared, lower mean sbp and minimum sbps were achieved with isoflurane indicating its enhanced hypotensive action. surprisingly, the mean mbp, dbpmax, sbpmax and mbpmax, min were not significantly different between the groups. searching for a more inclusive analytical technique to overcome the possible inaccuracies of these comparisons, we found computing of pcis very useful and advantageous. as an indicator of how closely a process is able to match the output to its overall specifications and to predefined targets, it is widely employed as a statistical tool to assess production, quality and process improvement efforts in engineering design. pcis measure patient volumes against predetermined parameter limits rather than vice - versa in conventional statistical analysis. uniquely, this methodology, therefore, takes into account a multitude of influencing factors, both known and unknown, to provide us a capability measure. in short a high value of cp (close to 1) was observed in the isoflurane group considering sbp within 80 and 100 mmhg. this translated into 87% of patients in the isoflurane group maintaining sbps between predefined limits vis - a - vis 65% of sevoflurane suggest superior the cp and cpk for blood pressures moved in consonance for isoflurane while following an off - process - centralisation with high variability for sevoflurane. we observed isoflurane group patients had higher cpk values of 0.6 (for the range of 80100 mmhg, sevoflurane 0.03) along with a greater percentage of negative cpk value in the sevoflurane group of all blood pressure data. both these findings confirm that the process mean has fallen out of usls (blood pressure readings over 100 mmhg systolic, 3% isoflurane patients vs. 32% sevoflurane) thereby lending support to the superiority of isoflurane. higher cpm for isoflurane suggests that irrespective of the predefined range considered, the ease of achieving target blood pressure (90 mmhg sbp) was higher with this agent. higher heart rates were recorded in the isoflurane group, but pcis were not computed for this non - targeted parameter. however, but for the additional pharmacological interventions necessitated by isoflurane, heart rates recorded would possibly have been higher. cardiovascular effects specific to isoflurane have been detailed in several studies on animals, human volunteers, asa1 patients and in patients with coronary artery disease. the circulatory effects of isoflurane are distinctly self - specific while sevoflurane resembles both isoflurane and halothane. a study of isoflurane and sevoflurane in healthy volunteers by philip malan and colleagues demonstrated that dose - dependent decrease of mbp could be blunted by concomitant use of n2o. our study groups were comparable to these patients since n2o was used in all and the complete interscalene block created a pain - free status before inhalational agents were administered. however, if not for n2o usage, the hypotensive effect of isoflurane demonstrated in our patients could have been more profound. in horses, isoflurane - induced decrease in mean, systolic and diastolic bps has been shown to be maximum at 80100 min of anaesthesia. a dose - dependent hypotensive effect for both the inhalational agents at 12 mac has been established ; each, however, having a different attributed mechanism of action. the variance in the magnitude of hypotension (isoflurane versus sevoflurane) is difficult to explain. multiple animal as well as human volunteer studies have shown the myocardial depressant effects of regional anaesthetic drugs. isoflurane acts synergistically with bupivacaine to decrease myocardial contractility in rats clearly demonstrating the additive myocardial suppressive activity induced by regional anaesthetic used concomitantly with general anaesthesia. bupivacaine at a plasma concentration of 3 10 mol / l, a level normally achieved during regional anaesthesia shows negative ionotropic effects (lower dp / dtmax) when administered with isoflurane. levobupivacaine has a higher negative effect on isotonic relaxation (maxvr) than bupivacaine at equipotent plasma concentrations, thus causing more diastolic dysfunction. moreover, plasma concentrations are doubled under additional inhalational anaesthesia as compared to awake patients under local anaesthetic alone, and hence the effects too could be simply binary. we have used a mixture of both levobupivacaine and lidocaine but have not measured plasma concentrations. animal studies have shown that the cumulative dose of bupivacaine required for inducing cardiac depression and arrhythmia is higher (though not statistically significant) with concomitant 1mac sevoflurane vis it has been suggested that enhanced myocardial depression could result from a fast in - slow out mechanism of the local anaesthetic drug during repolarisation, in tandem with the heart rate. our isoflurane patients did show higher heart rates than the sevoflurane group, but a simple extrapolation of our observations to explain the enhanced hypotensive effect may be an oversimplification. the application of engineering indices for analysis of haemodynamic parameters in medicine may be questionable. ninety - five percent confidence was used for power in contrast to true formulae of engineering indices where 99.99% confidence is routinely used. the desired target blood pressure and sls for blood pressures would be more meaningful if set for each individual patient rather than for a group. individual variability of mac, autonomic tone, etc. for pci analysis, the data should preferentially be normally distributed ; if not, a box - cox or johnson 's data transformation should be attempted. further, a 3-parameter distribution analysis with lowest ad statistic value too would best analyse non - normal data, but all these data transformations have their limitations. this study confirms the superiority of isoflurane over sevoflurane in achieving target sbps, a parameter that has been directly linked to intra - articular bleeding during arthroscopic procedures. we used pcis as an additional practical tool that we believe, analyses better, the observed overall and within performances, with more valid outputs of spec 's which are independent of capability index values. isoflurane can provide better intraoperative haemodynamic status as compared to sevoflurane in patients undergoing shoulder arthroscopic surgery with preliminary interscalene blockade. we also recommend that pcis be more frequently used for analysing haemodynamic and other similar data (e.g., pain scores) in medical research to establish their true place among current statistical methodologies. | background and aims : hypotensive anaesthesia reduces intra - articular bleed and promotes visualisation during arthroscopy. the haemodynamic effects of inhalational agents isoflurane and sevoflurane were studied extensively, and both were found to reduce mean arterial pressures (mbp) to an equivalent magnitude. we investigated the relative ability of isoflurane vis - a - vis sevoflurane to maintain the target systolic blood pressure (sbp) in patients undergoing shoulder arthroscopic procedures.methods:in a prospective randomised study, 59 patients in two groups of 30 and 29 patients each received concomitant general anaesthesia (1.21.5 mac of isoflurane and sevoflurane) and interscalene brachial plexus block. nitrous oxide was used in both groups. intraoperatively, serial blood pressure recordings of sbp, diastolic blood pressure (dbp), mbp and heart rates were done at every 3rd min intervals. the manipulations needed to achieve target sbp (t = 90 mmhg) for optimal arthroscopic visualisation and treat unacceptable hypotensive episodes were noted. conventional statistical tests and process capability index (pci) evaluation were both deployed for data analysis.results:lower mean sbp and dbps were recorded for isoflurane patients as compared to sevoflurane (p < 0.05, for mean, maximum and minimum recordings). higher mean heart rates were recorded for isoflurane (p < 0.05). pcis indicated that isoflurane was superior to sevoflurane in the ease of achieving target sbp of 90 mmhg as well as maintaining blood pressures in the range of 80100 mmhg.conclusion:isoflurane provides better intraoperative haemodynamic status vis - a - vis sevoflurane in patients undergoing shoulder arthroscopic surgery with preliminary interscalene blockade. the pci can be a useful additional medical data analysis tool. |
genetic screening in alzheimer 's disease (ad) has identified only a handful of genes that are mutated in the disorder. thus, for a very large proportion of patients, the biology of their disease is poorly understood. epigenetic alterations may provide an explanation in these cases. using dna methylation profiles of human hippocampus from controls and patients, we have identified the presence of promoter hypermethylation of the dual - specificity phosphatase 22 (dusp22) gene in ad. dusp22 is a likely candidate gene for involvement in the pathogenesis of the disorder since, as we demonstrate here, it inhibits pka activity and thereby determines tau phosphorylation status and creb signaling. 2014 the authors. hippocampus published by wiley periodicals, inc. |
|
prostate - specific antigen (psa) measurement in patients with serum psa level above 4.0 ng / ml has a sensitivity of about 20%, and the specificity of psa measurements is approximately 60% to 70% at this cut - off (1). if patients with psa levels below 10 ng / ml were submitted to prostate biopsy, 2040% would be diagnosed with prostate cancer and 6080% should undergo unnecessary biopsy without detecting prostate cancer (2). benign prostatic hyperplasia, urethral or prostatic trauma, and prostatitis, as well as prostate cancer, can all be associated with elevated serum psa levels. ejaculation and digital rectal examinations have been reported to increase psa levels but studies have shown the effects to be variable or insignificant (3). these non - malignant conditions which were associated with elevation of a serum psa would decrease the accuracy of a serum psa. to improve low sensitivity of psa, age - adjusted psa, psa density (psad), psa velocity (psav), or percentage of free psa (% free - psa) has been introduced and used (4 - 8). in the last two decades, individual fluctuation in serial psa measurements has been reported to characterize the normal biological variability in psa among men without prostate cancer (9 - 13). the aims of this study were to investigate whether psa fluctuation correlates with a prostate cancer and to assess whether psa fluctuation could be used for diagnosis of a prostate cancer. this was a retrospective cohort study in the department of urology of chonnam national university hospital (gwangju, korea) between january, 2012 and march, 2013. this study included 229 patients who were submitted to a transrectal ultrasonography (trus) guided prostate biopsy (177 in non - cancer group, 52 in prostate cancer group). trus - guided prostate biopsy was performed in at least 8 cores or more of tissue targeting the peripheral zone at the apex, mid gland, and base on each side of the prostate. enrolled patients were provided twice psa measurements within 6 months (baseline psa, psa1 ; secondary psa, psa2), and psa2 was measured at the day before prostate biopsy. patients with urinary tract infection and who were receiving a 5-alpha reductase inhibitor were excluded from the study. the research attained ethical approval from the institutional review board of connam national university hospital (irb no. 210 - 05 - 082). the recommendations of the declaration of helsinki for biomedical research involving human subjects were followed psa fluctuation (% /mo) was defined as a change rate of psa ((psa2-psa1)/psa1) per a month. psad (ng / ml / g) was defined as a psa2 divided by prostate volume. prostate volume (g) was measured according to the prostate ellipsoid formula, multiplying the largest anteroposterior (height, h), transverse (width, w), and cephalocaudal (length, l) prostate diameters by 0.524 (h w an automated immunoassay analyzer (architect i2000sr, abbott diagnostics, abbott park, il, usa) was used for all psa measurements, and trus - guided prostate biopsy was recommended for a psa level > 3.0 ng / ml or suspicious digital rectal examination. receiver operator characteristic (roc) curve was used to assess the availability as a differential diagnostic tool and the correlation. simple linear regression was performed to analyze a correlation between psa fluctuation and other factors such as age, psa, psad, and prostate volume. this was a retrospective cohort study in the department of urology of chonnam national university hospital (gwangju, korea) between january, 2012 and march, 2013. this study included 229 patients who were submitted to a transrectal ultrasonography (trus) guided prostate biopsy (177 in non - cancer group, 52 in prostate cancer group). trus - guided prostate biopsy was performed in at least 8 cores or more of tissue targeting the peripheral zone at the apex, mid gland, and base on each side of the prostate. enrolled patients were provided twice psa measurements within 6 months (baseline psa, psa1 ; secondary psa, psa2), and psa2 was measured at the day before prostate biopsy. patients with urinary tract infection and who were receiving a 5-alpha reductase inhibitor were excluded from the study. the research attained ethical approval from the institutional review board of connam national university hospital (irb no. 210 - 05 - 082). the recommendations of the declaration of helsinki for biomedical research involving human subjects were followed psa fluctuation (% /mo) was defined as a change rate of psa ((psa2-psa1)/psa1) per a month. psad (ng / ml / g) was defined as a psa2 divided by prostate volume. prostate volume (g) was measured according to the prostate ellipsoid formula, multiplying the largest anteroposterior (height, h), transverse (width, w), and cephalocaudal (length, l) prostate diameters by 0.524 (h w architect i2000sr, abbott diagnostics, abbott park, il, usa) was used for all psa measurements, and trus - guided prostate biopsy was recommended for a psa level > 3.0 ng / ml or suspicious digital rectal examination. roc) curve was used to assess the availability as a differential diagnostic tool and the correlation. simple linear regression was performed to analyze a correlation between psa fluctuation and other factors such as age, psa, psad, and prostate volume. mean psa1 and psa2 levels were 5.93 ng / ml and 4.90 ng / ml. psa fluctuation ranged from 0.12%/month to 122.6%/month, psad from 0.01 ng / ml / g to 0.58 ng / ml / g, and prostate volume from 8.9 g to 160 g. patients diagnosed with prostate cancer were 52 (22.7%), and patients with non - cancer were 177 (77.3%). patients with non - cancer presented benign prostatic hyperplasia (155, 67.7%), chronic prostatitis (16, 7.0%), and atypical small acinar proliferation (6, 2.6%). table 1baseline characteristics of patients.variablesmean (range)age (year)66.91 (41 - 85)psa1 (ng / ml)5.93 (0.23 - 24.62)psa2 (ng / ml)4.90 (0.20 - 9.96)interval of psa tests (month)1.93 (1 - 6)psa fluctuation (% /month)17.61 (0.12 - 122.60)psad (ng / ml / g)0.15 (0.01 - 0.58)prostate volume (g)37.61 (8.90 - 160)%free - psa (%) 20.22 (3.79 - 61.50)no. biopsy results (%) non - cancer177 (77.3) prostate cancer52 (22.7) psa = prostate - specific antigen, psa = baseline psa, psa = secondary psa, psad = psa density, % free - psa = percentage of free psa. psa = prostate - specific antigen, psa = baseline psa, psa = secondary psa, psad = psa density, % free - psa = percentage of free psa. psa2 and psad were significantly lower in non - cancer group than prostate cancer group (4.682.18 vs 5.611.76 ng / ml, p=0.002 ; 0.1320.796 vs 0.2270.124 ng / ml / g, p<0.001). psa fluctuation and % free - psa was significantly greater in non - cancer group than prostate cancer group (19.9523.34 vs 9.638.57%/month, p=0.004 ; 21.539.74 vs 15.757.96%, p<0.001). there was significant difference in prostate volume between the two groups (40.1219.93 vs 29.0512.05 g, p<0.001) (table-2). non - cancer group (n=177)prostate cancer group (n=52)p valueage (year)66.368.4568.787.610.103psa1 (ng / ml)6.003.755.701.700.300psa2 (ng / ml)4.682.185.611.760.002interval of psa tests (month)1.881.192.071.360.330psa fluctuation (% /month)19.9523.349.638.570.004%free - psa (%) 21.539.7415.757.96<0.001psad (ng / ml / g)0.1320.7960.2270.124<0.001prostate volume (g)40.1219.9329.0512.05<0.001 psa = prostate - specific antigen, psa 1 = baseline psa, psa 2 = secondary psa, % free - psa = percentage of free psa, psad = psa density. psa = prostate - specific antigen, psa 1 = baseline psa, psa 2 = secondary psa, % free - psa = percentage of free psa, psad = psa density. psa2, psad, % free - psa, and psa fluctuation was statistically significant as a differential diagnostic tool. the optimal cut - off values for detecting prostate cancer of psa and psad were defined as 4.92 ng / ml (sensitivity, 65.4% ; specificity, 56.5% ; area under curve (auc), 0.64 ; p=0.002) and 0.155 ng / ml / g (sensitivity, 73.1% ; specificity, 71.2% ; auc, 0.762 ; p<0.001). the appropriate cut - off values of % free - psa and psa fluctuation were defined as 17.31% (sensitivity, 63.3% ; specificity, 63.5% ; auc, 0.688 ; p<0.001) and 8.48%/month (sensitivity, 61.6% ; specificity, 59.6% ; auc, 0.633 ; p=0.004), respectively (figure-1). figure 1receiver operator characteristic curves analyses of secondary prostate - specific antigen (psa2), prostate - specific antigen density (psad), percentage of free prostate - specific antigen (% free - psa), and prostate - specific antigen (psa) fluctuation. the optimal cut - off values for detecting prostate cancer were defined as 4.92 ng / ml in psa2 (sensitivity, 65.4% ; specificity, 56.5% ; area under curve (auc), 0.64 ; p=0.002), 0.155 ng / ml / g in psad (sensitivity, 73.1% ; specificity, 71.2% ; auc, 0.762 ; p<0.001), 17.31% in % free - psa (sensitivity, 63.3% ; specificity, 63.5% ; auc, 0.688 ; p<0.001), and 8.48 % /month in psa fluctuation (sensitivity, 61.6% ; specificity, 59.6% ; auc, 0.633 ; p=0.004), respectively. simple linear regression was performed to analyze a correlation between psa fluctuation and other factors such as age, psa, psad, and prostate volume. psa1 and psa2 levels were significantly correlated with psa fluctuation in a simple linear regression model (coefficient b, 3.404, p<0.001 in psa1 ; coefficient b, -3.978, p<0.001 in psa2). age, % free - psa, psad, and prostate volume did not affect on psa fluctuation (table-3). table 3simple linear regression analyses of prostate - specific antigen fluctuation and clinical parameters.variablescoefficient bsep valueage (year)-0.0590.1700.728psa1 (ng / ml)3.4040.392<0.001psa2 (ng / ml)-3.9780.625<0.001%free - psa (%) 0.1630.1650.325psad (ng / ml / g)-20.06116.0290.212prostate volume (g)-0.0290.0750.696 psa = prostate - specific antigen, psa 1 = baseline psa, psa 2 = secondary psa, % free - psa = percentage of free psa, psad = psa density. psa = prostate - specific antigen, psa 1 = baseline psa, psa 2 = secondary psa, % free - psa = percentage of free psa, psad = psa density. mean psa1 and psa2 levels were 5.93 ng / ml and 4.90 ng / ml. psa fluctuation ranged from 0.12%/month to 122.6%/month, psad from 0.01 ng / ml / g to 0.58 ng / ml / g, and prostate volume from 8.9 g to 160 g. patients diagnosed with prostate cancer were 52 (22.7%), and patients with non - cancer were 177 (77.3%). patients with non - cancer presented benign prostatic hyperplasia (155, 67.7%), chronic prostatitis (16, 7.0%), and atypical small acinar proliferation (6, 2.6%). table 1baseline characteristics of patients.variablesmean (range)age (year)66.91 (41 - 85)psa1 (ng / ml)5.93 (0.23 - 24.62)psa2 (ng / ml)4.90 (0.20 - 9.96)interval of psa tests (month)1.93 (1 - 6)psa fluctuation (% /month)17.61 (0.12 - 122.60)psad (ng / ml / g)0.15 (0.01 - 0.58)prostate volume (g)37.61 (8.90 - 160)%free - psa (%) 20.22 (3.79 - 61.50)no. biopsy results (%) non - cancer177 (77.3) prostate cancer52 (22.7) psa = prostate - specific antigen, psa = baseline psa, psa = secondary psa, psad = psa density, % free - psa = percentage of free psa. psa = prostate - specific antigen, psa = baseline psa, psa = secondary psa, psad = psa density, % free - psa = percentage of free psa. psa2 and psad were significantly lower in non - cancer group than prostate cancer group (4.682.18 vs 5.611.76 ng / ml, p=0.002 ; 0.1320.796 vs 0.2270.124 ng / ml / g, p<0.001). psa fluctuation and % free - psa was significantly greater in non - cancer group than prostate cancer group (19.9523.34 vs 9.638.57%/month, p=0.004 ; 21.539.74 vs 15.757.96%, p<0.001). there was significant difference in prostate volume between the two groups (40.1219.93 vs 29.0512.05 g, p<0.001) (table-2). non - cancer group (n=177)prostate cancer group (n=52)p valueage (year)66.368.4568.787.610.103psa1 (ng / ml)6.003.755.701.700.300psa2 (ng / ml)4.682.185.611.760.002interval of psa tests (month)1.881.192.071.360.330psa fluctuation (% /month)19.9523.349.638.570.004%free - psa (%) 21.539.7415.757.96<0.001psad (ng / ml / g)0.1320.7960.2270.124<0.001prostate volume (g)40.1219.9329.0512.05<0.001 psa = prostate - specific antigen, psa 1 = baseline psa, psa 2 = secondary psa, % free - psa = percentage of free psa, psad = psa density. psa = prostate - specific antigen, psa 1 = baseline psa, psa 2 = secondary psa, % free - psa = percentage of free psa, psad = psa density. psa2, psad, % free - psa, and psa fluctuation was statistically significant as a differential diagnostic tool. the optimal cut - off values for detecting prostate cancer of psa and psad were defined as 4.92 ng / ml (sensitivity, 65.4% ; specificity, 56.5% ; area under curve (auc), 0.64 ; p=0.002) and 0.155 ng / ml / g (sensitivity, 73.1% ; specificity, 71.2% ; auc, 0.762 ; p<0.001). the appropriate cut - off values of % free - psa and psa fluctuation were defined as 17.31% (sensitivity, 63.3% ; specificity, 63.5% ; auc, 0.688 ; p<0.001) and 8.48%/month (sensitivity, 61.6% ; specificity, 59.6% ; auc, 0.633 ; p=0.004), respectively (figure-1). figure 1receiver operator characteristic curves analyses of secondary prostate - specific antigen (psa2), prostate - specific antigen density (psad), percentage of free prostate - specific antigen (% free - psa), and prostate - specific antigen (psa) fluctuation. the optimal cut - off values for detecting prostate cancer were defined as 4.92 ng / ml in psa2 (sensitivity, 65.4% ; specificity, 56.5% ; area under curve (auc), 0.64 ; p=0.002), 0.155 ng / ml / g in psad (sensitivity, 73.1% ; specificity, 71.2% ; auc, 0.762 ; p<0.001), 17.31% in % free - psa (sensitivity, 63.3% ; specificity, 63.5% ; auc, 0.688 ; p<0.001), and 8.48 % /month in psa fluctuation (sensitivity, 61.6% ; specificity, 59.6% ; auc, 0.633 ; p=0.004), respectively. simple linear regression was performed to analyze a correlation between psa fluctuation and other factors such as age, psa, psad, and prostate volume. psa1 and psa2 levels were significantly correlated with psa fluctuation in a simple linear regression model (coefficient b, 3.404, p<0.001 in psa1 ; coefficient b, -3.978, p<0.001 in psa2). age, % free - psa, psad, and prostate volume did not affect on psa fluctuation (table-3). table 3simple linear regression analyses of prostate - specific antigen fluctuation and clinical parameters.variablescoefficient bsep valueage (year)-0.0590.1700.728psa1 (ng / ml)3.4040.392<0.001psa2 (ng / ml)-3.9780.625<0.001%free - psa (%) 0.1630.1650.325psad (ng / ml / g)-20.06116.0290.212prostate volume (g)-0.0290.0750.696 psa = prostate - specific antigen, psa 1 = baseline psa, psa 2 = secondary psa, % free - psa = percentage of free psa, psad = psa density. psa = prostate - specific antigen, psa 1 = baseline psa, psa 2 = secondary psa, % free - psa = percentage of free psa, psad = psa density. after the recent reports of highly anticipated data from the prostate, lung, colorectal, and ovarian cancer screening trial (plco) and the european randomized study of screening for prostate cancer (erspc), the benefit of psa screening remains controversial (14, 15). twenty - five percent of men with psa levels from 4 to 10 ng / ml have a biopsy - proven prostate cancer, but 75% undergo unnecessary prostate biopsies, potentially leading to anxiety, discomfort, and significant additional health care cost (16). to improve the low sensitivity of psa, age - adjusted psa, psad, psav, and % free - psa have been introduced and used (4 - 8). in our study, the sensitivity and specificity of psa was not high (65.4% ; 56.5% ; auc, 0.64 ; p=0.002) in a roc curve. similarly with previous reports, both psad and % free - psa were the available parameters to improve the low sensitivity of psa (sensitivity, 73.1%, 63.3% ; specificity, 71.2%, 63.5% ; auc, 0.762, 0.688). in addition to psad and % free - psa, we found that psa fluctuation is associated with the presence of a prostate cancer. although low sensitivity and specificity, psa fluctuation could be valuable by using with other psa indices such as psad and % free - psa. in several studies, biological fluctuations in psa levels have been previously reported to characterize the normal biological variability in psa levels among men without prostate cancer (9 - 13). reported a significant fluctuation between two serum psa measurements obtained within a short - time interval of less than 90 days, and authors suggested not a single psa measurement but repeated psa tests (9). in our study, mean interval of twice psa measurements was 1.93 months (approximately 57.9 days), and there was no difference in psa1 but significant difference in psa2 between two groups within a more shorter - time interval. studied to assess the relationship between prostate volume and psa fluctuation, and found that psa fluctuation was not correlated with psa volume but correlated with baseline psa levels (11). in our study, psa fluctuation was correlated with baseline psa levels, and not correlated with age, psad, % free - psa, and prostate volume. thus, we suggest that psa fluctuation could be used for the differential diagnosis regardless with age and prostate volume. evaluated daily biological variations of psa levels by obtaining 10 serum samples from 24 patients during a 2-week (12). they concluded that the degree of biological fluctuation differs among patients, and the difference between serial psa measurements that is less than 20% to 46% may be due to biological and analytical variation alone. the reports mentioned above targeted to patients without prostate cancer, and focused on the biologic fluctuation itself. the hypothesis of our study was that degree of psa fluctuation might differ according to the presence or absence of prostate cancer, and we found the characteristic of psa fluctuation that patients with prostate cancer had a narrow range of fluctuation in serial psa measurements. in addition, these results are as practically useful as other indices related to psa such as a psad or % free - psa. it is important to clarify that the psa fluctuation should not be confused with psav as described by carter. psav represent the rate of change of psa over time that optimally requires three consecutive psa measurements over a 2-year period, as described by carter. psa fluctuation is simply a mathematical estimate of the absolute monthly changes in psa (ng / ml per a month) between two measurements that can be separated by less than 1 year. in our study, the mechanism of psa fluctuation could not be investigated ; however, psa fluctuation might include the possibility of physiologic changes in serial psa measurements, in contrast with the psav to consider a disease - progression. in our study, when patients with prostate cancer (n = 52) were divided by a gleason score, psa fluctuation was greater in patients with gleason score 6 (n=22) than gleason score 7 (n=30), although not significantly (10.509.45 vs 8.997.97 % /month, p=0.535 ; data are not shown in tables). however, this result might not have sufficient statistical power, due to small sample size. we carefully suppose that there might be differences in the psa fluctuation between low - risk and high - risk prostate cancer. a study based on larger population is necessary for further conclusive data. the major limitation is its retrospective design, and thus the present results may be vulnerable to confounding errors and bias. we enrolled patients that measured two times psa levels within 6 months to minimize the confounding by irregular intervals. however, we could have concluded about the difference of psa fluctuation between two groups, because psa fluctuation was not correlated with prostate volume in a simple linear regression model. finally, this study may not have had sufficient statistical power, due to the relatively small sample size. psa fluctuation is significantly greater in patients without cancer than patients with prostate cancer, and is positively correlated with baseline psa level. thus, clinicians should consider that patients with wide psa fluctuations, although baseline psa levels are high, might have a low risk of diagnosis with prostate cancer, and that serial psa measurements could be an option in patients with an elevated psa level. psa = prostate - specific antigen psa 1 = baseline prostate - specific antigen psa 2 = secondary prostate - specific antigen psad = prostate - specific antigen density psav = prostate - specific antigen velocity % free - psa = percentage of free prostate - specific antigen trus = transrectal ultrasonography roc = receiver operator characteristic | objective to investigate whether prostate - specific antigen (psa) fluctuation correlates with a prostate cancer and to assess whether psa fluctuation could be used for diagnosis of prostate cancer.materials and methods our study included 229 patients who were performed a prostate biopsy (non - cancer group, 177 ; prostate cancer group, 52). enrolled patients were provided twice psa tests within 6 months. psa fluctuation (% /month) was defined as a change rate of psa per a month. independent t test was used to compare between two groups. receiver operator characteristic curve was used to assess the availability as a differential diagnostic tool and the correlation. simple linear regression was performed to analyze a correlation between psa fluctuation and other factors such as age, psa, psa density, and prostate volume.results there were significant differences in psa, psa density, percentage of free psa, and psa fluctuation between two groups. psa fluctuation was significantly greater in non - cancer group than prostate cancer group (19.9523.34%/month vs 9.638.57%/month, p=0.004). the most optimal cut - off value of psa fluctuation was defined as 8.48%/month (sensitivity, 61.6% ; specificity, 59.6% ; auc, 0.633 ; p=0.004). in a simple linear regression model, only psa level was significantly correlated with psa fluctuation.conclusion patients with wide psa fluctuations, although baseline psa levels are high, might have a low risk of diagnosis with prostate cancer. thus, serial psa measurements could be an option in patients with an elevated psa level. |
in this issue of critical care, zwiers and colleagues describe the incidence of acute kidney injury (aki) in neonates on extracorporeal membrane oxygenation (ecmo) based on a 12-year cohort study from sophia children s hospital pediatric intensive care unit in rotterdam, the netherlands. of major interest, this study is looking at patients during an era when continuous renal replacement therapy (crrt) was not systematically used, giving a clearer perspective on the natural kinetics of renal function, estimated by serum creatinine (scr), during ecmo course. interestingly, the worst renal function occurred early during the ecmo run, within the first 2 days, and with a 2- to 4-day delay until renal function improvement could be observed. this suggests that aki is an early event in newborns requiring ecmo support. establishing the natural history of renal function in patients with multiple organ dysfunction syndrome (mods) gives us the expected time period during which one may, it would be valuable to know to what extent improving renal function during ecmo course really is associated with better outcome. better characterization of mods timing in the course of heterogeneous life - threatening diseases is central. international integrated database for the evaluation of severe sepsis and drotrecogin alfa (activated) therapy database analysis, regrouping 4,459 patients with sepsis, showed that worsening organ failures particularly, cardiovascular, respiratory, renal, and hematologic failure was the cause of death in patients with sepsis. interestingly, it showed that aggravating renal sequential organ failure assessment score was a late event close to death. one can hypothesize that bi - modal impairment in renal function should result in a more severe outcome. in children and neonates, similar data were published. aggravating pediatric logistic organ dysfunction score within the first 4 days was associated with a 50% mortality. however, in newborns, renal dysfunction does not seem to have a major impact on mortality. in the present study, the authors showed that severity of renal failure was strongly associated with mortality ; the odds ratio of mortality for acute kidney failure (identified as an scr of greater than 300% of normal value) was 12.7. this suggests that, although knowing aki natural course during ecmo may give arguments for delaying crrt, there is clearly a cutoff value at which aki severity directly impacts mortality. it is not the purpose of this commentary to discuss the ideal timing of crrt during ecmo, because many questions remain to be debated, but this study confirms that aki is a major outcome determinant in the course of ecmo. if not an unresolved dilemma, aki in the course of mods remains a circular reference : aki in patients requiring ecmo therapy is triggered by initial systemic insults, already present at the time of ecmo initiation, and aggravated by reperfusion injury and ecmo circuit - induced inflammation. the close interplay between the cause and severity of the disease, supportive therapies, and host response is influencing the development of aki and mods. identifying as well as determining the relative importance of extrinsic factors a ggravating mods / aki during ecmo therapy is central. besides technologic advances in ecmo circuit biocompatibility improvement reperfusion as well as function, identifying deleterious therapeutic interventions, and improving standard therapies, such as antimicrobial chemotherapy. recently, it was shown in an autopsy series of patients dying of septic shock that renal dysfunction was due mostly to focal renal tubular injury through apoptosis and not autophagy. that study clearly suggested that renal dysfunction found in patients dying of sepsis - induced mods is reversible. ecmo is certainly among the greatest recent advances, making a surgical theater technique widely available in the critical care setting for clinical conditions far away from the original cardiovascular indications. however, a lot remains to be done in order to identify proper indications, optimize all organ support, reduce complications, and better characterize pathophysiologic and cellular mechanisms of organ dysfunctions in children under ecmo. aki : acute kidney injury ; crrt : continuous renal replacement therapy ; ecmo : extracorporeal membrane oxygenation ; mods : multiple organ dysfunction syndrome ; scr : serum creatinine. | whether the egg or the chicken came first remains debated, although the debate is not critical for those who love eating omelets. at least, it is well accepted that one needs to break eggs to fry an omelet. in some ways, there are similarities with acute kidney injury. a lot of debate arises from whether acute kidney injury is a complication of various insults and therapies or an expected continuum of the organ failure process. indeed, it is well accepted that acute renal failure is associated with increased mortality in severely ill children and infants. |
chenaud and colleagues are to be commended for their interest in achieving a better understanding of ' informed consent for research obtained during the intensive care unit stay '. because intensive care medicine consumes an ever increasing percentage of total health care expenditure, research to define both its benefits and limitations is a moral imperative. ironically, ethical concerns about informed consent for clinical studies in the intensive care unit (icu) are making this research increasingly difficult to conduct, especially in europe [2 - 5 ]. the essential finding of this study is that research participants in the icu may have limited capacity to retain and remember elemental aspects of studies in which they have enrolled. the authors showed that most icu patients, when questioned 10 to 12 days after having given their consent for participation in a study (involving six blood draws over the course of a month), could not recall the purpose of the trial or its related risks. these findings are similar to results previously reported by this same team of investigators in icu patients who underwent elective cardiac surgery. what is the message of this study ? as emphasized by the authors, we must remember that informed consent for research is a process, not an event, and that we have an obligation to make sure that participants are continually reminded of the purposes and risks of a study and of their right to withdraw at any time. however, does this study call into question the validity of the informed consent process itself ? the authors remind us of the three mandatory conditions for informed consent for research, as outlined in the belmont report : communication of information about the purposes and procedures involved in the trial, including its associated risks and benefits ; ensuring that subjects comprehend this information ; and ensuring that subjects are able to provide consent voluntarily. of note, none of these conditions require subjects to be able to recall this information at a later time. in other words, whether subjects can recall elemental information at a later date has no bearing on whether the informed consent was valid. in fact, there are good reasons why this should not be a factor in determining the quality of the informed consent process. first, whether a patient has given a valid informed consent is a question that can only be asked and answered at the time when the consent is obtained. events that happen later in the patient 's hospitalization can not make the consent more or less valid. second, icu patients commonly experience neurologic derangements that limit their capacity for recall, caused both by their illnesses and by the medications they have been administered. patients who have given their genuine informed consent under ideal circumstances may therefore be unable to recall the specifics at a later time. third, the severity of the risks associated with the research may affect whether they can be recalled by subjects at a later time. for patients with a critical illness, a request for six blood draws (as in this study) might have seemed trivial and not worth remembering. the irrelevance of recall to the quality of informed consent can be illustrated by considering a hypothetical clinical trial that involved administration of a medication that would induce retrograde amnesia. if subjects could theoretically provide fully valid consent for a study of this type, as i believe they could, then the capacity to recall the informed consent process clearly can not be a criterion for its validity. to sum up, this study should remind us that informed consent is not just an event that occurs at the beginning of a study, but a process that needs to be continually revisited with patients during the course of a trial. it would be a mistake, however, to claim that the inability of patients to recall elemental features of a trial at a later time is relevant to judging the quality and validity of the initial consent. as a final note, it is curious that this study on informed consent was itself conducted without informed consent. the authors defend their decision not to obtain informed consent by noting that they obtained all of their data from the research database and from administrative files. clearly, however, the subjects had given consent only for their data to be used for the original purposes of the clinical research, and the investigators neither informed the subjects nor obtained their permission for these data to be used in a separate study for an entirely different purpose. as one part of the study, the investigators asked the subjects questions about their recall of earlier conversations. subjects who were asked these questions were not aware that they were participating in a research study and were not asked for their informed consent. other information was taken from ' administrative files ' for research purposes without approval from an ethical review board. although i acknowledge that it is very unlikely that any patients were harmed by their participation in this research, the question remains as to whether this study on the ethics of doing research itself satisfied the requirements of the belmont report. the report provides an opportunity to discuss and debate a great many interesting issues, from the question of how we measure the quality of the informed consent process to the issue surrounding the ethical standards that should be applied to this type of research, and as such is very deserving of our interest and attention. catherine chenaud, paolo merlani and bara ricou we are grateful to robert truog for his interesting and judicious comments on our report. our research article actually resulted from an interesting finding identified during the conduct of a study on inflammation, in which we had to re - contact the patients 10 to 12 days after their inclusion in order to plan for blood sampling on day 28. we realized that some patients did not remember having consented to participate in the study, its purpose, or its risks. in these cases, we reviewed the study information and asked the patients whether they agreed to continue their participation in the study. we therefore established an informed consent procedure based on a protocol to ensure that patients were adequately informed by all investigators. we additionally noted whether patients read the information leaflet and asked questions during the procedure. our objective in initiating this procedure was to ensure full adherence to the principle of autonomy. we were surprised to discover that so many patients did not remember their inclusion in the study, its subject, or the related risks. because problems stemming from the informed consent procedure may be frequent, we felt that it would be worthwhile to add to the debate on informed consent in critically ill patients by sharing our findings with the medical community. it is not unusual for multiple reports to come from a single protocol, and this also applies to studies on informed consent conducting during studies on other issues. some of these studies require informed consent only for the main study, whereas in others the need for informed consent is waived for all aspects of the study [8 - 11 ]. we are not aware of a specific informed consent procedure being in place in these situations. respect for fundamental ethical principles, embodied in the belmont report, is essential in protecting the human research subject. it also is interesting, however, to balance the importance of informed consent, acquisition of knowledge, and study - related risks or burdens. the most important safeguard for research subjects more so than informed consent is a conscientious, responsible, and caring investigator. in conclusion, we not only believe that ' the patients were not harmed by their participation ', but we also feel that we tried to respect our patients ' autonomy by examining our informed consent procedure. by sharing our experience with the scientific community, we hope to contribute to improvements in protection of human research subjects in future studies conducted in critically ill patients. | in the previous issue of critical care chenaud and colleagues found that most intensive care unit patients who had given informed consent for their participation in a clinical trial could not recall either the purpose of the trial or its related risks several days later. these findings should remind us that informed consent is a process, not an event, but they should not be interpreted to mean that recall is, of itself, a useful criterion for evaluating either the validity or the quality of the informed consent process. on an entirely separate note, the decision of the authors not to obtain informed consent for this study itself raises interesting questions about the ethics of doing research on the ethics of doing research. |
aflatoxins (afs) are secondary metabolites with toxic and carcinogenic effects, which are produced by species of aspergillus, particularly aspergillus flavus and aspergillus parasiticus (a. parasiticus). the commodities such as peanuts, rice, corn and cottonseed have suitable condition for growth of these fungi, so contamination of these commodities with afs often makes them unfit for consumption. afs are considered the most carcinogenic, mutagenic, and teratogenic compounds found naturally in foods and feeds. aflatoxins b1 (afb1), b2 (afb2), g1 (afg1), and g2 (afg2) are major naturally occurring afs produced by aflatoxigenic fungi. afb1 is the most powerful af ; moreover, afb1 has been classified as a human carcinogen in the group 1 by the international agency for research on cancer (iarc). in addition, afb1 is a hepatocarcinogenic compound that might cause tumors in other organs like colon and kidney. the importance of afb1 led to many researches on the effects of different compounds in order to inhibit its production. nanotechnology for the purpose of manufacturing new materials at nanoscale is considered as rapidly developing field that a large spectrum of research has been focused on its application. different types of nanomaterials like copper, zinc, platinum, titanium, magnesium, gold, alginate and silver have come up, but silver nanoparticles (agnps) have proved to be most effective as it has good antimicrobial efficacy against bacteria, viruses and other eukaryotic micro - organisms. for many years, silver has been in use to treat burns and chronic wounds. also silver and its compounds are regarded as a relatively safe antimicrobial metal that has a wide spectrum of activity. recently, due to enhancement of antibiotic - resistant bacteria and limitations of antibiotic usage, silver wound dressings with a variety of silver levels is used again as an alternative treatment. due to new advances of researches about metal nanoparticles, nano - ag has received special attention as a possible antimicrobial agent, which in low concentrations is nontoxic. nanoparticles due to their size have a larger surface area to come in contact with microorganisms than a bigger form of particles. antifungal activities of agnps against different kinds of fungus have not been reported as much as antimicrobial activities of them by researchers. it was reported that agnps could inhibit fungi in low concentrations and those levels had no toxic effect on human cells. in a research by kim., it is indicated that agnps have antifungal activity against trichophyton mentagrophytes, trichosporon beigelii, and candida albicans in comparison with available antifungal agents like amphotericin b and fluconazole. the aim of this study was to investigate the effects of agnps on the growth and afb1 production by a. parasiticus. the a. parasiticus ptcc 5280, a known producer of afb1 was used throughout the study. potato dextrose broth (merck, germany) was the culture medium used for afs production by the fungus. agnps in colloid form with 4,000 ppm were purchased from nanocid company in tehran (www.nanocid.com). a. parasiticus was cultured on potato dextrose broth in 10-well flat - bottom microplates (iwaki ; well dia. the culture medium was added to microplates in amounts of 1 ml / well and then inoculated with fungal spore suspension (110 spores / well) prepared in sterilized distilled water containing 0.1% tween 80. different concentrations of the agnps (60, 80, 100, 120, 140, 160, 180 and 200 ppb) prepared in dimethyl sulfoxide (dmso) were added to the test wells. ketoconazole and sterile distilled water (sdw) were used as positive control and negative control, respectively. growth of mold was observed visually throughout the incubation period. the minimal inhibitory concentration (mic) was defined as the concentration of agnps that prevented growth in the media as determined visually. for these experiments 250 l of a suspension containing 110 spores / ml were added to 250 ml erlenmeyer flasks containing 50 ml of broth in the presence of agnps at concentrations lower than the mic (75%, 50%, and 25% mic). following the addition of each solvent, a 50 ml of potato dextrose broth was mixed with 2.5 g nacl and 100 ml solution of 80% methanol in water for 5 min and then the mixture was filtered on whatman filter paper. the extract was diluted with 25 ml of distilled water and 5 ml pbs with ph 7.4. finally, 20 ml of this was purified on the immunoaffinity column activated with 20 ml of pbs by gentle syringe pressure at a flow rate of 1 ml / min and then the column was washed with 20 ml of deionized water. the column was dried by blowing air through it for 23 seconds with a syringe. the afs were slowly eluted from the column with 2 ml of hplc grade methanol and then were diluted with 2 ml of deionized water. the a. parasiticus ptcc 5280, a known producer of afb1 was used throughout the study. potato dextrose broth (merck, germany) was the culture medium used for afs production by the fungus. agnps in colloid form with 4,000 ppm were purchased from nanocid company in tehran (www.nanocid.com). a. parasiticus was cultured on potato dextrose broth in 10-well flat - bottom microplates (iwaki ; well dia. 16 mm). the culture medium was added to microplates in amounts of 1 ml / well and then inoculated with fungal spore suspension (110 spores / well) prepared in sterilized distilled water containing 0.1% tween 80. different concentrations of the agnps (60, 80, 100, 120, 140, 160, 180 and 200 ppb) prepared in dimethyl sulfoxide (dmso) were added to the test wells. ketoconazole and sterile distilled water (sdw) were used as positive control and negative control, respectively. the minimal inhibitory concentration (mic) was defined as the concentration of agnps that prevented growth in the media as determined visually. for these experiments 250 l of a suspension containing 110 spores / ml were added to 250 ml erlenmeyer flasks containing 50 ml of broth in the presence of agnps at concentrations lower than the mic (75%, 50%, and 25% mic). following the addition of each solvent, a 50 ml of potato dextrose broth was mixed with 2.5 g nacl and 100 ml solution of 80% methanol in water for 5 min and then the mixture was filtered on whatman filter paper. the extract was diluted with 25 ml of distilled water and 5 ml pbs with ph 7.4. finally, 20 ml of this was purified on the immunoaffinity column activated with 20 ml of pbs by gentle syringe pressure at a flow rate of 1 ml / min and then the column was washed with 20 ml of deionized water. the column was dried by blowing air through it for 23 seconds with a syringe. the afs were slowly eluted from the column with 2 ml of hplc grade methanol and then were diluted with 2 ml of deionized water. initial data showed that agnps was able to inhibit a. parasiticus growth and af production effectively. this inhibition was reported in concentration of 180 g / ml. figure 1 illustrates afb1 production without the effect of agnps, where the determined point was the start time of af production. the hplc results of af production showed that these nanoparticles were able to strongly inhibit afb1 production in a dose dependent manner, also afb1 inhibition was reported at a concentration of 90 g / ml after comparing with non - treated controls (figure 2).. shows different silver nanoparticles concentrations effect on aflatoxin b1 production, at 90 g / ml (50% mic) agnps, aflatoxin production was inhibited. initial data showed that agnps was able to inhibit a. parasiticus growth and af production effectively. figure 1 illustrates afb1 production without the effect of agnps, where the determined point was the start time of af production. the hplc results of af production showed that these nanoparticles were able to strongly inhibit afb1 production in a dose dependent manner, also afb1 inhibition was reported at a concentration of 90 g / ml after comparing with non - treated controls (figure 2).. shows different silver nanoparticles concentrations effect on aflatoxin b1 production, at 90 g / ml (50% mic) agnps, aflatoxin production was inhibited. silver is one of the most effective antibiotic substances known and has been used to treat human ailments for over 100 years due to its natural antibacterial and nontoxic properties. since nano - sized silver materials have stronger antifungal activity than bulk silver materials, it has recently attracted great attention. in fact, smaller sized particles possess a larger surface area in contact with the microorganism and have a higher percentage of interaction than bigger particles. although most of the studies are focused on nanoparticle applications, there are limited studies describing the impact of nanoparticles on human health. results of last researches showed that mic of agnps was lower than the cytotoxicity level of tested human cells. therefore, low concentrations of silver nanoparticles could inhibit fungi and those levels had no toxic effect on human cells. panacek. have claimed that nano - sized silver has a significant antifungal activity against candida albicans. also, in another study by kim., antifungal effects of agnps on candida albicans were investigated. the mic values of these studies indicated that agnps inhibited growth of candida albicans at low concentrations (< 4 g / ml). in comparison with the last two studies, the present research shows that a. parasiticus growth is inhibited at higher concentration of agnps. this discrepancy can be derived from different species of fungi and agnps used in both works, where agnps were stabilized by surfactants and polymers. in our study, this method was similar to the method performed by nozari., who reported that agnps showed an antifungal effect against candida species isolated from chronic candida vulvovaginitis. many studies have shown the antimicrobial effects of agnps. among the antimicrobial activity of agnps against gram - positive staphylococcus aureus and the mic of agnps against s. aureus and e. coli was 100 - 150 g / ml and in contrast with our study agnps were used in powder form. antifungal effects of agnps on dermatophytes especially trichophyton mentagrophytes, had been studied by kim. some researchers have reported that the activity of antifungal drugs against phoma glomerata, phoma herbarum, fusarium semitectum and trichoderma sp was enhanced in combination with agnps. however, in spite of recent researches, the effects of nano - ag against af producing a. parasiticus and afb1 are mostly unknown. based on previous studies, the main contribution of this study was agnps effect on growth and afb1 production by a. parasiticus. in the present study, we showed agnps inhibiting afb1 production by a. parasiticus in addition to the ability for strong fungal growth inhibition. therefore the mic value of the agnps against a. parasiticus was 180 g / ml and agnps inhibited afb1 production at 50% of the mic (90 g / ml). when different concentrations of agnps were added to the fungal cultures in media, a remarkable inhibition in aflatoxin synthesis was observed. the inhibition in growth and toxin production was dependent on the concentration of agnps. in this study, since the agnps were used as antifungal drug, antifungal drug of ketoconazole and sterile distilled water (sdw) were positive control and negative control, respectively. in a research by gajbhiye., fluconazole, which is antifungal agent, was used as positive control for comparison with ag - nps and kim. used amphotericin b as a positive control in their study. to the best of our knowledge, this research was the first study about the effects of agnps on afb1 production by a. parasiticus. due to the important role of af contamination, especially negative effect of afb1 on public health, efforts should be conducted to prevent the contamination, since prevention is the most economical and practical approach. agnps ability indicates that they may be considered as useful candidates to eliminate af contamination in food and feedstuffs. based on the results of the present study, agnps could inhibit growth and afb1 production by a. parasiticus. these nanoparticles must be subjected to further study to determine their effects on other mycotoxins, define toxicity, and evaluate economic feasibility. | background : aflatoxins (afs) are secondary hazardous fungal metabolites that are produced by strains of some aspergillus species on food and feedstuffs. aflatoxin b1 (afb1) is one of the most important af with high toxicity. prevention of af production and their elimination from food products is a matter of importance for many researchers in the last decades. nanomaterials applications in medical science have been widely studied in the recent years. most of existing researches seek the effect of nanoparticles on bacteria, fungi, and viruses. the aim of this study was to determine the effects of silver nanoparticles (agnps) on growth and afb1 production of af - producing aspergillus parasiticus.methods:a parasiticus was inoculated (106 conidia per ml of medium) to potato dextrose broth (pdb) medium and then agnps was added and incubated with shaking at 130 rpm and 28c for 7 days. af was assayed by high performance liquid chromatography (hplc). microbiological assay (mba) on microplates contained potato dextrose broth (pdb) medium (4 days at 28c) at different concentrations of agnps (60, 80, 100, 120, 140, 160, 180 and 200 g / ml) was measured.results:the results demonstrated that a minimum inhibition concentration (mic) equal to 180 g / ml was determined for agnps against a. parasiticus. the agnps effectively inhibited afb1 production at a concentration of 90 g / ml.conclusion : the results obtained in this study show agnps at concentrations lower than the mic drastically inhibited production of afb1 by a. parasiticus in culture medium. the agnps may be useful to control af contamination of susceptible crops in the field. |
the mood stabilizer and anticonvulsant drug valproic acid and the antidepressants doxepin and venlafaxine are well - established psychotropic drugs that are used widely. valproic acid is one of the most important antiepileptic agents (stephen, 2003 ; angalakuditi and angalakuditi, 2011) applicable in antiepileptic maintenance treatment as well as in epileptic emergency cases such as acute seizures or status epilepticus (wasterlain., 2011). moreover, it is an established mood stabilizer used in the treatment of bipolar affective disorders (dietrich and emrich, 1998 ; bowden, 2003), and additionally in nonpsychiatric indications such as vestibular migraine (bisdorff, 2011) or painful diabetic neuropathy (bril., 2011). the risk of a possible switch from depression to mania under treatment with antidepressants has led to a long debate on the use of these drugs in patients with bipolar disorder (koszewska and rybakowski, 2009) in whom especially tricyclic antidepressants and venlafaxine could trigger a particular switch risk. even if valproic acid monotherapy has been suggested to be efficacious (bond., 2010) at least in europe it is not unusual to treat severe depressive episodes in bipolar disorder with tricyclic antidepressants or venlafaxine (amsterdam and brunswick, 2003), although not supported by evidence from randomized - controlled trials. in addition, many patients with epilepsy show depressive symptoms during the course of their illness (miller., 2008), which, in some cases of severe depressive episodes, could be the reason for administration of a combination of a tricyclic antidepressant and valproic acid. the occurrence of severe adverse events during combined treatment with valproic acid and antidepressant drugs has been described in case reports on a recurrence of absence seizures after starting comedication with low - dosed amitriptyline (avoni., 1996), and for status epilepticus after adding clomipramine to valproic acid (detoledo., 1997). in experimental studies, a significant increase in the plasma concentration of amitriptyline and nortriptyline after the addition of valproic acid has been reported (vandel., 1988 ; an increase in nortriptyline serum levels in association with valproic acid comedication was also observed in two cases (fu., 1994). finally, we have previously published a drug drug interaction study that showed a marked increase in amitriptyline and nortriptyline serum levels in combination with valproic acid (unterecker., 2013). even though an influence of valproic acid on serum concentrations of tricyclic antidepressants such as amitriptyline, nortriptyline, and clomipramine has been reported repeatedly in the literature (detoledo., 1997 spina and perucca, 2002 ; patsalos and perucca, 2003 ; perucca, 2005), to date, no studies have examined potential interactions between valproic acid and the tricyclic antidepressant doxepin or the dual selective antidepressant venlafaxine. as treatment with the antidepressants doxepin and venlafaxine as well as with the mood stabilizer valproic acid is routinely monitored by therapeutic drug monitoring (tdm) in the department of psychiatry, psychosomatics and psychotherapy of the university hospital of wrzburg, we could retrospectively assess this tdm database for the time period january 2008 to december 2011 to identify all cases in which valproic acid in combination with doxepin or venlafaxine was administered. in cases of multiple serum - level determinations of the same drug, only the last determination was considered for evaluation to avoid multiple inclusion of the same individual. in a second step, we included a control group of patients receiving doxepin or venlafaxine without valproic acid comedication. this sample was matched with the patients in the valproic acid group with respect to sex, age, and dose of the respective antidepressant as well as number of comedications. patients with potential drug drug interactions because of comedication with drugs that could induce or inhibit the metabolism of doxepin or venlafaxine according to a review of hiemke. we then compared the respective groups with or without valproic acid in terms of dose - corrected serum levels (ng / ml per applied mg of daily dose) of the antidepressants as well as the ratio of the metabolite / parent compound by the mann spearman s correlation coefficients were calculated to analyze the association between valproic acid and antidepressants serum levels. serum levels were determined in the tdm laboratory of the psychiatric university hospital of wrzburg using an isocratic reversed - phase high - performance liquid chromatography method (doxepin, venlafaxine) and a spectrophotometric immunoassay (valproic acid), respectively. internal and external (cardiff bioanalytical services, the cardiff medic center, cardiff, uk) quality control programs were operated regularly without rejection. from january 2008 to december 2011, 16 patients were identified in whom serum levels of doxepin and valproic acid were determined and 41 patients in whom serum levels of venlafaxine and valproic acid were measured. from the same time period, a sample of control patients receiving doxepin and venlafaxine without valproic acid was obtained and matched for sex, age, and dose of the antidepressant agent (table 1). comparison of the sample with combined doxepin or venlafaxine and valproic acid treatment and the matched control samples of antidepressants without valproic acid in terms of matching variables and serum levels of antidepressants (mann whitney u - test) patients receiving valproic acid and doxepin had higher mean dose - corrected serum levels of doxepin, n - doxepin, and doxepin+n - doxepin in comparison with patients treated with the antidepressant alone. whereas four of 16 patients in the doxepin plus valproic acid sample showed a total serum level of doxepin+n - doxepin above the alert level of 300 ng / ml (hiemke., 2011), in the control group, this was not the case in any of the 16 patients (p<0.05). in patients receiving venlafaxine and valproic acid, the mean serum concentration of o - desmethylvenlafaxine was higher than that in patients treated with venlafaxine alone. for dose - corrected serum levels of venlafaxine+o - desmethylvenlafaxine, there only was a trend for a difference (0.05<p<0.10, table 1) whereas the parent compound showed no difference. in the total serum concentration of venlafaxine+o - desmethylvenlafaxine, two of 41 patients in the valproic acid comedication sample exceeded the alert level (800 ng / ml ; hiemke., 2011) whereas none in the group receiving venlafaxine without valproic acid exceeded this level. however, this difference was not statistically significant. the serum concentrations of the respective antidepressant and its metabolite in relation to the daily dose of the antidepressants in patients with and without valproic acid comedication are shown in figs 1 and 2. the ratio of the metabolite to parent compound did not differ between patients with or without valproic acid for both drugs (table 1). serum level of doxepin (dox)+n - dox (ng / ml) as a function of dox dose in patients with and without valproic acid (vpa) comedication (dashed lines : lower and upper limit of the therapeutic range). serum level of venlafaxine (ven)+o - desmethylvenlafaxine (odv) (ng / ml) as a function of ven dose in patients with and without valproic acid (vpa) comedication (dashed lines : lower and upper limit of the therapeutic range). on examining a potential association between the serum level of valproic acid and the dose - corrected serum levels of the respective antidepressants and their metabolites, a significant correlation (spearman s) was found between valproic acid and doxepin+n - doxepin serum levels (fig. 3). in terms of dose - corrected serum levels of venlafaxine+o - desmethylvenlafaxine (r=0.191, p=0.231, n=41) scatterplot of dose - corrected serum level of doxepin (dox)+n - dox [(ng / ml)/(mg / day) ] and serum level of valproic acid (vpa) (spearman s r=0.602, p<0.014, n=16). our results indicate a clinically relevant increase in the serum concentrations of doxepin and o - desmethylvenlafaxine if a comedication with valproic acid is administered. in patients receiving doxepin and valproic acid, there was also a significant positive correlation between the serum levels of valproic acid and dose - corrected serum level of the antidepressant. an obvious limitation is the retrospective nature of the study, which, in principle, can not determine any causal relationship. thus, the results of this study are of an explorative nature and have to be confirmed by prospective investigations. furthermore, our study did not take into account the fact that both doxepin and venlafaxine are formulated as a mixture of trans - stereoisomers and cis - stereoisomers (haritos., 2000). even if a potential pharmacokinetic influence of psychiatric and somatic comedication was controlled for by excluding patients who received a comedication with drugs known for their inducing or inhibiting properties in terms of the metabolic activity of cytochrome p450 enzymes, the possibility of an undetected drug drug interaction can not be ruled out completely. therefore, the polypharmacy that was observed in all the patients studied in both naturalistic samples might have compromised the analysis. in terms of the number of simultaneously administered psychotropic drugs, there was no significant difference between patients with and without valproic acid for any of the antidepressant drugs evaluated. moreover, both groups did not differ with respect to sex, age, or dose of the antidepressant agent. in terms of valproic acid and clomipramine, detoledo. (1997) reported the case of a patient with status epilepticus associated with a combination of valproic acid and clomipramine. they found elevated serum levels of clomipramine despite applying a relatively small dose (75 mg), which was also observed by fehr. (2000). in a patient who received a comedication with valproic acid, elevated serum levels of amitriptyline and nortriptyline resulting in a severe cardiac adverse effect (brugada syndrome) were described by roberts - thomson. however, the authors did not discuss a possible causal role of an interaction between amitriptyline and valproic acid, which shows the importance of a further clarification of the interaction potential of a combination of valproic acid and tricyclic antidepressants. in contrast, an increase in the serum level of another tricyclic antidepressant, desipramine, after discontinuation of valproic acid has been described (joseph and wroblewski, 1993), suggesting that potential interactions between valproic acid and antidepressants could result in different effects on serum levels of the antidepressants. according to the results of the present study, there is not only a significant influence of valproic acid on the serum level of doxepin but also a significant correlation between dose - corrected serum level of doxepin+n - doxepin and valproic acid serum level. as a significant influence of amitriptyline on the plasma half - life of valproic acid has been described (pisani., 1986) according to our results, a change in valproic acid metabolism by doxepin might also be assumed. however, the mechanism of the influence of valproic acid on doxepin and venlafaxine metabolism still remains unclear. both doxepin and venlafaxine are metabolized mainly by cyp2d6 and cyp2c19. to a minor degree, doxepin is metabolized by cyp2c9 and venlafaxine by cyp3a4 (hiemke., 2011). according to wen. (2001) valproic acid in vitro inhibited cyp2c19 as well as cyp3a4 slightly, and cyp2c9 to a larger extent. the latter might be the main reason for the considerable increase in doxepin+n - doxepin in combination with valproic acid. therefore, the addition of valproic acid in patients treated with substrates of cyp2c9 might be problematic as a considerable increase in the serum level of the respective drug might occur, even if alternative metabolic pathways exist. whereas cyp2c19 contributes considerably toward n - demethylation of doxepin, cyp2c9 seems to play only a minor role in the metabolism of doxepin (hrtter., 2002). nevertheless, an inhibition of its metabolic activity of cyp2c9 might be followed by an increase in doxepin serum concentrations (kirchheiner., 2002). in addition to an influence of valproic acid by inhibition of cyp2c9, the influence of saturated pathways must be considered as valproic acid is also metabolized by cyp2c9. (1988) on unchanged ratios of nortriptyline and amitriptyline before and after the addition of valproic acid, the present study showed no differences in the ratios of the metabolite and the parent compound for doxepin in patients with and without valproic acid comedication. as, according to kirchheiner. (2002), the doxepin as well as the n - doxepin serum level might be elevated by an inhibition of cyp2c9, our result of a lack of influence on the ratio in contrast to the strong inhibitory influence of valproic acid on the metabolism of doxepin, in the venlafaxine sample, only a significant increase in the metabolite o - desmethylvenlafaxine, which is also known as desvenlafaxine, was found. even if cyp2d6 is dominant, in addition to cyp2c19, cyp2c9 also plays a role in the n - demethylation of venlafaxine. however, inhibitors of cyp2c9 showed no consistent inhibition of o - desmethylvenlafaxine formation (fogelman. however, cyp2c9, in addition to cyp2c19 and cyp3a, contributes considerably toward the formation of n - desmethylvenlafaxine (fogelman., 1999). even if some authors disregard an influence of cyp2c9 on the n - demethylation of venlafaxine (shams., 2006 ; mcalpine., 2011), the results of the present study suggest a significant contribution of cyp2c9 because of the higher o - desmethylvenlafaxine serum levels in the valproic acid comedication sample. in particular, the inhibition of valproic acid on the n - demethylation pathway might lead to a stronger o - demethylation and as a consequence to higher serum levels of o - desmethylvenlafaxine. on the basis of this interpretation, it must be assumed that a treatment with desvenlafaxine that is chemically identical to venlafaxine s major metabolite o - desmethylvenlafaxine and marketed as an original drug is not influenced by valproic acid comedication. in contrast to previous findings (unterecker., 2013) showing a significant difference in the ratios of nortriptyline / amitriptyline in the samples with and without valproic acid comedication as an indicator of a change in metabolism by valproic acid, the present study found no differences in the ratios of the metabolite and the parent compound for doxepin and venlafaxine in patients with and without valproic acid comedication. therefore, the first step of biotransformation of doxepin and venlafaxine does not seem to be influenced significantly by valproic acid, but possibly further steps in the metabolic pathways. according to the results of this naturalistic study, there is a significant influence of valproic acid comedication on the dose - corrected doxepin+n - doxepin serum concentration (mean elevation of 124%) and on the dose - corrected o - desmethylvenlafaxine serum concentration (mean elevation of 27%), but only a trend of an influence on the dose - corrected venlafaxine+o - desmethylvenlafaxine serum concentration (mean elevation 17%). adverse events were not documented systematically in this study, but case reports in the literature suggest that especially in treatment with tricyclic antidepressants, severe adverse effects can be induced by a considerable increase in serum levels (avoni., 1996 ; detoledo., 1997 ; unterecker., 2013). the significant positive correlation between valproic acid serum level and dose - corrected doxepin+n - doxepin serum level indicates that in addition to a careful dosage of doxepin lower valproic acid doses are also advisable. to the best of our knowledge, no report of a significant correlation between the serum levels of an antidepressant and a mood stabilizer has been published thus far ; yet, clinicians should be aware of such an interaction. as a consequence, a combination treatment of valproic acid and tricyclic antidepressant drugs such as amitriptyline, nortriptyline, doxepin, or clomipramine should be avoided and other antidepressant drugs with a better safety profile and less interaction potential should be preferred. if valproic acid is applied in combination with these antidepressants, for reasons of safety, they should be used with great caution, avoiding high doses completely and administering half of the usual dose. dose adjustment by tdm will be very helpful and should be used regularly if available. s.u. has received travel and accommodation expenses from astra zeneca, pfizer, and janssen. j.d. has received speaker s honoraria from janssen, bristol - myers squibb, wyeth, lundbeck, astra zeneca, and pfizer and grant support from medice. b.p. has received speaker s honoraria from astra zeneca, janssen, and pfizer. for the remaining authors | valproic acid and the antidepressants doxepin and venlafaxine are frequently used psychotropic drugs. in the literature, an influence of valproic acid on serum levels of antidepressants has been described, although studies have focused on amitriptyline. the authors assessed their therapeutic drug monitoring (tdm) database for patients receiving a combination of doxepin or venlafaxine and valproic acid and compared these samples with matched controls without valproic acid comedication in terms of the serum concentration of antidepressants. the mean dose - corrected serum concentration of doxepin+n - doxepin in 16 patients who received valproic acid comedication was higher (2.1711.482 ng / ml / mg) than that in the matched controls (0.9710.857 ng / ml / mg, p<0.003). we also found a significant correlation between valproic acid serum level and dose - corrected doxepin+n - doxepin serum level (spearman s r=0.602, p<0.014). the mean dose - corrected serum level of venlafaxine+o - desmethylvenlafaxine in 41 patients who received valproic acid comedication did not differ significantly from that of the matched controls (p<0.089), but there was a significant difference between both groups in the dose - corrected serum level of o - desmethylvenlafaxine (1.4030.665 vs. 1.1020.444, p<0.017). as a consequence, if a combination of valproic acid with doxepin or venlafaxine is administered, cautious dosing is advisable and tdm should be performed. |
all replication - competent retroviruses encode genes for three major proteins : gag, pol, and env. complex retroviruses, such as human immunodeficiency virus type 1 (hiv-1), encode additional regulatory and accessory proteins required for efficient replication in host cell or the infected host organism. gag, an essential retroviral protein, is necessary and sufficient for the assembly, budding, and release of virus - like particles (vlps) in all types of retroviruses except the spumaviruses. gag is synthesized on cytosolic ribosomes and is assembled as a polyprotein precursor. during and/or shortly after budding and release, the polyprotein is cleaved into several domains by the viral protease (figure 1) as reviewed in [13 ]. the major domains of the precursor gag are the matrix (ma), capsid (ca), and nucleocapsid (nc). the primary role of the n - terminal ma domain is targeting of the gag precursor protein to the site of assembly, typically the plasma membrane (pm). in general, electrostatic interactions between basic amino acid residues in ma and the acidic inner leaflet of the pm are important for gag - membrane targeting [4, 5 ]. in the case of hiv-1, the n - terminal myristate group and a cluster of basic residues in the ma domain of the hiv-1 gag that interacts with phosphatidylinositol-4,5-bisphosphate (pi(4,5)p2) together although the gag - membrane targeting of both murine leukemia virus (mlv) and mason - pfizer monkey virus (mpmv) is also affected by pi(4,5)p2 modulation [8, 9 ], it has been reported that the membrane targeting of rous sarcoma virus (rsv) and human t - lymphotropic virus type 1 (htlv-1) is largely independent of pi(4,5)p2 [10, 11 ]. the ma domain also plays a role in the incorporation of the env glycoprotein into virions. the ca domain is important for gag - gag interactions during virus assembly and constitutes the outer part of the viral core after gag processing by the viral protease [1214 ]. this small, basic domain is responsible for the binding and incorporation of the viral rna genome into virions, which is mediated by gag interactions with genomic rna. many studies demonstrate that the major site of hiv-1 assembly is the pm [1518 ], although late endosomes could be a platform for virus assembly under specific conditions. in primary macrophages however, studies have recently suggested that the above vesicles are not late endosomes but rather membrane invaginations connected to the pm [2022 ]. in addition to gag, the other major structural retroviral protein is the env glycoprotein. env proteins are required for virus entry into target cells and are thus essential for forming infectious retroviral particles. in this paper, we discuss current knowledge about the biosynthesis, intracellular trafficking, and virion incorporation of retroviral env proteins, as well as the membrane microdomains involved in virus assembly and/or transfer. retroviral env glycoproteins are synthesized from a spliced form of the viral genomic rna as reviewed in [2325 ] (figure 1). translation of the env protein occurs on ribosomes bound to the endoplasmic reticulum (er) and starts with the leader sequence, which contains a small, n - terminal hydrophobic signal peptide. the env protein is cotranslationally inserted into the lumen of the rough er. in the er, the leader sequence is removed by cellular signal peptidases. in addition, env polypeptides are n- and o - glycosylated and subsequently trimmed [26, 27 ]. the hydrophobic transmembrane (tm) domain prevents env proteins from being fully released into the lumen of the er [28, 29 ]. the amino acid sequence following the tm is referred to as the cytoplasmic tail (ct), which varies from 30 to around 150 residues, depending on the virus. the hiv-1 accessory protein vpu binds to the cd4 receptor through its cytoplasmic domain and downregulates the receptor by transporting it to the proteasome for degradation, thereby preventing premature interactions between env and its receptor [3436 ]. in the golgi, cleavage of the retroviral env precursor occurs at a polybasic (e.g., k / r - x - k / r - r) motif by cellular proteases such as furin or closely related enzymes probably within or near the trans - golgi network (tgn) [3743 ]. for hiv-1, the surface glycoprotein gp120 and the tm glycoprotein gp41, which bind together noncovalently, gp160 processing is essential for the activation of env fusogenicity and virus infectivity [38, 42, 4446 ]. similarly, cleavage of env is also essential for membrane fusion and virus infectivity in mlv [39, 4750 ], in rsv [51, 52 ], and in mouse mammary tumor virus (mmtv). a recent report showed that cleavage of mlv env by furin also plays an important role in env intracellular trafficking and incorporation. although most retroviral env proteins including that of hiv-1 are associated with intracellular membranes [5557 ], at least part of the gp120/gp41 trimer complex traffics through the secretory pathway to the pm. it has been suggested that ap-1, one of adaptor proteins for clathrin - coated vesicle formation, is involved in the correct sorting of hiv-1 env from the tgn to the pm, [58, 59 ]. it has been reported that intracellular ctla-4-containing secretory granules are involved in the trafficking of hiv-1 env to the pm although the subsequent trafficking of env after the golgi is not well understood. after reaching the pm, like those of other lentiviruses, hiv-1 env undergoes rapid endocytosis, which is mediated by the interaction between the 2 subunit of the clathrin adaptor ap-2 and a membrane - proximal, tyr - based motif (yxxl) in the gp41 ct although some of the endocytosed env is recycled back to the pm, most retroviral env is associated with intracellular membranes [63, 64 ]. maintaining low levels of env at the cell surface allows the infected cells to evade the host immune response and to avoid induction of env - mediated apoptosis. gammaretroviruses such as mlv and mpmv also have dileucine- and tyr - based motifs in their env ct. these motifs are important to regulate intracellular trafficking of env of both retroviruses via interactions with clathrin adaptors [65, 66 ]. as for pseudotyping of gammaretroviruses, it has been reported that the feline endogenous retrovirus rd114 env does not allow pseudotyping with viral cores from lentiviruses such as siv, whereas the rd114 env is incorporated into mlv virions [6769 ]. intracellular trafficking of gag and env was examined using a set of chimeric viruses between mlv and rd114. interestingly, it was found that the rd114 env was mainly localized along the secretory pathway, whereas the mlv env was mostly localized in endosomes, and that intracellular localization was dependent on specific motifs in the env ct. in addition, subsequent work revealed that an acidic cluster in the rd114 env ct regulates assembly of not only the rd114 env but also the mlv env through the interaction with a host factor, phosphofurin acidic - cluster - sorting protein 1. several models have been proposed for the incorporation of retroviral env glycoprotein into virions as reviewed in [23, 70 ] (figure 2). passive incorporation is the simplest model for the incorporation of env proteins into virus particles (figure 2(a)). first, viral pseudotyping with a foreign glycoprotein can occur easily in many cases although there are some exceptions, one of which is the exclusion of hiv-1 or siv env with the long ct from most retrovirus cores. with respect to hiv-1, the virus can be pseudotyped with env glycoproteins not only from several other retroviruses but also with those from other virus families such as ortho (para) myxoviruses and flaviviruses [7184 ]. second, retroviruses allow passive incorporation of host membrane proteins into virus particles [8587 ]. most cellular proteins are incorporated into the retrovirus envelope without significant sorting [88, 89 ]. finally, in the case of hiv-1, several studies have demonstrated that the gp41 ct can be removed without affecting incorporation of the env into virions, although this has been shown to occur only for some laboratory cell lines such as hela or 293 t [9094 ]. although several lines of evidence support the passive incorporation model for retroviral env, there is much evidence indicating that env incorporation into virions is regulated by direct interactions between gag and env proteins (figure 2(b)). although removal of the gp41 ct sequence of hiv-1 has little effect on env incorporation in some cell types, as described above, smaller deletions in ct regions cause severe defects in env incorporation [95100 ]. the ma domain of gag has been shown to be important for env incorporation into virions [91, 92, 101, 102 ]. the defect in env incorporation caused by deletion of the gp41 ct is reversed by several ma mutations, indicating that an interaction between env and the ma domain of gag is required for incorporation of full - length env into virions, at least in the case of hiv-1 [93, 98 ]. more evidence for direct gag - env interaction comes from the finding that hiv-1 env directs gag budding to the basolateral surface of polarized epithelial madin - darby canine kidney (mdck) cells through the ct of hiv-1 env, whereas gag alone buds in a nonpolarized fashion [103106 ]. the tyr - based motif in the gp41 ct is also utilized in polarized budding of hiv-1 in lymphocytes. surprisingly, the polarized budding of hiv-1 in mdck cells could also be promoted by mlv and htlv-1 env through their ct. it also has been reported that coexpression of pr55 inhibits endocytosis of hiv-1 env through its interaction with the gp41 ct. another example of the specific gag - env interactions was demonstrated using gag and env proteins of mlv and hiv-1 in rat neurons. similarly, mlv env is preferentially recruited onto mlv gag through its ct domain in the presence of both mlv and hiv-1 cores although the authors also show an alternative mechanism by which the recruitment to hiv-1 budding sites is independent of the ct domain of mlv env. furthermore, rsv env is exclusively recruited to rsv budding sites through its ct, suggesting that the interaction between env and gag is direct in the case of this avian retrovirus. in addition to the circumstantial evidence discussed above, some biochemical data suggest a direct interaction between gag and env. in vitro binding between ma and a gp41 ct - gst fusion protein has been reported for both hiv-1 and siv [112, 113 ]. peptides corresponding to a large central domain of gp41 ct inhibited the capture of membrane - free pr55 with an anti - p24 antibody. in addition, a stable, detergent - resistant gp41-pr55 interaction was detected in immature hiv-1 virions. the retention of gp41 in detergent - treated virions is dependent on the ct region, suggesting a direct or indirect interaction between pr55 and gp41 [115, 116 ]. in the third model, it is assumed that host cellular factors (mostly proteins) play a role in bridging gag and env in virus - infected cells (figure 2(c)). several host factors have been reported to bind to gag and/or env of hiv-1 or siv however, only a couple of host factors were shown to be required for env incorporation and/or viral replication. the 47-kda tail - interacting protein (tip47) has been reported to bridge gag and env, allowing efficient env incorporation in hiv-1 [117, 118 ]. the same group also showed that both the we motif near the n - terminus of the ma domain and the yw motif in the gp41 ct domain are important for interactions between gag or env and tip47. in a subsequent paper, the same group showed that mutations in either the we motif of ma or the yw motif in the gp41 ct caused defects in virus replication in primary monocyte - derived macrophages. although this finding of an important role for tip47 in env incorporation in hiv-1 has received much attention from retrovirologists, no confirmatory data have been published by other researchers in this field. human discs large protein (hdlg1) has been reported to interact with the ct of htlv-1 env and to colocalize with both env and gag in virus - infected cells. subsequent work demonstrated that dlg1 also binds hiv-1 gag and that the expression level of dlg1 is inversely correlated with hiv-1 env expression and incorporation levels of the env proteins, although the mechanism behind this phenomena needs to be investigated. prenylated rab acceptor 1 (pra1), which was identified as a rab regulatory protein, was reported to be a binding partner for the siv gp41 ct in a mammalian yeast two - hybrid (y2h) assay. although colocalization of pra1 and siv env was observed, changes in the endogenous levels of pra1 did not affect virus production, env incorporation, or infectivity of siv or hiv-1. a prohibitin 1/prohibitin 2 (phb1/phb2) heterodimer was identified as a binding partner of the gp41 ct of hiv-1 using human t - cell lines and tandem affinity chromatography. phb1 and phb2 are members of the prohibitin superfamily of proteins, which are localized to several cellular compartments such as the mitochondria, nucleus, and the pm [125, 126 ]. gp41 ct mutants, in which binding to phb1/phb2 is disrupted, could replicate well in permissive cell types such as mt-4, but could not replicate efficiently in nonpermissive h9 cells. further analysis is necessary to elucidate the mechanism by which these proteins regulate virus replication through interactions with env. luman, a transcription factor that is mainly localized to the er, was found to interact with the gp41 ct of hiv-1 in a y2h screen using a cdna library from human peripheral blood lymphocytes (pbl). overexpression of a constitutively active form of this protein reduced the intracellular levels of gag and env, leading to a decrease in virus release. the mechanism for this negative effect on virus assembly involves luman binding to tat, which decreases tat - medicated transcription. by using a y2h screen with human cdna libraries, p115-rhogef, an activator of rho gtpase, was found to interact with the gp41 ct through its c - terminal regulatory domain. the gp41 mutants that lost the ability to bind p115 showed impaired replication kinetics in t - cell lines such as supt1, h9, and jurkat, suggesting that the gp41 ct could modulate the activity of p115-rhogef to support virus replication. in addition to the host factors described above, calmodulin [129132 ] and -catenin [133135 ] have been reported to interact with hiv-1 and/or siv. however, their roles in virus replication, especially with respect to the env functions of both proteins, have not been clearly elucidated. regardless of whether direct or indirect interactions between retroviral gag and env proteins are required for env incorporation into virions, a great deal of experimental evidence suggests that retroviruses assemble and bud from membrane microdomains. the most well - known microdomains are lipid raft(s), which are enriched in cholesterol and sphingolipids [136, 137 ]. lipid rafts are widely thought to function as a platform for the assembly of protein complexes and to allow various biological processes such as cellular transport and signal transduction to proceed efficiently [138, 139 ]. lipid rafts are reportedly used as assembly platforms or entry scaffolds in the replication of enveloped viruses such as retroviruses [140146 ]. the association of gag / env with lipid rafts is important for the regulation of env incorporation and pseudotyping [143, 144, 147, 148 ]. evidence that both the hiv-1 pr55 and env proteins are preferentially localized to lipid rafts comes from biochemical studies as well as direct observations by microscopy [142, 149, 150 ]. another membrane microdomain for retrovirus assembly is the tetraspanin - enriched microdomain (tem) [151154 ]. tetraspanins are a superfamily of cell surface proteins that are ubiquitously expressed in mammalian cells. tems have been reported to be involved in the assembly and release of not only hiv-1, but also htlv-1 and hcv. when both hiv-1 and influenza virus were produced in the same cell, only hiv-1 colocalized with the tem marker, and its release was inhibited by an anti - cd9 ab, which led to extensive aggregation of tetraspanins. analysis of dynamics of both lipid rafts and tems by quantitative microscopy has revealed that components of both lipid rafts and tems are recruited during viral assembly to create a new microdomain that is different from preexisting membrane microdomains [153, 157 ]. there have been three recent reports in which both pseudotyping and microdomain issues were discussed. in the first paper, the authors examined hiv-1 assembly under conditions where the env proteins of hiv-1 and ebola virus were coexpressed with hiv-1 gag in the same cell. interestingly, however, the virions contained either hiv-1 env or ebola virus glycoprotein (gp), but not both env proteins within a single virion. these results suggest that hiv-1 env and ebola virus gp localized to distinct microdomains on the surface of the same cell. in the second paper, the subcellular localization of gag and env proteins was investigated using a combination of three different retroviral env proteins (rsv env, mlv env, or vesicular stomatitis virus (vsv) g) and two different gag proteins (rsv or hiv-1). both vsv - g and mlv env were redistributed to the virus budding sites when coexpressed with hiv-1 or rsv gag. a subsequent paper from the same group showed that the ct of mlv is not required for recruitment of mlv env to hiv-1 budding sites, suggesting that there are no specific interactions between mlv env and hiv-1 gag. collectively, these results also suggest that retroviral env glycoproteins are not recruited to preexisting membrane platforms but rather that they are actively recruited to newly formed microdomains on the cell surface. human retroviruses such as hiv-1 and htlv-1 spread more efficiently between target t cells by cell - cell infection than by cell - free infection [159, 160 ]., the virological synapse (vs) as a point of contact between virus - infected cells and uninfected cells [161, 162 ]. the molecular mechanisms of retroviral vs formation are as follows. (1) with respect to hiv-1 t - cell vs, initial contact between virus - infected cells and uninfected cells occurs through gp120-cd4 binding. (2) the gp120-cd4 interaction recruits cd4, coreceptors such as cxcr or ccr5, adhesion molecules, and filamentous actin into the synaptic area. (3) the cellular secretory machinery and microtubule organizing centers (mtoc) are polarized towards the hiv-1 assembly sites at the pm to form the vs. it has been reported that a so - called microsynapse formed by nanotubes between virus - infected cells and uninfected cells is also involved in cell - cell infection of hiv-1 [84, 163 ]. in cell - cell transfer of htlv-1-infected cells, an extracellular matrix structure referred to as the viral biofilm was proposed as an alternative to the vs. in addition to hiv-1 and htlv-1, the spread of mlv between fibroblasts also occurs via the vs [165, 166 ]. it is noteworthy that assembly of mlv is directed towards cell - cell contact sites through the interaction of the ct of mlv env with gag [167, 168 ]. although the concept of cell - cell infection through the vs is now well appreciated, the detailed molecular mechanism of vs assembly and its relevance to viral spread in vivo will require further elucidation through the use of more advanced techniques. although this paper has introduced several experimental models for retroviral env trafficking and/or incorporation, the correct mechanism for this process is still unclear. the following questions must be clearly addressed to not only gain a better understanding of this complex biological process, but also to develop new antiretroviral compounds that target env incorporation.what are the structures of the cts of retroviral env proteins ? the answers for this question will give useful information on elucidating a role of the env cts in the env trafficking and/or incorporation in virus - infected cells.what host factor(s) are necessary for the retroviral env trafficking and/or incorporation into virions?where and how env and gag proteins of retroviruses are recruited to the assembly sites in order to form infectious virus particles ? the answers for this question will give useful information on elucidating a role of the env cts in the env trafficking and/or incorporation in virus - infected cells. what host factor(s) are necessary for the retroviral env trafficking and/or incorporation into virions ? where and how env and gag proteins of retroviruses are recruited to the assembly sites in order to form infectious virus particles ? | together with the gag protein, the env glycoprotein is a major retroviral structural protein and is essential for forming infectious virus particles. env is synthesized, processed, and transported to certain microdomains at the plasma membrane and takes advantage of the same host machinery for its trafficking as that used by cellular glycoproteins. incorporation of env into progeny virions is probably mediated by the interaction between env and gag, in some cases with the additional involvement of certain host factors. although several general models have been proposed to explain the incorporation of retroviral env glycoproteins into virions, the actual mechanism for this process is still unclear, partly because structural data on the env protein cytoplasmic tail is lacking. this paper presents the current understanding of the synthesis, trafficking, and virion incorporation of retroviral env proteins. |
systemic lupus erythematous (sle) is an autoimmune disease presenting many kinds of autoantibodies in serum. in case of elevated levels of antiphospholipid antibodies, the patient presents recurrent episodes of arterial and venous thrombosis, thrombocytopenia and spontaneous fetal losses. the vascular thrombosis may occur at any small and large vessels resulting in various clinical manifestations. here, we reported a case of secondary antiphospholipid syndrome in a lupus patient who was presented with budd - chiari syndrome, due to the thrombosis of the intrahepatic portion of the inferior vena cava (ivc) and persistent elevation of anticardiolipin antibody. a 32-year old korean female was admitted with a complaint of edema and pain on the left leg for 2 months. in january 1993, she was diagnosed as sle at another hospital and manifested gross hematuria, proteinuria, azotemia, anemia, thrombocytopenia, hypocomplementemia, positive fana, positive anti - ds dna antibody and positive anti - ena antibody. in may 1993, she was transferred to kangnam st. we checked the titer of anticardiolipin antibody (aca), which was 100 gpl iu / ml and followed up the titer of aca regularly at 2 months intervals and the titer of aca igg was persistently elevated. her parity was 0 - 0 - 0 - 0 and she showed thrombocytopenia (35,000/mm) and prolonged partial thromboplastin time (59.2 sec, control 27.0 sec). her clinical features were antiphospholipid syndrome in sle and she was treated with baby aspirin 100 mg / day and steroid (prednisolone 1mg / kg) at the outpatient clinic. from april 1994, she suffered from edema and pain on the left leg and was admitted to our hospital in june 1994. on admission, she had polyarthralgia but did not complain of fever, malar rash, photosensitivity, oral ulcer, raynaud s phenomenon, xerostomia, xerophalmia and allopecia. on physical examination, pulse rate 76 beats per minute, respiration rate 20 per minute and body temperature 36.5c. there were no pathologic lesions in her eyes, ears, nasal or oral mucosa. hemoglobin was 10.6 g / dl, hematocrit 32%, white blood cell 8.110/mm (neutrophil 82%. renal function showed blood urea nitorgen 5.3 mg / dl, creatinine 0.9 mg / dl and 24hr urine protein 6.18 g / day. urinanalysis showed 0 to 2 white cells and 10 to 20 red cells per high power fields. iu / l, alkaline phosphatase 229 iu / l, total bilirubin 0.7 mg / dl, total protein 4.1 g / dl and albumin 2.1 g / dl. the prothrombin time was 11.8 sec (control 12.1 sec) and activated partial thromboplastin time 59.2 sec (control 26.6 sec). on immunologic studies, fana was positive (homogenous pattern, titer 1 : 1280), anti - ds dna antibody 5 iu / ml, c3 21 mg / dl and c4 15 mg / dl. rheumatoid factor was negative and anca was positive (gs - ana, titer 1 : 80). the immunoglobulin g, a, m levels revelaed 928, 274, 106 mg / dl, respectively. the serum viral hepatitis markers revealed that hbs antigen was negative, hbs antibody positive and hcv antibody negative. abdominal ultrasonography showed a moderate amount of ascites, moderate splenomegaly and marked coarse increased liver echogenecity. at computed tomography of the abdomen doppler ultrasonography of the left leg showed no thrombosis in the superficial femoral vein and popliteal vein. inferior and superior venocavograms showed obstructions at the intrahepatic portion of ivc and at both subclavian veins and abnormal collateral vessels were found around the obstructions (fig. 2, 3). we injected heparin 5,000 units and urokinase 500,000 units intravenously at the bolus during venocavogram and further thrombolytic therapy (heparin 5,000 units / day and urokinase 500,000 units / day continuously all day long) was done for additional two days. we followed the venocavogram to evaluate the extent of thrombosis, compared with pre - thrombolytic therapy, but we could not find any interval change. we decided to give the patient warfarin 5 mg / day, prednisolone 1 mg / kg and baby aspirin 100 mg / day and to follow her up at the outpatient clinic. the antiphospholipid syndrome (aps) is characterized by the production of autoantibodies directed against negatively charged phospholipid. clinically, it is associated with multiple thrombotic events, thrombocytopenia and recurrent fetal loss. the syndrome can be primary without other systemic disease or secondary, i.e. part of systemic lupus erythematosus. antiphospholipid antibodies (apls) are also found in certain malignancies, or as a side effect to certain drugs. the prevalence of apls in sle is 20% to 50% and approximately one - third of sle patients may have clinical manifestations of aps. the exact mechanism by which apls cause aps is still unkown. since phospholipid is the essential constituent of cell membrane and coagulation pathway, most efforts to elucidate the mechanism have been based on vascular endothelial cell and platelet function. antiphospholipid antibodies reduce the release of protacyclin at the vascular endothelial cell and enhance the production of thromboxane at the platelet and interfere with many cascades of the coagulation pathway - factor x - converting complex, prothrombinase complex, antithrombin iii, thrombomodulin and protein c and s etc. protein c and a co - factor, protein s, act together to degrade activated factors v and viii, which leads to inhibit clotting. antiphospholipid antibodies require a serum co - factor in order to bind to phospholipid, known as 2-glycoprotein 1 (2-gp1). 2-glycorpotein 1 inhibits the activation of factor xii and the formation of prothrombinase complex, here, apls disturb the inhibitory effect of 2-gp1 resulting in the hypercoagulable state. these thromboses may occur at any organs, causing thrombophlebitis and gangrene of the limbs, budd - chiari syndrome, addison s disease, pulmonary embolism, livedo reticularis, retinal vessel thrombosis, stroke, myocardial infarction, renal artery thrombosis, hepatic infarction, chorea, psychosis and avascular necrosis of bones. budd - chiari syndrome is characterized by ascites, hepatomegaly, abdominal pain, varicose veins on the lower legs and collateral vessels at the abdominal wall because of the obstruction of the hepatic vein or the inferior vena cava. the syndrome was described, at first, by budd and chiari in 1845 and 1899, respectively, and has been mainly reported in east asia, south africa and india. the pathogenesis of vascular obstruction is still unclear but some cases of membranous obstruction of the inferior vena cava (movc) have been reported in korea, and movc has been known to have a relationship with oral contraceptive agents or type b viral hepatitis. recently. budd - chiari syndrome, associated with lupus anticoagulant, has been reported in many countries, but budd - chiari syndrome, as a manifestation of secondary antiphospholipid syndrome in sle, is rare and has not yet been reported in korea. the patient who has secondary antiphospholipid syndrome could die unexpectedly, from either cardiopulmonary arrest or circulatory failure, depending on which organ is predominanlty involved by the extensive occlusions. in this instance, the differential diagnosis is often difficult between lupus vasculitis, thrmobotic thrombocytopenic purpura or disseminated intravascular coagulation. to eleminate apls, energetic immunosuppression, e.g., with pulse cyclophosphamide, plasmapheresis or gammaglobulin infusion is sometimes effective, but there is usually a rapid rebound to pre - treatment levels shortly after discontinuation of the therapy. anti - hypertensives, cholesterol - lowering agents and treatment of active nephritis are needed to remove additional risk factors. it is important to prevent occlusive vascular complications in patients who have not experienced thrombosis. for the prophylaxis of venous thermbosis, low - dose subcutaneous heparin (10,000 to 15,000 units / day) is useful and patients who show resistance to the above doses require higher doses of subcutaneous heparin(25,000 units / day) or intravenous heparin(40,000 units / day). in the case of occlusive vascular complications, patients require anticoagulation on a long - term basis, and probably for life, because of the tendency of recurrence. warfarin is used up to 20 mg / day and inr should be kept a a level of 3 to 4 rather than 2 to 2.5. in the case of using heparin, anticoagulation should be controlled by the recalcification test (howell test) not by aptt because of the interference of the apls with the latter. to prevent fetal loss, low dose aspirin (30 to 80 mg / day) if the patient is receiving warfarin, because of previous thrombotic manifestation, this must be changed to subcutaneous heparin, at least in the first trimester, since warfarin is teratogenic. | antiphospholipid syndrome is characterized by recurrent episodes of arterial and venous thrombosis, spontaneous fetal losses, thrombocytopenia and persistently elevated levels of antiphospholipid antibodies. we experienced a case of budd - chiari syndrome in a 32-year old female lupus patient who was presented with left leg edema, ascites and esophageal varix. the clinical and laboratory findings were compatible with the cirteria for systemic lupus erythematosus (sle) and she was found to have anticardiolipin antibody, thrombocytopenia and prolonged partial thromboplastin time. initially, she was treated with intravenous heparin and urokinase and she was followed up with warfarin, baby aspirin and steroids. |
in the pathogenesis of multiple sclerosis (ms), which is an autoimmune disease, pathologic remodelling of the blood - brain barrier precedes the formation of focal demyelination in the brain white matter [13 ]. the remodelling of the blood - brain barrier in the course of ms is controlled by the activated t cd4 + lymphocytes and cytokines they release. in the initial phases, endotheliopathy caused by the adhesion of activated t lymphocytes is observed within the blood - brain barrier, and these lesions can lead to vascular dysregulation. vascular dysregulation can be congenital, or primary (pvd) or secondary (svd). the latter is often a result of autoimmune disease, including ms [46 ]. the vascular dysregulation syndrome, earlier referred to as the vasospastic syndrome, is characterized by increased spasticity of blood vessels manifested as excessive vasoconstriction or insufficient vasodilation. endothelial dysfunction is thought to play the main role in its pathogenesis as it results in the impairment of vasodilation and in increased blood levels of endothelin-1 (et-1). et-1 is one of the most potent and longest acting vasospastic substances [810 ] produced by the vascular endothelium. apart from endothelial dysfunction, impaired humoral or neurogenic mechanisms, which additionally may be interrelated, can play a role in the pathogenesis of the vasospastic syndrome. in the course of severe clinical attacks of ms increased concentrations of et-1 were measured in the cerebrospinal fluid. the few studies published to date found increased levels of et-1 also in the blood of ms patients. a transient increase of et-1 plasma level has been reported in a patient with optic neuritis which very often is the first sign of ms. ms - dependent optic neuropathy is characterized by a mild increase in the cup to disc ratio [1517 ] and pallor of the optic disk suggesting ischaemia of the initial segment of the optic nerve which can result from a spasm of the supplying blood vessels. et-1 has been shown to have a potent vasoconstrictive effect in the eye and hence to decrease the ocular blood flow [7,1820 ], including blood supply to the optic disc. studies using color doppler imaging have shown in ms patients a decreased blood flow velocity and increased vascular resistance index (ri) in the extraocular vessels [13,2325 ], which indicates a reduction of the ocular blood flow in the course of ms. the aim of this study was to determine the et-1 levels in the plasma of ms patients in view of a potential role of et-1 in the vascular dysregulation observed in the course of ms. the study protocol was approved by the bioethics committee at the medical centre for postgraduate education in warsaw. the patients were requested to sign written informed consent to participate in the research study. the exclusion criteria were as follows : a history of cardiovascular disease, tobacco smoking, dyslipidemia, and current treatment with vasoconstrictors or vasodilators. lipid fractions (total cholesterol, triglycerides, ldl cholesterol, hdl cholesterol) in the blood were determined in the study group and controls to exclude subjects with dyslipidemia, i.e., those whose measurements were outside any of the following ranges : total cholesterol : 130200 mg / ml ; triglycerides : 35131 mg / ml ; ldl cholesterol : < 135 mg / ml ; hdl cholesterol : 4280 mg / ml. following that, 20.41% and 12.9% of subjects were excluded from the initial ms group of 49 and from among 31 prospective controls, respectively. additionally, subjects with a history of diseases known to be associated with increased blood levels of et-1 were also excluded. ultimately, the study group consisted of 39 ms patients (9 males, 30 females) aged 2262 years, mean age : 38.810.02. the diagnosis of ms was established using the mcdonald criteria and the patients were recruited at the department of neurology and epileptology, medical centre for postgraduate education in warsaw. the control group consisted of 27 healthy volunteers, free of any systemic disease, recruited mainly from among the hospital staff : 3 males and 24 females aged 2062 years, mean age 37.410.88. of the study group, 12.8% of the patients were diagnosed with primary progressive multiple sclerosis (ppms), 15.4% with secondary progressive multiple sclerosis (spms), 20.5% with progressive relapsing multiple sclerosis (prms), and 51.3% with relapsing remitting multiple sclerosis (rrms). at the time of the study, a history and/or medical records revealed a relapse in the previous 2 years in 12 patients, in the previous year in 9 patients, and in the previous 6 months in 2 patients. however, in none of the patients a clinical relapse occurred in the 3 months preceding et-1 measurements within the study. the mean duration of ms (the medically documented diagnosis) was 4.4 years (range : 1 year to 22 years). of the 46.2% of patients in the study group who received treatment, 13 were treated with interferon -1b, 4 patients with glatiramer acetate and 1 patient with azathioprine. the remaining patients did not take any medication either because of low activity of their disease or because their disease was newly diagnosed and no treatment had yet been instituted. the levels of clinically observed disabilities in the study patients were measured with the kurtzke expanded disability status scale (edss) (30), the mean score being 2.55 (range : 1.06.5). blood was drawn from the basilic vein after at least a 30-minute rest in a relaxed position (supine), at room temperature, in the morning hours (9 a.m.10 a.m.). in patients on interferon therapy, blood et-1 plasma level determinations were conducted at the department of neuroendocrinology, medical centre for postgraduate education. blood samples from 27 controls and 39 study patients were placed in test - tubes containing edta and aprotinin (protease inhibitor). after centrifugation of the blood samples at 4c, plasma samples were frozen and stored at 70c until endothelin extraction. et-1 was extracted from 1.5 ml of plasma. prior to plasma sample injections, sep - pak c18 extraction columns (phoenix pharmaceuticals, inc. ; usa) were rinsed with 1 ml 60% acetonitrile with 1% trifluoroacetic acid, followed by 9 ml 1% trifluoroacetic acid. the sample extracts were stored at 70c until endothelin-1 determination. immediately prior to the quantitative determination of et-1, the extracts were dissolved in 0.15 ml of pbs buffer containing 1% bsa and 0.05% tweed 20. the et-1 concentration was determined using the endothelin-1 elisa kit (immuno - biological laboratories co., japan ; code no. the efficiency of the extraction procedure was tested by adding a specified amount of exogenous endothelin-1 standard (20 pg / ml and 10 pg / ml) to 1.5 ml of plasma with the endogenous endothelin content below the analytical sensitivity of the method. the final measurements of et-1 concentrations in the study samples were adjusted by the extraction efficiency. the et-1 concentrations were below the limit of detection in 29.0% of the control samples and in 36.7% of the samples from ms patients. it was assumed that in such samples, endothelin-1 concentrations were below 8 fmol / ml. the differences between the measurements were analyzed with the nonparametric mann - whitney u test for 2 independent groups of observations. statistical significance was established at p<0.05. additionally, to assess the homogeneity of the study group, the et-1 plasma levels were statistically analyzed in patients receiving immunomodulatory treatment vs. untreated patients, and in patients with rrms vs. progressive courses of multiple sclerosis (spms, ppms, prms). statistical analysis of potential differences in the et-1 levels between the patients with progressive courses of multiple sclerosis (spms, ppms, prms) could not be performed due to small numbers of patients in these subgroups. the differences between the measurements were analyzed with the nonparametric mann - whitney u test for 2 independent groups of observations. statistical significance was established at p<0.05. additionally, to assess the homogeneity of the study group, the et-1 plasma levels were statistically analyzed in patients receiving immunomodulatory treatment vs. untreated patients, and in patients with rrms vs. progressive courses of multiple sclerosis (spms, ppms, prms). statistical analysis of potential differences in the et-1 levels between the patients with progressive courses of multiple sclerosis (spms, ppms, prms) could not be performed due to small numbers of patients in these subgroups. the mean et-1 (sd) plasma level in ms patients was significantly lower than in healthy subjects : 0.550.44 pg / ml (146.05118.27 fmol / ml) vs. 0.950.48 pg / ml (252.83127.16 fmol / ml) (p=0.012) (figure 1). patients receiving immunomodulatory treatment tended to have lower et-1 plasma levels than untreated patients, but the difference was not statistically significant : 0.510.51 pg / ml (135.98136.66 fmol / ml) vs. 0.580.39 pg / ml (155.20104.75 fmol / ml) (p=0.44). also, there were no statistically significant differences in the et-1 plasma levels between the patients with rrms and those with the other progressive courses of ms (ppms, spms, prms) : 0.640.45 pg / ml (170.85118.67 fmol / ml) vs. 0.450.44 pg / ml (118.77117.72 fmol / ml)(p=0.46). no correlation was established between the et-1 plasma levels and age (control group p=0.69, ms group p=0.77, all p=0.50) or the edss scores (p=0.66). weak correlation between the et-1 plasma levels and the disease duration was found (p=0.044). the pathogenetic changes in ms result from the remodelling of the blood - brain barrier associated with endotheliopathy due to the effect of activated cd4 + t - cells. et-1 not only regulates the vascular wall tension, but may also act as a proinflammatory mediator, including its effect on the proliferation of astrocytes with an associated increase in the production of metalloproteases, which are involved in the remodeling of the extracellular matrix and the blood - brain barrier. in the present study we observed significantly lower plasma levels of et-1 in ms patients compared to healthy subjects, unlike earlier studies that found significantly higher et-1 blood levels in ms patients than in controls. interestingly, the groups of ms patients in those studies and in our study are comparable in terms of age and size (haufschild. : 20 patients, 10 females and 10 males, mean age 43.8 years 14.7, pache. : 30 patients, 22 females and 8 males, mean age 38 years 7.5 years, the present study : 39 patients, 30 females and 9 males, mean age 38.8 years 10.02. the ms patients in our study, as compared to the study by pache. had a slightly lower level of disease activity and almost twice as short disease duration (4.4 years vs. 8.4 years), which might account for the lower blood levels of et-1. moreover, 46.2% of the patients in our study group were treated with immunosuppressants, which decrease the activity of t lymphocytes and the production of t cell - dependent mediators involved in the pathophysiologic process. the earlier studies also found that untreated ms patients had higher blood levels of et-1 compared to patients who received treatment, a tendency which we confirmed., the percentage of patients receiving treatment was similar (pache. 56.7%.), which makes explanation of the differences between the studies difficult. since et-1 blood levels are increased in cardiovascular disease, we excluded from our study not only patients with clinically diagnosed cardiovascular disease, as it had been done in earlier studies, but also subjects with dyslipidemia confirmed by laboratory investigations. with these criteria, 20.41% of the ms patients and 12.9% of the prospective controls were excluded at baseline, which could account for lower et-1 levels in the ms patients. additionally, the et-1 plasma levels might be related to a particular clinical course of ms. however, we did not find any statistically significant differences in the et-1 plasma levels between rrms patients and those with the other forms of ms. it could be speculated that, compared to other studies, lower disease activity and shorter duration of ms, and exclusion of patients with cardiovascular disease associated with endothelial dysfunction, including clinically silent dyslipidemia, may have accounted for the plasma levels of et-1 found in this study. however, these factors seem unlikely to cause the decrease of et-1 plasma levels in the ms patients to values below the normal range. this finding may suggest another type of vascular dysregulation different from secondary vascular dysregulation, dependent on the autoimmune process in the course of ms, in which increased levels of et-1 in blood were observed. the finding of lower than normal, et-1 plasma levels in the study group is in agreement with the results of studies in patients with optic neuropathy not associated with ms (glaucomatous optic neuropathy), which found lower blood levels of et-1 in glaucoma patients compared to healthy subjects [3235 ]. increased spasticity of blood vessels in the course of primary vascular dysregulation (pvd) has been considered a vasogenic risk factor for glaucomatous optic neuropathy for over 20 years [4,26,3646 ]. endothelial dysfunction with increased et-1 blood levels can play a role in the pathogenesis of pvd syndrome and normal tension glaucoma (ntg). a recent meta - analysis of studies concerning et-1 levels in the blood of primary open - angle glaucoma (poag) patients found that only ntg patients had significantly higher levels of et-1 compared to healthy individuals. however, the results of studies measuring the et-1 levels in the serum of ntg patients are inconsistent as various authors have shown in ntg patients compared to healthy individuals either increased blood levels of et-1 [4750 ] or no difference at all or decreased levels. these discrepancies in measurements of et-1 blood concentration in ntg patients may be due to many factors. each study was carried out in a different age group, while et-1 levels are known to increase with age and the associated progression of endothelial dysfunction. lower et-1 levels in patients with glaucomatous optic neuropathy were observed mainly in the japanese population. these observations suggest that the decreased blood levels of et-1 in ntg patients can be associated with the pvd syndrome. the lower blood levels of et-1 in blood could be a result of interactions between neurogenic and endothelium - dependent vascular tone control mechanisms, associated with the already present dysregulation of the autonomous nervous system. yoshida. suggest that the low levels of et-1 in the serum of glaucoma patients can be related to the up - regulation of endothelin receptors (et - a, et - b1, etb2). other researchers observed in poag patients a significantly higher increase in the serum levels of et-1 following exposure to cold, particularly in patients with ntg. in this situation, a transient increase of et-1 level in the blood serum due to cold can intensify the et 1-induced vasospastic reaction. such a response may indicate an imbalance between the release of et-1 which is a vasoconstrictor and no which is a vasodilator, and can be related to the impairment of the vasodilating function of endothelium in ntg patients. the above observations may suggest that as a result of impaired neural - endothelial control of vascular tone in pvd syndrome blood levels of et-1 can be low under normal conditions, while an increase in the et-1 concentration occurs only on a cold challenge test, which would provoke a vasospastic reaction. it has been also noted that ms patients, similar to ntg patients, tend to develop pvd syndrome. patients with ms experience problems typical of pvd, i.e., a tendency to peripheral vasospastic reactions due to exposure to cold or emotional stress which often precedes ms symptoms. this is confirmed by our observations as 76.92% of the ms patients had a history of peripheral vasospastic reactions before the actual diagnosis of ms. it is possible that the lower levels of et-1 in ms patients found in the present study are accounted for by the et-1 measurements being performed at the time when the levels of et-1 had not yet increased as such increases are a consequence of svd, which results from the progression of the underlying autoimmune process. the results showing significantly lower levels of et-1 in the plasma of patients with multiple sclerosis compared to healthy subjects suggest that some form of endothelium - dependent vascular dysregulation could occur in these patients. this finding is in agreement with the reports of low blood levels of et-1 from other studies in patients with primary open - angle glaucoma, especially normal tension glaucoma. this may suggest that similar pathophysiologic mechanisms may be involved in both, multiple sclerosis and primary open - angle glaucoma. the role of et-1 in the pathogenesis of these 2 diseases, characterized by optic neuropathy, remains to be explained. | backgroundmultiple sclerosis (ms) is a demyelinating autoimmune disease of the central nervous system with possible involvement of vascular dysregulation secondary to endothelial dysfunction caused by destruction of the vessel wall. vascular dysregulation leads to excessive vasoconstriction or insufficient vasodilatation, resulting in vasospasm mediated by endothelin-1 (et-1), the most potent and long - lasting mediator. vascular dysregulation can play an important role in the pathogenesis of some eye disorders and it has been hypothesized that it is a vascular risk factor for glaucomatous optic neuropathy. the aim of this study was to estimate endothelin-1 (et-1) plasma levels in patients with ms.material/methodsthe ms group consisted of 39 patients (9 males, 30 females), mean age : 38.810.02 years, range : 2262. the control group consisted of 27 healthy volunteers (3 males and 24 females), mean age : 37.410.88 years, range : 2062 ; clinically, in a non - active stage of the disease. et-1 plasma levels were measured using the endothelin-1 elisa kit (immuno - biological laboratories co., japan). statistical analysis was performed with the nonparametric mann - whitney u test for independent groups.resultsendothelin-1 (et-1) plasma levels were significantly lower in ms patients compared to healthy controls : mean value 0.550.44 pg / ml (146.05118.27 fmol / ml) vs. 0.950.48 pg / ml (252.83127.16 fmol / ml) ; p=0.012.conclusionssignificantly decreased et-1 plasma levels in the ms patients could reflect the non - active disease at the time of et-1 measurements or the effects of immunomodulatory treatment, but it can not be excluded that decreased et-1 plasma levels in these patients might result from vascular dysregulation. |
acinetobacter species are strictly aerobic nonfermenting gram - negative coccobacilli if in the inactive phase or bacilli if in the rapid - growth phase. the acinetobacter calcoaceticus acinetobacter baumannii complex comprises a. baumannii, a. pittii, a. nosocomialis, a. lwoffii and the environmental species a. calcoaceticus. common commercial tests can not differentiate among these species, as they share the same phenotypic tests. for daily microbiology work, speciation adds clinical value, as a. baumannii is the only species in this genus that is clinically important,. for epidemiologic studies, it is important to know the identity of the main strains or clones of the same species causing infections, especially in outbreak investigations, by determining virulence or resistance genes using genotypic studies,. different genotypic tests have been used to study the relatedness of the acinetobacter isolates to learn the sources of outbreaks and epidemics and the modes of intrahospital or regional transmission. these tests include pcr - based methods, mainly pulsed - field gel electrophoresis (pfge), amplified fragment - length polymorphism, pfge followed by further subtyping using variable number of tandem repeat loci and finally multilocus sequence typing (clonality analysis), which is considered a powerful and discriminatory tool,,. mechanisms of carbapenem resistance in a. baumannii are mainly due to the production of carbapenemases, especially oxa - type carbapenem - hydrolyzing (class d) -lactamases, which are either chromosomally located, like blaoxa-51, which become expressed only when the insertion sequence isaba1 element is inserted upstream of the gene, or acquired, mostly blaoxa-23-like, blaoxa-24-like and blaoxa-58-like subfamilies, and metallo--lactamases (class b ; blaimp, blavim, blandm). rapid diagnosis of resistance helps clinicians adequately manage infection, contain the spread of infection and decrease the toxic adverse effects of antimicrobial drugs due to multiple trials of empirical treatment. qatar 's population structure is complex and unique : approximately 93% of the population comprises expatriates coming from different countries, mainly other arab nations and the indian continent (http://www.gsdp.gov.qa/portal/page/portal/ppc/ppc_home/ppc_news/ppc_files_upload/populations_status_2012_en.pdf). the expatriate workforce is kinetic ; many people travel frequently more than once a year to their home countries. if one of these multidrug - resistant (mdr) organisms such as a. baumannii gained access to the hospital, it is not easy to eliminate it, as the hospital environment favours its growth and transmission either by colonizing or infecting healthcare workers or living within biofilms formed by the bacteria, thus protecting it from the effects of common disinfectants. a recent study in qatar described the mechanisms of carbapenem resistance in eight a. baumannii isolates. ours is the second study to describe the genetic causes of carbapenem resistance among 48 mdr a. baumannii isolates. the objective of our study was to determine carbapenem resistance genes in a randomly selected number of mdr a. baumannii from isolates stored at hamad medical corporation (hmc), qatar, and to learn whether they were genetically related. the outcome of our study will help inform a project studying the magnitude of mdr a. baumannii in the last few years, the common resistance genes and the dominant clones circulating in qatar. hmc (comprising tertiary, general and continuing care hospitals) is the principal public healthcare provider for the state of qatar. forty - eight mdr a. baumannii samples of the period 20112012 were randomly chosen. isolates were taken from stored mdr isolates in the cryobank of hmc 's microbiology department, which is qatar 's premier not - for - profit healthcare provider. located in the state of qatar, hmc manages eight hospitals (approximately 2600-bed capacity). forty - eight mdr a. baumannii were identified, and antibiotic susceptibility testing was performed by the broth microdilution method (bd phoenix ; becton dickinson, franklin lakes, nj, usa) and confirmed for identification at urmite (unit des maladies infectieuses et tropicales emergentes), marseille, france, by matrix - assisted laser desorption / ionization time - of - flight mass spectrometry (maldi - tof) using a ms lt spectrometer (bruker daltonics, bremen, germany) as previously described, with flex control software (bruker) and maldi biotyper version 3.0. a score of 1.9 was considered positive for identification at the species level, as previously reported. confirmation of resistance by etest (biomrieux, marcy letoile, france) was performed. the susceptibility breakpoints used were those recommended in 2013 by the clinical and laboratory standards institute (m100-s23). susceptibility testing by etest was additionally done in marseille to the following antibiotics : colistin, imipenem and sulbactam (ab biodisk, solna, sweden). the 48 isolates were collected mainly from respiratory specimens (n = 10) ; 11 of the patients were from the intensive care unit (icu), two from the coronary care unit, 12 from the medical intensive care unit (micu), one from the paediatric intensive care unit, five from the surgical intensive care unit and eight from the trauma intensive care unit (ticu) (table 1). twenty - seven patients had comorbidities, and 15 patients died, ten of whom were icu patients. dna was extracted using the ez1 advanced xl extractor with dna bacteria card and the ez1 dna tissue kit (qiagen, courtaboeuf, france) according to the manufacturer 's instructions. all 48 a. baumannii isolates were screened for the presence of resistance genes blaoxa-23, blaoxa-24, blaoxa-58 and blandm by real - time pcr (c1000 themal cycler ; bio - rad, hercules, ca, usa). amplification was performed using the following thermocycler conditions : initial denaturation step at 95c for 15 minutes, followed by 35 cycles of denaturation at 95c for 30 seconds and extension at 60c for 1 minute. pcr amplification, sequencing and correction of gene sequences were performed as previously described. for each of the two genes, the dna sequences obtained from our isolates were aligned with those of the reference strains by clustal w software. the phylogenetic relationship of our strains together with the reference strains was then determined by mega 5 software with the kimura two - parameter model and bootstrap analyses based on 1000 replications. all isolates were confirmed as a. baumannii by maldi - tof microflex (bruker). all isolates were resistant to imipenem, meropenem, ciprofloxacin, levofloxacin, amikacin, gentamicin, sulfamethoxazole / trimethoprim, amoxicillin / clavulanic acid, piperacillin / tazobactam, cefotaxime and ceftazidime ; 39 isolates were resistant to sulbactam. the colistin resistance rate was 0 (0/48), so treatment of these patients with colistin would be suitable unless otherwise contraindicated. all 48 isolates were positive for blaoxa-23 ; none was positive for blaoxa-24, blaoxa-58 or blandm. clonality analysis typing revealed the existence of two predominant genotypes (fig. 1). the first genotype was the most frequent (20 isolates), six of which were isolated from the micu in 2011. the second most frequent genotype was isolated from ten isolates (after excluding one wrongly included sample) ; five were from the micu in 2012. this finding suggests the existence of an outbreak in the micu, but because the isolates were chosen randomly, confirmation of an outbreak can not be done except after a clonality study of all isolated a. baumannii during the 2 years to determine the isolation of certain genotypes from the micu. mdr a. baumannii has emerged globally in both community and hospital settings, causing many outbreaks, especially in icus. in our study, 28 of 48 patients were from icus. resistance to carbapenems among these isolates left no options for treatment except colistin, which has many adverse effects, including nephrotoxicity and neurotoxicity which affect mainly debilitated persons,. in hmc, approximately 60% of a. baumannii isolated from clinically significant samples are mdr ; in our study, we found 48 mdr a. baumannii clinical isolates which were randomly selected during the period 20112012 from isolates stored in the cryobank of hmc as a pilot study. in addition to describing the molecular characterization of carbapenems resistance in a. baumannii, we also studied the genetic relatedness of these isolates. results of our report will be used to study all mdr a. baumannii isolated in the previous years to describe the magnitude of resistance in this organism and to learn which common genotypes are circulating in qatar. we detected no new delhi metallo--lactamase (ndm) in the studied isolates even though qatar 's population structure is composed of different nationalities, including many expatriates coming from the indian subcontinent. studying all a. baumannii stored in the previous years is expected to reveal the presence of ndm. our results are comparable with a recent study of a. baumannii which included seven hospitals in the gulf cooperation countries, including eight isolates from qatar, all of which were positive for blaoxa-23, as well as many other countries in the region, including all isolates from kuwait, oman and united arab emirates and 90% of isolates from riyadh, saudi arabia ; 38% from bahrain were positive for blaoxa-23. ndm was detected in many countries in the middle east in enterobacteriaceae and a. baumannii, including the united arab emirates, oman, saudi arabia and kuwait,,,. by comparing different studies which were conducted in the middle east (kuwait, saudi arabia, egypt, algeria, yemen), no specific carbapenemase was found to be confined to the region. in egypt, three acquired class d carbapenemases (blaoxa-23 in 72%, blaoxa-40 in 4%, blaoxa-58 in 20%) were identified among studied carbapenem - resistant a. baumannii strains in two egyptian centres. in saudi arabia, blaoxa-23, blaoxa-24 and blaoxa-58 were detected in 72.5, 45 and 37.5% respectively in isolated a. baumannii strains. blaoxa-23 was detected in riyadh and the eastern province, with 53 and 79.5% respectively among nonsusceptible a. baumannii (a. ribeiro, paper presented at 22nd european congress of clinical microbiology and infectious diseases (eccmid), 2012). in the united arab emirates, one study found blaoxa-23-like and blaoxa-64-like genes in all three isolates under study. in abu dhabi, it was found that the blaoxa-23-like gene was detected in 73.6% of all strains included in the study, while the main oxacillinases in bahrain were blaoxa-40-like, which is a subgroup of the blaoxa-72-like gene (5/8). found less frequently were the blaoxa-58-like (1/8) and blaoxa-23-like (2/8) genes. a yemeni study identified three mdr a. baumannii ; the blaoxa-51-like gene and the acquired carbapenemase blaoxa-23-like gene were detected in all three strains. clonality analysis typing revealed high diversity within our isolates, with predominance of two genotypes. clonal dissemination was observed in the micu during 20112012 ; nonclonal spread occurred in whole hospital wards and outpatient clinics. in 1998, a qatari study in an icu in hmc revealed that all a. baumannii were carbapenem susceptible, while another study, performed between 2007 and 2008 on blood culture isolates, found carbapenem resistance in more than one third of the isolated a. baumannii (41.5%). in 2002, an outbreak in a ticu in hmc occurred by carbapenem - resistant a. baumannii which involved 20 patients admitted to the ticu during a 6-month period. a typing study was not performed at that time, but by comparing antibiograms of patient isolates to those isolated from the environment, it was found that all isolates shared the same antibiogram,,. given the occurrences of mdr a. baumannii in hmc, especially in the micu, it is clear that stringent infection control measures need to be implemented. further, studying the occurrence of all a. baumannii in previous years will provide insight into the presence of this organism 's endemicity or epidemicity ; there is also a need to screen these wards to compare the environmental clones to those isolated from patients. in conclusion, studying molecular resistance genes and molecular the clonal relatedness provides insight into the transmission of mdr a. baumannii within hmc. this study has revealed the need to study all a. baumannii isolated in previous years to confirm the occurrence of the micu outbreak of mdr a. baumannii during the 20112012 period and to confirm the presence or absence of other resistance genes, such as ndm or other metallo--lactamase resistance genes. | the objective of our study was to describe the molecular support of carbapenem resistance from randomly selected clinical isolates of multidrug - resistant (mdr) acinetobacter baumannii as a pilot study from the hamad medical corporation (hmc), qatar. results of our report will be used to study carbapenemases using molecular techniques in all isolated mdr a. baumannii. forty - eight mdr a. baumannii were randomly selected from isolates preserved at hmc. identification of all isolates was confirmed by matrix - assisted laser desorption / ionization time - of - flight mass spectrometry. antibiotic resistance was tested phenotypically by phoenix and confirmed by etest. the molecular support of carbapenemases (blaoxa-23, blaoxa-24, blaoxa-58, blandm) was investigated by real - time pcr. the epidemiologic relatedness of the isolates was verified by phylogenetic analysis based on partial sequences of csue and blaoxa-51 genes. all 48 isolates were identified as a. baumannii and were confirmed to be resistant to most antibiotics, especially meropenem, imipenems, ciprofloxacin, levofloxacin, amikacin, gentamicin and most of the -lactams ; they were sensitive to colistin. all the isolates were positive for blaoxa-23 and negative for the other tested carbapenemase genes. clonality analysis demonstrated that different lineages were actually circulating in qatar ; and we suggest that an outbreak occurred in the medical intensive care unit of hmc between 2011 and 2012. here we report the emergence of mdr a. baumannii producing the carbapenemase oxa-23 in qatar. |
otitis media with effusion (ome) is the fluid in the middle ear with no signs or symptoms of acute ear infection.1 relentless middle - ear fluid from ome results in decreased mobility of the eardrum and serves as a barrier to sound conduction.2 the eardrum is often cloudy with distinctly weakened mobility, and an air - fluid level or bubble may be visible in the middle ear.3 about 2.2 million diagnosed episodes of ome occur yearly in the united states, resulting in a combined direct and indirect annual cost estimate of four billion dollars.4 approximately 90% of children have otitis media with effusion before school age, frequently between ages 6 months and 4 years.5 6 we investigated the frequency of serous otitis media in patients referred to the pediatric clinic between 316 years of age without any active ear, nose, and throat complaints in our study. this study included 589 children patients (280 boys, 309 girls ; mean age : 9.42 ; range 316) who were administered to the pediatric clinic without otolaryngologic complaints (fig. the ethics board granted approval for the study, and each individual signed the informed consent form. the inclusion criteria applied in the selection of subjects were children belonging to the age group from 316 years old. exclusion criteria were patients aged less than 3 years and over 16 years ; patients having active otorhinolaryngological symptoms ; cleft palate repair history in the past and cases with submucous cleft palate ; and patients having ear wax. patients underwent examination with flexible nasopharyngoscope (fiegert - endotech, tuttlingen, germany) for adenoid hypertrophy. the scaling of adenoid hypertrophy was according to grade given by clemens and mcmurray,7 which is : grade i has adenoid tissue filling 1:3 the vertical tallness of the choana, grade ii up to 2:3, grade iii from 2:3 to almost complete but not completely filling the choana, and grade iv with complete choanal obstruction. in our study, we considered grade ii - iii - iv as adenoid hypertrophy. an otorhinolaryngologist examined all children on both ears using an otoscope and tested them with tympanometry. we classified tympanometric measurement results according to adjusted jerger 's classification as types a, as, b, or c.8 type a and as curves were accepted as no middle ear effusion while type b, type c, and type as as predicting of middle ear effusion. tympanometry results were used to diagnose eom. we performed statistical analyses by using spss 22.0 operating program (license no : 10240642). we used the pearson chi - square test and fisher - freeman - halton test. each analysis the study included 589 patients that underwent fiber optic examination of the nasopharynx done with an endoscope. adenoid vegetation was present in 58 patients (9.8%) and was not detected in 531 patients (90.2%). we detected grade 2 adenoid vegetation in 22 of 58 patients (38%), 18 (31%) had grade 3, 18 (31%) had grade 4 adenoid vegetation (fig. we obtained type a tympanogram for 47 (81%) of the 58 patients with adenoid vegetation, 6 (10.3%) were type b, and 5 (8.6%) type c. we found serous otitis media frequency in the 58 patients with adenoid vegetation to be 18.9%., we obtained type a tympanogram in 448 patients without adenoid vegetation (84.4%), type b in 19 (3.6%), and type c in 64 (12%) patients. we found the incidence rate of serous otitis media in 531 patients without adenoid vegetation to be 15.6%. table 1 shows the frequency of adenoid vegetation in patients with and without serous otitis media. when 58 patients with adenoid vegetation compared with 538 patients without adenoid vegetation about serous otitis media, the frequency was not statistically significant (p > 0.05). relation between age range and eom is not found statistically meaningful (p > 0.05). ome may be spontaneously due to poor eustachian tube function, or as an inflammatory response following acute otitis media. the importance of understanding the ome condition stems from its high prevalence with effusion, difficulties in identifying and assessing duration, increased risk of conductive hearing loss, potential impact on linguistic communication and cognition, and significant practice variations in management.9 when the diagnosis of otitis media with effusion is uncertain, tympanometry or acoustic reflectometry should be measured as an adjunct to pneumatic otoscopy.10 11 in our study, an otorhinolaryngologist examined all children on both ears using an otoscope and tested them with tympanometry. we investigated the frequency of serous otitis media in patients referred to the pediatric clinic between 316 years of age without any active ear, nose, and throat complaints in our study. williamson studied 856 children aged 5 to 8 years from four south west hampshire schools, which underwent an examination in three - years time by tympanometry, a method used to detect otitis media with effusion (> 90% specificity and sensitivity) performed once per school term. they recorded normal ears in 54.9% of children with 27% showing evidence of middle ear effusion.12 our study found similar results, albeit in smaller numbers : 94 of 589 patients (15.9%) presented serous otitis media. the lower ratio of serous otitis media in our study may be due to the fact that none of the patients included in this study had active otolaryngologic complaints. tomonaga studied nasopharyngeal bacterial flora in 259 children with otitis media with effusion. the results of this study suggest that adenoid vegetation plays an important role in the etiology of otitis media with effusion.13 sanli performed that ear, nose, and throat examination and a questionnaire on 1,165 children from four randomly selected schools. there was significant relation between otitis media with effusion and adenoid vegetation (p 0.05). this may be because adenoid vegetation does not have much impact on serous otitis media ; moreover, the number of the patients with adenoid vegetation (n = 58) is less than the number of the patients without adenoid vegetation (n = 531), which leads us to consider the reason insufficient. screening surveys of children in good health ranging in age from infants to age five years show a 15% to 40% prevalence of middle - ear effusion.6 12 13 14 15 16 17 18 19 20 21 among children examined at normal intervals for one year, 50% to 60% of child care center attendees17 and 25% of school - aged children22 had otitis media with effusion at some time during the examination period, with elevated incidence during the winter months. population - based screening has not impacted short - term language outcomes18 and we have not assessed its long - term effects in a randomized clinical trial. thus, the recommendation for screening is based not only on the ability to identify otitis media with effusion but, more importantly, on a lack of incontrovertible benefits from treating children identified as such that exceed the auspicious natural history of the disease. the new zealand health technology assessment23 could not determine if preschool screening for otitis media with effusion was effective. more recently, the canadian task force on preventive health care24 studied that there was insufficient evidence to recommend including or excluding regular early screening for otitis media with effusion. although screening for otitis media with effusion is not inherently harmful, potential risks include erroneous diagnoses, overtreating self - limited disease, parental fear, and the costs of screening and excessive treatment. population - based screening is suitable for conditions that are ordinary, can be found by a sensitive and specific test, and provide the advantages stemming from early detection and treatment.25 the first two requirements are fulfilled by otitis media with effusion, which affects up to 80% of children by school entry4 6 12 and can be easily screened with tympanometry. kucur reported that the prevalence of ome among 712-year - old schoolchildren in erzurum (n = 26). local data provide a population specific standard and can be used in healthcare planning.26 complications of ome especially occur if the disease is not recognized in its early stages and/or treated accordingly. chronic otitis media, adhesive otitis media, retraction pockets, and tympanosclerosis are the most common complications of chronic ome. when permanent hearing loss develops due to complications, it may lead to impairment in development of speech and language.27 as a result, we believe it is possible to detect serous otitis media in children without any ear, nose, and throat complaints with adenoid vegetation. therefore, pediatric patients should undergo screening at regular intervals. the scan time and frequency terms | introduction otitis media with effusion is the fluid in the middle ear with no signs or symptoms of acute ear infection. objective this study aims to research the frequency of serous otitis media in patients referred to the pediatric clinic between 316 years of age without any active ear, nose, and throat complaints. methods this study included 589 children patients (280 boys, 309 girls ; mean age : 9.42 ; range 316) who were administered to the pediatric clinic without otolaryngologic complaints. patients underwent examination with flexible nasopharyngoscopy for adenoid hypertrophy. an otorhinolaryngologist examined all children on both ears using an otoscope and tested with tympanometry. we used tympanometry results to diagnose som. results the study included 589 patients that underwent fiber optic examination of the nasopharynx with an endoscope. adenoid vegetation was present in 58 patients (9.8%) and was not detected in 531 patients (90.2%). we found serous otitis media in 94 (15.9%) patients. we obtained type a tympanogram in 47 (81%) of 58 patients with adenoid vegetation, 6 (10.3%) type b, and 5 (8.6%) type c. when comparing 58 patients with adenoid vegetation with 538 patients without adenoid vegetation for serous otitis media, the frequency was not statistically significant (p > 0.05). conclusion we believe that in children without any ear, nose, and throat complaints, it is possible to detect serous otitis media with adenoid vegetation. thus, pediatric patients should undergo screening at regular intervals. |
in 1992, medicare implemented the medicare physician fee schedule (mpfs) using a resource - based relative value scale (rbrvs), which established physician service payments based on relative costs instead of prevailing charges. the goal of the mpfs was to correct distortions produced by charge - based payments and to encourage medical practice efficiencies (physician payment review commission, 1989). under the new system, total rvus reflect three cost components : (1) physician work (or time and effort), (2) practice expenses, and (3) professional liability insurance for a given service. costs associated with each component are given a weight, or index value, and are adjusted to account for area price differences. the three index values for a service are then summed and multiplied by a standard dollar amount (a conversion factor) to arrive at a payment amount. on average, work represents 52 percent of total physician payments, practice expenses represent 44 percent, and liability insurance represents 4 percent (u.s. overall, medicare physician payments totaled over $ 40 billion in 2003, or almost 17 percent of medicare spending (centers for medicare & medicaid services, 2006a). medicare payments represent roughly 20 percent of revenues to physicians, although the share varies by specialty (smith., while resource - based work rvus were the foundation of the mpfs, practice expense and liability insurance rvus continued to be based on historical charges until 1999 and 2000, respectively, when resource - based values for these components were phased in (federal register, 1998a, b). by 2002, most of the system 's relative values were derived from estimates of resources, however the program made substantial refinements to the rbpe values between 2002 and 2004 (federal register, 2002 ; 2003). like the original rbrvs created for physician work, the shift to rbpe and liability insurance values was intended to better align payments with resource costs, and was expected to redistribute payments toward evaluative - oriented services. one aspect of the new practice expense payment system is that cms substantially increased the number of services for which the practice expense payment is affected by the site of service, and changed the level of the site of service differential for services that already had a differential. in essence, these changes regarding site of service differentials were designed to more accurately compensate physicians when they furnish procedures in their offices versus in other ambulatory settings. for a service with a site of service differential, facility practice expense rvus are applied when that service is furnished in a setting whose facility costs are reimbursed under other medicare payment systems (such as hospital outpatient departments or ambulatory surgical centers) (federal register, 2002). non - facility practice expense rvus (which are higher in value than the facility rvus) are applied when a service is furnished in a setting where no other medicare payment system covers the facility - related expenses. by far the most common non - facility setting, in terms of service quantity and medicare spending, is the physician office. until 1999, facility practice expense rvus were calculated simply by applying a 50-percent reduction to a service 's non - facility practice expense rvu value (federal register, 2002). however, when developing the rbpe rvus, average practice expenses were estimated in both the facility and non - facility settings, for the services that medicare determined would have a site of service differential. advances in clinical care, anesthesia methods, and medical technologies have allowed many elective procedures that used to be furnished in the hospital inpatient setting to be furnished in ambulatory settings, and it is estimated that at least 60 to 70 percent of all surgeries are done on an ambulatory basis (owings and kozak, 1998). the shift toward furnishing services in hospital outpatient departments and ambulatory surgical centers has been occurring for over 20 years, while the trend to furnish some procedures in the office setting is more recent (pasternak, 2004). recognizing the trend toward performing more procedures, and more complex procedures, in the office setting, in 1999 the american society of anesthesiologists (2004) developed formal guidelines for office - based anesthesia, and over 24 states have considered legislation, regulation, or guidelines in the area (sutton, 2002). across the elderly and non - elderly population, the office setting accounts for estimates ranging from 5 (pasternak, 2004) to 10 percent (american society of anesthesiologists, 2001) of all surgeries, with common procedures in the office setting ranging from, for example, relatively simple biopsies to hernia repairs to knee arthroscopies (american society of anesthesiologists, 2001). our focus is in identifying the additional services with site of service payment differentials and seeing whether changes occurred in setting choice and in rvu volume during the period that site of service differentials were added and that rbpe rvus were implemented. while the current literature includes assessments of the impact of the new practice expense rvu system (maxwell, zuckerman, and aliaga, 2005 ; u.s. general accounting office, 2001 ; federal register, 1998b), we are not aware of studies that have examined both aspects of the new system rbpe and expansion of the site of service differential policy across services. moreover, if the new payment system results in some shift of services into non - facility settings, then it could be contributing to the growth in medicare physician expenditures and the size of the conversion factor reductions resulting under the sustainable growth rate (sgr) policy. in this study, we identified : (1) changes in the site of physician services furnished between 1998 and 2004, (2) the types of services in which site of service differentials now apply, and (3) the level of the site of service differentials per service. we then analyzed aggregate growth in medicare physician practice expense and total rvu volume (the latter being a counterpart to medicare spending on physician services) and the sources of that growth in terms of : (1) shifts in site of service, (2) changes due to shifting from charge - based to rbpe rvus, and (3) changes in the quantity and mix of services furnished. we developed data on utilization of medicare physician services in 1998 - 2004 from cms annual summaries of physician / supplier claims files. rvu files list the work, practice expense, and liability insurance relative values for each service code paid under the medicare fee schedule. using the annual rvus and claims, we calculated practice expense rvus and total rvus for each service code paid under the medicare fee schedule. to permit our decomposition analyses, we restricted our attention to services utilized in both 1998 and 2004. in any given year, new codes introduced in that year represent less than 1 percent of medicare physician payments in that year (medicare payment advisory commission, 2004). an rvu is the unit of measure for medicare 's rbrvs and each service is assigned a different number of rvus according to its relative resource costs. since payment rates are determined by multiplying rvus by a single conversion factor, total rvus are analogous to relative payment rates. in this study, we used rvus to compute an intensity - weighted measure of service quantity, called rvu volume (physician payment review commission, 1996 ; glass and anderson, 2002 ; mccormack and burge, 1994 ; conoley and vernon, 1991). thus, rvu volume in a given year is the sum, across services, of the number of units of each service multiplied by the rvu value assigned to that service in that year. we computed both practice expense and total rvu volume (which includes work, practice expenses, and liability insurance rvus) as well as their aggregate change between 1998 and 2004. we then decomposed the change in practice expense and total rvu volume over the 6 years into three factors : (1) changes due to site of service, (2) changes due to the implementation and refinement of rbpe rvu values, and (3) changes in the quantity and mix of services furnished over the period. in essence, we isolated and quantified each of these components of change by alternately holding constant the other two factors over the study period. first, we identified volume change due to shifts in site of service using the following calculation, summed across all services : equation 1 (site of service component) : where i denotes services (1,,n), k site of service (facility or non - facility) q04ik is the quantity of service i provided in site of service k in 2004 ; rvu04ik is the 2004 rvu for each service i in site of service k, and wtik is the share of service i provided in site of service k in year t (t= 1998 or 2004). we define this share as : wtik = qtikk=12qtik thus, the change in rvu volume resulting from equation 1 quantifies the change in rvu volume due purely to shifts in site of service between 1998 and 2004. second, we identified rvu volume change due to the shift from charge - based to rbpe rvus using the following calculation : equation 2 (resource - based rvu component) : where all terms are defined as in equation 1 ; and rvu98ik is the rvu that applies to service i in site of service k in 1998. the change in rvu volume resulting from equation 2 quantifies the change in rvu volume due to the shift from charge - based to rbpe rvus. third, we identified residual rvu volume change, due to changes in the mix and quantity of services furnished over the 6-year period, using the following calculation : equation 3 (service mix and quantity component) : where all terms are as previously defined ; and q04ik is the quantity of service i in site of service k in 1998. thus, the change in rvu volume resulting from equation 3 quantifies a residual change in rvu volume, due to changes in the mix and quantity of services furnished over the period. service mix and quantity is a unified concept used by policymakers and researchers when analyzing changes in physician service volume (dummit, 2006 ; medicare payment advisory commission, 2005 ; mitchell, 1992 ; zuckerman and holahan, 1992 ; barer, evans, and labelle, 1988). to present the study results, we grouped services using the berenson - eggers type of service (betos) system (berenson and holahan, 1992 ; centers for medicare & medicaid services, 2006c), which assigns service codes to 1 of 104 clinically meaningful categories. we first present the data according to five betos summary groups : (1) evaluation and management services, (2) major procedures, (3) other procedures, (4) imaging services, and (5) tests. other procedures include cataract extractions, colonoscopies and other endoscopic procedures, and routine dermatology procedures. we retain the imaging services category in our results for completeness, however only a small number of services in the imaging category (mainly services conducted in preparation for x - rays) are paid in the same manner as other services on the mpfs and are potentially affected in the same manner by the facility / non - facility shifts isolated in equation 1. payment for the vast majority of imaging services are split into technical and professional components, and changes in the growth and mix of those components are captured in equation 3. an rvu is the unit of measure for medicare 's rbrvs and each service is assigned a different number of rvus according to its relative resource costs. since payment rates are determined by multiplying rvus by a single conversion factor, total rvus are analogous to relative payment rates. in this study, we used rvus to compute an intensity - weighted measure of service quantity, called rvu volume (physician payment review commission, 1996 ; glass and anderson, 2002 ; mccormack and burge, 1994 ; conoley and vernon, 1991). thus, rvu volume in a given year is the sum, across services, of the number of units of each service multiplied by the rvu value assigned to that service in that year. we computed both practice expense and total rvu volume (which includes work, practice expenses, and liability insurance rvus) as well as their aggregate change between 1998 and 2004. we then decomposed the change in practice expense and total rvu volume over the 6 years into three factors : (1) changes due to site of service, (2) changes due to the implementation and refinement of rbpe rvu values, and (3) changes in the quantity and mix of services furnished over the period. in essence, we isolated and quantified each of these components of change by alternately holding constant the other two factors over the study period. first, we identified volume change due to shifts in site of service using the following calculation, summed across all services : equation 1 (site of service component) : where i denotes services (1,,n), k site of service (facility or non - facility) q04ik is the quantity of service i provided in site of service k in 2004 ; rvu04ik is the 2004 rvu for each service i in site of service k, and wtik is the share of service i provided in site of service k in year t (t= 1998 or 2004). we define this share as : wtik = qtikk=12qtik thus, the change in rvu volume resulting from equation 1 quantifies the change in rvu volume due purely to shifts in site of service between 1998 and 2004. second, we identified rvu volume change due to the shift from charge - based to rbpe rvus using the following calculation : equation 2 (resource - based rvu component) : where all terms are defined as in equation 1 ; and rvu98ik is the rvu that applies to service i in site of service k in 1998. the change in rvu volume resulting from equation 2 quantifies the change in rvu volume due to the shift from charge - based to rbpe rvus. third, we identified residual rvu volume change, due to changes in the mix and quantity of services furnished over the 6-year period, using the following calculation : equation 3 (service mix and quantity component) : where all terms are as previously defined ; and q04ik is the quantity of service i in site of service k in 1998. thus, the change in rvu volume resulting from equation 3 quantifies a residual change in rvu volume, due to changes in the mix and quantity of services furnished over the period. service mix and quantity is a unified concept used by policymakers and researchers when analyzing changes in physician service volume (dummit, 2006 ; medicare payment advisory commission, 2005 ; mitchell, 1992 ; zuckerman and holahan, 1992 ; barer, evans, and labelle, 1988). to present the study results, we grouped services using the berenson - eggers type of service (betos) system (berenson and holahan, 1992 ; centers for medicare & medicaid services, 2006c), which assigns service codes to 1 of 104 clinically meaningful categories. we first present the data according to five betos summary groups : (1) evaluation and management services, (2) major procedures, (3) other procedures, (4) imaging services, and (5) tests. other procedures include cataract extractions, colonoscopies and other endoscopic procedures, and routine dermatology procedures. we retain the imaging services category in our results for completeness, however only a small number of services in the imaging category (mainly services conducted in preparation for x - rays) are paid in the same manner as other services on the mpfs and are potentially affected in the same manner by the facility / non - facility shifts isolated in equation 1. payment for the vast majority of imaging services are split into technical and professional components, and changes in the growth and mix of those components are captured in equation 3. table 1 shows the share of services furnished in non - facility (namely physician office) settings in 1998 and 2004, by type of service. varying levels of shift toward the non - facility setting is seen across the five service categories. the very small shift among evaluation and management services (from 61 to almost 62 percent) is driven mainly by an increase in pathology services (located in the specialty visit group) and consultations occurring in the non - facility setting. among major procedures, a broad range of minimally invasive cardiovascular major procedures and other major procedures shifted toward the non - facility setting, causing a shift from 2.4 to 3.9 percent. in the other procedures category, the increase in the share of non - facility services (from 79.7 to 85.7 percent) was driven by fairly small shifts across several procedures, including eye procedures and some ambulatory and minor procedures. the increasing share of imaging procedures and tests in non - facility settings occurred across a broad range of services. to identify the type of services affected by medicare 's application of a site of service practice expense payment differential in 1998 versus 2004 (and currently), we examined the number of services used in both 1998 and 2004 that have site of service differentials (table 2). in many cases this table confirms the findings from table 1, in that many of the types of codes with newly added site of service differentials are consistent with the types of services that exhibited some shift in quantity toward the non - facility setting. in 1998, 600 services were used in which site of service differentials applied, compared with 1,444 in 2004. among evaluation and management services, in 1998 site of service differentials applied to mainly office / outpatient and ophthalmology visits (located in the specialty visits group). after 1998, site of service differentials were added to four additional types of visits(1) psychiatry, (2) pathology, (3) nursing home, and (4) critical care (data not shown). among major procedures, site of service differentials were added to several orthopedic procedures, and to a range of other services including prostate procedures, skin grafts, and various types of biopsies (data not shown). as table 2 shows, several hundred types of other procedures gained site of service differentials, including services in the eye, ambulatory, minor, and endoscopy categories493 codes used in 1998 had differentials, compared to 1,115 in 2004. examples of the codes in the other procedures category in which site of service differentials were added include colonoscopies, upper gastrointestinal endoscopies, skin graft and wound procedures, and several types of fracture and tendon repairs. as noted, x - rays and most other imaging services do not have site of service differentials. however as table 2 indicates, site of service differentials were added to several codes grouped in this category, most of which describe injections and other preparations for x - rays. in analyzing the data in tables 1 and 2, we found that growth in service frequency in the non - facility setting and in the applicable practice expense rvus are more highly correlated among the codes with newly - designated differentials than among codes that had site of service differentials in 1998. this occurred, in part, because the pe rvu values applied to the non - facility setting increased more, on average, among the newly designated services than among services that had previous differentials. this also occurred because the numbers of services furnished in the non - facility setting were much higher among those codes that already had site of service differentials, which results in a much smaller rate of service growth. services that exhibited particularly large growth in both non - facility service frequency and their pe rvus included a range of codes related to injections for x - rays, wound management, minor orthopedic procedures such as strapping, and some eye, endoscopic, and prostate procedures (data not shown, but available on request from the authors). figure 1 illustrates the variation in site of service differentials between non - facility and facility pe rvus per service in 2004, and the number of codes with a given level of differential. under the rbpe payment system, the variation in the differentials, calculated here as the percent decrease from the non - facility to facility value, the average non - facility - to - facility differential, among services with a non - zero differential, is 51 percent. figure 2 illustrates our decomposition analysis of change in practice expense rvu volume between 1998 and 2004, by type of service. across all services, changes in the site of service (and the corresponding application of a site of service differential)controlling for all other changes in implementing rbpe rvus and for changes in service quantity and all other changes due to implementing rbpe rvu values resulted in an increase of 83.8 million pe rvus. the importance of the factors varies across service types, for example resource - based rvus is the largest source of volume growth for evaluation and management, while resource - based rvus and changes in site of service are comparable sources of volume growth for the other procedures category. for major procedures and imaging, volume growth due to changes in site of service offset some of the volume losses attributable to the shift to resource - based pe rvus. figure 2 also illustrates that changes in service quantity and mix are substantial drivers of volume. this factor serves essentially as a control variable in the pe rvu analysis, and our discussion of it is reserved for the decomposition analysis of total rvu volume, which provides a more comprehensive context for examining the factor. table 3 shows the results of the decomposition of pe rvus using detailed betos categories. while most of the increase in pe rvu volume among evaluation and management services was due to implementation of resource - based pe rvus, changes in site of service resulted in some increase in practice expense volume among mainly office / outpatient and specialty visits, and nursing home visits. site of service changes among nursing home visits reflect a shift from physicians billing for visits regarding beneficiaries in skilled stays to those in non - skilled stays. major procedures experienced a volume loss due to implementing rbpe values, but setting shifts among services mainly in the other major procedures group offset some of this loss, particularly regarding prostate procedures such as laser surgery and thermotherapy (data not shown). in the other procedures category, shifts in site of service resulted in increased practice expense volume across a broad range of services, including cataract extraction and other eye procedures, several types of skin procedures (found in the ambulatory and minor service groups), and endoscopies (particularly colonoscopies and cystoscopies). in contrast, eye procedures and endoscopies experience an rvu volume decrease due to the shift to rbpe values, whereas a broad range of services in the minor procedure category had substantial increases in volume due resource - based pe rvus. in the imaging category, the overwhelming source of growth was due to increases in service quantity and mix, while as expected changes in facility / non - facility designation and the implementation of rbpe values resulted in relatively small changes in rvu growth. figure 3 illustrates the decomposition analysis in terms of total (i.e., work, practice expense, and liability insurance) volume. across all services, service quantity and mix is the overriding source of total rvu volume growth, increasing it by 437.2 million rvus. while changes in pe rvus per service and shifts in site of service were substantial sources of practice expense volume growth in the evaluation and management and other procedures categories, service quantity and mix was the dominant source of growth across each service category when viewing total rvu volume growth. while the relative impact of the factors varies in terms of practice expense volume growth versus total volume growth, note that the absolute levels of volume change due to setting shifts are the same across the practice expense and total volume analyses. for example, figures 2 and 3 indicate that across all services, setting shifts increased volume by 66.7 million rvus (whether pe rvus or total rvus). this level of change is the same because practice expense rvu values can vary by setting, but work and liability insurance values do not. thus, rvu volume changes associated with setting shifts captures change only in practice expense values, whether one is examining practice expense volume or total volume. comparing the three factors of growth changes in site of service (and the corresponding application of site of service differentials), changes in rvu values per service due to implementing resource - based values, and changes in service quantity and mix the latter factor is the dominant source of growth in terms of total volume, and this factor has a larger relative influence in total volume than it does with regard to practice expense volume. the relative influence of service quantity and mix is larger because practice expense payments represent only about 44 percent, on average, of total payments to physicians, and thus the impact of changes related to pe rvus and shifts in site of service are diluted when examining total rvu volume. table 4 shows the total rvu decomposition results according to detailed betos service categories. in the evaluation and management category, office / outpatient, hospital, and consultation visits were the main drivers of growth in service quantity and mix. among major procedures, cardiovascular and orthopedic were equal drivers of growth in service quantity and mix ; and among other procedures, a range of services in the minor procedures group contributed to the growth in quantity and mix. among imaging services, four types of services were the largest drivers of growth in quantity and mix(1) nuclear medicine (detail not shown, but is located in the standard imaging group) ; (2) computerized axial tomography, (3) magnetic resonance imaging (detail not shown, but is located in the advanced imaging group) ; and (4) echographies of the heart. between 1998 and 2004, we found that, across all five main types of services, more services were being provided in physicians ' offices. among major procedures, this shift was driven by, for example, minimally invasive cardiovascular and a broad range of other services in the major procedures category. in the other procedures category, these findings are consistent overall with other literature (pasternak, 2004 ; fields, 2003 ; society for ambulatory anesthesia, 2003) indicating a trend toward furnishing an increasing number of procedures, and increasingly complex ones, in the physician office setting. advances in short - acting anesthesia methods have made this trend clinically feasible, and the implementation and refinement of rbpe rvus along with the application of site of service differentials to hundreds of additional services have made the physician office setting a more financially feasible setting in many cases. for example, site of service differentials were added to several major orthopedic procedures, and to a range of other major procedures including prostate procedures, skin grafts, and various types of biopsies. several hundred types of services in the other procedures category gained site of service differentials, including colonos - copies, upper gastrointestinal endoscopies, skin graft and wound, several types of fracture and tendon repairs, and many eye procedures. in addition to applying site of service differentials to more services, the differentials were changed through the course of implementing rbpe rvus. until 1999, there was a 50-percent reduction of the non - facility pe rvu value when a service was provided in a facility, regardless of the service (federal register, 2002). however, when developing rbpe rvus, average practice expenses were estimated in both the facility and non - facility settings, for the services that medicare determined would have a site of service differential. we found that the percentage decrease from a given service 's non - facility practice expense value to its facility practice expense value averaged 51 percent, however that percentage spanned the range from nearly no differential, to a 99-percent reduction. we found that shifts in site of service, and the corresponding application of site of service differentials, were important sources of growth in pe rvu volume for evaluation and management, major and other procedures. for major procedures, volume growth due to site changes offset some of the volume losses attributable to the remaining changes brought by implementing rbpe rvus. we have not found other studies examining pe rvus and site of service differentials across services, but our findings are consistent with one study which examined setting choice and site of service differentials for 20 selected gastrointestinal and urologic endoscopic services furnished to medicare beneficiaries between 1996 and 2002 (u.s. general accounting office and our findings indicated little or no change in the share of these 20 services furnished in non - facility settings. however, their study did not examine practice expense or total rvu volume regarding these services. while growth in service quantity and mix functioned largely as a control variable in this study of the move to pe rvus and more site of service payment differentials, our findings nonetheless confirm that recent growth in medicare physician expenditures due to increases in service quantity and mix (medicare payment advisory commission, 2004). we did not control for growth in the beneficiary population in the study, which rose approximately 1 percent annually over the study period (centers for medicare & medicaid services, 2006b). controlling for this population increase would have resulted in our level of growth due to service quantity and mix being slightly smaller than is shown. the medicare payment advisory commission (2004) recently studied a large number of factors potentially affecting aggregate medicare spending for physician services, but found beneficiary growth to be a minor source. these findings suggest that medicare 's expanded application of site of service differentials and implementation of rbpe rvus were sources of volume growth. in fact, to the extent that site of service shifts in combination with the new pe rvu and site of service payment differentials contributed to medicare physician volume growth, these shifts could be a factor leading to the projected fee cuts under the sgr policy and could make the sgr problem harder to address. although the policy changes (i.e., new pe rvus and expanded site of service differentials) are factored into the calculation of the sgr targets, actual shifts of services toward the office setting would add to service volume growth and make it more likely that sgr targets would be surpassed. the payment system changes that were made suggest a conclusion that prior fees were not adequately reflecting differences in practices expenses across sites of services. the medicare fee schedule was designed so that relative fees would reflect relative resource costs across services, taking setting into account. the policy changes explored in this study were intended to reduce the extent of overpayment or underpayment that may have resulted from the previous pe rvus and site of service differentials. for example, some physicians may have been providing services in their offices but getting underpaid relative to the practice expenses, while others were providing services in their offices and getting excess payments relative to their practice expenses. although it is beyond the scope of this study to assess the accuracy of the rbpe rvus that were implemented, the changes may be better reflecting the range of clinically appropriate settings for certain services. | in 1999, medicare implemented a resource - based relative value unit (rvu) system for physician practice expense payments, and increased the number of services for which practice expense payments differ by site. using 1998 - 2004 data, we examined rvu growth and decomposed that growth into resource - based rvus, site of service, and service quantity and mix. we found that the number services with site of service differentials doubled, and that shifts in site of service and introduction of resource - based practice expenses (rbpe) were important sources of change in practice expense rvu volume. service quantity and mix remained the largest source of growth in total rvu volume. |
the quality of a scintigram depends on the number of acquired photons per unit area. generally, the geometric efficiency of a gamma camera is small, and the data acquisition time of a scintigram is limited, and so the acquired counts of gamma rays are sometimes several tens to a hundred per pixel for imaging. as a result, the image is distorted with poisson noise, making it hard to detect small uptake on a scintigram. many methods have been proposed to remove this noise and restore the spatial resolution in a scintigram, for example, linear filters and order statistic filters such as a median filter in the spatial domain, and butterworth filter and wiener filter in the frequency domain [111 ]. on the other hand, a wavelet transform is useful to remove the noise selectively without loosing the edge information, and so several methods with a discrete wavelet transform have been proposed [1320 ]. donoho proposed a method called visushrink in reference to the good visual quality of reconstruction obtained by the simple shrinkage of wavelet coefficients. here, shrinkage means a thresholding operation. to improve the performance of denoising with the criterion of mean - squared error (mse), sureshrink has been developed to suppress noise with a threshold determined by the principle of minimizing stein 's unbiased risk estimator (sure). the method with the concept of sure has an advantage in that the statistics of the original image need not be considered, and sure - let (linear expansion of threshold) was developed [16, 17 ], in which the denoising was performed with a thresholding function instead of a simple threshold value. as an alternative threshold selection method, bayesshrink was developed to reduce the noise adaptively, in which a different threshold derived in a bayesian framework is applied to the wavelet coefficients for each pixel. this method is more effective in removing gaussian noise than sureshrink, but is insufficient to remove the poisson noise appearing in a scintigram. the noise reduction methods with a wavelet transform including the above methods commonly assume the uniform distribution of gaussian noise on an image and so do not always prove effective for the poisson noise whose variance is equivalent to the mean value of the signal. on the other hand, methods to reduce poisson noise have also been proposed by many researchers [19, 20, 2227 ], and these methods sometimes work well. of these methods, wang 's method [19, 20 ] with a wavelet transform can reduce the poisson noise effectively ; however, the parameter selection in this method is inappropriate for scintigrams and sometimes looses edge information in the process of denoising. in this paper, we proposed a new method to yield high - quality scintigrams by reducing poisson noise adaptively. in our method, we multiplied the threshold value determined with the bayesshrink method by a factor in considering the local average count around the pixel of interest and used it to reduce the poisson noise with a filtering function. and we also applied the idea of a translation - invariant (ti) denoising to reduce the artifacts caused in the process of wavelet shrinkage. in this study, we evaluated the performance of our proposed method in comparison with the conventional denoising methods (1) making shifted imageshere, we assumed an original image i0 composed of n n pixels, where n = 2, and m was an integer value. to apply the concept of the ti denoising method, we made several images by shifting the pixel position in the direction of the x- and/or y - axis circularly. in this study, we used a wavelet kernel consisting of 4 taps, and so the number of images shifted here became 16 (i0 i15), equal to 4 4. here, we assumed an original image i0 composed of n n pixels, where n = 2, and m was an integer value. to apply the concept of the ti denoising method, we made several images by shifting the pixel position in the direction of the x- and/or y - axis circularly. in this study, we used a wavelet kernel consisting of 4 taps, and so the number of images shifted here became 16 (i0 i15), equal to 4 4. (2) wavelet decomposition of the 16 shifted imagesin the discrete wavelet transform, we used the daubechies kernel [29, 30 ] and decomposed the 16 images up to level 3. in the discrete wavelet transform, we used the daubechies kernel [29, 30 ] and decomposed the 16 images up to level 3. (3) reduction of poisson noisewe applied the following method to coefficients of the above 16 images (i0 i15) in the wavelet domain. the fluctuations of counts in a scintigram obey the poisson distribution, and its variance differs locally depending on the number of detected photons. in the poisson distribution, the variance equals the expected value of detected photons, and so we used scaling coefficients sxy as a reference in determining a local threshold txy at a given position (x, y) : (1)txyj=sxyj2jbj, where j was a subband level, and b was a threshold at level j determined by the bayesshrink method. the weight was determined by the scaling coefficients sxy at level one as follows : (2)=1n2y=1n/2x=1n/2|sxy1|y=1n/2x=1n/2|sxy1|. by using this weight, we took into account the local signal - to - noise ratio in (1), because the scaling coefficient is proportional to the local average of the numbers of gamma rays. we applied the following method to coefficients of the above 16 images (i0 i15) in the wavelet domain. the fluctuations of counts in a scintigram obey the poisson distribution, and its variance differs locally depending on the number of detected photons. in the poisson distribution, the variance equals the expected value of detected photons, and so we used scaling coefficients sxy as a reference in determining a local threshold txy at a given position (x, y) : (1)txyj=sxyj2jbj, where j was a subband level, and b was a threshold at level j determined by the bayesshrink method. the weight was determined by the scaling coefficients sxy at level one as follows : (2)=1n2y=1n/2x=1n/2|sxy1|y=1n/2x=1n/2|sxy1|. by using this weight, we took into account the local signal - to - noise ratio in (1), because the scaling coefficient is proportional to the local average of the numbers of gamma rays. (4) thresholding functionin our method, we used the following filtering function to remove poisson noise while preserving the edge information:(3)xy={sgn(xy)(|xy|txyjexp(t0|xy|)1+exp(t0|xy|))if |xy|>txyj,0,otherwise, where xy is an original wavelet coefficient, xy is the wavelet coefficient after thresholding, and t0 is an arbitrary value that is the inflection point of (3). in this paper, we selected t0 value so as to match a value above 2% of the number of absolute wavelet coefficients from the largest value.the filtering function works like a soft thresholding method where the absolute of the coefficients is near zero. on the other hand, it works like a hard thresholding method where the absolute of wavelet coefficients is large. and so the denoised wavelet coefficients gradually change around the threshold, and an abrupt truncation effect that appears in a hard thresholding method is avoided. in our method, we used the following filtering function to remove poisson noise while preserving the edge information:(3)xy={sgn(xy)(|xy|txyjexp(t0|xy|)1+exp(t0|xy|))if |xy|>txyj,0,otherwise, where xy is an original wavelet coefficient, xy is the wavelet coefficient after thresholding, and t0 is an arbitrary value that is the inflection point of (3). in this paper, we selected t0 value so as to match a value above 2% of the number of absolute wavelet coefficients from the largest value. the filtering function works like a soft thresholding method where the absolute of the coefficients is near zero. on the other hand, it works like a hard thresholding method where the absolute of wavelet coefficients is large. and so the denoised wavelet coefficients gradually change around the threshold, and an abrupt truncation effect that appears in a hard thresholding method is avoided. (5) reconstruction of the 16 denoised images and averagingafter the wavelet reconstruction of the 16 images, we restored the pixel positions to their original ones and averaged the pixel value of these 16 images pixel by pixel. after the wavelet reconstruction of the 16 images, we restored the pixel positions to their original ones and averaged the pixel value of these 16 images pixel by pixel. to evaluate our proposed method quantitatively, we used two images and compared our method with conventional methods : bayesshrink, sure - let, and wang 's method. bayesshrink estimates the variance of the gaussian noise with a robust median estimator and applies its weighted values to each subband. wang 's method uses an optimum weight that is multiplied to the threshold determined in the bayesshrink method. in the simulation, we used an image whose gray levels changed from 20 to 230 like a staircase as shown in figure 2(a). in addition, we used a brain image (figure 2(b)) with a size of 512 512. we set three expected values (20, 50, 100) inside the brain image. knuth 's method was used to add poisson noise to the above original images. the original images with poisson noise are shown in figures 2(a) and 2(b). we used the daubechies kernel (tap : 4) in the discrete wavelet transform, and the decomposition level was three. to evaluate the quality of the denoised images, we used a psnr (peak signal - to - noise ratio) as follows : (4)mse=1n2x=1n y=1n(f(x, y)g(x, y))2,psnr=10 log10(dmax2mse), where dmax means the maximum pixel value in an image, f(x, y) is an original image without noise, and g(x, y) is a denoised image., we used 8-bit images, and so we set dmax = 255. to confirm the validity of our proposed method, we acquired scintigrams (tc - mdp bone - scan and ga - scan) with a gamma camera (gca9300, toshiba medical systems, japan). in tc - scan, we used a low - energy high - resolution collimator, and in ga - scan a medium - energy high - resolution collimator. the dose administered was 555 mbq for tc - scan and 111 mbq for ga - scan, and a whole body data acquisition mode was used with a moving speed of 100 mm / min. the sizes of an image were 512 512 (tc - scan) and 256 256 (ga - scan), and the pixel depth was 16 bits. each image was processed with bayesshrink, sure - let, wang 's methods, and our proposed method. wavelet decomposition with daubechies kernel (tap : 4) was performed up to the third level to make a fair comparison of these methods. the images denoised with bayesshrink, sure - let, wang 's methods, and our proposed method are shown. to evaluate the fluctuation of pixel values quantitatively, we showed a profile of pixel values along a line indicated with two arrows. the results of the numerical evaluation with the psnr are shown in table 1. the original image used in this evaluation and image denoised with bayesshrink, sure - let, wang 's methods, and our proposed method figure 5 shows the results of tc - mdp bone - scan image, and figure 6 shows those of ga - scan image. in these figures, only half of a processed image is shown (512 256 or 256 128). the count profile along a line indicated with two arrows is shown below each image. the main feature of our method is that the threshold value used in the wavelet shrinkage is scaled adaptively with the local average of acquired counts. most of the early denoising methods with a wavelet transform use a fixed threshold to remove noise, and the threshold is determined with the variance of wavelet coefficients. on the other hand, bayesshrink is an effective method that changes the threshold at each level. and if we compare the results with those of linear filters in the spatial domain or the frequency domain, the bayesshrink method works well in eliminating gaussian noise. in this method, the threshold value is determined referring to the wavelet coefficients of the diagonal components in level one, and the median of the absolute value of the wavelet coefficients is adopted as a reference value. however, if the fluctuation of the wavelet coefficients differs locally such as in the case of poisson noise, the denoising sometimes failed as shown in figures 2 and 3. the method works effectively when the gaussian noise with a specified variance is distributed uniformly on an image. the application of a thresholding filter in sure - let yields good results by using the sure. the method could remove the gaussian noise almost perfectly, provided that its variance was known or correctly estimated. however, in the case of a scintigram, the denoising failed in some regions as shown in figures 2 and 3. on the other hand, wang 's method modified the threshold determined by the bayesshrink method by multiplying a weighting factor. this approach is somewhat similar to that of our method, and the performance of denoising is better than that of the former two methods as shown in figures 2 and 3. the major difference between our method and wang 's method is that our method refers to a local mean in the determination of a threshold of interest. the scaling coefficient is equivalent to the local mean of acquired counts, as a result of which the threshold value becomes more adaptive as compared to the other conventional methods. figures 2 and 3 show that our method can remove poisson noise at any count level. the results of the quantitative analysis with the psnr showed that our method, which modified the threshold function slightly pixel by pixel according to the local average count, was better than the conventional methods by more than 3-db. denoising methods with a wavelet transform basically use either a soft thresholding method or hard thresholding method. the soft thresholding method reduces the amount of coefficients outside the shrinkage region, as a result of which the contrast resolution of the denoised image is decreased. on the other hand, the hard thresholding method keeps the wavelet coefficient outside the shrinkage region, and so there becomes an abrupt change in wavelet coefficients that occurs around the threshold value. this introduces ripples near sharp edges in denoised images. with regard to these artifacts that occur in the process of denoising with a shrinkage method, coifman and donoho proposed a method called ti denoising, which efficiently suppresses the artifacts due to the lack of translation invariance of the wavelet basis. in our method, we applied the concept of the ti method and successfully suppressed the artifacts appeared at the edge of a region. in scintigrams, there is a region outside the human body where the number of detected photons is nearly zero. this area affects the estimation of an optimal threshold, and thus, we eliminated the pixels whose values were less than 10 percent of the maximum counts in an image. with this process, we could eliminate the effect of this region and reduce the poisson noise appropriately. as for the decomposition level, we decomposed an original image with the third level in the discrete wavelet transform. if we increase the level, the denoised images are considerably smoothed, and if we decrease the level, denoising is insufficient, and so we set the decomposition level at three. our proposed method has only one parameter to control the shape of a filtering function. we can modify the amount of wavelet coefficients near the threshold with this parameter more adaptively depending on image features, if necessary. our method could remove poisson noise efficiently, and a translation - invariant denoising operation suppresses artifacts occurring near the edge. the results of the simulations showed that our proposed method was better than the conventional methods by more than 3-db in psnr, and processed scintigrams were improved in quality without excess smoothing. we confirmed that our method was effective in reducing poisson noise while preserving the fine structures on scintigrams. | the aim of this study was to eliminate the effect of poisson noise in scintigrams with a wavelet thresholding method. we developed a new noise reduction method with a wavelet transform. the proposed method was a combination of the translation - invariant denoising method and our newly introduced denoising filter which was applicable for poisson noise. to evaluate the validity of our proposed method, phantom images and scintigrams were used. the results with the phantom images showed that our method was better than conventional methods in terms of the peak signal - to - noise ratio by 3 db. quality of the scintigrams processed with our method was better than that with the conventional methods in terms of reducing poisson noise while preserving edge components. the results demonstrated that the proposed method was effective for the reduction of poisson noise in scintigrams. |
acute pulmonary thromboembolism is a fatal disease that can cause patients to take a sudden turn for the worse from the moment of symptom manifestation due to right heart dysfunction, hypotension, and hypoxia, if there is no precise and fast diagnosis and treatment for it. for medical therapy of acute pulmonary thromboembolism however, when it comes to patients who have unstable vital signs or for whome medical therapy is not indicated, ecmo (extracorporeal membrane oxygenator) application and emergent thromboembolectomy can be considered. on the basis of the authors ' surgeries, we wanted to determine the indications and results of thromboembolectomy. eight patients underwent surgery due to acute pulmonary embolisms from january 1999 to december 2004. among them, we reviewed 7 patients who could be investigated by medical records. one of these underwent reoperation due to recurrence of pulmonary embolism on the 13th postoperative day. patients who had needed vasopressors for hypotension or had shown right heart dysfunction by echocardiography underwent surgery. we performed median sternotomy under general anesthesia and then performed cardiopulmonary bypass without cardiac arrest. after making incisions to the pulmonary arteries longitudinally, we removed the thromboembolisms and cautiously compressed both lungs after opening both pleurae using an uncapped yankauer sucker. for artery cannulation, we used the ascending aorta in 7 cases and the femoral artery in one case. on the other hand, for venous cannulation, we used both the superior vena cava (svc) and inferior vena cava (ivc) in 7 cases and the femoral vein in one case. the one case of using the femoral artery and vein was the patient who had suffered from hypotension in the operating room, so we cannulated the femoral artery and vein and ran the cpb first and then continued the surgery. the mean duration from admission to operation was 3 days, which included the cases referred from other departments. the total patients were 7 cases (4 males, 3 females). because one female had a reoperation on the 13 postoperative day, there were a total of 8 operations. the main symptoms were dyspnea in 4 cases, chest pain and discomfort in 2 cases, palpitation in one case, and syncope in one case. however, a vasopressor was infused into the two patients who had suffered from hypotension. the mean respiratory rate was 27 breaths per minute (22 to 36) and the mean pulse rate was 113 beats per minute (98 to 120). we diagnosed the disease using chest computed tomography and lung perfusion scan, echocardiography and pulmonary angiography. in the chest computed tomography scans, echocardiography showed right heart dilatation in 6 cases, and moderate tricuspid regurgitation was noted in 3 of them. a preoperative check of d - dimer was performed in 4 cases, which were found to be elevated to > 1.0, 3.28, 1.84, and 16.8 mcg / ml. troponin i was elevated to 2, 2, and 3.43 ng / ml in 3 cases. we calculated the difference in oxygen pressure (aado2) and the values were elevated in 6 cases (table 1). the causes of pulmonary artery thromboembolism were deep vein thrombosis in 4 cases, previous knee transplantation in 2, cases and schizophrenia in 2 cases. of the remaining cases, one each was caused by right atrial thrombosis, patent foramen ovale (pfo) with cerebral stroke (for which we performed thromboembolectomy with pfo primary closure) and steroid taking due to renal failure. there were two patients who had used vasopressors before surgery and one of them underwent cardiopulmonary resuscitation. we infused heparin to 4 patients before surgery, and we inserted an ivc filter below the renal vein in 4 cases. one patient suffered from pleural and pericardial effusion, but went home without any special treatment. the patients who had a long hospital stay needed treatment for psychotic problems, and reoperation made for a long hospitalization. two patients died, one on the operative day and the other on the first postoperative day. one was in brain death after cpr, and the other died of right heart failure with myocardial infarction. the patient in brain death underwent the operation due to the family 's insistence (table 2). four patients who came back for follow - up among the five surviving cases lived at least 5 years after their operations. the main clinical symptoms were acute dyspnea and chest comfort, and other symptoms are hypoxemia and hypotension without specific previous disease. twenty percent of patients show the normal range of arterial oxygen pressure and the normal difference between alveolar and arterial oxygen pressure (aado2). hemodynamic changes can be shown in the time when 30~50% of pulmonary arteries are plugged with thrombi. acute pulmonary thromboembolism can be categorized into massive and sub - massive groups. in massive acute pulmonary thromboembolism, there can be cases of systolic blood pressure below 90 mmhg, systolic blood pressure decreases of more than 40 mmhg over the course of 15 minutes or more, and cardiogenic shock. on the other hand, sub - massive acute pulmonary thromboembolism evidences right heart dysfunction even when it shows a hemodynamically stable state. the risk factors of acute pulmonary thromboembolism include old age, history of deep vein thrombosis, four - limb limitation due to neurogenic problems, long bedridden periods due to cardiac or acute pulmonary injury, neoplasm, hormonal therapy, congenital or acquired thrombophilia, oral contraception, pericarditis, and history of pulmonary thromboembolism. in patients with deep vein thrombosis in the proximal lower extremity without chest symptoms, seventy percent of the detected pulmonary thromboembolisms are combined with deep vein thrombosis in the lower extremities. among these combined cases, limitation of movement due to neurogenic disease, being over 75 years old, and cardiopulmonary disease or neoplasm are risk factors for death by acute pulmonary thromboembolism. danilo. reported that moderately depressive patients with movement limitations were in danger of pulmonary thromboembolism. the score takes into account age over 65 years, history of arrhythmia, thrombus and pulmonary embolism, history of operation within the most recent one month, history of fracture, progressive cancer, pain of a unilateral lower extremity, hemoptysis, heart rate over 75 beats per minute, pain on palpation of the lower extremity vein, and unilateral edema in the lower extremity. clinical possibilities can be classified into three grades (low, intermediate, high) according to the grade of individual risk factors. other diagnostic tools are chemical tests such as pro - bnp, bnp, troponin, echocardiography, chest computed tomography, and lung perfusion scan. echocardiography can reveal the level of pressure overload to the right ventricle, through the signs of a diameter ratio between the right and left ventricle of more than 1, right ventricular dilatation, right ventricular hypokinesis, and the degree of ventricular septal bowing. in particular, it is said that the degree of ventricular septal bowing is useful in predicting death. among the patients diagnosed with pulmonary thromboembolism, hemodynamically if there is an abnormal finding of the right heart, the patient can be treated with thrombolytics under close observation. initial therapies include anticoagulation (unfractionated heparin, low molecular weight heparin, fondaparinux, warfarin), thrombolytics, percutaneous thromboembolectomy, and operative treatment. warfarin therapy must be continued for three months (target inr : 2.0~3.0). in the cases with risk factors such as male gender, old age, malignancy, and pulmonary embolism without special preceding causes, however, warfarin therapy must be continued at least three months due to the increased possibility of recurrence. thrombolytics can not be used in cases of cerebral diseases, intractable hypertension, or within three weeks post - operatively. an ivc filter is indicated for cases of contraindication of anticoagulation therapy, the failure of anticoagulation therapy, cardiopulmonary dysfunction with arrhythmogenic thrombosis, high risk patients for operation and the patient taking thrombolytics due to proximal arrhythmogenic thrombosis. pulmonary thromboembolectomy has to be performed whenever several medical treatments do not show the effect in the cases of unstable blood pressure, hypoxemia, imbalance of electrolytes, or acidosis. if an emergency operation is difficult to perform, the application of ecmo can be helpful to maintain survival. the first indication is the case of confirmed massive pulmonary thromboembolism with hemodynamic changes. in this case, right heart dysfunction or the need for vasopressors becomes evident. the second one is hemodynamic instability such as shock, in spite of heparin infusion or supportive care for stable vital signs. if there is a massive thrombus in the proximal lower limb and a percutaneous thromboembolectomy using a catheter can not be performed, an operation has to be considered even though the vital signs are stable. although noninvasive therapies such as anticoagulation and thrombolytics tend to gradually replace surgical interventions, in light of this study, we suggest that emergency pulmonary thromboembolectomies are needed for patients who are in a hemodynamically unstable state or have a right heart dysfunction. furthermore, patients whose movements are limited due to psychotic problems are in danger of pulmonary thromboembolism. therefore | backgroundacute pulmonary thromboembolism is fatal because of abruptly occurring hypoxemia and right ventricular failure. there are several treatment modalities, including anticoagulation, thrombolytics, ecmo (extracorporeal membrane oxygenator), and thromboembolectomy, for managing acute pulmonary thromboembolism.materials and methodsmedical records from january 1999 to december 2004 at our institution were retrospectively reviewed for pulmonary thromboembolectomy. there were 7 patients (4 men and 3 women), who underwent a total of 8 operations because one patient had post - operative recurrent emboli and underwent reoperation. surgery was indicatedfor mild hypoxemia and performed with cpb (cardiopulmonary bypass) in a beating heart state.resultsthe patients had several symptoms, such as dyspnea, chest discomfort, and palpitation. four patients had deep vein thromboembolisms and 3 had psychotic problems, specifically schizophrenia. post - operative complications included hemothorax, pleural effusion, and pericardial effusion. there were two hospital deaths, one each by brain death and right heart failure.conclusionemergency operation should be performed when medical treatments are no longer effective. |
its evolution can run through serious complications and irreversible damage [1, 2 ], mainly in our areas which are characterized by low medication and delays in referral specialist consultations. the issue of the com in developing countries still lies not only in its diagnostic approaches, but also in its treatment modalities. the purpose of this study was to analyze the epidemiological, clinical, and therapeutic aspects of this disease at the university hospital of ouagadougou. this prospective descriptive study focused on 79 patients with com, aged from 6 months to 75 years. these cases have been collected from march 1 2009, to february 29 2010, in the ent ward of the university hospital (chu - yo) of ouagadougou. it included all patients with com who came in consultation during the said period in the service and had given their informed consent. the diagnosis of com was based upon the following arguments : chronic inflammation of the middle ear lasting for more than 3 months with otorrhea or not, and changes in the eardrum, eardrum perforation or not, pure tone threshold audiometry showing a hearing loss. patients had a follow - up control check on the 15th, 30th, 60th, and 90th days after treatment. controls evaluated local changes (ending of otorrhea, aspect of the eardrum, and the bottom case, with research of complications). we developed a data collection sheet taking into account age, gender, history, datasheet of the clinical examination, further investigations, treatment, and evolution. seventy - nine patients (0.96%) were recruited during the study period among a group of 8200 patients who had consulted. there were 43 men (54.3%) and 36 women (45.70%) with a sex ratio of 1.19. the most common age was that from 0 to 15 years with a frequency of 32 cases or 40.50% of cases. twenty - one patients or 25% had had their first special consultation after more than 10 months of disease development. the main reasons for consultation were otorrhea, 53 cases (67.10%), followed by earache, 13 cases (16.50%), and hearing loss, 8 cases (10.13%). ent histories found in our patients were listed in table 1. contributing factors found in our patients were shown in table 2. bilateral com (35.40%) was relatively more common than unilateral shapes taken as isolated cases : right (30.40%) and left (34.20%). among the 158 ears examined, 107 showed com. germs were found in 36 cases. there were 9 cases of staphylococcus aureus (25.01%), 8 cases of pseudomonas aeruginosa (22.20%), and 5 cases of proteus mirabilis (13.90%). the rest of the germs (26.47%) were varied (streptococcus, escherichia coli, klebsiella, and providencia). antibiogram testing was performed in 31 cases. among the antibiotics tested, ciprofloxacin and ceftriaxone were the most active, with respective rates in 26 cases or 83.90% and in 24 cases or 77.40% of cases. the pure tone threshold audiometry was performed in all cases, but the types of hearing loss were identified in 76 cases (96.20%). conductive hearing loss in 38 cases (50%) and mixed hearing loss in 32 (42.10%) were the most represented types in our series. this deafness was of varying intensity but dominated by the mild degree in 36 cases (47.37%). our patients received only medical treatment in 59 cases (74.68%) : local antibiotherapy and anti - inflammatory treatment were systemically used, respectively, in 52 cases (88.13%) and 51 cases (86.44%). it consisted mainly in a paracentesis (7 cases) in case of failure of medical treatment in the com, a myringoplasty (6 cases), and a radical mastoidectomy in 4 cases of cholesteatoma. the response to treatment was favorable with lesion stabilization in 63 cases (86.35%). they concerned mastoiditis in 3 cases (3.80%), peripheral facial paralysis in 3 cases (3.80%), and meningoencephalitis in 1 case (1.27%). postotitis sequelae were dominated by deafness in 76 cases (96.20%) of variable intensity. in our experience, 79 patients with chronic otitis media were examined in 1 year, an amount of 0.96% of consultants. indeed, the actual frequency of this disease is difficult to specify in our conditions of exercise where health facilities, qualified staff, and technical facilities are limited. therefore, there is underreporting of cases in our context. the highest frequencies of com cases were recorded during the period from march to june and during the month of december. this corresponds in burkina faso to the period of the dry, dusty harmattan winds on the one hand and the cold on the other hand, that undermine the mucosa, favoring acute respiratory infections including acute otitis medium (aom). it thus plays an important role in the genesis of com [7, 8 ]. according to triglia. in france, the average length of the otitis episode in cold period is nearly three times longer than in warm weather. the seasonal influence is thus a significant factor in the genesis and maintenance of com. the age group most represented in our study was that of 015 years with a frequency of 40.50%. these results are comparable to those of david and peter in the us, which recorded a rate of 39% for the age group from 0 to 15 years. we agree with these authors that at this age the immune immaturity of the child and the anatomical features of the ent area predispose them to aom and thus to com. the average delay for specialized consultation in our study was 6 months and 10 months for more than 25% of patients. this delay in specialist consultation could be partly accounted for by the lack of third - party payment (medical costs are entirely borne by the patient), and secondly, it is due to the importance of self - medication and the weight of traditional treatment in our context. to this could be added the low impact of the symptoms of this disease, which constitutes a trivializing factor in our regions. simple com was the most represented in our series (71.02%) with a rather central perforation (61.73% of cases). these results are comparable to those of other authors such as home. from denmark which noted a predominance of central perforation with a frequency of 86%. com with effusion seems to be less frequent in our context (24.30% of cases). nevertheless, many of this simple com might be genuine com with effusion seen at its superinfected and open stage. but this scarcity is relative for us since many cases certainly go unnoticed when you do not have a microscope for otology consultation. moreover, in our developing countries, many patients, carriers of com, do not consult ent. anyway, we must keep in mind the specific gravity of cholesteatoma com [5, 11 ]. among the contributing factors encountered, in - ear instillation of traditional products (46.09%) was rhinitis and nasopharyngitis, classic predisposing factors, are taken into account in the genesis of com by their chronic impairment of tubal function. however, in our context, we should first blame ear instillation of traditional products (46.09%) of badly known chemical nature. they will probably increase the risk of transition to chronicity and the development of extensive lesions. unfortunately, the low purchasing power of patients, the influence of sociocultural habits (including pond baths), and disregard of the risks incurred induce this therapeutic use. the treatment of com is medicosurgical [1, 6, 10, 12 ]. it not only helps to curb the infection process and the inflammatory process but also prevents otogenes complications. topical antibiotics and anti - inflammatory are very important : 88.61% and 87.34%, respectively, of cases in our series. paracentesis and myringoplasty were the most practiced surgical interventions in our series followed by mastoidectomy. this surgical treatment concerned, respectively, four main directions : otitis media with effusion, simple open - spandrel com, infectious complications, and cholesteatoma [7, 13 ]. the early care and the quality of technical facilities are important assets for the prognosis [3, 6 ]. however, endotemporal complications are frequent in our series. the sequelae were primarily functional in our study, dominated by deafness with important socioprofessional consequences. the management of these sequelae is also a fundamental step in the management of com. being a relatively common condition in our context, com remains a public health problem that is often wrongly trivialized by people. we should undoubtedly focus on prevention through public awareness, an appropriate care of upper respiratory tract infections, and early treatment of aom. | objectives. the aim of this study was to analyze the epidemiological and clinical aspects of chronic otitis media and its therapeutic processes in our context. patients and methods. in a prospective study over a period of 1 year (march 2009february 2010), 79 patients with chronic otitis media have been cared for in the otolaryngology ward of the university hospital of ouagadougou. results. chronic otitis media (com) commonly occurs in the age group from 0 to 15 years (40.50%). otorrhea was the main reason for consultation in 53 cases (67.10%) ; the most frequently encountered clinicopathological forms were simple com (71%) followed by otitis media with effusion (24.30%). intra - auricular instillations of traditional products (46.09%) were the dominant favoring factor. treatment was essentially through medication in 59 cases with a stabilization of lesions. endotemporal complications were noticed in 6 cases. conclusion. the fight against chronic otitis media is carried out through preventive measures of education the of people. |
the meeting was introduced by edwin l. cooper, a very communicative and scientifically participative professor, who illustrated the main aims of the journal ecam, evidence - based complementary and alternative medicine, and roused everyone to contribute publishing scientific - based evidences on homeopathy and other complementary / alternative medical approaches. he described how the journal born in los angeles (ucla) sustained by important collaboration in kanazawa and japan, with assistance from oxford university press. professor cooper illustrated the electronic submission of all contribution types and hastened peer reviewing that results in free access to electronic publication before the appearance of a hard copy issue. professor paolo bellavite opened the conference by discussing the historical background of homeopathy, and then developed into a session of open - ended questions. what can be concluded through meta - analysis ? is it possible to imagine the future of the homeopathic approach by either exceeding and/or incorporating the different doctrines ? 1) ; they shape a triangle whose vertices are (from the top) as follows : complexity and individuality, similarity and dilutions. daily medical practice and clinical studies lie on the sides of the triangle and within its area, sustained and supported by other scientific trials : from phase i clinical trials to phases ii iv trials, from basic research on the similia principle to electromagnetic properties of water passing through the paradox of very high dilution. taken together, this could increase the area of the triangle, which determines the acceptance of homeopathic medicine. similarity : healing is achieved by taking a drug that proved by healthy individuals have yielded symptoms and signs very similar to those of the patients. similarity : healing is achieved by taking a drug that proved by healthy individuals have yielded symptoms and signs very similar to those of the patients. the published homeopathic clinical trial and meta - analysis review was very detailed (as many as 80 studies were reviewed). results varied, and the following observations were extensively discussed during the course of the conference : (i) homeopathic research requires more rigorous trials ; (ii) clinical studies on asthma, allergies and other respiratory pathologies yielded the best results ; and (iii) classic homeopathy requires more specific trail methodology. special attention was given to a recent famed meta - analysis from the lancet (1) which addressed the prejudice toward homeopathy, primarily due to the choice of trials that were analyzed. homeopathic trails must employ more rigorous methodologies : they frequently lack in randomization criteria, placebo use and laboratory markers. the speaker stressed efficacy in homeopathy, which could be evidenced both referring to complex therapeutic method (the use of individualized therapy) and to specific drug effects on specific pathology. provings, i.e. homeopathic pathogenetic trials (htps), contributed by professor giuseppina pitari. milestones of homeopathic medicine, htps suffer about large methodological variability : different aims, different described outcomes, placebo usage, supervising, poor remedy description, multivariegated symptoms collections, lack of data analysis, etc. a possible methodology was described and some indications were discussed on study design (double - blind placebo - controlled trial) (2), doses and potency of the drug, description of the potentized substance detailing its toxicological effects, time of observation. carlo m. rezzani concluded the session by describing a research project (ciflicol) on clinical report cases : an electronic case sheet can be drawn up and sent to a worldwide database, continuously updated (www.hmssrl.com). the intriguing discussion about placebo solution preparation was flowed into the description of the world of high dilutions. the most characteristic and controversial principle of homeopathy is that the potency of a remedy can be enhanced by dilution, in a procedure known as dynamization or potentization. paolo bellavite discussed about basic researches showing limits, successes and possible hypotheses. life has evolved around water, into water, because of water : special water properties permit hydrophobic interaction, very few water molecules go with biological compounds keeping its imprint, water clusters activated during homeopathic dynamization can reach a cellular receptor and trigger specific responses. papers on animal or in vitro models showed the effects of very diluted and potentized on human basophils, chicken embryos, rat duodenum, mouse blood, etc. hormetic effect were reviewed : stimulus or molecule different doses trigger opposite effects on the same receiver system. as paolo bellavite clearly showed as a system 's (cells, organs and organisms) starting conditions can be crucial to treatment results and as some drug effects can be paradoxical, thus supporting the possible use of similia principle as curative efficient approach (3). at the end of the conference the speaker expounded coherence of homeopatic medicine towards the dynamic complexity of diseases. homeodynamic conditions make possible the organized complexity of life and a pharmacological complex information mimicking disease via high homeopathic dilutions are reported to be effective both in humans and animal / in vitro models. methodological problems in clinical trials can be overcome drawing up a specific approach to clinical homeopathic research with a large approved consensus. | verona 's school of homeopathic medicine (www.omeopatia.org) organized a day of full immersion in the field of homeopathy, focusing on the validity of this much - debated discipline. there is widespread consensus in the medical community that evidence - based medicine is the best standard for assessing efficacy and safety of healthcare practices, and systematic reviews with strict protocols are essential to establish proof for various therapies. students, homeopathic practitioners, academic and business representatives, who are interested in or curious about homeopathic practices attended the conference. |
we have introduced and reported a potential novel clinical indicator for keratoconus (kcn) cornea instability assessment based on consistent, increased overall corneal epithelial thickness. as in our previous report, most epithelial measurements have been performed in vivo, by high - frequency scanning ultrasound biomicroscopy (hf - ubm). we report herein similar data using anterior segment optical coherence tomography (as - oct). we present the case of a 25-year - old male subject, diagnosed with topographic and topometric asymmetrically manifested kcn among his two eyes. 170. corrected distance visual acuity with this prescription was 20/20 +. the left eye (os), the more symptomatic one, had an uncorrected distance visual acuity of 20/80 and a manifest refraction 7.00 3.50 the kcn diagnosis was further confirmed by corneal tomography imaging, obtained by wavelight oculyzer ii (alcon surgical, ft., usa) which is a pentacam hr (high - resolution) scheimpflug imaging camera [2[ga1 ] ]. four consecutive corneal scans in each eye were obtained by as - oct rtvue-100 (optovue inc., examples of od and os epithelial pachymetry maps (6 mm diameter) are provided in fig. repeatability, which can be assessed by the standard deviation of the central epithelium of the 4 scans, was 0.60 and 1.50 m in od and os, respectively. 2a, od had a central epithelial thickness (epi ct) of 52.23 0.60 m. overall epithelial thickness (epi average) was computed by taking the average of the 17 segment thickness points shown in fig. 1c, d. the values displayed in each of the 17 segments are the average of the epithelial thickness measurements within each segment. od had an epi average of 51.97 0.70 m. os had an epi ct of 56.75 1.50 m and an epi average of 55.65 1.22 m. the epithelial topographic thickness variability (epi variability, fig. our results show that on average, the epi variability was 1.53 0.21 m for the less affected od, while it was 9.80 0.41 m for the more affected os. hf - ubm has known intrinsic examiner operative challenges (both for capture and interpretation), and although available for over a decade, it has seen very little clinical use and mainstream practice acceptance. clinical availability of corneal epithelial mapping by as - oct is currently in practice, and introduces a simple and effective clinical tool for corneal epithelial mapping. the data are very easily captured and epithelial thickness parameters are automatically calculated by a novel software algorithm and presented in topographic imaging [3, 4 ]. this case illustrates a vivid agreement with previous findings by kanellopoulos. that an overall thicker epithelium with large variations can be observed in the topographically evident kcn eye, and to a much lesser degree in the less affected eye. qualitatively, the defining feature of the epithelium in kcn is the pattern, such that there is a thin epithelium over the cone surrounded by a thicker epithelium as can be seen in fig. 1d. quantitatively, epithelial thickness variations can be expressed as the topographic thickness variability and are computed by the standard deviation of the 17 segment thickness points. specifically, in our case, it was 9.80 m in the affected kcn eye and 1.53 m in the less affected eye. in fig. 2b, the graph compares the corresponding values of epithelial thickness from the hf - ubm study and the case described herein. this case not only confirms our findings regarding the increased overall epithelial thickness in ectatic eyes, but also that the new as - oct feature of epithelial imaging may illustrate these differences in a more pronounced way, as indicated by the data shown in fig. the ease of use of as - oct epithelial imaging in comparison to hf - ubm as well as the increased predictability that may be offered by as - oct epithelial imaging may hold promise for wider clinical application, such as the screening of young adults for early kcn and, in a much wider perspective, potential candidates for laser cornea refractive surgery. | purposeto evaluate safety, efficacy and ease of measurement of epithelial thickness in a keratoconic patient based on anterior segment optical coherence tomography (as - oct).methodsa 25-year - old male patient, previously diagnosed with keratoconus, with highly asymmetric manifestation among the two eyes, was subjected to as - oct corneal epithelial imaging. we investigated epithelial thickness and epithelial topographic thickness distribution.resultsmean epithelial thickness was 51.97 0.70 for the less affected right eye (od), and 55.65 1.22 for the more affected left eye (os). topographic epithelial thickness variability for the od was 1.53 0.21 m, while for the os it was 9.80 0.41 m.conclusionsthis case further supports our previous findings with high - frequency ultrasound measurements of the increase in overall epithelial thickness in keratoconic eyes in comparison with normal eyes. as - oct further offers ease of use and possibly higher predictability of measurement. this case report, based on as - oct imaging, verifies increased overall epithelial thickness in keratoconic eyes, as introduced by a previous study [kanellopoulos. : clin ophthalmol 2012;6:789800 ], based on high - frequency scanning ultrasound biomicroscopy imaging. |
innovations in research, diagnosis and therapeutics stimulated interest in this young branch of medicine. in 1805, cuvier defined the medulla and cortex of the adrenal gland. a few years late, alibert described acromegaly (1822), while rathke described the formation of the pituitary gland (1838). in 1860 prevost and dumas described ovulation, and in 1827, von baer discovered the human ovum. berthold, in 1849, conducted elegant experiments on testicular transplants in birds, and brown- sequard tried organotherapy, using testicular extracts on himself. in such a rapidly evolving, exciting period of scientific discovery, the parathyroids took back seat. the choice of their name itself was unfortunate, as they were considered thyroid appendages, and were not given their due physiological significance too easily. in 1852, the parathyroids were described in the rhinoceros by sir richard owen in london. he noted a small compact yellow, glandular body, attached to thyroid, in an indian rhinoceros cadaver, preserved in london. virchow described the human parathyroids in 1963, but credit for the first complete description goes to the swedish doctor sandstroem, in 1980. he identified two parathyroid bodies in 43 out of 50 autopsies. in 1890, anton woelfler described areas of young tissue or foetal rests which might have been intrathyroid, as parathyroid glands. though the anatomy of the parathyroids had been reasonably well described, their physiology was not understood until much later. eugene gley studied the parathyroid glands (he thought there were two in each animal) in rabbits, and performed parathyroidectomy, without causing death (1891). he thought that the parathyroids were potential thyroid tissue, as they grew hypertropic after thyroidectomy. they demonstrated the occurrence of tetany and myxedema after parathyroid and thyroid removal, in 1895 and 1986, respectively. at the same time, walter edmunds proved that the parathyroids did not convert to thyroid tissue after thyroidectomy. a few years later, kohn was able to establish that the parathyroids were anatomically independent from the thyroid. later workers showed fatal tetany after complete removal of all parathyroid tissue, proving that the glands are essential for life, in the first decade of the twentieth century. in spite of this research, however, scientists such as noel paton and findlay continued to assert that the function of the parathyroid was to detoxify guanidine (1917). though the study of anatomy and physiology of the parathyroids proceeded slowly, clinical medicine had recognized the symptoms of parathyroid disease quite early. tetany in the pediatric age group was described by john charke in 1815, and carpopedal spasm and glottis spasm by george kellie in 1816. trousseau 's sign was described in 1862, erb 's sign in 1873, and chvostek 's sign in 1876. though organotherapy had been in vogue as far as testicular and thyroid extracts were concerned, for quite some time, the first account of parathyroid hormone replacement was given in 1898. g. moussu injected on aqueous extract of 12- 20 equine glands and successfully treated post- parathyroidectomy tetany in canine models. in 1909, berkeley and beebe described correction of hypo- calcemic tetany, with parathyroid extract, in man. in the same year, mac callum and vogetlin demonstrated a much simpler method of managing tetany with intravenous calcium chloride. while experimental parathyroidectomies had been carried out by early researchers in the ninetieth century, the first parathyroid transplant was attempted by ws halsted in 1909, in baltimore. he transplanted canine parathyroids into thyroid tissue and under the abnormal skin, trying both iso- and auto- transplantation. mandl was the first surgeon to include the small parathyroid glands in the ambit of endocrine surgery. he successfully treated a case of osteitis fibrosa by surgical removal of a parathyroid adenoma in 1925. the first report of isolation of an effective parathyroid extract is by hanson, who reported his work in cattle in 1923. parathromone was discovered by collip in 1925, and used to treat tetany successfully, by leitch and him, in the same year. it is surprising that collip is remembered more for his role in the discovery of insulin (though the nobel prize committee did not feel him worthy of the prize), than for his role in the discovery of parathyroid hormone, an equally important feat. the parathyroid hormone was isolated and purified by ramussen and craig in 1959, and its polypeptide structure defined by them in 1962. greenwald identified its phosphaturic action in 1911, while barnicot noted its resorptive effect on bone in 1948. the anti calciuric and anti magnesiuric action were described by jahan and pitts in the same year. another ten years passed before talage and elliott observed an increase in calcium absorption form the small intense parathormone. it has taken many years for scientists to understand the actual relationship between vitamin d and parathormone. in 1962, a new hormone, calcitonin, was discovered, and was initially thought to be secreted from the parathyroid gland. von recklinghausen gave a complete description of the disease in 1891. in 1904, askanasy discovered a parathyroid adenoma while performing a post- mortem on a patient with skeletal disease, and postulated a connection between parathyroid tumour and osteitis fibrosa cystic. in 1907, erdheim described hyperplasia of the parathyroids in osteomalacia in humans, while in 1914 ; he found the same finding in rachitic rats. the pathophysiology of the parathyroids was put in perspective by greep ro, in 1963, who studied the comparative endocrinology of the glands. he suggested that as amphibians migrated from calcium- rich marine environment to calcium- poor terrestrial surroundings, and the need for a calcium homeostasis mechanism occurred. the endocrinology of the parathyroids has grown slowly over the nineteenth and early twentieth centuries. advances in anatomy, physiology, medicine, surgery and biochemistry have contributed to effective modalities of diagnosis and treatment which are in use today. this brief article pays homage to the pioneers of our specialty, while offering tribute to their acumen and perseverance. | the parathyroid glands are now recognized as being essential for life. their structure and function is well delineated, and their disease and dysfunction, well characterized. diagnosis and management of parathyroid disease has improved in the past few decades. the path of parathyroid science, however, has been far from smooth. this paper describes the early history of parathyroid endocrinology. in doing so, it focuses on major events and discoveries, which improved the understanding and practice of our specialty. contribution in anatomy, physiology, pathology, medicine, surgery and biochemistry are reviewed. |
angiosarcoma (as) is an uncommon malignant neoplasm characterized by rapidly proliferating, extensively infiltrating anaplastic cells derived from blood vessels and lining irregular blood - filled spaces. as of the mediastinum. we present a case of as of mediastinum that was managed with recombinant activated factor vii (rfviia) during postoperative period. a 41 years old male presented with chief complaint of gradual onset breathlessness on exertion new york heart association (nyha) ii and pain in right lower chest. there was no history of haemoptysis, orthopnea or paroxysmal nocturnal dyspnea. pain in chest was dull in nature, non - radiating and relieved by taking medication. there was no history of hypertension, diabetes mellitus or any other prolonged illness. routine blood investigations including complete blood count (cbc), renal and liver function tests were within normal limits. his coagulation profile including platelet count, prothrombin and activated partial thromboplastin time were also within normal limits. chest radiograph revealed bilateral pleural effusion that was later confirmed by ultrasonography of the chest. echocardiography revealed localized pericardial effusion adjacent to right atrium (ra) with multiple echodense nodular masses seen within pericardial cavity with constriction pathology. there was mild dilation of ra with no regional wall motion abnormality (rwma). computerized tomography (ct) scan thorax revealed large eccentric sarcomatous mass lesion, aneurysmal dilatation of ra and bilateral pleural effusion. fine needle aspiration cytology (fnac) and pleural cytology revealed no active malignant or inflammatory cells. a provisional diagnosis of anterior mediastinal tumor was made and exploratory biopsy via midsternotomy was planned to confirm the diagnosis and informed consent was obtained for the same. patient was premedicated with lorazepam 2 mg and pantoprazole 40 mg a night before the surgery. on arrival in the operating room, pulse oximetry revealed oxygen saturation of 96% on air. after securing venous access, anaesthesia was induced with sodium thiopentone (3 mg / kg) and fentanyl citrate (5 mcg / kg). vecuronium bromide (0.15 mg / kg) was administered intravenously to facilitate tracheal intubation. anaesthesia was maintained with intermittent doses of fentanyl citrate (1 mcg / kg), vecuronium bromide (0.02 mg / kg), and isoflurane in 50% oxygen in air. intraoperative monitoring included ekg with st segment analysis, oxygen saturation, end tidal co2, temperature and urine output, direct arterial blood pressure, central venous pressures, cardiac output and derived parameters, arterial blood gas analysis, and activated coagulation time (act). transesophageal echocardiography (tee) revealed large cavity around ra with communication with it and there was homogenous opacity inside the cavity. heparin sulphate 4 mg / kg was administered to maintain act more than 450 seconds before initiating cardiopulmonary bypass (cpb). a large necrotic vascular mass was seen in the anterior pericardium with invasion of ra and right ventricle. during dissection of the mass a rent in ra occurred which was repaired with bovine pericardial patch. weaning from cpb was uneventful. a total of three units of packed red blood cells (prbc) and four units of platelet concentrates (pc) and fresh frozen plasma (ffp) were transfused intraoperatively. tranexamic acid 10 mg / kg as bolus and 1 mg / kg / hr infusion was also started. patient was shifted to the postoperative recovery room for mechanical ventilation and monitoring of haemodynamics and bleeding from chest drains. in the recovery room patient was haemodynamically stable however constant bleeding was there from the mediastinum. he was planned for sternal closure on the second postoperative day after stabilisation of bleeding. however, during reopening significant oozing was still there from the surgical sites. mediastinum was again packed with only skin closure and patient was shifted to the recovery room. histopathology of the mediastinal sample gave impression of angiosracoma with microscopic findings of highly vascular mitotically active spindle cell neoplasm composed of freely anastomosing vascular channels lined up by atypical cells. he was haemodynamically stable in the postoperative period. however, constant bleeding from the chest drain was still there at 150 - 200 ml per day for next three days. therefore, he was planned for removal of pack and secondary closure of the chest. during secondary closure, significant bleeding was still there from the raw surgical surface that was not controlled even by adequate haemostasis and electrocautry. a total of nine packed red blood cells, four units of fresh frozen plasma and four units of platelet concentrate and apheresis were transfused in the recovery room. keeping in view of the intractable bleeding, massive transfusion and second reopening it was decided to administer rfviia (novoseven, novo nordisk india ltd) in the doses of 90 mcg / kg to this patient. after administering recombinant factor seven secondary closure of the chest was done and patient was shifted to the recovery room. after stabilization and discharge from the hospital patient was referred to oncology unit for further management and he is on a regular follow up for radiation therapy. primary angiosarcomas of the anterior mediastinum are rare tumors that need to be considered in the differential diagnosis of primary anterior mediastinal neoplasms. despite their histologic similarity to angiosarcomas at other sites, primary angiosarcomas of the anterior mediastinum appear to follow a more protracted clinical course than their counterparts in other organ systems. these tumors have a high local recurrence rate and metastasis because of their intrinsic biologic properties and because they are often misdiagnosed, leading to a poor prognosis and a high mortality rate. malignant vascular tumors are clinically aggressive, difficult to treat, and have a reported 5-year survival rate of around 20%. primary heart tumours are extremely rare in clinical practice, occurring at a frequency of 0.11 - 0.30% in surgical series and only 25% of them are malignant. as (75%) is the most common primary cardiac malignant tumor and is an extremely rare, rapidly spreading vascular tumor. it is seen more commonly in males than in females, usually presenting between the third and fifth decade of life. clinical presentation is usually unspecific and can vary depending on the dimension and the site of the tumour. increasing dyspnoea, peripheral oedema, superior venacava syndrome, lung oedema, arrythmia, weakness, syncope and dizziness are the most common symptoms. potentially mortal complications are represented by pericardial effusion and thromboembolic events. as are commonly located in the ra with a high incidence of pericardial involvement. this predilection of the tumor affecting the right heart often produces right - sided congestive heart failure, superior vena cava obstruction and pericardial effusion. in this case ; the tumor was found arising from the ra presenting with pericardial effusion and symptoms of right heart failure. imaging studies like chest radiograph, computerized tomography (ct) and magnetic resonance imaging (mri) can reveal the extent and severity of tumor preoperatively. standard treatment includes extensive surgical resection followed by radio and chemotherapy to improve the survival as done in this case. perioperative management of these case warrant special care due to the presence of huge areas of necrosis and extensive loco - regional spread. anaesthetic considerations in patients with tumor involving ra include hypoxemia, low cardiac output, possible right to left shunt, and potential pulmonary emboli. optimal anaesthetic management depends on the judicious administration of anaesthetics, avoidance of cardiac depression and maintenance of preload. invasive haemodynamic monitoring and good venous access for rapid transfusion is necessary in these cases. the primary problem in this case was refractory bleeding which was controlled even by reopening and adequate haemostasis. rfviia (eptacog alpha activated) was introduced to clinical medicine in the 1980s as a prohemostatic agent. it is thought to act locally at the site of tissue injury and vascular wall disruption, by binding to exposed tissue factor and generating small amounts of thrombin that are sufficient to activate platelets. the activated platelet surface can then form a template on which rfviia can directly or indirectly mediate further activation of coagulation, resulting in the generation of much more thrombin and, ultimately, fibrinogen to fibrin conversion. clot formation is stabilized by inhibition of fibrinolysis, due to factor viia - mediated activation of thrombin - activatable fibrinolysis inhibitor. various authors have used rfviia safely as a rescue for refractory bleeding after cardiac surgery and found that it is associated with reduced blood loss, rapid improvement of coagulation variables, and decreased need for blood products. some authors reported use of rfviia in the setting of pulmonary haemorrhage secondary to chemotherapy for choriocarcinoma thereby preventing rapid deterioration in clinical condition and allowed salvage therapy. it has also been used as rescue in bleeding associated with obstetrics, hepatic resection, trauma, intracerebral bleed and even dental extractions apart from coagulation disorders. however, therapy with rfviia may lead to thromboembolic complications (10%) and the patient may not respond. a meta - analysis showed that, in 73% of patients, rfviia achieved a reduction of bleeding and the probability of survival increased. however, data from 35 randomized controlled trials suggested that rate of arterial thromboembolic events is higher in patients who received rfviia than among those who received placebo (5.5% vs 3.2%, p=0.003). in the present case we have found significant reduction in bleeding after administering rfviia and secondary closure of the chest was possible., rfviia may be used as a rescue therapy in patients with malignant vascular tumors in the setting of intractable bleeding following surgical resection. | sarcomatous lesions of the mediastinum usually present as aggressive and multicentre masses often attached to adjoining structures including heart and lungs. a forty one year male diagnosed with sarcomatous lesion in mediastinum presented for biopsy through midsternotomy later confirmed as angiosarcoma on histopathology. patient bled excessively after surgery and required reopening of the chest. however, bleeding could not be controlled with reopening, blood products and packing of the mediastinal cavity. bleeding could only be controlled by using recombinant activated factor vii as rescue therapy without any adverse effects. |
the behavioral, cognitive, and neurosciences (hereafter : the bcn - sciences) are gradually beginning to reveal the mechanisms that make us who we are. the success of this enterprise has led some to worry that these sciences will undermine the notion of free will and the idea that people are responsible for what they do [e.g. 13 ]. the feared challenge of the bcn - sciences is often seen as a denial of the idea that persons are able to act differently than they in fact do. however, many philosophers have abandoned the idea that the ability to do otherwise is relevant to free will and responsibility long ago and they tend to dismiss the challenge as directed at an outdated view [e.g. 4, 5].1 according to a strong and influential current in philosophy, it is rather the ability to act for reasons that is crucial to our everyday practices of personal responsibility one important reason to favor the new compatibilist account of responsibility over accounts in terms of the ability to do otherwise is that it seems so obvious that we act for reasons, whereas it is unclear and highly controversial what kind of ability the ability to do otherwise would be (especially if our behavior turns out to be determined by genes and environment). because such determinism seems not to preclude us from acting for reasons, research that merely seems to strengthen determinism is perceived as irrelevant by these compatibilists. ironically, as we shall show, the ability to act for reasons is central to a great deal of interesting research in the bcn - sciences. this research indicates, as we shall argue, that it is not as obvious as it seems that the ability to act for reasons can serve as an unproblematic basis to justify our daily practices of responsibility. this does not imply, of course, that this research shows that we do not act for reasons, but it does pose a challenge to new compatibilist philosophers, as we shall explain.2 this challenge deserves full philosophical attention. we would like to invite those who think that the bcn - findings challenge our views of free will and personal responsibility to explicitly address the new compatibilist view, and we aim to convince the new compatibilist that the results from the bcn - sciences provide an interesting challenge to what we believe to be the core strength of their position. in the classical problem, two crucial turns we present a short en sketchy introduction to the view we call new compatibilism. these sections are not meant as a review of the state of the art of the contemporary free will debate, but as an introduction to one influential and attractive family of positions in this debate, namely the positions we collect under the heading new compatibilism. in the classical problem we introduce the idea of free will as the ability to do otherwise and the debate about the compatibility of this notion with the thesis of determinism. in we describe two important contributions to the discussion that shifted attention away from the ability to do otherwise and determinism. peter strawson moved the focus of the debate to our everyday practices of holding ourselves and each other responsible for what we do. free will does not refer to alternative possibilities, but to something we did willingly. in new compatibilism we describe the new compatibilist view and explain why it is so attractive. in bcn findings we summarize some relevant bcn - findings. in new problems we explain how these findings pose a challenge to new compatibilist philosophers. in the problem of free will is one of the oldest and most frequently discussed in philosophy. it is traditionally framed as the problem of how to reconcile freedom and determinism. this difficulty arises out of the tension between our view of ourselves as persons who can be held responsible for what they do, and the scientific view that depicts our actions as the combined result of genes and environment. the traditional view is that humans are responsible for what they do to the extent that they have the freedom to do otherwise. determinism poses a threat to personal responsibility because, if true, it is not clear how it could ever be possible that someone could ever do otherwise. classical compatibilists (beginning with thomas hobbes in the 17th century) argued that determinism does not exclude human freedom by interpreting the principle of alternative possibilities in a conditional way. according to them being able to do otherwise means that one would have done otherwise if one had willed or chosen to do otherwise. incompatibilists such as thomas reid (18th century) have objected that, while this interpretation might perhaps salvage human freedom, it does not restore personal responsibility. suppose, for example that, unbeknown to me, some gum that i chewed contained nicotine, and that the taste of nicotine triggered my former addiction. most people would agree that, in this situation, i am less responsible for taking the cigarette on the table in front of me than i would have been had i not chewed the gum. however, in either scenario i willed or chose to take the cigarette and would not have taken the cigarette if i had willed or chosen otherwise. the argument, of course, is that my will has been seriously tampered with. so, according to traditional incompatibilists one can not be blamed for doing what one chooses to do if the choice is not free. hence, personal responsibility can be salvaged only if one could have chosen otherwise and this possibility does not exists in a deterministic world. incompatibilists come into two kinds : libertarians who hold that incompatibilist free will exists and that determinism is untrue and hard determinist who hold the opposite view. in some senses, the bcn - sciences aggravate the problem of determinism. as long as we did not know the workings of the brain however, as the brain sciences advance and we learn more and more about our brains, the lack of any scientific basis for incompatibilist free will strengthens the idea that this kind of free will does not exist.3 given the emphasis on the determinism issue in the discussion about the bcn - sciences, it is easy for compatibilist philosophers (which has been the dominant view in philosophy for many centuries) to maintain that those sciences do not pose a threat to free will. if free will and determinism are compatible, the alleged support of determinism by the results of the bcn - sciences can not pose a threat to free will. moreover, in the eyes of many compatibilists, libertarianism had already been dismissed on philosophical grounds, so why bother about a threat to this outdated view?4 as we argue below, this response ignores the specific character of the new compatibilist answer to the incompatibilist challenge. the new compatibilist approach is based on the idea that personal responsibility is grounded not in our assumed ability to choose otherwise, but in our ability to decide and act on the basis of reasons. in the example of the gum chewing smoker the new compatibilist would point out that the unknown presence of nicotine in the gum prevented the smoker from deciding on the basis of the relevant reasons. in this view it is the impossibility to take an influence (the presence of nicotine) into account that lessens responsibility, not the diminished ability not to take the cigarette (whatever that would be). ironically, it is our ability to act for reasons in relation to all the factors that influence us (including those we are not aware of) rather than our ability to do otherwise on which the bcn - sciences focus. in order to explain new compatibilism and the challenges posed by the bcn - sciences we first need to discuss two landmark insights that explain how compatibilist came to see the ability to do otherwise as irrelevant to free will and personal responsibility. nowadays many compatibilists propose to sidestep the whole issue of the compatibility of the freedom to do otherwise with the thesis of determinism. they focus on a concept of personal responsibility that does not require such a freedom. a first landmark in the development of this idea is peter strawson s seminal freedom and resentment. strawson pointed out that our interpersonal relations are inextricably intertwined with spontaneous reactive attitudes such as gratitude and resentment, attitudes that constitute the practice of holding ourselves and each other responsible for what we do. in strawson s view the abolition of this practice is impossible and undesirable because it constitutes the natural human way of relating to each other. strawson observes that our natural tendency to react to wrongdoing with sentiments such as guilt, resentment, blame, and moral indignation is lessened only when we discover that the wrongdoer did not mean harm (excuses) or that she was not a full - blown adult human being at the moment of her action (exemptions). in the latter case, we switch to what strawson calls the objective attitude towards this person, no longer regarding her as a human equal but as someone to be treated or manipulated or otherwise prevented to act wrongly. on the basis of this observation, strawson argued that the thesis of determinism would threaten our everyday practices of moral responsibility only when it could be understood as implying no one ever meant any harm or that everyone should be regarded from the objective attitude. this, according to him, is an absurd suggestion. hence, the thesis of determinism is irrelevant to our views of moral responsibility.5 strawson s arguments have influenced many contemporary positions6 and also inspired many objections.7 relevant to our purposes is that his essay changed the way in which philosophers discuss personal responsibility. in the wake of strawson s essay our every day practices of responsibility, the distinctions we make in those practices, the conditions in which we excuse and exempt wrongdoers, and the reasons we give for our moves in those practices became the central focus of the debate. contemporary philosophical accounts of responsibility aim to capture, understand, and evaluate the conditions for responsibility and the excusing and exempting conditions that we accept in everyday life. doing something of our own free will, we do not refer to indeterminist intuitions of any kind. for example, if i witness a crime and do not warn the police out of disinterest, the fact that i could not have warned them because unknown to me my phone has been disconnected, seems irrelevant to my responsibility for not warning the police. how exactly to define what it means to do something willingly is, even today, subject to controversy. for our purposes, it is sufficient to understand it as in some relevant sense authorized by the self / person ; as something we agree with, accept, or central to frankfurt s hierarchical view is the idea that, as human beings we are not only directed at the world by desiring certain things (e.g. chocolate, a career, to stay dry when it rains), but are also directed at the desires that move us into action. hence, we might prefer not to have the desire for chocolate, but we might be glad for and embrace our desire to work. free will. i act of my own free will when the desires that move me into action are the desires i authorize ; i typically lack free will when the desires that move me into action are desires i resist, feel alienated from, and do not identify with. frankfurt s work opened up a new way of understanding free will without the need to meet the challenge posed by determinism and/or the conceptual problems attached to indeterminism. frankfurt also offered an attractive explanation for the widespread and, in his eyes, mistaken idea that libertarian free will matters to our everyday practices of responsibility. he pointed out that we sometimes seem to excuse people for wrongdoing because they could not have done otherwise, for example, when someone hurts us because she is pushed into us by another or by the abrupt movement of the train we are both on. however, frankfurt points out that the reason that we accept this as an excuse is that we believe that the person would have done otherwise if she could have done otherwise. in other words, we believe that if she were not pushed, she would have avoided hurting us. according to frankfurt, it is misleading to say that we excuse her because she lacks alternatives ; we excuse her because she hurts us it is not the lack of alternatives but the fact that we assume that, if she were not pushed, she would not have hurt us. frankfurt s criticism of the idea that responsibility is grounded in the ability to do otherwise is one of the defining landmarks in contemporary discussions on free will and responsibility. it needs to be addressed by everyone who defends or argues against a libertarian account of free will. however, it is not easy to formulate adequate conditions for personal responsibility based on frankfurt s hierarchical view. whereas the fact that someone wholeheartedly identifies with a certain action might be sufficient to hold her personally responsible for it even if alternate possibilities were absent (we will come back to this below), there is little reason to excuse someone for moral wrongdoings only because she did not wholeheartedly identify with them e.g. if someone steals my wallet, her reluctance to do so (because she knows that i need the money) does not in itself seem to lessen her personal responsibility. many contemporary compatibilists looking for a justification of our common practices of responsibility have turned to a concept that we, for the purposes of this paper, will label reasons - responsiveness [e.g. 911].8 this is the approach that we call new compatibilism. it is currently one of the most important and influential views in philosophy. according to new compatibilism the ultimate justification of our practices of responsibility lies in our ability to act for reasons. roughly, the idea is that we are responsible for what we do because we are the kind of beings that can figure out what to do and respond correspondingly. sane human beings who are able to distinguish good from bad and are able to adjust our behavior in the light of it. what capacities exactly make up our ability to act for reasons is a controversial matter. however, it is not controversial that in the case of human beings we can make a distinction between, on the one hand, actions done for reasons (stopping your car because others have right of way), and, on the other hand, bodily movements that are mere reactions to internal and external causes (tripping on the carpet). new compatibilism claims that we can understand and justify our everyday practices of responsibility on the basis of this distinction without further appeal to an assumed ability to do otherwise. unlike frankfurt, new compatibilists do not believe that our personal responsibility can be grounded purely on a person s attitude towards the desires she acts upon. new compatibilists argue that in our practices of responsibility, in order to be held responsible, it does not suffice that an agent did something because she freely willed it ; she should also be a sane and morally competent being (at the time of her action and with regard to it). that is, she should not only act on the basis of considerations that she accepts as reasons, but these considerations should also be real reasons. for example, if someone murders her neighbor because she understands this neighbor to, literally, be the devil ; this person might be free in the sense that the murder was one she wholeheartedly embraced as the necessary and required thing to do at that moment, yet she can not be held personally responsible for it because she does not qualify as a sane and morally competent being.9 much more can be said about the notion of reasons - responsiveness and the conditions for responsibility based on this idea. however, for our purposes, it suffices to point out that, what is central and common to these views is the idea that some people clearly are reasons - responsive in that they act for reasons they can explain and justify, whereas others are not, either temporarily (e.g. when acting under conditions of extreme personal distress) or more permanently (e.g., when suffering from a mental illness that affects their moral competence). this, we believe, is the strength and attraction of the new compatibilist view. contrary to views that connect personal responsibility with the ability to do otherwise, new compatibilism does not need to assume the existence of a metaphysical obscure counterfactual freedom, i.e. that we could have done otherwise than we actually did. they just point out that we are the kind of beings who regularly act for reasons and that it is our ability to do so that determines our status as responsible agents. we often manage to observe traffic regulations (e.g. to stop for the reason that another has right of way), play difficult games such as chess, and know exactly how and when to be polite, to give a few examples. within that picture, we are excused if, and only if, our ability to act for reasons was imposed upon (e.g. because we were pushed or constrained) or undermined (e.g. because we were under hypnosis or suffering from a mental disease). in this way, new compatibilism can have its cake and eat it too. it enables us to do full justice to the everyday moral distinctions that we make without getting into metaphysical trouble, or so it seems. before we explain how the bcn - sciences challenge new compatibilist accounts of responsibility, let us first turn to the bcn literature that deals with our ability to act for reasons. according to this literature the reasons we give for our behaviors do not tell us about the inner deliberations that motivated our actions, but rather explain and justify these behaviors in a post - hoc manner, confabulating reasons if needed and rationalizing our behavior if that suits. in the next section our point will not be that the bcn - sciences indicate that we are not reasons - responsive, but rather that in the light of the bcn - findings the concept of reasons - responsiveness turns out to be not as clear and free of metaphysics as it seems. confabulation was discovered by michael s. gazzaniga in the early seventies when he experimented with patients whose corpus callosum (the only direct nerve connection between the two hemispheres of the brain) has been severed. split - brain patients (as these patients are known) can not describe pictures presented to only the left part of the visual field. this is because the information from the left visual field is routed to the right hemisphere and hence, is not available to the speech center in the left hemisphere if the brain is split. however, these patients are able to pick up with their left hand, a card related to a picture in the left visual field. in one experiment, gazzaniga showed a boy two pictures at the same time, one in the left and one in the right visual field, each visible to a different hemisphere. the right hemisphere saw a snow scene, the left hemisphere a chicken claw. when asked to pick up cards related to what he saw, the boy picked up a picture of a shovel with his left hand and a picture of a chicken with his right. he explained this by saying that he picked the chicken because he saw a claw ; and the shovel because you have to clean the chicken shed with a shovel. he had no idea that he was making up plausible reasons to explain his behavior, caused by factors of which he was not aware. gazzaniga has argued that this tendency to confabulate reasons is not an aberration of split - brain patients, but a process that occurs often when people are not aware of the causes of their actions. in their discussion of our ability to introspect about our higher cognitive processes, nisbett and wilson go a step further than gazzaniga. not only do they suggest we easily confabulate reasons when we do not know the causes of our actions, but that we also lack introspective insight into those causes. instead, causes are inferred based on a priori causal theories originating from experience and the social environment. these theories tell us the possible causes of certain actions. when asked to explain an action, we determine which of the possible causes were present at the time of the action and causes that escaped our attention, causes that are not easily remembered, and causes that are not within our known range of possible causes will never be cited. wegner takes this one step further, arguing that even the feeling of having acted is the result of the application of certain general principles of causal inference, rather than direct experience. we infer that we initiated a certain action in the same way as we infer that the movement of one billiard ball caused the movement of another. more specifically, people experience themselves as the originator of a certain event when they have a conscious thought corresponding to that event just prior to it and when they do not observe an alternative cause for that event. to support this theory, i spy study a participant and a confederate together moved a computer mouse to guide a cursor on a screen with many small pictures. unknown to the participant, the confederate forced the cursor to stop at a certain picture. it turned out that, when the experimenter induced thoughts about the relevant picture either 1 or 5 s before the movement was halted, the participants reported feeling that they intentionally stopped the cursor at that picture. when the thoughts were induced 30 s before the movement was halted or one second after it, they said that they merely allowed the other to stop the cursor. in another experiment, the experimenters asked participants, allegedly as part of a study of psychological influences on health, to perform a voodoo curse upon another person, in the presence of that person. the other person was a confederate who, at the end of the experiment, pretended to have a headache. participants that were led to have negative thoughts about the confederate (for example, because he behaved badly) attributed the headache much more frequently to the curse than participants in whom no such thoughts were induced. what this research shows is that we do not have access to the inner processes that connect the causes of our actions with the actions. when asked for reasons, we interpret our behavior with the help of a priori theories. of course, it does not follow from this that we do not act for reasons, nor that conscious thoughts do not influence our actions. nisbett and wilson emphasized that a priori theories usually give quite reliable estimates about the real causes of our actions. wegner admits that the application of principles of causal inference usually lead to correct identification of the originator of an action.10 why should we bother about the mistakes people tend to make in ingeniously constructed, highly unusual, experimental conditions ? it is not the fact that people make mistakes that challenges new compatibilism, but rather the new picture of the process of giving reasons that is supported by these mistakes. the mistakes indicate that the process of providing reasons is quite different from what it seems and only loosely connected to the processes that generate the actions. initially one might think that when we give reasons we recollect the motives that drove our actions. the fact that people can make real errors in reporting reasons (errors that are neither the result from conscious or unconscious distortion of what they perceived, nor of an unwillingness to perceive their motives) shows that we have no direct access to our motives and, hence, that we do not recollect our motives when asked for reasons, but infer them on the basis of the information we do have. as in any experiment, the assumption is that the processes operating in the experimental conditions are the same as in the normal conditions. just like the mistakes we discussed above, many optical illusions occur only in unusual and artificial conditions (when looking at drawings, movies or rooms that are especially designed to elicit the illusion), but this does not prevent them from providing insight in the manner in which we normally process visual input. in the same way the reasons brought up in experimental conditions and the mistakes people make in such situations provide insight in the way in which the process of giving reasons normally operate. another line of research however, does seem to lead to the conclusion that reasoning does not influence our moral judgments. this line of research originates in work emphasizing the role of intuitions and emotions in human decision - making and in work that suggests that most of our everyday life is determined by automatic processes triggered by our social environment and operating without conscious awareness or guidance. in an exciting and controversial article, the moral psychologist jonathan haidt combined these insights and applied them to moral thinking to argue for what he called the social intuitionist model of moral judgment. according to this model, our moral judgments are not caused by moral reasoning, but rather are the result of intuitions : more or less instantaneous feelings of approval or disapproval that pop up in our minds and are generated by rapid unconscious processes. moral reasoning is, in this view, just a post hoc attempt to justify these feelings and influence other people. later research indicates that this model needs important qualifications,11 but the important point for our purposes is the suggestion that, overall, moral deliberation might be post - hoc. finally, there is a line of research known as situationist psychology that indicates that our moral judgments are influenced by many irrelevant factors (e.g. being in a hurry),12 some of which might even escape our attention (e.g. in cases where we are good samaritan experiment by darley and batson, people s willingness to help a stranger in distress varied in accordance with the degree to which they believed themselves to be in a hurry. this, in itself, might not sound so shocking in an age where time is precious and helping strangers is not always without danger, however ; the experiment was performed more than three decades ago with students in training for a helping profession (students of a theological seminary). late for a video recording of a sermon about the biblical story of the good samaritan as part of their training [32, 33 ]. surely, one would expect people training for a helping profession to be sensitive to the needs of someone in distress, regardless of being in a hurry. more recently, wheatley and haidt hypnotically primed people to react with disgust to an arbitrary word and asked them to assess the severity of certain moral transgressions. they found that the participants were harsher in their judgment when the description contained the primed words. schnall. discovered that such things as the cleanliness of the table or the presence of certain odors could influence the severity of moral judgments. to sum up these findings, bcn - research suggests that providing reasons for our behavior is an interesting and complicated process that is better described as interpreting our behavior than recalling what moved us. this process is guided by a priori theories that inform us of plausible causes for our actions. many factors that influence our behavior escape our attention and we are inclined to fill in the gaps in our knowledge with fabrications that are experienced as real. this process is tailored to justify our behavior and convince others, rather than to providing the truth about the motives of our actions. in the next section, as we discussed in new compatibilism among the main attractions of new compatibilism are its foundation in the seemingly obvious fact that we act for reasons, as is evidenced by the efficacy of our daily practice of giving and asking for reasons, and the idea that our daily practices of responsibility (including the assumption that at least some people sometimes do things for which they are not responsible and our habit to hold people by default responsible for what they do) can be legitimized on the basis of this fact, without further appeal to obscure notions such as the ability to do otherwise. in this section we will argue that the bcn - findings discussed in bcn findings cast doubts on this latter claim. the bcn - evidence indicates that many actions for which the actor can give reasons are automatic responses to external stimuli, many of which are not recognized by the actor. these findings have led many scientists to the conclusion that, normally, people do not act for reasons. we do not think that this conclusion follows. saying that a certain act was performed for a particular reason does not necessarily mean that that act resulted in one way or another from a conscious process of reasoning. there might be ways to accommodate the bcn - finding that normally people act automatically while maintaining that people normally act for reasons. yet, we do think that these findings spell trouble for the new compatibilist, for, if these findings are true, new compatibilists must find a way to view automatic actions as actions for a reason if they are to avoid the conclusion that acting for reasons is exceptional. because new compatibilists are also committed to the thesis that the ability to act for reasons distinguishes actions for which the actor is responsible from action for which she is not, it follows that new compatibilists must come up with an account of what distinguishes automatic actions for a reason from automatic actions that were not for a reason. it is far from obvious that such a distinction can be made without introducing obscurities such as the ability to do otherwise. this challenge is aggravated by the bcn - thesis that giving reasons is more a matter of interpretation than of recollection. as we explained in new compatibilism the project of new compatibilism is to legitimate our common practices of responsibility independent of the issue whether someone ever could have acted otherwise. in practice, the issue of personal responsibility typically arises when someone behaves immorally without an adequate excuse or exemption. in such cases of wrongdoing we assume that there is a distinction between cases in which wrongdoers are responsible for doing wrong, and those in which they are not. blameless wrongdoing. according to new compatibilism, the distinction between blameful and blameless wrongdoing in our daily practice is made and should be made based on the ability to act for reasons. however, someone who acts immorally without an adequate excuse or exemption in fact ignores the reasons or moral justifications for not acting in such a way. clearly, someone who steals without an adequate excuse fails to respond to the reasons not to steal. that is, cases of wrongdoing by their very nature disclose a failure to respond adequately to reasons (see, chapter 3). this means that the distinction between blameful and blameless wrongdoing can not be viewed as a distinction between wrongdoings in which one did respond to reasons and wrongdoings in which one did not ; it must be seen as a distinction between being able to respond to reasons and not being able to do so. it follows that the new compatibilist is committed to the view that in cases of blameful wrongdoing a person did not respond to the reasons there were, although she could have done so. this sounds astonishing like saying that she would have been able to do otherwise ! at this point, new compatibilists might want to point out that our every day practices provide evidence for the view that in some cases of wrongdoing wrong doers are capable of responding to reasons although in fact they did not do so. the kleptomaniac is deemed unaccountable because she communicates that she feels awful about her behavior and freely commits herself to treatment (showing she is not able to respond to reasons). the thieving student is deemed accountable either because her remorse shows her to be aware of having made a wrong choice (showing that she is able to respond to reasons) ; or, alternatively, because her anger at us, shows her unwillingness to accept our norms and values, which we firmly believe to be valid (showing that she responds to reasons, albeit to reasons we do not accept). so although we have a problem to explain how it is possible that people are sometimes able to respond to reasons to which they did not respond, we might be sure that this sometimes is the case. however, if the bcn - sciences are right that reasons are inferred after the fact, it is far from clear that this practice provides the evidence needed by the new compatibilist. for the bcn - view suggests that differences between the self - reports of the thieving student and the kleptomaniac might result only from differences in their ability or willingness to account for their failure to respond to the reasons there are, rather than from differences in their capability to act for reasons. the problem is not that people can make mistakes in their self - reports or lie about their motivations. the problem is that if giving reasons is a matter of post hoc interpretation, the alleged fact that we can make a distinction between blameful and blameless wrongdoers on the basis of the reasons they provide, does not provide evidence for the view that there ever are wrongdoers who are able to respond to reasons although they do not do so. it might only indicate that some people are better than others in rationalizing their failure to respond to the reasons there are. the thieving student might be just as incapable to act for reasons as the kleptomaniac although she thinks otherwise (and due to her rationalizing talents is able to convince others of it too). let us stress that we do not think that the bcn - sciences have shown that it is impossible for someone not to respond to reasons while being able to do so, or that the bcn - sciences show that our everyday ways of judging whether some wrongdoer can be held responsible for what she did are illegitimate. our point is rather that in the light of the bcn - sciences it is unclear what it would mean to fail to respond to reasons while being capable of doing so and hence that it is unclear how on the new compatibilist view someone could ever be responsible for doing wrong. the new compatibilist needs an account of what it means to be able to respond to reasons while in fact failing to do so, an argument based on this account that shows that it is a real possibility that someone who did not respond to reasons was nevertheless able to respond to those reasons, and an argument that this account legitimates our common practices of deciding about the blamefulness of wrongdoings. fischer & ravizza (chapter 3 ] provide an account that seems tailor made to solve this problem. put very simply, the idea is that a person who in a certain case did not respond to certain reasons is nevertheless able to respond to those reasons if there is a scenario available in which she would have responded differently.13 suppose someone stole a wallet. if she would not have stolen it when a police officer was standing next to her, this would show that she was nevertheless able to respond to the reasons not to steal. as fischer and ravizza put it : we believe that, if an agent s mechanism reacts to some incentive... however, the argument is flawed. it does not help to distinguish between the thieving student and the kleptomaniac. for, a kleptomaniac, too, would be able not to steal under conditions such as having a police officer stand beside her. however, most of us do not need a police officer to prevent us from stealing. therefore, the very fact that someone would steal means that she does not respond to the reasons to which most of us would respond i.e. internal reasons. why would the fact that a person reacts to other reasons (the presence of a police officer) indicate she was nevertheless able to react to the reasons to which she did not respond ? fischer and ravizza [9 : 74 ] suggest that this inference is justified to the extent that the decision mechanism is the same in both situations. yet, this response only displaces the problem, for it gives rise to the question of how to decide whether the same mechanism is in play. how can we be sure that this is the case and on what basis do we infer it ? the assumption that the ability to react to one reason provides evidence that one is able to react to all the reasons one recognizes is seriously challenged by situationist psychologists who have investigated the influence of features that we do not notice or believe to be relevant in explaining behavior [e.g. 33 ]. the general view of this paradigm is that our behaviors and actions are better explained in terms of the particularities of the situation that often go unnoticed or are deemed irrelevant than in terms of internal character traits, virtues, and morality. if it really is the case that the particularities of the situation strongly influence our ability to respond to reasons, our ability to respond to reasons in situations in which we respond to reasons, does not indicate that we were able to respond to reasons in situations in which we do not do so. so in the light of the bcn - sciences it is not clear how, on a new compatibilist account, it would ever be possible to do something wrong while being responsible for it. the new compatibilist is not only committed to explain how it is ever possible that a wrongdoer was able to respond to reasons, although in fact she did not do so. the new compatibilist should also explain why in cases of wrongdoing it is reasonable to assume by default that the wrongdoer was able to respond to reasons. after all, in our daily practices we hold wrongdoers by default responsible for what they did. however, if situationist psychologists are right about the influence of the situation on what we do and decide, this practice must be reconsidered. if the particularities of the situation rather than differences in agential decision procedures determine whether or not someone acts morally it seems not reasonable to hold the agent responsible for acting wrong. as doris observes, the challenge of situationism is that the sensible default attitude would be : [... ] a general agnosticism about responsibility attribution, since we could never confidently rule out the presence of competence defeaters [33 : 138 ]. this is a problem for new compatibilism, which argues that the assumption that we are reasons - responsive beings is metaphysically modest. therefore, new compatibilism needs our reasons - responsiveness to be an unproblematic, easy to observe aspect of our everyday lives.14 when the reasons we provide for acting immorally can be taken at face value, we can infer that at least sometimes some of us act immorally and are to blame for it e.g. the thieving student, but not the kleptomaniac. so, the bcn - sciences pose at least three problems to the new compatibilist. first, the new compatibilist should find a way to accommodate the insight that most of our everyday life is determined by automatic processes triggered by external cues without introducing obscurities. second, in the light of the bcn - thesis that giving reasons is a matter of post hoc interpretation, the new compatibilist can not point to our every day practice to determine whether someone was responsible for doing wrong on the basis of the reasons they give to rebut the challenge that the new compatibilists idea that some wrongdoers are able to respond to reasons to which they do not respond is as obscure as the libertarians idea that those wrongdoers were able to do otherwise. third, the new compatibilist should answer the challenge that everyone s ability to act for reasons is heavily compromised by the influence of the situation. before concluding, let us emphasize that in our view these challenges are problems that should be addressed rather than findings that undermine new compatibilism. however, we do believe that it correctly points to the importance of our abilities to respond to reasons as a key to understanding our moral practices. for that reason, we believe that our understanding of free will and responsibility will be improved if we take bcn - findings concerning these abilities into account. we suspect that, in doing so, some version of incompatibilist free will will reappear, but this does not alter our view that our common point of focus should be the efficacy of reasons, moral deliberation, and our general reasons - responsiveness. our main point has been that the alleged threat of the bcn - sciences to free will and personal responsibility must be discussed in connection with our ability to act for reasons. new compatibilism, which we regard as the most influential compatibilist view of personal responsibility today, seeks the basis for our ascriptions of personal responsibility in our ability to act for reasons. the main attraction of this view is the fact that our ability to act for reasons seems so mundane and undeniable, quite unlike an assumed ability to do otherwise. our daily practice of asking and giving reasons seems to show that we are acting for reasons all the time. however, as we discussed, developments in the bcn - sciences suggest that it is not as obvious as it seems that our ability to act for reasons can serve as an unproblematic basis for our views of free will and responsibility. the bcn - findings indicate that most of daily life consists of automatic responses to external stimuli. to accommodate this insight, the new compatibilists must find a way to distinguish automatic actions for a reason from automatic actions that were not for a reason. it is not obvious that this distinction can be made without an appeal to something like the freedom to do otherwise. furthermore, developments in the bcn - sciences suggest that our self - reports and self - understanding are not necessarily evidence of the ability to act for reasons. this underscores a problem that arises independent of the bcn - findings : how to justify our everyday ascriptions of personal responsibility for wrongdoings (including us taking responsibility for our own wrongdoings). so the new compatibilist seems committed to the view that at least in certain cases wrongdoers were capable of responding to the reasons to which they, in fact, did not respond. this sounds as obscure as being able to do otherwise than one, in fact, did, but the new compatibilist might point out that in our everyday practices we routinely infer that some people are responsible for wrongdoings based on the reasons they provide. however, if the bcn - science are right that giving reasons is a matter of post hoc interpretation rather than of recalling motivations it might be that the differences between those who are deemed to be responsible for their wrongdoings and those who are not, have more to do with their ability to interpret what they did than with their ability to act for reasons. this brings to the fore the situationist challenge that the particularities of the situation might adequately explain wrongdoings, hence, excuse the wrongdoing agent. if this is correct, then our everyday beliefs about personal responsibility need serious revision ; if it is not, we need to determine how to respond to the overwhelming and fascinating evidence from the bcn - sciences that problematizes our reasons - responsive abilities. | many philosophers ignore developments in the behavioral, cognitive, and neurosciences that purport to challenge our ideas of free will and responsibility. the reason for this is that the challenge is often framed as a denial of the idea that we are able to act differently than we do. however, most philosophers think that the ability to do otherwise is irrelevant to responsibility and free will. rather it is our ability to act for reasons that is crucial. we argue that the scientific findings indicate that it is not so obvious that our views of free will and responsibility can be grounded in the ability to act for reasons without introducing metaphysical obscurities. this poses a challenge to philosophers. we draw the conclusion that philosophers are wrong not to address the recent scientific developments and that scientists are mistaken in formulating their challenge in terms of the freedom to do otherwise. |
gram - negative bacterium campylobacter is responsible for an estimated 400 million human cases of enterocolitis worldwide each year, making it the leading cause of bacterial foodborne disease and a major causative agent of traveller 's disease. in a limited number of cases, the enteric manifestations are followed by sequelae, such as reactive arthritis and the life - threatening neuropathy guillain - barr syndrome (gbs). two thermophilic species, c. jejuni and c. coli, are responsible for the vast majority of human campylobacteriosis (~90% and ~10%, resp.). animals such as chickens, cattle, pigs, sheep, and dogs may act as asymptomatic reservoirs, by shedding c. jejuni in their stools, which results in the contamination of animal food products and surface water during slaughter and carcass dressing. chickens, often heavily colonized with c. jejuni without signs of pathology, are considered to be one of the most important sources for human infection. it is generally assumed that c. jejuni - contaminated poultry constitutes a major risk to human health. a wide array of interventions has been developed to reducing the carriage of c. jejuni in livestock and poultry, including attempts to eliminate c. jejuni from farms by increasing biosecurity, separating contaminated flocks, and improving hygiene during slaughter. although these measures undoubtedly help to control shedding of c. jejuni in infected animals, and may reduce the number of positive flocks and the contamination level of their products, vaccination of poultry against c. jejuni will probably be the most effective measure, and remains a major goal [6, 7 ]. considering the physiology of campylobacter and their intestinal ecological niche in poultry, conventional vaccines have a poor performance, including inactivated vaccines [8, 9 ]. the rapid advances in genomics, proteomics, and molecular design of vaccines provide hope that an effective vaccine for campylobacter spp. can be developed in the near future [1, 10, 11 ]. in 1990, it was first reported that intramuscular injection of plasmid dna in a simple saline solution could transfect muscle cells in vivo. genetic immunization is a novel vaccine strategy that conceptually combines some of the most desirable attributes of standard vaccine approaches. most recent studies associated with the efficacy of dna vaccine against c. jejuni focus on the potential vaccine antigens, plasmid vector, and dna delivery (mucosal adjuvants). the gene flaa plays an important role in the pathogenicity of c. jejuni. as a result of its biocompatibility, biodegradability, low cost, and ability to open intercellular tight junctions, chitosan can be used as a delivering vehicle for the mucosal vaccine and may have an adjuvant effect. here, we reported intranasal immunization of white leghorn chickens using chitosan - dna nanoparticles that carried the recombinant plasmid pcaggs - flaa for the flaa gene encoding the major structural protein flaa of c. jejuni, and demonstrated its efficacy in inducing specific immune responses and protection against homologous strain challenge. white leghorn chickens aged 1 day were obtained from the comparative medicine center of yangzhou university (yangzhou university, jiangsu, china). animals were housed, handled, and immunized following approval by the institutional animal experimental committee. miyazaki (faculty of medicine, university of tokyo, japan). c. jejuni strain alm-80 was isolated from chicken by the jiangsu key laboratory of zoonosis, yangzhou university (jiangsu, china). cos-7 cells were ordered from institute of biochemistry and cell biology, chinese academy of sciences (shanghai, china), and grown in dmem (gibco, grand island, ny, usa) supplemented with 10% (v / v) fetal bovine serum (fbs ; gibco). chitosan, fitc - labeled rabbit antichicken igg, horseradish peroxidase- (hrp-) labeled goat antichicken iga, hrp - labeled rabbit antichicken igg and igm were obtained from sigma (st louis, mo, usa). all other chemicals and reagents were of analytical grade, and obtained from sinopharm chemical reagent co., ltd. a pair of primers were designed to amplify gene flaa of c. jejuni that contained xbai and ecori sites, forward : 5-catctagaagcatttaacaagttcatgg-3, reverse : 5-tagaattcgtgtttatcctaaaacccat-3. amplification was conducted in a volume of 50 l, containing 5 l 10 buffer, 3 pm dntp, 20 pm primers, 2 l (10 pg) dna, and 1 u taq polymerase (takara diagnostics, dalian, china). the reactions were performed with a thermal cycler (bio - rad ltd, hercules, ca, usa) using the following temperature - cycling parameters : initial denaturation at 95c for 5 min, followed by 32 cycles of 1 min at 94c, 1 min at 58c, 1.5 min at 72c, with a final extension step of 5 min at 72c. eight microliters of pcr products were separated on a 1% (w / v) agarose gel following electrophoresis at 60 v for 1.5 h. gels were stained with ethidium bromide (0.3 mg / l) and visualized under uv illumination. a 100-bp dna ladder (promega, madison, wi, usa) was used as a molecular size standard. then, the pcr product was cloned into pgem - t easy vector (sangon biotech, shanghai, china) to give rise to pt - flaa. the ecori - xbai - restricted insert of pt - flaa was cloned into eukaryotic expression vector pcaggs, and then the recombinant vector pcaggs - flaa was constructed and inserted in escherichia coli (dh5) by electrotransformation. for immunization purposes, homogeneous stocks of dna were purified from 2.5 l cultures using the plasmid giga preparation kit (qiagen, hilden, germany). the dna preparations were quantified by optical density (od) measurements at 260 nm and analyzed by 1% (w / v) agarose gel electrophoresis. the chitosan / pcaggs - flaa dna nanoparticles were synthesized by mao.. in brief, a chitosan (sigma, st louis, mo, usa) solution (200 g / ml in 5 mm sodium acetate buffer, ph 5.5), 400 kd, 85% deacetylated, and a pcaggs - flaa solution (100 g / ml in 5 mm sodium sulfate solution) were separately preheated to 50c52c in parallel. then, the pcaggs - flaa solution was added into an equal volume of the chitosan solution. uniform particles were obtained by coacervation between chitosan and dna, and were left to stand for at least 1 h at room temperature. freshly prepared chitosan - dna complexes were characterized by morphological examination by transmission electron microscopy (tem). the samples were placed on a cotton grid, allowed to sit for a few minutes and air - dried. then, they were negatively stained with uranyl acetate for visualization under a transmission electron microscopy (tem, accelerating voltage/120 kv, philips tecnai 12, holland). naked dna (1 g in 20 l of 25 mm na2so4 solution) or chitosan - dna suspension (20 l, equivalent to 1 g of dna) was incubated with 0.5 u dnase i (final concentration of 28 u / ml) for 15 min at 37c. edta was added to stop the reaction to a final concentration of 50 mm. then, chitosan - dna was subjected to chitosanase and lysozyme (final concentrations of 0.15 and 15 u / ml) digestion at 37c for 4 h. integrity of dna was analyzed by agarose electrophoresis. two micrograms of plasmid (chitosan - pcaggs - flaa) was transfected into 70% confluent cos-7 cells covering a 6 cm dish using a lipofectamine 2000 kit (invitrogen life technologies, carlsbad, ca, usa) according to the manufacturer 's instructions. after 2 days incubation at 37c in 5% co2, the cells were washed with phosphate - buffered saline (pbs) and fixed with 3% (v / v) paraformaldehyde in pbs for 20 min at room temperature. the cells were then washed three times and permeabilized with pbs containing 0.05% (v / v) tween 20 for 30 min. after a further wash with pbs, the cells were incubated with a 1 : 50 dilution of mouse antiflaa antiserum (from our laboratory) for 1 h followed by rinsing with pbs and incubation with fluorescein isothiocyanate- (fitc-) conjugated goat antimouse immunoglobulin g antibody (sigma - aldrich, st. the cells were washed again with pbs and visualized by a fluorescence microscope (leica microsystems gmbh, wetzlar, germany). to assay the association efficiency (ae) of pcaggs - flaa, the nanoparticles suspension was first centrifuged (heraeus fresco 21 ; thermo scientific, germany) at 30,000 g, at 4c for 30 min. the total amount of the original pcaggs - flaa and free (or unconjugated) pcaggs - flaa were then analyzed using a microspectrophotometer (biophotometer ; eppendorf, germany). the association efficiency was calculated as follows : (1)ae(%)={total amount of pcaggs - flaatotal amount of pcaggs - flaa total amount of free pcaggs - flaatotal amount of pcaggs - flaa}100(%) one - day - old white leghorn chickens, randomly divided into three groups (30 per group), were immunized intranasally with chitosan / pcaggs - flaa nanoparticles, chitosan / pcaggs, and saline control, respectively. these chickens were immunized three times on days 1, 15, and 29 at a dose of 150 g in 200 l (100 l each nostril). on day 42, all chickens were challenged orally with 510 alm-80 strain. three chickens were sacrificed every 3 days from day 45 to day 63 to harvest the small intestine, large intestine, and cecum to calculate the number of c. jejuni alm-80. the method of isolation and enumeration of campylobacter can be found in our preliminary study. blood was collected after 4 and 6 weeks of primary immunization and sera were stored at 70c until they were tested by elisa for antibodies. the abdominal cavity was opened aseptically, and the entire small intestine, including the duodenum, jejunum, and ileum, was collected. pancreas, connective tissue, and fat were removed into pbs, and the intestine was cut longitudinally and then cut into 1-cm - long sections. the intestinal antibodies were extracted using a pbs solution containing tween 20 (0.05%, v / v), soybean trypsin inhibitor (0.1 mg / ml) (sigma - aldrich, st. louis, mo, usa), edta (0.05 mg / ml), and phenylmethylsulfonyl fluoride (pmsf) (0.35 mg / ml) (sigma - aldrich, st. intestinal lavage solutions were mixed with extraction solution and shaken for 2 h at 4c. after centrifugation at 20,000 g for 30 min at 4c the supernatant was collected. bovine serum albumin was added to a final concentration of 0.1% (w / v) and samples were preserved at 20c. the titer of antibodies against campylobacter in intestinal secretions was measured using an indirect enzyme - linked immunosorbent assay (elisa) developed by laboratory procedure. briefly, the elisa involved the following steps : (1) 96-well microtitre plates were coated with the isolated strain alm-80 (5 10 cfu / well) for 6 h at 42c, and blocked with bsa solution (10%, w / v) for 1 h at 37c, then washed with a 0.05% (v / v) solution of tween 20 in pbs. (2) samples were serially diluted and added. the plates were incubated for 2 h at 37c and washed with pbs - tween. the plates were incubated for 1.5 h at 37c and washed with pbs - tween. (4) o - phenylenediamine dichloride (opd ; sigma, usa) was added to the plates at room temperature. (5) h2so4 (2.5 m) was added to stop the reaction 30 min after addition of the substrate. to analyze the changes in t - cell composition upon immunization, spleen and cecal tonsil of each animal (four per group on investigation days 42 and 56) were crushed in ice - cold pbs. the homogenates were centrifuged at 300 rpm for 2 min at below 4c before the insoluble matter settled. the isolated cells were incubated with fitc- (fluoresceinisothiocyanate-) labeled cd4 and pe (phycoerythrin-) labeled cd8 monoclonal antibodies (southern biotechnology associates, birmingham, al, usa) for 30 min at 37c in the dark. after the cells were washed, aliquots of 20,000 cells per sample were analyzed using a facsaria flow cytometry system (becton dickinson, ca, usa). the data were presented as mean standard deviation. the student t - test for comparison of two independent samples viable counts of bacteria were converted into logarithmic form. for the purpose of statistical analysis, a log10 viable count of 90%), as demonstrated by electrophoresis and electron microscopy. protection tests showed that chitosan - dna nanoparticle vaccine that contained flaa of c. jejuni reduced effectively colonization of c. jejuni in the small intestine, large intestine, and cecum. at present, investigation of the protective immune responses against c. jejuni is at the initial stage. campylobacter vaccine can induce significant immune protection against experimental infection of mice, ferrets, rabbits, or primates, and might relieve or eliminate clinical symptoms in these animals. nevertheless, vaccines have different effects on mammals and chickens, which needs to be considered when research is conducted using chicken models of colonization of the intestinal tract. in addition, since flaa of c. jejuni is highly variable, it is interesting to assess the protective efficacy of the chitosan / pcaggs - flaa nanoparticles against challenge with other c. jejuni strains in future studies. what 's more, they need to replicate more efficiently in broilers by optimizing the immunization strategy. this study demonstrated that intranasal delivery of chitosan - dna vaccine successfully induced effective immune response and might be a promising vaccine candidate against c. jejuni infection. | campylobacter jejuni is the most common zoonotic bacterium associated with human diarrhea, and chickens are considered to be one of the most important sources for human infection, with no effective prophylactic treatment available. we describe here a prophylactic strategy using chitosan - dna intranasal immunization to induce specific immune responses. the chitosan used for intranasal administration is a natural mucus absorption enhancer, which results in transgenic dna expression in chicken nasopharynx. chickens immunized with chitosan - dna nanoparticles, which carried a gene for the major structural protein flaa, produced significantly increased levels of serum anti - campylobacter jejuni igg and intestinal mucosal antibody (iga), compared to those treated with chitosan - dna (pcaggs). chitosan - pcaggs - flaa intranasal immunization induced reductions of bacterial expellation by 2 - 3 log10 and 2 log10 in large intestine and cecum of chickens, respectively, when administered with the isolated c. jejuni strain. this study demonstrated that intranasal delivery of chitosan - dna vaccine successfully induced effective immune response and might be a promising vaccine candidate against c. jejuni infection. |
recently, the number of newly diagnosed patients with hiv infection is increasing in japan and eastern asia (even though it is decreasing in most western countries) while amebiasis is also increasing in japan as a sexually transmitted disease, especially among males who admit to having sex with men (msm). there is also a high frequency of asymptomatic entamoeba histolytica infection, especially among msm. amebiasis is characterized by diarrhea and it sometimes induces the development of liver abscesses as a complication with amebic colitis.1 pleural empyema is rare as a complication in cases of amebiasis. trimethoprim - sulfamethoxazole is often administered to patients with an hiv infection to prevent pneumocystis pneumonia. unfortunately, trimethoprim - sulfamethoxazole may also induce agranulocytosis in patients with an hiv infection, thus leading to the development of severe infectious diseases. a 41-year - old male was admitted to the hospital with symptoms of diarrhea, fever, dyspnea and right pleural effusion. the illness began in the latter part of august 2008, initially presenting with diarrhea and fever. he had no history of traveling abroad, alcoholism, any medication or intravenous drug use. his vital signs on admission were ; conscious, blood pressure 95/60 mmhg, pulse late 146 beats / min, respiration, 45 breaths / min, saturation o2 (room air), 88% and body temperature 39c. the notable findings of a physical examination included emaciation (bmi 16.1), oral candidasis and decreased breath sounds on the right side of his chest. a chest radiograph and computed tomography (ct) of the chest showed a large amount of right pleural effusion (figure 1). the laboratory data included a leukocyte count of 10,320/l with 89% neutrophils, 8% lymphocytes, 3% monocytes, hemoglobin 8.8 g / dl, c - reactive protein 23.6 mg / dl, aspirate aminotransferase 95 u / l, alanine aminotransferase 74 u / l, alkaline phosphatase 478 u / l, -glutamyl transpeptidase 134 u / l, albumin 2.1 g / dl, total cholesterol 57 mg / dl, blood urea nitrogen 18.4 mg / dl, creatine 0.57 mg / dl and hyponatremia (123 meq / l). the findings of human immunodeficiency virus type 1 antibody tests were positive for enzyme immunoassays (eia) and also based on the western blot method. thoracentesis revealed milk chocolate or caf au lait colored pleural fluid (figure 3). in an examination of the pleural fluid, cytology, bacterial culture, smear and polymerase chain reaction to detect mycobacterium tuberculosis dna were negative, the adenosine deaminase activity was 240 the pleural fluid showed a cell count of 40125/ml (74.3% neutrocytes, 25.7% monocytes). other examinations of the laboratory findings detected cysts of entamoeba histolytica in the patient s stool. the cd4 lymphocyte count in the peripheral blood was 179/l (repeated counts for cd4 lymphocytes ranged from 286 to 359/l) and the amount of hiv - rna was 3700 copies/l (repeated counts for hiv - rna ranged from 43,000 to 90,000 copies / ml). although e. histolytica was not identified from the pleural fluid, antibodies (fluorescence antibody technique) against e. histolytica were demonstrated in the serum (200). the patient was thus diagnosed to have amoebic colitis, amoebic liver abscess and amoebic empyema complicated with an hiv infection. the right side pleural effusion was drained using a chest tube and he was administered metronidazole (2250 mg / day) orally for 28 days in total. the patient was therefore administered trimethoprim - sulfamethoxazole to prevent pneumocystis pneumonia and itraconazole to prevent fungal infections. agranulocytosis in this case was therefore considered to have been caused by the administration of trimethoprim - sulfamethoxazole. after the discontinuation of trimethoprim - sulfamethoxazole, the recombinant human granulocyte colony - stimulating factor (g - csf) drug filgrastim was administered daily at a dose of 200 g / m intravenously. following 4 days of treatment with g - csf, the patient s absolute neutrophil count was above 9/l, while after 7 days of treatment it was 2990/l (white blood cell count 4600/l, neutrophils 65%). amebiasis may become invasive depending on various host immune factors, especially in patients with an hiv infection.2 three to 9% of patients with amoebic colitis develop amoebic liver abscess3 and furthermore 7% to 20% of amoebic liver abscess develop amoebic empyema.4,5 however, about a third of all cases of pleuropulmonary amebic disease demonstrate the presence of exudative or serous, reactive pleural effusion.6,7 this means that some of intrathoracic complications of amebiasis are thus included reactive pleural effusion other than amoebic empyema. some mechanisms of amoebic empyema have been previously described. for example, a rupture of an amoebic liver abscess into the pleural space through the diaphragm, hepatobronchial fistula, lymphatic spread, hematogenous spread from the primary intestinal lesion have all been reported.68 the most common pathogenetic mechanism of pleural amebic empyema is that the liver abscess advances to and across the diaphragm or bursts into the right pleural space. in this case, there was no hepato - bronchial fistula, no sign of lymphatic spread and no perihepatic ascites detected by ct, thus indicating that there was no rupture of a liver abscess. amoebic empyema was suggested to occur by extension or inflammatory invasion of an amoebic liver abscess directly into the pleural cavity. the detection of e. histolytica from pleural fluid is rare in the diagnosis of amoebic empyema. amebas are detected in less than 10% of cases.5 the diagnosis of amoebic empyema is made by the identification of antibodies against e. histolytica in the serum, and a negative bacterial culture of the pleural fluid. the color of the pus aspirated from amoebic liver abscesses also tends to be described as chocolate brown or anchovy - sauce color in the literature.6 however, the features of amoebic empyema remain to be fully elucidated. the color of the pleural fluid in the current case was noteworthy. furthermore, the pleural fluid in this case did not have a foul odor, although most pleural fluid specimens with bacterial empyema tend to have a foul odor because the majority of empyema are caused by anaerobes. the color and smell of the pleural fluid may therefore be a unique diagnostic feature of amoebic empyema and may thus be helpful in making a differential diagnosis to distinguish common bacterial empyema from amoebic empyema. the administration of trimethoprim - sulfamethoxazole to prevent pneumocystis pneumonia is common in the management of patients with hiv infection. therefore, trimethoprim - sulfamethoxazole was administered after diagnosing the patient to have an hiv infection. although agranulocytosis is a potentially life - threatening condition, especially under conditions of severe amebiasis, the patient was able to successfully recover after the administration of g - csf and oral metronidazole. trimethoprim - sulfamethoxazole is known to sometimes induce agranulocytosis as a side effect. as a result, an increasing number of such cases are expected in the future because many patients with hiv infection require the administration of trimethoprim - sulfamethoxazole in order to prevent pneumocystis pneumonia, and the occurrence of amebiasis is also increasing. the management of amoebic empyema in most cases involves the administration of parenteral metronidazole,9 followed by drainage. metronidazole was administered orally in the current patient, followed by drainage, and this yielded a good outcome. the incidence of amebiasis is not as high in aids patients as in hiv - seronegative patients.10 however, whether risk of invasive amebiasis is higher among hiv - infected persons than uninfected persons remains. hung and coworkers described persons infected with hiv are at an increased risk for invasive amebiasis.2,11 furthermore the epidemiology demonstrated that invasive amebiasis occurs much more frequently in taiwan than reported in western countries. interestingly, amebiasis is a relatively common parasitic disease at a time when cd4 counts are relatively high in taiwan in comparison to western countries.2,11 extraintestinal amebiasis is also treated by metronidazole, even in aids patients who have low cd4 cell counts and receiving anti - hiv drugs.8,11,12 the estimated mean survival is not significantly different between the hiv - infected patients with and without invasive amebiasis.11 even though the population of newly diagnosed patients with hiv infection is decreasing in most western countries, the number is, in contrast, increasing in japan, korea, hong kong and taiwan. in addition, the occurrence of invasive amebiasis is therefore also expected to increase in these countries. | a 41-year - old male was admitted to the hospital with symptoms of diarrhea, fever and rapidly progressive respiratory distress. a chest radiograph and computed tomography (ct) of the chest and the abdomen showed a large amount of right pleural effusion and a large liver abscess. the patient was thus diagnosed to have amoebic colitis, amoebic liver abscess and amoebic empyema complicated with an hiv infection. the patient demonstrated agranulocytosis caused by the administration of trimethoprim - sulfamethoxazole. however, the administration of granulocyte colony - stimulating factor made it possible for the patient to successfully recover from agranulocytosis, and he thereafter demonstrated a good clinical course. |
malignant metastatic involvements of oral tissues have been infrequently reported only in 1% of all oral malignancies.[14 ] breast, lung, kidney, thyroid, and prostate are the most common primary sites. furthermore, metastasis to soft tissues is less common compared with the osseous structures, and metastasis to gingiva is very rare and usually occurs as gingival hyperplastic or reactive lesions with clinical appearance of pyogenic granuloma or epulis.[79 ] a case of metastatic signet ring cell adenocarcinoma of the esophagus in a 60-year - old patient is reported here in which the patient had no complaint related to the primary site and presented as multiple localized gingival growths. a 60-year - old male patient came to opd of karnavati school of dentistry, uvarsad, gandhinagar, gujarat, with the chief complaint of mobile teeth in lower right back teeth region since 1 year and he noticed swelling of gums in right side upper and lower back teeth region since 1 month with occasional bleeding tendency. he had history of exfoliation of 11, 18, and 26 before 45 years. intraoral examination revealed exophytic sessile growth of gingiva of 33 cm in size in right mandibular posterior region, which was extending from right mandibular first molar to third molar and extending into lower vestibular mucosa. on palpation, growth was firm, non - tender, with 47 and 48 grade iii mobile. bleeding on probing was also present. we found another exophytic growth of 23 cm in size with pedunculated base in maxillary right posterior region extending from distal of 15 to distal of 16 [figure 1 ]. lesions in (a) maxilla and (b) mandible orthopantomograhic examination showed mild - to - moderate bone loss in all the teeth except 27, 36, 41, 47, and 48, which showed severe bone loss with root resorption and 11, 18 and 26 teeth were missing [figure 2 ]. (a) pre - treatment and (b) post - treatment opg showing moderate - to - severe interdental bone loss we made diagnosis of generalized periodontitis with pyogenic granuloma in right maxillary and mandibular posterior region with differential diagnosis of other reactive lesions like fibrous epulis, giant cell lesion, and neoplastic lesion involving gingiva. excisional biopsy of the lesion was carried out along with the removal of teeth 47, 48 [figure 3 ]. specimen was sent for histopathologic examination, which showed features of signet ring cell adenocarcinoma [figure 4 ]. the possibility of metastatic lesion was considered because it is extremely rare for a signet ring cell adenocarcinoma to develop in gingiva as the primary site. immunohistochemistry was performed to know more about tumor cells, which was positive for ema (epithelial membrane antigen), ck7 (cytokeratin), and ck15 markers [figure 5 ] and negative for ck20, ttf-1 (thyroid transcription factor), and psa (prostate specific antigen) markers suggestive of the gi tract as the possible primary site. the patient did not have any complaints related to any other region of the body like difficulty in swallowing or hematemesis. (a) maxillary and (b) mandibular specimen of excisional biopsies with extracted teeth histopathologic features of metastatic signet ring cell adenocarcinoma [h and e stain in (a) 10 and (b) 40 ] immunohistochemistry stains positive for (a) ck7, (b) ck15, and ema, 10 and 20 respectively the patient was referred to gujarat cancer research institute, ahmedabad, for further examination. barium swallow was performed, which showed 8 cm long defect in lower one - third of the esophagus. computed tomography (ct) scan of thorax was performed, which showed malignant lesion involving lower esophagus, gastro - esophageal junction, and fundus of the stomach [figure 6 ]. a biopsy from esophagus ct scans of other regions were taken to rule out metastasis but did not show any such involvement. the patient was advised for surgical treatment and chemotherapy but patient refused to take any treatment and he expired within 5 months of the final diagnosis. ct scan of thorax showing lesion involving the lower one - third of esophagus and gastro - esophageal junction as esophageal signet ring cell adenocarcinoma had not been recognized at the time of diagnosis of oral lesion. the oral lesion was identified as a metastatic signet ring cell adenocarcinoma with lower third of esophagus identified as the primary site. primary signet ring cell adenocarcinomas are mainly associated with the gastrointestinal tract, breast, or lung and have a more aggressive behavior. it is unlikely that it will be surpassed by adenocarcinoma in number in the near future. the highest reported increase in esophageal adenocarcinoma has been reported in usa at 10% per annum. among the asian countries, china and singapore esophageal adenocarcinoma is the 15 most common cancer in developed country and the 4 in the developing world. esophageal adenocarcinoma tends to grow locally, invading surrounding tissues, which may lead to death. most common invasion of esophageal adenocarcinoma is into tracheo - esophageal fistula / broncho - esophageal fistula. mediastinum and lung are secondarily involved ; lymphatic, liver, and spinal cord can be involved, rarely involving supraclavicular organs. gastric signet ring adenocarcinomas have a lower rate (8%) of lymph node metastasis than the non - signet ring cell type. cases of gingival metastasis are usually found in the later stages of tumor growth and are most often associated with metastatic deposits in other organs. therefore it has a poor prognosis, leading to death of the patient within a few weeks or months. in this case, patient died within 5 months of diagnosis of metastatic signet ring cell adenocarcinoma. despite this, an early diagnosis is must for successful treatment and prevention of other complications like tissue destruction and pain. like in the present case, clinically early gingival metastatic lesions may imitate benign reactive lesions such as pyogenic granuloma, giant cell granuloma, or peripheral ossifying fibroma batson proposed valveless vertebral venous plexus as the mechanism for bypassing filtration through the lungs in an attempt to explain the metastasis to the oral region from a primary tumor of the lower part of the body, particularly in the absence of lung metastasis. once circulating malignant cells reach the oral region, they can be trapped by the rich capillary network of the chronically inflamed attached gingiva. the criteria for diagnosis of a metastatic neoplasm are : (1) primary lesion must be histologically verified, (2) histologically, the metastatic lesion must be the same subtypes as the primary lesion, (3) the possibility of direct extension from a primary lesion must be excluded. in the present case, gingival lesion was diagnosed before detection of the primary lesion (esophagus). according to bhasker, approximately 33% of oral secondary tumors are an initial indication of the existence of a primary tumor. histopathologically, gingival and esophageal lesions were same in terms of subtypes and morphology of tumor cells, so our final diagnosis was consistent with the above - mentioned criteria. the treatment modalities are limited to conservative and palliative therapies intended to improve the quality of life of these patients, and include local resection, radiotherapy, or chemotherapy. most of patients die within the first year of diagnosis with a survival rate at 4 years of 10% cases. in the patients with the history of malignant tumors or with a rapidly growing oral soft tissue mass, possibility of the metastatic tumor should be considered in differential diagnosis. detailed and careful oral examination is must to determine if there are any metastatic lesions that could manifest in the oral cavity, with or without swelling, pain, and looseness of the teeth. | localized gingival enlargement is often associated with systemic medications, abscess formation, trauma, or reactive lesions. very few reports are available reporting enlargement of gingiva due to metastasis of adenocarcinoma of the esophagus. a case of localized gingival growth affecting right maxillary and mandibular gingiva was reported in a 60-year - old male patient in which excisional biopsy of the lesion was done. histopathological examination showed metastatic signet ring cell adenocarcinoma, which on further examination showed lower one - third of esophagus as the primary site of metastasis. |
obesity is one of the major health challenges throughout the world, due to its association with an array of vascular, metabolic, and psychosocial complications [1, 2 ]. obesity is traditionally associated with populations in europe and north america ; however asian countries such as japan have recently reported increasing prevalences of obesity, which may reflect changes in dietary patterns and lifestyles [3, 4 ]. body weight is tightly regulated by complex homeostatic mechanisms involving the hypothalamus and brainstem which integrate inputs from higher cortical centres with peripherally derived signals of the body 's nutritional and energy status. in the hypothalamic arcuate nucleus (arc), there are two neuronal populations with opposing effects on food intake : neurons which coexpress neuropeptide y (npy) and agouti - related peptide (agrp) which stimulate food intake, whereas neurons coexpressing proopiomelanocortin (pomc) and cocaine- and amphetamine - regulated transcript (cart) suppress food intake (see figure 1). within the brainstem, the dorsal vagal complex (dvc) consisting of the dorsal motor nucleus of vagus (dvn), area postrema (ap), and the nucleus of the tractus solitarius (nts) plays a pivotal role in relaying of peripheral signals such as vagal afferents from the gut to the hypothalamus. in human, higher cortical centres are implicated in psychological and emotional factors which can drive food intake beyond homeostatic requirements. in addition, the corticolimbic pathways are responsible for reward - associated feeding behaviour. this article summarises our current understanding of the role of gut hormones in appetite regulation and its potential as therapeutic targets for obesity. more than 30 gut hormone genes are known to be expressed, and more than 100 bioactive peptides are distributed in the gastrointestinal tract, which is thus regarded as the largest endocrine organ in the body. meal anticipation and the presence of food in the upper gastrointestinal tract stimulate the release of gut hormones and neurotransmitters from the gut. these neurohumoral signals are involved in the initiation and maintenance of food intake as well as termination of meals. the satiating effect of stomach distension is revealed by observing that infusion of either saline or nutrients into the rat stomach results in same reduction in food intake. in humans, the effects of intragastric balloon insertion on body weight and food intake are conflicting [8, 9 ] ; this may reflect differences in the types of balloon used during these studies. both meal duration and size are markedly increased during sham feeding, where ingested food is prevented from distending the stomach or small intestine by surgical intervention, whereas intraluminal gastrointestinal (gi) infusion of macronutrient before food access reduces subsequent meal size in a dose - dependent manner. these findings suggest that the upper gi tract has an important role in negative feedback regulation of food intake, and the upper intestine is critical for nutrient absorption. the vagus nerve is closely implicated in the transmission of the food - induced negative feedback signals which are critical for determining meal size. transection of all gut sensory vagal fibres results in increased meal size and meal duration but does not block gastric preload - induced feeding suppression ; this implies that vagal afferent signals contribute to satiety during spontaneous meals [10, 11 ]. perfusion of nutrients into the colon inhibits upper gastrointestinal secretion, motility, and transit ; this negative feedback mechanism has been called the ileal brake. fat is the most potent trigger of the ileal brake, and glucagon - like peptide-1 (glp-1) and peptide yy (pyy) may be among the mediators of this phenomenon. almost all pharmacological and behavioural treatments for obesity result in weight loss followed by weight regain. in contrast, gastric bypass surgery is an established and effective treatment for obesity which provides sustained weight loss maintenance for at least 15 years [15, 16 ]. malabsorption - based techniques include the jejuno - ileal bypass, allowing nutrients to pass directly from the proximal jejunum to the terminal ileum, and roux - en - y gastric bypass (rygb), combining restrictive and malabsorptive procedures. in some cases restrictive bariatric surgery involves the laparoscopic application of an adjustable gastric banding (lagb). lagb procedures result in slightly less weight loss compared with rygb but have been reported to be safer. intriguingly, the mechanisms of long - term weight loss following bariatric surgery are yet to be determined ; however several gut hormones have been implicated as contributory factors ; a decrease in ghrelin and an increase in pyy and glp-1 levels have been found following bypass surgery [1921 ]. recent evidence suggests that an increase in energy expenditure may play a role in part in weight loss after gastric bypass surgery as an additional factor. gastric bypass surgery also improves glycaemic control in patients with type 2 diabetes, and this often occurs prior to observable weight loss. thus emulating the altered gut hormone signals associated with bypass surgery may offer promising novel treatments for obesity. have observed that adult germ - free mice had 40% less total body fat than mice with normal microbiota ; furthermore replacing the microbiota in adult germ - free mice produced a 60% increase in body fat content and insulin resistance within 14 days of replacement. in addition, germ - free mice may be protected against high fat diet - induced metabolic changes. there has also been considerable interest in the potential benefits of prebiotic drinks containing bacterial cultures. the study by cani. evaluated the effect of prebiotics on plasma levels of gut hormones in healthy subjects. after two weeks of prebiotic treatment, they observed increased gut microbiota fermentation, decreased appetite, and improved postprandial glucose responses. current data therefore suggest that gut microbiota may promote the development of obesity and that manipulation of gut microbiota using probiotics may alter gut endocrine function. further studies are required in order to further investigate the pathophysiological basis of the association between gut microbiota and energy homeostasis. the pp - fold family consists of neuropeptide y (npy), peptide yy (pyy), and pancreatic polypeptide (pp). pyy and pp are secreted from gastrointestinal tract, whereas npy is predominantly distributed within central nervous system. the members of pp - fold family act via g protein - coupled receptors : y1, y2, y4, y5, and y6. there are two circulating forms of pyy : pyy (136) and pyy (336). pyy (336), the major circulating form, is produced by cleavage of the n - terminal tyrosine - proline residues from pyy (136) by the enzyme dipeptidyl - peptidase iv (dppiv). pyy (136) has affinity to all y receptors, while pyy (336) binds with highest affinity to the hypothalamic y2 receptor, suppressing food intake. circulating pyy concentrations are low in fasted state and rise rapidly following a meal with a peak at 1 - 2 hours and remain elevated for several hours. ingestion of fat results in greater release of pyy than observed with ingestion of carbohydrate or protein meals with a similar calorie content. peripheral pyy administration shows a decrease in food intake and body weight gain in rats. in both lean and obese humans, intravenous injection of pyy reduces appetite and food intake [32, 33 ], suggesting that, unlike leptin, the sensitivity of pyy is preserved in obese subjects. pyy levels are found to be elevated in patients with gastrointestinal disorders including inflammatory bowel disease and steatorrhea [34, 35 ]. in addition to its effect on food intake, pyy may regulate energy expenditure [36, 37 ], delay gastric emptying, and reduce acid secretion [38, 39 ]. in obese subjects circulating pyy levels are low [33, 40 ], and pyy levels are reported to be higher in patients with anorexia nervosa when compared with control subjects. studies of circulating levels of pyy in obese and lean people have yielded conflicting results [42, 43 ]. however a blunted postprandial rise in pyy is observed in obese people, which suggests its association with impaired satiety. the anorectic effects of pyy (336) may be mediated centrally via a direct action in the arc, through an indirect action involving the vagus and brainstem, or by a combination of both pathways. peripheral administration of pyy (336) increases c - fos expression (a marker of neuronal activation) in the arc, and direct injection of pyy (336) into the arc inhibits food intake. this effect is most likely mediated through the y2 receptor since the anorectic effect of peripheral pyy (336) administration is blocked in y2 receptor - null mice and intra - arcuate injection of a y2 receptor selective agonist also reduces food intake. although there have been conflicting results, the importance of vagal - brainstem signalling to the actions of pyy on food intake is suggested by observing that bilateral subdiaphragmatic vagotomy and brainstem - hypothalamic pathway transectioning abolish the anorectic effect of peripheral pyy (336) administration in rats [45, 46 ]. in contrast to peripheral and intra - arcuate pyy (336) administration, pyy (336) results in an increase in food intake when administered directly into the third ventricle of the brain or directly into the paraventricular nucleus (pvn). this apparently confusing observation may be explained by considering that such effects might be endogenously mediated by the cns - distributed peptide, npy, through an action on y1 receptor and y5 receptors. pyy may also act in areas of the brain other than the hypothalamus and brainstem. suggested that pyy (336) infusion modulates neural activity within corticolimbic and higher cortical brain using functional magnetic resonance imaging. under conditions of high circulating pyy (336) designed to mimic the postprandial state, changes in neural activity within the caudolateral orbital frontal cortex predicted subsequent feeding behaviour. by contrast, hypothalamic activation correlated with food intake under conditions of low circulating pyy (336). pp appears to reduce food intake directly through the y4 receptor in the brainstem and hypothalamus. the anorectic effects of pp are abolished by vagotomy in rodents, suggesting that pp may also act via the vagus nerve to reduce food intake. y4 receptor expression is found in the ap, nts, dvn, arc, and pvn. an autoradiography study also identified saturable pp binding sites at the interpeduncular nucleus, ap, nts, and dvn, thus suggesting the brainstem as the major site of action for pp. like pyy, differential effects on food intake are observed following pp injection, depending on the route of administration. in contrast to the anorectic effects observed with peripheral pp administration, its central administration stimulates food intake. these differential effects may be explained by activation of distinct receptor populations, although the exact mechanism is not yet clear. although reported differences in circulating levels of pp between lean and obese people have been conflicting [55, 56 ], some studies have demonstrated significantly reduced levels in obese subjects [57, 58 ]. patients with prader - willi syndrome (pws) have been reported to show reduced pp release both basally and postprandially when compared with age- and weight - matched control subjects. the anorectic effects of pp have been demonstrated in a number of experimental models. in mice, acute and chronic peripheral administration of pp reduces food intake [47, 57 ]. in leptin - deficient ob / ob mice, repeated intraperitoneal injection of pp decreases body weight gain and ameliorates insulin resistance and hyperlipidaemia. furthermore, transgenic mice overexpressing pp are lean and demonstrate reduced food intake compared with wild - type controls. in normal - weight human subjects, intravenous infusion of pp results in a 25% reduction in 24-h food intake. furthermore twice - daily infusion of pp in volunteers with pws caused a 12% reduction in food intake. glp-1, glp-2, oxyntomodulin (oxm), and glucagon are proglucagon - derived peptides. proglucagon is expressed in the pancreas, l - cells of the small intestine, and in the nts of the brainstem [64, 65 ]. glucagon is produced in the pancreas, whereas oxm, glp-1, and glp-2 are the major products in the brain and intestine. glp-1 is cosecreted with pyy from l cells in the intestine in response to nutrient intake. enzymatic degradation by dppiv and renal clearance rapidly inactivate and remove glp-1 from plasma circulation, respectively [67, 68 ], thus accounting for its short plasma half - life of 1 - 2 minutes. glp-1 has two biologically active forms, glp-1 (737) and glp-1 (736) amide, the latter being the major circulating form in humans. glp-1 exerts its effect at the glp-1r to stimulate adenylyl cyclase activity and thereby camp production. glp-1r is widely distributed particularly in the brain, gi tract, and pancreas [71, 72 ]. intravenous infusion of glp-1 results in a dose - dependent reduction of food intake in both normal weight and obese subjects ; however obese subjects have a blunted postprandial glp-1 response compared to lean subjects. glp-1 possesses a potent incretin effect in addition to its anorectic action ; it stimulates insulin secretion in a glucose - dependent manner following ingestion of carbohydrate. continuous subcutaneous infusion of glp-1 to patients with type 2 diabetes for 6 weeks reduces appetite, body weight and improves glycaemic control. exendin-4, a naturally occurring peptide from the saliva of the gila monster lizard, is a dppiv - resistant glp-1r agonist. exendin-4 (exenatide, byetta) has been approved for type 2 diabetes in conjunction with either metformin, a sulphonylurea, or both drugs. twice - daily subcutaneous injection of exendin-4 to type 2 diabetes patients failing to achieve glycaemic control with maximal doses of metformin improves glycaemic control and decreases body weight. once - weekly subcutaneous injection of a long - acting exenatide preparation and once - daily subcutaneous injection of the glp-1 analogue called liraglutide demonstrate greater improvements in glycaemic control than twice - daily exenatide administration [79, 80 ]. most recently, glp-1 and exendin-4 have been shown to promote cellular growth and reduce apoptosis in nervous tissues. glp-1 receptor stimulation has been shown to have neuroprotective effect in models of parkinson 's disease [8385 ], alzheimer 's disease [86, 87 ], cerebrovascular stroke, and peripheral neuropathy. further work is needed to determine if glp-1 analogues could be potential novel therapies for patients with these neurological and neurodegenerative diseases. glp-2 is released from enteroendocrine cells in a nutrient - dependent manner, like glp-1. acute or chronic administration with glp-2 has no effect on food intake in either rodents or humans [89, 90 ]. however, glp-2 has an intestinal trophic effect [91, 92 ], and chronic subcutaneous administration of glp-2 stimulates crypt cell proliferation. as such, glp-2 analogues have been developed for use in patients with inflammatory bowel disease. in addition, some studies have demonstrated a reduction in gastric emptying in humans by glp-2, although the effect is not as potent as glp-1. oxm is another product of the proglucagon gene and is released from l - cells of the intestine in response to ingested food and in proportion to caloric intake. administration of oxm reduces food intake and increases energy expenditure in both rodents and humans [9698 ]. the anorectic effect of oxm is blocked by the glp-1r antagonist exendin 939 and is abolished in glp-1r null mice ; this suggests that oxm mediates its effects via the glp-1r. however oxm has relatively low in vitro affinity for the glp-1r which is 50 fold lower than the affinity of glp-1 for glp1r. this raises the possibility that a further receptor through which oxm mediates its anorectic effect has yet to be identified. indeed, several actions of oxm appear to be independent of the glp-1r [97, 101, 102 ]. for example, the cardiovascular effects of oxm are preserved in glp-1r knockout mice. like glp-1, oxm is inactivated by dppiv ; hence oxm analogues resistant to dppiv degradation are being developed as potential obesity treatments. ghrelin is the only known orexigenic gut hormone and was identified as an endogenous ligand for the growth hormone secretagogue receptor (ghs - r) in rat stomach. both central and peripheral administrations of ghrelin increase food intake and body weight with a reduction in fat utilisation in rodents [106, 107 ]. in human, fasting plasma levels of ghrelin are high in patients with anorexia nervosa and in subjects with diet - induced weight loss. by contrast, obese subjects display a less marked drop in plasma ghrelin after meal injection. plasma ghrelin levels are elevated in cachectic patients with heart failure as compared with noncachectic patients with heart failure and control subjects. furthermore elevated circulating ghrelin levels are observed in patients with pws compared with individuals with nonsyndromic forms of obesity. dysregulation of ghrelin secretion is also implicated in the mechanism through which sleep disturbance contributes to obesity. subjects with short sleep duration have elevated ghrelin levels, reduced leptin, and high body mass index compared with subjects with normal sleep duration. evidence suggests that ghrelin mediates its orexigenic action via stimulation of npy / agrp coexpressing neurons within the arc of hypothalamus. peripheral administration of ghrelin increases c - fos expression in arc npy / agrp neurons, and ablation of both agrp and npy neurons completely abolishes the orexigenic effect of ghrelin. brainstem and vagus nerve may also contribute to the effects of ghrelin on food intake. furthermore blockade of gastric vagal afferents in rats abolishes ghrelin - induced feeding and prevents the ghrelin - induced rise in c - fos expression within the arc. ghrelin may promote food intake in part by enhancing the hedonic responses to food cues. using functional magnetic resonance imaging during exposure to food pictures revealed increased activation in the amygdala, orbitofrontal cortex, anterior insula, and striatum, during intravenous infusion of ghrelin. furthermore the effects of ghrelin on the response of amygdala and orbitofrontal cortex were correlated with self - rated hunger ratings. cck is secreted postprandially by the i cell of the small intestine into circulation, with a short plasma half - life of a few minutes. cck is reported to reduce food intake in human and rodents [119, 120 ]. there are two cck receptor subtypes ; cck1 and cck2 receptors, previously classified as cck a and cck b. the anorectic action of cck appears to be mostly mediated via cck1 receptors on the vagal nerve [121, 122 ]. cck 1 and 2 receptors are widely distributed in brain including the brainstem and hypothalamus. intermittent prandial cck infusion reduces meal size in rats but provokes a compensatory increase in meal frequency. in addition, a 2-week continuous intraperitoneal infusion of cck failed to suppress food intake at any time point. adiposity signals are involved in the long - term regulation of energy balance, while gut peptides modulate food intake on a meal - by - meal basis. circulating levels of insulin and leptin are positively correlated with adipose tissue mass within the body and are implicated in the long - term regulation of energy balance. insulin is synthesized in the cells of the pancreas and secreted rapidly after a meal, with well - characterised hypoglycaemic effects. however intracerebroventricular administration of insulin also results in a dose - dependent suppression of food intake and body weight gain in baboons and rodents [127, 128 ]. leptin is secreted by adipocytes with circulating levels proportional to fat mass with a diurnal and pulsatile pattern, peaking at night. however obese subjects are resistant to leptin, which may account for its lack of effectiveness in such individuals [131, 132 ]. obesity, the metabolic syndrome, and their associated risk factors of cardiovascular disease and diabetes mellitus are among the most important health issues facing modern economies regardless of geographical location. recent work has revealed that energy homeostasis is maintained by an array of complex pathways. the presence of multiple, overlapping feeding mechanisms reflects the vital nature of feeding behaviour for survival. however these homeostatic feeding mechanisms may be viewed as maladaptive in obese individuals exposed to diets with a high calorific content. several gut hormones are thought to play a role in the sustained weight loss observed following bypass surgery ; hence mimicking bypass surgery by administration of gut hormone - derived therapies could offer a promising treatment for obesity. a further understanding of the pathogenesis of obesity and the role of gut hormones in appetite regulation is imperative. | obesity has received much attention worldwide in association with an increased risk of cardiovascular diseases, diabetes, and cancer. at present, bariatric surgery is the only effective treatment for obesity in which long - term weight loss is achieved in patients. by contrast, pharmacological interventions for obesity are usually followed by weight regain. although the exact mechanisms of long - term weight loss following bariatric surgery are yet to be fully elucidated, several gut hormones have been implicated. gut hormones play a critical role in relaying signals of nutritional and energy status from the gut to the central nervous system, in order to regulate food intake. cholecystokinin, peptide yy, pancreatic polypeptide, glucagon - like peptide-1, and oxyntomodulin act through distinct yet synergistic mechanisms to suppress appetite, whereas ghrelin stimulates food intake. here, we discuss the role of gut hormones in the regulation of food intake and body weight. |
insulin resistance (ir) is a complicated metabolic disorder with a wide range of clinical traits. ir means that circulating insulin does not do its function in insulin sensitive tissues such as skeletal muscle, adipose tissue, liver, and endothelium. ir is related with central obesity, low high - density lipoprotein cholesterol, high triglycerides, raised blood pressure, and hemostatic defects. diet, body composition, and usual physical activity (pa) levels are known factors. diet management is a key component in the long - term health and quality of life of people with ir, and many features of the diet composition have been considered to be critical in the alteration of ir. one of these diets is the dietary approaches to stop hypertension (dash), which encourages the eating of vegetables, fruits, and low - fat dairy products with sodium restriction. this diet is high in unsaturated fatty acids, fiber, antioxidant constituents, and low - fat dairy, which may be beneficial for decreasing ir. the metabolic efficiency of the dash diet, including its impact on insulin sensitivity is less known. genetic variations with affecting on insulin signaling, as well as environmental factors such as diet and pa, plays an important role in insulin sensitivity. candidate genes for insulin sensitivity either directly or indirectly encode the proteins, which are participated in glucose metabolism. insulin receptor substrate (irs) type 1 which is a main substrate for the insulin receptor, controls insulin signaling in skeletal muscle, adipose tissue, and the vascular, so it is an important candidate gene for ir. it is determined that decreased tyrosine phosphorylation of the irs1 proteins and dysregulation of the insulin receptor participates in peripheral ir and b - cell malfunction. the gene - environmental interaction may effect on insulin sensitivity, clarify the fundamental mechanisms of type 2 diabetes, and provide effective prevention strategies. dietary factors and nutrient intake are the main environmental factors in the incident and expansion of the typical polygenic, diet - related diseases such as ir. to date, no intervention studies in humans have thoroughly explored the effects of dash diet on gene expression. the purpose of this study, therefore, was to evaluate whether dash diet effects on irs1 gene expression and ir. fifty - one healthy, overweight, or obese (body mass index > 25 kg / m) female volunteers aged 20 - 50 years that were referred by the general health center were recruited. subjects were not included by nutritionist if they were pregnant or lactating women or they had history of incidence of cardiovascular, gastrointestinal, hepatic, renal, thyroid, diabetes, rheumatoid arthritis, lupus, severe infection, trauma, allergy, and if they consumed of multivitamin and mineral or omega-3 fatty acids supplements, antacid drugs that containing magnesium and calcium, aspirin and nonsteroidal anti - inflammatory drugs, anti - inflammatory and anti - depressant, and hormone drugs. they were excluded if they had changed their normal pa or they had not complete compliance. the nature of the trial was explained to the individuals, and all subjects provided written informed consent. after a 2-week run - in period with the usual dietary advices (uda) diet participants were randomly assigned to 12 weeks to a uda diet or the dash diet. we conducted a run - in to homogenize in the consumption of macronutrients and base of diets. in this period group assignments were made by statistic using random sequencing created in spss (spss inc., the nutritionist that prescribed the diets had to be aware of the group assignment, but laboratory staff members were not aware of that. participants were controlled every 2 weeks, and measurements were taken. during the study period, patients were prescribed the diet and prepared their own meals while living independently. they were demanded to record their pa for 3 days every month and not to change and it was assessed by using compendium of pa. participants were randomly assigned to one of two diets : a uda diet and the dash diet. the uda group was not given a diet and simply recommended to eat as regular and the intervention group was prescribed dash diet that was rich in fruits, vegetables, whole grains, and low - fat dairy products, and low in saturated fat, total fat, cholesterol, refined grains, sweets, and red meat. furthermore, it contained 2400 mg sodium per day [table 1 ]. to calculate the energy requirement for each participant the diets were individually prescribed using a calorie count system, and an exchange list was given to each patient for changing food items and counting the calories. every participant had to bring her 3-day dietary records every month, and trained nutritionist reviewed the diaries. in these sessions, they were questioned about their diets and the food items that they should be eaten and their compliance was assessed by analyzing the three food record diaries by the nutritionist iv software (version 7.0 ; n - squared computing, salem, or, usa) that was modified for iranian food items. dietary goals of the dash intervention versus usual dietary advice participants were weighed wearing minimal clothing and without shoes, using digital scales (seca, germany) and recorded to the nearest 0.1 kg. height was measured without shoes in a standing position while the shoulders were in a normal state. waist circumference was measured where the waist was narrowest and the hip at the maximum level over light clothing, using an outstretched tape, without any pressure to the body surface and measurements were recorded to the nearest 0.1 cm. blood samples (5cc) were collected at baseline and at 12 weeks, and human peripheral blood mononuclear cells (pbmc) was isolated by centrifugation on a ficoll - paque plus (amersham biosciences) density gradient. total rna was isolated from the pbmc using trizol reagent (invitrogen) according to the manufacturer 's instructions. briefly, 1.0 ml trizol reagent and 200 l chloroform were added to the sample, and the admixture was vortexed for 15 s and stood at 25c for 3 min. the supernatant was transferred to a fresh tube after centrifugation at 12,000 g for 15 min at 4c, and then 500 l isopropanol was added. the mixture was centrifuged at 12,000 g for 10 min at 4c after incubation at 20c for 20 min, to remove the supernatant and the rna pellet was washed with 75% ethanol. ethanol was removed by centrifugation at 7500 g for 5 min at 4c, and rna was air - dried for 5 min and then dissolved in 25 l rnase - free water. the purity of isolated rna was ascertained by od260/280 using a nanodrop nd-1000 (thermo scientific, worcester, ma). isolated rna was dissolved in rnase - free water, and the amount of rna was determined by measuring absorbance at 260 nm with a spectrophotometer. the rna samples were treated with dnase i (thermo scientific) in order to avoid potential contamination with genomic dna. two micrograms of total rna were used to synthesize double - stranded cdna by revert aid first strand cdna synthesis kit (thermo scientific) and oligo dt primers. the primers for all assayed genes were designed using the allele i d 7 software (premier biosoft international, palo alto, usa) [table 2 ]. the real - time polymerase chain reaction (pcr) was performed using sybr green pcr master mix (thermo scientific) and the step one plus real time pcr detection system (applied bio systems). the expression level of each target gene was calculated as 2, as previously described. primers used in real - time pcr the normality of continuous variables was assessed by normal probability plots and by one - sample kolmogorov - smirnov test. paired - samples t - test and tests were used to determine the significance of any baseline differences between diet groups. energy - adjusted dietary intake of nutrients was computed using the residual method and compared using analysis of covariance. we used independent sample t - test and paired - samples t - test to compare means of all variables within and between two groups, respectively. statistical analyses were performed by using the spss - software package 16.0 (spss inc., chicago, il), statistical power was 90%, and a priori defined value of p < 0.05 was considered statistically significant. this study was a randomized, parallel clinical trial. after a 2-week run - in period with the usual dietary advices (uda) diet participants we conducted a run - in to homogenize in the consumption of macronutrients and base of diets. in this period, patients consumed a uda diet. group assignments were made by statistic using random sequencing created in spss (spss inc., the nutritionist that prescribed the diets had to be aware of the group assignment, but laboratory staff members were not aware of that. participants were controlled every 2 weeks, and measurements were taken. during the study period, patients were prescribed the diet and prepared their own meals while living independently. they were demanded to record their pa for 3 days every month and not to change and it was assessed by using compendium of pa. participants were randomly assigned to one of two diets : a uda diet and the dash diet. the uda group was not given a diet and simply recommended to eat as regular and the intervention group was prescribed dash diet that was rich in fruits, vegetables, whole grains, and low - fat dairy products, and low in saturated fat, total fat, cholesterol, refined grains, sweets, and red meat. furthermore, it contained 2400 mg sodium per day [table 1 ]. to calculate the energy requirement for each participant the diets were individually prescribed using a calorie count system, and an exchange list was given to each patient for changing food items and counting the calories. every participant had to bring her 3-day dietary records every month, and trained nutritionist reviewed the diaries. in these sessions, they were questioned about their diets and the food items that they should be eaten and their compliance was assessed by analyzing the three food record diaries by the nutritionist iv software (version 7.0 ; n - squared computing, salem, or, usa) that was modified for iranian food items. participants were weighed wearing minimal clothing and without shoes, using digital scales (seca, germany) and recorded to the nearest 0.1 kg. height was measured without shoes in a standing position while the shoulders were in a normal state. waist circumference was measured where the waist was narrowest and the hip at the maximum level over light clothing, using an outstretched tape, without any pressure to the body surface and measurements were recorded to the nearest 0.1 cm. blood samples (5cc) were collected at baseline and at 12 weeks, and human peripheral blood mononuclear cells (pbmc) was isolated by centrifugation on a ficoll - paque plus (amersham biosciences) density gradient. total rna was isolated from the pbmc using trizol reagent (invitrogen) according to the manufacturer 's instructions. briefly, 1.0 ml trizol reagent and 200 l chloroform were added to the sample, and the admixture was vortexed for 15 s and stood at 25c for 3 min. the supernatant was transferred to a fresh tube after centrifugation at 12,000 g for 15 min at 4c, and then 500 l isopropanol was added. the mixture was centrifuged at 12,000 g for 10 min at 4c after incubation at 20c for 20 min, to remove the supernatant and the rna pellet was washed with 75% ethanol. ethanol was removed by centrifugation at 7500 g for 5 min at 4c, and rna was air - dried for 5 min and then dissolved in 25 l rnase - free water. the purity of isolated rna was ascertained by od260/280 using a nanodrop nd-1000 (thermo scientific, worcester, ma). isolated rna was dissolved in rnase - free water, and the amount of rna was determined by measuring absorbance at 260 nm with a spectrophotometer. the rna samples were treated with dnase i (thermo scientific) in order to avoid potential contamination with genomic dna. two micrograms of total rna were used to synthesize double - stranded cdna by revert aid first strand cdna synthesis kit (thermo scientific) and oligo dt primers. the primers for all assayed genes were designed using the allele i d 7 software (premier biosoft international, palo alto, usa) [table 2 ]. the real - time polymerase chain reaction (pcr) was performed using sybr green pcr master mix (thermo scientific) and the step one plus real time pcr detection system (applied bio systems). the expression level of each target gene was calculated as 2, as previously described. the normality of continuous variables was assessed by normal probability plots and by one - sample kolmogorov - smirnov test. paired - samples t - test and tests were used to determine the significance of any baseline differences between diet groups. energy - adjusted dietary intake of nutrients was computed using the residual method and compared using analysis of covariance. we used independent sample t - test and paired - samples t - test to compare means of all variables within and between two groups, respectively. statistical analyses were performed by using the spss - software package 16.0 (spss inc., chicago, il), statistical power was 90%, and a priori defined value of p < 0.05 was considered statistically significant. one patient was diagnosed with polycystic syndrome and another with high weight change, so these two patients had to be excluded from the analyses. five patients deviated from the study protocol and therefore, their data were not available. differences in distribution of several characteristics among 22 individuals in dash group and 22 subjects within the uda group are shown in table 3. the mean patient age was 38 8 years in uda group and 37 9 years in the intervention group. there was no difference between groups regarding age, socioeconomic status, weight, pa, and gene expression at the baseline. consort diagram template effects of recommendations to follow the dash diet and uda diet on anthropometric, gene expression (mean values with their sd) analysis of diet showed that calorie and protein intake of two groups was not significantly different between groups, but these two diets were different in total fat and fat composition intake, as well as the percentage of the carbohydrate intake. these two diets were different in sodium content although these differences were not statistically significant but nutritionally are important. the dash diet had a higher amount of calcium, potassium, and fiber [table 4 ]. daily energy and nutrient intakes in dash group and uda group at baseline an at end of the study the result of reverse transcription - pcr showed that dash diet significantly increased the expression of irs1 compared to uda group (p = 0.000) and after adjusting for weight change, the results did not appreciably alter. this suggests that dash diet may increase the expression of irs1 [table 3 ]. the finding of this study indicated that the dash diet could induce the expression of irs1, which is an early substrate for the insulin receptor and plays a key role in mediating some of the insulin 's actions. however, to the best of our knowledge, effect of the dash diet on gene expression has not been reported previously, but a number of studies show the dash diet is high in fiber, unsaturated fatty acids, antioxidant components, and low - fat dairies improve ir. the mechanism behind this effect is not clear, but it may be due to the increased expression of some genes such as irs1 whose activation leads to translocation of glut4-containing vesicles and subsequent increase in glucose uptake. because irs1 is a membrane - bound protein and its function is membrane - dependent, it is logical to hypothesize that alteration in membrane lipid induced by dietary fat may impression on the function of the plasma membrane insulin receptor. as it can be seen from the table 4, fat intake is significantly less in dash group, and its composition is different between two groups such as polyunsaturated fat (pufa), saturated fatty acid (sfa) and monounsaturated fatty acids (p < 0.05). these findings further support the idea of previous studies have shown that long - term high - fat diets and increased plasma free fatty acid levels impair insulin signaling by alteration in irs1 expression and tyrosine / serine phosphorylation of irs1, leading to decreased irs1-associated pi3k activity. in fact, the insulin - stimulated uptake of glucose in visceral fat deposits and muscle were damaged by the high fat diet (hfd) as corn oil - based hfd intervention causes the expansion of ir concurrently in the liver, adipose tissue, and skeletal muscle in young adult c57bl/6 mice. furthermore, the evidence shows that the diet composition, such as quality and quantity of fat, plays a notable role in glucose homeostasis and insulin sensitivity. it is commonly approved that saturated fats have a negative effect on insulin sensitivity, whereas unsaturated fats have a positive effect. it has been established that a high - pufa diet can increase receptor tyrosine kinase activity and a high pufa : sfa improved insulin receptor function, glucose oxidation, and glucose transport in rats. some studies established that dietary supplementation with calcium and magnesium reduce ir and low amount of potassium, magnesium, calcium, and fiber in the diet are correlated with diminished insulin sensitivity, so fruits and vegetables ; rich sources of magnesium, potassium, and fibers may improve ir. thus, as regard to a transactional study that shown the fruit and vegetable consumption was inversely associated with mrna expression of some pro inflammatory indicators in healthy young adults a possible explanation for our results may be higher fruit and vegetable consumption in dash diet that may similarly effects on ir related genes. in the same way, epidemiologic research data show a useful effect of raised whole grain, nuts, and dairy on diabetes risk and insulin sensitivity. thus, other possible explanations for irs1 up - regulation are consumption more dairy product, and so more ca intake that may be supported by study which show high - calcium whey, causes smaller adipocyte size, can also partly explain the clustering of up - regulated genes in the insulin signaling pathway. another important finding was that weight for the dash diet group significantly has reduced in spite of fixing calorie intake and no change in pa during the study. as regards to the dairy product were higher in the dash diet than the uda diet, this finding are consistent throughout the study which has indicated the macronutrient variability of the dash diet might be related to weight reduction. although the study has successfully demonstrated that dash diet induces irs1 expression, it has certain limitations in terms of dietary intake in this study was self - reported, and patients were advised to follow a special diet rather than getting prepared foods, thus possibly lead to incomplete adherence to the diets. dash diet increased irs1 gene expression and it may be one of the mechanisms, which diets influence on ir. food security research center, isfahan university of medical sciences. mk involved in conception, design, data collection, statistical analysis, and data interpretation. | background : insulin receptor substrate (irs) type 1 is a main substrate for the insulin receptor, controls insulin signaling in skeletal muscle, adipose tissue, and the vascular, so it is an important candidate gene for insulin resistance (ir). we aimed to compare the effects of the dietary approaches to stop hypertension (dash) and usual dietary advices (uda) on irs1 gene expression in women at risk for cardiovascular disease.materials and methods : a randomized controlled clinical trial was performed in 44 women at risk for cardiovascular disease. participants were randomly assigned to a uda diet or the dash diet. the dash diet was rich in fruits, vegetables, whole grains, and low - fat dairy products and low in saturated fat, total fat, cholesterol, refined grains, and sweets, with a total of 2400 mg / day sodium. the uda diet was a regular diet with healthy dietary advice. gene expression was assessed by the real - time polymerase chain reaction at the first of study and after 12 weeks. independent sample t - test and paired - samples t - test were used to compare means of all variables within and between two groups respectively.results:irs1 gene expression was increased in dash group compared with uda diet (p = 0.00). weight and waist circumference decreased in dash group significantly compared to the uda group (p < 0.05) but the results between the two groups showed no significant difference.conclusion:dash diet increased irs1 gene expression and probably has beneficial effects on ir risks. |
all persons living in 2 sami municipalities in northernmost finland (inari and utsjoki) on 31 december 1978 were identified from the finnish population information system. the sami were identified by using the material of the finnish international biological program, human adaptability section. those data were produced by interviewing the sami themselves and by genealogical sources (1, 11). in the current study, a person representing at least 75% of any ethnic subgroup of sami was classified as a sami. because of historical computational reasons, the non - sami were restricted to those born between the 1st and 24th day of any month of any year. the final cohort consisted of 2,091 sami and 4,161 non - sami people. all persons in this cohort had personal identity codes given to all residents who have lived in finland in 1967 or later and used in all person registers in finland. the cohort was updated from statistics finland with information on dates and causes of death up to 31 december 2009. the cohort was also linked with the finnish cancer registry including incident cancer cases diagnosed during 19792009. the outcome is a net survival measure representing survival from a specified cause of death, in this case the patients cancer, in the absence of other causes of death. the survival times of individuals who died from causes other than those specified are considered to be censored. the cancer - specific survival experience of patients classified as sami and non - sami was compared with that of the finns outside the cohort. the 5-year cancer - specific survival was estimated only for all cancers combined because of the small numbers of individual cancers. to produce comparative cancer - specific survival figures, the sami cancer patients were matched to other finnish cancer patients obtained from the finnish cancer registry with respect to site, gender, age at diagnosis and year of diagnosis, and in a separate analysis also with respect to the stage. the stage was analyzed in five categories : (a) localized, (b) regional, (c) distant, (d) non - localized, not known whether regional or distant, and (e) unknown. cancer - specific analyses were conducted using the matched cox regression model (12). weighted survival analyses were made separately for sami and non - sami cancer patients using the kaplan - meier method. the weight for each matched control was calculated as the inverse of the number of controls for each case (i.e. weight=1/number of controls for each case). the statistical software stata was used to calculate 5-year cumulative weighted cause - specific survival figures. in addition to the cancer - specific analyses, regular matched overall or all - cause survival analyses were also performed, disregarding the cause of death information. all persons living in 2 sami municipalities in northernmost finland (inari and utsjoki) on 31 december 1978 were identified from the finnish population information system. the sami were identified by using the material of the finnish international biological program, human adaptability section. those data were produced by interviewing the sami themselves and by genealogical sources (1, 11). in the current study, a person representing at least 75% of any ethnic subgroup of sami was classified as a sami. because of historical computational reasons, the non - sami were restricted to those born between the 1st and 24th day of any month of any year. the final cohort consisted of 2,091 sami and 4,161 non - sami people. all persons in this cohort had personal identity codes given to all residents who have lived in finland in 1967 or later and used in all person registers in finland. the cohort was updated from statistics finland with information on dates and causes of death up to 31 december 2009. the cohort was also linked with the finnish cancer registry including incident cancer cases diagnosed during 19792009. the outcome is a net survival measure representing survival from a specified cause of death, in this case the patients cancer, in the absence of other causes of death. the survival times of individuals who died from causes other than those specified are considered to be censored. the cancer - specific survival experience of patients classified as sami and non - sami was compared with that of the finns outside the cohort. the 5-year cancer - specific survival was estimated only for all cancers combined because of the small numbers of individual cancers. to produce comparative cancer - specific survival figures, the sami cancer patients were matched to other finnish cancer patients obtained from the finnish cancer registry with respect to site, gender, age at diagnosis and year of diagnosis, and in a separate analysis also with respect to the stage. the stage was analyzed in five categories : (a) localized, (b) regional, (c) distant, (d) non - localized, not known whether regional or distant, and (e) unknown. cancer - specific analyses were conducted using the matched cox regression model (12). weighted survival analyses were made separately for sami and non - sami cancer patients using the kaplan - meier method. the weight for each matched control was calculated as the inverse of the number of controls for each case (i.e. weight=1/number of controls for each case). the statistical software stata was used to calculate 5-year cumulative weighted cause - specific survival figures. in addition to the cancer - specific analyses, regular matched overall or all - cause survival analyses were also performed, disregarding the cause of death information. there were 204 cancer cases in the sami cohort, 391 in the non - sami cohort. the number of controls was 20,181 when cancer patients were matched with respect to site, gender, age at diagnosis and year of diagnosis and 7,874 when also matched with respect to stage. survival until 5 years after diagnosis was first compared without considering the stage and later also matching for stage. in the cancer - specific analysis without stage variable, the hazard ratio for sami was 1.05 (95% ci 0.851.30) and for non - sami 1.02 (0.861.20). when the sami cancer patients were also matched according to the stage of the cancer, the cancer - specific analyses gave a hazard ratio for the sami 1.02 (0.781.33) and for the non - sami 1.10 (0.911.33). the hazard ratios in the all - cause observed 5-year survival analysis were 1.13 (0.941.37) for the sami and 0.97 (0.841.12) for the non - sami. in the survival curves (fig. 1) a small difference can be seen between survival of the sami and matched controls. the curves of sami and non - sami and their matched controls run at different levels in the figures. cumulative cancer - specific survival curves of all cancer sites combined for the sami and non - sami cancer patients in inari and utsjoki compared with controls of finnish population, matched with respect to site, gender, age at diagnosis and year of diagnosis. only the survival of all sites of cancer could be assessed because of the low number of cancer cases. because the different sami groups could only be assessed together due to the small numbers of cancer cases in each of them, the possible survival differences between the sami categories could not be assessed. the starting assumption of this study was that both genetic or lifestyle features of the sami, and long distances to the medical care and to hospitals could have an influence on the survival of cancer. the results, however, do not support these hypotheses. about half of the sami people in this cohort were born before 1950, and hence have been living according to the traditional sami culture. the quality of food was healthy, including reindeer meat, fish and berries. before the era of cars and other motor vehicles, the sami had to do a lot of exercise. the increased communication between the sami area and other districts brought along more smoking, alcohol drinking, and unhealthy eating habits, but also a higher living standard, better health care and facilities, making life easier. finnish legislation since 1969 has made it possible to get a 75% subsidy for the costs for building new reindeer farms, and in that way affecting the well - being and health of reindeer herders. the skolt sami have their own legislation, which helps their living conditions. from the 1970s, the ways of life of the sami and the non - sami have been very much alike, also with regard to how they seek health services. a publication from the usa describes and compares cancer - specific survival ratios of patients of 6 major racial or ethnic groups during the years 19751997 in the usa (13). in 19751987, the cancer survival ratio of american indian and alaskan native patients was the lowest ; 25% in males and 36% in females (13). although the 5-year survival ratios of cancer patients during 19881997 in any group were more favourable than in 19751987, the differences between ethnic groups persisted. an 11 percent - unit lower all - site cancer survival ratio was reported in a comparison between the alaska natives and the usa caucasian cancer patients in 19841994 (14). however, the mortality / incidence ratios in the northernmost finland in the 1950s suggest that the survival of cancer patients in that area was worse than in the rest of finland, but the difference disappeared before the 1970s, thanks to a more rapid decrease in the mortality / incidence ratio in the north (15). it is likely that the survival of patients with cancer (and other diseases) improves when the living standard increases and the living conditions get better. one has to remember that the living circumstances such as distances, living standards, and social situations of indians and alaskan natives are quite different from those of the sami in finland. the explanation for the similar cancer survival of sami and non - sami and the finnish population might be the similar possibilities to get physician consultations and care everywhere in finland. when the sickness insurance act came into force 1964, it recognized the need for travelling to the medical doctor. from that time on it was possible to get reimbursement for travelling costs. for those who lived far from services (health centre, shops, banks etc.), it was practical to also manage other things such as shopping when coming to visit the doctor. hence, the threshold to visit the doctor was rather low, similarly for the sami and non - sami from the northernmost finland. in the past, language has been a problem, because all the 3 sami groups in finnish lapland speak different sami languages, and it is clear that physicians and public health nurses, who came from the south did not speak sami at all, and sami nurses spoke only their own sami language. the utsjoki municipality later got northern - sami speaking general practitioners (gp) and nurses. today health care workers receive a salary increment if they speak a sami language. when the public health act came into force in 1972, it was a big step towards better health care, especially in the sparsely populated rural areas. new health centres, often with beds, were built, more posts for medical doctors and other staff were established, and especially, the health education and early detection of diseases was prioritized. the equality in health care should have been realized, providing the same system and same rules for everybody. in the inari health centre during the time of this study, there were 6 gp posts and 35 beds. a local deviation or application from the public health act was that the doctors met patients not only in health centres but also in remote sami villages. when travelling to the remote villages, the gp also made home visits on the way. in the inari municipality and partly also in utsjoki, there were the same gps working from the beginning of the 1970s until they gradually retired from 2005. these gps knew well the population and circumstances, which benefits the early diagnosing of diseases, also cancer. the sami and non - sami in utsjoki and inari had all possibilities for early detection, which is an important reason for better survival. from the present study we see that there was no difference between the results with and without adjustment for the stage. when the nearest central hospital in rovaniemi got its own oncologist in the beginning of 1990s, most cancer patients no longer needed to travel to oulu (another 200 km further), unless a specialized treatment such as radiotherapy was required. because of the experienced gps and good cooperation with the central hospital oncologist, it was possible to follow the treatment plan in the local health centre and carry out such cancer treatments (e.g. chemotherapy), which normally are implemented in central hospitals. special investigations such as tomography, mri and ultrasound were done in the central hospital. the survival curves of the sami cancer patients and their control cancer patients matched according to sex, age and cancer type were on a lower level than the respective curves for the non - sami and their controls (fig. 1). the reason for this difference is the different cancer type distribution of the sami and non - sami. the sami have a lower incidence of cancers with high survival (cancers of the skin, breast, prostate, testis, kidney, bladder and thyroid, and hodgkin lymphoma) than the non - sami, while the incidence of more lethal common cancer types such as stomach cancer or lung cancer is not lower (4). the sami persons were also older than the non - sami, and older cancer patients tend to have lower relative survival rates than young ones. there was no difference between the all - cause survival of sami and non - sami and other patients in finland. the higher mortality hazard in the sami patients may well also reflect a higher mortality from the other causes of death (10), which may as well be partly due to the higher age of the sami compared to the non - sami. during the study period (19792009), the survival of cancer patients in the far north has been the same as in finland generally. that concerns both sami and non - sami patients, which means that neither long distances in finland nor ethnic background have an effect on surviving. these results might also tell something about good and persistent patient - physician relationships (early detection), which are known to advance the surviving of all diseases. the authors have not received any funding or benefits from industry or elsewhere to conduct this study. | objectivesthe incidence of cancer among the indigenous sami people of northern finland is lower than among the finnish general population. the survival of sami cancer patients is not known, and therefore it is the object of this study.study designthe cohort consisted of 2,091 sami and 4,161 non - sami who lived on 31 december 1978 in the two sami municipalities of inari and utsjoki, which are located in northern finland and are 300500 km away from the nearest central hospital. the survival experience of sami and non - sami cancer patients diagnosed in this cohort during 19792009 was compared with that of the finnish patients outside the cohort.methodsthe sami and non - sami cancer patients were matched to other finnish cancer patients for gender, age and year of diagnosis and for the site of cancer. an additional matching was done for the stage at diagnosis. cancer - specific survival analyses were made using the kaplan meier method and cox regression modelling.resultsthere were 204 sami and 391 non - sami cancer cases in the cohort, 20,181 matched controls without matching with stage, and 7,874 stage - matched controls. in the cancer - specific analysis without stage variable, the hazard ratio for sami was 1.05 (95% confidence interval 0.851.30) and for non - sami 1.02 (0.861.20), indicating no difference between the survival of those groups and other patients in finland. likewise, when the same was done by also matching the stage, there was no difference in cancer survival.conclusionlong distances to medical care or sami ethnicity have no influence on the cancer patient survival in northern finland. |
utilizing the patient s immune system represents a promising approach for eradication of cancer. the immune system is well equipped to identify and eliminate malignant cells, but cancer cells can escape from immune surveillance, which can lead to the development of tumors with the potential to metastasize. cancer vaccines aim to evoke a strong adaptive immune response against tumor antigens, and among many different strategies applied in recent years, synthetic peptide epitopes have been an important approach for t cell based immunotherapy of cancer. however, unsatisfactory antitumor effects in both animal models and humans have raised the question whether these peptide epitopes, even in combination with strong adjuvants, are sufficiently immunogenic. insufficient efficiency of minimal peptide - based vaccines may be due to their rapid extracellular degradation, fast diffusion from the site of injection and poor uptake by antigen - presenting cells, including dendritic cells (dcs), as well as lack of generation of costimulatory signals. in some publications, short peptide vaccines have been reported to induce t - cell tolerance and anergy by direct binding to major histocompatibility complex (mhc) molecules on all cells, instead of only antigen presenting cells. therefore, synthetic long peptides (slps) have been proposed as a solution of these drawbacks of the minimal peptide epitope vaccines. however, slps are still prone to enzymatic degradation by proteases present in blood and also by endopeptidases and exopeptidases present on the surface of dcs. moreover, due to their relatively small size, these peptide vaccines are rapidly cleared from the injection site, and as a consequence, their uptake by dcs is limited. furthermore, lack of information on pharmacokinetic and physical properties (solubility / aggregation) of peptide vaccines impedes control and prediction of immune responses. numerous studies have demonstrated that delivery of peptide vaccines through particulate carriers (e.g., polymeric or lipidic nanostructures) can improve the efficacy of peptide epitopes through, for example, protection against degradation and better uptake by dcs. self - assembling peptides have gained increasing attention as a way to construct biomaterials for biomedical applications such as scaffolds for tissue engineering or nanomaterials for drug and vaccine delivery. self - assembling peptides can be synthesized by both standardized solid phase peptide synthesis methods and recombinant technology. furthermore, these peptides are easy to formulate since simple dispersion in aqueous media results in the spontaneous formation of discrete and uniform particles, without the need for laborious processing as often the case for other particulate systems. furthermore, other functionalities such as adjuvanticity and receptor / cell specificity can be introduced in a single polypeptide. in the present study, we have designed short amphiphilic peptides (sa2 and sa7 : ac - aavvlllwe27-cooh) that form nanovesicular structures in aqueous solution. the self - assembly was due to both hydrophobic clustering and intermolecular hydrogen bond formation as driving forces. progress in polymer science has resulted in a variety of polymers suitable for drug delivery applications. particularly, stimuli - responsive polymers that respond to certain stimuli such as ph, temperature, light, magnetism, or ultrasound have received tremendous interest in the last decades. as an example, poly(n - isopropylacrylamide) (pnipam), is hydrophilic and water - soluble below the so - called lower critical solution temperature (lcst), whereas above this temperature of 33 c it is insoluble in water and precipitates. because of the aim of this study was to augment the immunogenicity of peptide epitopes by conjugating them to self - assembling moieties to obtain well - defined nanostructures for cancer immunotherapy. in the present study, the ova250264 peptide (sgleqlesiinfekl (covering a cd8 epitope of ovalbumin : siinfekl)) and the hpv16 e74357 of the e7 protein of human papillomavirus type 16 (gqaepdrahynivtf (covering both a cd8 epitope rahynivtf and a cd4 + epitope pdrahyni)) were conjugated to the hydrophobic domain of the sa2 peptide (ac - aavvlllw - cooh) or to the thermosensitive polymer (pnipam) to trigger peptide self - assembly into discrete nanostructures. the peptide vaccines were biophysically characterized, and their capacity to induce or expand antigen - specific cd8 t cell were tested in mice. finally, in vivo studies in mice were conducted to evaluate the efficacy of sapes that contain the hpv peptide epitope (hpv sapes) as a therapeutic vaccine. acetonitrile (acn), dichloromethane (dcm), dimethylformamide (dmf), methyl - tert - butyl ether (mtbe), n - methyl-2-pyrrolidine (nmp), n - hexane, and diethyl ether were purchased from biosolve bv (valkenswaard, the netherlands). n - isopropylacrylamide (nipam ; > 99%), n, n - dimethyl acrylamide (dmam ; > 99%), deuterium oxide (d2o), deuterated dimethyl sulfoxide, (99.9%, dmso - d6), -bromoisobutyryl bromide, triisopropylsilan, nile red, poly - l - lysine, hexafluoroisopropanol (hfip), and 4-(2-hydroxyethyl) piperazine-1-ethanesulfonic acid (hepes) were purchased from sigma - aldrich (zwijndrecht, the netherlands). n, n - diisopropyl - ethylamine (dipea) was purchased from biosolve (valkenswaard, the netherlands). cucl and cucl2 were obtained from sigma - aldrich (zwijndrecht, the netherlands). g / l) (pbs) was purchased from b. braun (melsungen, germany). iscove s modified dulbecco s medium (imdm) was purchased from lonza (walkersville, usa). cpg odn 1826 (cpg) was purchased from invivogen (cayla, france). pe - labeled h-2d epitope e74957 (rahynivtf)- and pe - labeled h-2d epitope ova257264 (siinfekl)-containing tetramers were constructed and used for the analysis of peptide - specific ctl immunity as described earlier. all other chemicals were of analytical grade, and all aqueous solutions were prepared with millipore milli - q deionized water (18.2 m ; millipore milli - q system, billerica, ma). resin - protected peptide epitopes of ovalbumin (ova250264 : devsgleqlesiinfekl) and human papilloma virus type 16 (hpv 16) oncoprotein e7 (hpv16-e74357 : gqaepdrahynivtf) were ordered from ansynth service bv (roosendaal, netherlands). the purity of the mentioned peptides as determined by reverse - phase hplc and mass spectrometry was > 90%. the characteristics of the other peptides that were used in this study are listed in table 1. the peptides were synthesized by standard solid - phase peptide synthesis and delivered with a purity > 95%. the synthesis of the ova and hpv peptide - atrp macroinitiator is shown in scheme 1. resin - protected peptides (ova250264 or hpv16 e74357) with deprotected n - terminus (equal to 0.1 mmol of the peptide) was dispersed in and washed three times with 5 ml of dried dichloromethane. next, the resin was washed three times with 5 ml of nmp. subsequently, 3 equiv of dipea and 2 equiv of 2-bromo - isobutyryl bromide (relative to nh2 groups) in nmp were added. the kaiser test was done to determine nonreacted free amines, and when this test was negative, the reaction was considered completed. first, the resin washed three times with nmp and subsequently a solution of tfa / water / triisopropylsilan (95/2.5/2.5 v / v / v %) was added and incubated for 4 h at room temperature under vigorous shaking to fully deprotect the peptide. next, the peptide - initiator product was precipitated in a cold mtbe / n - hexane (1/1 ; v / v %), separated, and washed two times with mtbe / n - hexane using centrifugation (3000 g, 5 min, 4 c). the obtained product was dispersed in water and freeze - dried using a christ the molecular masses of the synthesized peptide - initiator was determined by electrospray mass spectrometry. the ova250264- and the hpv16 e74357-poly(nipam) peptide polymer conjugates, referred to as ova - pnipam and hpv - pnipam, and hpv16 e74357-poly(dmam), referred as to hpv - pdmam, were synthesized using atom transfer radical polymerization (atrp). the peptide macroinitiator (20 mol) was dissolved in 2 ml of water / acn (80:20 v / v %) in a screw - capped septum vial. in case of ova250264, the peptide was first dissolved in an alkaline solution (ph 12), and subsequently, the ph was adjusted to ph 8.5 with hcl (0.5 m). in another screw - capped septum vial, 15 mol of cubr, 0.05 mol of cubr2, and 5.3 mmol (600 mg) of nipam or 525 mg of dmam were dissolved in 3 ml of water / acn (80:20 v / v %). the vials were capped with a septum and the solutions were flushed with n2. next, the peptide solution was added to the nipam or dmam solution, flushed with n2, and placed in an ice bath, under rapid stirring. the polymerization was initiated by adding 0.1 ml of 0.4 m me6tren solution in water (degassed by flushing with n2 prior to addition), which immediately turned the reaction mixture blue. periodically, 50 l samples were taken, diluted in air - saturated d2o, and analyzed by h nmr to determine the nipam or dmam conversion. when the conversion was 70%, the reaction was stopped by flushing air into the reaction mixture. the crude product was dialyzed (with dialysis cassettes of 3000 kda mwco) against water at 4 c for 2 days and subsequently lyophilized. the peptide polymer conjugates were characterized by gel permeation chromatography (gpc) using mixed - d columns (polymer laboratories), a solution of 10 mm licl in dmf as eluent, a flow of 0.7 ml / min, and a temperature of 40 c. a refractive index detector was used, and peg standards were used for calibration. all peptide formulations indicated in table 1 (except ova - sa peptide) were prepared as follows. one milligram of the peptide was hydrated with 40 l of 0.2 m naoh solution, and subsequently, phosphate buffered saline (pbs, 140 mm nacl, 13 mm na2hpo4, and 2.5 mm nah2po4, ph 7.4) was added in 200 l portions up to 1 ml. after each step, the peptide dispersion was sonicated in a water bath sonicator (fisher scientific, loughborough, uk) for 3 min at 30 c. before reaching to final volume, the ph was adjusted to ph 7.4 by dropwise adding 0.2 m hcl. to prepare the ova - sa peptide formulation, after solvent evaporation, the obtained peptide film was hydrated in 40 l of 0.2 m naoh, and then similar to other peptide preparations, 1 ml of pbs (140 mm nacl, 13 mm na2hpo4, and 2.5 mm nah2po4, ph 7.4) was added in 200 l portions. after ph adjustment, some of the peptide formulations were supplemented with cpg (20 g per injection ; 10 l of a 2 mg / ml of a stock solution of cpg in pbs) as an adjuvant (table 2). the dose of antigen in ova - sa, ova - pnipam, and ova peptide was 40 nmol / injection (concentration : 200 m). the dose of antigen in hpv - sa, hpv - pnipam, hpv - pdmam, and hpv peptide was 60 nmol / injection (concentration : 300 m). peptide - pnipam formulations were prepared by either a rapid heating or a heat shock procedure. pnipam conjugates and nonthermosensitive peptide - pdmam, as a nonself - assembling peptide polymer conjugate, were dissolved in 10 mm pbs or 20 mm hepes at room temperature. subsequently, some of the formulations were supplemented with cpg (20 g per injection ; 10 l of 2 mg / ml stock solution of cpg in pbs), as an adjuvant (table 2). for the heat shock procedure, 100 l of polymer solution (1 mg / ml) with or without cpg was added to 900 l of pbs or hepes heated at 50 c. next, the self - assembled nanostructures were equilibrated at 37 c for at least 5 min before being analyzed for their physicochemical properties. for the rapid heating procedure, an aqueous polymer solution (110 mg / ml in pbs or hepes) was rapidly heated at 50 c and kept at this temperature for 5 min. subsequently, the formed nanoassemblies were cooled down to 37 c until further analysis. the critical aggregation concentration (cac) of the ova - sa and hpv - sa vaccines was determined using the nile red assay as described by zhang. in short, peptide - based sapes were dissolved in pbs (ph 7.4) in concentrations ranging from 0.1 to 500 g / ml. next, 200 l of each dilution was spiked with 0.2 l of nile red solution (1.25 mm in ethanol). after overnight incubation at room temperature, fluorescence emission (ex550/em635) was measured by a horiba fluorolog fluorometer (horiba jobin yvon, longjumeau cedex, france). the fluorescence intensity at 635 nm was plotted against the logarithm of peptide concentrations to determine the cac. the point of intersection of two linear fits of the plot was considered as the cac value. the cac of ova - pnipam and hpv - pnipam vaccines was determined by dynamic light scattering (dls, malvern instruments, malvern, u.k.). in detail, peptide - pnipam conjugates were dissolved in pbs (ph 7.4) in concentrations ranging from 1 to 1000 g / ml. the thermosensitive spaes (peptide - pnipam) were formed by the rapid heating method, as described above. the z - average diameter (zave, nm) and light scattering intensity (lsi) of the sape dispersion were monitored by dls at 37 c. the lsi was plotted against the logarithm of the conjugate concentrations, and the point of intersection of two linear fits of the plot was considered as the cac of the peptide - pnipam sapes. the prepared sape particles in pbs (ph 7.4) were sized using an alv cgs-3 goniometer system (malvern instruments, malvern, u.k.) equipped with a jds uniphase 22 mw he ne laser operating at 632.8 nm, an optical fiber - based detector, a digital lv / lse-5003 correlator. and a temperature controller (julabo water bath). the dls time correlation was analyzed by alv correlator 3.0 software (alv, langen, germany). zeta potential measurement of the peptide particles was performed in 10 mm hepes, ph 7.0, at 25 c for the peptide peptide and 37 c for the peptide - pnipam assemblies using a malvern zetasizer nano - z (malvern instruments, malvern, u.k.) with universal zen 1002 dip cells and dts (nano) software (version 4.20). dts 1235 latex beads (zeta potential transfer standard, malvern instruments, malvern, u.k.) were used for calibration. the morphology and size of the peptide - pnipam sapes were visualized by transmission electron microscopy (tem). briefly, samples (0.1 mg / ml in hepes 10 mm) were soaked onto prewarmed carbon - coated copper grids for 2 min, and excess liquid was removed by a filter paper. the grids were subjected to negative staining with 2% uranyl acetate (merck, germany) for 45 s and dried for 10 min at room temperature before acquisition of tem images (tecnai 10, philips, the netherlands). atomic force microscopy (afm) was applied to visualize the morphology of the peptide - based vaccines. briefly, 40 l of a 0.02% (w / v) polylysine solution in water was placed on a freshly cleaved mica substrate and, after 5 min incubation, washed with filtered milli - q water followed by drying under n2 flow. next, 30 l of the sample was loaded on the treated mica and incubated for 1 min, followed by washing three times with 20 l of filtrated milli - q water to discharge nonattached particles and salts. scanasyst image mode was used at room temperature with a digital instruments nanoscope v, equipped with silicon nitride cantilevers (veeco, ny, usa). circular dichroism spectra were obtained by a double beam dsm 1000 cd spectrometer (online instrument systems, bogart, ga, usa) using quartz cuvettes with different path length appropriate for the different concentrations. samples of peptide - based sapes (at concentration of 200 mm ova - sa and 300 mm hpv - sa) were prepared in pbs (ph 7.4, 140 mm nacl). five measurements at 25 c using 1 nm intervals and 1 nm bandwidth at a wavelength range from 185250 nm were performed. next, the spectrum of the buffer was subtracted from the averaged spectrum of the samples. to normalize for concentration, tc-1 cells were derived from primary lung epithelial cells of c57bl/6 mice cotransformed with hpv-16 e6 and e7 and c - ha - ras oncogenes. these cells were cultured at 37 c with 5% co2 in imdm, supplemented with 8% fetal calf serum (fcs) (greiner), 400 g / ml of geneticin (g418) (life technology), 2 mm l - glutamine, 1 mm sodium pyruvate, 2 mm nonessential amino acid, and 100 iu / ml penicillin. to establish antigen presentation in vivo, cd8 t cells were isolated from spleen and lymph nodes of cd90.1 ot - i mice. t cells were enriched using the cd8 + enrichment kit according to manufacturer s protocol (bd bioscience), and 500,000 cells were injected intravenously into the tail vein of cd90.2 mice (n = 5/group). injection with self - assembled or soluble peptide constructs containing ova ctl epitopes (40 nmol / injection) (table 2). peripheral blood mononuclear cells (pbmcs) were collected at days 3, 5, 7, and 10 after immunization to analyze the expansion of the transferred ova - specific t cells caused by cross presentation of the ova antigen. after lysis of red blood cells, t cells were stained with fluorescently labeled antibodies for cd8 and the ot - i congenic marker cd90.1 (thy1.1) and analyzed by flow cytometry. t cell expansion is expressed as the number of transferred (ot - i) t cells as a percentage of total cd8 t cells. to evaluate the potency of the sape vaccines to induce endogenous specific cd8 t cells, nave c57bl/6 mice (n = 5) were s.c. pbmcs were collected 10 days after prime vaccination and 5 and 7 days after the boost vaccination. to quantify antigen - specific cd8 t cells by flow cytometry, after lysis of red blood cells, groups of mice (n = 12) were challenged in the right flank with 100,000 tc-1 tumor cells. at day 7, when the tumors were palpable (tumor size between 0.5 and 10 mm), mice were s.c. vaccinated with the vaccine formulations (table 2). tumor size was measured two - dimensionally with calipers 23 times per week and followed for approximately 35 days. mice were sacrificed for ethical reasons when the actual tumor volume reached about 2000 mm or when the tumor became ulcerated. before and after booster vaccination, blood samples were collected via tail vein in heparinized tubes for detecting hpv - specific cd8 t by flow cytometry. kaplan meier survival curves were applied, and the differences between survival curves were analyzed by log - rank test (p < 0.05 was considered statistically significant). expansion of antigen - specific cd8 t cells in the blood of immunized mice after booster vaccination with the sape vaccines was compared to control mice by student t test. the percentage of ot - i cells on day 5 postimmunization in mice treated with sape vaccines was compared to control group by student t test. the sa2 peptide was previously designed and studied in depth as a self - assembling peptide forming nanovesicles in aqueous solutions. in the present study, we have exploited the capacity of sa2 hydrophobic domain (sa : ac - aavvlllw - cooh) to form nanostructures once conjugated to antigen epitopes. to this end, peptides (ova250264 (sgleqlesiinfekl) derived from chicken ovalbumin and containing the h2b restricted mhc class i peptide epitope siinfekl, and hpv74357 (gqaepdrahynivtf) derived from human papillomavirus e7 protein and containing the h2b restricted mhc class i peptide epitope rahynivtf) were fused to the c - terminus of the sa domain (ova - sa and hpv - sa, table 1). in the selected hpv74357 and ova250264 peptides, the presence of the natural flanking amino acids, gqaepd at the n - terminus of the hpv and sgleqle at the n - terminus of ova ctl epitopes, allows proper cleavage and processing of the peptides in dcs. the ova and hpv peptide macroinitiators were synthesized by coupling an atrp initiator to the n - terminus of the peptides (scheme 1). the molecular masses of the peptide - initiators were determined using an electron spray mass spectrometer, and this analysis showed that the atrp initiator was coupled to the n - terminus of the peptides (data not shown). polymer conjugates were synthesized by atrp using nipam and dmam, as the monomer and the peptide macroinitiators (scheme 2). polymer conjugates have pnipam block length of mn 30,000 and 40 000 g / mol and a fixed peptide molecular weight of 1719 g / mol (ova) and 1717 g / mol (hpv), respectively. the hpv - pdmam peptide polymer conjugate had also mn 30 000 g / mol, similar to the peptide - pnipam conjugates. atrp was used for the synthesis of the peptide - pdmam and peptide - pnipam conjugates since this is an efficient polymerization technique, especially for acrylamides, and results in polymers with a very low polydispersity. the synthesized peptide - pnipam and peptide - pdmam conjugates had an average molecular weight close to the target value and a very low polydispersity. it has been shown that pnipam is a thermosensitive polymer with an lcst around 33 c in aqueous solution. consequently, it is expected that peptide - pnipam conjugate can form self - assemblies with a hydrophilic peptide shell and a hydrophobic pnipam core above the lcst of the pnipam blocks as first described for peg - pnipam. however, pdmam is a nonthermosensitive / fully water - soluble polymer, and the resulting peptide - pdmam conjugate does, therefore, not self - assemble into nanoparticles and was used as a control formulation in the in vivo tumor experiments. mn = number - average molar weight (g / mol) and mw = weight - average molar weight (g / mol) as determined by gpc. to characterize the peptide nanostructures, several complementary methods were applied (table 4). in peptide based systems, similar to the previously reported sa2 peptide, amphiphilic peptide epitopes self - assembled into discrete nanostructures above a threshold concentration, the critical aggregation concentration (cac). the cac values of the ova - sa and hpv - sa vaccines were both ca. 15 m, which is in the same range as that of sa2, and indicate that the peptide epitope sequences appended to the c - terminus of the self - assembling sa domain had marginal influence on the cac. afm revealed that ova - sa particles had a spherical morphology with similar particle size as measured by dls (figure 1). the obtained hpv - sa nanoparticles were also analyzed at concentrations used for the in vivo experiments (300 m), which showed consistent characteristics regarding size and morphology. dls for the hpv - sa peptide revealed that self - assembling peptide formed nanostructures with a mean hydrodynamic diameter of 85 nm and a pdi of 0.4 (table 4). afm analysis of the immobilized nanostructures on mica revealed toroidal structures with a diameter of 100 nm in accordance with the size obtained by dls (figure 1). the observed concave structures may suggest a hollow, vesicular nature of these nanostructures, similar to the vesicular structures formed by the previously reported sa2 peptide. although the cac for the different sa based peptides were dictated by the sa tag, the morphology of the nanoparticles, however, was affected by the appended peptide epitope sequences. negative zeta potential was seen for both sapes at ph 7.4. the isoelectric point (pi) of the ova and hpv peptides are 4.1 and 5.7, respectively, and therefore, they bear negative charge at ph 7.4. afm images of (a) ova - sa and (b) hpv - sa peptides self - assemblies immobilized on poly - l - lysine coated mica. the previous study on sa2 peptide demonstrated the ability of this peptide to form a stable beta - sheet structure once integrated into self - assemblies. however, comparison between the secondary structures of hpv - sa and ova - sa with sa2 above their cacs can be indicative in similarity or dissimilarity of self - assembling pathways in these series of peptides. the cd spectrum of the hpv - sa and ova - sa nanostructures showed a negative peak between 210 and 220 nm (figure s1) that is typical for peptides forming -sheets. this result is in accordance with the obtained secondary structure of previously studied sa2 peptide. peptide - pnipam (ova and hpv) sapes prepared by rapid heating in pbs were characterized for their morphology, size, polydispersity, and zeta potential (table 4). ova - pnipam and hpv - pnipam sapes had a mean hydrodynamic diameter of 115 and 196 nm, respectively, with a narrow size distribution (table 4). tem analysis showed spherical particles of 2080 nm for both ova - pnipam and hpv - pnipam sapes (figure 2) but no particles for hpv - pdmam conjugate. the mean hydrodynamic diameters of all nanoparticle formulations, determined by tem, were smaller than those determined by dls. in a nonmonodisperse particle suspension, the mean hydrodynamic diameter of the particles might be overestimated by dls measurement because of the presence of large particles or small aggregates. tem analysis of sape nanostructures demonstrates that the majority of the particles are in a range of 2050 nm. however, there are a few larger particles of 200500 nm, which affect the actual average particle size of sape nanostructures as measured by dls. zeta potential analysis of the peptide - pnipam nanoparticles showed a negative zeta potential for both nanoparticles at ph 7.4 (table 4), which indicates the presence of negatively charged ova or hpv peptide at the surface of the nanoparticles at ph 7.4. from all these results, it can be concluded that these amphiphilic peptide polymer conjugates mainly form micelles. the cac of ova - pnipam and hpv - pnipam sapes was 0.02 mg / ml, comparable to those of other amphiphilic pnipam block copolymers. preparation of the peptide - pnipam nanoparticles was relatively easy because of the hydrophilicity of pnipam at ambient temperature (below the lcst of pnipam, 33 c), which allows dissolution of the peptide - pnipam conjugates in an aqueous solution and at room temperature. next, rapid heating of this solution resulted in small and relatively uniform nanoparticles with a narrow size distribution due to dehydration and self - assembling of the pnipam part of the conjugate. tem pictures of nanoparticles composed of (a) hpv - pnipam and (b) ova - pnipam sapes. to assess the t cell activation capacity of the sapes in vivo, ova - specific cd8 t cells (ot - i) were injected into c57bl/6 mice 1 day before administration of ova containing sapes. in this way, the precursor frequency of ova - specific t cells was artificially elevated to high levels, thereby facilitating the read - out of in vivo antigen processing and presentation and enabling the detection of subtle differences between vaccine formulations in terms of (cross-)presentation of the ova antigens. the degree of ot - i t cells expansion as a consequence of in vivo (cross-)presentation of the ova antigens at various time points after vaccination is shown in figure 3. high numbers of ot - i cells were observed in the blood samples peaking at day 5 after vaccination with both sape vaccines (ova - sa and pnipam - ova) adjuvanted with cpg, which proved stronger to the administration of the ova250264 peptide with cpg (figure 3) (p < 0.05 for pnipam - ova). the strong expansion of ot - i cells indicated the capacity of these designed vaccines for cross - presentation, which is necessary for effective induction of cellular immunity. these results clearly show that sape formulations adjuvanted with cpg are efficiently processed in vivo leading to t cell activation. in vivo (cross)-presentation of ova antigen to ova - specific cd8 (ot - i) t cells. the percentage of ot - i cells relative to the total number of cd8 t cells in pmbcs of the mice vaccinated with 200 l of indicated peptide formulations (equal to 40 nmol of ova peptide / injection) on days 2, 5, 7, and 9 postimmunization. the percentage of ot - i cells on day 5 postimmunization in mice treated with ova - sa + cpg and ova - pnipam + cpg vaccines is compared to that of soluble ova peptide + cpg. n = 5 mice per group, and data are presented as mean se. the development of strong functional cd8 t cells is a necessity for robust antitumor immunity. as the hpv sapes were further evaluated in vivo for antitumor efficacy, the immunostimulatory potential of the hpv vaccines were investigated for induction of an endogenous t cell response by s.c. injection of formulated sapes in a prime - boost regimen into nave c57bl/6 mice (table 2). ten days after prime injection and 5 and 7 days after the booster, the induction of specific hpv cd8 t cells in the collected blood samples was analyzed using tetramer staining. for both adjuvanted sapes (hpv - sa and hpv - pnipam), as shown in figure 4, the nanoassemblies were able to induce significantly higher hpv - specific cd8 t cell response in mice after booster vaccination, as compared to the control groups (p < 0.001). the response increased from day 5 to 7 after booster immunization (p < 0.001). however, after prime immunization, the mice showed weak immune responses. thus, for such peptide vaccines, not only an adjuvant is necessary to induce a strong immune response but also a booster vaccination is important to induce strong immunity and antigen - specific memory t cells. percentage of endogenous hpv 16 e74957-specific cd8 t cells in peripheral blood of mice vaccinated with indicated formulations (equal to 60 nmol of hpv peptide per injection) 10 days after prime vaccination and 6 or 7 days after booster vaccination. hpv - sa + cpg was tested in a different experiment thus presented separately because of different background (untreated mice) in facs analysis. hpv - specific cd8+t cell expansion after booster vaccination in mice treated with hpv - sa + cpg and hpv - pnipam + cpg vaccines is compared to untreated mice and/or soluble hpv peptide + cpg. n = 5 mice per group, and data are presented as mean se. in general, therapeutic cancer vaccines aim to raise the number of antigen - specific cd8 cytotoxic t lymphocyte cells. our experiments show efficient endogenous cd8 t cell activation (hpv vaccines) indicating that these designed vaccines enable effective cross - presentation, which is obligatory for induction of cellular immunity. our results also point out that the adjuvant and particulate system have a complementary effect to induce efficient immune responses, in agreement with other studies. it has been reported that cpg enhanced antigen cross - presentation and improved cd8 t cell responses. the effect of odns containing unmethylated cytosine - guanine (cpg) motifs as toll - like receptor 9 (tlr-9) agonist on cellular immunity has been associated with its ability to induce and expand the number of activated dcs. in addition, it can elevate the expansion of antigen - stimulated t cells by inhibition of activation - induced cell death. therefore, codelivery of efficient adjuvants such as toll - like receptor ligands with the sapes can improve the efficiency of such formulations. interestingly, several peptide - based toll - like receptor ligands exist (such as rs01, gln - glu - ile - asn - ser - ser - tyr ; rs09, ala - pro - pro - his - ala - leu - ser) that can be exploited for incorporation into sapes to improve ctl responses. codelivery of antigen and adjuvant does not only result in proper dc activation and antigen presentation, but it also significantly lowers systemic toxicity due to reduced systemic exposure. to investigate the potential antitumor efficacy of hpv sape vaccines in a mouse model of hpv - related cancer, seven days after tumor inoculation (when the tumors were palpable), the treatment group received hpv sape vaccines adjuvanted with cpg in a prime - boost regimen. in addition, one group of mice was vaccinated with soluble hpv16 e74357 peptide, without a self - assembling domain, + cpg. as negative controls, one group did not receive any formulation, and one group was treated with hpv - pdmam + cpg, a similar structure as hpv - pnipam, without sape forming capacities. tumor size was monitored over time, and the proportions of mice with a tumor size not exceeding the humane end point (tumor size of 2000 mm) are presented in a kaplan meier plot (figure 5). both hpv sape vaccines adjuvanted with cpg strongly delayed the tumor growth and significantly prolonged the overall survival of mice compared with untreated mice (p < 0.0005 for hpv - pnipam + cpg and p < 0.05 for hpv - sa + cpg). importantly, the hpv - pdmam vaccine did not delay tumor outgrowth, indicating that self - assembly into nanostructures is crucial for efficient vaccine function, and merely elongating the peptide by attaching a long polymer chain did not enhance t cell activating properties. moreover, development of hpv - associated tumors was not delayed by injection of only hpv16 e74357 peptide + cpg, emphasizing the need for nanoparticle formation of the peptide vaccine for efficient t cell priming, delaying tumor growth. is associated with the particulate form of peptide vaccines, while the soluble form of peptide vaccine is not effective at all. seven days after tc-1 tumor inoculation in wild - type c57bl/6 mice, and when tumors were palpable, mice were either left untreated or were s.c. vaccinated in the opposite flank with the indicated formulations (equal to 60 nmol of hpv peptide per injection) followed by a boost injection 14 days after the prime dose. statistical differences between the groups were calculated using a log - rank (mantel cox) test. the survival of mice vaccinated with sape vaccines (hpv - sa and hpv - pnipam) with cpg was significantly longer compared to the no treatment group (p < 0.0005 for hpv - pnipam + cpg and p < 0.05 for hpv - sa + cpg). however, there was no significant difference in survival between mice vaccinated with either hpv peptide + cpg or hpv - pdmam + cpg and untreated mice. numbers in the legends represent median survival in days. p < 0.05, p < 0.001. n = 12 mice per group, pooled results from two independent experiments. based on these results, it can be concluded that the soluble form of the peptide vaccine even with a strong adjuvant is not effective. however, in the form of a particular structure, it is efficiently processed and presented by dcs to activate effector t cells that delay the tumor growth. it has been shown that peptide vaccines offer a promising approach to raising specific humoral or cellular immune responses against cancer cells. various studies proposed to deliver peptide vaccines in a particulate form, which favors innate immune recognition and activation. only a few studies explored peptide self - assembly as a means to present peptide epitopes in a particulate form to the immune system. for example, collier and co - workers produced a nanofiber vaccine by incorporating a fiberizing self - assembling peptide into the structure of a peptide antigen. they showed that the self - assembling peptide epitope triggered the formation of high - levels of igg1, igg2a, and igg3 antibodies against the attached antigen epitope. most other studies used long stretches of amino acids to drive peptide self - assembly, which impedes solid phase peptide synthesis. in addition, it also increases the risk of immunogenicity against the carrier part. in this study, we demonstrated that by attaching an eight amino acid peptide sequence or a thermosensitive polymer tail to antigenic peptide epitopes with different length and composition, discrete nanostructures could be generated in a reproducible fashion. this strategy can overcome some shortages of other particulate systems. besides the ease of production and well - defined formulation, several studies indicated a correlation between epitope density and immune responses. in the designed sapes, the generated particles comprise a high density of antigenic epitopes displayed on the surface of nanoparticles, while in several studied polymeric nanoparticles the reported peptide loading was on the average < 5%. our in vivo results have shown that relatively short hpv peptides in particulate forms are able to significantly delay the tumor growth but did not cause complete tumor regression, and this is in agreement with previous studies. in a study, we evaluated the antitumor efficacy of a synthetic long peptide (slp) covering hpv peptide encapsulated in polymeric nanoparticles (nps) in a therapeutic tumor model. similar to the results described here we showed that the peptide vaccine in the particulate form without adjuvant (poly i : c) did not significantly delay tumor growth or prolong the survival of mice in comparison with untreated mice. interestingly, peptide - loaded nanoparticles with poly i : c (encapsulated or soluble) significantly prolonged the survival of mice compared to the untreated group. although there are differences between the two studies in the experimental settings, such as the nature of the particulate carrier, type, and dosage of the adjuvants and length of hpv peptide vaccines, similar results in antitumor efficacy for the adjuvanted particulate systems in both studies were observed. these findings support our hypothesis that by simply extending the peptide epitopes with a self - assembling segment, a particulate antigen - delivery system can be established without laborious processing and formulation steps. we conclude that nanoparticle formation based on the introduced self - assembling materials for peptide vaccines can be an attractive approach and simple alternative for other particulate systems. the extension of minimal epitopes by a self - assembling segment can efficiently augment the induction of a desired immune response : first, by risk reduction of t cell anergy since the segments have to be processed by dcs to release the minimal epitopes ; second, by enhancing cellular uptake of particulate vaccines and antigen - specific t cell response. the described approach exploits the advantages of self - assembling peptide epitopes to improve tumor - specific t cell response for cancer treatment. in conclusion peptide and peptide polymer conjugates are attractive systems for molecularly well - defined vaccines. | the aim of the present study was to improve the immunogenicity of peptide epitope vaccines using novel nanocarriers based on self - assembling materials. several studies demonstrated that peptide antigens in nanoparticulate form induce stronger immune responses than their soluble forms. however, several issues such as poor loading and risk of inducing t cell anergy due to premature release of antigenic epitopes have challenged the clinical success of such systems. in the present study, we developed two vaccine delivery systems by appending a self - assembling peptide (ac - aavvlllw - cooh) or a thermosensitive polymer poly(n - isopropylacrylamide (pnipam) to the n - terminus of different peptide antigens (ova250264, hpv - e74357) to generate self - assembling peptide epitopes (sapes). the obtained results showed that the sapes were able to form nanostructures with a diameter from 20 to 200 nm. the sapes adjuvanted with cpg induced and expanded antigen - specific cd8 + t cells in mice. furthermore, tumor - bearing mice vaccinated with sapes harboring the hpv e74357 peptide showed a delayed tumor growth and an increased survival compared to sham - treated mice. in conclusion, self - assembling peptide based systems increase the immunogenicity of peptide epitope vaccines and therefore warrants further development toward clinical use. |
primary intraosseous or ectopic meningioma of the skull is a rare tumor accounting for about 1% of meningiomas. it is postulated to arise from arachnoid cell rests captured at inappropriate sites during embryonic development or implantation of these cells by some mechanical insult like trauma or dural tear. their origin can also be attributed to cellular dedifferentiation within the diploic space or cranial nerve sheath cells during their course through dipoles. these arise in paranasal sinuses, neck, and orbit and very rarely in diploe of cranial bones. these tumors are observed mostly within the first two decades of life and histologically are usually of psammomatous variety. here the authors present a case of a 16-year - old female who had progressive proptosis with intact vision and was managed successfully surgically. this patient presented to our out - door department with complaints of progressive proptosis of the right eye for the last 2 years with associated occasional mild to moderate headache. there was neither associated history of diminution of vision on the affected side nor diplopia in any of the gaze. on examination, there was axial proptosis on right side without any restriction of the extraocular movements. visual acuity as per snellen 's chart was 6/6 in bilateral eyes with normal visual fields and fundus examination. computerized axial tomography (ct) scan with thin cuts of the orbit suggested a hyperdense lesion of about 4 cm 5 cm size at the orbital roof causing splaying of the outer and inner tables with extension into the superior and supero - lateral aspects of right orbit displacing the globe antero - medially and enlargement of the right orbit [figure 1 ]. it also encroached upon the ethmoidal, sphenoid and frontal sinuses but without any bony destruction. preoperative ct brain coronal bone cuts (b) preoperative contrast computed tomography brain sagittal magnetic resonance imaging (mri) showed t1-weighted iso - hypointense and t2-weighted heterogeneous mass lesion in the right orbital roof with intense postgadolinium enhancement [figure 3 ]. mri brain post gadolinium sagittal (b) routine presurgical work - up was done, and the patient was electively taken up for microsurgical excision under general anesthesia. tumor was found to be completely extra - axial destroying the orbital roof and extending into the basifrontal region and into the sphenoid sinus. orbital roof was reconstructed using split calvarial bone graft to avoid any postoperative pulsatile proptosis. lumbar drain was placed to prevent any cerebrospinal fluid (csf) leak from the basifrontal dura and consequent csf rhinorrhoea. mostly meningioma are considered as primary intradural lesion, however those originating from location other than meninges are called extra calvarial or ectopic meningioma. they can originate from subcutaneous tissue of skin, paranasal sinus, orbit, neck, salivary gland, calvaria and along per neural sheath of cranial nerves. extradural meningioma arising in the skull is usually referred as intraosseous, calvarial or intradiploic. intraosseous meningioma denotes a subset of extradural meningioma arising in bone and accounts for about two - third of extradural meningioma. after reviewing 31 cases of intraosseous meningioma, observed that orbital and frontoparietal regions are the most common locations. intradiploic meningioma is very rare in children and reported in isolated case reports. in 2011, khalatbari. could find only seven cases of intradiploic meningioma of the orbital roof published in the western literature and added their one own case in a 14-year - old female. crawford. reported the diagnostic criteria mass has histopathology consistent with a meningioma, located in epidural and intraosseous compartment ; however brain, arachnoid and dura matter is not involved. one postulate is that intradiploic meningioma originates from entrapment of arachnoid cells within the bone. multiple theories exist on how the cells become located in the skull ; although none are universally accepted, and different origins are possible. head trauma, abnormal cranial moldings and embryogenesis, and arachnoid cells accompanying blood vessels and cranial nerves as they traverse the skull, can all result in the entrapment of arachnoid cells or meningocytes in the bone. it is presumed that intradiploic meningioma arise from these entrapped cell rests in the calvarium. classified primary extradural meningioma in three groups, first being purely extracalvarial, next purely calvarial, and finally the third group represents calvarial meningioma with extracalvarial extension. clinically these case present with exophthalmos, on the involved side, tends to occur predominantly in early second decade of life. however, vision is usually unaffected and in addition they can have a subcutaneous mass. radiographically, x - ray can delineate location and its chronic pressure effect on surrounding bone. it shows generally osteoplastic or hyperostosis reaction in the form of granular or speckled calcification which involves roof or wall of the orbit. radiologically intradiploic meningiomas are typically either osteoplastic or osteolytic, however, mixed versions also have been reported although the majority are osteoblastic, extremely rarely are osteolytic or very extremely have a mixed pattern. these can present with opacity of the orbital roof on x - ray skull study. the osteolytic subtype of intradiploic meningiomas are more likely to be malignant than the osteoblastic subtype. intradiploic meningiomas should be considered in the differential diagnosis of patients presenting with osteoblastic or osteolytic skull lesions. the osteolytic lesions typically cause thinning, expansion, and interruption of the inner or outer tables of the skull and these lesions also enhance homogeneously after contrast administration. however, ct imaging can reveal osteoplastic, intradiploic placement of meningioma, mri can show better delineation of extension of meningioma and soft tissue involvement. however, clinically intradiploic orbital roof meningioma presents with proptosis, but intraorbital meningioma presents with proptosis and decline in visual acuity to almost complete vision loss. however, ct scan and mri will clearly delineate even intraorbital meningioma. rarely rapidly progressing chondrosarcoma, can sometimes occur in orbital wall, is known for aggressive behavior with a high recurrence rate and causes distant metastasis. hence, preferably orbital chondrosarcoma should be excised along with an eye ball and the orbital contents to prevent recurrence in future. in the present case, the lesion appeared as an osteolytic variety, with an interruption of the outer table as well as an intact inner table with extensions as described earlier. surgery is usually the standard mode of treatment, and all reported pediatric cases had surgical excision, and no recurrence is reported in pediatric cases. however, meticulous reconstruction of the orbital roof is essential and can be done using calvarial bone graft or titanium plate. in the present case, we achieved complete microsurgical excision of the lesion with reconstruction with split calvarial bone graft with excellent neurological and cosmetic results without any postoperative complications. histopathology of previously reported five cases were the psammomatous meningioma with one cases each of transitional, transitional with psammomatous body, and meningothelial meningioma. khalatbari. also reported a case occurred in 14 years who presented with exophthalmos and double vision. ct scan and mri showed an intradiploic orbital roof tumor causing expansion of diploic space and associated pneumosinus dilatans. she also underwent complete surgical resection, and histopathological study of the specimen revealed the transitional meningioma. authors have previously reported a transitional meningioma in a 40-year - old male, who underwent surgical excision with reconstruction of the orbital roof ; he had no recurrence or exophthalmos in the follow - up period. intradiploic meningiomas are extremely rare lesions and usually do not cause dural infiltration, so extradural complete surgical excision is preferred, and intradural exploration is usually not required. however, intradural exploration is advised only if there is extensive dural infiltration or dural breach is observed. | primary intraosseous or ectopic meningioma of the skull is a rare tumor accounting for about 1% of meningioma. intradiploic meningioma is an extremely rare type of extraneuraxial meningiomas. intradiploic meningioma of the orbit is extremely rare, and < 8 such cases are reported till date in western literature occurring in the pediatric age group. here the authors present a case of 16-year - old female, who presented with progressive proptosis, with normal vision and was managed successfully surgically. clinical features, pathophysiology, and surgical management of this rare entity are discussed in the context of pertinent literature. |
the genus dirofilaria consists of at least 2 species of epidemiologically important human pathogens, dirofilaria immitis (leidy, 1856) and dirofilaria (nochtiella) repens (railliet and henry, 1911). these worms commonly cause dirofilariasis in dogs, cats, and wild carnivores and are globally recognized as etiological agents of zoonotic infections in humans, transmitted by vectors / mosquitoes (mosquito - borne zoonosis), including anopheles, culex, and aedes. d. immitis, that causes dirofilariasis in dogs, cats, and humans, tends to distribute in temperate and tropical regions of the world, while d. repens infections are limited in asia and europe, including vietnam. however, to our knowledge, no previous report of human infection on the posterior thoracic region due to d. repens has been reported. here, we report a rare case of subcutaneous posterior thoracic infection caused by d. repens diagnosed by morphology and molecular analysis. on 14 march 2011, a 34-year old woman, visited a surgeon at a clinic in a suburban area of hanoi, vietnam with a painful swelling and itchy and palpable nodule on her posterior thoracic wall. she lived in an area where dogs and cats were outdoors allowed and several times exposed to mosquito bites. three weeks before, on 26 february 2011, she suddenly noticed a swollen, tangible, subcutaneous nodule of the similar appearance as the current one at the same site but it has spontaneously disappeared days after. during the physical examination, a smooth, tangible, slightly movable, painful nodule of 12 cm in size was touchable under the skin on the posterior part of the thoracic wall, correlative with the vertebrae d11. the overlying skin was normal without any overt signs of inflammation and axillary lymph nodes were not enlarged. routine laboratory test showed red blood cells of 3.910/mm, white blood cells of 6.110/mm (the percentage of neutrophils, lymphocytes, and eosinophils were 60%, 20.7%, and 11.5%, respectively). no microfilaraemia was detected at this time in her blood samples by microscopy. by local excision under anesthesia, after opening the capsule, a thin thread - like worm was noted and captured in 3 fragments which then were fixed in 10% formalin for morphological examinations and a piece was preserved in 70% ethanol for molecular identification. a long, slender, whitish worm (fig. 1a, b) excised from the nodule was approximately 10.5 cm in length and about 400 m in its largest width, typical of the description of a female d. repens. microscopy revealed a thick laminated cuticle with the characteristic longitudinal ridges and cross - striations (fig. the anterior end was bluntly rounded and was of greater diameter than the posterior end (fig. 1a). the body cavity contained a female reproductive system, with the bulbous vulva of about 1 mm from the anterior end, and ended in a uterine bifurcation. following the surgical removal, symptoms were quickly resolved, and the patient was recovered without any consequences after a long - time followed up. total genomic dna was extracted from an ethanol - fixed fragment of the excised worm by qiaamp dna mini kit (qiagen, hilden, germany). pcr of a portion of the mitochondrial cytochrome c oxidase i (cox1) gene was performed using the primer pairs (forward dimref, 5 gatgttgcctttgatattggg 3 ; and reverse dimrer, 5 accagcwgtwyacatatgatgacc 3) designed based on the alignment of cox1 sequences of both dirofilaria repens and d. immitis available in genbank. the pcr, of 50 l containing 25 l pcr master mix from promega, 2 l of each primer (10 pmol/l), 2.5 l dmso, 16.5 l pure water, and 1 l template (100 ng/l), was carried out in a mj thermal cycler ptc-100 (mj research, watertown, massachusetts, usa) with initiation at 94c for 4 min, then 35 cycles including denaturation at 94c for 30 sec, annealing at 55c for 30 sec, extension at 72c for 1 min ; and a final cycle of 7 min at 72c to obtain a pcr product of 643 bp, and a 576 bp portion was used for alignment for taxonomic identification. to support the identification, the presence of 16s rrna sequence of wolbachia sp. was obtained by pcr with the primer pairs designed hereby in this study, based on 16s ribosomal sequence of wolbachia pipientis available in genbank (wp16f : 5-ccacactggaactgagatacg-3 and wp16r : 5-tgtagccaccattgtagcac-3). the parasite recovered from the subcutaneous tissue of our patient was identified as d. repens on the basis of the morphology and molecular methods. the external longitudinal cuticular ridges differentiate d. repens from d. immitis, the other important human pathogens of the genus dirofilaria. however, identification of dirofilaria spp. based only on the morphology is difficult ; therefore, molecular methods supported to determine the species. molecular identification was carried out by using primers of cox1 and of nuclear internal transcribed spacer 2 (its2), and additionally 16s rrna identification of the endosymbiont w. pipientis commonly co - existing with dirofilaria spp.. nucleotide cox1 sequence determination of the vietnamese dirofilarial nematode revealed 96% identity to those of the italian / albanian d. repens strains (genbank no. am749230-am749234 ; dq358814 ; aj271614 ; jf461458) ; and 89% to d. immitis (genbank : am749226 ; am749227 ; am749229 ; aj537512 ; eu159111 ; eu163945 ; kc107805 ; aj271613 ; dq358815 ; fn391553) of different geographic origins. the cox1 amino acid sequence showed 99 - 100% similarity to all of the d. repens samples, while only 96% to d. immitis. high intraspecific variability was observed in d. repens cox1 sequences, while those of d. immitis species samples were identical (100% identity to each other), regardless of geographical distribution. phylogenetic tree inferred from the 576 bp mitochondrial cox1 sequence of 20 strains including d. repens collected from the subcutaneous posterior thoracic nodule in this study, and 8 other d. repens, 10 d. immitis, and a nematode species o. lupi (as an out - group) indicated that the vietnamese filarial sample clustered with cox1 sequences of d. repens, in a group, that was completely separated from the d. immitis and from o. lupi out - group sequences (fig. the genetic distances among the newly identified d. repens of vietnamese patient and reference strains were calculated based on the kimura 2-parameter model using mega5.2 software (table 1). the genetic distances among the dirofilaria strains within each of d. repens or d. immitis, respectively, were very low, ranging from 0.000 to 0.039 for d. repens (table 1, no. 1 - 9) and no variation (0.000) for d. immitis (table 1, no. there was relatively high taxonomic genetic distance, ranging from 0.103 to 0.117 between d. repens and d. immitis (table 1, no. 1 - 9 10 - 19) ; and 0.109 to 0.125 between dirofilaria spp. and a nematode o. lupi, used for an out - group (table 1, no. 20). by amplification with the primer pairs based on 16s ribosome, a sequence of 918 nucleotides was obtained and compared with those of the previously known w. pipientis 16s rrna sequences, i.e., one amplified from a d. repens (italian strain, genbank : aj276500) and several from d. immitis strains (z49261, af088187, and af487892), available in genbank. the comparative sequence analysis revealed 96 - 97% identity among the endosymbionts and accurately confirmed the presence of the endosymbiont w. pipientis in the vietnamese d. repens. the species identification of this vietnamese d. repens, thus, was completely accurate using both the mitochondrial and nuclear nucleotide analysis and distance - based / phylogenetic approaches. to date, of 3,192 human dirofilariasis cases reported worldwide, 372 pulmonary and 1,410 subcutaneous / ocular infections were documented ; and due to aberrant migration of the microfilariae, dirofilaria spp. lesions caused by d. immitis are focused mainly in the heart (dogs and cats) and in the lungs and skin (in humans, presented as pulmonary and subcutaneous forms), whilst d. repens tends to localize in multiple organs, mainly in the subconjunctiva, lungs and coronary artery [11 - 13 ], soft tissues as the breast, penis, spermatic cord, epididymis, and scrotum [14 - 17 ], brain, liver, lymph nodes, muscles, and anterolaterial neck [5,18 - 21 ], and rare places, i.e., causing intravitreous infection in humans. to our knowledge, this is the first case of human infection on subcutaneous posterior thoracic region due to d. repens reported. in humans, normally a single subcutaneous nodule and lesions have been developed during weeks and described as little granulomatous inflammatory lesions. in the case reported here, the time and the means of transmission by which the patient caught d. repens infection is unclear, probably by mosquitoes bites (infected by larvae from the outdoor dogs / cats wandering in the suburb). unfortunately, no surveys of microfilariae in dogs / cats have been conducted yet. to date, 12 dirofilaria infections of the conjunctiva (eye subcutaneous and subconjuctiva) have been detected in vietnam. the case of posterior thoracic localization hereby presented is a rare record and all of the vietnamese infections documented are autochthonous, caused by solitary d. repens. in our case, molecular classification of the causal agent confirmed it to be d. repens using complex approaches, including morphological, historic, mitochondrial cox1, nuclear its-2, distance - based / phylogenetic analysis, and supported by the endobiosymbiont, w. pipientis, 16s - rrna based identification. regarding high risk of human dirofilariasis (imported dirofilaria is not exclusive) in vietnam, detailed national surveys involving pathological, epidemiological and etiological information on dirofilaria species, animal / host reservoirs, vectors / mosquitoes, provincial distribution and improvement of routine laboratory diagnostic approaches, including molecular identification / discrimination of zoonotic dirofilaria are needed for early control of the emerging dirofilarial infections. | the emergence of dirofilarial infections in asia including vietnam is a clinically significant threat to the community. we here report a rare case of subcutaneous dirofilaria repens infection on the posterior thoracic wall in a young woman presenting a painful, itchy, and palpable nodule. the adult worm was identified by mitochondrial cox1 and nuclear its-2 sequence determination. the diagnosis was additionally confirmed by 16s rrna sequencing of the endosymbiont wolbachia pipientis commonly co - existing with d. repens. this is a rare case of subcutaneous human infection on the posterior thoracic region caused by d. repens. |
mesenteric venous thrombosis is a rare but potentially fatal complication associated with laparoscopy which has now become common practice and gold standard for many procedures in general surgery. there are only few scattered case reports in the literature describing this postoperative thrombotic event. in the present study, we describe a patient presenting with severe abdominal pain at 25 days following an uneventful laparoscopic paraesophageal hernia (peh) repair and nissen fundoplication. exploratory laparotomy revealed an extensive small bowel ischemia requiring bowel resection followed by a second look laparotomy. retrospectively performed hematologic workup revealed a genetic mutation associated with hyperhomocysteinemia in addition to her hyperfibrinogenemia. mesenteric venous thrombosis is a rare but potentially serious complication after laparoscopic surgery especially in patients with underlying hypercoagulability. peritoneal insufflation during laparoscopic surgery may carry significant morbidity of thrombosis in the mesenteric venous system. its clinical presentations vary from a nonspecific abdominal discomfort to an acute abdomen mandating an exploratory laparotomy. warren and eberhard in 1935 reported 34% mortality rate. in more modern day however, prompt diagnosis followed by an aggressive use of anticoagulation, thrombolytic agents and relatively new endovascular techniques seem to improve outcomes. previously published reports have described mvt in association with roux - en - y gastric bypass, splenectomy, colectomy, cholecystectomy and appendectomy. in this article, we report a patient who developed an extensive small bowel infarction due to mesenteric venous thrombosis (mvt) following a laparoscopic paraesophageal hernia repair and nissen fundoplication. a 61 year old female with history of hypertension and gastroesophageal reflux was referred to our facility for a repair of type iii paraesophageal hernia with 75% intrathoracic stomach. her postoperative course was unremarkable and she was discharged home on postoperative day (pod) 2. on pod 9 after appropriate investigation, she was released on an oral antibiotic for urinary tract infection. during follow up in our clinic 2 weeks postoperatively she complained of nonspecific abdominal pain and moderate gas bloatedness consistent with common complaints following nissen fundoplication. computed tomography (ct) scan demonstrated thickened small bowel loops consistent with mural ischemia (fig. 1) and nearly complete filling defects in the superior mesenteric / portal veins (fig. laboratory findings showed leukocytosis of 25,000/mm and elevated lactic acid of 9.4 mg / dl. sagittal section of small bowel mural thickening consistent with mesenteric ischemia.demonstration of intraluminal narrowing is facilitated by administration of oral contrast agent. coronal section of portal venous system showed near complete filling defects in the superior mesenteric and portal veins. intravascular thrombosis presents as hypodense areas in the vascular lumen during the portal phase of intravenous contrast administration. patient was immediately heparinized and taken to the operating room for an exploratory laparotomy when 110 cm of ischemic jejunum with complete thrombosis of the superior mesenteric vein (smv) were found. jejunal resection with primary anastomosis was performed and the abdomen was left open. during a second look laparotomy on the following day, dusky terminal ileum was again seen with adequately perfused surrounding small bowel and cecum mandating an additional 10 cm terminal ileum resection. comprehensive hematologic workup revealed a c-677-t point mutation associated with methylenetetrahydrofolate reductase (mthfr) deficiency leading to an elevated level of homocysteine. it is postulated that mvt is caused by physiologic derangements associated with laparoscopy since it occurs at a much lower incidence following open surgery. an early prospective study conducted by masataka ikeda on patients undergoing splenectomy revealed that portal venous system thrombosis occured at a significantly higher rate in laparoscopic group versus open group, 55% and 19% respectively. twenty four previously reported cases of mvt that we have collected along with our current case are displayed in table 1. previously published reports on splanchnic venous thrombosis following laparoscopic operations a variety of factors associated with laparoscopy such as pneumoperitoneum induced hemodynamic changes, hypercapnia induced mesenteric vasoconstriction, and coagulation impairment may contribute to the development of mvt. takagi showed that portal venous trunk diameter and blood flow were significantly decreased with intraperitoneal pressure elevation above 10 mmhg. quantitatively measured, elevation of intraperitoneal pressure during laparoscopy to 7 and 14 mmhg is associated with 37% and 53% reduction in mean portal blood flow respectively. majority of splanchnic vein thrombosis developed within the widely accepted insufflation pressure of 12 to 15 mmhg. serum level of vasopressin related to hypercapnia is a well documented phenomenon that also occurs in response to peritoneal insufflation using carbondioxide (co2). epstein discovered that hypercapnia induced by breathing co2 at a concentration less than 5 percent increases portal venous pressure and results in mesenteric vasonconstriction. soft tissue trauma associated with surgery releases tissue factors that can lead toward mvt in patients with previously undiagnosed hypercoagulable state. our literature review showed that 44% of patients have had underlying prothrombotic state which was diagnosed retrospectively only after occurrence of this complication (table 1). the more likely occurrence of mvt during laparoscopic operations for inflammatory pathologies such as diverticulitis seems to support this theory. in addition, literature has also described a controversy on alteration of coagulation associated with laparoscopy. edematous bowel or mesenteric fat stranding, although not conclusive, should also prompt consideration of mvt in the absence of other obvious clinical etiologies. even though angiography is the gold standard in diagnosing arterial thrombosis other tests such as transabdominal doppler ultrasound, and magnetic resonance imaging are less accurate and more expensive without additional benefit respectively. diagnostic laparoscopy is controversial for a suspected mvt because it may compound the primary problem. however, many surgeons prefer to perform diagnostic laparoscopy to exclude bowel ischemia therefore cimcumventing the need for nontherapeutic laparotomy[1618 ]. not to undermine the superiority of ct scan in diagnosing mvt, it is however notoriously to be inaccurate in determining the extent of bowel ischemia. all patients with known underlying prothrombotic states should be placed on a preoperative thrombotic prophylaxis regiment. in our opinion, a consultation with a hemato - oncologist is an appropriate step in this situation. aggressive intravenous hydration, bowel rest and total parenteral nutrition are important adjunctive measures to operative intervention. abu demonstrated a 12% reduction in mortality in patients undergoing resection and anticoagulation versus those who underwent resection alone. less invasive measures such as surgical thrombectomy, percutaneous transhepatic thrombectomy, intra - arterial papaverin infusion through superior mesenteric artery, and thrombolytics (urokinase and streptokinase) have also been successfully used[162124 ]. for those with primary coagulation disorder, splanchnic venous thrombosis is a rare but potentially serious complication associated with laparoscopic surgery especially in patients with underlying hypercoagulability disorders. high index of suspicion is needed for early diagnosis and treatment when this condition occurs. primary care physicians including general surgeons should be well aware of this potential untoward event post laparoscopic operations. | context : mesenteric venous thrombosis is a rare but potentially fatal complication associated with laparoscopy which has now become common practice and gold standard for many procedures in general surgery. there are only few scattered case reports in the literature describing this postoperative thrombotic event.case report : in the present study, we describe a patient presenting with severe abdominal pain at 25 days following an uneventful laparoscopic paraesophageal hernia (peh) repair and nissen fundoplication. exploratory laparotomy revealed an extensive small bowel ischemia requiring bowel resection followed by a second look laparotomy. retrospectively performed hematologic workup revealed a genetic mutation associated with hyperhomocysteinemia in addition to her hyperfibrinogenemia. previously published data were collected and discussed.conclusions:mesenteric venous thrombosis is a rare but potentially serious complication after laparoscopic surgery especially in patients with underlying hypercoagulability. high index of suspicion is important in early diagnosis and subsequent treatment. |
granulomas are focal accumulations of epithelioid cells, typically with a rim of lymphocytes and fibroblasts, representing a delayed - type hypersensitivity reaction in response to antigenic stimulation. this stimulation is usually triggered by exposure to antigen that can not be degraded or in cases of immune dysfunction. liver granulomas have been reported in 215% of unselected liver biopsies, with the etiology varying according to geography. in the us, 75% of cases are result in sarcoidosis, mycobacterial infection, primary biliary cirrhosis and drug - induced liver injury. in other countries, such as iran, mycobacterium tuberculosis and visceral leishmaniosis account for 60%. studies have shown that 615% of granuloma findings are idiopathic [1, 2 ]. few histological features associated with certain diseases include caseous necrosis in acid fast bacilli containing granulomas, or ova in schistosoma mansoni. a 38-year - old male sudanese immigrant pronounced brain dead after a motor vehicle accident became an organ donor for liver and kidneys. his serology came back positive for hepatitis b core antibody and surface antibody, hbsag negative, hepatitis c and hiv negative. gross appearance of donor liver gave suspicion of granulomas based on surface heterogeneity (fig. his liver biopsy at the donor hospital was consistent with < 5% macro and micro steatosis, no fibrosis but significant for the presence of having multiple granulomas (fig. the initial slide review by the pathologist found multiple granuloma, and requested re - biopsy from the donor liver. the re - biopsy result found parasitic disease in the hepatocyte that later found to be schistosomiasis (fig. lack of data regarding the behavior of this disease in the recipient, the biopsy result caused us to decline the liver due to the parasitic liver disease. schistosomiasis is a chronic enteral parasitic disease caused by trematode worms of the genus schistosoma. it is estimated that over 258 million people are affected yearly, with most of its disease burden in africa, south america, the caribbean, the middle east and asia. at the present time, due to increased global mobility, schistosoma may be encountered in non - endemic areas. over 90% of the cases of schistosomiasis are currently found in sub - saharan africa, where more than 200 000 deaths occur yearly due to the disease. schistosomiasis is the most prevalent parasitic disease in sudan due to the wide river basin areas and large irrigated agriculture along the nile rivers. once infection occurs, the adult worms reside in veins releasing eggs that are either shed into the environment through feces or urine, or are retained in host tissues where they induce inflammation and then die. when schistosoma eggs are trapped in tissues, they activate an immunologic reaction leading to the development of granuloma and fibrosis. hepatic schistosomiasis leading to severe fibrosis is a well - recognized cause of chronic liver disease and portal hypertension. it results from the host s granulomatous cell - mediated immune response to the ova antigen and progressing to irreversible fibrosis. multiple factors influence the development and pathology of schistosomiasis including the type of immune response developed by the host, host genetic background, intensity and number of infections. most schistosomiasis is caused by schistosoma hematobium, s. mansoni and s. japonicum ; however, s. mansoni and s. japonicum tend to cause hepatobiliary disease, while s. hematobium mainly affects the urinary tract. due to the life cycle of schistosoma, the acute phase of infection is usually asymptomatic, the only chronic sequelae identified via tissue biopsy is necrotic eggs with granuloma formation. strategies such as living donation, split liver transplantation, domino liver transplantation and the extensive use of marginal donor grafts have been implemented in many countries. as a result of this, there are an increasing number of unusual diseases from asymptomatic donors, including schistosomiasis. reports have shown schistosomiasis transmission through liver grafts from deceased donors with no consequences for graft or recipient survival. a retrospective study in brazil highlights cases of living donor liver transplantation (ldlt) with schistosomiasis diagnosed on post - reperfusion liver biopsy showing granulomatous reaction with s. mansoni eggs in transplant recipients. also describe the first intentional transplant with schistosomiasis, where known schistosoma eggs in feces were found in a donor. after treatment with praziquantel, ldlt with a graft was performed with no donor or recipient complications after 2 years post - operatively. chronic changes caused by schistosomiasis, leading to granuloma formation to a parasite s egg, might be only a sign of a distant infection. donor organs from endemic areas who have negative fecal examinations and normal liver function tests may be considered for partial liver donation. while organ shortages remains a major limitation to liver transplantation, expansion of the donor pool criteria to include patients presented in this case report might allow expansion and allocation of donor livers. | abstracta shortage of donor organs is a major limitation to liver transplantation. expansion of donor pool criteria to include patients with schistosomiasis diagnosed on liver biopsy might allow the allocation of more transplant livers. schistosomiasis is a chronic parasitic disease affecting millions in endemic areas including sub - sahara africa that might lead to the development of granulomas as a response to the parasite s ova and might cause chronic liver disease and portal hypertension. due to increased mobility globally, schistosomiasis may be encountered in non - endemic areas. currently, the usage of donor livers with known schistosomiasis is not universally defined. |
a descriptive cross - sectional study of students of federal school of dental therapy and technology, enugu, nigeria was conducted using self - administered questionnaire. all the students in year 14 were included in the study. data was obtained on demography, frequency and duration of tooth brushing, texture of tooth brush, factors influencing choice of tooth brush, how often tooth brush is changed and why, the use of additional tooth cleaning agent, the practice of tongue cleaning and tongue cleaning agent used, frequency of snacking and types of snacks consumed. prior to administration of questionnaire, the aim and nature of the study was explained to the participant and informed consent obtained. approval for this study was obtained from the ethics and research committee of the university of benin teaching hospital. statistical package for social science (spss version 15.0) a total of 242 students responded with dental technology students constituting 52.5% and dental therapist students constituting 47.5%. male : female ratio was 1:1.6. majority (95.5%) of the respondents were single, in 2025 year age group (75.2%) and 45% were in the first - year class. about one - fifth (21.1%) of the respondents brushed their teeth once daily, 71.9% brushed their teeth twice daily and 5.8% brushed more than twice daily (table 1). more than half (52.1%) spent 35 minutes brushing and 30.2% usually checked their teeth in the mirror after brushing (table 1). texture of tooth brush used by respondents were soft (17.4%), medium (78.9%) and hard (2.5%) (table 1). about half (51.7%) also combined chewing stick and only 0.8% use dental floss. the main factors that influenced the choice of tooth brush was strength (63.2%), brand 12.8% and size (10.3%), cost (1.2%), combination of factors (4.2%), no special consideration (5.8%) and no response (2.5%) (table 1). frequency and duration of tooth brushing four - tenth of the respondents replaced their tooth brush every 3 months. fraying of tooth brushes was the most common reason for tooth brush replacement (table 2). the following were used for tongue cleaning : tooth brush (81.8%), tongue cleaner (9.5%), chewing stick (2.1%) and knife (0.8%). majority (66.1%) consumed snacks occasionally and only 20.2% reported regular snack consumption. meat pie (46.7%) was the most common snack consumed followed by biscuits (18.2%), cakes (11.2%), others include egg roll, chin - chin, ice cream and fruits (fig. 1). majority (92.6%) expressed confidence in teaching people how to brush properly and 90.5% had done that in the past, of which 35.1% had discussed with everybody they knew, i.e. parents, siblings, other relatives, friends and neighbours (table 3). the frequency and duration of tooth brushing correlates with oral hygiene and oral health. brushing twice daily for acceptable duration and the use of a mirror to visualise one 's efforts twice - daily brushing confers optimal effect on oral hygiene and gingival condition of both males and females (23). twice - daily brushing is recommended by most dentists in order to improve plaque control, since most patients are not able to achieve sufficient plaque removal by performing oral hygiene measures at home (24). in this study, majority of the students (71.9%) brushed twice daily and 52.1% brushed for 35 minutes. this is comparable with 68% twice or more daily brushing recorded among turkish non - dental university students (25), lower than 81% among mongolian dentists (26) but higher than what was recorded in many other similar studies (12, 2730). in this study, this is consistent with findings of other studies (22, 25, 31). females have been said to have better oral health knowledge (32), to exhibit greater interest in oral health and to consider sound teeth more important than males (33, 34). medium texture tooth brushes were the most frequently used and the most important factor considered when purchasing a tooth brush by the students was the texture. it has been documented that tooth brush with frayed bristles is ineffective for proper cleaning and also causes adverse effects like gingival recession and oral ulcer, and it was recommended that tooth brushes should be replaced every 3 months or when the bristles are frayed (19, 35, 36). in this study, 40.5% replaced their tooth brush every 3 months and the usual reason for tooth brush replacement was frayed bristles in 45.5% of respondents. chewing stick is known to contain antimicrobial agents which are beneficial for prevention and treatment of periodontal disease (37) but when not properly used it can cause tooth wear lesions. some tooth brush users believe that the use of chewing stick in addition to tooth brushing is the most effective way of reducing mouth debris (38). a study even concluded that the chewing stick is more effective than tooth brushing for reducing plaque and gingivitis, when preceded by professional instruction on its correct application (39). it has also been said that the use of chewing stick appears to be more effective than tooth brushing for removal of plaque from the embrasures, thus enhancing interproximal health (39). the additional tooth cleaning method used by the use of dental floss was minimal and this is similar to the findings of kirtiloglu. tongue cleaning is a component of oral hygiene measure, as tongue coating is known to be the predominantly implicated cause of halitosis (40, 41). several volatile sulphur compound producing bacteria have the ability to colonise the dorsum of the tongue in periodontally healthy subjects (42) and they are reduced by tongue cleaning (43, 44). in this study, tongue cleaning was carried out by majority using the tooth brush and only 9.5% used the tongue cleaner. increased snacking frequency and inadequate tooth - brushing have been identified as predisposing factors for tooth decay (28). regular snack consumption was practiced by 20.2%. this percentage is fewer than what was reported previously in other studies (11, 45). the dental auxiliaries have been said to play an important role in educating their friends, family members, patients and their society on how to maintain good oral health (1821). respondents in this study will be able to carry out this role as 92.6% expressed confidence in teaching people how to brush their teeth and 90.5% are presently actively discussing issues on tooth brushing with parents, siblings, other relatives, friends and neighbours. the level of oral self - care behaviour of the dental therapist and dental technology students is satisfactory, but there is room for improvement of tooth brushing and dietary habits in relation to snacking. the zeal to educate others about proper tooth brushing revealed in this study suggests that these students may also be helpful in promoting oral health promotion. the authors have not received any funding or benefits from industry to conduct this study. | objectiveto determine the tooth brushing, tongue cleaning and snacking behaviour of dental technology and therapist students.methodsa descriptive cross - sectional study of students of federal school of dental therapy and technology enugu, nigeria. self - administered questionnaire was used to obtain information on demography, frequency, duration and technique of tooth brushing and tongue cleaning as well as information on consumption of snacks.resultsa total of 242 students responded. dental technology students made up 52.5% of the respondents and dental therapist in training made up 47.5%. majority (63.2%) of the respondents considered the strength of tooth brush when purchasing a tooth brush and 78.9% use tooth brushes with medium strength. seven - tenth (71.9%) of the respondents brush their teeth twice daily and 52.1% brush for 35 minutes. about one - third (30.2%) brush their teeth in front of a mirror. chewing stick was used by 51.7% of respondents in addition to the use of tooth brush. tongue cleaning was done by 94.2% with only 9.5% using a tongue cleaner. only 20.2% reported regular snacks consumption. nine - tenth (90.4%) of respondents were previously involved in educating others, apart from their colleagues, on tooth brushing.conclusionthis survey revealed that most of the dental therapy and technology students had satisfactory tooth - brushing behaviour. the zeal to educate others about proper tooth brushing revealed in this study suggests that the students may be helpful in oral health promotion. |
these types of internal hernias are difficult to diagnose on imaging modalities, as herniated small bowel loops are non - clustered and non - encapsulated. we report a rare case of idiopathic combined transomental and transmesocolic internal hernia with its imaging features, diagrammatic representations and review of literature. (i.e., stomach and large bowel were stretched down by the herniating small bowel loops through the mesentery) can be used as an important clue to diagnose this type of internal hernia on cross sectional imaging, along with features of intestinal obstruction (non - clustered, non - encapsulated dilated small bowel loops). a 55 year old male patient presented to emergency department with a history of sudden - onset vomiting, vague abdominal pain, and increasing abdominal distension. patient was known to have chronic renal disease for 5 years prior to presentation. a radiograph of the abdomen obtained in an erect position showed few central air - fluid levels suggesting the presence of small bowel obstruction. usg of the abdomen revealed dilated stomach extending below the level of the umbilicus and a few dilated hyperperistaltic small bowel loops. a non - contrast enhanced computed tomography (ct) scan of the abdomen was performed which showed non - clustered, non - encapsulated dilated small bowel loops predominantly in the lower abdomen with large stretched stomach. transverse colon was seen below the level of the stomach in the upper pelvis and the small bowel loops were seen ventral to the transverse colon. an internal hernia, probably of transmesocolic transomental type, causing small bowel obstruction with stretching of stomach and transverse colon was suspected. stomach and proximal jejunal loops were opacified with oral contrast ; however, distal jejunal and ileal loops were not opacified even on delayed scan images (6 hours). dilated small bowel loops were seen predominantly right antero - lateral and inferior to the stomach and transverse colon. afferent and efferent small bowel loops with beaking were seen clearly just above the antral part of the stomach [figures 1a c ]. these findings suggested the presence of a transomental (lesser omentum) and transmesocolic internal hernia. ct scan axial and oblique coronal images show elongated and stretched down stomach (star - shaped markers) and transverse colon (white open arrow) with two collapsed small bowel loops with beaking (black arrows in a) seen antero - superior to the antral part of the stomach. dilated small bowel loops are seen right lateral and inferior to the stomach and the transverse colon. mild free fluid in between the bowel loops and mild distal stomach wall thickening (congestive edema) are also noted the patient subsequently underwent open laparotomy. a loop of non - ischemic dilated small bowel was seen herniating through the defects in the transverse mesocolon (5.0 cm) and the lesser ometum (gastrohepatic ligament, about 4.0 cm) into the peritoneum. stomach and transverse colon were stretched down by the herniated small bowel loops [figure 2 ]. intraoperative image showing herniated small bowel loops (black arrows) seen entering the peritoneal cavity from the superior aspect of the antrum of the stomach (star - shaped marker). transverse colon is seen just below the stomach (open arrow) postoperatively, the patient was followed up with usg, and he has been doing well for more than 10 months. transmesenteric hernia occurs when a loop of intestine protrudes through a defect in the intestinal mesentery or omentum. the reported frequencies of transomental and transmesenteric hernias are about 4% and 8%, respectively. combined transomental and transmesocolic hernia these hernias are the most common type of internal hernia in pediatric population and account for 35% of all internal hernias. mesenteric defects have an association with intestinal ischemic accidents and have an increased incidence in infants with intestinal atresia. small bowel mesenteric defects were found in 71% all transmesenteric hernias, with ileo - cecal defects accounting for 54% of these occurrences. mesocolic defects were found in 26%, with transmesocolic defects making up 59% of these variants. a second peak of transmesenteric hernia is seen in the adult population and can be iatrogenic or related to prior abdominal surgery, especially with roux - en - y anastomosis, trauma, or inflammation. three main types of transmesenteric internal hernias are seen which are as follows : the most common type is the transmesocolic, which has been documented to occur in 0.7 - 3.25% of patients after laparoscopic roux - en - y gastric bypass surgeryhernia through a defect in the small bowel mesenterypeterson type, which involves herniation of small bowel behind the roux loop before the small bowel eventually passes through the defect in the transverse mesocolon. the most common type is the transmesocolic, which has been documented to occur in 0.7 - 3.25% of patients after laparoscopic roux - en - y gastric bypass surgery hernia through a defect in the small bowel mesentery peterson type, which involves herniation of small bowel behind the roux loop before the small bowel eventually passes through the defect in the transverse mesocolon. depending on the type of transmesenteric hernia and the segment and length of the herniated bowel, imaging appearances may vary. transmesocolic hernia on oral contrast studies and ct may show a beaked appearance of both the afferent and efferent loops and the resultant mass effect on the stomach and transverse colon. these findings may simulate a left paraduodenal hernia or can be mistaken for a concomitant occurrence of small - bowel volvulus and closed loop obstruction, but are almost always clustered and encapsulated. in our case, the stomach and transverse colon were stretched down by the non - clustered, non - encapsulated herniating small bowel loops. defect in the transverse mesocolon may provide access for internal herniation of small bowel loops posterior to the transverse colon into the lesser sac. usually the orifice will be very large with an avascular space in the base of the mesocolon. re - entry into the greater peritoneal cavity is frequent via the routes of the foramen of winslow, the gastrohepatic ligament, and the gastrocolic ligament. in our case, we found herniation of small bowel loops through the transverse mesocolon and gastrohepatic ligament back into the peritoneal cavity with significant small bowel obstruction. most occur on the right side of the greater omentum without a sac and are always intraperitoneal. chou. described the ct findings of their case on contrast study (oral and iv) as an unusual course of mesenteric vessels and unusual location of the small bowel. the proximal small bowel loops were in the right upper quadrant at a level cephalad to the hepatic flexure of the colon and ventral to the transverse colon dilated proximal small bowel loops were seen in the mid abdomen on the right side, caudal to the hepatic flexure and ventral to the transverse colon. a shows the herniated bowel loops seen ventral to the distal stomach, and c represents the stretched down stomach and the transverse colon with increasing intestinal obstruction. b represents the initial findings of the same hernia herniation of small bowel loops through the defect in the transverse mesocolon and gastrocolic ligament can also cause mass effect with stretching of transverse colon and non - clustered, non - encapsulated dilated small bowel loops. double omental hernia probably may not cause stretching of transverse colon as the small bowel loops will pass ventral and superior to the transverse colon into the lesser sac and then prolapse into the peritoneal cavity through the defect in the lesser omentum [figure 4 ]. prolapsed small bowel loops will be seen extending from the antero - superior aspect of the distal stomach. pressure effects over the stomach can be seen with increasing herniating bowel segment or obstruction as compared to our case (stretched bowel sign). also, it can be diagnosed on ct scan either by mesenteric vascular reorientation or by abnormal small bowel position. diagram showing double omental hernia with small bowel loops herniating from greater and lesser omental defects with prolapsed loops seen anterior to the distal stomach ; it may present as epigastric lump in the classification of transomental hernias given by takeyama., herniation through the free greater omentum and into the lesser sac through the defect in gastrocolic ligament has been mentioned. but in the present case and a few other reported cases, the classification can be modified as herniation either into the lesser sac or into the peritoneal cavity across the omentum (through greater or lesser omentum) and into the layers of omentum. the indirect signs (small bowel loops antero - superior to the distal stomach, ventral to the transverse colon, and the stretched bowel sign) are useful for diagnosis of combined transomental (through lesser omentum) and transmesocolic hernia and double omental hernia (internal hernias where the herniating bowel loops are seen antero - superior to the distal stomach and stretching of adjacent bowel loops with increasing herniating bowel segment and/or intestinal obstruction) on routine usg and ct examinations and even on barium follow - through study. using the same principle, hernias through a defect in the transverse mesocolon and gastrocolic ligament can also cause mass effect with stretching of the transverse colon. | transomental and transmesenteric hernias are rare types of internal hernia, with a reported frequency of upto 4% and 8%, respectively. combined transomental and transmesocolic hernia is even rare. only in a few types of internal hernia, the dilated small bowel loops will be seen extending from the antero - superior aspect of the distal stomach and cause stretching effect over the adjacent bowel loops with increase in the size of the herniated bowel segment or intestinal obstruction. we report a rare case of idiopathic combined transomental (across the lesser omentum) and transmesocolic internal hernia with stretched bowel sign, its diagrammatic representations, and review of literature. |
polyamides, polyimides, and their copolymers are certainly one of the most useful classes of high - performance polymers, which have found many applications in industries as discussed by mittal and abade. aromatic polyimides are an important class of heterocyclic polymers with remarkable heat resistance and superior mechanical and electrical properties, and also durability as discussed by banihashemi and abdolmaleki, ghosh and mittal and wilson.. various efforts have been focused on the preparation of soluble and/or thermoplastic polyimides, while still maintaining the excellent thermal and mechanical properties. typical approaches that have been employed to improve the processability of them include the incorporation of flexible links as discussed by tamai., bulky pendant or cardo groups as discussed by hsiao and li and mller and ringsdorf, kinked or asymmetric structures as discussed by li., and spiro skeletons as discussed by reddy. into the polymer chain. these modifications lower the melting temperature and lead to soluble and amorphous polymers. in general, amorphous polymers have a lower softening temperature (tg) and improved solubility with respect to their crystalline analogues. some of the block copolymers composed of polyethers and polyamides have already been commercialized as thermoplastic elastomers as discussed by legge.. a number of synthetic routes for polyether - polyimide block copolymers have been known as discussed by noshay and mcgrath. the synthesis and application of optically active polymers is a considerable topic, which has been paid more attention recently as discussed by hajipour.. most of the natural polymers are optically active and have special chemical activities, such as catalytic properties that exist in genes, proteins, and enzymes. some other applications are construction of chiral media for asymmetric synthesis, chiral stationary phases for resolution of enantiomers in chromatographic techniques as discussed by akelah and sherrington, aglietto. okamoto and yashima, and soai and niwa, chiral liquid crystals in ferroelectrics and nonlinear optical devices as discussed by wulff and fontanille and guyot. these synthetic polymers based on optically pure amino acids can induce crystallinity with their ability to form higher ordered structures that exhibit enhanced solubility characteristics as discussed by birchall.. these properties have caused them to be good candidate for drug delivery systems, biodegradable macromolecules, biomaterials, and also as chiral purification media as discussed by mallakpour.. recently, we have synthesized optically active polymers by different methods as discussed by mallakpour. l - lysine with good functionalities has been used to prepare some polytartaramides as discussed by bou and muoz - guerra and maj.. in this research, we report the synthesis and characterization of some pas and pis from an inexpensive starting material through polycondensation in refluxing dmf. these polymers showed good optical activity (28.12 to 48.56) and because of the presence of pendent ester moiety they can potentially be ion exchangeable as discussed by mller and ringsdorf. in pi2 because of the presence of benzophenone moiety, this polymer can potentially be photolabile. the photolabile polymers can potentially be used as affinity columns for protein purification as discussed by guo.. the outstanding characteristics of these polymers include thermal stability, good solubility, optical activity, semicrystallinity, potentially being photolabile and ion exchangeable. h nmr spectra were recorded on 300 mhz (bruker avance) instrument, using dmso - d6 as solvent and tetramethylsilane as shift reference (tube diameter, 5 mm). ir spectra were recorded on a shimadzu ft - ir-680 instrument, using kbr pellets. thermogravimetric analyses (tga) were recorded on a mettler tga-50 with heating rate of 10c min under air atmosphere. inherent viscosities of polymers were measured by a standard procedure using a kpg cannon fenske routine viscometer at 25c using dmf as solvent. elemental analyses were preformed in a heraeus chns - rapid instrument. in a 50 ml round - bottomed flask equipped with a reflux condenser and a stirring bar, 8 ml of thionyl chloride was added dropwise to the stirring absolute ethanol (2.5 ml) at 10c. l - lysine hydrochloride (7.3 g, 0.04 mol) was added to the mixture and refluxed for 6 hours. the solvent was evaporated under reduced pressure and the residue was washed with diethyl ether for three times. yield : 87% ; m.p. : 136 - 137c ; ir (cm) : 3421, 33502514, 2019, 1740, 1603, 1583, 1501, 1217, 851, 740 ; h - nmr (d2o, ppm) : 1.07 (3h), 1.29 (2h), 1.49 (2h), 1.76 (2h), 2.78 (2h), 3.91 (1h), 4.08 (2h) ; elemental analysis for c8h18n2o22hcl, calculated : c (38.87%), h (8.16%), n (11.33%), found : c (38.62%), h (8.31%), n (11.40%). for the general procedure in a 25 ml round - bottomed flask equipped with a reflux condenser and a stirring bar, a mixture of dianhydride (0.001 mol), ethyl l - lysine dihydrochloride (0.001 mol), et3n (0.002 mol), and dmf (5 ml) were placed. the mixture was stirred at r.t. for 2 hours and then at refluxing temperature for 5 hours. the white precipitate was filtered off, washed with water, and dried under vacuum condition. pi1 (using pyromellitic dianhydride)yield : 75% ; inh (dl g) = 0.42 ; []d = 30.68 ; uv (max) : 263 ; ir (cm) : 29802894, 2858, 17741680, 1495, 14581386, 1244, 1120, 1023, 719, 496 ; h nmr (dmso - d6, ppm) : 1.26 (2h), 1.41 (3h), 1.761.83 (2h), 2.33 (2h), 3.74 (2h), 4.23 (1h), 4.87 (2h), 8.068.29 (2h). elemental analysis for c18h16n2o5 : calculated : c (63.52%), h (4.73%), n (8.23%), found : c (63.42%), h (4.80%), n (8.11%). wide - angle x - ray diffraction patterns of this polymer in the region of 2 = 570 at room temperature indicate 2030% of crystallinity. yield : 75% ; inh (dl g) = 0.42 ; []d = 30.68 ; uv (max) : 263 ; ir (cm) : 29802894, 2858, 17741680, 1495, 14581386, 1244, 1120, 1023, 719, 496 ; h nmr (dmso - d6, ppm) : 1.26 (2h), 1.41 (3h), 1.761.83 (2h), 2.33 (2h), 3.74 (2h), 4.23 (1h), 4.87 (2h), 8.068.29 (2h). elemental analysis for c18h16n2o5 : calculated : c (63.52%), h (4.73%), n (8.23%), found : c (63.42%), h (4.80%), n (8.11%). wide - angle x - ray diffraction patterns of this polymer in the region of 2 = 570 at room temperature indicate 2030% of crystallinity. pi2(using 3,3,4,4-benzophenone tetracarboxylic-3,3,4,4-dianhydride)yield : 80% ; inh (dl g) = 0.15 ; []d = 48.56 ; uv (max) : 265, 290 ; ir (cm) : 2938, 17761715, 1669, 1619, 1441, 1385, 1294, 1246, 1184, 1157, 1096, 1024, 859, 726 ; h nmr (dmso - d6, ppm) : 1.26 (2h), 1.44 (3h), 1.751.82 (2h), 2.34 (2h), 3.73 (2h), 4.24 (1h), 4.87 (2h), 7.998.23 (6h). elemental analysis for c25h20n2o6 : calculated : c (67.55%), h (4.54%), n (6.30%), found : c (67.46%), h (4.77%), n (6.16%). yield : 80% ; inh (dl g) = 0.15 ; []d = 48.56 ; uv (max) : 265, 290 ; ir (cm) : 2938, 17761715, 1669, 1619, 1441, 1385, 1294, 1246, 1184, 1157, 1096, 1024, 859, 726 ; h nmr (dmso - d6, ppm) : 1.26 (2h), 1.44 (3h), 1.751.82 (2h), 2.34 (2h), 3.73 (2h), 4.24 (1h), 4.87 (2h), 7.998.23 (6h). elemental analysis for c25h20n2o6 : calculated : c (67.55%), h (4.54%), n (6.30%), found : c (67.46%), h (4.77%), n (6.16%). pi3(using 4,4-(hexaflouroisopropylidene) diphthalic anhydride)yield : 70% ; inh (dl g) = 0.18 ; []d = 28.26 ; uv (max) : 280 ; ir (cm) : 2941, 17791719, 1442, 1385, 1297, 1255, 1210, 1140, 1105, 722 ; h nmr (dmso - d6, ppm) : 1.051.12 (2h), 1.22 (3h), 1.531.58 (2h), 2.11 (2h), 3.49 (2h), 4.01 (1h), 4.65 (2h), 7.607.99 (6h). elemental analysis for c27h20n2o5f6 : calculated : c (57.24%), h (3.56%), n (4.95%), found c (57.10%), h (3.64%), n (4.86%). yield : 70% ; inh (dl g) = 0.18 ; []d = 28.26 ; uv (max) : 280 ; ir (cm) : 2941, 17791719, 1442, 1385, 1297, 1255, 1210, 1140, 1105, 722 ; h nmr (dmso - d6, ppm) : 1.051.12 (2h), 1.22 (3h), 1.531.58 (2h), 2.11 (2h), 3.49 (2h), 4.01 (1h), 4.65 (2h), 7.607.99 (6h). elemental analysis for c27h20n2o5f6 : calculated : c (57.24%), h (3.56%), n (4.95%), found c (57.10%), h (3.64%), n (4.86%). in a 25 ml round - bottomed flask equipped with a reflux condenser and a stirring bar, a mixture of aromatic acid dichloride (0.001 mol), ethyl l - lysine dihydrochloride (0.001 mol), et3n (0.004 mol) and dmf (5 ml) were placed. the white precipitate was filtered off, washed with water, and dried under vacuum conditions. pa4(using terephthaloyl dichloride)yield : 65% ; inh (dl g) = 0.31 ; []d = 28.12 ; uv (max) : 265 ; ir (cm) : 3423, 2963, 17271615, 1505, 1439, 1410, 1276, 1197, 1118, 1018, 727 ; h nmr (dmso - d6, ppm) : 1.12 (2h), 1.231.26 (3h), 1.32 (2h), 1.381.60 (2h), 1.82 (2h), 2.96 (2h), 3.29 (1h), 4.30 (1h), 4.47 (2h), 7.658.16 (4h), 11.42 (1h). elemental analysis for c16h20n2o3 : calculated c (66.65%), h (6.99%), n (9.71%), found c (66.54%), h (7.07%), n (9.66%). yield : 65% ; inh (dl g) = 0.31 ; []d = 28.12 ; uv (max) : 265 ; ir (cm) : 3423, 2963, 17271615, 1505, 1439, 1410, 1276, 1197, 1118, 1018, 727 ; h nmr (dmso - d6, ppm) : 1.12 (2h), 1.231.26 (3h), 1.32 (2h), 1.381.60 (2h), 1.82 (2h), 2.96 (2h), 3.29 (1h), 4.30 (1h), 4.47 (2h), 7.658.16 (4h), 11.42 (1h). elemental analysis for c16h20n2o3 : calculated c (66.65%), h (6.99%), n (9.71%), found c (66.54%), h (7.07%), n (9.66%). pa5(using isophthaloyl dichloride)yield : 60% ; inh (dl g) = 0.17 ; []d = 30.22 ; uv (max) : 265 ; ir (cm) : 3422, 2962, 17221685, 1431, 1312, 1288, 1251, 11311077, 724 ; h nmr (dmso - d6, ppm) : 1.12 (2h), 1.231.26 (3h), 1.39 (2h), 1.401.79 (2h), 2.97 (2h), 3.25 (1h), 4.42 (2h), 7.648.56 (5h). elemental analysis for c16h20n2o3 : calculated c (66.65%), h (6.99%), n (9.71%), found c (66.48%), h (7.10%), n (9.62%). yield : 60% ; inh (dl g) = 0.17 ; []d = 30.22 ; uv (max) : 265 ; ir (cm) : 3422, 2962, 17221685, 1431, 1312, 1288, 1251, 11311077, 724 ; h nmr (dmso - d6, ppm) : 1.12 (2h), 1.231.26 (3h), 1.39 (2h), 1.401.79 (2h), 2.97 (2h), 3.25 (1h), 4.42 (2h), 7.648.56 (5h). elemental analysis for c16h20n2o3 : calculated c (66.65%), h (6.99%), n (9.71%), found c (66.48%), h (7.10%), n (9.62%). ethyl l - lysine dihydrochloride was prepared with the reaction of a mixture of etoh and thionyl chloride with l - lysine hydrochloride. l - lysine hydrochloride was added to the mixture dropwise at 10c and then refluxed for 6 hours. the dark solid was washed three times with diethyl ether to leave a bright white solid (87%). ft - ir spectroscopy shows a strong and broad peak at 33502514 cm corresponding to the amonium n h stretchings and a strong peak at 1740 cm corresponding to the c = o stretchinng of ester moiety. h - nmr (d2o, ppm) spectroscopy shows the corresponding peaks such as 3.91 (1h) due to the chiral center and 1.07 (3h) and 2.78 (2h) peaks due to the ethyl moiety. solution polymerization in dmf in the presence of et3n was applied to prepare the polymers from ethyl l - lysine dihydrochloride and the other corresponding monomers (schemes 1 and 2). but in preparing the pis the mixture was refluxed to turn the amic acid groups to imide. et3n was used to release the amino group of the l - lysine derivative and also to scavenge the released hcl in amidation. we also found that using an ionic liquid (1-methyl-3-propyl imidazolium bromide) as the solvent of polymerization can cause some difficulties in purification, so it is an unsuitable polymerization media. all of the very probable atactic polymers were obtained from an inexpensive starting material in quantitative yields with moderate inherent viscosities (0.150.42 dl g) and optical rotation (28.12 to 48.56). as there is no obvious regioselectivity between alpha and epsilon amino groups of the lysine ester during the polymerisation step then random orientation of lysine moieties along the polymer backbone can be predicted and the concept of tacticity " can not be addressed in this research. head - to - tail regiorandomness may likely affect some physical properties of the polymers such as crystallinity. the formation of pis was confirmed by ir and h nmr spectroscopy and elemental analysis. as an example, the ir of pi1 showed the c = o asymmetric stretching of imide group, the c = o symmetric stretching of imide and ester groups at 17741680 cm, c n stretching at around 1386 cm, and c o stretching at 1120 cm. all of these pis exhibited strong absorption at around 1380 and 720 cm, which shows the presence of the heterocyclic imide groups (figure 1). as an example the h nmr spectrum of pi1 is presented in figure 2 which shows peaks that confirmed its chemical structure (h nmr (dmso - d6, ppm) : 1.26 (2h), 1.41 (3h), 1.761.83 (2h), 2.33 (2h), 3.74 (2h), 4.23 (1h), 4.87 (2h), 8.068.29 (2h)). the formation of pas was confirmed by ir and h nmr spectroscopy and elemental analysis. as an example, the ir of pa4 showed the n h stretching of amide group at 3423 cm, the c = o stretching of amide and ester and also the n h bending of amide groups at 17271615 cm and the c o stretching at 1118 cm (figure 3). as an example the h nmr spectrum of pa4 is presented which shows peaks that confirmed its chemical structure (figure 4). the elemental analyses results are also in good agreement with calculated / expected percentages of carbon, hydrogen, and nitrogen contents in the polymer - repeating units. the resulting homogenous glassy compound films were isolated by adding methanol / h2o (80 : 20) and triturating, followed by filtration. transparent, flexile, and tough films of these polymers were obtained which showed good mechanical strength of the films and consequently high molecular weight. wide - angle x - ray diffraction patterns of pi1 in the region of 2 = 570 at room temperature indicate 2030% of crystallinity. tga technique shows moderate to good thermal stability for these polymers (table 1). for example the tga / dtg spectrum of pi1 presents t5% and t10% at around 240c and 310c, respectively. these polymers can be partially hydrolyzed to present the pendent carboxylic acid groups (ion - exchangeable polymers). one of the major objectives of this work is to study the solubility and the versatility of these polymers by incorporating the soft segment in the polymer backbone. the solubility of these polymers was tested qualitatively in various solvents and the results are summarized in table 2. five new chiral polyamides and polyimides incorporating ethyl l - lysine ester have been synthesized from an inexpensive starting material by usual solution polycondensation method. the resulting polymers are identified spectroscopic methods such as ft - ir, uv - vis and h nmr spectroscopy and elemental analysis. the polymers are characterized by yield of reaction, inherent viscosity, wax diffraction, and specific rotation. | ethyl l - lysine dihydrochloride was reacted with three different dianhydrides to yield the poly (ethyl l - lysinimide)s (pi13) ; it was also reacted with two different diacyl chlorides to yield the poly (ethyl l - lysinamide)s (pa4 - 5). the resulting polymers have inherent viscosities in the range of 0.15 to 0.42 dl g1. these polymers are prepared from an inexpensive starting material and are optically active, potentially ion exchangeable, semicrystalline, thermally stable, and soluble in polar aprotic solvents such as dmf, dmso, nmp, dmac, and sulfuric acid. all of the above polymers were fully characterized by ft - ir and 1h nmr spectroscopy, elemental analysis, wax diffraction, tga, inherent viscosity measurement, and specific rotation. |
fistulas inaccessible from the vagina may require abdominal repair ; we sought to evaluate the robotic - assisted laparoscopic approach for this procedure. a 41-year - old nulliparous woman presented with urinary incontinence following an abdominal hysterectomy, and office evaluation identified a vesicovaginal fistula. after discussion with the patient regarding the surgical options, the robotic approach was chosen to facilitate precise dissection, fine visualization, and suturing. a stent was placed from the bladder into the vagina, and no intentional cystotomy was made. the bladder was dissected away from the anterior vaginal wall at the fistula site, and the defects were closed independently with interposition of a fatty epiploica from the sigmoid colon. total operative time was approximately 4 hours, and robotic time was about 2.5 hours. the robotic - assisted laparoscopic approach is a viable option for successful repair of a vesicovaginal fistula in a patient in whom a vaginal approach is not indicated. most vesicovaginal fistulas in the united states today are the result of abdominal gynecologic surgery and may not have been detected or predictable based on the original surgery. patients typically complain of incontinence of urine, particularly upon standing. after confirming the absence of urinary tract infection, a careful speculum examination should be done to look for vaginal mucosa defects. additionally, use of medication to dye the urine while a tampon is in the vagina may confirm the presence of a connection., imaging should be used to investigate for involvement of the upper urinary tract. if conservative options fail and after allowing postoperative inflammation to subside, traditional surgical options have included vaginal repair, usually using the latzko technique, or an abdominal incision for open repair. patients are typically offered an abdominal repair if the defect is large, multiple, involves other pelvic structures including the ureters, or if there is poor descent of the vaginal cuff causing the defect to be inadequately visualized from a vaginal approach. prior reports, however, have often included the use of an intentional cystotomy to facilitate dissection. because of the morbidity and recovery required for an abdominal incision, we sought to evaluate the role of the da vinci robotic system (intuitive surgical, sunnyvale, ca, usa) to facilitate repair of a vesicovaginal fistula. a 41-year - old, nulliparous woman presented with urinary incontinence after an emergent total abdominal hysterectomy with bilateral salpingectomy. there was no difficulty with dissection of the bladder or cystotomy noted at the time of the procedure. a phenazopyridine tampon test in the office 2 weeks after the surgery confirmed a connection from the bladder to the vagina. a 1 cm opening was identified on the base of the bladder above the trigone to the right of the midline and 2 cm posterior to the interureteric ridge. the ureteral orifices did not appear to be compromised by the fistula and outflow was seen from both. the patient declined prolonged drainage with a catheter after counseling that this might promote healing. given the difficulty in visualizing the lesion and the lack of cuff descent in this nulliparous woman, an abdominal rather than vaginal approach for repair was recommended. after discussion with the patient regarding the risks and benefits of an open abdominal procedure, a laparoscopic repair, or a robotic approach, the patient chose the robotic surgery. the similarities and differences between the 3 procedures were discussed with the patient, along with the attending surgeon 's experience with robotic surgery, which spans 4 years. the patient was aware that the surgery could be converted to laparoscopy or an open procedure should there be any difficulty with the robotic approach. the surgery was scheduled approximately 3 months after the hysterectomy had been performed. in the operating room, the patient was positioned in the dorsal lithotomy position similar to that used in standard laparoscopy. on cystoscopy, the fistula was noted, and a 5-french pollack stent was placed from the bladder through the fistulous tract into the vagina. double j ureteral stents were placed over guide wires, given the close proximity of the ureteral orifices to the fistula and repair. the hasson technique was chosen for umbilical port access due to the patient 's previous surgery. the camera was placed through a 12 mm port located superior to the umbilicus and approximately 18 cm superior to the symphysis pubis. twelve mm and 5 mm assistant ports were placed on the right side, and 8 mm robotic trocars were inserted on the lateral edge of the rectus muscles bilaterally (figure 1). lysis of omental and small bowel adhesions in the area of the previous incision was performed using hook cautery and the 30-degree up lens. port placement for robotic - assisted vesicovaginal fistula repair : c = 12 mm camera port ; r = 8 mm robotic ports located on lateral edge of rectus muscles ; s = 5 mm suction port ; a = 12 mm assistant port located superior and medial to anterior superior iliac spine. the vaginal cuff was identified by a sponge stick in the vagina and dissection proceeded along the anterior vaginal wall. the bladder was dissected away from the anterior vaginal wall by using hook cautery and the 0-degree lens for the robotic camera. fluid containing indigo carmine was instilled into the bladder and was seen coming from the fistula site. the bladder was repaired by using a running stitch of 3 - 0 vicryl on an rb needle using the da vinci robot. a second layer of closure was performed in an imbricating fashion with the same suture. the vagina was closed using a running stitch of 2- 0 monocryl on an sh needle. the ureteral stents were removed without difficulty, and backfill of the bladder again using indigo carmine failed to reveal any interruption of bladder integrity. a fatty epiploica from the sigmoid colon total operative time, including patient positioning, cystoscopy for ureteral stents, and fistula identification, was approximately 4.5 hours. she returned for a follow - up 3 weeks after surgery and reported no continuing symptoms of urinary incontinence. as in this patient, abdominal hysterectomy is the most common cause of vesicovaginal fistula in developed countries, while obstetric causes are much less common. although conservative management is successful in some patients, and others are candidates for vaginal repair, some patients may not be candidates or may be unsatisfied with these options. the laparoscopic approach is a viable option for successful repair of a vesicovaginal fistula in a patient in whom a vaginal approach is not indicated. as with other laparoscopic surgeries, this provides superior magnification of tissue, visualization of any additional pathology, and requires no large abdominal incision. additionally, laparoscopic and robotic surgery may result in a shorter hospital length of stay and improved cosmesis as compared with open abdominal surgery. however, this may be an obstacle to surgeons without laparoscopic suturing or advanced dissecting skills. the da vinci robotic tower includes 1 camera arm and 2 to 3 instrument arms that are controlled remotely by the surgeon sitting at a nonsterile console. once a surgeon is trained to use the robotic - assisted approach, the da vinci robot can be used to facilitate the laparoscopic repair. its advantages include improved dexterity with increased degrees of freedom giving the surgeon the sensation of having wrists rather than lever arms, enhanced magnification, 3-dimensional visualization providing depth perception similar to that of open surgery, increased surgeon comfort with a seat and decreased surgeon hand fatigue compared with traditional operative laparoscopy. a successful robotic - assisted technique has been described. in both of these previous reports of this surgical technique, intentional cystotomies were made in a healthy area of the posterior wall of the bladder to facilitate identification and repair. a stent placed cystoscopically from the bladder into the vagina, as explained here, may obviate the need to make an intentional cystotomy. this may decrease the risk of recurrence and length of postoperative catheterization. because robotic surgery is relatively new to gynecology, its ultimate role is still evolving. procedures that involve a high degree of precision and technical skill like suturing appear to be the first areas of application of this technology, given the advantages of robotic surgery over traditional laparoscopy. given the extent of gynecologic surgery that is performed laparoscopically at this point, it is reasonable to believe that robotic surgery could have an expanding list of uses. as the case volume grows, additional studies should be carried out to assess the benefits of robotic assistance over traditional laparoscopy or other surgical approaches. although the vaginal approach is the most common for repair of vesicovaginal fistulas, the robotic - assisted laparoscopic approach can also be a successful option in patients for whom the vaginal approach is not possible. | background and objectives : fistulas inaccessible from the vagina may require abdominal repair ; we sought to evaluate the robotic - assisted laparoscopic approach for this procedure.methods:a 41-year - old nulliparous woman presented with urinary incontinence following an abdominal hysterectomy, and office evaluation identified a vesicovaginal fistula. after discussion with the patient regarding the surgical options, the robotic approach was chosen to facilitate precise dissection, fine visualization, and suturing. a stent was placed from the bladder into the vagina, and no intentional cystotomy was made. the bladder was dissected away from the anterior vaginal wall at the fistula site, and the defects were closed independently with interposition of a fatty epiploica from the sigmoid colon. total operative time was approximately 4 hours, and robotic time was about 2.5 hours.results:at 3 months after surgery, the patient had no recurrent symptoms.conclusions:the robotic - assisted laparoscopic approach is a viable option for successful repair of a vesicovaginal fistula in a patient in whom a vaginal approach is not indicated. |
it is estimated that 26.2% of americans aged 18 and older (about 1 in 4 adults) have a diagnosable mental disorder. in the aftermath of the sandy hook tragedy, mental health has been recognized as a priority issue in the united states, specifically depression. in a study by the centers for disease control and prevention, among a sample of 235 067 adults (in 45 states, the district of columbia, puerto rico, and the us virgin islands), 9.1% met the criteria for current depression (significant symptoms for at least 2 weeks before the survey), including 4.1% who met the criteria for major depression. depression can be described as a state of low mood and a loss of interest in daily activities. it can be accompanied by other symptoms such as guilt, low energy, the disturbance of appetite and sleep, and concentration. these feelings can lead to extreme thoughts or actions, including suicide. according to the american foundation for suicide prevention, over 60% of all people who die by suicide have major depression. the us preventive services task force (uspstf) recommends screening adults for depression in primary care practices that have systems in place to assure accurate diagnosis, effective treatment, and follow - up. primary care settings are the locale where up to 70% of patients are diagnosed and treated for the most prevalent mental health conditions including anxiety, mood, and substance abuse disorders. furthermore, medical comorbidity is the rule for this population in which the majority have at least 1 co - occurring chronic medical illness. because many acute and chronic medical conditions (eg, chronic pain, copd, obesity) involve health behaviors or psychosocial issues with the potential to exacerbate symptoms or undermine treatment outcomes, primary care is well suited as the medical home for provision of essential behavioral health care. there is a growing amount of research, which shows that integrated behavioral care produces significant positive results, including decreases in depression levels, improvement in quality of life, decreased stress, and lower rates of psychiatric hospitalization. analysis of national ambulatory medical care surveys from 2003 to 2006 revealed that, despite the high prevalence of depression in primary care, screening is extremely low at 2% to 4%. per the 2013 study by mcgoey, the average annual frequency of documented depression screening was 1.3%. for visits to primary care providers specifically, the rate of screening was 1.8%, for internists it was 2.8%, and for pediatricians it was 1.8%. there are many standardized depression screening tools that can be used by primary care medical providers, but the study shows that an overwhelming 65% are using the patient health questionnaire 2/9 (phq-2/9) screening tools. the phq-2 inquires about the frequency of a patient s depressed mood and anhedonia (lack of interest or pleasure in doing things) over the past 2 weeks. it is not used to establish a diagnosis, but it is the first step in identifying possible depressive symptoms. a study by arroll in 2010 reported that a phq-2 score of 2 or higher has a sensitivity of 0.86, meaning that 86% of those with a major depression will be found to be positive on the phq-2 screening test. patients who test positive are further evaluated with phq-9 and diagnostic and statistical manual of mental disorder criteria to determine whether they meet the criteria for a depressive disorder. the purpose of this study is to examine the rate of depression screening among patients, aged 19 and older, seen at a community health center while referencing to uspstf screening recommendations. the purpose of this study is to examine the rate of depression screening among patients, aged 19 and older, seen at a community health center while referencing to uspstf screening recommendations. a random sample of 500 patients, aged 19 and older, were extracted from the total number of patients who have been seen at the community health center, between december 1, 2013, and april 30, 2014, using electronic medical records (emrs). using the emr software, the patients who were previously diagnosed with depression were excluded from the total screened for depression. the data was then broken down by gender, race, and ethnicity to see whether there are any significant trends that can be compared to national averages. of the 500 patients in the sample, 49 of them were excluded due to being previously diagnosed with depression. subsequently, data examined by gender showed the rate of screening of males was 8.4%, and for females, it was 17.5% (table 1). depression screening data by gender. additionally, the race with the highest rate of screening was asian, with 23.2% of patients being screened, and the race screened at the lowest rate was white, at 12.8%. then looking at the data - based ethnicity showed that a slightly higher percentage of hispanics were screened (15.3%) than non - hispanics (14.8%), and those patients who did not report their ethnicity (8.7%) (tables 2 and 3). compared to available data on depression screening, for example, the study by cherry and mcgoey (1.8% and 4% respectively), the rate of screening at the community health center was significantly better. primary care providers then either treat depression in primary care setting or use appropriate referral pathways to address depression, since offering treatment after depression screening improves outcomes. several studies have shown that major depression is more frequent among members of minority groups than among whites. a 2005 study by riolo examined racial / ethnic differences among middle - aged women and found that depressive symptoms among hispanic and african american women were higher compared to other ethnicities. also, a 2010 study by gonzlez showed that african americans and hispanics exhibited elevated rates of major depression relative to whites. previous research has also shown that socioeconomic indicators, such as education, income, and marital status, are associated with depressive symptoms and, in some cases, may explain racial / ethnic differences in rates of depression. there is also clear evidence that females are more likely to have depressive symptoms compared to males. our study findings seem to mirror current differences in race, ethnicity, and gender. community health centers aid the underserved, with a significant portion of the population belonging to the lower socioeconomic strata and minority race or ethnicities. screening and treatment of depression in the community health centers setting deserve special focus. however, behavioral health is not currently fully integrated into general internal medicine at primary care practices, including community health centers. current health care policy makes it difficult for most primary care practices to integrate mental health staff because of insufficient reimbursement, mental health insurance carve outs, and difficulty in supporting collocated mental health professionals, to name a few. the particular health center, at the time of the survey, did not offer on - site behavioral health services, that is, there were no psychologists, case workers, or psychiatrists on staff. furthermore, physicians, physician assistants, and nurse practitioners often lack the time or training to effectively address mental health needs. primary care providers also continue to encounter barriers to referring patients to specialty mental health settings, while patient uptake to these offsite referrals remains low. finally, patients might be reluctant to talk about mental health problems such as depression. per the study by psych central in 2011, 43% were hesitant to talk to their primary care physician about their depressive symptoms. the most common reason was they did nt want to be put on medications, such as antidepressants. also, 16% of patients said they did nt think talking about emotional issues were a part of their physician s job, while others stated that they did nt want to be branded as being a psychiatric patient with a mental disorder. our study was designed to survey the screening rates and provide evidence of its lack. therefore, future studies should be designed to look not only into the rates but also to determine the underlying factor for why almost 85% of patients were unfortunately not screened. in summary, although mental health wellness has drawn more public attention in recent years, there continues to be barriers surrounding mental health, including depression. improving screening and treatment for depression in primary care will require better mental health care integration. enhanced coordinated financial support for the integration of mental health care into primary care could improve identification and treatment of depression. there is an urgent need for quality improvement initiatives that look into the current practices and potentials for innovations and integrations. the studied community health center had the rate of depression screening at 14.6%, while the current recommendation is universal screening of depression, per the uspstf. since evidence shows that mental health can coexist with medical illness and integration of mental health services to primary care improves overall outcomes, there is an overarching need to improve the screening rates. mass screening in primary care will help clinicians identify missed depression cases and initiate appropriate treatment earlier in their course of depression. addressing barriers to screening, including patient education, provider education, system practices, and provision of screening and treatment resources could help address this important health care gap. | purpose : the purpose of this study is to examine the rate of depression screening among patients, aged 19 and older, seen at a community health center, while referencing to us preventive services task force (uspstf) screening recommendations.methods:a random sample of 500 patients, aged 19 and older, were extracted from the total number of patients seen at the community health center, between december 1, 2013, and april 30, 2014. the rate of depression screening was calculated by analyzing the completed standardized screening questionnaires (patient health questionnaire 2).results : on analysis, it was found that 14.6% of patients were screened for depression. the rate of screening for males was 8.4% and for females it was 17.5%. the race with the highest rate of screening was asian at 23.2%, and the lowest rate was white at 12.8%.conclusion : the studied community health center had a suboptimal rate of depression screening at 14.6%. the uspstf recommends depression screening on all adults. addressing barriers to screening including patient education, provider education, system practices, and provision of resources may help improve the rate of depression screening, leading to early treatment and better health outcomes. |
pseudomyxoma peritonei, a mucinous cancer primarily of ovarian origin, was first described by rokitansky in 1892, although the term pseudomyxoma peritonei was first used by werth., in 1901, frankel reported a similar pathology in association with a cyst of the appendix. since then, the term has been used for various mucusproducing tumors characterized by abundant extracellular mucin. this disease occurs most commonly in females 40 to 60 years of age and originates from mucinous tumors of the ovary or appendix. it is a rare disease characterized by abdominal swelling caused by the mucinous material collected in the entire abdominal cavity following cyst rupture, whether benign or malignant. in many cases, examination reveals an elevated rate of erythrocyte sedimentation and elevated levels of carcinoembryonic antigen. diagnostic findings of fluid collection and tumor images are often obtained through advanced imaging technologies including supersonography or ct. recurrences may be observed, and when they are, complete removal of mucus - producing cells disseminated in the peritoneal cavity is difficult, and multiple abdominal surgeries are often required. in some cases, prophylactic removal of pelvic viscera is performed. the prognosis is generally poor, because many cases, whether benign or malignant initially, recur repeatedly regardless of further treatment. herein, we report on 4 patients diagnosed as having pseudomyxoma peritonei who underwent repeated mucus removal via laparoscopy. this patient was a 47-year - old, g0p0 (gravidity = 0, parity = 0) female. she underwent a partial appendectomy for treatment of appendicitis when she was 7 years old. at that time, a portion of the appendix was not resected because of intense inflammation. at age 23 the tumor was 3 cm 3 cm in diameter with a calcified shell and was determined to be pseudomyxoma peritonei of primary appendiceal origin. the patient was treated with oral administration of cyclophosphamide for 2 years and was followed by ultrasonography every other year on an outpatient basis. at age 33, an abnormal shadow in the douglas cavum was found on ultrasonography and ct. the first laparoscopic surgery was performed, and recurrence of pseudomyxoma peritonei localized in the uterus and uterine appendages was confirmed. one year later, at age 34, a second laparoscopic surgery was performed with the intention of confirming the rate at which the lesion was expanding. the lesions in the uterus and appendages remained unchanged, but additional lesions were observed around the liver. then, the patient was placed under follow - up on an outpatient basis and underwent ultrasound imaging every other year. a third laparoscopic surgery was performed, and expansions of lesions were observed throughout the peritoneal cavity with formation of masses on the serous surface of the sigmoid and gastric corpus. the peritoneal cavity was washed with low - molecular - weight dextran, and mucus was removed to the maximum extent possible. during the next 2 years, the patient experienced abdominal distention, and fourth and fifth laparoscopic surgeries were performed when she was 44 and 45 years old, respectively. on each occasion, mucus had accumulated throughout the peritoneal cavity, and 9.6 l and 5.6 l of mucus was removed with saline at the fourth and fifth surgeries, respectively. computed tomographic scan of accumulated mucus (case 1). the patient has undergone a total of 5 laparoscopic surgeries to date and has survived 25 years since initially presenting with pseudomyxoma peritonei. a 56-year - old, g2p2 female had been seen in the department of internal medicine at our hospital when she was 51years of age. her chief complaint of abdominal distention was thought to result from pseudomyxoma peritonei, diagnosed by ct (figure 2). a mass near the appendix and mucus spreading throughout the peritoneal cavity were confirmed, and the mucus was removed. the second and third laparoscopic surgeries were performed when the patient was 52 and 53 years old, respectively, because of continued complaints of abdominal distention. on each occasion the accumulated mucus was removed to the maximum extent possible, and 6.8l and 6.7l of mucosa was removed at the second and third surgery, respectively. at present, this patient is being followed up on an outpatient basis. a 75-year - old, 2g2p, female, at age 71 was referred to our department from another hospital where an accumulation of ascites and the presence of masses in the left lower abdominal quadrant had been observed. laparoscopic appendicectomy was performed, and mucus that had accumulated up to the volume of 0.5l was removed as far as possible. two years later, at the age of 74, the patient developed abdominal distention, and ct confirmed the presence of pseudomyxoma peritonei spreading to the upper abdomen. the second laparoscopic surgery was performed. a 61-year - old, 2g2p female, at age 60 visited her local hospital with a chief complaint of abdominal distention and received a diagnosis of inoperable pancreatic cancer. she was referred to our hospital where laparoscopic surgery revealed masses throughout the peritoneal cavity and abundant accumulation of mucus at the volume of 10.8 l. mucus was removed to the maximum extent possible. six months later, the second laparoscopic surgery was performed because of the recurrence of abdominal distention and weight gain of 18 kg from after the previous surgery. six months later, the third laparoscopic surgery was performed because of increased abdominal distention and weight gain of 20 kg from the previous time. pseudomyxoma peritonei is generally considered a disease with a poor prognosis, with 5-year and 10-year survival rates of 53% and 32%, respectively, according to a recent report from the mayo clinic, and 75% and 10%, respectively, according to a report from the memorial sloan kettering cancer center. sugarbaker reported that the treatment of pseudo - myxoma peritonei is principally based on resection of the primary lesion and removal of mucus by laparotomy. because complete removal of mucus - producing cells from the peritoneal cavity is rarely achieved, laparotomy must be repeated at intervals determined by the rate of mucus accumulation. in addition, a recurrence rate of over 90% is reported even after the removal. consequently, patients with this disease, which has a poor prognosis with repeated recurrence, must undergo multiple highly invasive procedures. nonsurgical treatment approaches have been reported recently, including systemic and intraperitoneal applications of chemical therapy using 5-flurouracil (5fu) or cisplatin (cddp). various therapies including continuous hyperthermic peritoneal perfusion, in which the peritoneal cavity is perfused with heated saline solution, and intraperitoneal hyperthermic chemotherapy, in which anti - cancer agents are included with the heated saline perfusion have also been attempted. however the major symptom of pseudomyxoma peritonei is abdominal distention resulting from accumulation of mucus. to alleviate this symptom, mucus removal is performed. however, the mucus is often highly viscous, and its removal by abdominal puncture is difficult. green described a mucolytic therapy using a 5% glucose solution to dissolve mucin - like mucus. others have reported that the mucolytic effect of such solutions was not superior to that of saline or low - molecular - weight dextran. in some of the cases presented here, in which mucus removal through the suction tube was difficult, we used low - molecular - weight dextran or saline. usually, intraperitoneal mucus can not be completely removed, and the prognosis of this disease remains poor. at present, laparoscopic procedures have been reported for observing the peritoneal cavity. among them, mucus removal by trocar insertion and postoperative administration of an anti - cancer agent via that portal site have also been reported. laparoscopy, which provides a view of the entire peritoneal cavity, is also useful for observing the progression of the disease, which may recur repeatedly in the entire abdominal cavity. the first trocar is inserted at the umbilicus to locate the mucus pool, and the second trocar is inserted for aspiration and cleaning. the trocar can be inserted selectively from sites including the right and left sides of the pubic region and the upper and lower abdomen along the median line, depending on the mucus - pooling site, to remove the mucus from the entire peritoneal cavity. in laparotomy, on the contrary, a large incision is needed to view the entire cavity ; therefore, the procedure is more invasive for the patient. consequently, the quality of life of patients with pseudomyxoma peritonei would be improved by repeatedly performing minimally invasive laparoscopic surgery. in this article, we report on 4 patients who underwent repeated laparoscopic mucus removal. based on this experience, we plan to continue performing intraperitoneal observation and mucus removal by laparoscopy in these cases. | background and objectives : pseudomyxoma peritonei results from ovarian and appendiceal mucinous tumors. cyst rupture results in intraabdominal mucin accumulation, leading to abdominal distension. no effective treatment has yet been established. pseudomyxoma peritonei is generally associated with a poor prognosis. in a recent mayo clinic report, the 5-year survival rate for this disease was 53% and the 10-year survival rate was 32%, while the memorial sloan - kettering cancer center reported 5- and 10-year survival rates of 75% and 10%.methods and results : in this report, we describe 4 patients with a laparoscopically confirmed recurrence of pseudomyxoma peritonei who subsequently underwent repeated laparoscopic mucin removal.conclusion:because laparoscopic surgery can be performed frequently, it appears that laparoscopic surgery, a minimally invasive procedure, greatly improves the quality of life of patients with pseudomyxoma peritonei. |
we retrospectively reviewed the radiological and clinical findings of 13 patients with a pathologically confirmed mesenchymal hamartoma of the liver. the institutional review board approved the review of the radiological and clinical data for this study and waived the requirement for informed consent. a computed hospital information system was used to identify all patients with a pathologically proved mesenchymal hamartoma during a 15-year period. the pathological diagnosis for a mesenchymal hamartoma was based on overgrowth of the mesenchymal stroma and the proliferation of architecturally abnormal bile ducts with or without a cystic change, accompanied by periductal collaring of the stromal cells (1, 9). three pediatric radiologists retrospectively reviewed the radiological features of the hepatic mesenchymal hamartomas by consensus. ct scans were obtained with various third generation ct scanners at 80 - 120 ma, 100 - 120 kvp, and 5- to 10-mm thick sections. ct scans were obtained after an intravenous bolus injection of contrast media and portal venous phase scans of the liver were available for all patients. ct images of the tumor were evaluated for location, size, presence of septa within the cystic portion, ct attenuation of the tumor relative to the surrounding hepatic parenchyma (low, iso, or high), pattern of contrast - enhancement (homogeneous or heterogeneous enhancement of the solid portion, and septal enhancement of the cystic portion) and presence of calcification on a pre - contrast ct scan. according to the extent of cystic component on the ct scans, we classified each tumor into one of three types : 1) multiseptated cystic - a purely cystic tumor with multiple thin septa ; 2) mixed cystic and solid - a partially cystic tumor with irregular thick septa ; 3) solid - a purely solid tumor without a cystic portion. the cystic portion was defined as an area of low attenuation that showed 0 - 40 hounsfield units (hu) of ct attenuation value. we classified the septal thickness as follows : thin (2 mm in thickness). ultrasonographic (us) scans of nine patients were available for review. among them, seven patients had a color or power doppler us examination. us images were evaluated for the presence of capsule, internal content of the cystic portion (echogenic debris or fluid - fluid level), septal thickness within the cystic portion, and the echogenicity of the solid portion. the amount of mesenchymal stroma, the presence or absence of duct proliferation, the amount of hepatocytes, and the presence or absence of vascular proliferation was evaluated. the amount of mesenchymal stroma and hepatocytes were evaluated semi - quantitatively : little in 50% of the mesenchymal hamartoma. the age of the patients, size of the tumor and various histological findings were compared with the imaging features of the hepatic mesenchymal hamartomas among the three ct types using the kruskall - wallis test. chicago, il). a two - tailed p - value of 2 mm in thickness). ultrasonographic (us) scans of nine patients were available for review. among them, seven patients had a color or power doppler us examination. us images were evaluated for the presence of capsule, internal content of the cystic portion (echogenic debris or fluid - fluid level), septal thickness within the cystic portion, and the echogenicity of the solid portion. the amount of mesenchymal stroma, the presence or absence of duct proliferation, the amount of hepatocytes, and the presence or absence of vascular proliferation was evaluated. the amount of mesenchymal stroma and hepatocytes were evaluated semi - quantitatively : little in 50% of the mesenchymal hamartoma. the age of the patients, size of the tumor and various histological findings were compared with the imaging features of the hepatic mesenchymal hamartomas among the three ct types using the kruskall - wallis test. chicago, il). a two - tailed p - value of < 0.05 was considered to be statistically significant. the subjects were seven boys and six girls, aged from 6 months to 7 years 6 months (mean age : 3 years 2 months). there was no significant difference of age (p = 0.93) among the three ct types of tumors. the patients presented with abdominal distension (n = 8), a palpable mass (n = 3) or an incidentally detected tumor during us (n = 2) for other clinical indications : a patient (case 8) with peutz - jeghers syndrome, and a patient (case 13) that had a kasai operation for biliary atresia at one month of age, respectively. the serum level of alpha - fetoprotein, total and direct bilirubin level, alkaline phosphatase level, and level of transaminases (aspartate transaminase and alanine transaminase) were normal in all except two patients that had an elevated level of alpha - fetoprotein : the patient with biliary atresia (case 13) and a 9-month - old girl (case 5). the tumor occurred in the right lobe of the liver in nine patients and in the left lobe in four patients. splenomegaly, ascites and retroperitoneal lymphadenopathy were noted in one patient that had biliary atresia. the longest diameter of the tumors ranged from 1.8 to 20 cm (mean 13.0 cm) and was larger than 10 cm in 11 patients (85%). there was no significant difference in the size of the tumors (p = 0.79) among the three ct types of tumors. 1), mixed solid and cystic in five patients (38%) (figs. 2, 3), and solid in four patients (31%) (figs. 4, 5). in four patients with a multiseptated cystic tumor, us (n = 1) showed a well - defined tumor with variable cystic spaces and multiple thin septa in the liver (fig. all of these tumors showed fine enhancing septa within the cystic tumor on post - contrast ct (fig. neither calcification nor a solid portion was detected in these patients. in five patients with a mixed cystic and solid tumor, us (n = 5) showed a well - defined tumor with variable - sized cystic spaces, irregularly thick septa, and a solid portion of variable extent with heterogeneous hyperechogenicity (figs. 2a, 3a). in three patients, internal debris with fluid - fluid level was seen in the cystic portion of the tumor (figs. 2a, 2c). on color and power doppler us (n = 4) a tiny nodular intratumoral calcification was seen in one patient (case 8) (fig. = 3) showed a well - defined, isoechoic tumor (n = 1) or slightly hyperechoic (n = 2) (fig. color or power doppler us (n = 3) showed central (fig. these tumors showed low attenuation on a pre - contrast ct scan in all patients, except for one with a high attenuating lesion. at post - contrast ct, 4b, 5c). in the patient that had biliary atresia (case 13), the tumor appeared as a 1.8-cm sized enhancing nodule with a peripheral rim of low attenuation at post - contrast ct (fig. the mesenchymal hamartomas showed multiple variable sized cystic portions within the tumor in their gross morphology (figs. each mesenchymal hamartoma with a multiseptated cystic appearance contained various amounts of myxoid or collagenous stroma and showed proliferation of the malformed bile ducts with periductal collaring of the stromal cells (fig. all of the four patients with a multiseptated cystic tumor contained a small amount of hepatocytes (< 10%) on a semiquantitative evaluation. the mesenchymal hamartomas with a mixed solid and cystic appearance also contained various amounts of myxoid or collagenous stroma and showed proliferation of the malformed bile ducts with periductal collaring of the stromal cells (fig. the amount of hepatocytes was small in three patients and moderate in two patients. in four patients with a solid mesenchymal hamartoma, a moderate (n = 3) amount or abundant amount (n = 1) of hepatocytes was found in the cords, islands or lobular pattern. the solid tumor also contained various amounts of mesenchymal stroma and proliferation of the small bile duct was seen (fig. 4d). in one patient with an enhancing nodule with a peripheral rim of low attenuation (case 13), the enhancing portion revealed a large amount hepatocytes histologically with a rim of myxoid stroma. the amount of hepatocytes was significantly different among the multiseptated cystic, mixed solid and cystic, and solid tumors (p = 0.042). the other pathological findings such as the amount of mesenchymal stroma, the presence of a bile duct or vessel proliferation were not statistically significant among the three groups of the different imaging spectrum. the subjects were seven boys and six girls, aged from 6 months to 7 years 6 months (mean age : 3 years 2 months). there was no significant difference of age (p = 0.93) among the three ct types of tumors. the patients presented with abdominal distension (n = 8), a palpable mass (n = 3) or an incidentally detected tumor during us (n = 2) for other clinical indications : a patient (case 8) with peutz - jeghers syndrome, and a patient (case 13) that had a kasai operation for biliary atresia at one month of age, respectively. the serum level of alpha - fetoprotein, total and direct bilirubin level, alkaline phosphatase level, and level of transaminases (aspartate transaminase and alanine transaminase) were normal in all except two patients that had an elevated level of alpha - fetoprotein : the patient with biliary atresia (case 13) and a 9-month - old girl (case 5). the tumor occurred in the right lobe of the liver in nine patients and in the left lobe in four patients. splenomegaly, ascites and retroperitoneal lymphadenopathy were noted in one patient that had biliary atresia. the longest diameter of the tumors ranged from 1.8 to 20 cm (mean 13.0 cm) and was larger than 10 cm in 11 patients (85%). there was no significant difference in the size of the tumors (p = 0.79) among the three ct types of tumors. 1), mixed solid and cystic in five patients (38%) (figs. 2, 3), and solid in four patients (31%) (figs. 4, 5). in four patients with a multiseptated cystic tumor, us (n = 1) showed a well - defined tumor with variable cystic spaces and multiple thin septa in the liver (fig. all of these tumors showed fine enhancing septa within the cystic tumor on post - contrast ct (fig. neither calcification nor a solid portion was detected in these patients. in five patients with a mixed cystic and solid tumor, us (n = 5) showed a well - defined tumor with variable - sized cystic spaces, irregularly thick septa, and a solid portion of variable extent with heterogeneous hyperechogenicity (figs. 2a, 3a). in three patients, internal debris with fluid - fluid level was seen in the cystic portion of the tumor (figs. 2a, 2c). on color and power doppler us (n = 4) a tiny nodular intratumoral calcification was seen in one patient (case 8) (fig. = 3) showed a well - defined, isoechoic tumor (n = 1) or slightly hyperechoic (n = 2) (fig. color or power doppler us (n = 3) showed central (fig. these tumors showed low attenuation on a pre - contrast ct scan in all patients, except for one with a high attenuating lesion. at post - contrast 4b, 5c). in the patient that had biliary atresia (case 13), the tumor appeared as a 1.8-cm sized enhancing nodule with a peripheral rim of low attenuation at post - contrast ct (fig. the mesenchymal hamartomas showed multiple variable sized cystic portions within the tumor in their gross morphology (figs. each mesenchymal hamartoma with a multiseptated cystic appearance contained various amounts of myxoid or collagenous stroma and showed proliferation of the malformed bile ducts with periductal collaring of the stromal cells (fig. all of the four patients with a multiseptated cystic tumor contained a small amount of hepatocytes (< 10%) on a semiquantitative evaluation. the mesenchymal hamartomas with a mixed solid and cystic appearance also contained various amounts of myxoid or collagenous stroma and showed proliferation of the malformed bile ducts with periductal collaring of the stromal cells (fig. the amount of hepatocytes was small in three patients and moderate in two patients. in four patients with a solid mesenchymal hamartoma, a moderate (n = 3) amount or abundant amount (n = 1) of hepatocytes was found in the cords, islands or lobular pattern. the solid tumor also contained various amounts of mesenchymal stroma and proliferation of the small bile duct was seen (fig. 4d). in one patient with an enhancing nodule with a peripheral rim of low attenuation (case 13), the enhancing portion revealed a large amount hepatocytes histologically with a rim of myxoid stroma. the amount of hepatocytes was significantly different among the multiseptated cystic, mixed solid and cystic, and solid tumors (p = 0.042). the other pathological findings such as the amount of mesenchymal stroma, the presence of a bile duct or vessel proliferation were not statistically significant among the three groups of the different imaging spectrum. a mesenchymal hamartoma is the second most common benign hepatic tumor in children and accounts for 8% of all hepatic tumors in children (10 - 14). histologically, a mesenchymal hamartoma appears as a disordered arrangement of mesenchyme, bile ducts and hepatocytes (1 - 3, 9, 15). cords of normal - appearing hepatocytes are separated by zones of loose poorly cellular mesenchyme. cystic degeneration of the mesenchyme with resultant fluid accumulation from obstruction and dilatation of the lymphatics and/or by entrapped bile ducts may lead to enlargement of the tumor (12). the margin between the liver and the tumor is distinct ; however, a true capsule is generally not present (2). the level of serum alpha - fetoprotein, which is believed to be secreted by the proliferating hepatocytes within the tumor, can be elevated (13, 14). a multiseptated cystic appearance, which may be a typical finding of mesenchymal hamartoma, is rarely seen in other hepatic tumors in children. intratumoral calcification, which can be frequently detected in hepatoblastomas (over 50%) or infantile hemangioendotheliomas (up to 40%) (11), has been reported very rarely for a mesenchymal hamartoma. (8) described the ct findings of a mesenchymal hamartoma containing central and peripheral calcifications in a 57-year - old woman. (15) also described the ct findings of the multiseptated cystic form of a mesenchymal hamartoma with a septal calcification in a 10-year - old boy. in this series although a mesenchymal hamartoma present most frequently as a multiseptated cystic or mixed solid and cystic tumor (1 - 5), it can rarely occur as a solid tumor (6 - 9). in this study, according to the extent of the cystic component on ct scans, we classified each tumor into one of three types for evaluating the imaging spectrum of this tumor. in this study, the tumor was totally solid in 31% of the patients, and one case of a solid mesenchymal hamartoma (case 11) showed features of a so - called " mixed hamartoma. " the mixed hamartoma is a rare hamartomatous lesion composed of all cellular components of the normal liver, including a larger amount of hepatocytes, ductal proliferation, and hepatocellular - ductal transition. the mixed hamartoma and mesenchymal hamartoma may be in one disease spectrum, since there is some overlapping in the histological features of both hamartomas (16, 17). in children with a solid mesenchymal hamartoma, radiological differential diagnosis should include various hepatic tumors such as a hepatoblastoma, a hepatocellular carcinoma, an infantile hemangioendothelioma, a hepatic adenoma, or a focal nodular hyperplasia. heterogeneous enhancement and absence of a tumor capsule in a mesenchymal hamartoma can be helpful in the differential diagnosis from other tumors. as in one of our patients that had biliary atresia and a solid mesenchymal hamartoma (case 13), lack (18) described a mesenchymal hamartoma in a 5-month - old girl with biliary atresia, which was found incidentally during an exploratory laparotomy for obstructive jaundice. lack (18) showed an interest in this case because one of the theories for development of a mesenchymal hamartoma is biliary obstruction (19). in conclusion, a mesenchymal hamartoma of the liver in children can show a wide spectrum of radiological features from a multiseptated cystic tumor to a mixed solid and cystic tumor, and even a solid tumor. | objectivea hepatic mesenchymal hamartoma is an uncommon benign tumor in children and little is known about the spectrum of its radiological features. the purpose of this study is to describe the spectrum of radiological features of a hepatic mesenchymal hamartoma in children.materials and methodsthirteen children with a pathologically confirmed hepatic mesenchymal hamartoma (m : f = 7:6 ; mean age, 3 years 2 months) were included in our study. ultrasonography (us) was performed in nine patients including color and power doppler us (n = 7). ct scans were performed in all patients. we evaluated the imaging findings of the hepatic mesenchymal hamartomas and the corresponding pathological features.resultseach patient had a single tumor (mean diameter : 13 cm [1.8 - 20 cm ]). on ct and/or us, four patients (31%) had a " multiseptated cystic tumor ", five patients (38%) had a " mixed solid and cystic tumor ", and four patients (31%) had a " solid tumor. " the septa of the cystic portion were thin in the multiseptated cystic tumors and irregularly thick in the mixed solid and cystic tumors as seen on us. on a post - contrast ct scan, solid portions or thick septa of the tumors showed heterogeneous enhancement. the amount of hepatocytes was significantly different among the three tumor groups according to the imaging spectrum (p = 0.042).conclusiona hepatic mesenchymal hamartoma in children can show a wide spectrum of radiological features, from a multiseptated cystic tumor to a mixed solid and cystic tumor, and even a solid tumor. |
hereditary transthyretin (ttr) amyloidosis is a life - threatening autosomal - dominant disorder characterized by peripheral neuropathy, autonomic dysfunction, heart and kidney failure, and other symptoms leading to death, usually within 10 years of the onset of disease. it can be classified as early - onset and late - onset types, on the disease onset, before or after 50 years. misdiagnosis is frequent in the disease with atypical presentations, including chronic inflammatory demyelinating polyradiculoneuropathy or motor neuron disorder. amyloid deposits containing mutant ttr are the distinctive pathological characteristics. however, the sural nerve biopsies are negative for amyloid deposits in about half of the cases. at present, over 100 point mutations in the ttr gene have been identified, in which val30met is the most common in many countries. the 5-year survival rate of patients who do not have the val30met mutation is significantly lower than that of patients with ttr val30met. liver transplantation is the most effective treatment for the disease, especially for patients with val30met mutation. hence, the early diagnosis of the disease is significant. in china, there were only a few reports of hereditary ttr amyloidosis families. for most of them, amyloid deposits in different tissues were the initial cues for the consideration of the disease. in this article, we will report nine chinese patients from eight families with hereditary ttr amyloidosis. clinical and necessary examination materials were collected from the nine patients of eight families with hereditary ttr amyloidosis at peking university first hospital from january 2007 to november 2014. all the research methods and investigational tools in this study were approved by the ethics committee of peking university first hospital. the sural nerve biopsies were taken for eight patients and skin biopsies were taken in the calf / upper arm for two patients. parts of the samples were fixed in 4% formaldehyde, paraffin - embedded, 8-m sections, and stained with hematoxylin and eosin, congo red, as well as luxol fast blue (not for skin tissues). other parts of the samples were fixed in 3% glutaraldehyde, postfixed in 1% osmium tetroxide, dehydrated through serial alcohol baths, and embedded in epon 812 (electron microscopy sciences, usa). semithin sections of sural nerve samples for light microscopy examination were stained with toluidine blue. ultrathin sections of nerve and skin tissues for electron microscope examination were contrasted with uranyl acetate and lead citrate. we got 5 ml of peripheral blood and extracted genomic dna by the method of salt precipitation. polymerase chain reaction (pcr) primers for exons 14 of the ttr gene were designed using primer 3 software. the experimental products were purified and then sequenced using the abi 3730xl automatic sequencing machine (applied biosystems, usa). the clinical manifestations of nine patients with hereditary ttr amyloidosis are shown in table 1. there were five males and four females, ranging in age from 25 to 85 years (mean standard deviation, 50.1 20.3 years), with the duration of disease ranging 120 years. the initial symptoms were pure paresthesia of lower limbs in two patients, pure weakness of lower limbs in two, paresthesia and weakness of all limbs in one, bilateral dysacusis in one, dizziness resulting from orthostatic hypotension in one, alternating diarrhea and constipation in one, and dysarthria owing to glossohypertrophia in one. at the diagnostic time, all the patients had paresthesia except patient 9, among them seven patients were with distal weakness, six patients were with proximal weakness. dysautonomic manifestations included diarrhea / constipation in six patients, urinary incontinence in one patient, sexual dysfunction in one patient, and orthostatic hypotension in four patients. clinical data of nine hereditary ttr amyloidosis patients + : with the symptom or sign ; : without the symptom or sign ; ttr : transthyretin. sensory nerve conduction velocity (scv) tests showed reduced amplitude or disappearance of sensory nerve action potential (snap) in four patients, slow scv combined with reduced snap in three patients, and only slow scv of median nerve in patient 5. motor nerve conduction velocity (mcv) tests showed reduced amplitude of compound muscle action potential (cmap) in one patient, slow mcv in one patient and slow mcv combined with reduced cmap in five patients, and normal mcv in one patient (patient 5). patient 5 had a family history of autosomal - dominant inheritance [figure 1 ], in which the clinical phenotypes varied largely in different individuals. one sister of patient 8 had numbness of four limbs and alternating constipation / diarrhea. individual i-2 and ii-3 had very severe neuropathy in the early stage of disease and died at ages of 35 and 58, respectively. the sural nerve biopsies from the eight patients (except patient 9) showed variable pathological changes [figures 2 and 3 ]. seven patients (1, 2, 3, 4, 6, 7, and 8) had severe loss of myelinated fibers, three (1, 2, and 4) of whom had amyloid deposits, while the other patients had no amyloid deposits from light and electron microscopic examinations. amyloid deposits were present in the perineurium, endoneurium, and endoneurial arterioles in two patients (1 and 4), and only in a single endoneurial arterioles in one patient (2). one patient (5) had nearly normal sural nerve and skin with no amyloid deposits from light microscopic examinations, but with amyloid deposits among the capillary from skin electron microscopic examinations. one patient (9) had no skin amyloid deposits from light and electron microscopic examinations. (patient 1) congo red stain demonstrates amyloid deposits at the endoneurium (a), apple green birefringence by polarized light (b). toluidine blue stained sections show a marked loss of myelinated fibers (c) (patient 3) and nearly normal sural nerve (d) (patient 5). electron microscopy reveals amyloid deposits around sural nerve capillary (a) and high magnification of amyloid filament (b) in patient 4. different missense mutations in the ttr gene were identified in the eight families, including val30met (patients 1, 2, 8, and 9), phe33leu (patient 3), ala36pro (patient 4), val30ala (patient 5), phe33val (patient 6), and glu42gly (patient 7). the clinical manifestations of nine patients with hereditary ttr amyloidosis are shown in table 1. there were five males and four females, ranging in age from 25 to 85 years (mean standard deviation, 50.1 20.3 years), with the duration of disease ranging 120 years. the initial symptoms were pure paresthesia of lower limbs in two patients, pure weakness of lower limbs in two, paresthesia and weakness of all limbs in one, bilateral dysacusis in one, dizziness resulting from orthostatic hypotension in one, alternating diarrhea and constipation in one, and dysarthria owing to glossohypertrophia in one. at the diagnostic time, all the patients had paresthesia except patient 9, among them seven patients were with distal weakness, six patients were with proximal weakness. dysautonomic manifestations included diarrhea / constipation in six patients, urinary incontinence in one patient, sexual dysfunction in one patient, and orthostatic hypotension in four patients. clinical data of nine hereditary ttr amyloidosis patients + : with the symptom or sign ; : without the symptom or sign ; ttr : transthyretin. sensory nerve conduction velocity (scv) tests showed reduced amplitude or disappearance of sensory nerve action potential (snap) in four patients, slow scv combined with reduced snap in three patients, and only slow scv of median nerve in patient 5. motor nerve conduction velocity (mcv) tests showed reduced amplitude of compound muscle action potential (cmap) in one patient, slow mcv in one patient and slow mcv combined with reduced cmap in five patients, and normal mcv in one patient (patient 5). patient 5 had a family history of autosomal - dominant inheritance [figure 1 ], in which the clinical phenotypes varied largely in different individuals. one sister of patient 8 had numbness of four limbs and alternating constipation / diarrhea. individual i-2 and ii-3 had very severe neuropathy in the early stage of disease and died at ages of 35 and 58, respectively. the sural nerve biopsies from the eight patients (except patient 9) showed variable pathological changes [figures 2 and 3 ]. seven patients (1, 2, 3, 4, 6, 7, and 8) had severe loss of myelinated fibers, three (1, 2, and 4) of whom had amyloid deposits, while the other patients had no amyloid deposits from light and electron microscopic examinations. amyloid deposits were present in the perineurium, endoneurium, and endoneurial arterioles in two patients (1 and 4), and only in a single endoneurial arterioles in one patient (2). one patient (5) had nearly normal sural nerve and skin with no amyloid deposits from light microscopic examinations, but with amyloid deposits among the capillary from skin electron microscopic examinations. one patient (9) had no skin amyloid deposits from light and electron microscopic examinations. (patient 1) congo red stain demonstrates amyloid deposits at the endoneurium (a), apple green birefringence by polarized light (b). toluidine blue stained sections show a marked loss of myelinated fibers (c) (patient 3) and nearly normal sural nerve (d) (patient 5). electron microscopy reveals amyloid deposits around sural nerve capillary (a) and high magnification of amyloid filament (b) in patient 4. different missense mutations in the ttr gene were identified in the eight families, including val30met (patients 1, 2, 8, and 9), phe33leu (patient 3), ala36pro (patient 4), val30ala (patient 5), phe33val (patient 6), and glu42gly (patient 7). the present series confirmed polyneuropathy with different severity was the common symptoms of hereditary ttr amyloidosis. both early - onset and late - onset types of the disease the initial symptoms were different among them, including paresthesia or weakness of limbs, dizziness, dysacusis, alternating diarrhea and constipation, and dysarthria. similar to other reports, autonomic nervous dysfunction occurred in most patients, especially in early - onset hereditary ttr amyloidosis.. local amyloid deposition or nerve compression, ischemia and siderosis due to leptomeningeal, and vascular amyloidosis explain acoustic dysfunction in such cases. we also confirmed that macroglossia resulting in dysarthria may occur in the patients with hereditary ttr amyloidosis, though that is more common in patients with light - chain amyloidosis. low amplitudes of cmap and snap in presented series indicated extensive axonal impairment, which are very common in hereditary ttr amyloidosis. the demyelinating feature can not exclude the possibility of hereditary ttr amyloidosis. in our patient with predominant ophthalmologic symptoms and hearing loss, the ncv showed only mild median nerve involvement, indicating mild peripheral neuropathy for some patients with the disease. about half of our patients did not show amyloid deposits, similar to other reports. we have proved skin biopsy can show amyloid deposits among the capillary in sural nerve negative pathology for amyloidosis. in addition, salivary gland biopsy, abdominal fat aspiration, and muscle biopsy can be used for the detection of amyloid deposits. ttr should be tested in a wide clinical spectrum of progressive neuropathies even for patients with negative pathological findings. in keeping with other reports, endemic areas of hereditary ttr amyloidosis are portugal, japan, sweden, and brazil. we found six different kinds of missense mutations in the ttr gene in present series, including val30met in three families in which all the patients were late - onset ones. in our patients val30ala, ala97ser, and gly83arg are recognized as the most common amyloidogenic forms in chinese patients, but in our patients only val30ala appeared in one family. the reasons explaining the discrepancy may be that patients with ttr gly83arg mutant, indicating solitary ocular vitreous amyloidosis, without the evidence of systemic involvement, often came from the department of ophthalmology, while ala97ser may be common in chinese patients. some mutations indicating special clinical phenotypes such as familial carpal tunnel syndrome (tyr114his) and predominant cardiomyopathy (ala45ser) proved the genotype - phenotype correlation, while sometimes the same genotypes show different phenotypes just like the family of patient 5. the fact that there are large differences in penetrance in different populations may explain different family histories of our patients. since there are many patients with negative pathological findings of amyloid deposits in the sural biopsy, ttr gene should be tested in a wide clinical spectrum of chronic progressive neuropathies in adulthood, especially with extra - neural features. | background : mutations of transthyretin (ttr) cause the most common type of autosomal - dominant hereditary systemic amyloidosis, which occurs worldwide. to date, more and more mutations in the ttr gene have been reported. some variations in the clinical presentation are often observed in patients with the same mutation or the patients in the same family. the purpose of this study was to find out the clinicopathologic and genetic features of chinese patients with hereditary ttr amyloidosis.methods:clinical and necessary examination materials were collected from nine patients of eight families with hereditary ttr amyloidosis at peking university first hospital from january 2007 to november 2014. sural nerve biopsies were taken for eight patients and skin biopsies were taken in the calf / upper arm for two patients, for light and electron microscopy examination. the ttr genes from the nine patients were analyzed.results:the onset age varied from 23 to 68 years. the main manifestations were paresthesia, proximal and/or distal weakness, autonomic dysfunction, cardiomyopathy, vitreous opacity, hearing loss, and glossohypertrophia. nerve biopsy demonstrated severe loss of myelinated fibers in seven cases and amyloid deposits in three. one patient had skin amyloid deposits which were revealed from electron microscopic examination. genetic analysis showed six kinds of mutations of ttr gene, including val30met, phe33leu, ala36pro, val30ala, phe33val, and glu42gly in exon 2.conclusions:since the pathological examinations of sural nerve were negative for amyloid deposition in most patients, the screening for ttr mutations should be performed in all the adult patients, who are clinically suspected with hereditary ttr amyloidosis. |
however, not every orthopaedic surgeon has had the opportunity to observe a case of simultaneous shoulder dislocation with ipsilateral humeral shaft fracture. the literature related to this rare injury is limited to case reports often with inadequate follow ups. herein we present a case of a 15-year - old boy with an anterior shoulder dislocation and ipsilateral fracture of humerus, and discuss his non - invasive treatment. the patient was a 15-year - old, boy who had been working at a bakery, and his right upper extremity had been caught in an electrical mixer used to mix wheat dough. he had sustained a combined anterior dislocation of shoulder with ipsilateral fracture of humeral shaft and greater tuberosity (figure 1). the patient underwent an urgent attempt for closed reduction of both shoulder and humeral shaft under general anesthesia. counter traction method by grasping the proximal fragment and traction against the counter traction through a rolled sheet in the axilla of the patient (figure 2). the successful closed reduction, achieved at first attempt, was followed by coaptation plaster splint for four weeks followed by sarmiento splint for an additional four weeks (figure 3). anteroposterior radiograph showing an anterior dislocation of the right glenohumeral joint with ipsilateral fracture of humerus. the neurologic exam for axillary and radial nerve was normal before and after the procedure. despite the somehow common occurrence of the shoulder dislocation and humeral shaft fracture, simultaneous occurrence of them is rare such that all the reports in the literature are restricted to case reports by various authors. in 1977 chen. reported two cases of this injury, and their attempt at reviewing the literature only revealed only 14 case reports. they first fixed the humeral fracture with a plate, and then closed the reduction of shoulder dislocation in both cases.. also reported one case treated by humeral shaft internal fixation with plating and closing the reduction of shoulder dislocation. review of various cases presented in the literature shows that the main problem for surgeons has been the lack of adequate lever arm to do the closed reduction of the joint. this forces surgeons to first fix the shaft by a plate or external fixator, and then to attempt closed reduction of the shoulder joint. there is, however, a report, similar to our experience, of successful closed treatment of both problems. the other problem with this rare combination is the possibility that shoulder dislocation is missed, especially if it is posterior, and the x ray is of poor quality and does not clearly show the shoulder joint position. the present case indicates that closed reduction of both injuries under general anesthesia was accopanied by good clinical results 15 years later. | simultaneous dislocation of shoulder and humeral shaft fracture is a rare injury, and there is no clear protocol for its treatment. herein we present a case of a 15-year - old boy, who suffered from a job - related accident and sustained fracture of humeral shaft associated with ipsilateral anterior shoulder dislocation and fracture of greater tuberosity 15 years ago. he received closed reduction of both injuries and coaptation plaster splint for four weeks, followed by sarmiento splint at that time. fifteen years after the injury, he has no problem related to the previous injury, and does not experience any episode of shoulder instability. |
early mortality in the initial 90 days after antiretroviral therapy (art) initiation is strikingly high among persons with low body mass index (bmi < 18.5 kg / m) compared to those with normal bmi [14 ]. while a greater incidence of opportunistic infections and more advanced immunosuppression likely contributes to increased mortality in undernourished patients [5, 6 ], the loss of metabolically active tissue may negatively impact a range of critical physiologic processes and also contribute to these early deaths [79 ]. skeletal muscle mass, a major reservoir of bioavailable phosphate, is reduced early in hiv - associated weight loss, and among hiv - uninfected persons chronic undernutrition is associated with a reduction in mitochondrial enzyme activity which rapidly normalizes with nutritional support [1012 ]. prior studies of malnourished prisoners - of - war and chronically ill hospital patients found that rapid depletion of serum phosphate after aggressive feeding disrupts electrolyte homeostasis and can induce cardiac and pulmonary complications and death a condition termed refeeding syndrome [1316 ]. we hypothesized that a similar syndrome resulting from increased metabolic demand for phosphate - dependent cellular metabolism intermediates (e.g., adenosine triphosphate and 2,3-diphosphoglycerate) after art initiation, due to increased anabolism, physical activity, nutrient intake, viral suppression, or immune reconstitution, may deplete bioavailable phosphate stores in undernourished adults and contribute to the high early mortality observed in this population [17, 18 ]. to investigate whether hypophosphatemia is a novel determinant of early art mortality, we measured pretreatment serum phosphate levels, several previously described predictors of poor survival, and vital status at 12 weeks among hiv - infected adults starting treatment with a range of bmi values in lusaka, zambia. between november 2006 and december 2007, we enrolled hiv - infected adults starting art at a single public sector primary care clinic in lusaka, zambia into two simultaneous observational cohorts to evaluate metabolic predictors of mortality within 12 weeks of treatment initiation. enrollment criteria were art - eligibility according to national guidelines in place at the time (i.e., world health organization (who) stage 4 disease, a cd4 lymphocyte count < 200 cells/l, or who stage 3 disease and a cd4 lymphocyte count < 350 cells/l), intention to start therapy the same day and remain in the area for the study duration, and agreement to adhere to the additional study visits and laboratory testing requirements. one cohort (nemart) comprised 142 individuals with severe malnutrition and advanced disease (i.e., bmi < 16 kg / m or cd4 lymphocyte count < 50 cells/l), and the other (dgplead), comprised 210 participants with bmi 16 kg / m and cd4 50 cells/l. all screened patients offered the opportunity to enroll in nemart or dgplead elected to participate in the study. in this analysis we combine data from both cohorts to evaluate the common primary study endpoint of all - cause mortality within the first 12 weeks of art. study participants were evaluated at enrollment by a research nurse and a clinical officer, and additional assessment was performed by a supervising physician as needed. the initial visit included a detailed health history, review of systems, physical examination, and laboratory testing (serum metabolic panel including electrolytes, phosphate, albumin, ferritin, and high - sensitivity c - reactive protein (hscrp)). the initial art regimen was selected from the national program formulary : lamivudine, efavirenz or nevirapine, and zidovudine or stavudine. in july 2007, tenofovir with emtricitabine replaced lamivudine, zidovudine, and stavudine in the national program 's first - line regimen. participants in the nemart cohort were evaluated by the study staff at 1, 2, 4, 8, and 12 weeks after initiating art. serum electrolyte measurements were done in real time, and when deficiencies of phosphate were detected participants were given supplements within seven days according to a predetermined algorithm based on serum levels. participants in the dgplead cohort were evaluated by study staff at baseline and after 12 weeks of art ; their serum samples were frozen at 80f and assayed after the study was completed. cd4 lymphocyte counts were performed using a beckman coulter epics xl - mcl flow cytometer (beckman coulter, inc., chemistry assays were measured using a roche cobas integra 400 + (roche diagnostics, basel, switzerland) or a pointe 180 chemistry analyzer (pointe scientific, canton, mi, usa). if a participant missed a study visit and could not be reached by mobile phone, community outreach teams attempted to locate the patient using housing locator forms completed at enrollment. if the participant could not be located or credible information on vital status could not be obtained from relatives or the community, the participant was classified as lost to follow - up. we used logistic regression to assess the relationship between a 0.1 mmol / l decrease in baseline serum phosphate and the odds of death within 12 weeks of art in the full cohort (including an interaction term for bmi and phosphate) and after stratifying the cohort according to who bmi criteria for grading malnutrition (< 16, 16 - 17, and 17 - 18.49 kg / m). all models were adjusted for sex, age, and cd4 lymphocyte count at art initiation and secondary analyses further adjusted for baseline albumin, ferritin, and hscrp, and concomitant tuberculosis treatment. patients lost to follow - up were excluded from primary analyses ; a secondary analysis considered the combined endpoint of lost to follow - up or death. the study protocol was approved by the university of zambia research ethics committee and the institutional review boards at the university of alabama at birmingham and vanderbilt university. all procedures were consistent with the ethical standards of the helsinki declaration of 1975, as revised in 2000. vital status was available for 307 of 352 enrolled participants at 12 weeks (87%) and 45 were classified as lost to follow - up ; 28 (19%) of those with pretreatment bmi < 18.5 kg / m died compared to 12 (7%) of those with bmi 18.5 kg / m. the alive, deceased, and lost to follow - up groups differed by median age, bmi, cd4 lymphocyte count, and serum phosphate, ferritin, and hscrp levels (table 1 ; p < 0.05 for all comparisons). there was no difference between the three groups in the proportion of participants receiving tuberculosis treatment at the time of art initiation. among those with known vital status at 12 weeks, deceased participants had significantly lower bmi, cd4 lymphocyte counts, serum albumin levels, and serum phosphate levels, but higher inflammation biomarkers (serum hscrp and ferritin), compared to survivors (p < 0.01 for all comparisons). participants lost to follow - up prior to 12 weeks were more likely to be female and had a lower median age, but the clinical characteristics of this group did not consistently resemble either the alive or deceased participants. lost participants had the lowest median cd4 lymphocyte count (36 cells/l), which was closer to the median of 50 cells/l observed in the deceased group versus the 109 cells/l in the alive group. however, median serum levels of phosphate, albumin, ferritin, and hscrp among the lost participants more closely approximated the alive group compared to the deceased. baseline phosphate values were generally uniform across the bmi range (spearman 's rank correlation for bmi and phosphate : rho = 0.05, p = 0.41), indicating that low phosphate values were not clustered among the low - bmi participants (normal serum phosphate is 0.811.4, 7 (8%) survivors and 5 (20%) deceased subjects in nemart had received oral or intravenous phosphate ; electrolyte repletion was not provided in dgplead. there was no association between phosphate supplementation and mortality (p = 0.20). while tenofovir has been linked to renal phosphate wasting and toxicity in some reports, though not in randomized trials, the initiation of a tenofovir - containing regimen in our cohort was not associated with increased mortality (p = 0.12) [2628 ]. in a logistic regression model excluding participants with unknown vital status and adjusted for sex, age, and cd4 lymphocyte count, both serum phosphate (odds ratio (or) 1.18 per 0.1 mmol / l decrease ; p = 0.02) and bmi (or 1.33 per 1.0 kg / m decrease ; p < 0.01) we did not detect an interaction of bmi and phosphate on the log - odds of mortality (p = 0.52). 18.5 kg / m (n = 144 ; i.e., undernourished by who criteria) had an increased odds of morality (or 1.24, 95% confidence interval [ci ] : 1.05 to 1.47 ; p = 0.01) for each 0.1 mmol / l decrease in baseline phosphate. a similar relationship was observed among those with bmi < 17 kg / m (n = 86, or 1.25, 95% ci : 1.02 to 1.52 ; p = 0.03) (table 2). among those with bmi < 16 kg / m (n = 49) the relationship between serum phosphate and outcome was not statistically significant (or 1.06, 95% ci : 0.79 to 1.42 ; p = 0.70), though the death rate was substantially higher (27%). among participants with bmi 18.5 kg / m (n = 161) we did not detect an association between baseline phosphate and 12-week mortality (or 0.96, 95% ci : 0.76 to 1.21 ; p = 0.74). in a model including all patients but dichotomizing bmi at < 18.5 versus 18.5, the interaction between bmi and phosphate was significant (p = 0.046). when the logistic regression model was further adjusted for pretreatment serum hscrp, ferritin, and albumin levels, there was minimal change in the odds of mortality with each 0.1 mmol / l reduction in baseline phosphate among those with bmi < 18.5 kg / m(or 1.22, 95% ci : 1.01 to 1.48 ; p = 0.04). similarly, the relationship between serum phosphate and mortality among those with bmi < 18.5 kg / m remained significant after adjusting for concomitant tuberculosis treatment (or 1.27, 95% ci : 1.06 to 1.51 ; p < 0.01), and tb treatment was not associated with mortality in the other models. when we repeated the analyses using the combined endpoint of death or loss to follow - up at 12 weeks, there was no significant association between a 0.1 mmol / l decrease in pretreatment serum phosphate and this outcome among all participants (or 0.99, 95% ci : 0.90 to 1.08 ; p = 0.76) or those with a bmi < 18.5 kg / m (or 1.04, 95% ci : 0.93 to 1.17 ; p = 0.46). we attribute this lack of an association to likely heterogeneity in both the clinical characteristics and 12 week outcome among participants lost to follow - up. our study was limited by the inability to determine actual causes of death and to make definitive diagnoses of opportunistic infections (only local clinic facilities were utilized). additionally, plasma hiv-1 viral load measurements were not utilized in routine clinical care at the time of the study, which may have introduced unmeasured confounding. the criteria for classifying a participant as lost to follow - up in our 12-week study differed from the definition used by the zambian national art program for pragmatic reasons. at the time of the study, patients in the national program were classified as lost to follow - up if they did not return to clinic within 37 days after a scheduled pharmacy visit or, if no pharmacy visit was scheduled, 60 days after the last clinical visit. this definition would not accurately classify participants at a single time point (i.e., 12 weeks), and therefore a more intensive outreach procedure utilizing home locator forms and phone calls was used to trace study participants. while some participants classified as lost may have eventually returned to care, the follow - up rates observed in our study approximated rates in the zambian national art program and in similar resource - limited settings. we hypothesize that the observed association between lower pretreatment serum phosphate and early art mortality may represent a variant of the refeeding syndrome associated with advanced hiv disease, in which depleted reserves of bioavailable phosphate (primarily skeletal muscle) are insufficient to maintain electrolyte homeostasis in response to a rise in phosphate - dependent cellular respiration after treatment initiation. the increased metabolic activity could result from viral suppression, immune reconstitution, or increased tissue repair and redeposition following a decline in inflammation - induced catabolism, possibly in combination with increased physical activity and dietary intake. under these circumstances, low - bmi individuals with poor reserves of muscle mass may not be able to mobilize sufficient phosphate to meet metabolic demands. the consequences of a failure to maintain adequate bioavailable phosphate after art initiation would likely mimic a classic refeeding syndrome, in which potentially lethal cardiovascular, respiratory, and neurologic sequelae result from electrolyte and fluid shifts accompany a reversal from catabolism and fat oxidation to the utilization of exogenous carbohydrate [14, 3032 ]. at present, a role for refeeding syndrome in early art mortality is provisional and additional studies are needed to understand whether the pathophysiologic processes contributing to death among malnourished individuals with low serum phosphate are consistent with this syndrome or a separate disorder. further investigation of phosphate - dependent biological processes in these patients, including mitochondrial protein content and function, intracellular phosphate content, and potassium and magnesium homeostasis, will be critical for identifying the specific biological mechanisms involved and designing effective treatments to reduce mortality in the early art period. low pretreatment serum phosphate levels were associated with increased risk for early mortality among adults with low bmi starting art in zambia. this association was independent of established risk factors for early art mortality, including bmi, cd4 lymphocyte count, serum albumin, and biomarkers of inflammation. the effect was not seen among individuals starting art with normal bmi and may reflect an acute physiologic dysfunction resulting from insufficient bioavailable phosphate reserves in the immediate posttreatment period among individuals with reduced metabolically active tissue. given the high early mortality rates among low bmi adults starting art in africa, further studies of metabolic dysfunction in this population are warranted to confirm these findings and explore potential mechanisms. additionally, clinical trials to explore the benefits and risks of phosphate supplementation on art outcomes among low - bmi individuals are needed. | background. low body mass index (bmi) at antiretroviral therapy (art) initiation is associated with early mortality, but the etiology is not well understood. we hypothesized that low pretreatment serum phosphate, a critical cellular metabolism intermediate primarily stored in skeletal muscle, may predict mortality within the first 12 weeks of art. methods. we prospectively studied 352 hiv - infected adults initiating art in lusaka, zambia to estimate the odds of death for each 0.1 mmol / l decrease in baseline phosphate after adjusting for established predictors of mortality. results. the distribution of phosphate values was similar across bmi categories (median value 1.2 mmol / l). among the 145 participants with bmi < 18.5 kg / m2, 28 (19%) died within 12 weeks. lower pretreatment serum phosphate was associated with increased mortality (odds ratio (or) 1.24 per 0.1 mmol / l decrement, 95% ci : 1.05 to 1.47 ; p = 0.01) after adjusting for sex, age, and cd4 + lymphocyte count. a similar relationship was not observed among participants with bmi 18.5 kg / m2 (or 0.96, 95% ci : 0.76 to 1.21 ; p = 0.74). conclusions. the association of low pretreatment serum phosphate level and early art mortality among undernourished individuals may represent a variant of the refeeding syndrome. further studies of cellular metabolism in this population are needed. |
a 9-year - old boy presented to the outpatient department with bilateral webbing from the lateral chest wall extending up to his elbows, which looked like wings [figure 1 ]. this deformity had been present since birth and involved anterior axillary fold as well as medial elbow [figure 2 ]. this was successfully treated on the left side with multiple z - plasty operation (parents consented for only one side initially).during the procedure, the fibrous bands were excised down to deep fascia and z - plasty flaps were transposed to lengthen the axillary and elbow contractures [figures 3 and 4 ]. bilateral upper limb webbing (pterygia) webbing involving only anterior axillary fold early post op. it can be a part of multiple pterygium syndrome, also referred to as escobar syndrome. it is a rare autosomal recessive disorder, which is characterized by a web across every flexion crease in the extremities, most notably the popliteal space. in addition, this syndrome is associated with other structural anomalies : a vertical talus, vertebral segmentation anomalies and congenital lordoscoliosis. other associated anomalies are multiple joint webs, unusual finger contractures, syndactyly, rocker bottom feet, ptosis, antimongoloid slant of palpebral fissures, epicanthal folds, cleft lip and or palate, highly arched palate, scoliosis and short stature. autosomal recessive inheritance of multiple pterygium syndrome was suggested by findings in affected siblings with normal parents. it is differentiated from other types of inheritance like autosomal dominant type of multiple pterygium syndrome, autosomal dominant type of popliteal pterygium syndrome and x - linked dominant inheritance variety. pterygia seen in this variety of multiple pterygium syndrome of neck, antecubital and axillary areas are not present in the popliteal pterygium syndrome. cleft lip (with or without cleft palate) has been seen in nearly all cases of popliteal pterygium syndrome, whereas cleft palate is present in only 41% of multiple pterygium syndrome. intellect is usually normal in these cases, although there is a danger of mental retardation being assumed due to the multiple congenital defects, misdiagnosis, and delayed motor milestones. manual dexterity is often better than predicted from the appearance of the hands as seen in our case. correction of restricting webbing by simple z - plasty adds to the mobility of the affected limb. a joint approach with a team of paediatrician, genetics consultant and orthopaedic and plastic surgeon | reporting images in a case of a 9-year - old boy who presented with bilateral congenital webbing (pterygium) of axillae and elbows. this deformity was restricting his axilla and elbow movements. this was successfully treated on one side with multiple z - plasty. an outline of multiple pterygium syndrome is given herewith. |
epidermoid cysts are rare, slow - growing, congenital, space - occupying lesions accounting for 0.2 - 1.8% of all primary brain tumors. epidermoid cysts involving the brainstem are extremely rare, with only 18 reported cases in the literature and only five purely intrinsic epidermoid cysts within this group. typically, epidermoids appear hypointense on t1-weighted magnetic resonance (mr) images, and hyperintense on t2-weighted sequences. dense or white epidermoids have high protein content and show reversed signal intensity on mr images, with high signal intensity on t1-weighted images and low signal intensity on t2-weighted images. here, we report an interesting case of intrinsic brainstem dense or white epidermoid cyst in a 15-year - old girl. the clinical presentation, radiological imaging, and surgical management are discussed, along with a review of pertinent literature. a 15-year - old girl presented with a one - year history of progressive quadriparesis, diplopia, dysphagia, dysarthria, and unsteadiness of gait with frequent falls to either side. her neurological examination revealed upper motor neuron type of quadriparesis with multiple cranial nerve involvement (v, vi, ix, x, and xii). brain mr imaging (mri) demonstrated an atypical intra - axial pontomedullary lesion, which had a high t1 signal, a low t2 signal, and subtle contrast enhancement [figure 1 ]. for further confirmation, a diffusion - weighted imaging (dwi) sequence was obtained [figure 2 ], which revealed a bright signal within the tumor suggestive of an epidermoid cyst rather than a cavernous malformation or brain tumor. on splitting the vermis, the floor of the fourth ventricle was exposed and found to be distended from the underlying cyst. a myelotomy was performed through the thinned - out floor, revealing a pearly white, viscous substance that was resected gross totally with the aid of micro - neurosurgery. postoperatively, the patient experienced mild, transient sixth cranial nerve palsy that resolved completely within several weeks. postoperative computed tomography (ct) scan confirmed the intraoperative impression of gross - total removal [figure 3 ], and histological testing confirmed the presence of an epidermoid cyst. sagittal t1-weighted brain magnetic resonance imaging showing an apparently intra - axial space - occupying lesion of the pontomedullary region (a) with subtle contrast enhancement (b), the lesion is hyperintense in axial t1-weighted images (c) and hypointense in t2-weighted images (d) magnetic resonance diffusion - weighted image revealing a bright signal within the tumor postoperative computed tomography scans sagittal (a) and axial (b) demonstrate gross - total removal of the brainstem tumor epidermoid cysts are rare, slow - growing, congenital, space - occupying lesions accounting for 0.2 - 1.8% of all primary brain tumors. these primarily arise in the basal subarachnoid spaces and commonly involve the cerebellopontine angle and juxtasellar areas. those located in the brainstem occur very rarely, and purely intrinsic lesions as described in the present case have been reported previously in five cases only. patients harboring these cysts typically become symptomatic between the ages of 20 and 40 years. due to the insidious manner in which these grow, brainstem epidermoid cysts in children are extremely rare and the pathogenesis of true intra - axial brainstem epidermoid is unclear and usually not considered in the preoperative differential diagnosis of brainstem tumors. although considered as histologically benign, epidermoid cysts can cause significant neurological defects by compressing vital structures. patients presenting with intrinsic epidermoid cysts commonly exhibit symptoms related to the compression of associated brainstem structures. in the present case, the presentation suggested lesion enlargement that resulted in pyramidal tract involvement, multiple cranial nerve palsy, and balance problem. the best diagnostic clue is a cerebrospinal fluid (csf)-like mass that insinuates within cisterns, encasing adjacent neurovascular structures. typically, epidermoids appear hypointense on t1-weighted mri scans, but might also have an intermediate intensity between the brain and csf on t1, whereas they are usually hyperintense on t2-weighted sequences. however, signal intensity can be variable depending on the relative amount of lipid, cholesterol, keratin, and proteins and seldom show contrast enhancement. white epidermoids have high protein content and may appear hyperattenuated on ct scans. compared with the classic epidermoid cyst, these dense or white epidermoids show reversed signal intensity on mr images, with high signal intensity on t1-weighted images and low signal intensity on t2-weighted images. the rarity of brainstem epidermoid cysts can make their diagnosis difficult ; thus, the use of modern mri techniques, such as dwi and fluid attenuated inversion recovery (flair) imaging, might be helpful in establishing the diagnosis in such cases. they do not suppress completely on flair images and restrict (show high signal intensity) on dwis. in our case, the radiological presentation was unusual, fitting rightly to the rare type of white epidermoids. although there appears to be a consensus about surgical resection being the best therapeutic option for the treatment of epidermoid cysts, these tumors pose a surgical challenge and attempts for aggressive removal of the cyst wall are fraught with increased risks of morbidity and mortality. on the other hand, cases treated more conservatively show good or excellent results with minimal complications. nevertheless, ziyal. pointed out that surgical resection should be as radical as possible. neurosurgical judgment at the time of surgery is warranted to ensure maximum resection while minimizing postoperative neurologic deficits. the use of modern diffusion - weighted mri techniques might be helpful in establishing the diagnosis in such cases. neurosurgical judgment at the time of surgery is warranted to ensure maximum resection while minimizing postoperative neurologic deficits. | epidermoid cysts involving the brainstem are extremely rare, with only 18 reported cases in the literature and only five purely intrinsic epidermoid cysts within this group. white epidermoids, a rare entity, have high protein content and show reversed signal intensity on magnetic resonance images. in contrast to the classical variety, these cysts show high signal intensity on t1-weighted images and low signal intensity on t2-weighted images. here, we report an interesting case of intrinsic brainstem white epidermoid cyst in a 15-year - old girl and discuss its clinical characteristics, radiological features, and surgical treatment. the girl presented with a one - year history of progressive quadriparesis, and features of multiple cranial nerve involvement. because the cyst was purely intrinsic and had altered signal intensity, the diagnosis was initially unclear until definitive neuroimaging was performed using diffusion - weighted magnetic resonance imaging (dw - mri) sequences. |
a 75-year - old man was referred to chungbuk national university hospital owing to urinary frequency. he had a history of transurethral resection of the bladder for invasive urothelial carcinoma 8 years previously. the tumor was of a low grade and invaded the subepithelial connective tissue. however, proper muscle involvement was not evaluable because the specimen had no proper muscle component. the patient had been treated with bacillus calmette - guerin (bcg) and had lived without recurrence. there was widespread urothelial carcinoma in situ ; therefore, radical cystoprostatectomy with orthotopic bladder substitution (ghoneim) was carried out. grossly, the mucosal surface of the urinary bladder showed multifocal flat erythematous lesions, and there were no remarkable lesions in the remainder. the microscopic findings showed multiple urothelial carcinoma in situ lesions throughout the mucosa of the urinary bladder and both ureters (fig. the left seminal vesicle was covered by large polygonal tumor cells, which were confined to the mucosa in single to several layers (fig. the tumor cells had large and hyperchromatic nuclei with distinct nuclear membranes and relatively abundant eosinophilic cytoplasm. in addition, bizarre - shaped tumor cells showing irregular hyperchromatic or smudged nuclei were occasionally identified. the tumor cells mostly involved the mucosa between the epithelial cells and the basal lamina of the seminal vesicle, a feature that is referred to as pagetoid spread. in some areas, the entire thickness of the mucosa the mucosa of the ejaculatory duct and adjacent prostatic acini and duct were also scattered with tumor cells (fig., we considered that the urothelial carcinoma in situ of the urinary bladder revealed mucosal spread to the seminal vesicle along the ejaculatory duct. in addition, there was an incidental prostatic adenocarcinoma, which was a small, solitary lesion with a gleason score of 6. at the time of the surgery, the patient 's serum prostate - specific antigen level was 0.87 ng / ml. the patient had no evidence of disease for 5 months after surgery. the frequency of seminal vesicle involvement has been reported to be approximately 3% in cystoprostatectomy cases [2 - 4 ]. reported that only 8% of pt4 transitional cell carcinoma cases showed invasion to the seminal vesicle. pointed out that insufficient histologic sections from the seminal vesicle may result in underestimation of seminal vesicle involvement. one is direct invasion through the bladder wall, and the majority of cases fall under this pattern [1 - 3 ]. however, multiple mucosal involvements of the urothelial carcinoma into adjacent organs are not common ; therefore, the pathogenesis of this phenomenon has not been well explained. several possibilities have been suggested, including pagetoid mucosal spread, tumor cell implantation, and de novo development of urothelial carcinoma. de novo development from the seminal vesicle epithelium seems less plausible, because there is no transition between normal epithelium and the tumor cells. although the possibility of implantation via sloughing of tumor cells can not be completely excluded, it also seems unlikely, inasmuch as the tumor cells usually demonstrate the pagetoid feature. in this case, widespread urothelial carcinoma in situ was identified in the bladder, both ureters, the ejaculatory duct of the prostate, and the seminal vesicle, and these tumor cells seemed to grow continuously. therefore, our case supports the notion of pagetoid mucosal extension of urothelial carcinoma rather than de novo development. in this case, differential diagnosis for metastatic carcinoma, primary seminal vesicle carcinoma, and atypical degenerated epithelial cells of the seminal vesicle was required. first, the possibility of metastasis from adjacent organs, such as the prostate and the rectum, should be considered. immunohistochemical staining for prostate - specific antigen (psa), cytokeratin (ck)7, and ck20 may be helpful for distinguishing urothelial carcinoma (psa-, ck7 +, and ck20 +) from prostatic adenocarcinoma (psa+) or rectal carcinoma (ck7- and ck20 +). in this case, the tumor cells were negative for psa and positive for ck7. second, primary adenocarcinoma as well as squamous cell carcinoma can occur in the seminal vesicles. however, there must be no other primary carcinoma in the body to establish a diagnosis of primary carcinoma of the seminal vesicle. in addition, ormsby. reported that primary adenocarcinoma of the seminal vesicle shows cancer antigen-125 positivity, which is helpful for making a diagnosis. finally, the seminal vesicle frequently shows atypical epithelial cells associated with aging (so - called " monstrous cells "). like the tumor cells of this case, however, the monstrous cells contain lipofuscin granules and intranuclear inclusions beyond what is demonstrated in urothelial carcinoma or prostatic adenocarcinoma. the question we must ask here is how the involvement of the seminal vesicle is classified in the aspect of staging. invasion of the seminal vesicles is classified as pt4 according to the current tnm staging system. because direct invasion to the seminal vesicle portends poor prognosis, this assignment is warranted in the case of direct extension. reported that mucosal spread to the seminal vesicle adversely affects the prognosis of urothelial carcinoma of the bladder unlike involvement of the prostate only. on the other hand, many authors have insisted that mucosal spread should be under a separate subcategory regarding its better prognosis compared with direct invasion [2 - 4 ]. thus, awareness of seminal vesicle invasion is important to verify the clinicopathologic implications. in summary, we experienced a case of bladder urothelial carcinoma in situ with mucosal spread to the seminal vesicle. it may be difficult to distinguish this from the metastatic carcinoma from other organs and the primary carcinoma and the reactive epithelial atypia of the seminal vesicles. recognition of the involvement of seminal vesicles by urothelial carcinoma as well as the pattern of this involvement is important for determining the clinicopathologic implications. | mucosal spreading of urothelial tumors to the seminal vesicles is very rare. we experienced a case of mucosal involvement of the seminal vesicles by a bladder tumor in a 72-year - old man. the patient had a history of transurethral resection for invasive urothelial carcinoma of the bladder 8 years previously. radical cystoprostatectomy was performed owing to recurrent and multiple urothelial carcinoma in situ. microscopically, the urothelial carcinoma in situ was throughout the mucosa of the urinary bladder, both ureters, the prostate, and the left seminal vesicle. to date, the implication of mucosal involvement of the seminal vesicles by urothelial carcinoma is unclear. however, careful microscopic examination is needed to avoid an erroneous diagnosis. |
fibrinogen is a 340-kd glycoprotein, one of the critical proteins of the blood coagulation and platelet aggregation (1). it is composed of six polypeptide chains, (,,)2, which are held together by disulfide bonds and organized in a symmetrical dimeric fashion (1). until now, a variety of mutations in each of the fibrinogen chain genes have been reported in more than 465 families all over the world, with a-chain mutation being the most common form, followed by -chain mutation (2). the first report was a(517 - 522)delins31, designated as " fibrinogen seoul " in a 7-yr - old girl associated with amyloidosis (3). the second was ala341asp, which was designated as " fibrinogen seoul i ", in a 66-yr - old woman with peripheral artery obstructive disease (4). the third was a gln328pro, which was designated as " fibrinogen seoul ii ", in a 51-yr - old man who suffered from recurrent myocardial infarction (5). here we describe a -chain fibrinogen variant (fibrinogen yecheon), which is a point mutation from t to c in the 1,007th nucleotide of the fgg gene, resulting in a methionine (met)-to - threonine (thr) substitution at the 310th residue in the carboxy - terminal region of the fibrinogen -chain. this is the fourth report of met310 to thr substitution in the world, and the first in korea. as for genetic dysfibrinogenemia, this is the fourth case report in korea. a 20-yr - old male patient with past medical history of bleeding tendency in neonate period visited the department of otorhinolaryngology for a preoperative evaluation for operation of chronic maxillary sinusitis. he reported a family history of easy bruisability of his father and conductive hearing difficulty after meningitis in childhood. no laboratory abnormalities indicating coagulation defect had been detected after birth. in the preoperative evaluation, the patient had normal blood counts and serum chemistry test results. however, the initial coagulation screening showed prolonged prothrombin time (pt, 24.5 sec ; normal 10.4 - 12.5 sec) and activated partial thromboplastin time (aptt, 47.3 sec ; normal, 26.0 - 41.0 sec). the bleeding time was normal (2 min and 30 sec ; normal, 1 - 5 min). the fibrinogen degradation product (fdp) and d - dimer were within normal ranges. other coagulation tests were normal (table 1). on the other hand, plasma fibrinogen activity of the subject examined using the clauss method was lower than the detection limit (c) (fig. we designated the patient 's abnormal fibrinogen as " fibrinogen yecheon ", naming after the local city where he and his family are residing. for further evaluation, fibrinogen mixing test (table 2) was run and the results showed no significant improvements in the fibrinogen level. the plasma fibrinogen activities of the patient 's parents by clauss method were within normal range (309 and 254 mg / dl, respectively). molecular genetic study was performed only with his parents, including his father who had a history of easy bruising, and they both were homozygous for the wild - type allele (fig. dysfibrinogenemia was suggested in the subject according to the initial plasma fibrinogen activity and antigen levels. the patient himself decided not to take operation after the diagnosis of dysfibrinogenemia, although cryoprecipitate treatment was possible. cryoprecipitate contains factor viii, fibrinogen, von willebrand factor and factor xiii, so it is generally used for dysfibrinogenemia. although he was born with bleeding tendency, the patient had no symptoms of bleeding or thrombosis after childhood. according to cote.(1), an examination of the clinical symptoms associated with -dysfibrinogenemia shows that < 5% of the individuals experienced significant bleeding, and < 30% showed thrombotic tendencies. unfortunately, data on long - term follow - up of dysfibrinogenemic patients are rarely available. met310thr was already reported by the names of asahi (6), frankfurt vii (7), and hannover xxiv (2). details of biochemical mechanisms involved in fibrin polymerization, release of fibrinopeptides a / b, factor xiiia - mediated cross - linking profiles, and the position of glycosylation were elucidated in the study of fibrinogen asahi (6). asahi fibrinogen showed normal release of fibrinopeptides a / b, but fibrin polymerization and factor xiiia - mediated -chain cross - linking were severely impaired regardless of calcium ions, which was caused by n - glycosylation consensus sequence asn (308)-gly (309)-thr (310) conferred by the mutation (1, 6, 8). specifically, severely impaired polymerization of asahi fibrin monomers may account for extremely retarded cross - linking between the two asahi -chains, although the amine receptor gln (398) was found to function normally (1, 6, 8). those functional abnormalities could explain fibrinogen asahi patient 's bleeding tendency as well as that of the fibrinogen yecheon subject, which was supported by the ultrastructure of fibrinogen caracas ii (a ser434 to n - glycosylated asn) detected with the use of scanning electron microscopy. in the microscopic image, large pores bounded by local fiber networks made up of thin fibers were observed (9). normally, fibrinogen contains approximately 3% carbohydrate consisting of neuac, gal, man, and glcnac, which is linked to asn 52 on the chain and asn 364 on the b chain (10). the role of glycosylation in fibrinogen function has been studied and its involvement in the clotting process was proposed (10), although contradictory results have been reported (11). steric hindrance by the extra carbohydrate itself, the disruption of d : d interactions by the new glycosylation, and strong negative charges of sialic acids in the extra carbohydrate could be raised to account for disturbed fibrin polymerization or impaired cross - linking in niigata (b asn160ser), asahi, and lima (a arg141ser) fibrins, respectively (1, 12 - 14). being a heterozygote, in fibrinogen yecheon, as in fibrinogen asahi, fibrin monomer containing at least one gamma chain mutated is not likely to function on making polymerization properly. those facts, therefore, suggested extra glycosylated gamma chain not only dysfunction on polymerization but also inhibit normal fibrin and fibrinogen resulting in hardly clotting with thrombin in fibrinogen activity assay by clauss method. in addition, the subject 's coagulation abnormality was thought to be caused by extra glycosylation of -chain and subsequent disruption of d : d interaction because other coagulation factors were within normal ranges (table 1). usually, dysfibrinogenemias having extra glycosylations concerned hemorrhagic tendency unlike tokyo v (ala327-thr) fibrinogen which was somewhat unique in that its propositus was thrombophilic partly owing to fibrinolysis - resistant fibrin clots despite the very low clottability of the fibrin. it was suggested that tissue plasminogen activator binding to tokyo v fibrinogen might have been affected directly. the subject of fibrinogen yecheon presented de novo mutation in fgg, while his parents did not show any coagulation abnormalities including dna sequencing. de novo mutations are associated with advancing paternal age (15) and pollutants (16, 17). one thing different between yecheon and asahi subjects was the level of fdp, which was normal (2.3 g / ml) for the yecheon subject while that was markedly increased to 160 g / ml for the asahi patient. because d - dimer level was within normal range, the yecheon subject was not considered in the state of hyperfibrinolysis, which was partially supported by the normal levels of plasminogen and antithrombin. as a follow - up, a further study can be conducted to understand what brought about marked increase in fdp level for asahi subject. fibrinogen yecheon is the only congenital dysfibrinogenemia in korea associated with bleeding tendency, and not thrombosis or amyloidosis. our subject was born with bleeding tendency, although he had no history of serious bleeding symptoms. in general, two patients, baltimore i (gly292val) and giessen iv (asp-318gly), who experienced mild bleeding symptoms, also suffered from thrombotic tendencies. the only -dysfibrinogenemia associated with a serious bleeding diathesis is asahi i (met310thr). in this instance, the bleeding symptoms were probably related to the extra glycosylation resulting from the substitution (1). in conclusion, this report describes a variant fibrinogen, hereinafter called " fibrinogen yecheon ", using the name after the town where the patient was living at the time of diagnosis (2). fibrinogen yecheon has a de novo heterozygous point mutation of fgg resulting in met310thr and subsequent extra n - glycosylation at asn308. | this case study reports a rare fibrinogen variant, met310thr mutation, for the first time in korea. the case shows a point mutation from t to c in the 1,007th nucleotide of the fgg gene. this report describes a variant fibrinogen, hereinafter called " fibrinogen yecheon ", using the name after the town where the patient was living at the time of diagnosis. fibrinogen yecheon has a de novo heterozygous point mutation of fgg resulting in met310thr and subsequent extra n - glycosylation at asn308. extra n - glycosylated fibrinogen is considered a main inhibitor of normal fibrinogen activity. |
cell culture, transfection, and plasmid constructs culture and transfection of cos1 cells were performed as previously described (2). mammalian expression plasmids pmcfp - rac1 and pmyfp - rac1 encoding the nh2-terminal fusion of monomeric cyan fluorescence protein (cfp) or yellow fluorescence protein (yfp) to rac1 as well as rac1 derivatives having the g12v, r66a, c189s, or 6q (kkrkrk qqqqqq) mutations have been described (22, 23). the k186e mutation in rac1 was generated using the stratagene (la jolla, ca) quikchange site - directed mutagenesis kit. plyn - mcfp consists of a 10-amino acid myristoylation / palmitoylation sequence of lyn kinase fused to the 5-end of the mcfp gene (6). rac1(c189s) or rac1(6q / c189s) devoid of the geranylgeranylation signal were inserted in frame into the cooh terminus of plyn - mcfp to generate plyn - mcfp - rac1(c189s) or plyn - mcfp - rac1(6q / c189s). mcfp - gerger and myfp - gerger containing fluorescence protein fused to the caax geranylgeranylation signals, without the upstream polybasic region, were kindly provided by dr. r. tsien (university of california, san diego) (24). plasmids encoding ha - myfp, lyn - ha - myfp, myc - mcfp, and lyn - myc - mcfp fusions were constructed by replacing the enhanced green fluorescent protein gene in pegfp - c1 (clontech) with each tag - encoded gene indicated. various rac1 alleles (wt, r66a, 6q, c189s, and 6q / c189s) were then cloned into all four plasmids. rac1 derivatives used in this study and their properties are described in table 1. table 1rac1 derivatives used in this studyconstructionspropertiespredicted localization mcfp - rac1 (wt) wild type cytoplasm and membrane myfp - rac1 (wt) wild type cytoplasm and membrane myfp - rac1 (6q) missing rac1 pbr cytoplasm mcfp - rac1 (g12v) gtp hydrolysis - defective cytoplasm and membrane mcfp - rac1 (r66a) defective for rhogdi binding predominantly membrane mcfp - rac1 (c189s) missing prenylation site nucleus and cytoplasm myfp - rac1 (k186e) defective for pip5k binding membrane and cytoplasm mcfp - caax prenylated mcfp membrane myfp - caax prenylated myfp membrane mcfp - rac1 (g12v) (6q) gtp hydrolysis - defective ; missing pbr cytoplasm mcfp - rac1 (g12v) (c189s) gtp hydrolysis defective ; missing prenylation site cytoplasm and nucleus mcfp - rac1 (g12v) (k186e) gtp hydrolysis - defective ; defective for pip5k binding membrane and cytoplasm lyn - mcfp - rac1 (6q) (c189s) myristoylated ; missing pbr and prenylation site membrane lyn - mcfp - rac1 (c189s) myristoylated ; missing prenylation site membrane lyn - myfp - rac1 (c189s) myristoylated ; missing prenylation site membrane lyn - mcfp - rac1 (g12v) (k186e) myristoylated ; gtp hydrolysis - defective ; defective for pip5k binding membrane lyn - myfp - rac1 (g12v) (k186e) myristoylated ; gtp hydrolysis - defective ; defective for pip5k binding membrane lyn - myfp - rac1 (g12v) (c189s) myristoylated ; gtp hydrolysis - defective ; missing prenylation site membrane lyn - mcfp - rac1 (g12v) (c189s) myristoylated ; gtp hydrolysis defective ; missing prenylation site membrane lyn - mcfp - rac1 (6q) (c189s) myristoylated ; missing pbr and prenylation site membrane lyn - myfp - rac1 (6q) (c189s) myristoylated ; missing pbr and prenylation site membrane lyn - mcfp - rac1 (g12v) (6q) (c189s) myristoylated ; gtp hydrolysis - defective ; missing pbr and prenylation site membrane lyn - myfp - rac1 (g12v) (6q) (c189s) myristoylated ; gtp hydrolysis - defective ; missing pbr and prenylation site membrane myc - mcfp - rac1 (wt) wild type cytoplasm and membrane ha - myfp - rac1 (wt) wild type cytoplasm and membrane myc - mcfp - rac1 (6q) missing pbr cytoplasm myc - mcfp - rac1 (c189s) gtp hydrolysis - defective ; missing prenylation site cytoplasm and nucleus myc - mcfp - rac1 (r66a) defective for rhogdi binding predominantly membrane lyn - myc - mcfp - rac1 (6q) myristoylated ; missing pbr membrane lyn - ha - myfp - rac1 (6q) myristoylated ; missing pbr membrane lyn - ha - myfp - rac1 (c189s) myristoylated ; missing prenylation site membrane lyn - myc - mcfp - rac1 (c189s) myristoylated ; missing prenylation site membrane lyn - ha - myfp - rac1 (6q) (c189s) myristoylated ; missing pbr ; missing prenylation site membrane lyn - myc - mcfp - rac1 (6q) (c189s) myristoylated ; missing pbr and prenylation site membrane lyn - myc - mcfp myristoylated mcfp membrane lyn - ha - myfp myristoylated myfp membrane rac1 derivatives used in this study culture of y. pseudotuberculosis infection of mammalian cells and immunofluorescence protection assay of bacterial uptake conditions for growth of virulence plasmid - cured y. pseudotuberculosis ypiii(p) with or without yope or yopt and infection of cos1 have been described (22). the plasmid - cured y. pseudotuberculosis strain lacks the virulence plasmid (pyv) that encodes yope and yopt and is efficiently internalized into host cells. strains that harbor the yope rho family gap (22) or the yopt family caax protease (kind gift of dr. james bliska, suny stony brook) contain plasmids encoding these proteins as well as the plasmid pyv (yopt - deficient yope::kan yoph::cam ; referred to as strain yp17) to allow translocation of these proteins via the bacterial type iii secretion system (22). for bacteria lacking the virulence plasmid, the ypiii(p) strain was grown logarithmically in luria bertani broth at 26 c until an a600 of 0.7, prior to inoculation onto cultured mammalian cells (22). for strains harboring the pyv plasmid and yop - encoding plasmids, bacteria were grown with aeration at 26 c overnight in broth supplemented with 2.5 mm cacl2 and 100 g / ml ampicillin and then subcultured and grown at 26 c until a600 of 0.2. at this point, the cultures were shifted to 37 c and aerated for 1 h. a multiplicity of infection of 50:1 was used for ypiii(p) incubations, and a multiplicity of infection of 25:1 was used for other derivatives. for the pyope - expressing plasmid, 0.1 mm isopropyl--d - thiogalactopyranoside briefly, bacteria appropriately cultured were incubated with transfected cells for 30 min at a multiplicity of infection of 50 at 37 c. after incubation, the adherent cells were analyzed for internalized or surface - bound bacteria as described previously (6). the monolayers were fixed in 3% paraformaldehyde and probed with primary antibody directed against y. pseudotuberculosis, followed by a fluorescent secondary antibody (anti - igg conjugated to either alexa fluor 594 or cascade blue) to detect extracellular bacteria. the cells were then permeabilized (2) and probed with antibodies directed against the bacteria to allow detection of both intracellular and extracellular bacteria. fret measurements the basis of the assay is that association between rac1 derivatives fused to either monomeric cfp or monomeric yfp should be detected as a fret readout. cos1 cells were first transfected with a combination of various derivatives of mcfp - rac1 and myfp - rac1 and then challenged with bacteria. the cells were then imaged and analyzed for sensitized fret from cfp to yfp essentially as described (22), using correction factors for cfp (0.32) and yfp (0.18) for bleed - through from cfp emission and cross - yfp excitation by the fret filter set. to measure fret, images from yfp, cfp, and fret filter sets (22) sensitized fret was then calculated from these regions, by subtracting the cfp and yfp correction factors, using exactly the same procedure as described previously (22). fret signals were normalized by combination of mcfp and myfp emissions calculated from the cfp and yfp filter sets using the following formula as described (25). (eq.1)\documentclass[10pt]{article } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{pmc } \usepackage[euler]{upgreek } \pagestyle{empty } \oddsidemargin -1.0 in \begin{document } \begin{equation}{\mathrm{normalized\;fret}}\hspace{1em}=\hspace{1em}\frac{{\mathrm{sensitized\;\;fret}}}{\sqrt{{\mathrm{cfp}}\hspace{1em}{\times}\hspace{1em}{\mathrm{yfp}}}}\end{equation}\end{document } determination of myfp - rac1 expression levels relative to endogenous rac1cos1 cells were transfected with myfp - rac1 and cultured overnight. transfected cells were lifted and subjected to flow cytometry using yfp fluorescence to sort cells into four fractions according to levels of fluorescence (yfp negative, low, medium, and high). a portion of the sorted cells were plated onto fibronectin - coated coverslips, allowed to adhere for 3 h, fixed in 4% paraformaldehyde, and imaged to quantify yfp fluorescence. the remaining sorted cells were lysed in sample buffer ; lysates were resolved by sds - page, blotted, and probed for rac1 using a monoclonal anti - rac1 antibody (clone 23a8 ; sigma). immunoprecipitation of myc / ha - tagged mcfp / myfp fusions293 t cells were transfected with 0.5 g of each plasmid in 6-well dishes. bait constructs were myc - tagged, and prey constructs were ha - tagged. cells were lysed 24 h post - transfection in 500 l of lysis buffer (20 mm tris, ph 7.5, 150 mm nacl, 1% nonidet p-40, and complete protease inhibitor mixture (roche applied science)). were then incubated at 4 c (with agitation) for 10 min and spun to remove debris. 50 l of the cleared lysates was saved as the input fraction, and 400 l was applied to washed anti - ha epitope affinity resin (monoclonal anti - ha ; sigma) and incubated at 4 c (with agitation) for 1 h. the resin was washed three times in wash buffer (25 mm tris, ph 7.5, 30 mm mgcl2, 40 mm nacl, 0.1% nonidet p-40), and bound proteins were eluted in 100 l of sample buffer. 10 l of eluted proteins (immunoprecipitate) as well as 10 l of cleared lysates (input) were analyzed by sds - page and western blotting. input and immunoprecipitated proteins were detected using an anti - myc epitope antibody (rabbit polyclonal ; santa cruz biotechnology, inc., santa cruz, ca) as well as an anti - ha epitope antibody (rabbit polyclonal ; santa cruz biotechnology). y. pseudotuberculosis employs a variety of proteins to activate and misregulate rac1 in host cells (22). in this report, we examined whether y. pseudotuberculosis could also control self - association of rac1 (21). previously, self - association was demonstrated in vitro by gel filtration chromatography and immunoprecipitation of differentially tagged rac1 derivatives in an event requiring the cooh - terminal pbr (fig. 1a) (21). to determine if self - association occurs in cells and can be detected at spatially distinct sites within the cell, rac1 self - association was analyzed by a fret - based system, using monomeric cfp and yfp derivatives (mcfp - rac1 and myfp - rac1) (fig. when coexpressed in the same cells, mcfp - rac1(wt) and myfp - rac1(wt) produced fret throughout the cells in all regions except for the nucleus (fig. 1, b and c). when normalized to the concentration of rac1 at individual sites in the cell, fret signals (normalized fret) were notably stronger at membrane ruffles, indicating enhanced rac1 self - association (fig. these elevated fret levels were specific to these sites, because at regions where no ruffles were evident, the lower levels of normalized fret were independent of rac1 concentrations. gly (g12), arg (r66), and lys (k186) are the sites of constitutively active, rhogdi binding - defective, and pip5k binding - defective mutations, respectively. b, reduced self - association in the absence of membrane localization or loss of the pbr. the mcfp- or myfp - rac1 derivatives noted in b were cotransfected into cos1 cells, and fret measurements were determined (see materials and methods). sensitized fret from 20 regions of interest (see materials and methods) were plotted as a function of the intensity of the mcfp - rac1 donor and myfp - rac1 acceptor. c - g, left, schematic diagrams for detecting rac1-rac1 self - association using fret. monomeric forms of cfp and yfp were fused to the nh2 terminus of rac1, as displayed in schematic diagrams. derivatives in which myfp - rac1 is defective for plasma membrane localization (e.g. rac1 6q and rac1 c189s) are defective for interaction with wild - type rac1 on the plasma membrane and thus failed to produce fret. right, cos1 cells were transfected with mcfp - rac1 and myfp - rac1 having the indicated mutations. the cells were fixed and analyzed by fret using fluorescence microscopy (see materials and methods). sensitized fret (sens. fret) corresponds to the total amount of fret, whereas normalized fret (norm. fret) corresponds to the amount of fret per unit of fluorescent protein (see materials and methods). both sensitized fret and normalized fret are displayed as color gradient look - up tables, with the appropriate scale bars below each panel. white scale bar in g, 10 m (applies to all panels). gly (g12), arg (r66), and lys (k186) are the sites of constitutively active, rhogdi binding - defective, and pip5k binding - defective mutations, respectively. b, reduced self - association in the absence of membrane localization or loss of the pbr. the mcfp- or myfp - rac1 derivatives noted in b were cotransfected into cos1 cells, and fret measurements were determined (see materials and methods). sensitized fret from 20 regions of interest (see materials and methods) were plotted as a function of the intensity of the mcfp - rac1 donor and myfp - rac1 acceptor. c - g, left, schematic diagrams for detecting rac1-rac1 self - association using fret. monomeric forms of cfp and yfp were fused to the nh2 terminus of rac1, as displayed in schematic diagrams. derivatives in which myfp - rac1 is defective for plasma membrane localization (e.g. rac1 6q and rac1 c189s) are defective for interaction with wild - type rac1 on the plasma membrane and thus failed to produce fret. right, cos1 cells were transfected with mcfp - rac1 and myfp - rac1 having the indicated mutations. the cells were fixed and analyzed by fret using fluorescence microscopy (see materials and methods). fret) corresponds to the total amount of fret, whereas normalized fret (norm. fret) corresponds to the amount of fret per unit of fluorescent protein (see materials and methods). both sensitized fret and normalized fret are displayed as color gradient look - up tables, with the appropriate scale bars below each panel. white scale bar in g, 10 m (applies to all panels). consistent with biochemical data, self - association of rac1, as detected by fret, required the presence of the pbr on both partners. co - transfection of mcfp - rac1(wt) with myfp - rac1(6q), which has each of the basic residues in the pbr replaced with gln (26), produced a lower fret signal (fig. 1, b and d ; 6q), confirming the previous published findings that the pbr mediates rac1 self - association in vitro (21). self - association is not due to overexpression of rac1 constructs since any self - association observed by fret could result from aggregation of overexpressed protein, the concentration of rac1 expressed from the transfected plasmids relative to endogenous levels of rac1 was determined. cos1 cells were transfected with myfp - rac1 and sorted by flow cytometry to determine the concentration of rac1 relative to the amount of yfp fluorescence observed by microscopy. 2a), with a peak of untransfected cells and a shoulder of cells having increasing amounts of fluorescence. the total cell population was collected into four separate fractions consisting of cells with increasing amounts of yfp fluorescence (neg, lo, med, hi ; fig. 2a), and each population was analyzed to determine the amount of myfp - rac1 expression as well as the level of fluorescence using our standard microscopic techniques. the expression of myfp - rac1 in the yfp - lo fraction was lower than that of endogenous rac1, based on western blotting with anti - rac1 antibody. the levels of myfp - rac1 were about 50% of the levels of endogenous rac1 in this population (fig. 2b ; yfp med and yfp hi) expressed much higher levels of yfp - rac1 compared with endogenous rac1. transfectants plated onto coverslips from the yfp - lo population clearly had fluorescence levels similar to those being used for fret analysis (fig. when the fluorescence was determined on individual cells from the myfp - lo fraction, the average intensity of individual cells was 500 fluorescence units (fig. 2d), which is about the mean intensity of all the cells used for fret (fig. 2d ; myfp - rac1(fret)). in fact, the cell populations that showed overexpression of yfp - rac1 gave fluorescence intensities that were well beyond what was analyzed by fret (fig. therefore, a large proportion of the cells analyzed by fret expressed amounts of myfp - rac1 that are at or below endogenous levels of rac1. we conclude that self - association is not due to overexpression of the fluorescence derivatives. figure 2.fret analysis of rac1 self - association was performed at physiological rac1 levels. a, myfp - rac1-transfected cos1 cells were sorted according to fluorescence (negative (neg), low fluorescence (lo), medium (med), and high (hi)). b, sorted cells were lysed and analyzed by western blotting, probing with a monoclonal rac1 antibody (top). blots were scanned, and the extent of overexpression with respect to endogenous rac1 levels was quantified by densitometry (bottom). c, sorted cells were plated onto fibronectin - coated coverslips and allowed to adhere. two representative images are displayed where the med image has been normalized to the fluorescence maximum of the lo image, as indicated by the look - up table. d, fluorescence intensity of the low and medium fluorescence populations was quantified exactly as the fret analysis. data are displayed as average yfp fluorescence s.e. on a per cell basis. average yfp fluorescence from a typical fret experiment is included in this graph for comparison purposes. a, myfp - rac1-transfected cos1 cells were sorted according to fluorescence (negative (neg), low fluorescence (lo), medium (med), and high (hi)). b, sorted cells were lysed and analyzed by western blotting, probing with a monoclonal rac1 antibody (top). blots were scanned, and the extent of overexpression with respect to endogenous rac1 levels was quantified by densitometry (bottom). c, sorted cells were plated onto fibronectin - coated coverslips and allowed to adhere. two representative images are displayed where the med image has been normalized to the fluorescence maximum of the lo image, as indicated by the look - up table. d, fluorescence intensity of the low and medium fluorescence populations was quantified exactly as the fret analysis. data are displayed as average yfp fluorescence s.e. on a per cell basis. average yfp fluorescence from a typical fret experiment is included in this graph for comparison purposes. myfp - rac1 fusions were expressed in cos1 cells and imaged microscopically for yfp fluorescence. a, myfp - rac1(wt) ; b, myfp - rac1(k186e), defective for effector (pip5k) binding ; c, myfp - rac1(c189s), lacking prenylation ; d, lyn - myfp - rac1(c189s), myristoylated derivative ; e, myfp - rac1(6q), defective pbr ; f, lyn - myfp - rac1(6q)(c189s) ; g, myfp ; h, lyn - myfp, myristoylated myfp. note that lyn myristoylation targets proteins localized nuclearly (c) or perinuclearly (e) to the plasma membrane (f and h, respectively). white scale bar in h, 20 m (applies to all panels). myfp - rac1 fusions were expressed in cos1 cells and imaged microscopically for yfp fluorescence. a, myfp - rac1(wt) ; b, myfp - rac1(k186e), defective for effector (pip5k) binding ; c, myfp - rac1(c189s), lacking prenylation ; d, lyn - myfp - rac1(c189s), myristoylated derivative ; e, myfp - rac1(6q), defective pbr ; f, lyn - myfp - rac1(6q)(c189s) ; g, myfp ; h, lyn - myfp, myristoylated myfp. note that lyn myristoylation targets proteins localized nuclearly (c) or perinuclearly (e) to the plasma membrane (f and h, respectively). white scale bar in h, 20 m (applies to all panels). plasma membrane localization of rac1 is not sufficient to promote self - association the 6q mutation that replaces the pbr has the secondary effect of interfering with plasma membrane localization of rac1 (14) (fig. we therefore tested whether blocking plasma membrane localization would affect the ability of rac1 to self - associate. the c189s mutation, immediately downstream of pbr, prevents geranylgeranylation of rac1 at the carboxyl - terminal caax box and resulted in a large pool of the protein localizing in the nucleus, as previously described (27) (fig. this lipid modification is essential for the ras superfamily of small gtpases to anchor onto the plasma membrane (28). based on the fret assay, mcfp - rac1(c189s) showed no ability to interact with myfp - rac1(wt) (fig. 1, b and e ; c189s), indicating the importance of plasma membrane localization for rac1 self - association. the c189s mutation also blocks rhogdi binding (29), raising the possibility that rhogdi could play some role in rac1 self - association. to rule out this possibility, the interaction of the rac1(r66a) mutant was analyzed, which is unable to bind rhogdi but maintains plasma membrane localization (22, 30). mcfp - rac1(r66a) produced fret with myfp - rac1(wt) as efficiently as was observed for the interaction between the fluorescent wild type derivatives of rac (fig. 1, b and f ; r66a). thus, plasma membrane localization, but not rhogdi binding via the caax geranylgeranylation site, was necessary for rac1 self - association. figure 4.the polybasic region is not sufficient to allow rac1 self - association of membrane - localized protein. schematic diagrams on the left represent the pairs of fluorescent proteins used for fret analysis in cos1 cells. derivatives used were mcfp - rac1(wt) and myfp - rac1(wt) (a) ; the mcfp - gerger and myfp - gerger pair having caax boxes at the carboxyl termini of the fluorescent proteins, lacking all other rac1 sequences (24) (b) ; lyn - mcfp and lyn - myfp, fluorescent proteins localized in the membrane via the nh2-terminal myristoylation site (c) ; lyn - mcfp - rac1 - 6q(c189s) and lyn - myfp - rac1 - 6q(c189s), localizing hybrid proteins in the membrane via the nh2-terminal myristoylation site (d) ; and lyn - mcfp - rac1(c189s) and lyn - myfp - rac1(c189s), in which caax box defective mutants with intact pbrs are forced into the plasma membrane by the lyn myristoylation signal (e). constructs encoding these proteins were transfected into cos1 cells, fixed the day after transfection, and subjected to fret microscopy. representative images of the cfp and yfp channels, along with the sensitized fret (sens. fret) are displayed as color gradient look - up tables, using the displayed scale. white scale bar in e, 10 m (applies to all panels). the polybasic region is not sufficient to allow rac1 self - association of membrane - localized protein. schematic diagrams on the left represent the pairs of fluorescent proteins used for fret analysis in cos1 cells. derivatives used were mcfp - rac1(wt) and myfp - rac1(wt) (a) ; the mcfp - gerger and myfp - gerger pair having caax boxes at the carboxyl termini of the fluorescent proteins, lacking all other rac1 sequences (24) (b) ; lyn - mcfp and lyn - myfp, fluorescent proteins localized in the membrane via the nh2-terminal myristoylation site (c) ; lyn - mcfp - rac1 - 6q(c189s) and lyn - myfp - rac1 - 6q(c189s), localizing hybrid proteins in the membrane via the nh2-terminal myristoylation site (d) ; and lyn - mcfp - rac1(c189s) and lyn - myfp - rac1(c189s), in which caax box defective mutants with intact pbrs are forced into the plasma membrane by the lyn myristoylation signal (e). constructs encoding these proteins were transfected into cos1 cells, fixed the day after transfection, and subjected to fret microscopy. representative images of the cfp and yfp channels, along with the sensitized fret (sens. fret) are displayed as color gradient look - up tables, using the displayed scale. white scale bar in e, 10 m (applies to all panels). to determine whether plasma membrane localization was sufficient to cause intermolecular fret in this particular assay, we targeted mcfp / myfp onto the plasma membrane by either an nh2-terminal myristoylation signal from the lyn protein (24) or the cooh - terminal geranylgeranylation site from rac1 (see fig. neither of the two tags could enable the cfp / yfp pair to generate fret (fig. 5, a - c and i) even at high concentrations (fig. 5, b and c). this lowered self - association was observed, in addition, with cells that were challenged with y. pseudotuberculosis, since no fret signal could be detected at regions of membrane aggregation resulting from invasin binding or at regions of membrane ruffling (see below ; fig. we conclude that plasma membrane localization was not sufficient to cause protein self - association. forcing plasma membrane localization of proteins that do not interact also was not sufficient to cause protein self - association. the addition of the lyn myristoylation signal to either rac1(c189s) (fig. rac1(6q / c189s) (fig. 3, compare e with f) resulted in plasma membrane localization of these derivatives. neither lyn - modified derivative generated a significant fret signal for rac1-rac1 interaction (fig. therefore, the aberrant localization of these rac1 derivatives to sites such as the nucleus and perinuclear locales (fig. 3) does not explain the inability of these proteins to self - associate, since even when they are plasma membrane - localized, they could not self - associate. additionally, gtpase activation does not cause self - association under these conditions, because constitutively active membrane - targeted rac1 variants lacking the appropriate carboxyl - terminal sequences fail to generate a fret signal (fig. 5, f, g, and i). lowering affinity for effectors reduces rac1 self - association the pbr has been characterized to have a role in binding effectors, such as phosphatidylinositol-4-phosphate 5-kinase- (pip5k) and protein kinase c - related kinase 1 (7, 31). to determine whether disruption of effector recognition reduces rac1 self - association, we introduced the k186e mutation into rac1, which has been demonstrated to block the binding of pip5k without affecting plasma membrane localization of rac1 (7) (fig. 3b). a lower level of mcfp - rac1(k186e) self - association was observed relative to wild type (figs. 1 g and 5, h and i). therefore, maximum rac1 self - association depended on sequence determinants that are also important for effector binding (residue lys) as well as geranylgeranylation (residue cys). formation of a stable rac1-rac1 complex requires the presence of the pbr and prenylation signal to support the data from the fret assay, an independent test of rac1 self - association was performed using a coimmunoprecipitation procedure (fig. the power of the fret readout is that it provides spatial information and may allow the detection of transient interactions. if the observed self - association is transient, then it may not survive other detection strategies, such as immunoaffinity techniques, that require slow dissociation rates. to determine if interaction could be observed using more restrictive conditions, several of the constructs used in the microscopic assay were tagged with either myc or ha epitopes and expressed in mammalian cells (fig. two constructs were co - transfected into 293 t cells, each having different tags to allow detection of self - association. extracts from the transfectants were then subjected to immunoprecipitation with anti - ha, followed by immunoblotting with anti - myc, to determine if a fraction of the myc - tagged partner was found in the precipitate (see materials and methods). when ha - tagged cfp - rac1(wt) was immunoprecipitated, it was able to pellet either myc - tagged yfp - rac1(wt) or myc - tagged yfp - rac1(r66a) based on immunoblotting, consistent with the fret observations (fig. on the other hand, any disruption of the prenylation site (rac1(c189s)) or the pbr (rac1(6q)) was sufficient to interfere with co - immunoprecipitation (fig. this loss of association was true even if only one of the partners was lacking the critical carboxyl - terminal sequences (fig. 6, b and f ; wt + 6q and wt + c189s) or if membrane localization was forced by adding a lyn myristoylation site (fig. 6, b and f ; lyn constructs). therefore, there is concordance between the two assays for detecting interaction, since rac1 self - association is sufficiently long lived to survive detergent extraction and immunoprecipitation. furthermore, these results provide direct evidence that rac1 self - association requires the pbr and cooh - terminal prenylation signal. figure 5.rac1 self - association of rac1(wt) is independent of expression levels. a - h, cos1 cells were cotransfected with mcfp - rac1 and myfp - rac1 constructs, and rac1 self - association was determined by fret in two regions of interest (roi) within each cell. each data point represents results from a single cell, and data are plotted for 20 cells per construct (see materials and methods). sensitized fret determinations were then normalized to the total concentration of both derivatives, calculated as (mcfp - rac1 myfp - rac1), and data were plotted as a function of the concentration of the derivatives in each of the regions of interest. data are plotted as the mean of the normalized fret determinations s.e. ; pooling data from all of the analyzed transfectants are displayed in a - h. a - h, cos1 cells were cotransfected with mcfp - rac1 and myfp - rac1 constructs, and rac1 self - association was determined by fret in two regions of interest (roi) within each cell. each data point represents results from a single cell, and data are plotted for 20 cells per construct (see materials and methods). sensitized fret determinations were then normalized to the total concentration of both derivatives, calculated as (mcfp - rac1 myfp - rac1), and data were plotted as a function of the concentration of the derivatives in each of the regions of interest. data are plotted as the mean of the normalized fret determinations s.e. ; pooling data from all of the analyzed transfectants are displayed in a - h. invasin binding results in localized rac1 self - association engagement of 1 integrin receptors by the y. pseudotuberculosis outer membrane protein invasin triggers the recruitment of rac1 onto the phagosomal membrane (6). to examine the degree of self - association of rac1 in response to invasin binding, we visualized rac1 clustered about y. pseudotuberculosis associated with cos1 after a 30-min incubation with bacteria. to analyze self - association, cells were challenged with a bacterial strain that expressed invasin as the only adhesin and lacks the ability to translocate rac1-inactivating yops (33). fret analysis showed that the mcfp - rac1 recruited around nascent phagosomes had elevated levels of self - association in comparison with the nearby rac1 located at regions distal from the phagosomes (fig. rac1 on membrane ruffles displayed similar higher efficiency of self - association (data not shown ; fig. this enhanced self - association was not due to simple recruitment of mcfp - rac1 and myfp - rac1 to the active sites, because the fret levels were still elevated after the fret signals were normalized against the concentration of mcfp - rac1, indicating that the fraction of rac1 undergoing self - interaction is higher at the site of bacterial adhesion than at other sites (fig. in addition, the increased fret signal was dependent on the presence of rac1 in the fusion constructs as well as the caax motif. when the simple mcfp - gerger / myfp - gerger pair or the lyn - mcfp - rac1(c189s)/lyn - myfp - rac1(c189s) pair was analyzed, neither was able to generate a fret signal at any site in the host cells even on nascent phagosomes associated with sites of bacterial adhesion (fig. this is despite the fact that the caax - containing constructs showed evidence of concentration about the phagosomal cups (fig. therefore, enhanced rac1 self - association was not a result of increased membrane density resulting from invasin engagement of integrins but was a property of the presence of an intact rac1 protein. figure 6.stable self - association of rac1 derivatives shows identical profile to fret assay. a, ha (yfp derivatives) or myc (cfp derivatives) epitope tags were introduced into each of the constructs used in the fret assays and used in co - immunoprecipitation experiments to detect stable self - association. displayed to measure self - association, the noted cfp and yfp derivatives were co - transfected into 293 t cells, and lysates were subjected to immunoprecipitation (ip) with anti - ha igg to precipitate yfp derivatives. association with the noted cfp derivatives was detected after gel fractionation and western blotting (ib) with anti - myc igg (b), and the total amount precipitated was determined by blotting with ha (d). as controls to determine relative efficiency of immunoprecipitation, the lysates were probed with anti - myc (c) or anti - ha (e), loading 25% of the total fraction available for immunoprecipitation. f, quantitation of the fraction of rac1 that self - associates. bands from b and c were subjected to densitometry scanning to determine the fraction of myc - tagged protein that associated with ha - tagged rac1. a, ha (yfp derivatives) or myc (cfp derivatives) epitope tags were introduced into each of the constructs used in the fret assays and used in co - immunoprecipitation experiments to detect stable self - association. displayed to measure self - association, the noted cfp and yfp derivatives were co - transfected into 293 t cells, and lysates were subjected to immunoprecipitation (ip) with anti - ha igg to precipitate yfp derivatives. association with the noted cfp derivatives was detected after gel fractionation and western blotting (ib) with anti - myc igg (b), and the total amount precipitated was determined by blotting with ha (d). as controls to determine relative efficiency of immunoprecipitation, the lysates were probed with anti - myc (c) or anti - ha (e), loading 25% of the total fraction available for immunoprecipitation. f, quantitation of the fraction of rac1 that self - associates. bands from b and c were subjected to densitometry scanning to determine the fraction of myc - tagged protein that associated with ha - tagged rac1. removal of the caax motif by yersinia yopt protease destroys rac1 self - association the above data argue that the caax prenylation motif and the pbr collaborate to promote rac1 self - association. one possibility for how this occurs is that membrane insertion resulting from prenylation facilitates close contact between rac1 monomers, stimulating pbr self - association. the other possibility is that insertion in the membrane is required to maintain self - association. to determine if membrane insertion was required for maintenance of the interaction, we analyzed the consequences of translocating the y. pseudotuberculosis yopt protein into host cells on rac1 self - association. the yopt protease activity targets membrane - localized rac1 (13), cleaving just upstream of the caax box, releasing rac1 from the membrane. if the role of the prenyl group is limited to initiating rac1 association, then protein released from the membrane should continue to self - associate. to test this model, transfectants expressing the mcfp - rac1/myfp - rac1 pair were challenged with a yopt - expressing y. pseudotuberculosis strain, and the amount of fret between the rac1 pairs was determined (22). within 1 h of incubation with y. pseudotuberculosis, yopt had reduced rac1 self - association, since no fret signal could be detected between the rac1 pairs (fig. 7d). therefore, because rac1 rapidly lost self - association after release from the membrane, localization of the protein in the membrane via the prenyl groups was required to maintain this relationship. furthermore, the loss of self - association after release from the membrane could not be due to competition for binding by rhogdi, because removal of the prenyl group prevents recognition by rhogdi (32). loss of self - association is not the cause of defective signaling that results from alterations in the polybasic region to investigate the function of the rac1 cooh terminus in invasin - promoted uptake, a strategy was pursued in which mutated plasmid - encoded rac1 genes were introduced into cell lines that expressed endogenous rac1. to this end yope is translocated into mammalian cells and subsequently inactivates endogenous rac1, thus inhibiting the phagocytosis of the bacterium. this uptake inhibition can be overcome by the exogenous expression of a gap - insensitive (constitutively active) rac1 allele. a number of rac1 pbr mutants were introduced onto the constitutively active rac1v12 allele and were transfected into cos1 cells. cells were challenged with yope - expressing y. pseudotuberculosis (strain yp17/pyope), and the extent of bacterial uptake was quantified. cos1 cells were transfected with mcfp - rac1 and myfp - rac1 constructs (a and d), mcfp - gerger and myfp - gerger (b), or lyn - mcfp - rac1(c189s) and lyn - myfp - rac1(c189s) (c). transfected cells were challenged the next day with a 30-min incubation of ypiii(p) (a - c) or yp17/pyopt (d), followed by immunostaining of extracellular bacteria (ext. bacteria) bound onto host cells. sensitized and normalized fret readings (sens. fret, respectively) were determined as described (see materials and methods). e, mean normalized fret levels at nascent phagosomes were plotted comparing mcfp - rac1/myfp - rac1 and mcfp - gerger / myfp - gerger as described in the legend to fig. white scale bar in d, 5 m (applies to all panels). cos1 cells were transfected with mcfp - rac1 and myfp - rac1 constructs (a and d), mcfp - gerger and myfp - gerger (b), or lyn - mcfp - rac1(c189s) and lyn - myfp - rac1(c189s) (c). transfected cells were challenged the next day with a 30-min incubation of ypiii(p) (a - c) or yp17/pyopt (d), followed by immunostaining of extracellular bacteria (ext. bacteria) bound onto host cells. sensitized and normalized fret readings (sens. fret, respectively) were determined as described (see materials and methods). e, mean normalized fret levels at nascent phagosomes were plotted comparing mcfp - rac1/myfp - rac1 and mcfp - gerger / myfp - gerger as described in the legend to fig. white scale bar in d, 5 m (applies to all panels). the indicated plasmids expressing various rac1v12 mutants were used to transfect cos1 cells. all constructs except mcfp - rac1(v12) were defective in self - association (figs. 3 and 4), whereas only mcfp - rac1(v12)(c189s) and mcfp - rac1(v12)(6q) were defective in localizing on the plasma membrane. 24 h after transfection, cells were challenged with yp17/pyope for 30 min, fixed, and then immunostained for extracellular bacteria and internalized bacteria. uptake efficiency of 50 cfp - positive cells from each of the three coverslips was determined and summarized as mean s.e. for each construct. the indicated plasmids expressing various rac1v12 mutants were used to transfect cos1 cells. all constructs except mcfp - rac1(v12) were defective in self - association (figs. 3 and 4), whereas only mcfp - rac1(v12)(c189s) and mcfp - rac1(v12)(6q) were defective in localizing on the plasma membrane. 24 h after transfection, cells were challenged with yp17/pyope for 30 min, fixed, and then immunostained for extracellular bacteria and internalized bacteria. uptake efficiency of 50 cfp - positive cells from each of the three coverslips was determined and summarized as mean s.e. for each construct. control, no plasmid included in transfection. as demonstrated previously, rac1v12 restored significant bacterial uptake in the presence of yope, allowing the effects of mutations to be compared (fig. not surprisingly, the rac1v12(c189s) derivative that lacks gerenylgerenylation, and therefore could not target to the membrane, was unable to bypass yope activity (fig. similarly defective was the racv12(6q) mutant, which also could not restore uptake in the presence of yope (fig. 8 ; mcfp - rac1v12(6q) versus mcfp - rac1v12 ; p 0.004). thus, invasin - mediated uptake required the pbr. to determine if the defect in uptake seen in these mutants was due to an absence of self - association or due to loss of effector interactions, the k186e effector binding mutation (34) that also lowers rac1 self - association (figs. 1 (b and g) and 5(h and i)) the effect of this mutation on bacterial uptake was similar to that seen with the 6q mutation, since the two derivatives showed no statistical difference in being able to promote uptake (fig. 8 ; mcfp - rac1v12(k186e) versus rac1v12(6q) ; p = 0.47). since both the 6q and c189s mutations reduce plasma membrane localization of rac1, we could not determine if lowered uptake was a result of lowered self - association, effector interactions, or plasma membrane localization (14). to address this issue, uptake was analyzed under conditions in which plasma membrane localization of the mutant rac1 proteins was forced, using the constructs that have a lyn nh2-terminal myristoylation site (24). the addition of the lyn myristoylation site significantly suppressed the defect observed in the c189s mutant (fig. 8 ; mcfp - racv12(c189s) versus lyn - mcfp - racv12(c189s) ; p < 0.004). therefore, the loss of uptake that results from lack of prenylation appears to be almost totally due to defective membrane localization, because the lyn construct lacking the prenylation site showed no evidence of self - association (figs. 4e,5d, and 6) yet if the 6q mutation was introduced into the lyn construct (lyn - rac1v12(6q / c189s)), then uptake was as poor as observed in the construct lacking the lyn site (fig. 8 ; rac1v12(c189s) versus lyn - rac1v12(6q / c189s) ; p < 0.6). the defect in uptake resulting from the 6q mutation was unlikely to be due to poor plasma membrane localization, because the myristoylation site was intact (fig. does not appear to be essential for promoting invasin - mediated uptake in this system, and the 6q mutation that replaces the pbr is defective even when plasma membrane localization is forced, the pbr must be required either for recognition by downstream effectors or racgef proteins. the importance of the latter could not be the cause of the defect in this assay, because rac1v12 derivatives were used, which do not require guanine nucleotide exchange factors for activation. the importance of pbr recognition by effectors for invasin - dependent uptake is supported by results using the k186e mutant. therefore, it appears that in this system, the pbr was required for downstream effector recognition. in this report, we used fret technology to demonstrate that rac1 is able to self - associate in live cells and that the highest levels of this interaction occurred at sites documented to contain the highest concentrations of actin remodeling (14, 22), such as regions of cell surface ruffling and nascent phagosome formation during bacterial uptake. these are also the regions of the cell that have the highest levels of activated rac1 (14, 22). this result supports the model that the rac1 pbr is an important determinant of self - association (21). our data indicate that the pbr is not sufficient for this interaction within host cells, however, since insertion of rac1 into the membrane via its caax prenylation motif was required for detectable self - association. using an assay for the ability of rac1 to support uptake of y. pseudotuberculosis, we demonstrated that rac1 self - association was not required for driving actin polymerization events that lead to internalization of the microorganism. the pbr, however, was important for efficient uptake in this system under conditions in which uptake did not require self - association of rac1, indicating that the pbr was probably required for interaction with downstream effectors. the nature of the assay used to analyze uptake involved using constitutive active derivatives of rac1 and did not rule out the possibility that rac1 self - association may be important to stimulate its activation. rac1 self - association was originally demonstrated using gel filtration experiments, which showed that the cooh - terminal pbr was required for the formation of high molecular weight species of rac1 that had been purified as a nonprenylated protein (21). our observations are consistent with the importance of this region in promoting self - association within mammalian cells (fig. 1b), but unlike this biochemical assay, we could obtain no evidence for self - association in the absence of membrane localization. in particular, the orientation of the protein relative to the membrane was extremely important, since forcing membrane localization by an nh2-terminal myristoylation tag was not sufficient to generate a rac1:rac1 fret signal (figs. 4 and 5). it may be that an important nucleation event that initiates self - interaction requires a particular orientation of the protein in the membrane. alternatively, prenylation could target rac1 into microdomains on the plasma membrane that are required for close association of rac1 monomers. first, active rac1 is preferentially localized on cholesterol - rich lipid raft domains, which could stimulate self - interaction (35). second, rac1 preferentially self - associated at the sites of actin polymerization observed in lamellipodia and nascent phagosomes. after recruitment to these sites, there could be back - signaling to membrane - localized rac1 that stimulates self - association. in fact, the presence of a high concentration of active rac1 at these sites (13, 14) could act as a further important stimulus of rac1 self - interaction, perhaps by initiating cycles of signaling from membrane - localized rac1 to downstream effectors and back to membrane - localized rac1. the self - association initiated at the host cell membrane is stable in the presence of gentle detergent, but it may have a limited lifetime within a host cell once rac1 is liberated from the membrane. the fret data obtained in this study could be reproduced using immunoprecipitation analysis, in which epitope - tagged rac1 variants were used to identify self - interaction complexes (fig. 6). only rac1 derivatives that showed self - association by fret analysis were positive in the immunoprecipitation assay, so the fret analysis was a good predictor of whether multimeric rac1 complexes could survive the detergent extraction procedure. release of rac1 from the membrane by the yersinia yopt protease, which removes the caax prenylation signal, disrupted self - interaction (fig.. this could be due to binding of soluble proteins within the cell after release or the introduction of the protein into a microenvironment within the cell that stimulates dissociation. rhogdi is the most obvious candidate for a protein that could stimulate dissociation of rac1 monomers ; however, the proteolytic product of yopt, nonprenenylated rac1, is not a good substrate for rhogdi (36). release of rac1 from the membrane by yopt results in pbr - dependent translocation of rac1 into the nucleus, where at least a subpopulation of the protein is active (22). although it is not clear what downstream effectors interact with the protein in this compartment, either the biochemical environment of the nucleus or its interacting partners could interfere with self - association. the close correlation between results of the fret assay and the co - immunoprecipitation of rac1 derivatives indicated that the fret analysis could be reproduced using traditional methods of detecting interaction. this connection was not predicted from previously published work using membrane - targeted cfp / yfp derivatives, which indicated that acylated proteins inserted into membranes associate with each other in the absence of any evidence of stable protein interactions (24). (24) showed that the geranylgeranylated myfp / mcfp pair generated a concentration - independent fret signal. the fret by proximity observed in that work, in the absence of any protein domains that promote interaction, is thought to be due to the formation of microdomains within membranes, resulting in close congregation of proteins (24). although not investigated in that work, it is unlikely that such proximity interactions could have survived detergent extraction and allowed co - immunoprecipitation of protein pairs. presumably, our fixation procedures prior to fret (see materials and methods) prevented fluorophores that are located on closely oriented but noninteracting proteins from generating a signal, indicating that only strong protein - protein interactions can be detected. a recent study indicates that fixation can reduce the yield of fret in selected circumstances, particularly when both fluorophores are fused on a single polypeptide. mathematical modeling indicates that a likely explanation for this reduction is that with some fret pairs, fixation can limit protein flexibility and lock the fluorophores in conformations that interfere with energy transfer (38). although such interference appears irrelevant in the case of two physically unlinked proteins that have interacting regions (38), it is possible that fret caused by proximally localized but noninteracting proteins requires a level of flexibility of the fluorophore that is blocked by fixation. it has been suggested that pbr - mediated self - association of rac1 might drive optimal effector signaling, based on the observation that a pbr - defective rac1 derivative was highly defective in activating one of its downstream effectors, the serine / threonine kinase pak1 (21). arguing against this hypothesis were results from another study showing that nh2-terminal myristoylation could fully restore the ability of the pbr - defective rac1 to activate the kinase activity of pak1 (13). from our studies, we think it likely that the restoration of pak1 signaling was due to the myristoyl group forcing membrane localization of the rac1 mutant rather than due to self - association. our results support the idea that the loss of membrane targeting that results from the disruption of the pbr is a more profound consequence than loss of self - association, because membrane targeting of rac1 in the absence of self - association appeared sufficient to promote uptake of y. pseudotuberculosis. a membrane - targeted myristoylated rac1v12(c189s) did not self - associate, yet this activated rac1 mutant was able to restore bacterial uptake under conditions in which the endogenous rac1 was inactive, as long as the pbr was intact in such constructs. in addition to promoting self - association and membrane targeting, the pbr is known to facilitate nuclear localization of rac1 and binding to pip5k as well as other downstream effectors of rac1 (7, 31, 37, 39). phosphatidylinositol 4,5-bisphosphate, the product of pip5k, stimulates invasin - promoted uptake (6). therefore, the importance of pbr could be explained by its ability to stimulate localized phosphoinositol 4,5-bisphosphate accumulation at the phagocytic cup. the fact that we could not bypass the requirement for the pbr in bacterial uptake by simply forcing localization of the protein into the membrane (fig. 8) was very different from the result showing that pak1 signaling was pbr - independent after localization of rac1 in the plasma membrane (14). therefore, stimulation of pak1 is probably not sufficient to bypass the requirement of this sequence determinant for bacterial uptake. consistent with this hypothesis was the finding that a less drastic change in the pbr that interferes with pip5k binding (the rac1(k186e) allele), was sufficient to interfere with the ability of a membrane - localized and constitutively active rac1 variant to promote uptake. although the evidence presented here argue that loss of multimerization resulting from alterations in the pbr can not explain the observed defects in invasin - mediated uptake, it should be pointed out that the rac1 variants used to test uptake were activated forms of the protein (fig. at least for the integrin receptor, multimerization is important, although this does not mean that downstream signaling molecules require multimerization. artificially dimerizing invasin greatly reduces the concentration of the protein required to promote uptake of particles (19). the evidence that downstream multimerization my play a role in regulating this event is that many gtpases are known to form oligomers, an event associated with self - stimulatory gap activity (21). although this latter observation argues that multimerization plays a negative role in signaling, self - inhibition of rac1 may provide a mechanism to limit rac1 activation that is important for successful completion of cytoskeletal activities. such negative feedback may be critical at sites of local rac1 activity, especially when gap and rhogdi activities are expected to be down - regulated. since downstream signaling from rac1 to other gtpases has complex consequences on invasin - mediated uptake (23), localized down - modulation of rac1 signaling could play an important role in completing phagocytic events. future critical tests of the importance of multimerization in either down - modulation of rac1 activity or stimulating downstream signaling will require the development of straightforward systems to analyze mutants at limiting and highly defined protein concentrations. even so, this work demonstrates that multimerization and membrane localization promoted by the pbr do not encompass the entire spectrum of events that are modulated by this small region of the protein. | the cooh - terminal polybasic region (pbr) of rac1, a rho family gtpase member, is required for rac1 self - association, membrane localization, nuclear translocation, and interaction with downstream effectors. we previously demonstrated that phosphatidylinositol-4-phosphate 5-kinase, one of the effectors that requires the polybasic region for interaction, is necessary for efficient invasin - promoted uptake of yersinia pseudotuberculosis by nonphagocytic cells. here we further examined the role of this region in invasin - promoted uptake. using fluorescence resonance energy transfer experiments (fret), we determined that engagement of integrin receptors by invasin caused elevated levels of rac1 self - association at the site of bacterial adhesion in a pbr - dependent fashion. self - association could be disrupted using several strategies : translocation of the yersinia yopt prenylcysteine protease into host cells, inactivation of the rac1 isoprenylation signal that is required for membrane localization, and elimination of the pbr. disruption in each case impaired invasin - promoted uptake. to determine if there is a role for the pbr in rac1 effector signaling that was independent of its role in membrane localization or multimerization, we examined the effect of the pbr in the context of a rac1 derivative that was targeted to the membrane via an nh2-terminal lipid tail. the membrane - targeted rac1 derivative restored significant invasin - promoted bacterial uptake in a pbr - dependent manner and yet displayed no detectable self - association. this study indicates that, in addition to its role in promoting membrane localization, the pbr exerts a positive effect on rac1-controlled bacterial uptake that is independent of rac1 self - association, most likely due to signaling to downstream effectors. |
vitamin d deficiency is reemerging as a major public health problem throughout the world. it is acknowledged that the prevalence of vitamin d deficiency and its associated morbidities are higher than previously thought worldwide. in addition to metabolic bone disease, recent studies reported that vitamin d deficiency could increase the risk of certain cancers, heart disease, and autoimmune diseases including rheumatoid arthritis and multiple sclerosis in adults and diabetes mellitus [18 ]. chronic vitamin d deficiency may have serious adverse consequences in patients with kidney disease [913 ]. to test the hypothesis that low serum 25-hydroxyvitamin d (25(oh)d) levels are a risk factor for kidney disease progression, melamed. analyzed data from 13,328 participants in the national health and nutrition examination survey (nhanes) iii follow - up study, in which 25(oh)d levels were measured from 1988 through 1994, and then participants were followed for up to 12 years. the incidence of end - stage renal disease was 2.6 times greater in people whose serum 25(oh)d was less than 15 ng / ml than in those with higher levels. however, it is still not common practice among nephrologists to monitor and correct vitamin d deficiency of patients with kidney disease, because it is widely believed that the capacity of the 1 -hydroxylase to synthesize 1,25(oh)2d3 decreases progressively because of decreased renal mass and that any vitamin d deficiency associated with calcium - phosphate disturbances is better treated with activated vitamin d. although hypovitaminosis d has been reported frequently in patients with kidney disease, the prevalence of vitamin d deficiency among patients hospitalized in nephrology services is unknown. the aims of the study were to describe and compare the prevalence of vitamin d deficiency inpatients and outpatients in the nephrology department during early winter and to evaluate effect of assessing serum 25(oh)d levels and previous supplementation of cholecalciferol on vitamin d status. we undertook a retrospective audit of the serum 25(oh)d levels of inpatients and outpatients in the nephrology departments from october 15, 2010 to january 1, 2011, and previous serum 25(oh)d analysis, and previous vitamin d supplementation history of the patients. the following information was determined from the patients ' medical records : age, gender, primary underlying renal diagnosis, blood urea nitrogen (bun), serum creatinine, corrected total serum calcium, serum phosphorus, intact parathormone (ipth), serum albumin levels, recent and preceding results of serum 25(oh)d analysis, and previous documentary evidence of vitamin d supplementation. estimated gfr (egfr), using the abbreviated modification in diet in renal disease (mdrd) equation, was determined. vitamin d deficiency was defined as 25(oh)d levels below 15 ng / ml (37.4 nm / l). for subanalysis the patients were divided into four diagnostic categories according to their serum 25(oh)d levels : severe vitamin d deficiency (serum 25(oh)d3 level, less than 5 ng / ml, (12,5 nm / l)), moderate vitamin d deficiency (serum 25(oh)d3 level, 5 to 15 ng / ml (12.537.4 nm / l)), vitamin d insufficiency (serum 25(oh)d3 level, 15 to 30 ng / ml (12.537.4 nm / l)), and adequate vitamin d stores (serum 25(oh)d3 level, more than 30 ng / ml (37.4 nm / l)). the significance of difference between continuous variables was tested using unpaired t - test or mann - whitney rank sum test and for categorical variables using 2 or fisher exact test as appropriate. p values less than 0.05 were regarded as statistically significant. logistic regression analysis, binary logistic (hosmer - lemshow goodness of fit) by enter method, was studied. in the local biochemistry database we identified 25(oh)d requests in total 280 inpatients and outpatients in the nephrology department between october 15, 2010 and january 1, 2011. a total of 49 (17.5%) patients were receiving dialysis (17 (34,7%) due to acute renal failure, and all these were inpatients. the prevalence of vitamin d deficiency among these 280 patients was 62,1% (174 patients). fifty - three patients (18.9%) had severe vitamin d deficiency, 121 patients (43.2%) moderate vitamin d deficiency, and 66 patients (23.6%) vitamin d insufficiency. only 40 (14.3%) patients had adequate vitamin d stores. whereas in patients with vitamin d deficiency, age, bun, and ipth were higher, serum albumin, calcium levels were lower. there was no significant difference according to serum phosphorus, creatinine, and egfr (p > 0,05) (table 3). while in 72% of the inpatients (n : 90) serum 25(oh)d levels were less than 15 ng / ml (37.4 nm / l), in 54.2% of the outpatients (n : 86) serum 25(oh)d levels were less than 15 ng / ml (37.4 nm / l) (p 0,05). the mean duration between recent and preceding measurements of 25(oh)d levels and initiation of vitamin d supplementation was 10.3 3.6 months in female patients and 9.7 4.1 months in male patients (p > 0.05). no difference was found between males and females according to age, bun, serum albumin, calcium, phosphorus, pth, egfr, and hospitalization days (p > 0,05). serum creatinine was lower in female patients (5,3 3,3 versus 6,6 4,6 mg / dl, resp.) female gender, not having vitamin d supplementation history, low serum albumin, and low bun levels were significant independent predictors of vitamin d deficiency, while we were unable to demonstrate any relationship with vitamin d deficiency and presence of diabetes mellitus, serum creatinine, egfr, being on hemodialysis, and being hospitalized (table 4). malatya city, which gets lots of sunlight, is at a latitude of 38 : 21 north, longitude 38 : 19 east, and an altitude of 998 m. however, 62.1% of our patients had vitamin d deficiency, 23.6%vitamin d insufficiency, while 14.3% of the patients had adequate vitamin d stores. the results of a study reported a 57% prevalence of vitamin d deficiency in 290 patients hospitalized in the general medical wards at massachusetts general hospital. sixty - three percent of the patients studied in march and 49% of those studied in september had serum 25(oh)d concentrations of 15 ng / ml (37.4 nm / l) or less. these authors reported that anticonvulsant - drug therapy, renal dialysis, nephrotic syndrome, and winter season were significantly associated with hypovitaminosis d. daoudi. from belgium reported that more than 60% of 332 patients hospitalized presented with serum concentrations below the lower limit of normal (12 ng / ml, 29.9 nm / l), whereas less than 5% reached 30 ng / ml (74.9 nm / l), a level generally recommended to avoid vitamin d insufficiency. these authors reported that young patients are not at a lesser risk of vitamin d deficiency than the older patients and women showed a lesser deficiency than men. we found a higher prevalence of vitamin d deficiency in inpatients (63.9%) than those of outpatients (45.6%) in the nephrology department during early winter season (p or = 30 ng / ml (75 nmol / l). these authors reported that current k / doqi guidelines are inadequate for correcting vitamin d deficiency in ckd patients and recommended to monitor serum 25(oh)d levels regularly and to give appropriate vitamin d supplementation in order to achieve normal vitamin d status. it seems that our findings are consistent with those of qunibi. in our study during fall vitamin d deficiency was more common among women (69.3% versus 43.5%) ; even percentage of the women supplemented with cholecalciferol previously was similar to that of men. in another a cross - sectional study from turkey hatun. demonstrated that vitamin d insufficiency (43.8%) and deficiency (21%) are common among turkish adolescent girls at the end of the winter (in april). this finding is more striking in girls who wear concealing clothing, and they did not improve significantly during the summer, whereas the vitamin d status of girls in the other groups did. in turkey, the main source of vitamin d is cutaneous synthesis because there is no food fortification with vitamin d, and supplementation of vitamin d is not a routine practice. veiling or staying indoors is common in our female patients, although we did not have any information about these in this study. it is possible that these women benefited less from the decreased sunlight through the fall months than men do, possibly by exposing their skin less to the sun. firstly, this study suffers from all the limitations of retrospective observational studies that rely on existent databases, and the information was collected only at one point in time. as a conclusion, vitamin d deficiency seems to be an important problem in both inpatients and outpatients of nephrology in turkey. women are at more risk of deficiency and may therefore need to consume higher doses of the vitamin d. monitoring serum 25(oh)d levels regularly and replacement of vitamin d are important. a governmental mandate about the supplementation of foods with vitamin d | aims. kidney disease was found to be a major risk factor for vitamin d deficiency in a population study of patients hospitalized. the aims of the study were to describe the prevalence of vitamin d deficiency inpatients and outpatients in a nephrology department during fall and to evaluate effect of assessing serum 25-hydroxyvitamin d (25(oh)d) levels and previous supplementation of cholecalciferol on vitamin d status. methods. we studied 280 subjects in total, between october and january. the subjects were recruited from the following two groups : (a) inpatients and (b) outpatients in nephrology unit. we examined previous documentary evidence of vitamin d supplementation of the patients. results. the prevalence of vitamin d deficiency among these 280 patients was 62,1% (174 patients). fifty - three patients (18.9%) had severe vitamin d deficiency, 121 patients (43.2%) moderate vitamin d deficiency, and 66 patients (23.6%) vitamin d insufficiency. in logistic regression analysis female gender, not having vitamin d supplementation history, low serum albumin, and low blood urea nitrogen levels were significant independent predictors of vitamin d deficiency while no association of vitamin d deficiency with diabetes mellitus, serum creatinine, egfr, and being hospitalized was found. conclusion. vitamin d deficiency, seems to be an important problem in both inpatients and outpatients of nephrology. monitoring serum 25(oh)d concentrations regularly and replacement of vitamin d are important. women in turkey are at more risk of deficiency and may therefore need to consume higher doses of vitamin d. |
notwithstanding the astonishing discrepancies among the orr activities reported from different laboratories and typically attributed to experimental protocols, electrode conditioning, and current - potential curves corrections, the rde technique together with the rdde one seems to be the method most used by the electrochemists to characterize orr electrocatalysts. the reasons are simplicity and speed of the measurements as well as commercial availability and low cost of all the required facilities. for this specific electroanalytic application, poly - pt can be considered as a standard electrode that, notwithstanding the intrinsically poorly defined nature of a polycrystalline surface, exhibits a very robust and reproducible electrochemical response. moreover, since standardized disks of poly - pt are commercially available at convenient costs, their use as benchmark electrodes for the orr electrocatalytic studies seems appropriate. at present, orr at pt rde electrodes of different forms (wires, gauzes, foils, and disks of different areas) has been widely investigated in acid solution [13 ], due to their relevance in polymer electrolyte fuel cells. on the contrary marginal attention has been paid to pure pt in alkaline solutions (single crystal pt [5, 6 ], poly - pt particles, poly - pt wire, poly - pt thin film [911 ], and poly - pt rod [6, 1214 ]) despite the fact that orr plays a key role in the chlor - alkali technology and in metal - air batteries [15, 16 ]. due to the absence of an interlaboratory benchmark material in alkaline solution and the discrepancies in the few data available at the moment [6, 1214 ], we have realized an intralaboratory poly - pt benchmark against which the data gathered with novel ones can be safely gauged. limited interest for pt as orr electrocatalyst in alkaline solution is probably justified by high costs, less aggressive chemical conditions, and lower catalytic activity and efficiency due to ho2 generation. for these reasons, research in alkaline orr has been centred on catalysts featuring nonnoble metals such as palladium, ruthenium, iron [21, 22 ], nickel and cobalt mainly in the form of spinels [2326 ], perovskites [27, 28 ], and manganese oxides [14, 2936 ]. in particular, mnox are the most studied systems for applications in metal / air batteries [16, 37, 38 ] owing to their low cost, adequate electrochemical stability, and good catalytic activity towards the decomposition of ho2 species produced by the orr 2e pathway in alkaline solution [30, 31 ]. one of the main limits of mnox - based orr electrocatalysts is their poor electrical conductivity : to overcome this problem commercial air cathodes have to be fabricated by combining oxides with conducting materials, mainly carbon nanoparticles. among other approaches favouring electronic contact to mnox, the dispersion of metal oxide particles in a polypyrrole (ppy) matrix is also appealing for a series of physicochemical reasons, detailed in [4043 ]. among mn / ppy fabrication routes, electrodeposition offers the possibility of forming directly mn particles into the polymer layer [44, 45 ] or of entrapping metal complexes that yield metal particles during a subsequent reduction step. the first studies that have demonstrated the possibility of increasing the mixed oxide conductivity by using ppy also showed that the deposition of alternating layers of ppy and mncu or nicu oxide spinel particles protects the catalytic sites against dissolution during orr operation. recently, an alternative facile synthesis of composite metal oxide / ppy electrocatalysts has been proposed, based on one - pot electrodeposition onto conductive substrates [4752 ]. in this paper we have focused on the quantitative and reproducible assessment of the orr activity of electrodeposited mn / ppy nanocomposites in aqueous alkaline ambient, by using poly - pt electrodes as intralaboratory benchmark material. the electrocatalytic results are complemented by a morphological and structural characterization of our materials by fe - sem, afm, conductivity - probe spm, and raman spectroscopy. the mn / ppy electrodeposition bath contains the following : 0.1 m pyrrole, 25 mm mncl2, 0.1 m tetrabutyl - ammonium - perchlorate (tbap), and 1% v / v h2o dissolved in acetonitrile. acetonitrile, mncl24h2o, pyrrole, and tbap were supplied by aldrich. before each ppy electrodeposition experiment, the pyrrole monomer was distilled under rotary pump vacuum several times (typically three) until it becomes colourless. all the solutions were prepared with ultrapure water from a milli - q system (millipore, vimodrone (mi), italy), exhibiting a resistivity of 18.2 m cm. polycrystalline - pt (poly - pt) rod was mechanically polished with different grades of grit paper, down to 0.05 m diamond paste, and then accurately rinsed with double - distilled water. to guarantee an initial reproducible surface, the working electrode was held for 5 s at 1.40 v / rhe, a potential which a full coverage of platinum surface by o - containing species is attained to, followed by an electroreduction step to 1.13 v / rhe for 1 min. the surface of the graphite (g) was treated according to the following procedure : (i) polishing to mirror finish ; (ii) 10 min ultrasonication (us) in ultrapure h2o ; (iii) repolishing to mirror finish ; (iv) 10 min us in acetone us ; and (v) 10 min us in ultrapure h2o. electrochemical synthesis was performed using a three - electrode cell with a graphite disk (= 1.35 mm), as working electrode (we), a pt wire as counter electrode (ce), and an aqueous silver / silver chloride (ag / agcl/3 m : 0.209 v / nhe) as reference electrode (re). electrodeposition was carried out with the pulsed potential procedure described in previous works [47, 48, 50, 51 ] optimized in view of growing a composite consisting of two constituents that are formed anodically (ppy and mn(iii, iv) compounds) and cathodically (mn(0) and/or precipitated mn(ii) containing species). the initial step (0.971 v / rhe) does not lead to faradaic reactions, but it is required to relax the compositional double layer. after this relaxation step, a layer of ppy is electrodeposited during the first anodic pulse (2.17 v). during the subsequent cathodic pulse (0.829 v), reduced mn(0) or precipitated mn(ii) species can be incorporated into ppy. in the final anodic step of each cycle (2.17 v), another layer of possibly mn - doped ppy is deposited. after electrochemical synthesis, the films were rinsed with pure acetone and dried at room temperature. the morphology of mn / ppy catalyst electrodeposited onto graphite discs was investigated by field - emission scanning electron microscopy (fe - sem) using an nvision 40 zeiss, equipped with a high resolution gemini field - emission gun and with an oxford inca 350 xact energy dispersive x - ray (edx) spectrometer. details about the morphological features at the nanoscale and quantitative analysis of roughness and surface area were obtained with a nanoscope iii multimode atomic force microscope (afm) (bruker) in air using the scanasyst mode and the scanasyst probe (bruker). on each sample 5 different square areas of sizes 1, 5, and 20 m were scanned at rates of 0.7 and 1.5 hz. the electrical conductivity of the sample was mapped by the peakforce tuna module (bruker) using a pt / ir probe (pf - tuna 0.4 n / m, bruker). afm image analysis was carried out with the nanoscope analysis 1.5 program (bruker). a 10x long - working distance objective was used and the excitation line at 632.8 nm was provided by a 12 mw he - ne laser. the slit and pinhole were set at 200 and 400 m, respectively, corresponding to a scattering volume of ~3 pl ; raman spectra were acquired with a 600 grid / mm spectrometer. the recorded raman intensities are directly proportional to the discharge current of the ccd detector. oxygen reduction reaction (orr) linear sweep voltammetries (lsv) on mn - ppy / c electrodes were recorded to evaluate the catalytic activity in an o2-saturated (siad 6.0) 0.1 m koh electrolyte at quasi - steady - state (5 mv s) at different rotating disk electrode (rde) rotation speeds. graphite disks with mn / ppy electrodeposit were mounted in a rotating disk electrode system (parstat model 2273, photo analytical s.r.l., settala (mi), italy). the same electrochemical experiments were duplicated with solutions that had been deoxygenated by n2 saturation. the current densities are referred to the electrode geometric area (1.326 cm). o2 was bubbled for 20 min into the solution before the measurements and an o2 blanket was kept above the electrolyte during the measurement. in order to minimize disturbing effects of bubbles during the experiments, the electrolyte saturation has been performed at open circuit for 20 min and the pipette allowing gas into the solution was raised during the rde measurement leaving a gas blanket over the solution. special care was taken to avoid contingent ambient air suction into the analysis compartment caused by the electrode rotation. the orr levich slopes were estimated from current - voltage curves which the n2-background had been subtracted from. as it is well known from the literature, rde is an electrochemical technique based on controlled electrolyte convection, leading to a well characterized fluid velocity distribution on the working electrode, provided that appropriate boundary conditions are implemented in cell and electrode mounting as well as in the real shaft rotation process. in the rde method a discoidal electrode (e.g., glassy carbon or platinum), embedded in a rod of an insulating material (e.g., glass or teflon), connected to a motor, rotates at a certain frequency f = /2, where is the angular velocity (figures 1(a) and 1(b)). the rde technique operates on the principle of controllable stationary limiting currents, where the diffusion layer at the electrode maintains its thickness constant over time. to this end, the effective electrode surface and the scan rate are kept to values in correspondence of which double - layer charging produces a vanishing current. under these hypotheses, the mass transfer process can be described with simple equations that allow correlating the experimental parameters to the mass transfer of reactants to the electrode surface. when an electrode is rotated, mass transfer of reactants and products is governed by convective - diffusion mechanisms. at the rde the hydrodynamic flow pattern results from centrifugal forces that move the liquid horizontally out and away from the centre of the disk (figure 1(c)) while fresh solution continually replaces it by a flow normal to the electrode surface (figure 1(a)). of course, for these condition to hold true, a set of conditions have to be met, the details of which are provided, for example, in. the convective - diffusion equations imply the existence of a diffusion layer of quiescent electrolyte on the electrode surface, within which mass transfer takes place only by diffusion. outside this layer of thickness, the convection maintains the concentrations of all species uniform and equal to the bulk values (figure 1(d)). according to this model, by introducing the adjustable parameter, the convection problem is formally treated as a diffusional one. o2 diffusion to the catalyst surface may thus be modelled as illustrated in figure 1(d) : o2 diffuses through the boundary layer () in the electrolyte solution yielding a controlled o2 flux / limiting current. in the relevant geometry the steady - state convective - diffusion equation with mass - transport controlled source term can be solved analytically, yielding the koutecky levich (k l) equations : (1)1j=1jl+1jk=1b+1jk,(2)b=0.62nfcodo2/3v1/6,where jk is the kinetic current density ; jl the diffusion limiting current density ; j the measured current density ; b the reciprocal of the slope ; the angular velocity of the disk ; f the faraday constant ; c0 the saturation concentration of o2 in 0.1 m koh at room temperature (1.2 10 mol cm) ; d0 the diffusion coefficient of oxygen in water (1.73 10 cm s) ; v the kinematic viscosity of the solution at room temperature (0.01 cm s) ; and n the electron transfer number. the literature survey on orr at poly - pt electrode in alkaline solution using the rde methodology is limited and not consistent [6, 1214 ] ; therefore a definite comparison between the new developed mn - ppy material and the state - of - the - art electrocatalysts is not allowed. as a consequence, we have worked to obtain an intralaboratory benchmark (poly - pt rod) not aiming at proposing a standard rde curve usable as reference for general activity of poly - pt (to do that a dedicated work of analysis on the different parameters affecting the orr activity is necessary, together with interlaboratory testing ; this kind of work is actually a challenge especially in alkaline solution) but only at acquiring an internal reference on the basis of which our novel data can be safely evaluated. in section 3.1.2 's (1) and (2) the effects of (i) the distance (s) between the catalytic surface and the electrolyte - free surface and (ii) the initial features of the catalyst surface on the reliability and reproducibility of the orr measurements at rde are discussed. other experimental issues, such as glassware electrolyte impurity levels and uncompensated electrolyte resistance, slightly affect the results with errors less than the 2%, while dirty sliding electric contact of the rotator is responsible for a strong increase in the signal - to - noise ratio of the lsv curve (figure 2(a), red curves). the electrochemical cell design significantly affects the hydrodynamic conditions of the electrolyte that must satisfy the above mentioned conditions (section 3.1.1) to allow quantitative analysis according to the levich equation. the cell and experimental conditions must be therefore designed so that the solution flow within the cell becomes laminar. in this work, we report a detailed cell design (see the scheme reported in figure 1(a)) associated with the rde voltammetric curves of orr at poly - pt and mn / ppy catalysts in 0.1 m koh. in our experiments, we have evidenced that the determination of the distance (s) between the catalytic surface and the electrolyte - free surface (i.e., the electrolyte volume) radically improves the quality of rde voltammetries due to achieved laminar flow at the reacting electrode surface. the optimal s value was determined by experimental calibration and found to be 30 mm, corresponding to a volume of the electrolyte of 80 ml (figure 2(a)). in figure 2(b) it can be observed that the effect of s on the lsv curve is to modify (i) the butler - volmer behaviour under mixed kinetic control in the intermediate potential region and (ii) the curve repeatability. in table 1 the scatter of current density values (standard deviation) obtained from repeated measurements at the same rotation rates is shown. low s values find out a low reproducibility because, due to the turbulence effects, the diffusion limited conditions are neither constant nor controllable during the potential scan. as a consequence, it is well known that the state and coverage of oxygen - containing species on platinum are a crucial factor in determining the electrocatalytic activity of platinum surfaces towards o2 reduction. for this reason, the reproducibility of the initial surface of poly - pt was assured by holding the electrode for 5 s at 1.40 v / rhe, a potential which a full coverage of platinum surface by o - containing species is attained at, followed by an electroreduction step at 1.13 v / rhe for 1 min. the effect of this pretreatment reported in figure 2(a) (blue curves) is to shift the onset and half - wave potential to more positive values. at low overpotentials the surface of untreated pt is covered of oxygen intermediates strongly bonded with pt that affect the activation energy of the orr process, hindering the proton and electron transfer, while at high overpotentials their influence becomes negligible because the stability of the oxygen bond decreases and the orr may proceed (the two curves overlap). the surface initial conditions of mn / ppy electrocatalyst are strictly related to the morphochemical goodness of the electrodeposit ; this aspect is thoroughly discussed in section 3.3 where the morphological and molecular structure of mn / ppy materials has been characterized by fe - sem, afm, conductivity - probe spm, and raman spectroscopy in view of orr performance evaluation. poly - pt rod has been used as intralaboratory benchmark material in alkaline solution for the study of orr at mn - ppy / g catalyst. the electrode (figure 1(b)) has been pretreated using the protocol described in section 3.1.2.(2). in figure 3(a) we report orr quasi - steady - state voltammograms of poly - pt rod at a scan rate of 5 mv s in o2-saturated 0.1 koh aqueous solutions at different rde rotation speeds. stable and reproducible voltammograms were obtained following the experimental details discussed in section 3.1. at low overpotentials (00.2 v / rhe) the curves are independent of the rotation speed,, being the electrode kinetics governed by the charge transfer. at higher overpotentials instead, the increase of current density with potential becomes slower, as expected for an electrochemical reaction under mixed control, until the mass - transport kinetic contributions become significant and determine the appearance of a current plateau, which thus strongly depends on. sometimes a slight hump at 0.20 v is observed and presumably attributed to h - adatom adsorption on platinum. in agreement with the levich equation (see (2)) the height of this plateau increases linearly with the square root of as shown in figure 3(b). the slopes of the linear fit lines to the experimental levich plots were used to estimate n according to (1) in a range of electrode potentials that are representative of practical electrocatalytic operation and reported in figure 3(c). n values, averaged in the potential range 0.6 0.1, were found to be 3.79 0.09, suggesting the prevalence of orr four - electron mechanism typical of platinum. the charge - transfer kinetic is shown in the tafel plots of figure 3(d), where orr kinetic current ik is estimated according to 1/i = 1/il + 1/ik (il : limiting current density). the tafel slope is approximately 60 mv dec in agreement with literature for pt under alkaline conditions (0.16.0 m koh) in the low overpotential region [1013, 56 ]. this value, close to 2.303rt/f 60 mv / dec (where r is the molar gas constant, t the absolute temperature, the transfer coefficient, and f the faraday constant) at room temperature [57, 58 ], indicates that the transfer of the first electron catalysed by pt is probably the rate - determining step. the morphological, compositional, and chemical - state distribution of the as - deposited mn / ppy material, using the same electrodeposition procedure employed for this investigation, has been studied in detail by soft x - ray fluorescence (xrf) mapping and microabsorption spectroscopy (micro - xas) in a previous paper of ours. this analysis disclosed a rather homogeneous mn spatial distribution that is consistent in a rather wide range of current densities, while micro - xas has revealed that the potentiostatic pulsed codeposition process alternating anodic and cathodic polarization intervals leads to a ppy deposit containing manganese (ii, iii, iv) oxyhydroxides and traces of mn(0). a granular morphology was found in all the analyzed regions, with colocation of mn, n, and o, denoting the fact that mnox and polypyrrole act as nucleation centres for material electrodeposited in both the anodic and cathodic pulses. this is in agreement with the classical nucleation and growth mechanism for electrodeposition by pulse - plating. in this paper, we have assessed the morphological structure of the g substrate, of a pure ppy deposit after 60 electrodeposition cycles (ppy60/g), mn / ppy after 60 cycles (mn - ppy60/g), and mn / ppy after 240 cycles (mn - ppy240/g). fe - sem analysis has been used to assess the distribution of the deposit over the whole electrode area. figure 4 reports the in - plane morphology at low magnification of the g, ppy / g, and mn - ppy240/g samples. the g substrate, treated as specified in section 2.1, shows a highly structured morphology with a high surface area (figure 4(a)) ; the electropolymerization of ppy leads to a film covering uniformly the g electrode (figure 4(b)) while a uniform distribution of mn - containing nanoparticles is disclosed after electrodeposition of mn / ppy (figures 4(c) and 4(d)). the presence of mn has been positively assessed by edx analysis, a typical spectrum is shown in figure 4(e). afm analysis has been used to obtain quantitative morphological information on the surface : average grains size (rq), average roughness (ra), and the real surface area (data summarized in table 1). figure 5 reports afm height images of g substrate and of the following electrodeposits : ppy60/g, mn - ppy60/g, and mn - ppy240/g. the afm images of graphite substrate confirm the presence of a highly structured morphology and provide quantitative information on the roughness and surface area (table 2). the electrodeposition of ppy for 60 cycles to cover the graphite surface with a closely packed population of globules having a mean diameter of 21 5 nm : a concomitant reduction of the surface area by ca. the ppy globular structure shown in figure 5(a) is typical for ppy thicknesses below 1 m, such as in our sample, the mean thickness of which () has been estimated to be 0.9 m (in good agreement with literature) from the electrical charge (q) associated with pyrrole oxidation by application of faraday 's law and assuming 100% current efficiency for polypyrrole formation according to = qm / pazf, where m is the molar mass of the repetitive unit (67.09 g mol), f the faraday constant (96,500 c mol), q the electrical charge, a the working electrode area (1.326 cm), p the density of the polymer (1.5 g cm), and z the electron loss (2.25) [62, 63 ]. by adding mn ions to the pyrrole - containing electrolyte and using the same number of electrodeposition cycles (60), the electrodeposition process is no longer able to produce a polymer film covering homogeneously the whole electrode surface. the afm height images of the mn - ppy60/g show that the surface is irregular with some uncovered areas and a roughness value that is intermediate between those of g and ppy60/g (table 2). of course, the morphology and metal distribution of mn / ppy composites are affected by a wide range of parameters in a complex way, such as the electronic conductivity of ppy, doping degree, polymer porosity, metal ion transport within the ppy network structure, and chemical interactions between metal ions and their complexes with the polymer. this is chiefly instanced by the spread in rq values shown in table 2, since this parameter is the most sensitive to the presence of peaks and valleys among the selected morphology indicators. the morphology of electrodeposited mn / ppy films improves by increasing the number of cycles to 240 : in fact sample mn - py240/g is notably more compact and uniform coherently with sem analysis (figures 4(c) and 4(d)). in the afm height images of figure 4(c) the comparison between the samples mn - ppy60/g and mn - ppy240/g can be better appreciated at low magnification (20 20 m). the thicker sample shows the presence of particles with diameters of 120 81 nm, uniformly distributed over the whole surface. it is worth noting that the surface area of mn - ppy240/g and that of the film - covered areas of mn - ppy60/g are similar. the quality of the mn - ppy240/g deposit is coherent with the superior orr performance, discussed in section 3.4. figure 6 shows typical topography (a) and current (b) images obtained simultaneously from the surface of the mn - ppy240/g film. the current image clearly shows that the nanocomposite exhibits heterogeneous surface conductivity. by comparing figures 6(a) and 6(b) one can straightforwardly conclude that the top regions of the particles are not conductive while current preferentially flows at the border of the particles. this finding suggests that the grain can be composed of poorly conductive manganese oxides, with ppy in the reduced state, coherently with xrf mapping and micro - xas analysis as well as raman spectroscopy (see next section). moreover, our results are in keeping with a previous study, showing that the top of ppy globules is preferentially reduced during electrodeposition. micro - raman spectroscopy has been employed to characterize the ppy60/g, mn - ppy60/g, and mn - ppy240/g samples. in figure 7(a) the raman spectra of all ppy - containing samples display the typical prominent ppy bands. two of the three characteristic bands associated with the reduced / undoped (994, 1052 cm) and to the oxidized / doped form (938, 1090 cm) of ppy can also be appreciated. the other bands at 1564 cm (reduced) and 1612 cm (oxidized) are overwhelmed by the graphite signal. as is well documented in literature, the oxidation / reduction processes of ppy involve the fully reduced state (pp), the oxidized state bipolaron (pp) and the intermediate oxidized state polaron (ppy) according to ppyppyppy. the bands located at about 994 and 938 cm belong to ring deformations associated with bipolaron (dication) and polaron (radical cation), respectively [65, 66 ], while the two peaks revealed at about 1090 and 1052 cm can be attributed to the n h in - plane deformation of oxidized and reduced polypyrrole state. in the composite mn / ppy samples some peaks appear in the range 100800 cm and become more intense in the thicker sample, where the raman signal increases presumably due to the sers effect discussed in. according to the literature, the bands in the range 200500 cm(see also figure 7(b)) can be attributed to the mn o mn bending mode in the mno2 lattice and those in the range 500700 cm to the mn o stretching of octahedral mno6 groups [6871 ]. the main band at 692 cm is typically attributed to mn2o3, while the 625 cm feature is reported as the main band of -mno2 and the one at 143 cm the concomitant presence of the four features at 315, 368, 499, and 656 cm is usually ascribed to mn3o4 [71, 72 ], but some of these bands can also appear in mno2 [71, 73 ], mn2o3, or mno [72, 74 ]. even though the positions of raman bands alone are not enough to support a conclusive speciation of mn oxides not only owing to the intrinsic complexity of these vibrational spectra but also owing to inconsistent literature in the field [75, 76 ], our raman results, in combination with previous micro - xas data, definitively prove that the electrodeposition process yields a mixture of mn(ii, iii, iv) oxides. the orr electrocatalytic activity of the g substrate and that of electrodeposited ppy / g and mn - ppy / g films have been evaluated through rde measurements at different rotation speeds in 0.1 m koh solution (figures 8 and 9). the rde steady - state voltammograms shown in figures 8(a)8(c) and 9(a) have been replicated three times at every rotation speed to check the electrode stability. in order to evaluate the catalytic efficiency comprehensively, electrocatalytic figures of merit have been estimated from rde polarization curves obtained at 1600 rpm. the g substrate shows the two typical orr waves reported for graphite in alkaline conditions. in particular, the rde polarization curve reported in for bare graphite in an o2-saturated 0.1 m koh solution at 1600 rpm fits very well with our curve reported in figure 8(a). levich plots (figure 8(d)) at different electrode potentials display good linearity and the slopes are constant over the potential range from 0 to 0.9 v / rhe, providing an electron transfer number around 2.3, independent of potential. this finding suggests that orr on graphite in alkaline solution proceeds principally by the two - electron transfer to give peroxide ions and that no further reduction of ho2 occurs, as generally accepted in literature [77, 79 ]. the current density in the lsv curves shown in figure 8(a) has been calculated considering the geometric area of the graphite electrode ; we have not considered the effective surface area estimated by afm (table 2) because for orr electrocatalysts the impact of pore diameter can be more important than that of surface area since micropores can be inactive. the rde curves recorded with ppy60/g and mn - ppy60/g electrodes show a double wave structure that is less pronounced than the one observed with the bare graphite electrode (figures 8(b), 8(c), and 9(a)). with the increasing of the rotation speed, the diffusion limited current plateau becomes inclined and this slope increases. this behaviour is quite common in the literature for carbon - based catalysts (pyrolyzed mn, co, fe / ppy, ag mno2, pyrolyzed fe(iii)-tetramethoxyphenyl porphyrin, pyrolyzed cobalt and iron phthalocyanine, and n - doped carbon nanotubes) and has been attributed to the a heterogeneous distribution of the active sites on the surface catalyst [86, 87 ]. the orr performance of our ppy60/g film is superior to that of ppy prepared by a polymerization process via chemical oxidation with fecl3 : both the onset (eonset) and half - wave (e1/2) potentials shift to more positive values, from 0.72 to 0.85 v / rhe and from 0.34 to 0.69 v / rhe, respectively. moreover, the current density at 0.5 v / rhe increases from 1.8 to 2.2 ma cm. l results (n = 2.74, table 2) suggest that the o2 reduction at ppy60/g follows a combination of 2e (reduction of o2 to ho2) and 4e (o2 is directly reduced to oh) reactions. coherently with the rather heterogeneous morphology observed by afm (section 3.3.1 's (2)), the orr performance of the mn - ppy60/g catalyst is not significantly improved with respect to that of the mn - free ppy60/g sample and the number of exchanged electron returns to a value of 2.25, similar to that of graphite, while the current density decreases notably (table 2). the rde analyses conducted on the mn - ppy240/g sample, exhibiting the best morphology, are reported in figure 9. the koutecky levich plots and the correspondent n values at selected potentials (figures 9(b) and 9(c)) indicate that 4e oxygen reduction process is favoured similarly to poly - pt electrode in the same ambient. in addition, eonset and e1/2 potentials increase with respect to all the other samples reaching values very similar to poly - pt (table 3) and carbon / ppy materials. on the contrary, the current density of the mn - ppy240/g sample in the whole potential range analyzed is lower with respect to the benchmark poly - pt. the expected lower catalytic activity of mn / ppy with respect to poly - pt is also evidenced in the tafel plots of figures 3(d) (poly - pt) and 8(d) (mn - ppy240/g). 122 mv dec, notably higher than that found for ploy - pt : ca. 50 mv dec, and suggests an electron transfer mechanism with adsorption molecular oxygen as the rate - determining step. these values are in agreement with the literature, reporting values close to 120 mv dec for mn oxides (114 mv dec for -mno2/c, 120 mv dec for high mnxoy load / c). poly - pt has been characterized as intralaboratory benchmark material for the assessment of the orr electrocatalytic activity of mn / polypyrrole nanocomposites based on rde measurements. accurate electrocatalytic data of mn / ppy film complemented with structural and morphological characterizations (fe - sem, afm, and raman)have been used to disentangle intrinsic electroactivity factors from surface coverage effects and have allowed optimizing the electrodeposition process parameters in view of global electrocatalytic activity. in particular, mn / ppy grown with 240 electrodeposition cycles leads to the formation of continuous film catalytic particles ca. afm pf - tuna current imaging shows that the top region of these particles probably consisting of mnox and reduced ppy are poorly conductive and that the current preferentially flows at their border, where owing to the prevailing current density distribution these results are coherent with previous xrf mapping and micro - xas analysis and with raman spectroscopy results reported in this paper that confirm the presence of the characteristic bands associated with the reduced / undoped and with the oxidized / doped form of ppy and of mn(ii, iii, iv)ox. high - quality mn / ppy electrodeposits exhibit a superior electrocatalytic activity due to higher four - electron - transfer selectivity for the orr in alkaline solution, with respect to materials of the same chemistry grown suboptimal electrodeposition parameters. moreover, optimized mn / ppy exhibits electrocatalytic figures of merit such as eonset and e1/2 potentials that are similar to those of poly - pt, even though at lower nominal current densities. | this paper reports on the quantitative assessment of the oxygen reduction reaction (orr) electrocatalytic activity of electrodeposited mn / polypyrrole (ppy) nanocomposites for alkaline aqueous solutions, based on the rotating disk electrode (rde) method and accompanied by structural characterizations relevant to the establishment of structure - function relationships. the characterization of mn / ppy films is addressed to the following : (i) morphology, as assessed by field - emission scanning electron microscopy (fe - sem) and atomic force microscope (afm) ; (ii) local electrical conductivity, as measured by scanning probe microscopy (spm) ; and (iii) molecular structure, accessed by raman spectroscopy ; these data provide the background against which the electrocatalytic activity can be rationalised. for comparison, the properties of mn / ppy are gauged against those of graphite, ppy, and polycrystalline - pt (poly - pt). due to the literature lack of accepted protocols for precise catalytic activity measurement at poly - pt electrode in alkaline solution using the rde methodology, we have also worked on the obtainment of an intralaboratory benchmark by evidencing some of the time - consuming parameters which drastically affect the reliability and repeatability of the measurement. |
gastrointestinal stromal tumors (gists) are well recognized nonepithelial neoplasms of the gastrointestinal tract (gi). after decades of ultra structural, immunohistochemical, and genetic studies, it is now evident that most gists are believed to differentiate from cajal (iccs) pacemaker cells. the cajal pacemaker cells are involved in gastrointestinal tract mobility and regulation of autonomous neuronal transmission. other common sites include the jejunum and ileum (30%), duodenum (5%), colon and rectum (5%), and the esophagus (5%). only seven gallbladder gists have ever been reported, and of these, four were malignant [39 ]. these malignant gallbladder gists were all positive for cd 117 (c - kit) and cd34 or cd117 alone [47 ]. we report a unique gallbladder gist which is negative for cd 117 and cd 34 but positive for platelet - derived growth factor receptor alpha (pdgfra). apart from the extremely rare site of occurrence, gist of the gallbladder remains a challenging topic and needs to be examined on the basis of histologic findings, clinical history, and molecular profile with the later having significant impact on the treatment strategy. a 72-year - old woman was admitted to the first department of surgery, university of athens with symptoms suggestive of obstructive jaundice : fever and chills, dark urine, intermittent right upper quadrant (ruq) abdominal pain, and jaundice. initial investigations showed a white cell count (wcc) of 11,556 cells / mm, total bilirubin / direct bilirubin (tbil / dbil) of 4.80/3.60 mg / dl, alkaline phosphatase (alp) 440 iu / l, and -glutamyl transpeptidase (-gtp) 210 iu / l. ultrasound demonstrated a thickened gallbladder wall, bile stones, and moderate common bile duct (cbd) dilatation. bile duct lithiasis was suspected and an endoscopic retrograde cholangiopancreatography (ercp) was performed. this demonstrated an almost complete obstruction at the level of the cystic duct and common hepatic duct confluence. however, the underlying pathology could not be identified, and an exploratory laparotomy was decided. the mass was adherent to the duodenum involving the confluence of the cystic duct with the common hepatic duct and the retroduodenal part of the common bile duct. the common bile duct and common hepatic were excised en bloc with the specimen ensuring free surgical margins along the extrahepatic billiary tree. lymph node dissection was performed of the hepatoduodenal ligament, the hepatic artery lymph nodes, and the retropancreatic lymph nodes. the enteric - billiary continuity was established through a retrocolic roux - en - y hepatico - jejunostomy. the postoperative course was uneventful, and the patient was discharged ten days after operation. in the pathological review, the gallbladder was dilated and measured 7.5 cm 3.5 cm in size. within the gallbladder, there was a wide mass covering the entire wall, neck, and body, while the remainder of the mucosal layer was ulcerated. microscopically, tumor cells infiltrated the muscle layer were spindle shaped in nature, arranged in a short fascicle pattern and immunopositive for pdgfra (figures 1(a) and 1(b)). the cells demonstrated hypercromatic nuclei, severe pleomorphism and an increased mitotic rate of up to 50 mitosis/50 high power field (hpf). genomic dna isolationten m sections were cut from the paraffin - embedded tissue block and treated with xylene / ethanol. the samples were digested overnight at 37c using proteinase k. dna was extracted with phenol - chloroform, precipitated in ice - cold ethanol, redissolved in distilled water, and quantitated using a picodrop microliter spectrophotometer. ten m sections were cut from the paraffin - embedded tissue block and treated with xylene / ethanol. the samples were digested overnight at 37c using proteinase k. dna was extracted with phenol - chloroform, precipitated in ice - cold ethanol, redissolved in distilled water, and quantitated using a picodrop microliter spectrophotometer. high - resolution melting analysisfor the detection of c - kit exon 9, 11, 13, and 17 mutations as well as pdgfra mutations in exons 12 and 18, a real - time polymerase chain reaction approach followed by high - resolution melting curve analysis has proved to be a rapid, highly sensitive, and efficient screening method. pcr and hrm were consecutively performed on a lightcycler 480 (roche diagnostics, gmbh, germany) in one single run, and all reactions were repeated twice. each reaction consisted of 20 ng of dna, 200 nmol / l of each primer, 10 l of lightcycler lc480 high resolution melting master (roche), 3.5 mm mgcl2 and pcr - grade water adjusted to a total volume of 20 l. for the detection of c - kit exon 9, 11, 13, and 17 mutations as well as pdgfra mutations in exons 12 and 18, a real - time polymerase chain reaction approach followed by high - resolution melting curve analysis pcr and hrm were consecutively performed on a lightcycler 480 (roche diagnostics, gmbh, germany) in one single run, and all reactions were repeated twice. each reaction consisted of 20 ng of dna, 200 nmol / l of each primer, 10 l of lightcycler lc480 high resolution melting master (roche), 3.5 mm mgcl2 and pcr - grade water adjusted to a total volume of 20 l. sequencingpcr products with an abnormal hrm pattern were sequenced using the big dye terminator cycle sequencing kit (applied biosystems, california, usa). the sequencing products were analysed on an abi prism 310 genetic analyzer (applied biosystems). pcr products with an abnormal hrm pattern were sequenced using the big dye terminator cycle sequencing kit (applied biosystems, california, usa). the sequencing products were analysed on an abi prism 310 genetic analyzer (applied biosystems). the specimen was analysed for the presence of activating mutations in exons 9, 11, 13, and 17 of c - kit gene as well as exons 12 and 18 of pdgfra gene by performing high resolution melting analysis and sequencing. a mutation at codon 824 coding for valine in exon 18 of pdgfra gene was detected by high - resolution melting analysis (hrm) and was further confirmed by sequencing as c. 2472 c > this silent mutation has previously been described in 2 tumors from the central nervous system (gliosarcomas) as well as in soft - tissue tumors (gists). results were verified by a second independent pcr reaction and hrm analysis followed by sequencing. an estimated five - to - six thousand new cases of gist are diagnosed annually with 10% to 30% of these being malignant. most tumors are sporadic, affecting individuals in their 5th or 6th decade with some evidence indicating a male predominance. gists can also present earlier and this is often seen in one of the rare gist syndromes, which include neurofibromatosis type 1 (nf1), the carney - stratakis dyad and familial gist syndrome. these tumors may occur anywhere in the gastrointestinal tract but most commonly present in the stomach and small intestine. they can also occur in the surrounding structures such as the peritoneum, omentum, liver, pancreas, ovaries, and uterus. many gists are asymptomatic and are discovered incidentally ; however, over half of gastric gists present with signs of gi bleeding and anaemia with a smaller proportion presenting with abdominal pain or as an abdominal mass. histology can often be varied, but gists are broadly divided into spindle, epithelioid, or mixed cell types. in general, the risk of malignancy is greater in epithelioid tumors than in spindle - celled neoplasms [11, 12 ]. with the advent of immunohistology, previously, sarcomas, undifferentiated carcinomas, and melanomas would have featured heavily in the differential diagnosis ; however, these can largely be excluded with identification or absence of specific immunohistochemical markers. the three most well - described immunohistochemical markers in gists are cd117 (c - kit), pdgfra, and cd34 [13, 14 ]. kit is positive in over 95% of gists and only 58% of tumors are kit negative and pdgfra positive. cd34 is a less sensitve marker for gists but is reported in up to 6070% of the tumors. miettinen and lasota who have carried out the largest ever studies on gists define these tumors as generally kit - positive and kit or pdgfra mutation - driven mesenchymal tumors of the gi tract with a set of characteristic histologic features including spindle cell, epithelioid, and rarely pleomorphic morphology. we present the case of a malignant gist of the gallbladder which demonstrated spindle cell morphology and was pdgfra positive and kit negative. there have been a small number of gallbladder gists described in the literature, of which only four were malignant and all were kit positive. to our knowledge the significance of the kit negative genotype has implications on the response to further management. the identification of specific cellular markers has led to the development of effective targeted agents, namely, tyrosine kinase inhibitor (tki) therapy (e.g., imatinib). most kit positive tumors are sensitive to imatinib ; however, the majority (80%) of pdgfra mutations are resistant to treatment. primary gists, as in the case here, have the potential for curative treatment with surgical resection. overall 5-year survival rates for resectable gists have been shown to range from 46% to 78.5% ; however, predicting the recurrence rate of primary resectable gists has been very challenging [17, 18 ]. the survival rates from the reported gall bladder gists are mixed with only short - term followup noted in some of the cases. although the mutation status is important, the current most important prognostic factor for gists is tumor size, mitotic count, and tumor location. this scheme has evolved from studies initially outlined by the national institute of health (nih) and were greatly expanded on by the work of miettinen and lasota [13, 14 ]. the patient in this case had a very large tumor, with 50 mitosis/50 hpf, and was located in the gallbladder. the first two findings alone place this gist in the high - risk group for recurrence. this is likely compounded by the kit negative immunohistology which would potentially reduce the benefit of tyrosine kinase inhibitors treatment. it is important to mention that the immunohistochemical examination does not provide information on the exon affected on the type of mutation both of which may be prognostically important. this paper, presents a very unique case of gist, located in the gallbladder, negative for kit, and positive for pdgfra. apart from this being a previously undocumented case, it highlights the challenges in establishing the diagnosis, prognosis, and most effective management for this unpredictable tumour. | gastrointestinal stromal tumors (gists) compose the largest category of well - recognized nonepithelial neoplasms of the gastrointestinal tract (gi). gists of the gallbladder are extremely rare tumors. only four malignant, two benign and one gist - like tumor of the gall bladder have ever been described. the four malignant gists were all positive for cd 117 antigen (c - kit). we present for the first time a malignant gastrointestinal stromal tumor of the gallbladder, immunoreactive for platelet - derived growth factor receptor alpha (pdgfra) and negative for cd 117 antigen (c - kit). |
post activation potentiation (pap) is a method used to increase the explosive strength of a contractile activity in order to naturally increase physical capabilities in the acute phase1. the stimulus results in two opposing outcomes : on the one hand, there is atp level depletion post - workout ; and, on the other hand, there is an activation of the central nervous system that lasts a few seconds in the motor endplate (this time has not been defined nor standardized). the presence of both of these factors leads to a pap of the stimulated musculature1,2,3,4, provided that the recovery is faster than the dissipation of the neuronal transmission. there are a number of researchers who have tried to increase the explosive strength and velocity by generating pap through different activation methods5,6,7,8. for example, maio alves.6 obtained a significant velocity increase with 8 weeks of training. it is worth mentioning that all the studies consulted for this article are based on the principle explained by sale1 for the generation of pap. all of these studies used constant resistance as activation ; therefore, there is not enough evidence to support the notion that the basic principles of pap can be obtained with a complex training protocol. several of the authors mentioned in this article researched the pap effect with constant resistance9, 10, but there is no conclusive evidence about the changes in explosive strength due to pap when the activation is induced by complex training. it seems that a valid alternative in sports training is to know the behavior of the reflex elastic explosive strength in power zones (from 0.6 to 0.9 m / s of velocity in bar squats), and how this strength increases due to pap in the muscles involved in 30-m sprints. simultaneously, it is fundamental to determine how the power levels are modified during squats by extra load applied in order to meet the aim of the study, since diminishing the power would decrease the pap effect. the main aim of the study was to determine the acute temporal effect of complex training with squats on 30-m sprint times. as a secondary aim, these indicators show the variation of the average power and the maximum power of the squat during complex training. developing exercises with elite athletes is a privilege only a few researchers have ; however, doing so presents a few methodological issues. it is common for elite athletes to be a very small sample ; fortunately, there are experimental designs that facilitate such work with reduced and specific samples. using the same subjects in a controlled condition and the experimental condition is one of the most widely - used strategies in research involving people. seven male subjects participated in this study. a quasi - experimental intra subject design was used together with a control condition and an experimental condition ; both of the latter two conditions were conducted 48 hours apart. before any intervention, all the subjects were measured for their weight, and size and thickness of their skinfold. all the subjects of the study were requested to restrain from ingesting caffeine, drugs, or any substance that could increase their metabolism during the course of the experiment. seven male military athletes of the chilean navy (age : 25.0 2.6 years ; weight : 67.1 2.0 kg ; height 172.7 3.6 cm, body mass index : 22.5 1.0 kg / m2 ; body fat percentage : 12.0 2.6%) (table 1table 1.characteristics of the sample (means sd)experimental group (n=7)age (years) 25.0 2.6height (cm)172.7 3.6weight (kg)67.1 2.0bmi (kg / m)22.5 1.0fat percentage12.0 2.6bmi : body mass index ; sd : standard deviation) were enrolled in the study. each athlete and their coach was informed about the aim of the study and the possible risks of the experiment, and they all signed a consent form before participating in the study. the signed consent form and the study were approved by the research ethics committee of universidad de granada, spain (register n 933). bmi : body mass index ; sd : standard deviation for the characterization of the sample, weight and height were measured with a health o meter professional scale and stadiometer. the skinfolds of the biceps, triceps, subscapularis, and supraspinatus were measured to determine the fat percentage. standard warm - up : for the evaluation of one repetition maximum (1rm), the control set, and the treatment based on complex training, the standard warm - up consisted of a 10-minute jog. during the first 5 minutes, subjects performed a low - intensity run and in the next 5 minutes they added some ballistic movements to the lower limbs (hip adductions, abductions, flexion and extension, and knee and ankle flexion and extension). base line : for the evaluation of 1rm, encoder lineal chrono jump and chronojump version 1.4.6.0 software were used. the 1rm evaluation was performed indirectly through the formula proposed by sanchez - medina. twenty - four hours after the 1rm evaluation, a control set was performed that consisted of 4 sets of 1rm 60% squats. the aim of this was to verify the vertical speed of the bar of each subject13 by determining the peak power and average power of squats. furthermore, three 30-m sprint sets were evaluated using a chrono jump photocell and the chronojump version 1.4.6.0 software. the times were measured at the starting point, and 10 m, 20 m, and 30 m. protocol : the intervention session with complex training consisted of : 4 sets of 5 repetitions of 30% 1rm + 4 repetitions of 30% 1rm + 3 repetitions of 30-meter sprint with two - minute resets between repetitions of 30-meter sprint (fig. 1afig. 1a.experimental protocol in complex training in squats1rm : 1 repetition maximum ; 30-m : 30 meters sprints and 1bfig. 1rm : 1 repetition maximum ; 30-m : 30 meters sprints ; s : seconds ; r1 : first repetition of 30-m ; r2 : second repetition of 30-m ; r3 : third repetition of 30-m ; w : watts). experimental protocol in complex training in squats 1rm : 1 repetition maximum ; 30-m : 30 meters sprints design of experimental protocol with complex training. 1rm : 1 repetition maximum ; 30-m : 30 meters sprints ; s : seconds ; r1 : first repetition of 30-m ; r2 : second repetition of 30-m ; r3 : third repetition of 30-m ; w : watts during the protocol of complex training with squats, the vertical velocity of the bar in the low intensity (30% 1rm) and high intensity (60% 1rm) tasks in each set was monitored. also, all 30-meter sprint repetitions were evaluated (3 repetitions per set) in order to determine the appearance of pap (fig. sequence of 30-m sprint repetition in experimental protocol the minimum times of the 30-meter sprints (10 m, 20 m and 30 m), and average power and peak power were submitted to the kolmogorov - smirnov (k - s) test. repeated measures anova test was used to analyze the differences among the control sets and the four complex training sets. the effect size for this analysis was calculated using the partial eta - squared test. for post hoc analysis, student s t - test was conducted on those variables that showed significant differences in the repeated measures anova test. the following comparisons were carried out using student s t - test : control sets vs. experimental set 1 (pair 1), control set vs. experimental set 2 (pair 2), control set vs. experimental set 3 (pair 3), and control set vs. experimental set 4 (pair 4). the size of the effect for this analysis was calculated using cohen s d test with the following effect scale : insignificant (d 2.0). according to anova, the partial times of the 10-meter and 20-meter sprints did not show any significant differences between the control set and the 4 experimental sets (p = 0.46 and p = 8.80). however, was there a significant decrease in the 30-meter time between the control set and the 4 experimental sets (p = 0.0001). the decrease in the minimum time of the 30-meter sprint was attributed to pap in the lower limb muscles activated by the complex training. the control set and the 4 experimental set results are shown in table 2table 2.results (means [sd ]) of post activation potentiation (pap) elicited by complex training with squats for the control set and the four experimental setsvariables control setset 1set 2set 3set 4means (sd)means (sd)means (sd)means (sd)means (sd)time in 10 m (s)1.680.081.660.121.670.101.680.121.710.12time in 20 m (s)3.000.142.970.163.010.162.990.173.010.16time in 30 m (s)4.570.234.220.204.270.204.230.234.230.21average power (w)579.2133.2592.4110.0587.8115.6584.4144.5625.4143.9peak power (w)1,451.2216.11,368.5176.71,451.3210.21,424.5279.11,451.2285.7sd : standard deviation ; p<0.0001. sd : standard deviation ; p<0.0001 the average power and peak power of squats did not show any significant changes between the control set and the 4 experimental sets (p = 0.52 and p = 0.45). hoc analysis, the control set and the 4 experimental sets were examined in pairs. the results of student s t - test for all 4 pairs of results are shown in table 3table 3.post hoc analysis of 30-m sprint times after post activation potentiation (pap) elicited by complex training : control set vs. the four experimental setscontrast among conditions(control set sets) control setsetsmeans (sd)means (sd)pair 1time (s)control set set 14.570.234.220.20pair 2time (s)control setset 24.570.234.270.20pair 3time (s)control setset 34.570.234.230.23pair 4time (s)control setset 44.570.234.230.21 : seconds ; sd : standard deviation ; p<0.01. : seconds ; sd : standard deviation ; p<0.01 regarding the first aim of the study, the results of anova showed a positive temporal acute effect of complex training in 30-meter sprints performed by military athletes. this positive effect was a consequence of pap in the muscles used in the sprint, as a result of higher phosphorylation of the light chains of muscular miosine1. it is also important to mention that in the post hoc analysis, the size of the effect in the student s t - test was large in all the pairs evaluated. similar to this study, okuno.7 researched pap conducting complex training for the lower limbs, and found a significant increase in the sprint velocity in the repeated sprint ability (rsa) test (p = 0.01) (30 meters with a change of direction at 15 meters). however, lim.14 did not find any significant differences among the 10-m, 20-m, and 30-m sprint times. possibly, the weight increase (load) used in the present study elicited pap in the 30-meter sprint muscles, since both this study and the study performed by okuno.7 used complex training with squats as an activation method. in the literature, there are several studies which investigated the chronic effect of complex training on pap over different sprint distances5, 15,16,17, but only a few studies have demonstrated significant changes in sprint time and velocity over 30 m5, and/or demonstrated a positive correlation between explosive force tests (squat jump) versus sprints17. similarly, pap was only elicited acutely in those cases where complex training was conducted. in the studies where constant resistance was applied, the variables measured showed no significant changes9, 16. it seems that working with constant resistance causes the neuromuscular system to stabilize, limiting pap and, in consequence, explosive strength events. in contrast, complex training activates the neural system, but does not trigger fatigue in athletes. the combination of both processes generates pap and an increase in the explosive strength, and in this study, it generated a better performance in 30-m sprints. regarding the second aim of the study, the anova results show there were no significant changes in the peak power and average power of squats (p = 0.45 ; p = 0.53). similar to this study, marques.18 reported the bar velocity, peak power, and average power of throwing a handball ; however, these researchers did not evaluate pap as a study variable. walker.19 observed the chronic effects of complex training on pap and the fatigue index, and found a substantial increase in the active strength (p<0.05), as well as a substantial increase in the muscular fatigue after the activation (p<0.05). the evidence shows that long - term workouts increase the fatigue index, but there is no conclusive evidence to support the generation of neuromuscular fatigue with complex training of 60% 1rm, since this study pap in 30-meter sprints. if athletes had experienced fatigue, it is likely that they would not have shown potentiation1, 2, 20, 21. the present results shown indicate that complex training activation elicits pap as evidenced by the 30-meter sprint of military athletes. this pap is clearly seen in the significant decrease in the minimum times of the 30-meter sprints, and the lack of variation in the peak power and average power of the control set and the 4 experimental sets. therefore, working with 4 sets of 5 repetitions of 30% 1rm + 4 repetitions of 60% 1rm + 3 repetitions of 30-meter sprints with a 120-second rest, seems to be a valid way of developing explosive strength in the lower limbs. from a practical point of view, the application of complex training for physical capacity is a good method of increasing explosive strength levels in the lower limbs, since it stimulates two physical capacities simultaneously, increasing both muscular strength in the back squat series and explosive strength in 30-m sprints. it is our suggestion that complex training should be performed with load in power zones (from 0.6 to 0.9 m / s of velocity in bar squats) in the pre - competition and competition phases, since it stimulates the central nervous system without causing fatigue in the muscles used in the 30-m sprint. finally, it is our suggestion that all movements, either back squats or 30-m sprints, should be executed at the fastest speed of movement possible. | [purpose ] the aim of this study was to determine the acute effect temporal of a complex training protocol on 30 meter sprint times. a secondary objective was to evaluate the fatigue indexes of military athletes. [subjects and methods ] seven military athletes were the subjects of this study. the variables measured were times in 30-meter sprint, and average power and peak power of squats. the intervention session with complex training consisted of 4 sets of 5 repetitions at 30% 1rm + 4 repetitions at 60% 1rm + 3 repetitions of 30 meters with 120-second rests. for the statistical analysis repeated measures of anova was used, and for the post hoc analysis, student s t - test was used. [results ] times in 30 meter sprints showed a significant reduction between the control set and the four experimental sets, but the average power and peak power of squats did not show significant changes. [conclusion ] the results of the study show the acute positive effect of complex training, over time, in 30-meter sprint by military athletes. this effect is due to the post activation potentiation of the lower limbs muscles in the 30 meters sprint. |
primary cardiac lymphoma (pcl) is a very rare neoplasm originating in the heart. traditionally, pcl is defined as an extranodal lymphoma limited to the heart or pericardium. however, some previous reports demonstrated pcl cases with extracardiac involvement.1,2,3 pcl occupies 1.3% of primary cardiac tumors and 0.5% of extranodal lymphomas.4 patients with pcl generally complain of nonspecific symptoms such as dyspnea, edema, and arrhythmia.5,6 treatment of pcl is variable because the optimal treatment strategy has not yet been established. however, previous studies have shown that chemotherapy is the most effective therapy.5,7 in this report, we delineate a case of diffuse infiltrative type of pcl with spread to the mediastinum and cervical lymph nodes. a 48-year - old man visiting the korea university ansan hospital presented with the symptoms of exertional dyspnea and cough. chest radiography showed pleural effusion, pulmonary congestion, and cardiomegaly. in a transthoracic two - dimensional echocardiography, a large amount of pericardial effusion and diffuse cardiac wall thickening we performed cardiac magnetic resonance imaging (mri) for differential diagnosis of myocardial infiltrative diseases such as cardiac amyloidosis. however, there was no lymphadenopathy or a mass lesion in the mri images (fig. however, the myocardial biopsy showed myocyte hypertrophy, and the pericardial biopsy showed chronic inflammation with fibrosis and the congo red staining was negative. we could not identify a definite cause of the pericardial effusion ; hence, the patient underwent conservative treatment and received outpatient follow - up. chest computed tomography (ct) revealed an infiltrative soft tissue mass in the anterior mediastinum and diffuse thickening of all ventricular and atrial walls (fig. immunohistochemical staining was positive for cd45, but owing to the lack of specimen tissue, we could not perform more tests. clinically, we suspected a diagnosis of fibrosing mediastinitis, and glucocorticoids were used empirically. we prescribed prednisolone 60 mg daily for 1 month, which was tapered to 15 mg per day within 5 months. after tapering of prednisolone ten months later, the patient complained of a nontender mass on the right side of the neck (fig. immunohistochemistry demonstrated a large lymphoid neoplasm, which was positive for cd45, cd79a, and cd20. finally, the patient was diagnosed with primary cardiac diffuse large b cell lymphoma (dlbcl). he commenced chemotherapy with rituximab and chop (cyclophosphamide, doxorubicin, vincristine, and prednisolone). after the second cycle of chemotherapy, we performed chest ct. in the chest ct, the infiltrative lesion, involving the myocardium and multiple lymph nodes, 3b) compared with the chest ct performed before the r - chop therapy (fig. 3b). on the basis of this result, we are confident that the dlbcl originated in the heart and the final diagnosis was pcl. after 6 cycles of chemotherapy, chest ct and positron emission tomography scans were performed to assess the response to treatment. he commenced radiation therapy (total 40 gy) for the cardiophrenic angle lymph nodes. it is defined as an extranodal lymphoma limited to the heart or pericardium.4,5 histologically, diffuse large b cell type of non - hodgkin 's lymphoma is the most common of the pcls, and its incidence ranges from 60% to 81%.6,8,9 in previous reports, most of the cases showed a mass - like lesion.6 the right atrium is the most common site of invasion, followed by the right ventricle, left ventricle, and left atrium.7 patients commonly present with nonspecific, different symptoms ; and clinical findings such as dyspnea, arrhythmia, pericardial effusion, and congestive heart failure are observed.5,6 because of its nonspecific clinical manifestation, it is difficult to diagnose pcl. imaging studies such as echocardiography, ct, and mri are helpful for the diagnosis of pcl. however, pathologic examination is the only way to obtain a definite diagnosis.10 chemotherapy is effective for treatment of any subtype of primary cardiac lymphoma. a previous report demonstrated that rituximab in combination with the chop regimen has a good outcome in the dlbcl type of pcl.1,9,10 petric.5 stated that the median overall survival after diagnosis was 12 months. among the patients, the chemotherapy group had a longer overall survival up to 30 months.5 first, the pcl was observed as thickened myocardium without an intracardiac mass. to our knowledge, this is the second case report of a diffuse infiltrative pcl without an intracardiac mass.11 second, in this case, the dlbcl originated in the heart and delayed extracardiac involvement was noted. two cases presented with an extracardiac metastasis at the first diagnosis.1,2 one case had a pcl involving only the heart at the primary diagnosis, but microscopic involvement of the lungs, peritoneal, and retroperitoneal adipose tissue was detected on autopsy.3 however, these cases did not clearly show delayed metastasis of the pcl to an extracardiac site. our case clearly showed that the pcl had no extracardiac involvement initially but afterwards showed extracardiac involvement. mediastinal lymph node biopsy was performed at the second admission, and lymphoma was suspected. however, because of insufficient specimens and refusal of the patient to undergo further testing, we could not confirm the diagnosis of lymphoma, and we administered steroids for a possible diagnosis of fibrosing mediastinitis. we think that the use of steroids led to an immunocompromised state, and this state may have contributed to the delayed extracardiac involvement. it is well known that steroids have a lympholytic effect, and this effect probably caused a disturbance of the detection time from the symptom onset to the administration of proper treatment. although this is only a hypothesis, clinicians should be aware of the possibility of delayed diagnosis of a pcl owing to the use of steroids. despite these interesting points, this report had one large limitation. because we failed to confirm the diagnosis of pcl from previous cardiac and mediastinal biopsies, the tissues from the enlarged lymph node in the right neck were used to confirm the diagnosis of pcl. although the biopsy was not performed at the primary site of lymphoma, given that the initial cardiac mri demonstrated diffuse cardiac infiltration without lymph node enlargements, it appears proper to diagnose pcl. in summary, we have reported a case of an infiltrative type of pcl without an intracardiac mass and with delayed extracardiac involvement. | primary cardiac lymphoma (pcl) is an extremely rare and fatal neoplasm of the heart. traditionally, it is defined as lymphoma involving the heart or pericardium. pcl has a poor prognosis because of the diagnostic difficulty and its location. we present the case of a 48-year - old man who presented with pericardial effusion and diffuse cardiac wall thickening. we first suspected infiltrative heart disease. however, even after performing a biopsy, we could not establish an accurate diagnosis. after 20 months, primary cardiac diffuse large b cell lymphoma (dlbcl) was diagnosed by cervical lymph node biopsy. in this case, after chemotherapy, the dlbcl lesions, including cardiac wall thickening, improved. the treatment outcome suggests that the diagnosis was diffuse infiltrative pcl with delayed extracardiac involvement. |
it is composed of several mullerian type lesions like endometriosis, endocervicosis and endosalpingiosis occurring together. a 32 year old lady presented with complaints of dysuria and burning micturition during menstrual cycles. abdominal examination and per speculum examination was normal. cystoscopy showed a 4 cm raised papilliferous area in the right lateral wall of bladder with intact overlying mucosa. histopathological examination of the biopsy specimen revealed endometrial glands and stroma along with endocervical type of glands and glands lined by ciliated cells in the bladder wall [figures 1 and 2 ]. these findings indicate that the bladder lesion was mullerian in nature with endometriosis, endocervicosis and endosalpingiosis. the patient was found to be asymptomatic on follow up of 2 years but on cystoscopy a mass lesion was persistent which was smaller in size (1.5 cm) in comparison to the earlier lesion. (a) endometrial type of glands and stroma extending deep within the bladder wall (b) glands lined by tubal type epithelium (hematoxylin & eosin (h&e) ; 200) endocervical glands in the bladder wall lined by mucinous tall columnar epithelium with basal nuclei along with an endometrial gland (arrow) h & e ; 200. urinary bladder is the most common site of genitourinary endometriosis. in addition to classical endometriosis, glandular lesions made up of endocervical type glands (endocervicosis) can also occur in the bladder. this lesion is usually seen in women of child bearing age and presents as a mass in the posterior wall or dome of the bladder with suprapubic pain. other mullerian tissues such as tubal epithelium have been reported in the bladder under the name of endosalpingiosis. the term mullerianosis is used when there is a complex combination of these mullerian - type lesions. to our knowledge, only five cases of mullerianosis of urinary bladder have been reported. endometriosis of the urinary bladder classically affects women in the second to fifth decade of life but may be seen in postmenopausal women receiving exogenous oestrogens. endometriosis may also be rarely seen in men with prostatic carcinoma who have received exogenous oestrogen therapy. endometriosis usually presents as a mass lesion on cystoscopy, most commonly in the trigone or posterior wall. endocervicosis is characterised by extensive involvement of bladder wall by benign / mildly atypical columnar mucin secreting endocervical glands. mullerianosis is associated with presence of tubal - type epithelium in addition to endometriosis and endocervicosis. the pathogenesis of these lesions remain debatable and both implantative and metaplastic origins have been suggested. implantative origin is supported by a frequent past history of pelvic surgery in endometriosis and endocervicosis. in the present case the differential diagnosis of mullerianosis would include a variety of lesions both neoplastic and non - neoplastic. possibility of a minimal deviation adenocarcinoma of cervix infiltrating the bladder has to be ruled out. in the present case, cervix was normal on examination and the clinical course was indolent. minimal deviation adenocarcinoma will show at least focal atypia, which was lacking in the present case. benign lesions like cystitis cystica and cystitis glandularis can mimic mullerianosis but both these entities do not show deeply situated glands as in mullerianosis. urachal remnants in the bladder can also show tubular structures lined by mucinous epithelium however they are usually incidental findings observed near the dome of bladder and is usually surrounded by a loose peritubular fibromuscular tissue. mullerianosis of the bladder is a rare lesion, which may present as a mass lesion mimicking a tumor. | mullerianosis of the urinary bladder is a rare and morphologically complex tumor - like lesion, composed of several types of mullerian lesions like endometriosis, endocervicosis, and endosalpingiosis. this disease occurs in women of reproductive age group. implantative and metaplastic origins have been suggested in the pathogenesis. |
the prototypical member of the pif1 family of helicases is the saccharomyces cerevisiae pif1 (scpif1) protein, which was initially isolated in a genetic screen for mutations affecting mitochondrial dna (mtdna) recombination (reviewed in bochman., it was later discovered that scpif1 is a superfamily ib helicase with a variety of cellular roles. aside from affecting mtdna maintenance, scpif1 also uses its helicase activity to perform several nuclear functions, including telomerase inhibition (zhou., 2000 ; boule., 2005), okazaki fragment processing (pike., 2010), and resolving g - quadruplex (g4) structures (ribeyre., 2009 ; paeschke., additionally, s. cerevisiae encodes a second pif1 family helicase known as s. cerevisiae rrm3 (scrrm3). like scpif1, scrrm3 has roles in maintaining the stability of both the mitochondrial and nuclear genomes (bochman., 2010). scrrm3 is a component of the replisome (azvolinsky., 2006), where it is thought to act as an accessory helicase, facilitating timely dna replication by disrupting stable, nonnucleosomal protein dna complexes that would otherwise inhibit replication fork progression (ivessa., 2003 ; azvolinsky., two - dimensional gel electrophoresis of replication intermediates demonstrates that the absence of scrrm3 results in paused and broken dna replication forks (ivessa., 2000, 2003). mutations in rrm3 also result in local increases in recombination at regions containing sites of scrrm3 action, such as the rdna (keil and mcwilliams, 1993) and a trna - rich stretch of chromosome vii (ivessa., 2003). whereas multiple fungi also encode two pif1 family helicases, other organisms contain variable numbers of homologues, from one in fission yeast and humans to 23 in the fungal arthropod pathogen metarhizium anisopliae arsef 23. in many instances, little is known about these enzymes other than that they share essentially equal sequence similarity to scpif1 and scrrm3 and, where examined, seem to be found in both nuclei and mitochondria (bochman., 2010). searches of the national center for biotechnology information (ncbi) protein database reveal that many prokaryotic genomes also encode pif1-like helicases. due to sequence similarity with recd (scpif1 and scrrm3 are 18.9 and 16.4% identical, respectively, to escherichia coli recd), however, many of the prokaryotic pif1s are misannotated as recds (or ambiguously annotated using a variety of other terms). the situation in bacteria is further complicated by the existence of multiple recd (montague., 2009) and/or pif1 homologues in some species (see figure 1 and table 1 for examples). pif1 (solid boxes) and recd (dashed boxes) protein sequences were aligned using custalx (v. 2.0.12) by iterating each step of the alignment. the same program was used to both draw and bootstrap a neighbor - joining tree. treeview (v. 1.6.6) was used to visualize the phylogenetic tree and root it with the outgroup (human -actin, unpublished data). red boxes indicate prokaryotes, blue boxes denote eukaryotes, the green box indicates a bacteriophage, and the purple boxes designate viruses. ps, psychrobacter sp. prwf-1 ; mp, mucilaginibacter paludis dsm 18603 ; bb, borrelia burgdorferi n40 ; ec, e. coli ; sa, staphylococcus aureus ; da, desulfobacterium autotrophicum hrm2 ; ba, bacteroides sp. 2_1_16 ; rv5, e. coli phage rv5 ; iiv3, invertebrate iridescent virus-3 ; hs, homo sapiens ; bl, bifidobacterium longum subsp. longum f8 ; sc, s. cerevisiae ; v99b1, emiliania huxleyi virus 99b1 ; and sp, schizosaccharomyces pombe. repertoire of helicases in evolutionarily diverse prokaryotes as revealed by blast searches and clustalx alignments. due to sequence divergence from their better - characterized homologues, it was difficult to definitively determine the difference between pif1 and recd, as well as rep and uvrd, family helicases in some organisms. pif1s and recds are all superfamily ib helicases that share seven conserved motifs (i, ia, ii, iii, iv, v, and vi) common to sfi enzymes, as well as three additional motifs (a, b, and c) found only in pif1 and recd family helicases (see figre 2). only pif1-like helicases, however, contain the pif1 family signature sequence (dklexvarairkqxkpfggiq), a degenerate sequence located between motifs ii and iii, the function of which is currently unknown (bochman., 2010). aside from clustal alignments of protein sequences to determine phylogenies, one way to differentiate between pif1 and recd helicases is with the signature sequence. using the sequence above as a basic local alignment search tool (blast) query of the ncbi database returns only pif1 homologues, although the more distantly related a pif1 family helicase is from the canonical scpif1, the more degenerate the signature sequence becomes (compare bapif1 and bbpif1 in figure 2). careful analysis using clustal alignments, however, reveals that prokaryotic pif1 enzymes are generally more closely related to eukaryotic pif1 helicases than they are to any of the various recd subgroups (figure 1). vi, the pif1/recd - specific motifs a c, and the pif1 family signature sequence are shown (protein sequences were aligned as in figure 1). residues that are identical in 3 sequences are red, and conserved similarities (i.e., either similar to the red residues in the same column or 3 similar residues in the same column) are green. e. coli recd does not display conservation of the pif1 family signature sequence, so the residues aligned by clustalx in this region are shown in lowercase. the amino acid similarity groups were defined as fyw, ivlm, rk, de, ga, ts, and nq. here bb indicates b. bacteriovorus instead of b. burgdorferi ; the remaining abbreviations are the same as in figure 1. we hypothesize that pif1 family helicases are important for resolving common issues that arise during dna metabolism rather than performing eukaryotic - specific functions. thus, based on what we know about eukaryotic pif1 helicases, prokaryotic pif1s may serve multiple functions, including maintaining prokaryotic telomeres (in bacteria with long linear chromosomes), resolving dna and dna rna secondary structures, and complementing the lack of other helicases in vivo. whereas escherichia coli and bacillus have circular chromosomes, many bacteria have linear chromosomes, plasmids, and/or phages that replicate without a circular intermediate (reviewed in stewart. well - known examples of such organisms include borrelia burgdorferi (the causative agent of lyme disease), many streptomyces species (sources of various antibiotics), and the 29 bacillus subtilis bacteriophage. to solve the end replication problem, at least two different types of prokaryotic telomeres have evolved : 1) those with ends protected by a protein that is covalently linked to the terminal nucleotide (e.g., streptomyces spp. and 29), and 2) those with covalently closed terminal hairpins (e.g., borrelia spp.). in eukaryotes, for instance, scpif1 is a catalytic inhibitor of telomerase, scrrm3 is important for replication through telomeric dna, and mammalian pif1 helicases interact with telomerase in vivo (bochman., 2010). although the structures and sequences of prokaryotic telomeres are unrelated to the well - known eukaryotic telomerase - generated telomeres, pif1 family helicases may nevertheless be involved in prokaryotic telomere maintenance., 2004 ; casjens and huang, 2008). in some instances, such as generating antigen variability in borrelia spp., this recombination is beneficial, and bacterial pif1 helicases that resolve recombination intermediates may promote such processes. indeed, scpif1 promotes recombination in the linear mtdna of s. cerevisiae (foury and dyck, 1985). alternatively, prokaryotic pif1 helicases may possess a nucleoprotein disruption activity similar to that hypothesized for scrrm3 (ivessa. 2009) that is used to displace dna end - binding proteins during the replication of linear chromosomes and plasmids. more broadly, it is widely accepted that the genomic dna in eukaryotic organelles, such as mitochondria, has a prokaryotic origin. it was long overlooked and often disputed, however, that some eukaryotic mtdna molecules, including s. cerevisiae mtdna, are linear (nosek., 1998), perhaps reflecting an origin from a prokaryote species with a linear genome. because pif1 family helicases are important for mtdna maintenance (bochman., 2010), it is tempting to speculate that the first eukaryotic pif1 helicase may have had a mitochondrial (and hence prokaryotic) origin, with nuclear isoforms evolving later. indeed, there are several examples of mitochondrial proteins with putative prokaryotic origins (e.g., mitochondrial ribosomal proteins ; henze and martin, 2001) that are encoded in the nuclear genome. dna / rna secondary structure resolution. eukaryotic pif1 helicases have recently been implicated in the processing of g4 structures (ribeyre., 2009 ; sanders, 2010 ; paeschke., a g4 structure is a four - stranded rna or dna secondary structure that is held together by hoogsteen g - g base pairing. human pif1 and scpif1 both bind and efficiently unwind g4 structures in vitro (ribeyre., 2009 ; sanders, 2010). it is known that guanine - rich sequences that have the potential to form g4 structures are enriched in telomeric dna and rdna, and g4 structures are also found at transcriptional regulatory regions and preferred meiotic double - stranded break sites (neidle and balasubramanian, 2006 ; capra., 2010). thus g4 sequences are likely to have roles in diverse cellular functions, such as telomere maintenance (paeschke., 2008) and transcriptional regulation (rawal., moreover, a recent analysis of 18 prokaryotic genomes revealed that the association of g4 motifs with transcriptional regulatory regions is not limited to eukaryotes, as evidenced by conserved g4 motifs in the promoters of gene orthologues in distantly related bacteria (rawal., 2006). although helicases such as e. coli recq are also known to unwind g4 structures (wu and maizels, 2001), not all bacterial genomes encode recq homologues (table 1). it is therefore plausible that prokaryotes that lack recq helicases may instead encode pif1 helicases to resolve g4 structures. furthermore, as might be expected, bacteria with gc - rich genomes are predicted to contain more g4-forming sequences than are organisms with lower gc content (rawal., it is therefore intriguing that pif1 family helicases are found throughout the bifidobacteriales (a large order of actinobacteria) and the phylum bacteroidetes (which includes human gut commensals), the genomes of which are particularly gc - rich. previously, it was shown that scpif1 preferentially unwinds dna rna hybrids relative to dna dna substrates (boule and zakian, 2007), much like the e. coli uvrd helicase (matson, 1989). rna hybrid formed between telomeric dna and the telomerase rna template (boule. although the prokaryotic telomeres just discussed are not replicated by a conventional telomerase - based mechanism, perhaps pif1 helicases function in bacteria to resolve dna rna hybrids (i.e., r - loops) that form during transcription. because r - loop accumulation leads to genomic instability in organisms from e. coli to mammals, resolution of r - loops is important for maintaining genome integrity (li and manley, 2006). complementing the lack of other helicases. most genomes encode multiple distinct helicases that have specialized functions in dna and rna metabolism. for instance, there are 134 open reading frames in the s. cerevisiae genome that encode proteins containing helicase structural motifs (shiratori., 1999). the e. coli genome also encodes a variety of predicted helicases, with more than dozen such enzymes verified by direct biochemical assays. a universal collection of helicase types that is required for viability, however, has not been identified in bacteria or eukaryotes, likely due to functional redundancy in vivo. thus, although e. coli encodes one member each of the ding, recd, recq, rep, and uvrd helicase families (table 1), other bacteria contain multiple homologues of these helicases, are devoid of them altogether, and/or possess other types of helicases (e.g., pcra and pif1) that may complement the lack of one or more of these enzymes. in e. coli, ding is a 5-3 helicase with a putative role in homologous recombination (hr), recd is the 5-3 member of the recbcd complex (which is also involved in hr), recq (3-5) is involved in hr and double - stranded break repair, rep is a 3-5 accessory replicative helicase needed for timely dna replication, and uvrd is a 3-5 repair helicase that can remove reca from single - stranded dna (see wu and maizels, 2001 ; montague., 2009 ; boubakri., 2010 ; and references therein). given their sequence similarity to recd enzymes, one might predict that pif1 family helicases are found in the subset of bacterial species that lack a recd homologue. indeed, this situation is true in species such as rhodomicrobium vannielii and gardnerella vaginalis, which lack recd. other bacterial species, however, encode one or more homologues of both pif1 and recd (e.g., psychrobacter sp. prwf-1 and desulfobacterium autotrophicum ; table 1). additionally, across the diverse prokaryotic phyla (ciccarelli., 2006), many prokaryotes that encode pif1 family helicases appear to lack both recq and ding helicase homologues. as stated earlier in text, pif1 helicases may function in place of recqs to resolve g4 dna and/or to remove r - loops, as ding does in e. coli (boubakri., 2010). additionally, ding acts in concert with either rep or uvrd in e. coli to remove rna polymerase from the path of replication forks when replication and transcription complexes collide (boubakri., 2010).., 2003), and the increased replication fork pausing seen at inverted ribosomal operons in e. coli ding rep mutants is similar to the fork pausing observed at rdna repeats in rrm3 s. cerevisiae (ivessa., 2000). therefore, because eukaryotic pif1 helicases have functions similar to those observed for the e. coli ding, uvrd, and rep helicases, prokaryotic pif1 helicases may complement the lack of one or more of these enzymes in bacteria that do not encode ding, uvrd, and/or rep homologues. the possibilities presented here are by no means comprehensive, and none of these hypotheses has been tested. additionally, if prokaryotic pif1-like helicases were acquired by horizontal gene transfer, they may not be expressed or active in vivo. transcriptome data from bdellovibrio bacteriovorus indicate, however, that bbpif1 mrna is expressed (lambert., 2010), and biochemical results from a number of purified prokaryotic pif1 helicases demonstrate that these enzymes are active in vitro (bochman, judge, and zakian, unpublished). in any event, more bioinformatic analyses are needed to determine exactly how widespread pif1 family helicases are among prokaryotes. furthermore, molecular - genetic examination of nontraditional model organisms that encode pif1-like helicases (e.g., bifidobacteria and bacteroides spp.) is required to begin examining these enzymes in vivo. to the best of our knowledge, no in vivo functional research has been performed on a prokaryotic pif1 family helicase, but we hope that this article will generate interest in experimental tests of the roles of pif1 helicases in bacterial cells. we hypothesize that pif1 family helicases are important for resolving common issues that arise during dna metabolism rather than performing eukaryotic - specific functions. thus, based on what we know about eukaryotic pif1 helicases, prokaryotic pif1s may serve multiple functions, including maintaining prokaryotic telomeres (in bacteria with long linear chromosomes), resolving dna and dna rna secondary structures, and complementing the lack of other helicases in vivo. whereas escherichia coli and bacillus have circular chromosomes, many bacteria have linear chromosomes, plasmids, and/or phages that replicate without a circular intermediate (reviewed in stewart. well - known examples of such organisms include borrelia burgdorferi (the causative agent of lyme disease), many streptomyces species (sources of various antibiotics), and the 29 bacillus subtilis bacteriophage. to solve the end replication problem, at least two different types of prokaryotic telomeres have evolved : 1) those with ends protected by a protein that is covalently linked to the terminal nucleotide (e.g., streptomyces spp. and 29), and 2) those with covalently closed terminal hairpins (e.g., borrelia spp.). in eukaryotes, for instance, scpif1 is a catalytic inhibitor of telomerase, scrrm3 is important for replication through telomeric dna, and mammalian pif1 helicases interact with telomerase in vivo (bochman., 2010). although the structures and sequences of prokaryotic telomeres are unrelated to the well - known eukaryotic telomerase - generated telomeres, pif1 family helicases may nevertheless be involved in prokaryotic telomere maintenance., 2004 ; casjens and huang, 2008). in some instances, such as generating antigen variability in borrelia spp., this recombination is beneficial, and bacterial pif1 helicases that resolve recombination intermediates may promote such processes. indeed, scpif1 promotes recombination in the linear mtdna of s. cerevisiae (foury and dyck, 1985). alternatively, prokaryotic pif1 helicases may possess a nucleoprotein disruption activity similar to that hypothesized for scrrm3 (ivessa. 2009) that is used to displace dna end - binding proteins during the replication of linear chromosomes and plasmids. more broadly, it is widely accepted that the genomic dna in eukaryotic organelles, such as mitochondria, has a prokaryotic origin. it was long overlooked and often disputed, however, that some eukaryotic mtdna molecules, including s. cerevisiae mtdna, are linear (nosek., 1998), perhaps reflecting an origin from a prokaryote species with a linear genome. because pif1 family helicases are important for mtdna maintenance (bochman., 2010), it is tempting to speculate that the first eukaryotic pif1 helicase may have had a mitochondrial (and hence prokaryotic) origin, with nuclear isoforms evolving later. indeed, there are several examples of mitochondrial proteins with putative prokaryotic origins (e.g., mitochondrial ribosomal proteins ; henze and martin, 2001) that are encoded in the nuclear genome. eukaryotic pif1 helicases have recently been implicated in the processing of g4 structures (ribeyre., 2009 ; sanders, 2010 ; paeschke., a g4 structure is a four - stranded rna or dna secondary structure that is held together by hoogsteen g - g base pairing. human pif1 and scpif1 both bind and efficiently unwind g4 structures in vitro (ribeyre., 2009 ; sanders, 2010). it is known that guanine - rich sequences that have the potential to form g4 structures are enriched in telomeric dna and rdna, and g4 structures are also found at transcriptional regulatory regions and preferred meiotic double - stranded break sites (neidle and balasubramanian, 2006 ; capra., 2010). thus g4 sequences are likely to have roles in diverse cellular functions, such as telomere maintenance (paeschke., 2008) and transcriptional regulation (rawal., 2006 ; huppert., moreover, a recent analysis of 18 prokaryotic genomes revealed that the association of g4 motifs with transcriptional regulatory regions is not limited to eukaryotes, as evidenced by conserved g4 motifs in the promoters of gene orthologues in distantly related bacteria (rawal., 2006). although helicases such as e. coli recq are also known to unwind g4 structures (wu and maizels, 2001), not all bacterial genomes encode recq homologues (table 1). it is therefore plausible that prokaryotes that lack recq helicases may instead encode pif1 helicases to resolve g4 structures. furthermore, as might be expected, bacteria with gc - rich genomes are predicted to contain more g4-forming sequences than are organisms with lower gc content (rawal., 2006). it is therefore intriguing that pif1 family helicases are found throughout the bifidobacteriales (a large order of actinobacteria) and the phylum bacteroidetes (which includes human gut commensals), the genomes of which are particularly gc - rich. previously, it was shown that scpif1 preferentially unwinds dna rna hybrids relative to dna dna substrates (boule and zakian, 2007), much like the e. coli uvrd helicase (matson, 1989). rna hybrid formed between telomeric dna and the telomerase rna template (boule., 2005). although the prokaryotic telomeres just discussed are not replicated by a conventional telomerase - based mechanism, perhaps pif1 helicases function in bacteria to resolve dna rna hybrids (i.e., r - loops) that form during transcription. because r - loop accumulation leads to genomic instability in organisms from e. coli to mammals, resolution of r - loops most genomes encode multiple distinct helicases that have specialized functions in dna and rna metabolism. for instance, there are 134 open reading frames in the s. cerevisiae genome that encode proteins containing helicase structural motifs (shiratori., 1999). the e. coli genome also encodes a variety of predicted helicases, with more than dozen such enzymes verified by direct biochemical assays. a universal collection of helicase types that is required for viability, however, has not been identified in bacteria or eukaryotes, likely due to functional redundancy in vivo. thus, although e. coli encodes one member each of the ding, recd, recq, rep, and uvrd helicase families (table 1), other bacteria contain multiple homologues of these helicases, are devoid of them altogether, and/or possess other types of helicases (e.g., pcra and pif1) that may complement the lack of one or more of these enzymes. in e. coli, ding is a 5-3 helicase with a putative role in homologous recombination (hr), recd is the 5-3 member of the recbcd complex (which is also involved in hr), recq (3-5) is involved in hr and double - stranded break repair, rep is a 3-5 accessory replicative helicase needed for timely dna replication, and uvrd is a 3-5 repair helicase that can remove reca from single - stranded dna (see wu and maizels, 2001 ; montague., given their sequence similarity to recd enzymes, one might predict that pif1 family helicases are found in the subset of bacterial species that lack a recd homologue. indeed, this situation is true in species such as rhodomicrobium vannielii and gardnerella vaginalis, which lack recd. other bacterial species, however, encode one or more homologues of both pif1 and recd (e.g., psychrobacter sp. prwf-1 and desulfobacterium autotrophicum ; table 1). additionally, across the diverse prokaryotic phyla (ciccarelli., 2006), many prokaryotes that encode pif1 family helicases appear to lack both recq and ding helicase homologues. as stated earlier in text, pif1 helicases may function in place of recqs to resolve g4 dna and/or to remove r - loops, as ding does in e. coli (boubakri., 2010). additionally, ding acts in concert with either rep or uvrd in e. coli to remove rna polymerase from the path of replication forks when replication and transcription complexes collide (boubakri., 2010). this activity is reminiscent of the nucleoprotein disruption activity of scrrm3 (ivessa., 2003), and the increased replication fork pausing seen at inverted ribosomal operons in e. coli ding rep mutants is similar to the fork pausing observed at rdna repeats in rrm3 s. cerevisiae (ivessa., 2000). therefore, because eukaryotic pif1 helicases have functions similar to those observed for the e. coli ding, uvrd, and rep helicases, prokaryotic pif1 helicases may complement the lack of one or more of these enzymes in bacteria that do not encode ding, uvrd, and/or rep homologues. the possibilities presented here are by no means comprehensive, and none of these hypotheses has been tested. additionally, if prokaryotic pif1-like helicases were acquired by horizontal gene transfer, they may not be expressed or active in vivo. transcriptome data from bdellovibrio bacteriovorus indicate, however, that bbpif1 mrna is expressed (lambert., 2010), and biochemical results from a number of purified prokaryotic pif1 helicases demonstrate that these enzymes are active in vitro (bochman, judge, and zakian, unpublished). in any event, more bioinformatic analyses are needed to determine exactly how widespread pif1 family helicases are among prokaryotes. furthermore, molecular - genetic examination of nontraditional model organisms that encode pif1-like helicases (e.g., bifidobacteria and bacteroides spp.) is required to begin examining these enzymes in vivo. to the best of our knowledge, no in vivo functional research has been performed on a prokaryotic pif1 family helicase, but we hope that this article will generate interest in experimental tests of the roles of pif1 helicases in bacterial cells. | pif1 family helicases, which are found in nearly all eukaryotes, have important roles in both nuclear and mitochondrial genome maintenance. recently, the increasing availability of genome sequences has revealed that pif1 helicases are also widely found in diverse prokaryotes, but it is currently unknown what physiological function(s) prokaryotic pif1 helicases might perform. this perspective aims to briefly introduce the reader to the well - studied eukaryotic pif1 family helicases and speculate on what roles such enzymes may play in bacteria. on the basis of our hypotheses, we predict that pif1 family helicases are important for resolving common issues that arise during dna replication, recombination, and repair rather than functioning in a eukaryotic - specific manner. |
benzene (c6h6, cas number 71 - 43 - 2) is an aromatic hydrocarbon widely used as a solvent in chemical laboratories and as an intermediate in the chemical industry for manufacturing of polymers and other products. benzene in air comes either from natural sources, such as forest fires and volcanic activity, or from human activities, such as cigarette smoking and burning of fossil fuels. benzene is classified by the international agency for research on cancer (iarc) as a group 1 human carcinogen. nonsmokers inhale roughly 200450 g of benzene a day, while smokers may inhale three times as much. most of the human exposure to benzene occurs by inhalation but consumption of contaminated foods and water also play a role. benzene can enter foods in many ways : use of contaminated raw materials and packaging materials, storage in contaminated areas, and use of contaminated water for washing or preparing the food. it may form in food by some cooking processes, thermal decomposition of food components, additives, food irradiation, and preservative decomposition such as benzoate decomposition [5, 6 ]. agricultural products may also be contaminated with benzene from emissions caused by fires and the use of fossil fuel - burning equipment. finally, benzene may form in some food additives, such as liquid smoke, during their manufacturing. gardner and lawrence found that benzene can form when benzoate is decarboxylated in the presence of ascorbic acid and transition metals such as cu(ii) and fe(iii) and can be accelerated by light and heat. benzoate and ascorbic acid are widely used as preservatives and antioxidants, respectively, in nonalcoholic beverages but they may also occur naturally in foods. transition metals such as the ones mentioned above may catalyze the transfer of one electron from ascorbic acid to oxygen, producing the anion superoxide, which then undergoes spontaneous dismutation producing hydrogen peroxide. the further reduction of hydrogen peroxide by ascorbic acid is also catalyzed by those metals. this reduction may generate hydroxyl radicals, which can decarboxylate benzoic acid and form benzene. most studies indicate nonalcoholic beverages as the best candidates for benzene formation since ascorbic acid and sodium, potassium, or calcium benzoate are usually present in their composition. nutritive sweeteners such as sugar and high - fructose corn syrup, ethylenediaminetetraacetic acid (edta), and sodium hexametaphosphate may reduce or even inhibit benzene formation, increasing the susceptibility of diet and light nonalcoholic beverages to benzene formation [12, 13 ]. the ability of edta and sodium hexametaphosphate to chelate cu(ii) and fe(iii) ions may be reduced by competition, that is, by adding calcium or other minerals to the food. another important factor is storage time : the formation of benzene is greater when foods are stored for long periods of time under high temperatures [10, 11, 14 ]. in 2006, the american beverage association published some guidelines to help beverage manufacturers to reduce or inhibit the formation of benzene in their products. the most important guidelines involve replacing ascorbic acid by another antioxidant, adding edta or sodium polyphosphates to chelate the metalic ions that catalyze hydroxyl radical formation, and reviewing the storage conditions and shelf life to minimize product exposure to high temperatures and ultraviolet (uv) light. the limit established for potable water is used as reference : 10 ppb established by the world health organization (who), 5 ppb by the united states (usa) environmental protection agency, and 1 ppb by the european council [11, 15 ]. in 2011, the brazilian federal public ministry (mpf) signed a conduct adjustment term (tac) with three soft drink manufacturers (coca - cola indstrias ltda., companhia de bebidas das amricas (ambev), and primo schincariol indstria de cervejas e refrigerantes ltda.) establishing a maximum acceptable benzene content of 5 ppb. in this review, we summarized the benzene formation mechanisms in food and beverages, occurrence, and mitigation measures as well as data analysis of benzene in food (mainly nonalcoholic beverages) to investigate the potential risk of benzene exposure through oral ingestion. benzene may be introduced in foods during processing, in processes like smoking, roasting, and ionizing radiation. not much information is available on smoking, except for a study that found benzene concentrations of 21 and 121 parts per billion (ppb) in smoked meats [8, 18 ]. benzene in foods may form when the amino acid phenylalanine is broken down by ionizing radiation [19, 20 ]. while studying the mechanism of benzene formation in carrot juice for children, lachenmeier. found that some substances, such as -carotene, phenylalanine, or terpenes, may decompose during processing to yield benzene. six samples of beer have been contaminated with benzene through the use of contaminated carbon dioxide during carbonation. because of the growing demand for processed foods, preservatives have been gaining importance in modern food technology. benzoic acid and its sodium and potassium salts are among the most common preservatives used for inhibiting microbial growth because of their cost - benefit ratios. benzoates control the growth of some bacteria, filamentous fungi, and yeasts, preventing product deterioration and the growth of pathogenic species. although undissolved benzoic acid is the most effective antimicrobial agent, benzoates are used more often because of their greater solubility in water. a solution of benzoic acid contains dissolved and undissolved molecules in equilibrium. as the ph decreases, the equilibrium shifts towards undissolved benzoic acid. sodium, potassium, and calcium benzoates and ascorbic acid may occur naturally in foods or be added as food additives. ascorbic acid usually occurs naturally in some fruit juices, such as orange, lime, and acerola, among others, and may also be added as an antioxidant or nutrient. some benzoates / benzoic acids are present in some fruits and may be added as preservatives, especially in acidic foods with a ph < 4.5, which is usually the case of nonalcoholic beverages. transition metals, such as cu(ii) and fe(iii), may catalyze the transfer of one electron from ascorbic acid to oxygen, producing the radical superoxide, which then undergoes spontaneous dismutation to form hydrogen peroxide. hydrogen peroxide is further reduced, a reaction also catalyzed by those metal ions, and may generate hydroxyl radicals. in 1965, matthews and sangster found that irradiation of an aqueous solution of sodium benzoate causes hydroxyl radicals to attack benzoate ions forming unstable benzoic acid radicals which easily lose the carbon dioxide attached to the aromatic ring to form benzene. at the beginning of the 1990s, gardner and lawrence showed that hydroxyl radicals generated by the reduction of oxygen or hydrogen peroxyde by ascorbic acid, catalyzed by metal ions, could decarboxylate benzoic acid through a ph - dependent reaction, resulting in the benzene formation in foods and beverages. the said reaction was favored by an acidic ph but significantly slowed down at the 35 ph range. study of the effects of different phs and concentrations of ascorbic acid, hydrogen peroxide, and metal ions showed that hydroxyl production is directly proportional to the concentration of ascorbic acid. however, when the concentration of ascorbic acid exceeds that of benzoic acid, the formation of hydroxyls decreases, since benzoic and ascorbic acids compete. benzene formation increased linearly with hydrogen peroxyde concentration, until the ascorbic acid concentration was exceeded. at a temperature of 25c and reaction time of 15 minutes, benzene did not form in the absence of ascorbic acid or hydrogen peroxide. but at a temperature of 50c and reaction time of 3 hours, 25.0 1.4 nm of benzene formed in a solution with a ph of 3, buffered with 50 mm phosphate and containing 8 mm ascorbic acid, 6.25 mm benzoic acid, and 0.25 mm cuso4. optimal benzene formation occurred in the presence of 1.0 mm cuso4 and 0.05 mm feso4. reduced benzene formation. analysis of more than 50 foods, including eggs, by purge - and - trap / static headspace concentration and capillary gas chromatography showed that foods without added benzoates had less than 2 ng / g of benzene. on the other hand, the concentration of benzene in foods with benzoates and ascorbates varied from 1 to 38 ng / g. benzene may form in foods and beverages with benzoic and ascorbic acids because the conditions simulated by gardner and lawrence are the most prevalent during processing and storage. raw materials, such as some fruits and condiments, may contain ascorbic acid, sodium benzoate, or antioxidants naturally, which may lead to varying concentrations of benzene in the final product [10, 18, 29, 30 ]. liquid model systems and food samples containing sodium benzoate and ascorbic acid have been used by many studies to verify benzene formation and the influence of intrinsic factors, such as raw materials, ph, concentrations of sodium benzoate, ascorbic acid, and metal ions ; chelating action of antioxidants and sugars ; and hydroxyl precursors. extrinsic factors such as temperature, uv radiation, and storage time were also investigated. used aqueous models containing 0.025% ascorbic acid and 0.04% sodium benzoate, the same concentrations used in processed beverages, to study the effect of temperature and uv on benzene formation. a total of 300 ng of benzene per gram of solution formed in models stored at 45c or under intense uv light (wavelength and light intensity not reported) for 20 hours. on the other hand, only 4 ng / g of benzene per gram of solution formed in models stored in the dark and at room temperature for 20 hours. however, after 8 days, the benzene concentration had risen to 266 ng / g of solution. chang and ku conducted a study similar to that of mcneal. using the same ascorbic acid and sodium benzoate concentrations but did not add copper and iron ions to the solutions. after eight days stored in the dark, the solutions had a benzene concentration of 176 ng / g. these results suggest that traces of metal ions present in the water or reagents may be enough to catalyze hydroxyl formation. the addition of chelators, such as 0.1 mm edta and diethylenetriaminepentaacetic acid (dtpa), prevented benzene formation ; 100 mm ethanol solutions decrease benzene formation by 90%. aprea. studied the influence of temperature on benzene formation using aqueous models with the same ascorbic acid and sodium benzoate concentrations as those found in processed beverages. benzene formation in the solution stored at 25c remained constant for the first 12 hours (< 0.1 g / l) but increased to 0.44 g / l after 70 hours ; in the solution stored at 45c, 118.5 g / l of benzene formed after 24 hours, increasing to 125, soft drink samples were incubated at 3 different temperatures (20c, 45c, and 90c) for 21 days prior to the determination of benzene and that resulted in a significant increase in the levels of benzene in samples subjected to temperatures of 45c (ranging from 5.5 ppb to 6.6 ppb) and 90c (ranging from 25 ppb to 55.1 ppb) compared to the stored samples 25c (ranging from 0.7 ppb to 1.5 ppb). these data corroborate mcneal. who tested liquid models under similar conditions. investigated the influence of accelerated thermal conditions (40c or 60c for 24 hours or 40c for 15 days) and uv light (known wavelength and intensity for 24 hours or seven days) on liquid models containing 0.025% ascorbic acid and 0.04% sodium benzoate or processed beverage samples containing one or more benzene precursors (0.04% sodium benzoate and ascorbic acid are added to cranberry juice). polyethylene terephthalate (pet) bottles stabilized with tinuvin (uv light filter) were used to determine how well this uv light filter inhibits benzene formation. benzene formation was greater in samples heated to 40c than in those exposed to uv or visible light. however, stabilized pet bottles reduced benzene formation in beverages containing orange juice only marginally. among the samples not exposed to uv light or heat, only those with cranberry juice contained benzene (2.6 ng / g) after the storage period, possibly because benzoic acid is naturally found in cranberries. studied pickled green olives, cucumbers, and caper berries containing ascorbic and benzoic acids under three experimental conditions to determine the chemical and sensory changes induced by these additives : (0) without additives ; (1) with sodium benzoate ; and (2) with sodium benzoate and ascorbic acid. the samples were stored in glass or plastic bottles and under room temperature (20c24c) or refrigeration (6c9c). benzene only formed in treatment 2 under storage at room temperature and plastic pouches pack. for refrigerated or short storage periods (< 14 weeks), benzene concentrations were similar to those found by mcneal. for pickled vegetables. green olives stored in plastic bottles had 1.5 g / l of benzene at the end of a 67-week period. depending on the vegetable matrix and packing material, benzene concentration in samples stored for more than one year can exceed 10 g / l, which is the maximum acceptable concentration of benzene in water according to the who. pickled cucumbers stored in plastic bottles had 44.7 g / l of benzene after 67 weeks, while pickled cucumbers stored in glass bottles had 5.2 g / l after 27 weeks. pickled caper berries had lower benzene concentrations at the end of the storage periods, clearly demonstrating the influence of raw materials on benzene formation, possibly because some of these raw materials contained phenolic antioxidants, corroborating medeiros vinci.. even after all the ascorbic acid had reacted, as seen in pickled caper berries stored in plastic bottles for 26 and 27 weeks, benzene continued to form, indicating that benzoate decarboxylation can be induced by ascorbic acid degradation products during long storage periods at room temperature. this suggests that both ascorbic acide and its degradation products may induce peroxide formation in the presence of metal ions and oxygen, generating hydroxyl radicals that attack benzoate, yielding benzene. medeiros vinci. investigated some factors that promoted benzene formation in liquid models containing benzoate. the said factors include the buffer system used, other sources of hydroxyl radicals in foods (riboflavin photooxidation and lipid oxidation), concentration of transition metal ions, and the inhibitory action of antioxidants. benzene formation was greatest (1250 131 g / kg) in the model containing riboflavin, ascorbic acid, and cu(ii) ions in a solution buffered with sodium citrate and exposed to light. benzene formation was mostly attributed to the combined presence of ascorbic acid and transition metal ions at a concentration of 50 m (1400 g / kg). the study antioxidants were capable of reducing the formation of benzene, and when compared with edta, the standard antioxidant, which completely inhibited benzene formation at a concentration of 1 mm, would need to be present in higher concentrations to achieve the same results. complexation inactivates the catalytic activity of the metal by occupying all of its coordination sites. calcium and other minerals present in food, especially beverages, may compete with copper and/or iron ions for edta, reducing edta 's ability to prevent benzene formation. this is because hydroxyl radicals, which attack benzoic acid to yield benzene, only form in the presence of free copper and/or iron ions. antioxidants may occur naturally in foods or be added intentionally to prevent oxidation and the formation of hydroxyl radicals. they act through many different mechanisms, such as by scavenging metal ions or reactive species, and by donating a hydrogen atom to stabilize these species. in high concentrations, antioxidants may become a prooxidant and promote benzoate decarboxilation. the presence of other antioxidants and ph may also play a role. in 2008, aprea. studied the effect of sugar on benzene formation in liquid models containing ascorbic acid, benzoate, and three different concentrations of sucrose (0.1, 0.25, and 0.5 m). the influence of other sugars, such as fructose and glucose, on benzene formation was also studied. studies of benzene in food, especially in nonalcoholic beverages, are done globally (table 1). it is difficult to assess accurately human dietary exposure to benzene because benzene concentration in foods varies greatly. the human exposure characterization of chemical substances (hexpoc) has estimated that human dietary exposure to benzene varies from 3 to 50 ng / kg of body weight per day. according to smith., the moe (margin of exposure2 10 to 0.4 10) was established for benzene dietary exposure based on dose - response modeling for benzene gave a bmdl10 for female zymbal gland carcinoma of 17.6 mg / kg - bw / d. these authors believe that the amounts of benzene found in foods and beverages are too low to cause problems but emphasized that more studies are needed. used the margin of exposure (moe) to calculate the exposure of children to benzene in carrot juice and found that there was no reason to avoid the occasional consumption of this beverage ; however, one must bear in mind that this is not the only source of benzene exposure and that benzene tends to accumulate in the human body. inhalation is the most common route of exposure to benzene but only 50% of the inhaled benzene is absorbed, while 100% of the benzene in foods and beverages is absorbed. therefore, foods susceptible to benzene formation, such as processed foods, must be studied and monitored. chronic exposure to low concentrations of benzene is associated with genotoxicity and damage to the hematopoietic system. according to carcinogenicity studies in rats, the reference value of benzene inhalation is 0.01 mg / benzene is classified by the international agency for research on cancer (iarc) as a group 1 carcinogen and its role as a leukemogen has been clearly established by a series of epidemiological studies. studies indicate that individuals exposed to 1 - 2 ppm of benzene, or even less, for 40 years may have an increased risk of experiencing its toxic effects, including leukemia. they are more vulnerable because they absorb more contaminants than adults exposed to equal concentrations. children are estimated to intake 2.3 times more air and 6.1 times more food than adults per kilogram of body weight [41, 42 ]. the amount of benzene found in other foods by qualitative and quantitative studies is small. hence, the industry concentrates its efforts to reduce the formation of benzene on nonalcoholic beverages containing ascorbic acid and sodium benzoate. some guidelines have been established by the american beverage association in 2006 to minimize benzene formation in beverages and recommended special attention to some points of the manufacturing process : raw water may be contaminated with benzene.sugars may reduce benzene formation but do not inhibit it completely. therefore, light / diet products are more vulnerable to benzene formation.both ascorbic and benzoic acids may occur naturally in juices because they are present in many fruits.raw carbon dioxide may be contaminated the limit is 20 ppm of benzene (v / v).when acidity is low, ascorbic acid together with sources of benzoic acid is very likely to produce benzene.coloring agents and flavors may contain ascorbates.consider removing, reducing, or replacing benzoates with other microbial growth inhibitors.consider removing, reducing, or replacing ascorbates with other antioxidants.check the product storage conditions since strong light and high temperatures speed up the formation of free radicals.transition metals may be present in raw water and sweeteners. traces of copper and iron may catalyze reactions involving ascorbic and benzoic acids. in this case, the addition of chelators, such as edta or sodium polyphosphates, may help to minimize benzene formation. 's study showed contents of beverages benzene above 5 ng / g were reformulated by the manufacturer. reformulation included such methods as removal of ascorbic acid, addition of edta, deletion of benzoates, and addition of a blend of sodium benzoate with potassium sorbate. all of the reformulated products were found to contain 1.1 ng / g benzene or less. both ascorbic and benzoic acids may occur naturally in juices because they are present in many fruits. when acidity is low, ascorbic acid together with sources of benzoic acid is very likely to produce benzene. check the product storage conditions since strong light and high temperatures speed up the formation of free radicals. traces of copper and iron may catalyze reactions involving ascorbic and benzoic acids. in this case, the addition of chelators, such as edta or sodium polyphosphates, may help to minimize benzene formation. from the data presented in the literature and presented here, we conclude that benzene is a chemical hazard in food, although oral exposure is negligible compared to environmental exposure. mitigating measures applied in foods to decrease the reduction in the concentration of precursors (benzoic acid and ascorbic acid) has been shown to be the primary measure used in the formulation of food and efficiently reduces the levels of contaminants in the final product ; replacement of the antimicrobial agent (benzoate) is always an alternative to be considered. however, further studies on the actual prevalence of benzene in food samples, the intrinsic and extrinsic factors that actually contribute to their formation in food, and development / adaptation of methodologies for their detection in such matrices are needed. finally data from studies of oral exposure to benzene are scarce and such experimental data is crucial for clarifying the real oral exposure to contaminants and for establishing appropriate safe levels of benzene in foods. | this paper presents a literature review on benzene in foods, including toxicological aspects, occurrence, formation mechanisms, and mitigation measures and analyzes data reporting benzene levels in foods. benzene is recognized by the iarc (international agency for research on cancer) as carcinogenic to humans, and its presence in foods has been attributed to various potential sources : packaging, storage environment, contaminated drinking water, cooking processes, irradiation processes, and degradation of food preservatives such as benzoates. since there are no specific limits for benzene levels in beverages and food in general studies have adopted references for drinking water in a range from 110 ppb. the presence of benzene has been reported in various food / beverage substances with soft drinks often reported in the literature. although the analyses reported low levels of benzene in most of the samples studied, some exceeded permissible limits. the available data on dietary exposure to benzene is minimal from the viewpoint of public health. often benzene levels were low as to be considered negligible and not a consumer health risk, but there is still a need of more studies for a better understanding of their effects on human health through the ingestion of contaminated food. |
in a recent issue of the british journal of anaesthesia, moloney and griffiths reviewed basic issues surrounding the ongoing debate on ventilator induced / associated lung injury (vili) and the implications for patient care. the potential importance of vili / biotrauma is not only that it can aggravate ongoing lung injury but also that it may have important systemic consequences, and may explain why most patients with acute respiratory distress syndrome (ards) who go on to die, succumb to multiple organ failure (mof). vili / biotrauma offers a clinically relevant window of therapeutic opportunity in the management of ards / acute lung injury (ali). often the process of systemic inflammatory response syndrome has been initiated hours if not days before admission to the intensive care unit. in contrast, we know exactly when vili / biotrauma begins with intubation and initiation of mechanical ventilation. a full understanding of the mechanisms that mediate lung injury may permit potential strategies directed at reducing the incidence of vili - induced mof to be instituted early in the course of illness. this is no small issue for a syndrome with an incidence of 64.2 cases per 105 person - years and with a 4050% mortality rate. results from the ardsnet trial have underscored the potential importance of biotrauma in the management of ards : the results from that large multicenter trial showed a relative risk reduction of 22% in patients ventilated with the lower tidal volume. this improvement in mortality in patients ventilated with low tidal volumes was not due to a decrease in barotrauma between groups. it is postulated that injurious strategies of mechanical ventilation can cause pulmonary inflammation with release of various cytokines / mediators biotrauma. the initial insult (pneumonia, acid aspiration, or contusion are a few examples) ' primes ' the lung. a ' second hit ', or subsequent insult, such as mechanical ventilation, leads to an overwhelming pulmonary inflammatory response. loss of pulmonary compartmentalization allows for important mediators to escape the confines of the lung and gain access to the systemic circulation. recent experiments have shown that this is associated with apoptosis of cells in distal organs (kidney, villi of colon) and end - organ dysfunction (kidney), which potentially underlies the development of mof. in a randomized controlled trial conducted in 44 patients, ranieri and coworkers demonstrated that a lung protective strategy attenuated the levels of proinflammatory cytokines in plasma and bronchoalveolar lavage fluid, and was associated with a lower incidence of mof. however, the measurement of proinflammatory cytokines does not address the issue of maintenance of alveolar epithelial barrier integrity. in a recent study conducted by eisner and coworkers, circulating levels of surfactant protein (sp)-a and sp - d were evaluated in plasma samples from participants in the ardsnet randomized trial. baseline plasma sp - a levels were not found to be related to clinical outcome. in contrast, higher baseline plasma sp - d levels were associated with a greater risk for death (odds ratio 1.21 per 100 ng / ml increment ; 95% confidence interval 1.08 to 1.35) as well as higher overall morbidity. in addition, use of a lower tidal volume strategy significantly attenuated the rise in plasma sp - d levels (p = 0.0006). because injury to the alveolar epithelial barrier is a hallmark of ali, levels of circulating sps may not only represent a potential biomarker for ali / ards but they may also, in the future, be used to gauge the effects of treatment. ample evidence supports the use of a relatively low tidal volume, but what about the use of a open lung strategy (e.g. recruitment maneuvers, positive end - expiratory pressure [peep ], proning) ? the alveoli study (prospective, randomized, multi - center trial of higher end - expiratory lung volume / lower fio2 versus lower end - expiratory lung volume / higher fio2 ventilation in acute lung injury and acute respiratory distress syndrome), performed by the ardsnet investigators to study the use of higher peep levels, was discontinued prematurely because of lack of efficacy. accumulating evidence from both animals and human experiments suggest that not all patients are recruitable ; moreover, if improved oxygenation does not seem to affect outcome, then should recruitment be pursued for the sole purpose of decreasing atelectrauma ? data have been reported that suggest that recruitment maneuvers may be deleterious if sufficient peep is not used to maintain recruitment. repeated de - recruitments accentuate lung injury during mechanical ventilation, and it has also been suggested that allowing the lung to remain in a state of de - recruitment may mitigate biotrauma. one of the mechanisms for upregulation of cytokines during mechanical ventilation of acutely injured lungs is alteration in alveolar mechanics (i.e. the dynamic change in alveolar size and shape during ventilation) alveolar instability and recruitment / de - recruitment. using direct visualization of subpleural alveoli, schiller and coworkers demonstrated that normal alveoli are extremely stable with minimal movement during mechanical ventilation. in contrast, surfactant deactivation (also a classic finding in ards) causes a continuum of altered alveolar mechanics seen as repetitive collapse of alveoli at end - expiration and re - inflation at end - inspiration. in a recent follow - up study, steinberg and coworkers demonstrated that alveolar instability can mechanically injure the lung independent of inflammatory damage. moreover, the application of peep in this animal model was sufficient to stabilize the alveoli. that group also noted that alveolar instability was associated with modest increases in interleukin-6 levels after 4 hours of mechanical ventilation, even in the absence of neutrophil infiltration, and that this increase could be attenuated by the application of peep. these data suggest that mechanical injury alone is sufficient to cause a rise in tissue and bronchoalveolar lavage levels of proinflammatory cytokines, and that stabilization of alveoli is a key issue in reducing atelectrauma. this probably occurs via a direct attenuation of the mechanical injury to the capillary alveolar membrane, thereby limiting the effects of mechanotransduction (the response of cells to mechanical force) on cellular molecular physiology. preliminary evidence suggests that use of strategies that stabilize alveoli are lung protective, but definitive clinical outcome data are not yet available. further research is required to determine whether alveolar stabilization is achievable, measurable, and desirable. again, the answer is probably ' yes ', both as a consequence of mechanical injury and as the mechanism underlying the development of mof in this patient population. however, as pointed out by moloney and griffiths, a definitive answer to this latter question requires a study that monitors outcomes after specifically targeting certain mediator(s). ali = acute lung injury ; ards = acute respiratory distress syndrome ; mof = multiple organ failure ; peep = positive end - expiratory pressure ; sp = surfactant protein ; vili = ventilator - induced / associated lung injury. 1 | in a recent issue of the british journal of anaesthesia, moloney and griffiths reviewed clinically pertinent issues surrounding the management of the acute respiratory distress syndrome (ards) patient, particularly as it pertains to the treatment of ventilator induced / associated lung injury (vili). in addition to highlighting the important observations that have contributed to further our understanding of the relationship between the mechanical ventilator and inflammatory lung injury, the authors also offer a concise reappraisal of the clinical strategies used to minimize vili in ards. special emphasis is placed on the theory of biotrauma, which attempts to explain how multi - organ failure may develop in patients who ultimately succumb to this syndrome. |
the lij diabetes nurse champion (dnc) program was designed in 2010 to address the growing number of patients requiring inpatient diabetes education and the training needs of bedside nurses who are increasingly called on to educate these patients. both the american diabetes association and the joint commission have identified the most successful inpatient diabetes programs as those possessing several clinical attributes, including, among others, specific staff education requirements and identified program champions. whereas the joint commission is not specifically referring to diabetes nurse champions, the diabetes champions described here can also function as program champions in achieving improved inpatient glycemic management. nurse participants in the dnc program, who voluntarily enroll, represent all educational backgrounds and diverse ethnic groups and work in all aspects of patient care and on all shifts. a pre - program needs assessment is conducted to identify their specific knowledge deficits with regard to diabetes. the program consists of nine 90-minute sessions employing a variety of educational methods, including lectures, case studies, role - playing, team activities, and hands - on learning. each weekly session is offered three times to enable staff on all shifts to attend. a comprehensive take - home exam is administered at the end of the program to help participants use the resources they have been given in the preceding weeks and to reinforce and synthesize their new knowledge. participants track the number of hours they spend educating patients and staff and are mentored in their direct diabetes patient education so they can eventually take the cde certification exam. it was designed to meet established criteria for the most effective ways to deliver an educational program (i.e., multiple sessions, < 30 participants) and based on a model designed by a cde at a different institution (l. hughes, unpublished observations). participants are encouraged to teach a patient the information they learn each week, so they continually build on their knowledge and skills each week of the program. many of the sessions have a hands - on component during which participants monitor their own blood glucose, operate insulin pens and insulin pumps, and learn to count the carbohydrate content of foods or meals. these skills are reinforced in class with role - playing, teach - back exercises, and direct observations of patient teaching sessions conducted by one of the two cdes on the diabetes team. the diabetes team endocrinologist and nurse practitioner further reinforce staff knowledge during daily patient rounds. dnc program curriculum the curriculum is based on the american association of diabetes educators (aade) 's aade7 self - care behaviors, which include healthy eating, staying active, monitoring, taking medications, reducing risks, problem - solving, and coping. concrete teaching tools, including injection pads, saline pens, divided plates, glucagon teaching kits, blood glucose meters, monofilaments, and carbohydrate - counting books, are given to participants, who are also supplied with patient - education materials that have been developed by the health system and approved as having the appropriate fourth- to fifth - grade reading level by health literacy staff. these materials are made available on a shared computer drive and thus are available to all staff for distribution to patients. information about all of the health system 's diabetes support groups is also available on the shared drive. the take - home test was initially administered as an in - class exam but was changed to a take - home format to reduce participants ' test - taking anxiety. participants have 1 week to complete the test, which includes multiple - choice and open - ended questions, as well as a 16-question insulin test developed for nurses and physicians at johns hopkins university. given that 39% of all inpatient medication errors in the united states involve insulin, insulin knowledge and safety is a major focus of the program. to this end, a diabetes discharge checklist has also been developed as part of the champion program to assist champions in helping prescribers write appropriate discharge prescriptions for diabetes medications and supplies. aspects of the program were presented at aade national conferences in 2011, 2012, and 2013, and the program has been replicated in eight other hospitals in the north shore long island jewish health system. although this program continues to evolve and is offered in multiple sessions at our institution, not all of the champion programs at other sites within our health system follow the same format, and some are offered in a single - day training session. a study is underway to determine whether one educational format is more effective than others within our system with regard to the number of staff and patients educated or the retention of champions after training. the program has also been adapted into a multidisciplinary diabetes champion (dc) program open to non - nurse health care providers. throughout the entire north shore long island jewish health system, there are 455 diabetes champions, the majority of whom are registered nurses. at the lij site, there are 154 champions from various professional disciplines. including multiple disciplines has enriched the discussions and the depth of knowledge for all participants and is helping to change the culture of our institution with regard to multidisciplinary diabetes care. figure 1 presents data regarding the distribution of lij program participants by their professional disciplines. to date, 134 registered nurses, 2 nurse practitioners, 1 physician, 10 physician assistants, 3 pharmacists, 3 registered dietitians, and 1 physical therapist have completed the program. all inpatient units, as well as the operating room, post - anesthesia care unit, and ambulatory care unit, have at least one diabetes champion. of the nurses who have completed the program, four have become cdes, and three of the four have been hired as inpatient diabetes educators in other health system hospitals. the first multidisciplinary course offered was in 2013 in the clinical decision unit (cdu). the curriculum included more information about acute complications of diabetes such as severe hypoglycemia, diabetic ketoacidosis, and hyperosmolar hyperglycemic state. specialized courses for specific units, such as obstetrics or pediatrics, can be particularly helpful in meeting staff needs for knowledge about diabetes as it relates to the specific needs of their patient population. as more institutions adopt cdus for short - stay patients, this might be a specific model to consider. for this course, we varied not only the curriculum, but also the format to accommodate the schedules of cdu staff members. our cdu program also included some novel approaches to delivering patient education and earmarked some research funds to supply diabetes medications to uninsured, medicaid - eligible individuals. in the first 6 months after the cdu medication project, there was a reduction in the 30-day readmission rate from 48.4% to 7.7% for patients who received free diabetes medications while awaiting medicaid insurance approval. the free medication was coupled with a follow - up ambulatory care unit (acu) medical appointment to achieve this dramatic reduction. the latest group of 52 diabetes champions represents various ethnic groups, and 12 of the participants speak a language other than english. the languages spoken by participants in this group included spanish, french, slovakian, russian, haitian creole, korean, kannada, yoruba, hindi, and malayalam. this is encouraging because type 2 diabetes is disproportionately represented in ethnic and racial minorities, and there is a tremendous need for diabetes education provided in a variety of languages. in new york state, 90% of cdes are non - hispanic whites, and only 17% speak a language other than english. interest and enrollment in the program continues to grow, as evidenced by figure 1. this speaks to the current epidemic of diabetes, the increasing number of inpatients affected by this chronic condition, and the growing number of patients receiving their diabetes diagnosis while they are inpatients. with diabetes champions present throughout the hospital, more patients are receiving some degree of diabetes education than could ever have been seen by only the two staff cdes. although we can track the number of patients on the individual units receiving diabetes education (retrospectively, on a monthly basis), we do not yet have the statistical program in place to allow us to pull these data in a real - time format. on a weekly basis, we receive calls from champions who are questioning orders potentially made in error (e.g., physician orders to hold basal insulin for patients on npo status). such errors have been equally divided among prescribing, dispensing, and administering insulin, as research has shown is common. other common potential errors that have been averted by watchful champions have included insulin pens being prescribed for discharge without a corresponding prescription for pen needles and more serious errors such as a 70/30 premixed insulin being prescribed with meals in addition to glargine basal insulin at bedtime. figure 2 shows the number of actual medication errors reported in the past 3 years. the 2010 and 2011 programs occurred in the summer and fall, respectively. in 2012 and all subsequent years, the programs began in january to maximize the measureable annual impact of the program. although we did anticipate the benefits of more direct patient education, we did not expect the effect the champion program has had on insulin errors, including the prevention of insulin pumps being disconnected before basal insulin has been prescribed. by increasing staff knowledge, our first dc clinical update symposium, which was open to all health system diabetes champions, was held this spring. this full - day event, which participants gave an average 4.9 rating on a 5-point evaluation scale, gave champions the opportunity to discuss best practices with their colleagues from other hospitals within the health system. sessions included presentations about diabetes and depression and how to recognize depression in patients ; blood glucose pattern analysis ; a role - play exercise for diabetes foot exams ; and an overview of diabetes applications for mobile devices. some topics went beyond the reach of the basic diabetes champion course to help prepare champions to take their cde certification exam. an existing monthly journal club usually has only 8 - 10 participants because of timing and scheduling conflicts, much the same as that reported by the albert einstein program. a more flexible, internet - based option with ceus is in development to increase access to, and participation in, this resource. another major project in development is a return - on - investment analysis of a possible change that would allow interested nurse champions to receive no patient assignment for their 13th shift of each month, allowing them to spend a full 12-hour shift seeing diabetes patients in need of education. this would increase their direct hours of patient education, shortening the time before they are eligible to take the cde certification exam. it would also give existing cdes the opportunity to provide more direct mentorship to further the champions ' professional development needs and goals. the original model of the albert einstein program included the nurse champions shadowing the cde, but this was abandoned because of scheduling conflicts the overall program goal is to continue to evolve and find the most efficient ways to develop more diabetes educators. some of the technologies employed so far include online scheduling, through which participants can indicate in advance which session time they plan to attend each week, and video recording of the sessions, the product of which can then be shared with staff members who could not officially participate in the course. for example, recommendations regarding which mobile device applications patients have found most useful have been passed on to the champions, who are then able to recommend these products to other patients. in summary, dc programs are an effective way to deliver direct diabetes patient education in the inpatient setting. they can improve quality and patient safety and help to close gaps in care in the transition from inpatient to outpatient settings. further research is needed to determine which program format results in the greatest sustainability of diabetes champions within the institution. | in briefthis article describes a diabetes champion program in its fifth year of operation. this educational intervention was designed to increase direct diabetes patient education and has grown into a vehicle for improving quality of care and patient safety and reducing gaps in the transitions of care. |
bodybuilding is the use of progressive resistance exercise, and it involves drastic reductions in body fat while maintaining muscle mass. there is a tendency to think that there is a magic powder or supplement that will give you the physique of your dreams, but there is no substitute for hard work, commitment, and good diet. it has beneficial effects also in terms of lower long - term disease risk but doing unscrupulously can be harmful and may lead to more severe illnesses, injury and even mortality. a 35-year - old male who presented to us with a history of severe pain in both thigh and unable to walk for last around 3 days after having strenuous exercise activity in the gym. he also had vomiting and decrease oral in take thereafter. though he was a regular visitor to the gym but he did a new exercise in the form of more than 500 sit - ups. before visiting us, he took consultation outside and received analgesics but little relief in pain. on admission, he was conscious, maintaining vitals and having pain and tenderness in both thigh. laboratory evaluation at time of admission showed hemoglobin (hb) 14.8 g / dl, total leukocyte count 12,400, urea 128 mg / dl, serum creatinine 4.8 mg / dl, sodium 133 mmol / l, potassium 4.55 mmol / l, calcium 7.8 mg / dl, creatine phosphokinase (cpk) 87,000 u / l, total bilirubin 1.2 mg / dl, serum glutamic oxaloacetic transaminase (sgot) 1160 u / l, serum glutamic pyruvic transaminase (sgpt) 404. diagnosis of rhabdomyolysis due to strenuous exercise leading to acute kidney injury was made based on the temporal profile, clinical presentation, lab reports and ruling out other common causes like severe sepsis. though he was improving, but he opted to shift to some other hospital of his nearby area. a 28-year - old male who was regular at the gym for bodybuilding presented to us with 1-day history of epigastric pain radiating to back, recurrent vomiting and abdominal distension. on admission his heart rate was 160 per min regular, respiratory rate was around 40 per min, blood pressure 100/80 mmhg, abdomen was diffusely distended and mildly tender. initial lab evaluation showed hb 18.7 g / dl, total leukocycte count 6200, serum creatinine 0.8 mg / dl, urea 34 mg / dl, sodium 138, potassium 4.3 mmol / l, total protein 6.1 g / dl, albumin 3.7 g / dl, sgot 29, sgpt 26, alkaline phosphatase 145, lipase 104, serum amylase 760 u / l, prothrombin time (international normalized ratio) 1.23, activated partial thromboplastin time 38 s, serum calcium 9.4 mg / dl, serum triglyceride 148 mg / dl. arterial blood gas analysis reveal ph 7.33, pco235, po280 mmhg on oxygen through face mask at 8 l / min, lactate 3.7 mmol / l. on ultrasonography abdomen, pancreas was swollen with mild peritoneal collection, diffuses inflammatory changes with no evidence of gall stones or biliary sludge. on detailed history including alcohol intake and examination we could not find obvious reason of acute pancreatitis other than his history of taking androgenic anabolic steroids (aas) and protein supplements for body building since other less common causes which includes hypercalcemia, hypertriglyceridemia or post - endoscopic retrograde cholangiopancreatography was also not there and corticosteroids are known etiological agent for acute pancreatitis. after initial improvement over the period of 57 days patient 's condition start worsening again, and he was shifted to bigger center where he died after 23 days. an 18-year - old male presented to us with a history of 1-day of stiffness of jaw, neck, back and difficulty in swallowing. there was also associated history of sweating over face and neck. over the next few hours, he developed frequent sudden jerky movement of the body. as he developed spasm and hypoxia, he was requiring paralyzing agent in addition to diazepam infusion because of severe and frequent tetanic spasm. there was no history of fever, no evidence of poisoning or trauma, but he was on self - medication as part of body building and taking regular intramuscular injection of anabolic steroid. in the absence of any other clue, we attributed tetanus due to intramuscular injections. he remained on a ventilator with a paralyzing medication for more than 4 weeks with daily interruption of paralysis to observe for tetanic spasm. a 35-year - old male who presented to us with a history of severe pain in both thigh and unable to walk for last around 3 days after having strenuous exercise activity in the gym. he also had vomiting and decrease oral in take thereafter. though he was a regular visitor to the gym but he did a new exercise in the form of more than 500 sit - ups. before visiting us, he took consultation outside and received analgesics but little relief in pain. on admission, he was conscious, maintaining vitals and having pain and tenderness in both thigh. laboratory evaluation at time of admission showed hemoglobin (hb) 14.8 g / dl, total leukocyte count 12,400, urea 128 mg / dl, serum creatinine 4.8 mg / dl, sodium 133 mmol / l, potassium 4.55 mmol / l, calcium 7.8 mg / dl, creatine phosphokinase (cpk) 87,000 u / l, total bilirubin 1.2 mg / dl, serum glutamic oxaloacetic transaminase (sgot) 1160 u / l, serum glutamic pyruvic transaminase (sgpt) 404. diagnosis of rhabdomyolysis due to strenuous exercise leading to acute kidney injury was made based on the temporal profile, clinical presentation, lab reports and ruling out other common causes like severe sepsis. though he was improving, but he opted to shift to some other hospital of his nearby area. a 28-year - old male who was regular at the gym for bodybuilding presented to us with 1-day history of epigastric pain radiating to back, recurrent vomiting and abdominal distension. on admission his heart rate was 160 per min regular, respiratory rate was around 40 per min, blood pressure 100/80 mmhg, abdomen was diffusely distended and mildly tender. initial lab evaluation showed hb 18.7 g / dl, total leukocycte count 6200, serum creatinine 0.8 mg / dl, urea 34 mg / dl, sodium 138, potassium 4.3 mmol / l, total protein 6.1 g / dl, albumin 3.7 g / dl, sgot 29, sgpt 26, alkaline phosphatase 145, lipase 104, serum amylase 760 u / l, prothrombin time (international normalized ratio) 1.23, activated partial thromboplastin time 38 s, serum calcium 9.4 mg / dl, serum triglyceride 148 mg / dl. arterial blood gas analysis reveal ph 7.33, pco235, po280 mmhg on oxygen through face mask at 8 l / min, lactate 3.7 mmol / l. on ultrasonography abdomen, pancreas was swollen with mild peritoneal collection, diffuses inflammatory changes with no evidence of gall stones or biliary sludge. on detailed history including alcohol intake and examination we could not find obvious reason of acute pancreatitis other than his history of taking androgenic anabolic steroids (aas) and protein supplements for body building since other less common causes which includes hypercalcemia, hypertriglyceridemia or post - endoscopic retrograde cholangiopancreatography was also not there and corticosteroids are known etiological agent for acute pancreatitis. after initial improvement over the period of 57 days patient 's condition start worsening again, and he was shifted to bigger center where he died after 23 days. an 18-year - old male presented to us with a history of 1-day of stiffness of jaw, neck, back and difficulty in swallowing. there was also associated history of sweating over face and neck. over the next few hours, he developed frequent sudden jerky movement of the body. as he developed spasm and hypoxia, he was requiring paralyzing agent in addition to diazepam infusion because of severe and frequent tetanic spasm. there was no history of fever, no evidence of poisoning or trauma, but he was on self - medication as part of body building and taking regular intramuscular injection of anabolic steroid. in the absence of any other clue, we attributed tetanus due to intramuscular injections. he remained on a ventilator with a paralyzing medication for more than 4 weeks with daily interruption of paralysis to observe for tetanic spasm. a 35-year - old male who presented to us with a history of severe pain in both thigh and unable to walk for last around 3 days after having strenuous exercise activity in the gym. he also had vomiting and decrease oral in take thereafter. though he was a regular visitor to the gym but he did a new exercise in the form of more than 500 sit - ups. before visiting us, he took consultation outside and received analgesics but little relief in pain. on admission, he was conscious, maintaining vitals and having pain and tenderness in both thigh. laboratory evaluation at time of admission showed hemoglobin (hb) 14.8 g / dl, total leukocyte count 12,400, urea 128 mg / dl, serum creatinine 4.8 mg / dl, sodium 133 mmol / l, potassium 4.55 mmol / l, calcium 7.8 mg / dl, creatine phosphokinase (cpk) 87,000 u / l, total bilirubin 1.2 mg / dl, serum glutamic oxaloacetic transaminase (sgot) 1160 u / l, serum glutamic pyruvic transaminase (sgpt) 404. diagnosis of rhabdomyolysis due to strenuous exercise leading to acute kidney injury was made based on the temporal profile, clinical presentation, lab reports and ruling out other common causes like severe sepsis. though he was improving, but he opted to shift to some other hospital of his nearby area. a 28-year - old male who was regular at the gym for bodybuilding presented to us with 1-day history of epigastric pain radiating to back, recurrent vomiting and abdominal distension. on admission his heart rate was 160 per min regular, respiratory rate was around 40 per min, blood pressure 100/80 mmhg, abdomen was diffusely distended and mildly tender. initial lab evaluation showed hb 18.7 g / dl, total leukocycte count 6200, serum creatinine 0.8 mg / dl, urea 34 mg / dl, sodium 138, potassium 4.3 mmol / l, total protein 6.1 g / dl, albumin 3.7 g / dl, sgot 29, sgpt 26, alkaline phosphatase 145, lipase 104, serum amylase 760 u / l, prothrombin time (international normalized ratio) 1.23, activated partial thromboplastin time 38 s, serum calcium 9.4 mg / dl, serum triglyceride 148 mg / dl. arterial blood gas analysis reveal ph 7.33, pco235, po280 mmhg on oxygen through face mask at 8 l / min, lactate 3.7 mmol / l. on ultrasonography abdomen, pancreas was swollen with mild peritoneal collection, diffuses inflammatory changes with no evidence of gall stones or biliary sludge. on detailed history including alcohol intake and examination we could not find obvious reason of acute pancreatitis other than his history of taking androgenic anabolic steroids (aas) and protein supplements for body building since other less common causes which includes hypercalcemia, hypertriglyceridemia or post - endoscopic retrograde cholangiopancreatography was also not there and corticosteroids are known etiological agent for acute pancreatitis. after initial improvement over the period of 57 days patient 's condition start worsening again, and he was shifted to bigger center where he died after 23 days. an 18-year - old male presented to us with a history of 1-day of stiffness of jaw, neck, back and difficulty in swallowing. there was also associated history of sweating over face and neck. over the next few hours, he developed frequent sudden jerky movement of the body. as he developed spasm and hypoxia, he was requiring paralyzing agent in addition to diazepam infusion because of severe and frequent tetanic spasm. there was no history of fever, no evidence of poisoning or trauma, but he was on self - medication as part of body building and taking regular intramuscular injection of anabolic steroid. in the absence of any other clue, we attributed tetanus due to intramuscular injections. he remained on a ventilator with a paralyzing medication for more than 4 weeks with daily interruption of paralysis to observe for tetanic spasm. it was suspected on the basis of high - intensity exercise in otherwise routine gym visitor, followed by pain in both thigh with tenderness, deranged lab reports which include very high level of cpk, alanine and aspartate aminotransferases, low level of calcium and after exclusion of other common causes including severe sepsis. rhabdomyolysis may develop in an individual after strenuous activity even who are athlete as it was in our patient. he did more than 500 sit - ups at stretch that too first time along with his daily gym activity. moreover, he took analgesics for muscle pain, which in association with poor oral intake worsens acute kidney damage. exertional rhabdomyolysis is more likely to occur when strenuous exercise is performed under high temperatures and humidity. other factors include improper hydration, inadequate recovery between bouts of exercise, intense physical training, and inadequate fitness levels for beginning high - intensity workouts. as he did his activity in the gym intense physical training and inadequate fitness level for beginning high - intensity workouts appear to be more logical explanation for rhabdomyolysis in our patient. rhabdomyolysis is an important cause of acute renal failure (arf), and main pathophysiological mechanisms are renal vasoconstriction, intraluminal cast formation, and direct myoglobin toxicity. daher ede. reported a similar case of rhabdomyolysis leading to acute kidney injury after strenuous exercise. it was diagnosed on the basis of raised amylase level with ultrasonographic findings of swollen pancreas with inflammatory changes in patient of epigastric pain, which was later confirmed on computed tomography scan. androgenic anabolic steroids have grown in popularity amongst athletics and bodybuilders due to their ability to enhance performance, muscle mass, and aesthetic reasons. pancreatitis as a complication of aas is not much reported but of corticosteroids is well documented. the usual causes of pancreatitis were excluded in our patient on the basis of history, lab reports, and ultrasonography. researchers have recently discovered evidences that suggest anabolic steroids may demonstrate potentially new and serious adverse consequences. evidence obtained from a clinical trial suggests that acute pancreatitis and acute kidney injury can be caused by the use of anabolic steroids like methandrostenolone. reported a case of 50-year- old man who develop acute pancreatitis and acute kidney injury which was attributed to aas. described a case report of multi - organ damage after the use of anabolic steroids. they also suspected that besides hypercalcemia, acute pancreatitis have resulted from overuse of amino acid supplements. arginine was shown to be a potent secretagogue for anabolic hormones in addition to inducing pancreatic acinar damage. it was diagnosed on the basis of typical clinical picture consisting of the jaw, neck, back stiffness and difficulty in swallowing. later on, he developed typical recurrent tetanic spasms, for which he was intubated and kept on mechanical ventilation. he was regularly taking aas intramuscular injection as a self - prescribed and self - injected medication, as part of bodybuilding activity. as the people engaged in bodybuilding are on a continuous rise, with more data collection or planning an observational study will help to better understand this population subset. | bodybuilding is the use of progressive resistance exercise to control and develop one 's musculature. with the rise in number of persons adopting this activity, there is evolving paradigm of illnesses presented to intensive care in this population subset. strict adherence to details of bodybuilding and avoidance of unsupervised medications are essential to prevent untoward effects. |
high levels of 2,3,7,8-tetrachlorodibenzo - p - dioxin (tcdd ; up to 208 pg / g fat) were measured in samples of breast milk collected in 1997 from 64 donors [41 first - time mothers (primiparae) ] living on state farms in southern kazakhstan. tcdd was the major contributor (70%) to the toxic equivalents, matching the congener patterns found in breast milk and serum samples collected in 1994 and 1996 from donors in nearby villages. the highest tcdd levels were found in state farms adjacent to a reservoir (zone a), which receives agricultural runoff from cotton fields. tcdd levels in zone a were significantly higher than levels in a region more distant (zone b ; > 10 miles) from the reservoir (zone a : mean 53 pg / g, n = 17 ; zone b : mean 21 pg / g, n = 24 ; p = 0.0017). levels of tcdd in breast milk and animal - derived foodstuffs were 10 times u.s. levels. body burden and dietary data suggest that exposures to tcdd are chronic, environmental, and long term and may be related to the use of chemicals in cotton agriculture. the data suggest that the most likely source is the use of cotton defoliants contaminated with tcdd, and the most likely pathway for human exposure is via the consumption of contaminated foodstuffs.imagesfigure 1figure 2figure 3 |
|
1. analysis of tumor cases over eight years among the samples for which the department of veterinary pathology, gifu university, received requests for histological examination from other institutions during the eight - year period from 2005 to 2012, we used data only from the institutions located in gifu prefecture to understand the status of tumor development in dogs by breed in the prefecture. 11. distribution of age at the time of diagnosis of tumor cases classified by sex of the requested samples, only tumor cases were extracted for the analysis of age distribution of tumor cases classified by sex. statistical analysis was conducted using jmp11 analysis software (sas institute inc., tokyo, japan), and the mean age by sex and standard deviation were calculated ; the wilcoxon rank sum test was conducted at a significance level of less than 5%.. ratios between benign and malignant tumors by dog breed we calculated the ratios between benign and malignant tumors in dogs by breed for the tumor cases included in this study. the comparison of the ratios of benign and malignant tumors by breed was statistically calculated using the chi - square test with a significance level of less than 5% using r (version 3.2.2). additionally, we performed residual analysis to clarify and confirm this further. classification of tumors in dogs by breed tumors were classified as shown in table 1table 1.tumor classification by breed and incidencetumor sitesno. of casesincidence of tumor sites (%) bgbmdcgckcwdaxfbgrlrmarmixotherpappdpgpomschsibssdszyt1skin and adnexa1,23330.929.533.328.117.630.018.430.441.235.531.534.433.522.830.258.312.135.428.927.526.015.22gastrointestinal system, including oral cavity73318.420.110.011.48.818.617.434.815.519.714.121.516.76.320.617.924.230.820.118.123.115.23mammary glands71618.013.70.017.841.224.341.54.36.412.833.714.415.238.028.67.136.412.310.87.014.933.94not available and other tissue1,30332.736.756.742.732.427.122.630.436.931.920.729.734.632.920.616.727.321.540.247.435.935.7total3,985100100100100100100100100100100100100100100100100100100100100100100tumor incidence by dog breed and tumor site was statistically calculated by the chi - square test. these results indicate that between each dog species and whole dog species has a significant difference in table 1 (p<0.05). additionally, we performed residual analysis to clarify and confirm this further. a significantly high incidence (p<0.05) is indicated by values in bold, and a significantly low incidence (p<0.05) is indicated by values in bold and underlined font. tumors in the skin and adnexa accounted for 30.9% of all tumors, those in the gastrointestinal system adnexa accounted for 18.4%, and mammary gland tumors accounted for 18.0% ; the tumors in these four sites accounted for approximately 70% of all tumors. the incidence of mammary gland tumors was found to be higher in small dogs, such as ck, dax, mar, pap, pd, pom and yt, and lower in large dogs. in reference to the report by brnden.. to analyze the common sites for the development of tumors in dogs by breed, we determined the total number of tumor cases by calculating multiple tumors individually, i.e., when multiple, different types of tumors developed in the same dog, each tumor was separately included in the calculation. however, with regard to breast tumors, since the formation of numerous tumors is common and each tumor is given a different definitive diagnosis, it was difficult to classify each of the tumors separately. therefore, in such cases, only the most malignant tumor among the tissues submitted for pathological examination was selected for calculation. tumor incidence by dog breed and tumor site was statistically calculated by the chi - square test. these results indicate that between each dog species and whole dog species has a significant difference in table 1 (p<0.05). additionally, we performed residual analysis to clarify and confirm this further. a significantly high incidence (p<0.05) is indicated by values in bold, and a significantly low incidence (p<0.05) is indicated by values in bold and underlined font. tumors in the skin and adnexa accounted for 30.9% of all tumors, those in the gastrointestinal system adnexa accounted for 18.4%, and mammary gland tumors accounted for 18.0% ; the tumors in these four sites accounted for approximately 70% of all tumors. the incidence of mammary gland tumors was found to be higher in small dogs, such as ck, dax, mar, pap, pd, pom and yt, and lower in large dogs. the incidence of tumor sites by dog breed was statistically calculated using the chi - square test with a significance level of less than 5% using r (version 3.2.2.). additionally, we performed residual analysis to clarify and confirm this further. analysis of the number of domestic dogs by breed and crude incidence of tumors in dogs in gifu prefecture 21. the number of domestic dogs based on the dogs receiving antirabic vaccination in 2011 in gifu prefecture a request for a questionnaire survey regarding the number of domestic dogs by breed was sent to 42 municipalities through postal mail or email. for the types of dog breed, 20 breeds, including crossbreeds, were selected (table 2table 2.abbreviated terms for the dog breeds included in this study and the number of tumor casesdog breedabbreviated wordno. of tumor casesdachshunddax407golden retrievergr388labrador retrieverlr304shih tzusz281sibasib204welsh corgicg185shetland sheepdogssd171beaglebg139yorkshire terrieryt112maltese dogmar92pugpg84papillonpap79chihuahuacw70schnauzersch65poodlepd63cavalier king charles spanielck34pomeranianpom33bernese mountain dogbmd30french bulldogfb23mixed breedmix713other breedother508total 3,985a) dachshund, schnauzer and poodle : in the original data, these dogs were not classified into miniature or standard. therefore, all of these dogs were calculated as the same type.) in reference to shimamura s report. for the number of domestic dogs by breed, the number of dogs that received antirabic vaccination (rv) was selected, since these data were considered to reflect the current status most appropriately, and the number of domestic dogs for the 20 breeds was investigated for the period from april 2011 to march 2012. although the official data for the number of dogs receiving rv are published by each of the prefectural and municipal veterinarian associations as well as the ministry of health, labour and welfare (mhlw), the figure represents the total number of dogs receiving rv, and the breakdown by dog breed is unknown. a) dachshund, schnauzer and poodle : in the original data, these dogs were not classified into miniature or standard. therefore, all of these dogs were calculated as the same type. 22. the crude yearly incidence of tumors in dogs and the crude yearly incidence of malignant tumors in dogs based on the number of dogs receiving antirabic vaccination in 2011 in gifu prefecture to identify the number of tumor cases in dogs, the tumor cases from veterinary hospitals and clinics located only in gifu prefecture were extracted to calculate the samples for which the department of veterinary pathology of the gifu university received a request for histological examination in 2011, as stated in the previous section. with regard to the dog breeds, 20 breeds were selected, including crossbreeds. the crude incidences of tumors and malignant tumors were calculated in the following manner, using the number of dogs receiving rv in 2011 in gifu prefecture and the data mentioned above. crude incidence of tumors (%) = the number of tumor cases (the above - mentioned data) the number of domestic dogs (number of dogs receiving rv in 2011) 100 crude incidence of malignant tumors (%) = the number of cases of malignant tumor (the above - mentioned data) the number of domestic dogs (number of dogs receiving rv in 2011) 100 the crude incidence of tumors and malignant tumors by dog breed was statistically calculated by the chi - square test with a significance level of less than 5% using r 1. analysis of tumor cases over eight years as of april 2012 (mid - term), there were 131 veterinary hospitals and clinics in practice in gifu prefecture. among them, approximately 23% or 31 hospitals and clinics requested the department of veterinary pathology of the gifu university to conduct tests for tumors in 3,597 cases (1,598 male dogs ; 2,160 female dogs ; and 161 dogs of unknown sex) over the eight - year period from 2005 to 2012. among the total of 3,597 tumor cases that presented for pathological examination requests, 388 cases were found to have more than one tumor, excluding breast tumors, including 277 cases (6.95%) with 2 different types of tumors and 41 cases (1.03%) with 35 different types of tumors. including these multiple tumors, a total of 3,985 tumors distribution of the age at the time of diagnosis of tumor cases classified by sex in the analysis of age in all the samples, the mean age at which a tumor developed was 10.4 3.0 years (mean s.d.) in male dogs and 10.4 2.8 years (mean s.d.) in female dogs, showing no significant difference between males and females (fig. 2.distribution of the age at the time of diagnosis of tumor cases classified by sex. the age of the dogs diagnosed as tumor cases at the time of the examination request is shown in the graph classified by sex. analysis of age of the samples by pathological classification revealed that the mean age of developing tumors in male dogs was 10.4 3.0 years (mean s.d.) and that in female dogs was 10.4 2.8 (mean s.d.), showing no significant difference in the age between males and females.). distribution of the age at the time of diagnosis of tumor cases classified by sex. the age of the dogs diagnosed as tumor cases at the time of the examination request is shown in the graph classified by sex. analysis of age of the samples by pathological classification revealed that the mean age of developing tumors in male dogs was 10.4 3.0 years (mean s.d.) and that in female dogs was 10.4 2.8 (mean s.d.), showing no significant difference in the age between males and females.. ratios between benign and malignant tumors by dog breed the proportion of malignant tumors in all dogs was revealed to be 57.5%. the ratio of malignant tumors was significantly lower (p<0.05) in the following five dog breeds : yorkshire terrier (yt) (32.1%), maltese dog (mar) (42.4%), poodle (pd) (44.4%), shih tzu (sz) (48.0%) and dachshund (dax) (48.2%), while the proportion of malignant tumors was significantly higher in the following seven dog breeds : labrador retriever (lr) (63.2%), welsh corgi (cg) (65.9%), shiba (sib) (68.1%), shetland sheepdog (ssd) (69.0%), chihuahua (cw) (70.0%), beagle (bg) (73.4%) and bernese mountain dog (bmd) (80.0%) (p<0.05) (fig. 3fig. the ratio of tumor and malignant tumors by dog breed was statistically calculated by the chi - square test. the result was chi - squared=130.65, p - value < 2.2e-16. these results indicate that between each dog species and whole dog species has a significant difference in fig. 3 (p<0.05). the bold black line shows the mean of the ratio of malignant tumors in all dogs. : the ratio of malignant tumors was significantly lower in the following five dog breeds : yt (32.1%), mar (42.4%), pd (44.4%), sz (48.0%) and dax (48.2%) (p<0.05), while the ratio of malignant tumors was significantly higher in the following seven dog breeds : lr (63.2%), cg (65.9%), sib (68.1%), ssd (69.0%), cw (70.0%), bg (73.4%) and bmd (80.0%) (p<0.05).). the ratio of tumor and malignant tumors by dog breed was statistically calculated by the chi - square test. the result was chi - squared=130.65, p - value < 2.2e-16. these results indicate that between each dog species and whole dog species has a significant difference in fig. 3 (p<0.05). additionally, we performed residual analysis to clarify and confirm this further. the bold black line shows the mean of the ratio of malignant tumors in all dogs. : the ratio of malignant tumors was significantly lower in the following five dog breeds : yt (32.1%), mar (42.4%), pd (44.4%), sz (48.0%) and dax (48.2%) (p<0.05), while the ratio of malignant tumors was significantly higher in the following seven dog breeds : lr (63.2%), cg (65.9%), sib (68.1%), ssd (69.0%), cw (70.0%), bg (73.4%) and bmd (80.0%) (p<0.05). analysis of the ratios between the benign and malignant tumors by dog breed showed that smaller dogs tended to have a higher proportion of benign tumors. classification of tumors by dog breed in the analysis of the 3,985 tumors in terms of the location of tumor development, tumors were found most often in the skin and surrounding tissues, with 1,233 cases accounting for 30.9%. in particular, the pug (pg) and golden retriever (gr) breeds had the highest incidence of tumors in the skin and surrounding tissues with an incidence of 58.3% and 41.2%, respectively, while yt and pomeranian (pom) had a lower incidence of 15.2% and 12.1%, respectively. gastrointestinal tumors were the second most common tumors and were found in 733 cases accounting for 18.4%. gastrointestinal tumors included the areas from the oral cavity to the anus, and intraoral melanoma was particularly common, accounting for 55% of all gastrointestinal tumors as an intraoral tumor, followed by perianal tumors that accounted for 21%. breast tumors were the third most common tumors and were found in 716 cases that accounted for 18.0%. smaller dog breeds had greater proportion of breast tumors, which accounted for 41.5% in dax, 41.2% in cavalier king charles spaniel (ck), 38.0% in papillon (pap), 36.4% in pom, 33.9% in yt and 33.7% in mar, while medium to large dog breeds had fewer breast tumors, which accounted for 0% in bmd, 7.1% in pug (pg), 6.4% in gr, 7.0% in ssd, 10.8% in sib and 12.8% in lr. with regard to mast cell tumors, they were found more often in the two breeds, pg and bmd, accounting for 46.4% and 23.3%, respectively. analysis of the number of domestic dogs by breed and crude incidence of tumors in dogs in gifu prefecture 21. the number of domestic dogs in gifu prefecture by breed based on the number of dogs receiving rv in 2011 we conducted a questionnaire survey in 42 municipalities in gifu prefecture, and 29 of the 42 (approximately 69%) responded. with regard to the number of domestic dogs, the number of dogs receiving rv during the period from april 2011 to march 2012 was 93,234 according to the gifu veterinary medical association, and information about 76,316 dogs or approximately 82% of the total number of rv dogs was collected through the questionnaire survey. the numbers of domestic dogs in gifu prefecture revealed by this questionnaire survey included 18,357 mixed breeds (mix) (24.1%), 9,609 dax (12.6%), 8,609 sib (11.3%), 5,017 pd (6.6%) and 4,873 cw (6.4%) ; this demonstrated the high popularity of small dog breeds except for mix and sib, while large dog breeds were fewer, namely, 2,312 lr (3.0%) and 1,213 gr (1.6%). the top 5 dog breeds including mix accounted for 60% of all the dogs (table 3table 3.crude tumor incidence and crude malignant tumor incidence by dog breeddog breedregistration volumebreeding ratiosample volumecrude incidence ratemalignant sample volumemalignant crude incidence rate (%) dax9,60912.6710.7430.4sib8,60911.3410.5280.3pd5,0176.680.210.0cw4,8736.4130.390.2lr2,3123.0612.6431.9sz2,0212.6301.5150.7cg1,9272.5573.0402.1pap1,8092.4241.3130.7bg1,6362.1382.3301.8yt1,5542.0231.560.4pom1,4321.910.110.1gr1,2131.6524.3342.8sch1,0611.4161.580.8ssd8771.1222.5151.7mar8311.1172.050.6ck7541.091.260.8pg6520.9142.160.9fb5340.740.740.7bmd1400.2117.996.4mix18,35724.11160.6660.4other11,09814.5860.8470.4total 76,316100.07140.94290.6by calculating the number of domestic dogs and the ratio of each dog breed, crude tumor incidence and crude malignant tumor incidence were analyzed based on the number of samples for each dog breed obtained over a one - year period of time. tumor crude incidence by dog breed was statistically calculated by the chi - square test. the result was " chi - squared=476.01, p - value < 2.2e-16 ". these results indicate that between each dog species and whole dog species has a significant difference in table 3 (p<0.05). additionally, we performed residual analysis to clarify and confirm this further. significantly high incidences are indicated by p<0.05, and significantly low incidences are indicated by p<0.05. the crude tumor incidence was found to be low in dax, sib, pd, cw, pom, mix and other breeds (p<0.05), while it was high in lr, sz, cg, pap, bg, yt, gr, sch, ssd, mar, pg and bmd (p<0.05). the crude incidence of malignant tumors was also calculated in the same manner ; it was found to be low in sib, pd, cw, pom, mix and other breeds (p<0.05), but high in lr, cg, bg, gr, ssd and bmd (p<0.05).). by calculating the number of domestic dogs and the ratio of each dog breed, crude tumor incidence and crude malignant tumor incidence were analyzed based on the number of samples for each dog breed obtained over a one - year period of time. tumor crude incidence by dog breed was statistically calculated by the chi - square test. the result was " chi - squared=476.01, p - value < 2.2e-16 ". these results indicate that between each dog species and whole dog species has a significant difference in table 3 (p<0.05). additionally, we performed residual analysis to clarify and confirm this further. significantly high incidences are indicated by p<0.05, and significantly low incidences are indicated by p<0.05. the crude tumor incidence was found to be low in dax, sib, pd, cw, pom, mix and other breeds (p<0.05), while it was high in lr, sz, cg, pap, bg, yt, gr, sch, ssd, mar, pg and bmd (p<0.05). the crude incidence of malignant tumors was also calculated in the same manner ; it was found to be low in sib, pd, cw, pom, mix and other breeds (p<0.05), but high in lr, cg, bg, gr, ssd and bmd (p<0.05). the crude incidence of tumors in dogs and the crude incidence of malignant tumors in dogs in 2011 in gifu prefecture with regard to the number of samples for which examination was requested from the university during the one - year period (2011), most requests were for mix, with 116 samples, followed by dax with 71, lr with 61, cg with 57, gr with 52 and sib with 41 samples (table 3). using the samples collected for pathological examination, the crude incidences of tumors by dog breed were calculated for reference. our results showed that the crude incidence of tumors was significantly low in pom at 0.1%, pd at 0.2%, cw at 0.3%, sib at 0.5%, dax at 0.7%, and mix at 0.6% (p<0.05), while it was significantly high in pap at 1.3%, sz at 1.5%, yt at 1.5%, sch at 1.5%, mar at 2.0%, pg at 2.1%, bg at 2.3%, ssd at 2.5%, l r at 2.6%, cg at 3.0%, gr at 4.3%, and bmd at 7.9% (p<0.05). in addition, the crude incidence of malignant tumors was calculated in the same manner, and it was significantly low in sib at 0.3%, pd at 0.0%, cw at 0.2%, pom at 0.1%, and mix at 0.4% (p<0.05), and it was significantly high in lr at 1.9%, cg at 2.1%, bg at 1.8%, gr at 2.8%, ssd at 1.7%, and bmd at 6.4% (p<0.05). the analysis of tumor development in dogs by breed in gifu prefecture revealed the following characteristics : common breeds of dogs, such as mix and dax, showed a high number of tumor cases, and uncommon breeds of dogs, such as gr and lr, also showed a high number of tumor cases ; in contrast, common breeds of dogs, such as sib, showed a low number of tumor cases, suggesting the possibility that the crude tumor incidence in dogs varied depending on the dog breed. the analysis of the ratio between benign and malignant tumors by dog breed showed that small dog breeds tended to have a greater proportion of benign tumors. although the ratio of malignant tumors in this study was 57.5%, there was a swiss report in which malignant tumors accounted for 47.07% of all investigated tumors in the survey. this difference was considered to be caused by the differences in the types of dog breeds and breeding environment ; however, further investigation is necessary to clarify this point. with regard to the samples submitted for pathological examination, there is a possibility of potential bias with regard to the collection of the samples, since the primary veterinary hospital or clinic may have sent fewer samples of benign tumors or more samples, of malignant tumors, keeping in mind that the university with regard to analysis of the most commonly developed organ systems, tumors were found most frequently in the skin and surrounding tissues, similar to reports from other countries [7, 10, 14 ], but the organ systems showing a high frequency of tumors after the skin and surrounding tissues, differed slightly from reports from other countries. this is considered to be due to the differences in the types and incidence of dog breeds, e.g., reports from other countries included higher number of large dog breeds. with regard to breast tumors, dogs were divided into the high incidence group, including ck, dax, mar, pap, pd, pom and yt, and the low incidence group, including bmd, gr, lr, mix, pg and ssd. itoh. have also reported that small dog breeds have a lower risk of malignant breast tumors compared to another types of dogs. in some of the reports from other countries concerning breast tumors in dogs, dogs, such as boxer, cocker spaniel, english springer spaniel, dax, pointer, pd and boston terrier, had a higher incidence of breast tumors [14, 16 ] ; further, contrary to the results of our study, there was a report that breast tumors developed more frequently in large dog breeds, such as leonberger, irish wolfhound and bmd. it has been known for some time now that mast cell tumors develop more frequently in the mastiff - type boxer dog breeds. mast cell tumors have been found with a high frequency in pg, bmd and fb, which are related to mastiff - type breeds in the same manner as boxer breeds [21, 23 ], and breeds with a lower frequency for such tumors were also revealed to be ck, pom, ssd and yt. frequently, data registered at municipalities do not reflect the deaths of domestic dogs accurately. therefore, there is a possibility that many dogs as old as 25 years and even older exist in the database, and the research of hayashidani,. also showed that there is a possibility that the data of elderly dogs that are not alive have not been removed from the records. in this study, there were not many domestic dogs older than 20 years ; therefore, the reliability of the municipal data collected in this study was considered to be high. with regard to the fewer domestic dogs younger than 3 years noted in the age distribution, it was probably caused by unregistered younger dogs (rv the performance rate of rv in gifu prefecture has been 79.580.9% every year (2008 to 2011), which was higher than the national mean of 72.8% (2011). this shows the regional characteristics of gifu prefecture, and it was considered that the basic data were thus reliable. the decreasing number of domestic dogs leads to a bias in the age distribution. when more elderly dogs are present than younger dogs, the tumor incidence should be calculated after adjustment for age to be accurate, because higher figures would be noted otherwise. however, at present, it is difficult to obtain information regarding age for each breed from the municipal data, and we therefore decided to investigate the crude tumor incidence. the crude incidence of 0.9% seems to be slightly lower than the tumor incidence reported overseas, ranging from 0.96% to 4.82% [14, 17, 20 ], which may be the influence of basic data. it was considered that the tumor incidence calculated in this study may be lower than the actual incidence, because the performance rate of rv was not 100% of the population, and there is a possibility that the primary institutions may only have sent approximately 24% of the tumor samples for examination. in addition, since the number of dogs with tumors that visit a veterinary hospital (some dogs may not visit a hospital), the percentage of dogs diagnosed with a tumor at veterinary hospitals or clinics (some dog owners do not want to have examinations) and the percentage of cases for which a sample is sent to the university for pathological examination (some samples may be sent to another pathology laboratory) influenced the tumor incidence, it was considered that there is a possibility that the calculation of the crude tumor incidence and crude malignant tumor incidence in this study may have underestimated the reality. to control such bias, measures should be adopted to select target animals randomly in future studies. although the crude tumor incidence calculated by breed may be lower than it should be due to the problems with the size of the population and the number of samples collected, it is considered that the incidence by breed and by organ would not be easily affected by the changes in the number of samples or age distribution. most domestic dogs in japan are of small breeds, such as those kept mainly inside the house ; in our study, only three large dog breeds (lr, gr and bmd) were present among all the 20 selected breeds, which differed largely from the reports from other countries [6, 9, 20 ]. since the crude tumor incidence was affected by the type of breed and the body size, it is considered that the data obtained in this study are unique to japan, where most domestic dogs are small- and medium - sized, differing from data from other countries. it is necessary to investigate the relationship between the breeding environment and the crude tumor incidence in future studies. we consider that, in addition to improving the accuracy of the survey data, it is necessary to promote antirabic vaccination, to utilize the municipal database, and to obtain an accurate number of bred animals by adding an item in the surveys, such as a census, to investigate the status of bred animals. in addition, it is important to use domestic japanese data to manage cancers in dogs in japan, instead of using data obtained from other countries, where the size of the dogs is mostly large, considering the differences in dog size in japan and other countries. | we analyzed the status of tumor development in dogs by breed based on tumor cases that presented to the department of veterinary pathology of the gifu university for diagnostic examinations over eight years (20052012). we also calculated the crude incidence of tumors in dogs by breed based on the results of a survey conducted in 2011 in gifu prefecture. the most common sites of tumor development included the skin, digestive organs and mammary glands. smaller dogs showed a tendency to have a higher incidence of breast tumors. we thus identified dog breeds with a higher crude incidence of tumors (bernese mountain dog, golden retriever, corgi, etc.) and those with a lower crude incidence of tumors (pomeranian, poodle, chihuahua, etc.). unlike the current trends for domestic dogs in the us and europe, japan has a higher number of small dogs as pets ; it is therefore necessary to develop a policy for canine cancer specific to japan. |
rubella, also known as german measles or 3-day measles, is a contagious viral infection caused by rubella virus, an enveloped positive - stranded ribonucleic acid virus that is a member of the family togaviridae,1 genus rubivirus.2 the virus causes a mild rash - like disease that is associated with low - grade fever, lymphadenopathy, and a short - lived morbilliform rash.3 considered a relatively benign infection, rubella virus received considerably little attention after its recognition in 1881 until its association with congenital defects was recognized by an australian ophthalmologist, n mcalister gregg, in 1941.4 transmitted in airborne droplets when infected people sneeze or cough, rubella is an acute, usually mild viral disease traditionally affecting susceptible children and young adults worldwide.2,5,6 rubella infection just before conception and in early pregnancy may result in miscarriage, fetal death, or congenital defects known as congenital rubella syndrome (crs),3,7 which is characterized by multiple defects, particularly to the brain, heart, eyes, and ears. the highest risk of crs is found in countries with high rates of susceptibility to rubella among women of childbearing age, and worldwide an estimated 110,000 babies are born with crs every year.7 there is no specific treatment for rubella, but the disease is preventable by vaccination. although a comprehensive vaccination program in most industrialized regions, such as north america, europe, japan, and australia, has reduced the incidence of the disease in these areas to low levels, vaccination is not carried out in many developing countries,3 such as nigeria. epidemics occur every 610 years, with explosive pandemics occurring every 2025 years.8 epidemics in tropical countries usually pass unrecognized, due to the lack of significant clinical symptoms in affected children.3 two specific antibodies are associated with rubella. the first to appear is immunoglobulin (ig) m antibody, which rises and peaks 710 days after infection and then reduces after several weeks. the igg antibody develops more slowly, but remains positive for life, hence conferring immunity against repeat infection. therefore, the presence of igm antibody indicates a recent infection, while igg antibody indicates an old infection and immunity.9 most publications on the incidence and prevalence of rubella infection conducted in nigeria have been on either igm or igg, but not both.1017 this study aimed at detecting the presence of both anti - rubella igm and igg antibodies in pregnant women attending ahmadu bello university teaching hospital (abuth), zaria, thereby giving a complete picture of the occurrence of the disease among pregnant women in northern nigeria. this study will also help to ascertain possible risk factors associated with the spread of the virus and determine the level of awareness of infection among pregnant women. more importantly, this study, combined with the findings of other studies on rubella in nigeria, will provide information necessary for health care administrators and health care providers in nigeria to address rubella. the study was conducted between the months of june and august 2012 in the antenatal clinic of abuth, shika, zaria, nigeria. abuth is a referral hospital that receives patients from all over kaduna state and some neighboring states like zamfara, katsina, and kano. the study population comprised 160 pregnant women in different trimesters of pregnancy who expressed interest in participating in the study and gave consent. in order to compare prevalence between pregnant and nonpregnant women in the same community, determine if exposure to infection occurs more frequently before or during pregnancy, and also determine if awareness of the infection will be higher in an academic environment, 20 nonpregnant women of childbearing age studying at abu, zaria, nigeria were involved in the study. prior to sample collection, structured questionnaires were administered to all the women to obtain information on medical, obstetric, and sociodemographic characteristics, and also data on possible risk factors and knowledge of rubella. pregnant women were approached consecutively once a week for a period of 7 weeks, while nonpregnant women were approached randomly within the university female hostels for a week. three milliliters of venous blood sample was collected from each of the women using a standard aseptic technique into properly labeled plain bottles. the blood samples were allowed to stand at room temperature to allow for blood clotting, after which samples were transported to the laboratory, centrifuged at 2,500 rpm for 5 minutes, and sera separated. sera were analyzed for anti - rubella igm and igg antibodies using enzyme - linked immunosorbent assay commercial diagnostic kits (diagnostic automation / cortez diagnostics, inc., the results were read by a microplate reader (gf m3000 ; b braun scientific and instrument, uk) and compared in a parallel manner with the calibrator and controls. samples were interpreted as positive if their rubella igm or igg index was equal to or higher than the defined rubella igm or igg index, which was 1. all samples with an index of 0.90 or less were interpreted as negative, and those with an index of 0.910.99 were equivocal. the data obtained from the questionnaires and the results of the laboratory analysis were entered into microsoft excel, analyzed using spss version 16, and reduced to percentiles and figures. the pearson test at a 95% confidence interval and a significance level of 0.05 was used to determine the relationships between the data collected and prevalence rates. the study was conducted between the months of june and august 2012 in the antenatal clinic of abuth, shika, zaria, nigeria. abuth is a referral hospital that receives patients from all over kaduna state and some neighboring states like zamfara, katsina, and kano. the study population comprised 160 pregnant women in different trimesters of pregnancy who expressed interest in participating in the study and gave consent. in order to compare prevalence between pregnant and nonpregnant women in the same community, determine if exposure to infection occurs more frequently before or during pregnancy, and also determine if awareness of the infection will be higher in an academic environment, 20 nonpregnant women of childbearing age studying at abu, zaria, nigeria were involved in the study. prior to sample collection, structured questionnaires were administered to all the women to obtain information on medical, obstetric, and sociodemographic characteristics, and also data on possible risk factors and knowledge of rubella. pregnant women were approached consecutively once a week for a period of 7 weeks, while nonpregnant women were approached randomly within the university female hostels for a week. three milliliters of venous blood sample was collected from each of the women using a standard aseptic technique into properly labeled plain bottles. the blood samples were allowed to stand at room temperature to allow for blood clotting, after which samples were transported to the laboratory, centrifuged at 2,500 rpm for 5 minutes, and sera separated. sera were analyzed for anti - rubella igm and igg antibodies using enzyme - linked immunosorbent assay commercial diagnostic kits (diagnostic automation / cortez diagnostics, inc., the results were read by a microplate reader (gf m3000 ; b braun scientific and instrument, uk) and compared in a parallel manner with the calibrator and controls. samples were interpreted as positive if their rubella igm or igg index was equal to or higher than the defined rubella igm or igg index, which was 1. all samples with an index of 0.90 or less were interpreted as negative, and those with an index of 0.910.99 were equivocal. the data obtained from the questionnaires and the results of the laboratory analysis were entered into microsoft excel, analyzed using spss version 16, and reduced to percentiles and figures. the pearson test at a 95% confidence interval and a significance level of 0.05 was used to determine the relationships between the data collected and prevalence rates. the age of the pregnant women ranged from 18 to 47 years, while that of the nonpregnant women ranged from 17 to 43 years (table 1). the mean age of the pregnant women was 27.8 years, while that of the nonpregnant women was 23.3 years. more than half of the pregnant women (51.2%) were in their second trimester (table 2). reproductive characteristics, such as the number of term deliveries, preterm delivery, live births, stillbirths, spontaneous abortions, surviving children, and malformed children were studied (table 3). the means of term deliveries, preterm deliveries, live births, and surviving children were 2.8 (94 of 160, minimum one, maximum eleven), 1.1 (16 of 160, minimum one, maximum two), 2.7 (92 of 160, minimum one, maximum eleven), and 2.5 (89 of 160, minimum one, maximum eight), respectively ; 33 (20.6%), 14 (8.7%), and four (2.5%) of the pregnant women who had a history of spontaneous abortion, stillbirth, and malformed children, respectively. more than a quarter (28.1%) of the pregnant women had at least five children residing with them, while even more (33.8%) have fewer than five children living with them. most (103 of 160) of the pregnant women were educated up to the tertiary level, and 78 of them were in an occupation that involved children (table 4). of the 160 pregnant women, 26 (16.2%), 23 (14.4%), five (3.1%), and nine (5.6%) had fever, aching joints, rash, and headache, respectively, at the time of the study. none of them had swollen lymph nodes at the back of their neck or behind their ears. similarly, one (5%) of the nonpregnant women had rash, headache, and swollen lymph nodes, while two (10%) had fever and aching joints. only 20 (12.5%) and five (25%) of the pregnant and nonpregnant women, fifteen (9.4%) of the pregnant women claimed to have been vaccinated against rubella, while none of the nonpregnant women had ever received vaccination against rubella (table 5). analysis of the results showed a seroprevalence of 38.8% (62 of 160) and 93.1% (149 of 160) for rubella igm and igg antibodies, respectively, among the pregnant women, and 40% (eight of 20) and 90% (18 of 20) prevalence, respectively, among the nonpregnant women. of the 149 (93.1%) pregnant women that were positive for rubella igg antibody, 59 (39.6%) were also positive for rubella - specific igm antibody while out of the remaining 11 (6.9%) pregnant women that were negative for rubella igg antibody, 3 (27.3%) were positive for rubella igm antibody and the remaining 8 (72.7%) were negative for both igm and igg antibodies. among the nonpregnant women, of the 18 (90%) positive for rubella igg antibody, seven (38.9%) were also positive for rubella igm antibody. of the remaining two negative for rubella igg, one was positive and one negative for rubella igm antibody. because rubella is predominantly a childhood disease, situations that involve or result in having numerous children around examples include polygamy, occupation type, and place of residence (table 5). all the possible risk factors considered in this study were, however, not significant. analysis (igm and igg) showed that age (pregnant women, igm, =8.891, df=5, p=0.113, and igg, =6.010, df=5, p=0.305 ; nonpregnant women igm, =4.549, df=3, p=0.208, and igg, =3.333, df =3, p=0.343), trimester of pregnancy (igm-=0.220, df=2, p=0.896, and igg-=2.745, df=2, p=0.253), reproductive characteristics studied, sociodemographic data gathered, and clinical characteristics observed were not significant risk factors for rubella virus infection for pregnant or nonpregnant women (where applicable), as shown in tables 14 and 6. the level of awareness and knowledge of rubella was very low, despite the fact that the majority of the pregnant women were educated to the tertiary level (figure 1). the age of the pregnant women ranged from 18 to 47 years, while that of the nonpregnant women ranged from 17 to 43 years (table 1). the mean age of the pregnant women was 27.8 years, while that of the nonpregnant women was 23.3 years. more than half of the pregnant women (51.2%) were in their second trimester (table 2). reproductive characteristics, such as the number of term deliveries, preterm delivery, live births, stillbirths, spontaneous abortions, surviving children, and malformed children were studied (table 3). the means of term deliveries, preterm deliveries, live births, and surviving children were 2.8 (94 of 160, minimum one, maximum eleven), 1.1 (16 of 160, minimum one, maximum two), 2.7 (92 of 160, minimum one, maximum eleven), and 2.5 (89 of 160, minimum one, maximum eight), respectively ; 33 (20.6%), 14 (8.7%), and four (2.5%) of the pregnant women who had a history of spontaneous abortion, stillbirth, and malformed children, respectively. more than a quarter (28.1%) of the pregnant women had at least five children residing with them, while even more (33.8%) have fewer than five children living with them. most (103 of 160) of the pregnant women were educated up to the tertiary level, and 78 of them were in an occupation that involved children (table 4). of the 160 pregnant women, 26 (16.2%), 23 (14.4%), five (3.1%), and nine (5.6%) had fever, aching joints, rash, and headache, respectively, at the time of the study. none of them had swollen lymph nodes at the back of their neck or behind their ears. similarly, one (5%) of the nonpregnant women had rash, headache, and swollen lymph nodes, while two (10%) had fever and aching joints. only 20 (12.5%) and five (25%) of the pregnant and nonpregnant women, respectively, had knowledge of rubella and how it could be transmitted. fifteen (9.4%) of the pregnant women claimed to have been vaccinated against rubella, while none of the nonpregnant women had ever received vaccination against rubella (table 5). analysis of the results showed a seroprevalence of 38.8% (62 of 160) and 93.1% (149 of 160) for rubella igm and igg antibodies, respectively, among the pregnant women, and 40% (eight of 20) and 90% (18 of 20) prevalence, respectively, among the nonpregnant women. of the 149 (93.1%) pregnant women that were positive for rubella igg antibody, 59 (39.6%) were also positive for rubella - specific igm antibody while out of the remaining 11 (6.9%) pregnant women that were negative for rubella igg antibody, 3 (27.3%) were positive for rubella igm antibody and the remaining 8 (72.7%) were negative for both igm and igg antibodies. among the nonpregnant women, of the 18 (90%) positive for rubella igg antibody, seven (38.9%) were also positive for rubella igm antibody. of the remaining two negative for rubella igg, because rubella is predominantly a childhood disease, situations that involve or result in having numerous children around were considered in this study as possible risk factors. examples include polygamy, occupation type, and place of residence (table 5). all the possible risk factors considered in this study were, however, not significant. analysis (igm and igg) showed that age (pregnant women, igm, =8.891, df=5, p=0.113, and igg, =6.010, df=5, p=0.305 ; nonpregnant women igm, =4.549, df=3, p=0.208, and igg, =3.333, df =3, p=0.343), trimester of pregnancy (igm-=0.220, df=2, p=0.896, and igg-=2.745, df=2, p=0.253), reproductive characteristics studied, sociodemographic data gathered, and clinical characteristics observed were not significant risk factors for rubella virus infection for pregnant or nonpregnant women (where applicable), as shown in tables 14 and 6. the level of awareness and knowledge of rubella was very low, despite the fact that the majority of the pregnant women were educated to the tertiary level (figure 1). this value is similar to the 97.9% prevalence reported by mohammed in zaria, 96.1% prevalence reported by tamer in the western region of turkey, and 88.6% prevalence reported by fokunang in cameroon. the high prevalence obtained may have been due to a sustained infection and the development of antibodies to rubella virus. this suggests that rubella virus is prevalent in the study area and that the majority of the pregnant women had previously been exposed to the virus. the figure obtained in this study is, however, much higher than the 53%, 7%, 68.5%, 54.1%, and 76% reported in other parts of nigeria by onakewhor and chiwuzie,11 agbede,12 bamgboye,13 bukbuk,14 and onyenekwe in benin city, ilorin, ibadan, maiduguri, and lagos, respectively. this indicates that the distribution of rubella virus across nigeria varies for reasons that could possibly be climatic. the development of igg antibody is an effort made by the immune system to help neutralize the virus. therefore, it is correct to assume that the pregnant women that had igg antibodies are immune. a clearer picture was, however, seen when the seroprevalence of igm antibody to rubella virus was also considered. significantly, 36.9% of these pregnant women also had igg antibody, suggesting either reinfection or resolving primary infection and that they were not actually immune as concluded earlier, but were still in the recovery stage, although this was not confirmed with an avidity test. most of these women were in their second and third trimesters of pregnancy, suggesting that they were infected earlier in pregnancy, as virtually all infected persons should have developed igg antibodies by 30 days postinfection.20 these pregnant women s fetuses should therefore not be excluded from the risk of crs. the 38.8% prevalence obtained is much higher than any that has been reported in nigeria. ogbonnaya,16 onakewhor and chiwuzie,11 pennap,17 and agbede reported prevalences of 6.8%, 10%, 4.2%, and 1.1% in abia state, benin city, makurdi, and ilorin, respectively. the high prevalence obtained in the present study suggests the occurrence of an outbreak during the time of the study that might have gone unnoticed, as outbreaks of rubella may not always be recognized in developing countries, such as nigeria, and rubella - induced rashes are often misdiagnosed. the result goes further to confirm the reported alarmingly increased incidence of rubella in nigeria between 2009 (234 cases) and 2011 (3,691 cases) by the world health organization.21 between 2010 and 2011, there was an eightfold increase in the number of rubella cases from 450 to 3,691 and then a decline in cases, with 239 and 88 cases, respectively, reported in 2012 and 2013. the nonpregnant women also had high prevalence of igg and igm antibodies of 90% and 40%, respectively. the 90% igg antibody prevalence is much higher than the 77% prevalence reported by onyenekwe in nonpregnant women in lagos. however, they observed similar prevalence in pregnant (76%) and nonpregnant women (77%), as also noted in the present study. seeing as nonpregnant women were involved in the study in order to determine if the risk of infection was higher before or after pregnancy, results showed that risk of infection was high for both groups. this goes a long way to show that although pregnant women are at a greater risk due to fetal infection, attention should not only be placed on them but on the entire population, as they will serve as carriers and a source of infection, which is also a concern. in addition, the higher prevalence of igm antibody seen in the nonpregnant women further supports the occurrence of an outbreak during the study. just as reported by mohammed,10 the prevalence of rubella antibodies did not increase with age. this was probably due to the high endemicity of the virus in zaria, as it is in constant circulation. as such, age and many other factors do not seem to affect the risk of infection. antibodies were found in all the trimesters of pregnancy, with the highest prevalence being in the second trimester for both antibodies. this agrees with the work of agbede,12 but contrasts with the reports of bamgboye and fokunang,19 which showed the highest prevalence in pregnant women in their first trimester. the highest prevalence observed in the second trimester may have been because most of the pregnant women presented at the antenatal clinic in their fourth and fifth months of pregnancy. the virus is so much in constant circulation that prevalence did not differ much with the reproductive characteristics and sociodemographic data studied. however little, the prevalence of both antibodies was seen to increase with parity and all the other reproductive characteristics studied. such increased prevalence was also seen in the studies carried out by bukbuk and mohammed,10 which showed increased prevalence with parity, but contrasts with the study carried out by agbede,12 which showed a higher prevalence in primigravid women. no previous study has studied the association between the listed reproductive characteristics and risk of infection. however, agbede reported that multigravidity was not a predisposing factor to rubella virus infection, with primigravid women showing higher prevalence. the study carried out by onakewhor and chiwuzie11 also reported higher prevalence in nulliparous women, but in this case with nulliparity being associated with the risk for rubella infection. the result from this study suggests that the reproductive characteristics studied are not significant predisposing factors to rubella infection or immunity. despite the fact that the majority of the pregnant women and all the nonpregnant women were educated up to the tertiary level, the level of awareness and knowledge of rubella and its transmission was very low among the study and control population. this low level of awareness was also seen in the study carried out by mohammed in zaria. this poses a serious problem, as knowledge of a disease and its mode of transmission is important in its prevention and control. with both antibodies, pregnant women who knew about rubella and how it can be transmitted, the infection status of their children, and the availability of possible carriers around them all had a higher prevalence this poses a serious problem, as it is obvious that knowledge of rubella and its mode of transmission do not prevent infection. this emphasizes that vaccination is the best means of prevention, and enlightenment without vaccination will achieve nothing. of the 15 pregnant women who claimed to have been previously vaccinated, eight were positive for rubella igm antibody, indicating recent infection. owing to the fact that women are advised not to become pregnant within 3 months of vaccination, the presence of igm antibodies in these pregnant women was most probably not due to vaccination, and may have been as a result of the women not knowing exactly what they were vaccinated for and confusing it with rubella vaccination, or they simply misunderstood the question. previous studies mostly consisted of pregnant women who had never been vaccinated. for the control population, who were students of a tertiary institution, none of them had ever been vaccinated ; none of them knew their infection status nor did any of them know of possible carriers around them. this is a serious problem, as it is expected that students should be more enlightened, but that was not the case with these women. none of the characteristics considered to be risk factors was a statistically significant predisposing factor to rubella infection. some of the common clinical symptoms associated with rubella virus infection were observed in the pregnant women. they included mild fever, rash, headache, and arthralgia (painful joints). this is similar to the report by agbede,12 who observed that only one pregnant woman complained of swollen lymph nodes. very few of these women were, however, positive for rubella infection (igm antibody), suggesting that the fever and aching joints were due to other factors. this result shows that most of the infected patients were asymptomatic, and none of the clinical symptoms was significantly associated with the risk of infection. the prevalence of rubella igg antibody among pregnant (93.1%) and nonpregnant women (90%) was high, suggesting a sustained infection in the population and indicating endemicity. outbreaks and possibly reinfections are occurring in zaria, and are going unnoticed due to the absence of clinical symptoms. the fetuses of pregnant women in zaria are predisposed to crs due to the presence of igm and igg antibodies. a sustained infection in zaria makes possible risk factors and clinical symptoms that were studied irrelevant, and the awareness level of rubella virus and the infection it causes is very low. us recommendations are for childhood vaccination to prevent epidemics, combined with the vaccination of susceptible nonpregnant adolescent and adult females.11 pregnant women and women attending preconception programs should be screened for rubella, and postpartum vaccination should be done for seronegative women. the low level of awareness emphasizes the need for women to be enlightened about rubella infection, its dangers, and how it can be prevented. as such, rubella should be included in the health talks given to pregnant women in antenatal education programs and women in preconception programs. measures should be taken to ensure that outbreaks do not go unnoticed and are eventually stopped to prevent the free reign of rubella virus. this way, pregnancy can be more accurately monitored. also congenital anomalies and their risk burdens can be better assessed and arrested in good time. during the study, many of the pregnant women presented at the antenatal clinic in the second trimester (about 5 months), making it difficult to adequately assess the risk burdens associated with infection with rubella virus. also, the majority of the pregnant women did not want to take part in the study, saying it was not necessary and they did not need it. us recommendations are for childhood vaccination to prevent epidemics, combined with the vaccination of susceptible nonpregnant adolescent and adult females.11 pregnant women and women attending preconception programs should be screened for rubella, and postpartum vaccination should be done for seronegative women. the low level of awareness emphasizes the need for women to be enlightened about rubella infection, its dangers, and how it can be prevented. as such, rubella should be included in the health talks given to pregnant women in antenatal education programs and women in preconception programs. measures should be taken to ensure that outbreaks do not go unnoticed and are eventually stopped to prevent the free reign of rubella virus. this way, pregnancy can be more accurately monitored. also congenital anomalies and their risk burdens can be better assessed and arrested in good time. during the study, many of the pregnant women presented at the antenatal clinic in the second trimester (about 5 months), making it difficult to adequately assess the risk burdens associated with infection with rubella virus. also, the majority of the pregnant women did not want to take part in the study, saying it was not necessary and they did not need it. | backgroundrubella is a contagious viral infection that in pregnant women leads to the infection of a developing fetus, causing fetal death or congenital rubella syndrome.objectivepregnant women are not routinely screened for rubella in nigeria. epidemiological data on rubella is therefore necessary to create awareness and sensitize health care administrators and providers.materials and methodsa cross - sectional study was carried out at ahmadu bello university teaching hospital between june and august 2012 to determine the prevalence of immunoglobulin m (igm) and immunoglobulin g (igg) antibodies to rubella virus in pregnant women using enzyme - linked immunosorbent assay kits. seroprevalence was compared among 160 pregnant women attending the antenatal clinic of ahmadu bello university teaching hospital and 20 nonpregnant women of childbearing age studying at ahmadu bello university. prior to sample collection, questionnaires were administered to the women to obtain data on sociodemographics, awareness and knowledge of rubella, possible risk factors, and clinical symptoms associated with the viral infection.resultsof the 160 pregnant women, 149 (93.1%) and 62 (38.8%) were positive for anti - rubella igm and igg antibodies, respectively. similarly, of the 20 nonpregnant women, 18 (90%) and eight (40%) were positive for rubella igg and igm antibodies, respectively. none of the possible risk factors studied were significantly associated with infection. age and other sociodemographic factors were of little significance, and awareness of rubella was low.conclusionthe prevalence of rubella was high in both pregnant (93.1%) and nonpregnant women (90%), suggesting sustained transmission, which further suggests endemicity. the presence of rubella igm and igg antibodies in pregnant women predisposes babies to congenital rubella syndrome and emphasizes the need for the initiation of a national rubella vaccination program in nigeria. |
laser - assisted in situ keratomileusis (lasik) is the most popular refractive surgical procedure for the correction of myopia, hyperopia, and astigmatism.1 the procedure is fast, with painless recovery of vision and lack of subepithelial haze, which are mainly due to the creation of a corneal flap with a microkeratome. creating a corneal flap is the most important step for successful lasik.17 however, the use of microkeratome to create a corneal flap increases the risk of intraoperative flap - related complications, such as free flaps, irregular flaps, buttonhole flaps, incomplete flaps, and lacerated flaps.813 many different microkeratomes can be used to create the corneal flap.1429 the moria m2 (moria, antony, france) is a popular compact, automated, plastic, single - use head microkeratome with mechanical stop designed for maximum safety.16,2125 in this study, we evaluated the consistency and reproducibility of flap thickness produced by the moria m2 single - use head 90 microkeratome, designed to create a thin 120 m flap. in this retrospective analysis, 72 (37 right eyes and 35 left eyes) consecutive lasik procedures conducted on 37 patients (20 female and 17 men) for myopia and/or myopic astigmatism, between august 2005 and october 2005, at the excimer laser department of nisa hospital, istanbul, turkey, were evaluated. all patients underwent a complete preoperative ophthalmological examination, including measurement of uncorrected distance visual acuity (udva) and corrected distance visual acuity (dcva), measurement of refraction (manifest, dilated, and wavefront refractions), keratometry, slit lamp examination with fundus evaluation, measurement of corneal topography (orbscan ii ; bausch and lomb, rochester, ny, usa), ultrasonic pachymetry (us-1800 echoscan ; nidek, achi, japan), and measurement of intraocular pressure (ct-60 computerized tonometer ; topcon, tokyo, japan). all patients underwent primary lasik in all eyes by the same surgeon (yk) using the visx star s4 excimer laser system (advanced medical optics inc, santa clara, ca, usa). inclusion criteria were myopia between 1.00 d and 11.00 d, 5.00 d corneal astigmatism, age 18 years, stable refraction for at least 1 year, and central corneal thickness 490 m. patients with history of corneal dystrophy or herpetic eye disease, topographic or clinical evidence of keratoconus or degenerative corneal disorder or warpage from contact lenses, severe dry eye, corneal scarring, any ocular disease (such as glaucoma, uveitis, or collagen vascular diseases), and use of systemic corticosteroids or antimetabolites were excluded. two drops of proparacaine 0.5% (alcaine ; alcon pharmaceuticals ltd, puurs, belgium) were instilled in each eye two times, every 5 minutes before the procedure. eyelashes were isolated using sterile plastic adhesive drapes, and an eyelid speculum was placed. the microkeratome settings (suction ring, flap stop) were chosen according to the steepest k (manufacturer s nomogram), aiming for an optimal flap diameter. the flaps were created with the moria m2 single - use head 90 microkeratome using the moria evolution 2 control unit, and the hinges were positioned superiorly in all cases. the standard speed of pass (speed 2 : 15,000 rpm, 2 seconds of cutting time) was used. a single head - blade montage was used for both eyes, and the right eye was operated on first in all bilateral cases. after the microkeratome pass, the corneal flap was lifted and central residual stromal bed thickness was measured with ultrasonic pachymetry. this value was subtracted from the preoperative central corneal thickness and the difference was taken as the corneal flap thickness. after the ablation, the stromal bed was irrigated with balance salt solution to wash out any debris or epithelial cells and the flap reposed. flap position and centration were checked, and a striae test was performed to ensure proper flap adherence. postoperatively, patients were given prednisolone acetate 1%, and ofloxacin 0.3% drops four times a day for 2 weeks and artificial tears solution (single use) six times a day for 1 month. the study was approved by the ethical committee of the istanbul medipol university and performed as per the tenets of the declaration of helsinki. written informed consent was taken from all patients regarding the surgical intervention and inclusion in the study. two - tailed independent - samples t - test was used for independent events and paired - samples t - test was used for dependent events. in addition, pearson and spearman s rank correlation coefficients were used for the linear correlation between parameters depending on the normality of the data. in this retrospective analysis, 72 (37 right eyes and 35 left eyes) consecutive lasik procedures conducted on 37 patients (20 female and 17 men) for myopia and/or myopic astigmatism, between august 2005 and october 2005, at the excimer laser department of nisa hospital, istanbul, turkey, were evaluated. all patients underwent a complete preoperative ophthalmological examination, including measurement of uncorrected distance visual acuity (udva) and corrected distance visual acuity (dcva), measurement of refraction (manifest, dilated, and wavefront refractions), keratometry, slit lamp examination with fundus evaluation, measurement of corneal topography (orbscan ii ; bausch and lomb, rochester, ny, usa), ultrasonic pachymetry (us-1800 echoscan ; nidek, achi, japan), and measurement of intraocular pressure (ct-60 computerized tonometer ; topcon, tokyo, japan). all patients underwent primary lasik in all eyes by the same surgeon (yk) using the visx star s4 excimer laser system (advanced medical optics inc, santa clara, ca, usa). inclusion criteria were myopia between 1.00 d and 11.00 d, 5.00 d corneal astigmatism, age 18 years, stable refraction for at least 1 year, and central corneal thickness 490 m. patients with history of corneal dystrophy or herpetic eye disease, topographic or clinical evidence of keratoconus or degenerative corneal disorder or warpage from contact lenses, severe dry eye, corneal scarring, any ocular disease (such as glaucoma, uveitis, or collagen vascular diseases), and use of systemic corticosteroids or antimetabolites were excluded. two drops of proparacaine 0.5% (alcaine ; alcon pharmaceuticals ltd, puurs, belgium) were instilled in each eye two times, every 5 minutes before the procedure. eyelashes were isolated using sterile plastic adhesive drapes, and an eyelid speculum was placed. the microkeratome settings (suction ring, flap stop) were chosen according to the steepest k (manufacturer s nomogram), aiming for an optimal flap diameter. the flaps were created with the moria m2 single - use head 90 microkeratome using the moria evolution 2 control unit, and the hinges were positioned superiorly in all cases. the standard speed of pass (speed 2 : 15,000 rpm, 2 seconds of cutting time) was used. a single head - blade montage was used for both eyes, and the right eye was operated on first in all bilateral cases. after the microkeratome pass, the corneal flap was lifted and central residual stromal bed thickness was measured with ultrasonic pachymetry. this value was subtracted from the preoperative central corneal thickness and the difference was taken as the corneal flap thickness. after the ablation, the stromal bed was irrigated with balance salt solution to wash out any debris or epithelial cells and the flap reposed. flap position and centration were checked, and a striae test was performed to ensure proper flap adherence. postoperatively, patients were given prednisolone acetate 1%, and ofloxacin 0.3% drops four times a day for 2 weeks and artificial tears solution (single use) six times a day for 1 month. the study was approved by the ethical committee of the istanbul medipol university and performed as per the tenets of the declaration of helsinki. written informed consent was taken from all patients regarding the surgical intervention and inclusion in the study. two - tailed independent - samples t - test was used for independent events and paired - samples t - test was used for dependent events. in addition, pearson and spearman s rank correlation coefficients were used for the linear correlation between parameters depending on the normality of the data. in this study, the mean age of the patients was 29.026.23 years (range : 2045 years). the mean preoperative spherical equivalent refraction was 3.12.33 d (range : 0.625 to 10.50 d) in the right, 3.602.31 d (range : 0.75 to 11.00 d) in the left, and 3.552.30 d (range : 0.625 to 11.00 d) in both eyes (figure 1b). the mean preoperative steepest k was 44.071.47 d (range : 40.1246.75 d) in the right, 44.091.52 d (range : 40.0046.62 d) in the left, and 44.081.49 d (range : 40.0046.75 d) in both eyes. the mean preoperative ultrasonic pachymetry thickness was 539.1325.44 m (range : 492581 m) in the right, 54428.37 m (range : 490600 m) in the left, and 54126.82 m (range : 490600 m) in both eyes. orbscan topographic pachymetry thickness was 538.6234.64 m (range : 490651 m) in the right, 539.4835.24 m (range : 490651 m) in the left, and 539.0434.69 m (range : 490651 m) in both eyes. the mean flap thickness was 136.9720.07 m (range : 106192 m) in the right, 131.219.5 m (range : 91192 m) in the left, and 134.1619.85 m (range : 91192 m) in both eyes. there was no correlation between preoperative spherical equivalent refraction and central corneal thickness measured by ultrasonic pachymetry in all eyes (r=0.117, p=0.329), and the difference between the right and left eyes was not significant (t(70)=0.177, p=0.860). a statistically significant negative correlation was found between age and preoperative corneal thickness in all eyes (r=2.48, p=0.036), but no significant correlation was found in the right (r=2.58, p=0.123) and left eye (r=0.19, p=0.912), separately. a thicker cornea, especially for the younger patients, was observed (figure 2). there was no significant correlation between the flap thickness and age (r=0.017, p=0.890), preoperative spherical equivalent (r=0.121, p=0.310), and preoperative steepest k (r=0.162, p=0.173) in all eyes. there were similar results for the right and the left, separately (p>0.05). there was no significant difference in the corneal flap thickness between the right and left eyes (p=0.220). a statistically significant positive correlation was found between preoperative corneal thickness measured by ultrasonic pachymetry and flap thickness (r=0.239, p=0.043) for all eyes (figure 4). however, no significant correlation was found for the right and left eyes, separately. there was no correlation between preoperative orbscan corneal pachmetry result (thinnest of the cornea) and flap thickness (r=0.167, p=0.162). additionally, the difference in the central corneal thickness between orbscan pachymetry and ultrasonic pachymetry results was not significant (paired sample t - test : t(71)= 1.167, p=0.247 ; mean : 539541). creating the corneal flap is one of the most critical steps, and flap thickness is a very important parameter in lasik.2 since pallikaris described the lasik technique, the best flap thickness was considered to be 130160 m.29 one of the possible long - term complications in corneal refractive surgery is postoperative keratectasia, which is characterized by progressive thinning and steepening of the cornea and has severe impact on the patient s vision. a thin flap theoretically decreases the risk of corneal ectasia. on the other hand, when thinner flaps are created, the risk of flap irregularities, buttonholes, and epithelial defects may increase. in addition, flap manipulation may become more difficult and prone to complications, such as folds or striae, and irregular astigmatism may increase.2,7,19,29 contrary to this, prandi reported that complication and retreatment rates were not statistically different among the groups (group 1, flap thickness 100 m ; group 2, flap thickness > 100 m and 550 m, and the mean corneal thickness of the eyes was found to be 56912.85 m (range : 552600 m). the mean flap thickness of those patients was 14022.25 m (range : 98192 m). only six (8.3%) of 72 eyes had a flap thicker than 160 m. only one patient had a flap thickness of 192 m in the right eye and 184 m in the left eye. this patient was younger (age = 24 years) and had a normal corneal thickness (552 m for both eyes) and mild spherical equivalent refraction (right = 3.00 d, left = 3.25 d). steepest k was 46.75 d in the right eye and 46.50 d in the left eye. although there was no statistically significant correlation between flap thickness and the preoperative central corneal thickness in the right and left eyes, we found a positive statistically significant correlation between these two parameters in all eyes (r=0.239, p=0.043). this demonstrated that the thicker corneas were associated with the thicker flaps and the thinner corneas with thinner flaps. similar results were also reported in previous studies.8,16,24,28,29 we found no correlation between other parameters. in this study, all cases had no microkeratome - related major complications, such as incomplete flaps, buttonholes, and free flaps. it should be noted that the number of patients included in this study was limited. the other limitation of our study was the retrospective nature and the lack of more objective flap thickness measurement methods. the moria m2 single - use head 90 microkeratome seems to be safe as no major microkeratome - related complications were found. however, it cut thicker flaps than were intended and the range of flap thicknesses was wide. for this reason, intraoperative pachymetry should be performed to verify that at least 250 m of residual stromal bed remains following the laser ablation. more patients, with possibly comparison of different microkeratomes, are needed to fully evaluate the predictability of flap thickness. | purposethis study aimed to evaluate the accuracy and consistency of corneal flap thickness in laser - assisted in situ keratomileusis (lasik) with the moria m2 single - use head 90 microkeratome.methodsthe central corneal thickness of 72 (37 right, 35 left) eyes of 37 patients was measured by ultrasonic pachymetry preoperatively and intraoperatively after flap cut. the moria m2 single - use head 90 microkeratome was used to create a superior hinged flap in all eyes. the right eyes were always operated on before the left eyes in each patient, using the same blade in all bilateral cases. all patients underwent lasik for myopia and/or myopic astigmatism using visx star s4 platform.resultsthe mean preoperative spherical equivalent refraction was 3.552.30 d (range : 0.625 to 11.00 d), preoperative central corneal thickness by ultrasonic pachymetry was 54126.82 m (490600 m) and steepest k was 44.081.49 d (4046.75 d) in all eyes. the mean flap thickness was 136.9720.07 m (106192 m), 131.219.5 m (91192 m), and 134.1619.85 m (91192 m) in the right, left, and both eyes, respectively. a positive significant relationship was found between flap thickness and preoperative ultrasonic pachymetry thickness. no significant relationship was found between flap thickness and the age, preoperative spherical equivalent, and preoperative steepest k. the difference between the first and second eyes was not significant. there were no major intraoperative and postoperative complications in all eyes.conclusionthe moria m2 single - use head 90 microkeratome cut relatively thicker flaps than were intended. the flap thickness range was quite wide. this was a disadvantage for the accuracy and consistency of corneal flap thickness. |
currently for super - obese individuals, bariatric surgery is the only evidence - based approach that results in clinically significant and sustainable weight loss. with the increasing prevalence of obesity, there is an increased demand for bariatric surgery. subsequently, a large number of patients shall be presenting with the complications of bariatric surgery. a 42-year - old caucasian female underwent laparoscopic roux - en - y gastric bypass in february 2007. she subsequently developed gallstones, a known complication of bariatric surgery due to rapid weight loss. she presented to our unit in february 2012 with a week long history of right upper quadrant pain associated with vomiting. blood tests revealed deranged liver function tests : alkaline phosphatase of 169 u / l and alanine aminotransaminase of 188 u / l. a computed tomographic scan was organized confirming the appearances of a dilated common bile duct and the potential of a calcified stone in the common bile duct. she was managed conservatively with analgesia and ursodeoxycholic acid to attempt to dissolve the stones. her liver function tests and pain improved, and she was discharged with an outpatient magnetic resonance cholangiopancreatography (mrcp). in march 2012, her mrcp showed a dilated common bile duct of 10 mm and two small filling defects suggestive of gallstones. again, this confirmed the dilated common bile duct, but also showed free drainage of bile into the duodenum and no gallstones ; hence, therapeutic interventions were not undertaken. she was referred to the gastroenterologists for further advice, but as of june 2012 she was still symptomatic. ultimately, an endoscopic retrograde cholangiopancreatography (ercp) and sphincterotomy was deemed to be necessary to alleviate her symptoms. owing to the altered anatomy post roux - en - y gastric bypass, this was to be a technical challenge. the bypass of the distal stomach and proximal small bowel is achieved by anastomosis of the gastric pouch and the jejunum known as the roux alimentary limb. the biliary pancreatic limb is then anastomosed to a small bowel. as a result it is technically challenging to perform an ercp in the conventional manner, two subsequent port sites were used : a 5-mm port site in the right upper quadrant and a 10-mm port in the left hypochondrium (fig. 1). stay sutures were placed in a diamond - shaped configuration around the gastrotomy site these can allow both traction and counter - traction. a sterile ercp scope inserted manually through a left 10-mm port site all under laparoscopic visualization. there were no obvious gallstones in our patient (fig. 2). the gastrotomy site was closed with a two layer closure : the first layer as a running stitch and then as a horizontal mattress with 2.0 vicryl. she was admitted for an overnight stay and discharged the following day. upon review of the patient in a routine 6-week follow - up clinic, she was asymptomatic and was discharged back to the care of her general practitioner. with the increased demand for bariatric surgery worldwide, there will be an increased role of endoscopy to diagnose and manage complications. with altered anatomy, the transgastric approach can be used as an access point into the gastrointestinal tract. we have demonstrated that the technique when performed correctly can be a safe and viable option in most district general hospitals, which would certainly have a laparoscopic surgeon and a gastroenterologist on site. | the prevalence of bariatric surgery is increasing worldwide and as a direct consequence, there shall be an increasing number of patients presenting with the complications of bariatric surgery, often to non - specialist units. the authors report a case of a 42-year - old caucasian female who had previous laparoscopic roux - en - y gastric bypass, open cholecystectomy and abdominoplasty presenting with right upper quadrant pain in keeping with retained common bile duct stones. after the failure of conservative management, a laparoscopic - assisted transgastric endoscopic retrograde changiopancreatography and sphincterotomy was performed. we shall be describing our technique. |
human african trypanosomiasis (hat) or african sleeping sickness is a serious life threatening disease. around 60 million people in 36 african countries are currently in constant threat of infection. although the reported number of cases has dropped over recent years, the actual number of unreported cases is estimated to be around 7000080000. hat is caused by infection with trypanosoma brucei, a vector - borne parasite, which is transmitted by the bite of tsetse flies. the symptoms of the disease occur in two main stages. in the first stage, known as the hemolymphatic phase, the parasites multiply in blood, subcutaneous tissues, and lymph, causing headaches, fever, itching, joint pains, and swelling of lymph nodes. in the second stage, or neurological phase, this phase entails confusion, change of behavior, reduced coordination, sensory disturbances, disturbance of sleep cycle, and finally death. most available drugs for hat display severe toxic side effects, require long periods of administration, and/or are expensive due to the logistics to reach rural african areas. further, resistance to all in use drugs has been observed in the laboratory and/or in the field, resulting in an urgent requirement for better, safer, and inexpensive therapeutic alternatives to the current treatments. genetic knockdown studies have identified several proteins that are essential for the survival of the parasite, including members of the protein kinase (pk) family. in trypanosoma brucei pks are essential in many fundamental cellular processes, e.g., proliferation, differentiation, and cell cycle control, and can therefore be considered as potential drug targets for the treatment of hat. in the t. brucei genome there are two kinases that are highly homologous to human glycogen synthase kinase 3 (hsgsk3) : tbgsk3 short and tbgsk3 long. rna interference (rnai) knockdown of tbgsk3 has shown that tbgsk3 short is critical for cell growth, with a role in the control of mitosis and/or cytokinesis. the ability to selectively inhibit tbgsk3 over the off - target hsgsk3 is highly desirable because mouse knockout studies revealed that the disruption of the murine gsk3 gene causes embryonic lethality ; consequently, nonselective inhibitors are not applicable for use in infants and women of child bearing age. from a homology perspective, tbgsk3 is not only very closely related to hsgsk3 but also to other human pks such as cyclin dependent kinase 1 (hscdk1) and cyclin dependent kinase 2 (hscdk2).hscdk2 and hscdk1 are essential for g1/g2 progression and s / m - phase entry of the cell cycle. off - target inhibition of these human kinases will therefore result in cell cycle arrest and reduction of cellular proliferation and as such potentially lead to severe side effects. over the past decade, various groups and pharmaceutical companies have identified multiple series of hsgsk3 inhibitors. recently, astex therapeutics and researchers at the university of osaka have developed a series of aminopyrazoles that are potent inhibitors of hsgsk3. co - crystal structures of this series with hsgsk3 are not available to date ; however, complex structures with the closely related hscdk2 have been determined. in all structures, the pyrazole scaffold forms two hydrogen bonds to the hinge region of hscdk2 (figure 1). further, the nh group of the 3-position amide forms an additional hydrogen - bond interaction to the backbone of leu83. a water - mediated hydrogen bond from the amide carbonyl oxygen atom to the backbone the r residues (figure 2) access the gatekeeper region between the gatekeeper residue phe80 and the catalytic asp145 (figure 1). the r substituents occupy the hydrophobic pocket ii, formed by the backbone of the linker region, leu83, phe82, and side chains of ile10, asp86, and leu134. finally, an intramolecular hydrogen bond between the r - nh and r - carbonyl group is present. the similarity of hscdk2, hsgsk3, and tbgsk3 indicates that aminopyrazoles will also bind into the atp - binding site of the latter enzyme. co - crystal structure (2vu3) of at7519 (carbon atoms in gray) bound to cdk2. key : red sphere, water molecule ; black dashed lines, protein ligand and water ligand hydrogen bonds ; yellow stick, hydrogen atom.. generic binding mode of the r and r substituted aminopyrazole scaffold (carbon atoms in gray). herein, we describe the design, synthesis, and biological evaluation of aminopyrazole inhibitors which bind to tbgsk3 short. the inhibitors were also tested against the closely related off - targets hsgsk3 and hscdk2 and evaluated against a panel of mammalian protein kinases. the most potent compound has nanomolar affinity for tbgsk3 short, is selective over hsgsk3 and hscdk2, and clean in the kinase panel. by using computer - aided molecular modeling enzyme affinity correlated with inhibition of t. b. brucei proliferation, albeit a 100-fold offset in potency, was found. in light of these results, the aminopyrazole derivatives developed by astex therapeutics and yumiko uno. for inhibition of hscdk2 and hsgsk3 enzymes were chosen as a starting point for the investigation of tbgsk3 short inhibitors. aminopyrazoles analogues were generated by substituting at either r or r position (figure 2) using two synthetic routes (scheme 1a, b). reagents and conditions used in routes a and b : (a) trans-4-methoxycyclohexylamine, edc, hobt, dmf, rt ; (b) 10% pd / c, h2, dmf, rt ; (c) rcooh, edc, hobt, dipea, rt ; (d) socl2, meoh, 0c, rt ; (e) 10% pd / c, h2, etoh, rt ; (f) 2,6-dimethoxybenzoylchloride, et3n, dioxane, rt ; (g) naoh, dioxane, h2o, rt ; (h) r2nh2, polystyrene - bound carbodiimide, hobt, acetonitrile, mw, 100 c. a structural model of tbgsk3 was built to assess the differences in the binding sites of tbgsk3 short, hsgsk3, and hscdk2 and to guide ligand design. an overlay of 42 hsgsk3 crystal structures showed that there is low flexibility in the atp binding site. only the regions including phe67 and arg141 showed some mobility. arg141 also spans a number of distinct conformations, including examples where it occupies space in the binding site (1j1b, 1j1c, 1o9u, 2o5k) and therefore could influence docking results. however, to allow for ligands of a significant size, we have used examples with arg141 pointing out of the binding site. therefore, two homology models for tbgsk3 were generated representing both states of phe67. as we were mainly interested in aminopyrazoles with less extended r groups, the crystal structure with phe67 pointing toward the hinge (with structure 1r0e as a representative) the selection of 1r0e instead of other members of this group (with phe67 pointing toward the hinge) was arbitrary. for this analysis, all residues that are located within 6 of the ligand bound to the template structure (1r0e) were considered. the binding pockets of tbgsk3 and hsgsk3 differ by nine amino acid residues (table 1, figure 3a). of the amino acid side chains that point toward the ligand, the most significant differences are the replacement of tyr134 in hsgsk3 with phe103, leu132 with met101, gln72 with leu36, and tyr140 with his109. in total 16 out of 26 amino acids were found to be different (table 1, figure 3b), the most important of these differences being the replacement of lys20 in cdk2 with leu36, phe80 with met101, his84 with pro105, lys89 with arg110, and ala144 with cys170. interestingly, most of the amino acid differences occurred in the hydrophobic pocket ii and the gatekeeper region. therefore, we decided to direct the optimization of the lead scaffold toward suitable interactions with amino acids which are located in these subpockets of the atp binding site. amino acids of hgsk3 or hscdk2 which differ in tbgsk3 short are shown in boldface. superposition of the binding sites of the homology model of tbgsk3 short (blue carbon atoms) with (a) the hsgsk3 crystal structure (pdb code 1r0e) and the solvent accessible surface of tbgsk3 short is shown in light blue. only residues that differ between the binding pockets are shown. the synthesis of r and r substituted aminopyrazole derivatives started from 4-nitro - pyrazole-3-carboxylic acid 1 and is described by two different routes (scheme 1) based on previous work from wyatt. in route reduction of the subsequent intermediate 2 by hydrogenation in the presence of palladium on carbon generated amino pyrazole 3. the conversion to compounds 4a z was accomplished by coupling of 3 with a suitable selection of carboxylic acids. in route b, after esterification of the carboxyl group of 1, the nitro group of intermediate 5 was reduced to afford amine 6. treatment of 6 with 2,6-dimethoxybenzoyl chloride under standard conditions, followed by base hydrolysis of the ester, provided acid 8. in the final step, 8 was coupled with appropriate amines in a microwave reaction using polystyrene - bound carbodiimide to yield final compounds 9a x. twenty - six r substituted aminopyrazole analogues (table 2) were made according to the synthetic route shown in scheme 1a. a range of r groups varying in size and polarity was chosen to probe whether the differences in the gate keeper region between tbgsk3, hsgsk3, and hscdk2 could be exploited to derive selective and potent tbgsk3 inhibitors (figure 3). concentration required to inhibit the growth of t. b. brucei in culture by 50% over 72 h. concentration required to inhibit the growth of mrc5 cells in culture by 50% over 72 h. all compounds showed good potency against tbgsk3 (1000-fold). to rationalize the observed selectivity, all analogues were docked into the binding sites of tbgsk3, hsgsk3, and hscdk2 and their poses were visually analyzed. for most compounds, a binding mode similar to that observed for at7519 in hscdk2 (figure 1) was predicted in tbgsk3, hsgsk3, and hscdk2. one important difference between hscdk2, tbgsk3, and hsgsk3 is the gatekeeper residue (table 1, figure 3a, b). while hsgsk3 and tbgsk3 enzymes have leu or met, respectively, in this position, in hscdk2 phe is present. as a consequence, the gatekeeper region of hscdk2 (located between phe80 and asp145) is more restricted compared to the other two enzymes. this resulted in a higher energy, out of plane conformation of the amide group of 4f when binding into this pocket (figure 4), while a low energy conformation was found when binding into t. brucei and human gsk3 (not shown). further, without induced fit adaptations, the bulky r - substituents such as the 2,6-dimethoxybenzamide group of 4 m, the 2,4,6-trimethoxybenzamide groups 4n, and the phenylaminobenzamide groups of 4k and 4l can only be accommodated by the gatekeeper region of tbgsk3 and hsgsk3 but not the narrower hscdk2 gatekeeper region. these observations might explain the reduced binding affinity of 4f for hscdk2 compared to hsgsk3. of note, this explanation is further supported by the report by wyatt., which found that the aryl groups which are located in the same position need to twist in order to provide potent cdk2 activity docking results suggested that the phenyl ring of compound 4f needs to be significantly twisted out of plane by approximately 60 compared to the amide in order to fit into the gatekeeper region.. all r substituted compounds were tested for their ability to inhibit the proliferation of bloodstream form (bsf) t. b. brucei in culture. as an initial indication of potential toxicity, compounds 4a4z were additionally tested against proliferating human fetal lung fibroblast cells (mrc5 cell line). four compounds (4 g, 4j, 4 m, and 4y) had ec50 values 19-fold), 4x (12-fold), and 4n (> 9-fold), however, the majority of compounds showed a poor selectivity over mrc5 cells. correlation between the inhibition of recombinant tbgsk3 and bloodstream form t. b. brucei proliferation by r substituted aminopyrazole derivatives (4a z). as 4 m was the most potent inhibitor of tbgsk3 and proliferation of t. b. brucei cells, we retained the 2,6-dimethoxybenzamide group at position r for optimization of the r substituent. r substituted aminopyrazole analogues (9a9x) were made according to the synthetic route shown in scheme 1b to explore the structural requirements for improvement of antiparasitic activity and selectivity over the closely related human kinases. the majority of variations led to potent tbgsk3 inhibitors, indicating that chemical diversity at this position was well tolerated (table 3). one of the sar trends observed was that six - membered saturated rings (9c) and seven - membered saturated rings (9d) were favored over their three- and four - membered equivalents (9a and 9b). further, it was noted that the replacement of the cyclohexane of 9c with a phenyl ring or 4-pyridine, to give 9k or 9l, gave a 6-fold decrease in potency against tbgsk3. the 2-pyridine analogue (9 m), on the other hand, was much less active (50-fold) against tbgsk3. homologation of aromatic (9 g) and saturated six - membered (9j) rings by one carbon atom produced inhibitors with 1 nm activity for tbgsk3. for aliphatic side chain derivatives 9r9w, the pentanyl and 1-isopropoxypropanyl analogues had ic50 values of 1 nm. the impact of replacing the amide group (3-position) with carboxylic acid and ester groups was investigated with compounds 8 and 7. compound 8 containing a carboxylate group in the 4-position showed a dramatic loss in activity (ic50 > 50 m). the ester group of compound 7 on the other hand was better tolerated (ic50 0.5 m). interestingly, compared with 4a4z, a majority of r substituted analogues (9a9x) showed selectivity over hscdk2 and hsgsk3. these are the most selective tbgsk3 inhibitors described to date. concentration required to inhibit the growth of t. b. brucei in culture by 50% over 72 h. concentration required to inhibit the growth of mrc5 cells in culture by 50% over 72 h. the predicted binding mode of 9 g in tbgsk3 offers an explanation for the observed selectivity (figure 6). in the highest scoring docking pose, the core scaffold adopts a similar binding mode as observed for at7519 in hscdk2 (figure 1). in addition, the docking results suggested that the hydrophobic pocket ii of tbgsk3 was occupied by the n - benzylamide group of 9 g in such a way that its phenyl moiety formed t - shaped edge - to - face interactions with the side chain of phe103 and hydrophobic interactions with leu36 and ala26. in hgsk3, phe103 is replaced with a tyr (table 1, figure 3a), resulting in steric clash and electrostatic repulsion toward the benzyl moiety of 9 g. further, leu36 is substituted with gln72 in hgsk3 and lys20 in hscdk2, diminishing hydrophobic interactions between the benzyl moiety of 9 g and these residues. overall, these changes together with differences in the gatekeeper region of hscdk2 (see above) are likely to be responsible for the high selectivity of 9 g for tbgsk3 over hgsk3 and hscdk2. similar observations regarding the r group placement and selectivity were also made for compound 9h supporting this model. proposed binding mode of 9 g in the homology model of tbgsk3 (blue carbon atoms) overlaid on the hsgsk3 crystal structure (pink carbon atoms). both ligand and protein are represented as sticks and color coded by atom types. ligand carbon atoms are shown in gray, protein carbon atoms of tbgsk3 are shown in blue, and hsgsk3 carbon atoms in salmon. hydrogen bonds and hydrophobic interactions are shown as black dotted lines, with interaction distances in angstroms. tbgsk3 amino acids which are involved in hydrophobic interactions with the benzyl group are marked in bold. the gold sphere represents the center of the phenyl ring.. the r substituted compounds were tested against bsf t. b. brucei and mrc5 cells. as for the r - substituted analogues, a good correlation between the ec50 and ic50 values and a 100-fold drop in activity between the biochemical and cell assay was observed (figure 7). compound 9c had an ec50 for t. b. brucei of 4 m (table 3). limited selectivity (> 7-fold) over mrc5 cells was achieved with compounds 9c, 9d, 9 g, 9s, and 9 t. it was found that the compounds showed selective inhibition of tbgsk3 over hsgsk3 (> 20-fold) and hscdk2 (> 1200-fold). correlation between the inhibition of recombinant tbgsk3 and bloodstream from t. b. brucei proliferation using r substituted aminopyrazole derivatives (9a x). pk inhibitors frequently inhibit multiple kinases, often leading to off - target toxic effects. to assess the selectivity of the aminopyrazole inhibitors, remaining activity at 10 m concentration was measured for compounds 4f, 4 m, and 4y against a panel of 80 human pks and for compound 9 g against 124 human pks. compounds 4 m and 9 g were found to be highly specific (table 4). compound 4 m inhibited only two pks, namely gsk3 and cdk2, at more than 80%. 9 g showed activity against three pks : gsk3, mapkap - k2, and mink1 at more than 80%. compound 4f was found to inhibit seven pks and compound 4y 15 pks by greater than 80% at 10 m. numbers represent average percentage of activity compared to the control at 10 m. in this table, only kinases with activity values 500-fold) over hscdk2. docking studies provided a number of important insights into the binding modes and the selectivity profile of aminopyrazole derivatives. first, the docking results suggested that if the phenyl ring of compound 4f is planar with the amide group at r position it can not bind into the truncated gate keeper region of hscdk2, defined by phe80 in hscdk2, compared to met101 in tbgsk3. to fit into this region of hscdk2, the phenyl ring needs to significantly twist out of plane of the amide, with a torsion angle of approximately 60, resulting in reduced binding affinity (figure 4). to stabilize this twist, di - ortho - substituents on the r phenyl group are required to cause a steric / electronic clash with the carbonyl of the amide bond. however, this region of the pocket in hscdk2 is narrow (in a plane perpendicular to the hinge backbone and the pyrazole core), only allowing small ortho - substituents (such as in compound 9 g) on the phenyl group. in contrast, the wider gatekeeper regions of hgsk3 and tbgsk3 can tolerate large substituents such as the ortho - dimethoxy groups of compound 4 m or 4n and the ortho - phenylaminobenzamide groups of 4k or 4l. second, the highest increase in selectivity (> 10000-fold) over hscdk2 was achieved by accessing the hydrophobic pocket ii. exploitation of hydrophobic interactions in these two pockets not only reliably increased ligand - binding affinity but also impacted on the selectivity profile of these compounds. on the basis of the biological results of compound 9 g and structural modeling studies, we have shown that selectivity over hsgsk3 can be achieved by exploiting the phe103tyr, leu36gln, and ala26ile active site differences in the hydrophobic pocket ii of tbgsk3 enzyme (figure 6). taken together, the region between the gate keeper residue and the catalytic aspartate of the dfg loop, together with the hydrophobic pocket ii, are the key areas to exploit to achieve high selectivity over hscdk2. the tbgsk3 short enzyme ic50 values correlated well with the t. b. brucei antiproliferative ec50 activities of the described substituted aminopyrazole inhibitors (figures 5 and 7), indicating that the compounds act on target. however, a 100-fold drop in cell activity was observed, compared to that in the tbgsk3 assay (1 m). the calculated physical properties (mw 10000-fold) over hscdk2. with compound 9 g, we have shown that good (330-fold) selectivity over hsgsk3 can be achieved by targeting the hydrophobic pocket ii. in addition, 9 g proved to be highly selective against a panel of 124 human pks, showing > 90% inhibition at 10 m against only one pk, hsgsk3. molecular modeling has also shown that despite overall conservation in sequence and conformation between the three pks (hsgsk3, hscdk2, and tbgsk3), the binding pockets have distinct features that determine their specificity for particular compounds. further, we have shown that enzymatic inhibition correlates well with cell efficacy over a wide range of concentrations and a representative member of this series binds the endogenous tbgsk3 with nanomolar potency, indicating that compounds definitely act on target. however, a general 100-fold drop in activity between target and cellular activities resulted at best in compounds with low micromolar antiparasitic activity. taken together, this data suggests that specific atp competitive hinge binders of tbgsk3 short require low picomolar potency to obtain nanomolar antiproliferative activity against t. brucei. first, non - atp competitive approaches to inhibition of tbgsk3, through irreversible hinge binders or allosteric inhibitors, could be pursued. however, these approaches have potential downsides, through the introduction of a reactive functionality or an increased chance of resistance causing mutations, respectively. second, a polypharmacology approach through the inhibition of a number of essential t. brucei kinases in addition to tbgsk3 could be investigated, although obtaining selectivity over human kinases would be more problematical. however, the aminopyrazole compounds (4a4z and 9a9x) reported here represent an excellent start for chemistry optimization of selective tbgsk3 short inhibitors and an outstanding probe for studying the physiological functions of tbgsk3 short in t. brucei parasites. subsequently, modeler 9.2 was used to build homology models of tbgsk3 short, whereas the hsgsk3 crystal structure (pdb code 1r0e) served as template. modeler was run with default settings, and only the highest - scoring structure was used for further analysis and modeling. flexx 2.0.1 (biosolveit gmbh) was used to dock ligands flexible into protein binding sites. the active sites were defined as the areas within 7 of the co - crystallized ligands of hscdk2 (pdb code 2vu3) and hsgsk3 (pdb code 1r0e) or the equivalent residues in the homology model of tbgsk3. in all three structures, protonation states of amino acids and the orientations of the protons of hydroxyl and amine groups of active - site residues a highly conserved water molecule (h2o 82 in 1r0e or h2o 2134 in 2vu3) was kept in all three protein structures used for docking. docking was carried out using default settings, and only the highest scoring binding modes were visually analyzed. all figures of protein binding sites were prepared using pymol. for compound potency determinations, compounds were solubilized in dmso at a top concentration of 3 mm and serially diluted to achieve 10-point titration of final assay concentrations from 30 m to 0.3 nm with a final dmso concentration of 1% (v / v). the reaction mixtures contained 1 m biotinylated gsp2 substrate, 1 m atp, 3.7 kbq / well [-33p]-atp and 2.5 nm tbgsk3 in the tbgsk3 kinase assay buffer. gsk3 inhibitors were screened for selectivity assessment also against hsgsk3. for hsgsk3 assay, the reaction mixes contained 1 m biotinylated gsp2 substrate, 2 m atp, 7.4 kbq / well [-33p]-atp and 15 nm hsgsk3 in the tbgsk3 kinase assay buffer (25 mm tris - hcl, ph 7.5, 10 mm mgcl2, 5 mm dtt, 0.02% chaps, 2 u / ml heparin). for hscdk2/cyclin a assay, the reaction mixtures contained 1 mm cdk5 biotinylated peptide substrate (biotin - c6-pktpkkakkl), 1 m atp, 7.4 kbq / well [-p]-atp and 2 nm hscdk2/cyclin a in the kinase assay buffer (50 mm tris - hcl, ph 7.5, 10 mm mgcl2, 2 mm dtt, 100 mm nacl, 0.2 mm egta, 0.02% (v / v) brij35). the statistical significance of the compound potency (ic50) was based on the performance of standard molecules which have been tested to a high replication. in the case of tbgsk3 short assay the average pic50 value was 8.26 with a sd (standard deviation) of 0.23. the minimum significant ratio (msr) of 0.4 was evaluated considering the following formula : where sd is the standard deviation and n the number of replicate values routinely used for the assay (2 in our case). this implies that a difference of > 0.4 in pic50 can be considered statistically significant for this assay. in the case of hsgsk3 assay, the standard compound gw8510 was tested 47 times across 5 independent runs, with an average pic50 value of 8.10 and a sd of 0.21. this implies that a difference of > 0.3 in pic50 can be considered statistically significant for this assay. for the hscdk2 assay, the analysis was performed using two different standards (gw8510 and staurosporine) tested respectively five times in a single run and 19 times in 2 independent runs. this implies that a difference of > 0.3 in pic50 can be considered statistically significant for this assay. selected compounds were screened against a panel of mammalian kinases routinely run by the division of signal transduction therapy (dstt) at the university of dundee in duplicate at 10 m. enzymes included in the panel and assay conditions are reported in the literature. all biochemical assays are run below the km for the atp for each enzyme, allowing comparison of inhibition across the panel. measurement of inhibition of the proliferation of mrc5 (human lung fibroblast) cells and t. b. brucei bloodstream stage cells was performed using a modification of the cell viability assay previously described. compounds (50 m to 0.5 nm) were incubated with 2 10 cells / well in 0.2 ml of the appropriate culture medium (mem with 10% fetal bovine serum for mrc5 cells) in clear 96-well plates. plates were incubated at 37 c in the presence of 5% co2 for 69 h. resazurin was then added to a final concentration of 50 m, and plates were incubated as above for a further 4 h before being read on a biotek flx800 fluorescent plate reader. h and c nmr spectra were recorded on either a bruker avance dpx 300 or 500 mhz spectrometer. chemical shifts () are expressed in parts per million (ppm) and coupling constants (j) are in hertz (hz). signal splitting patterns are described as singlet (s), broad singlet (br s), doublet (d), triplet (t), quartet (q), quintuplet (quin), sextuplet (sex), septet (sept), multiplet (m), or combinations thereof. lcms (liquid chromatography mass spectrometry) analyses were performed with either an agilent hplc 1100 series connected to a bruker daltonics microtof or an agilent technologies 1200 series hplc connected to an agilent technologies 6130 quadrupole lcms, and both instruments were connected to an agilent diode array detector. lcms chromatographic separations were conducted with a phenomenex gemini c18 column, 50 mm 3.0 mm, 5 m particle size ; mobile phase / acetonitrile + 0.1% hcooh 80:20 to 5:95 over 3.5 min, and then held for 1.5 min ; flow rate 0.5 ml min. high resolution electrospray measurements (hrms) were performed with a bruker daltonics microtof mass spectrometer. thin layer chromatography (tlc) was carried out on merck silica gel 60 f254 plates using uv light and/or kmno4 for visualization. when applicable, all glassware was oven - dried overnight and all reactions were carried out under dry and inert conditions (argon atmosphere). all in this work synthesized compounds had a measured purity of greater than 95% (measured on analytical hplc - ms system). m data are given below to substantiate the purity and integrity of the compounds. h nmr, c nmr, and hrms experiments were also used to confirm compound identity and purity. a mixture of 4-nitro-3-pyrazolecarboxylic acid (1) (2.33 g, 14.8 mmol), trans-4-methoxy - cyclohexylamine (2.39 g, 18.5 mmol), edc (3.55 g, 18.5 mmol), and hobt (2.50 g, 18.5 mmol) in dmf (75 ml) was stirred at ambient temperature for 16 h. the mixture was reduced in vacuo and partitioned between saturated aqueous sodium bicarbonate and etoac. the organic layer was washed (water, brine), dried (mgso4), and reduced in vacuo to give a yellow oil, which was purified by column chromatography, eluting 0100% etoac in petroleum ether to give 2. h nmr (dmso - d6 dmso - d6) (ppm) 14.02 (s, 1h), 8.73 (s, 1h), 8.57 (d, j = 7.81 hz, 1h), 3.74 (m, 1h), 3.24 (s, 3h), 3.11 (m, 1h), 1.95 (dd, j = 55.8, 10.9 hz, 4h), 1.27 (m, 4h). c nmr (dmso - d6) (ppm) 159.04, 141.49, 132.17, 131.44, 77.40, 55.01, 47.58, 29.67, 29.30. lrms (es) : a solution of 2 (1.13 g, 4.2 mmol) in dmf (100 ml) was treated with 10% palladium on carbon then shaken under hydrogen at room temperature and atmospheric pressure for 5 h. the reaction mixture was diluted with etoac, filtered through celite, washing with further etoac, and the filtrate reduced in vacuo to give crude 3 as brown oil. yield : 982 mg, 98%. h nmr (cd3od) (ppm) 7.23 (s, 1h), 3.84 (m, 1h), 3.37 (s, 3h), 3.23 (m, 1h), 2.07 (dd, j = 45.8, 11.2 hz, 4h), 1.38 (m, 4h). c nmr (meod - d4) (ppm) 165.58, 134.15, 133.13, 118.22, 79.72, 56.15, 48.58, 31.37. lrms (es) : m / z 239 [m + h ]. a mixture of benzoic acid (0.051 g, 0.42 mmol), 3 (0.1 g, 0.42 mmol), edc (0.096 g, 0.5 mmol), and hobt (0.068 g, 0.5 mmol) in dmf (10 ml) was stirred at ambient temperature for 16 h. the mixture was reduced in vacuo and partitioned between saturated aqueous sodium bicarbonate and etoac. the organic layer was washed (water, brine), dried (mgso4), and reduced in vacuo to give a creamy solid 4f, which was purified by column chromatography. evaporation of the appropriate fraction yielded the desired compound as an amorphous solid. h nmr (cdcl3) (ppm) 10.65 (s, 1h), 8.52 (s, 1h), 8.01 (d, j = 7.2 hz, 2h), 7.57 (t, j = 7.2 hz, 1h), 7.51 (m, 2h), 6.86 (d, j = 8.3 hz, 1h), 4.01 (m, 1h), 3.39 (s, 3h), 3.22 (m, 1h), 2.16 (m, 4h), 1.42 (m, 4h). c nmr (cdcl3) (ppm) 164.36, 163.21, 133.54, 133.28, 132.03, 128.83, 127.24, 123.74, 120.82, 78.13, 55.91, 47.48, 30.69, 30.11. hrms (es) : calcd for c18h23n4o3 [m + h ] 343.1765, found 343.1751. h nmr (cdcl3) (ppm) 9.86 (s, 1h), 8.35 (s, 1h), 6.83 (d, j = 8.3 hz, 1h), 3.95 (m, 1h), 3.39 (s, 3h), 3.21 (m, 1h), 2.44 (m, 1h), 2.22 (m, 2h), 2.11 (m, 6h), 1.94 (m, 2h), 1.81 (m, 2h), 1.40 (m, 4h). c nmr (cdcl3) (ppm) 171.61, 163.21, 133.28, 123.22, 122.55 (t, j = 239.4 hz), 120.71, 78.07, 55.91, 47.50, 42.74, 32.85 (t, j = 23.5 hz), 30.35, 25.73. hrms (es) : calcd for c18h27f2n4o3 [m + h ] 385.2046, found 385.2036. h nmr (cdcl3) (ppm) 9.86 (s, 1h), 8.34 (s, 1h), 6.81 (d, j = 8.1 hz, 1h), 4.07 (m, 2h), 3.95 (m, 1h), 3.47 (m, 2h), 3.39 (s, 3h), 3.20 (m, 1h), 2.59 (m, 1h), 2.13 (d, j = 11.0 hz, 4h), 1.91 (m, 4h), 1.40 (m, 4h). c nmr (cdcl3) (ppm) 171.97, 163.30, 133.22, 123.23, 120.71, 78.12, 67.26, 55.92, 47.50, 42.20, 30.64, 30.12, 29.10. lrms (es) : m / z 351 [m + h ]. hrms (es) : calcd for c17h27n4o4 [m + h ] 351.2027, found 351.2011. h nmr (cd3od) (ppm) 8.20 (s, 1h), 7.38 (t, 7.7 hz, 1h), 7.347.26 (m, 1h), 7.187.05 (m, 2h), 3.83 (m, 1h), 3.80 (s, 2h), 3.33 (s, 3h), 3.16 (m, 1h), 2.06 (br d, j = 11.5 hz, 2h), 1.97 (br d, j = 12.0 hz, 2h), 1.34 (m, 4h). c nmr (cd3od) (ppm) 169.57, 164.14 (d, j = 159.5 hz), 134.23, 132.98, 130.64 (d, j = 10.9 hz), 125.75, 123.77, 123.20 (d, j = 18.2 hz), 121.96, 116.48 (d, j = 21.7 hz), 79.69, 56.14, 48.68, 37.61, 31.41, 31.27. hrms (es) : calcd for c19h24fn4o3 [m + h ] 375.1827, found 375.1817. h nmr (dmso - d6) (ppm) 13.13 (s, 1h), 9.76 (s, 1h), 8.15 (s, 1h), 8.00 (d, j = 8.3 hz, 1h), 7.317.23 (m, 2h), 7.02 (d, j = 8.0 hz, 1h), 6.93 (t, j = 7.4 hz, 1h), 3.82 (s, 3h), 3.793.70 (m, 1h), 3.24 (s, 3h), 3.07 (m, 1h), 2.01 (d, j = 11.4 hz, 2h), 1.79 (d, j = 11.4 hz, 2h), 1.45 (m, 2h), 1.21 (m, 2h). c nmr (dmso - d6) (ppm) 167.30, 162.43, 157.02, 132.38, 130.90, 128.59, 123.21, 122.30, 120.44, 119.70, 110.88, 77.70, 55.41, 55.04, 46.70, 38.17, 30.26, 29.73. lrms(es) : m / z 387 [m + h ]. hrms (es) : calcd for c20h27n4o4 [m + h ] 387.2027, found 387.2028. h nmr (dmso - d6) (ppm) 13.18 (br s, 1h), 9.86 (s, 1h), 8.14 (s, 1h), 8.05 (d, j = 7.9 hz, 1h), 7.51 (d, j = 8.2 hz, 2h), 7.36 (t, j = 8.2 hz, 1h), 4.10 (s, 2h), 3.76 (m, 1h), 3.24 (s, 3h), 3.08 (s, 1h), 2.01 (m, 2h), 1.81 (m, 2h), 1.45 (m, 2h), 1.19 (m, 2h). c nmr (dmso - d6) (ppm) 170.16, 162.31, 135.49, 131.62, 129.68, 128.30, 128.10, 122.23, 122.09, 77.68, 55.04, 46.77, 38.23, 30.25, 29.74. hrms (es) : calcd for c19h23cl2n4o3 [m + h ] 425.1142, found 425.1147. h nmr (cdcl3) (ppm) 10.89 (d, j = 12.2 hz, 1h), 8.45 (s, 1h), 8.07 (m, 1h), 7.44 (m, 1h), 7.22 (m, 1h), 7.13 (m, 1h), 6.73 (d, j = 8.3 hz, 1h), 3.96 (m, 1h), 3.29 (s, 3h), 3.11 (m, 1h), 2.05 (m, 4h), 1.31 (m, 4h). c nmr (cdcl3) (ppm) 162.80, 160.84 (d, j = 246.9 hz), 160.53, 133.81 (d, j = 10.9 hz), 131.77, 124.79, 123.19, 121.42, 120.65 (d, j = 10.7 hz), 116.46 (d, j = 21.8 hz), 78.19, 55.88, 47.27, 30.75, 30.14. lrms (es) : m / z 361 [m + h ]. hrms (es) : calcd for c18h22fn4o3 [m + h ] 361.1670, found 361.1645. h nmr (dmso - d6) (ppm) 13.40 (s, 1h), 10.22 (s, 1h), 8.32 (s, 1h), 8.29 (d, j = 8.6 hz, 1h), 7.907.88 (m, 1h), 7.847.81 (m, 1h), 7.787.75 (m, 2h), 3.72 (m, 1h), 3.23 (s, 3h), 3.06 (m, 1h), 2.00 (br d, j = 12.5 hz, 2h), 1.76 (br d, j = 12.5 hz, 2h), 1.45 (m, 2h), 1.14 (m, 2h). c nmr (dmso - d6) (ppm) 163.34, 162.73, 135.06, 133.01, 132.78, 130.73, 128.39, 126.63 (d, j = 5.2 hz) 126.04 (d, j = 29.1 hz), 123.57 (d, j = 276.3 hz), 122.06, 120.30, 77.66, 55.06, 46.97, 30.28, 29.67. lrms (es) : m / z 411 [m + h ]. hrms (es) : calcd for c19h22f3n4o3 [m + h ] 411.1639, found 411.1621. h nmr (cdcl3) (ppm) 10.04 (s, 1h), 8.39 (s, 1h), 7.53 (d, j = 7.6 hz, 1h), 7.39 (t, j = 7.6 hz, 1h), 7.30 (d, 7.7 hz, 1h), 7.25 (t, j = 7.5 hz, 1h), 6.87 (d, j = 8.3 hz, 1h), 3.92 (m, 1h), 3.36 (s, 3h), 3.16 (m, 1h), 2.90 (q, j = 7.6 hz, 2h), 2.08 (br d, j = 10.0 hz, 4h), 1.35 (m, 4h), 1.26 (t, j = 7.6 hz, 3h). c nmr (cdcl3) (ppm) 167.60, 163.29, 142.86, 134.89, 133.19, 130.65, 129.69, 127.15, 126.11, 123.25, 120.94, 78.18, 55.86, 74.45, 30.58, 30.12, 26.44, 15.84. hrms (es) : calcd for c20h27n4o3 [m + h ] 371.2078, found 371.2078. h nmr : (dmso - d6) (ppm) 13.25 (s, 1h), 11.77 (s, 1h), 8.44 (s, 1h), 8.15 (s, 1h), 8.04 (s, 1h), 7.63 (s, 1h), 7.29 (s, 1h), 7.18 (s, 1h), 4.15 (s, 3h), 3.88 (m, 1h), 3.30 (s, 3h), 3.16 (m, 1h), 2.08 (m, 2h), 1.91 (m, 2h), 1.55 (m, 2h), 1.29 (m, 2h). c nmr (dmso - d6) (ppm) 162.43, 160.94, 157.47, 133.49, 131.33, 122.29, 120.83, 120.59, 120.28, 112.32, 77.73, 56.05, 55.05, 46.72, 30.28, 29.83. lrms (es) : m / z 373 [m + h ]. hrms (es) : calcd for c19h25n4o4 [m + h ] 373.1870, found 373.1873. h nmr (dmso - d6) (ppm) 13.32 (br s, 1h), 10.93 (s, 1h), 9.53 (s, 1h), 8.31 (s, 1h), 8.28 (d, j = 8.5 hz, 1h), 7.68 (dd, j = 8.0, 1.4 hz, 1h), 7.43 (m, 1h), 7.337.28 (m, 3h), 7.167.14 (m, 2h), 7.016.96 (m, 2h), 3.82 (m, 1h), 3.35 (s, 1h), 3.25 (s, 3h), 3.09 (m, 1h), 2.03 (br d, j = 12.0 hz, 2h), 1.81 (br d, j = 12.0 hz, 2h), 1.48 (m, 2h), 1.20 (m, 2h). c nmr (dmso - d6) (ppm) 164.84, 162.97, 144.57, 141.62, 132.81, 129.33, 128.04, 122.32, 122.00, 120.01, 119.63, 119.26, 118.30, 116.49, 77.74, 55.06, 46.95, 30.33, 29.73. lrms (es) : m / z 434 [m + h ]. hrms (es) : calcd for c24h28n5o3 [m + h ] 434.2187, found 434.2165. h nmr (dmso - d6) (ppm) 13.35 (br s, 1h), 10.89 (s, 1h), 9.53 (s, 1h), 8.33 (s, 1h), 7.63 (dd, j = 8.1, 1.4 hz, 1h), 7.34 (m, 1h), 7.117.09 (m, 2h), 6.996.97 (m, 1h), 6.87 (m, 1h), 6.82 (dd, j = 8.4, 1.0 hz, 1h), 3.84 (m, 1h), 3.35 (s, 1h), 3.25 (s, 3h), 3.09 (m, 1h), 2.29 (s, 3h), 2.14 (s, 3h), 2.03 (br d, j = 12.0 hz, 2h), 1.82 (br d, j = 12.0 hz, 2h), 1.49 (m, 2h), 1.21 (m, 2h). c nmr (dmso - d6) (ppm) 165.36, 163.08, 147.05, 138.87, 137.74, 132.95, 132.72, 130.25, 127.52, 125.96, 125.74, 122.41, 120.79, 119.98, 117.44, 115.36, 114.63, 77.74, 55.06, 46.95, 30.33, 29.75, 20.25, 13.64. lrms (es) : m / z 462 [m + h ]. hrms (es) : calcd for c26h32n5o3 [m + h ] 462.2500, found 462.2503. h nmr (dmso - d6) (ppm) 13.28 (s, 1h), 9.75 (s, 1h), 8.29 (s, 1h), 8.20 (d, j = 8.4 hz, 1h), 7.39 (t, j = 8.5 hz, 1h), 6.75 (d, j = 8.5 hz, 2h), 3.76 (s, 6h), 3.70 (m, 1h), 3.22 (s, 3h), 3.06 (m, 1h), 2.00 (m, 2h), 1.76 (m, 2h), 1.45 (m, 2h), 1.13 (m, 2h). c nmr (dmso - d6) (ppm) 162.79, 161.21, 156.88, 132.21, 131.08, 122.52, 119.81, 115.03, 104.28, 77.66, 55.81, 55.08, 46.93, 30.29, 29.66. lrms (es) :. hrms (es) : calcd for c20h27n4o5 [m + h ] 403.1976, found 403.1960. h nmr (cd3od) (ppm) 8.36 (s, 1h), 6.17 (s, 2h), 3.84 (s, 3h), 3.82 (s, 6h), 3.35 (s, 3h), 3.22 (m, 1h), 2.08 (m, 4h), 1.36 (m, 4h). c nmr (cd3od) (ppm) 164.90, 164.72, 164.35, 160.74, 134.07, 124.36, 122.58, 108.39, 92.09, 79.74, 57.05, 56.89, 56.62, 48.71, 31.61, 31.40. lrms (es) : m / z 433 [m + h ]. hrms (es) : calcd for c21h29n4o6 [m + h ] 433.2082, found 433.2065. h nmr (dmso - d6) (ppm) 13.24 (s, 1h), 10.89 (d, j = 10.2 hz, 1h), 8.33 (s, 1h), 8.09 (q, j = 8.7 hz, 1h), 8.05 (d, j = 8.4 hz, 1h), 7.39 (m, 1h), 7.24 (m, 1h), 3.82 (m, 1h), 3.25 (s, 3h), 3.10 (m, 1h), 2.02 (d, j = 10.3 hz, 2h), 1.84 (d, j = 11.6 hz, 2h), 1.47 (q, j = 12.0 hz, 2h), 1.22 (q, j = 12.5 hz, 2h). c nmr (dmso - d6) (ppm) 164.3 (q, j = 250.6, 10.9 hz), 162.71, 160.3 (q, j = 250.8, 14.5 hz), 158.03, 133.26, 133.18, 132.82, 122.12, 120.50, 117.39, 117.31, 112.59, 112.42, 104.96, 104.75, 104.52, 79.12, 78.84, 78.58, 77.71, 55.07, 46.89, 30.09, 29.76;. lrms (es) : m / z 379 [m + h ]. hrms (es) : calcd for c18h21f2n4o3 [m + h ] 379.1576, found 379.1567. h nmr (dmso - d6) (ppm) 13.39 (s, 1h), 10.77 (s, 1h), 8.34 (d, j = 8.5 hz, 1h), 8.30 (s, 1h), 7.59 (m, 1h), 7.52 (m, 2h), 3.84 (m, 1h), 3.24 (s, 3h), 3.09 (m, 1h), 2.02 (d, j = 10.7 hz, 2h), 1.81 (d, j = 10.7 hz, 2h), 1.49 (q, j = 11.8 hz, 2h), 1.20 (q, j = 11.8 hz, 2h). c nmr (dmso - d6) (ppm) 162.8, 162.5(q, j = 250.7, 14.4 hz), 160.3, 137.16 127.75, 126.59, 124.12, 122.13, 118.94, 110.2 (q, j = 22.0, 14.5 hz), 107.5 (t, j = 27.0 hz), 77.71, 55.06, 46.99, 30.29, 29.76. lrms (es) : m / z 379 [m + h ]. hrms (es) : calcd for c18h21f2n4o3 [m + h ] 379.1576, found 379.1568. h nmr (cdcl3) (ppm) 10.34 (s, 1h), 8.23 (s, 1h), 7.60 (d, j = 1.9 hz, 2h), 7.31 (t, j = 1.8 hz, 1h), 7.05 (s, 1h), 6.58 (d, 1h), 3.77 (m, 1h), 3.15 (s, 3h), 2.98 (m, 1h), 1.91 (m, 4h), 1.18 (m, 4h). c nmr (dmso - d6) (ppm) 163.12, 161.74, 136.46, 135.73, 131.89, 128.34, 126.03, 125.79, 121.09, 78.10, 55.91, 47.48, 30.69, 30.08. lrms (es) : m / z 411 [m + h ]. hrms (es) : calcd for c18h21cl2n4o3 [m + h ] 411.0985, found 411.0966. h nmr (cdcl3) (ppm) 10.65 (s, 1h), 8.48 (s, 1h), 8.02 (d, j = 8.6 hz, 2h), 7.24 (d, j = 8.6 hz, 2h), 6.84 (d, j = 8.3 hz, 1h), 6.62 (t, j = 73.2 hz, 1h), 4.00 (m, 1h), 3.39 (s, 3h), 3.22 (m, 1h), 2.15 (m, 4h), 1.42 (m, 4h). c nmr (cdcl3) (ppm) 163.28, 163.20, 154.0 (t, j = 2.9 hz), 133.56, 130.28, 129.24, 123.64, 120.74, 119.22, 118.94, 115.47, 112.01, 78.11, 55.94, 47.53, 30.67, 30.12. hrms (es) : calcd for c19h23f2n4o4 [m + h ] 409.1682, found 409.1649. h nmr (cdcl3) (ppm) 10.44 (s, 1h), 8.49 (s, 1h), 7.89 (d, j = 8.8 hz, 2h), 6.85 (d, j = 8.3 hz, 1h), 6.62 (d, j = 8.8 hz, 2h), 4.01 (m, 1h), 3.39 (m, 7h), 3.20 (m, 1h), 2.15 (m, 4h), 2.06 (m, 4h), 1.41 (m, 4h). c nmr (cdcl3) (ppm) 164.74, 163.48, 150.26, 133.26, 128.99, 124.26, 120.52, 119.42, 111.20, 78.20, 55.92, 47.66, 47.39, 30.73, 30.18, 25.46. hrms (es) : calcd for c22h30n5o3 [m + h ] 412.2343, found 412.2338. h nmr (cdcl3) (ppm) 10.48 (s, 1h), 8.47 (s, 1h), 7.90 (d, j = 8.8 hz, 2h), 6.94 (d, j = 8.8 hz, 2h), 6.83 (m, 1h), 4.00 (m, 1h), 3.39 (s, 3h), 3.37 (t, j = 5 hz, 4h), 3.20 (m, 1h), 2.60 (t, j = 5 hz, 4h), 2.38 (s, 3h), 2.14 (m, 4h), 1.41 (m, 4h). c nmr (cdcl3) (ppm) 164.17, 163.44, 153.54, 133.33, 128.81, 124.05, 122.92, 120.61, 114.27, 78.17, 55.92, 54.79, 47.62, 47.41, 46.11, 30.72, 30.17. lrms (es) : m / z 441 [m + h ]. hrms (es) : calcd for c23h33n6o3 [m + h ] 441.2609, found 441.2597. h nmr (cdcl3) (ppm) 10.76 (s, 1h), 8.53 (s, 1h), 7.70 (d, j = 7.5 hz, 1h), 7.66 (d, j = 8.4 hz, 1h), 7.59 (d, j = 0.9 hz, 1h), 7.46 (t, j = 7.8 hz, 1h), 7.33 (t, j = 7.5 hz, 1h), 6.85 (d, j = 8.4 hz, 1h), 4.07 (m, 1h), 3.40 (s, 3h), 3.22 (m, 1h), 2.16 (m, 4h), 1.43 (m, 4h). c nmr (cdcl3) (ppm) 163.03, 156.21, 155.22, 148.18, 133.76, 129.23, 127.56, 127.24, 123.77, 122.59, 121.20, 112.41, 111.23, 78.15, 55.91, 47.41, 30.74, 30.14. hrms (es) : calcd for c20h23n4o4 [m + h ] 383.1714, found 383.1703. h nmr (dmso - d6) (ppm) 13.30 (s, 1h), 11.01 (s, 1h), 8.83 (d, j = 7.0 hz, 1h), 8.37 (s, 1h), 8.15 (d, j = 8.4 hz, 1h), 7.82 (d, j = 8.9 hz, 1h), 7.34 (t, j = 7.7 hz, 1h), 7.09 (t, j = 6.9 hz, 1h), 3.85 (m, 1h), 3.26 (s, 3h), 3.11 (m, 1h), 2.04 (d, j = 10.3 hz, 2h), 1.84 (d, j = 10.7 hz, 2h), 1.49 (m, 2h), 1.23 (m, 2h). c nmr (dmso - d6) (ppm) 162.70, 158.15, 146.85, 141.15, 132.80, 128.99, 124.60, 122.00, 120.08, 119.14, 114.53, 97.79, 77.74, 55.06, 46.95, 30.33, 29.79. lrms (es) : m / z 383 [m + h ]. hrms (es) : calcd for c19h23n6o3 [m + h ] 383.1826, found 383.1812. h nmr (meod - d4) (ppm) 9.57 (d, j = 6.9 hz, 1h), 8.31 (d, j = 8.3 hz, 2h), 7.74 (d, j = 9.0 hz, 1h), 7.57 (td, j = 6.9, 1.2 hz, 1h), 7.19 (t, j = 6.9, 1.2 hz, 1h), 3.94 (m, 1h), 3.39 (s, 3h), 3.27 (m, 1h), 2.12 (m, 4h), 1.50 (m, 2h), 1.39 (m, 2h). c nmr (dmso - d6) (ppm) 162.89, 156.52, 147.37, 136.35, 127.61, 127.41, 122.12, 119.89, 117.57, 117.46, 114.43, 77.71, 55.07, 46.90, 30.30, 29.76. lrms (es) : m / z 383 [m + h ]. hrms (es) : calcd for c19h23n6o3 [m + h ] 383.1826, found 383.1811. h nmr (cdcl3) (ppm) 10.88 (s, 1h), 10.24 (s, 1h), 9.58 (d, j = 6.9 hz, 1h), 8.51 (s, 1h), 7.67 (d, j = 9.0 hz, 1h), 7.41 (t, j = 7.9 hz, 1h), 6.99 (t, j = 6.9 hz, 1h), 6.80 (d, j = 7.9 hz, 1h), 4.01 (m, 1h), 3.39 (s, 3h), 3.21 (m, 1h), 3.02 (s, 3h), 2.14 (m, 4h), 1.41 (m, 4h). c nmr (dmso - d6) (ppm) 162.73, 157.27, 146.18, 145.49, 127.61, 127.42, 122.35, 120.04, 116.31, 114.46, 113.62, 77.74, 55.06, 46.77, 30.24, 29.81, 16.52. lrms (es) : m / z 397 [m + h ]. hrms (es) : calcd for c20h25n6o3 [m + h ] 397.1983, found 397.1972. h nmr (cdcl3) : (ppm) 10.61 (s, 1h), 8.49 (s, 1h), 7.84 (m, 2h), 7.48 (t, j = 7.5 hz, 2h), 7.38 (t, j = 7.4 hz, 1h), 7.31 (t, j = 3.6 hz, 1h), 6.85 (d, j = 8.5 hz, 1h), 6.80 (d, j = 3.6 hz, 1h), 4.07 (m, 1h), 3.40 (s, 3h), 3.22 (m, 1h), 2.16 (m, 4h), 1.42 (m, 4h). c nmr (cdcl3) (ppm) 163.03, 156.39, 155.72, 146.33, 133.74, 129.49, 128.94, 128.80, 124.72, 122.85, 120.91, 117.13, 107.30, 78.18, 55.88, 47.25, 30.78, 30.14. lrms (es) : m / z 409 [m + h ]. hrms (es) : calcd for c22h25n4o4 [m + h ] 409.1870, found 409.1832. h nmr (dmso - d6) (ppm) 13.30 (s, 1h), 11.20 (s, 1h), 8.68 (s, 1h), 8.38 (s, 1h), 8.30 (m, 2h), 8.14 (d, j = 8.4 hz, 1h), 7.587.51 (m, 3h), 3.83 (m, 1h), 3.26 (s, 3h), 3.11 (m, 1h), 2.04 (d, j = 10.5 hz, 2h), 1.84 (d, j = 11.0 hz, 2h), 1.49 (q, j = 12.5 hz, 2h), 1.23 (q, j = 11.5 hz, 2h). c nmr (dmso - d6) (ppm) 162.64, 157.34, 151.99, 150.43, 132.90, 130.23, 128.50, 128.07, 127.92, 126.62, 121.89, 120.02, 77.74, 55.06, 47.00, 30.33, 29.76. lrms (es) : m / z 410 [m + h ]. hrms (es) : calcd for c21h24n5o4 [m + h ] 410.1823, found 410.1807. a 100 ml three - necked round - bottomed flask equipped with a magnetic stirring bar and fitted with a dropping funnel was charged with 4-nitro-1h - pyrazole-3-carboxylic acid (4.0 g, 25.5 mmol) and methanol (40 ml). the flask was cooled to 0 c, and thionyl chloride (2.1 ml, 28.9 mmol) was added to the vigorously stirred solution over a period of 10 min. the mixture was stirred for an additional 12 h at room temperature, after which time tlc indicated complete consumption of the starting acid. the reaction mixture was concentrated under reduced pressure at 40 c and the residue treated with toluene and reconcentrated (3 20 ml) under reduced pressure at 40 c to give methyl ester 5 as an off - white solid. h nmr (dmso - d6) (ppm) 14.39 (br s, 1h), 9.98 (s, 1h), 3.90 (s, 3h). c nmr (dmso - d6) (ppm) 161.15, 138.13, 133.20, 130.90, 52.84. lrms (es) : m / z 172 [m + h ]. a 100 ml round - bottomed flask equipped with digital thermometer and stirrer was charged with 10% palladium on carbon (0.621 g) under argon. in a separate vessel, a slurry of methyl ester 5 (4.42 g, 25.8 mmol) in ethanol (45 ml) was warmed to 35 c to effect dissolution and the solution added to the catalyst under argon. following a nitrogen hydrogen purge sequence, an atmosphere of hydrogen was introduced and the reaction mixture maintained at 30 c until the reaction completion (6 h) was noted by h nmr analysis. following a purge cycle, the reaction mixture under argon was filtered and the liquors concentrated under reduced pressure to give amine 6 as a solid. h nmr (dmso - d6) (ppm) 12.83 (br s, 1h), 7.10 (s, 1h), 4.83 (br s, 2h), 3.78 (s, 3h). c nmr (dmso - d6) (ppm) 160.39, 136.94, 128.43, 115.59, 50.88. lrms (es) : a solution of amine 6 (3.57 g, 25.3 mmol) in 1,4-dioxane (50 ml) under argon was treated with triethylamine (4.3 ml, 31 mmol) followed by 2,6-dimethoxybenzoyl chloride (6.13 g, 30.6 mmol) such that the internal temperature was maintained in the range 2025 c. the reaction mixture was stirred at 25 c until the reaction was complete (12 h) by tlc analysis. the reaction mixture was filtered, the filter - cake washed with 1,4-dioxane, and the combined filtrates progressed to next stage without further isolation. to obtain analytical data for compound 7 and also to determine the yield of this reaction, a 2 g sample was taken out of the homogeneous filtrate solution (total weight of this solution is 91 g). the crude product (192 mg) was purified by column chromatography (dcm / meoh). evaporation of the appropriate fractions yielded finally the desired compound 7 as an amorphous solid (161 mg). a 5 mg sample was used for to obtain analytical data ; the rest was redissolved for use in the next reaction. h nmr (dmso - d6) 13.68 (br s, 1h), 9.16 (s, 1h), 8.31 (s, 1h), 7.41 (t, j = 8.4 hz, 1h), 6.76 (d, j = 8.4 hz, 2h), 3.83 (s, 3h), 3.77 (s, 6h). c nmr (dmso - d6) (ppm) 163.86, 161.55, 157.07, 131.27, 129.97, 123.61, 120.41, 114.66, 104.35, 55.84, 51.63. hrms (es) : calcd for c14h16n3o5 [m + h ] 306.1084, found 306.1081. to a solution of sodium hydroxide (3.32 g, 83 mmol) in water (20 ml) was charged a solution of ester 7 in one portion (7.33 g, 24.0 mmol ; the solution of crude 7 from the previous reaction, plus 156 mg of redissolved pure 7). the reaction mixture was stirred at 25 c until completion as determined by tlc analysis. the reaction mixture was concentrated under reduced pressure at 45 c, the oily residue diluted with water and acidified to ph 1 with concentrated hydrochloric acid, such that the temperature was maintained below 30 c. the resulting precipitate was collected by filtration, washed with water, pulled dry on the filter, and subsequently washed with heptanes. the filter cake was charged to a 200 ml rotary evaporator flask and drying completed azeotropically with toluene. h nmr (dmso - d6) 13.44 (br s, 2h), 9.17 (br s, 1h), 8.29 (s, 1h), 7.40 (t, j = 8.4 hz, 1h), 6.76 (d, j = 8.4 hz, 2h), 3.77 (s, 6h). hrms (es) : calcd for c13h14n3o5 [m + h ] 292.0928, found 292.0920. a mixture of carboxylic acid (50 mg, 0.17 mmol, 1.2 equiv), amine (14 mg, 0.14 mmol, 1.0 equiv), hydroxybenzotriazole (19 mg, 0.14 mmol, 1.0 equiv), polymer supported - carbodiimide (105 mg, 0.14 mmol, 1.0 equiv), and acetonitrile was heated by microwave irradiation for 10 min at 100 c. the final product (9c) was isolated from the reaction mixture by filtering through a short column of si - carbonate under gravity, which scavenged the excess carboxylic acid and hydroxybenzotriazole. removal of the solvent under reduced pressure yielded the required compounds as amorphous solids. h nmr (cd3od) (ppm) 8.33 (s, 1h), 7.42 (t, j = 8.5 hz, 1h), 6.75 (d, j = 8.4 hz, 2h), 3.86 (s, 6h), 3.82 (m, 1h), 1.88 (m, 4h), 1.68 (d, j = 12.8 hz, 1h), 1.40 (m, 4h), 1.27 (m, 1h). c nmr (cd3od) (ppm) 165.02, 164.71, 159.24, 134.17, 132.97, 123.89, 121.82, 115.64, 105.24, 56.50, 49.36, 33.77, 26.58, 26.19. lrms (es) : m / z 373 [m + h ]. hrms (es) : calcd for c19h25n4o4 [m + h ] 373.1870, found 373.1850. h nmr (cd3od) (ppm) 8.32 (s, 1h), 7.42 (t, j = 8.4 hz, 1h), 6.76 (d, j = 8.4 hz, 2h), 3.86 (s, 6h), 2.79 (m, 1h), 0.80 (m, 2h), 0.65 (m, 2h). c nmr (dmso - d6) (ppm) 161.32, 161.20, 131.10, 122.44, 122.30, 115.01, 104.28, 55.82, 22.13, and 22.02 (d, rotamers), 5.55. hrms (es) : calcd for c16h19n4o4 [m + h ] 331.1401, found 331.1385. h nmr (dmso - d6) (ppm) 13.28 (s, 1h), 9.71 (s, 1h), 8.60 (d, j = 8.1 hz, 1h), 8.30 (s, 1h), 7.40 (t, j = 8.4 hz, 1h), 6.74 (d, j = 8.4 hz, 2h), 4.37 (sex, j = 8.3, 1h), 3.76 (s, 6h), 2.13 (m, 4h), 1.63 (m, 2h). c nmr (dmso - d6) (ppm) 162.53, 161.23, 156.93, 132.14, 131.07, 122.61, 119.84, 115.07, 104.32, 55.82, 54.86, 43.39, 29.81, 14.62. lrms (es) : m / z 345 [m + h ]. hrms (es) : calcd for c17h21n4o4 [m + h ] 345.1557, found 345.1548. h nmr (cdcl3) (ppm) 12.19 (br s, 1h), 9.94 (s, 1h), 8.41 (s, 1h), 7.29 (t, j = 8.5 hz, 1h), 6.98 (d, j = 8.1 hz, 1h), 6.57 (d, j = 8.5 hz, 2h), 4.05 (m, 1h), 3.80 (s, 6h), 2.001.94 (m, 2h), 1.661.45 (m, 10h). c nmr (cdcl3) (ppm) 161.75, 160.98, 155.95, 131.18, 129.57, 121.16, 119.75, 112.84, 102.24, 54.19, 48.30, 33.28, 26.12, 22.39. lrms (es) : m / z 387 [m + h ]. hrms (es) : calcd for c20h27n4o4 [m + h ] 387.2027, found 387.2043. h nmr (dmso - d6) (ppm) 11.80 (br s, 1h), 9.72 (s, 1h), 8.28 (s, 1h), 8.00 (br d, j = 6.9 hz, 1h), 7.40 (t, j = 8.4 hz, 1h), 6.75 (d, j = 8.4 hz, 2h), 3.76 (s, 6h), 3.66 (m, 1h), 2.21 (br s, 1h), 2.15 (br s, 1h), 1.631.37 (m, 5h), 1.160.99 (m, 3h). c nmr (cd3od) (ppm) 165.11, 164.82, 159.28, 133.97, 133.00, 124.01, 122.33, 115.79, 105.34, 56.59, 53.91, 43.80, 40.38, 37.06, 36.28, 29.28, 27.54. lrms (es) : m / z 385 [m + h ]. hrms (es) : calcd for c20h25n4o4 [m + h ] 385.1870, found 385.1857. h nmr (dmso - d6) (ppm) 13.30 (s, 1h), 9.66 (s, 1h), 9.55 (s, 1h), 8.31 (s, 1h), 7.39 (t, j = 8.4 hz, 1h), 6.75 (d, j = 8.6 hz, 2h), 3.76 (s, 6h), 3.62 (m, 4h), 2.84 (m, 4h). c nmr (dmso - d6) (ppm) 161.26, 161.18, 156.93, 131.41, 131.10, 122.90, 119.80, 115.01, 104.32, 65.98, 55.82, 54.31. lrms (es) : m / z 376 [m + h ]. hrms (es) : calcd for c17h22n5o5 [m + h ] 376.1615, found 376.1620. h nmr (dmso - d6) (ppm) 13.15 (brs, 1h), 9.70 (s, 1h), 8.99 (t, j = 6.3 hz, 1h), 8.32 (s, 1h), 7.38 (t, j = 8.4 hz, 1h), 7.317.29 (m, 4h), 7.22 (m, 1h), 6.74 (d, j = 8.4 hz, 2h), 4.41 (d, j = 6.4 hz, 2h), 3.75 (s, 6h). c nmr (dmso - d6) (ppm) 163.46, 161.29, 156.93, 139.45, 131.95, 131.10, 128.21, 127.26, 126.71, 122.58, 120.18, 115.01, 104.32, 55.82, 41.66. lrms (es) : m / z 381 [m + h ]. hrms (es) : calcd for c20h21n4o4 [m + h ] 381.1557, found 381.1543. h nmr (dmso - d6) (ppm) 13.33 (br s, 1h), 9.66 (s, 1h), 8.96 (t, j = 5.9, 1h), 8.50 (m, 1h), 8.34 (s, 1h), 7.74 (td, j = 7.7, 1.9 hz, 1h), 7.39 (t, j = 8.4 hz, 1h), 7.30 (d, j = 7.8 hz, 1h), 7.25 (m, 1h), 6.73 (d, j = 8.4 hz, 2h), 4.53 (d, j = 5.6 hz, 2h), 3.75 (s, 6h). c nmr (dmso - d6) (ppm) 163.65, 161.32, 158.14, 156.93, 148.75, 136.68, 131.89, 131.10, 122.61, 122.06, 120.84, 120.18, 114.98, 104.32, 55.82, 43.54. lrms (es) : h nmr (dmso - d6) (ppm) 13.30 (br s, 1h), 9.68 (s, 1h), 8.72 (t, j = 5.0 hz, 1h), 8.39 (d, j = 5.0 hz, 1h), 8.34 (s, 1h), 7.60 (d, j = 7.6 hz, 1h), 7.39 (t, j = 8.4 hz, 1h), 7.23 (dd, j = 7.6, 5.0 hz, 1h), 6.75 (d, j = 8.4 hz, 2h), 4.54 (d, j = 5.0 hz, 2h), 3.76 (s, 6h), 2.29 (s, 3h). c nmr (dmso - d6) (ppm) 163.28, 161.29, 156.96, 153.98, 145.81, 137.64, 132.10, 131.13, 130.64, 122.47, 122.24, 120.04, 114.98, 104.32, 55.84, 40.96, 17, 13. lrms (es) : m / z 396 [m + h ]. hrms (es) : calcd for c20h22n5o4 [m + h ] 396.1666, found 396.1656. h nmr (cd3od) (ppm) 8.35 (s. 1h), 7.37 (t, j = 8.4 hz, 1h), 6.71 (d, j = 8.4 hz, 2h), 3.82 (s, 6h), 3.17 (d, j = 7.0 hz, 2h), 1.771.64 (m, 5h), 1.55 (m, 1h), 1.281.13 (m, 3h), 1.000.89 (m, 2h). c nmr (cd3od) (ppm) 165.64, 165.00, 159.22, 134.15, 132.99, 123.89, 122.10, 115.69, 105.31, 56.58, 46.09, 39.42, 32.00, 27.57, 27.03. lrms (es) : m / z 386 [m + h ]. hrms (es) : calcd for c20h27n4o4 [m + h ] 387.2027, found 387.2008. yield : 48 mg (solid), 76%. h nmr (dmso - d6) (ppm) 13.51 (s, 1h), 10.31 (s, 1h), 9.65 (s, 1h), 8.40 (s, 1h), 7.78 (d, j = 7.7 hz, 2h), 7.41 (t, j = 8.5 hz, 1h), 7.31 (t, j = 7.8 hz, 2h), 7.09 (t, j = 7.3 hz, 1h), 6.76 (d, j = 8.5 hz, 2h), 3.77 (s, 6h). c nmr (dmso - d6) (ppm) 162.29, 161.40, 157.02, 138.10, 132.32, 131.19, 128.49, 123.81, 123.02, 120.69, 120.37, 114.98, 104.40, 55.88. lrms (es) : m / z 367 [m + h ]. hrms (es) : calcd for c19h19n4o4 [m + h ] 367.1401, found 367.1402. h nmr (dmso - d6) (ppm) 13.63 (s, 1h), 10.73 (s, 1h), 9.55 (s, 1h), 8.43 (d, j = 6.4 hz, 3h), 7.83 (d, j = 5.5 hz, 2h), 7.42 (t, j = 8.3 hz, 1h), 6.77 (d, j = 8.4 hz, 2h), 3.78 (s, 6h). hrms (es) : calcd for c18h18n5o4 [m + h ] 368.1353, found 368.1347. h nmr (dmso - d6) (ppm) 13.61 (s, 1h), 9.63 (s, 1h), 9.49 (s, 1h), 8.42 (s, 1h), 8.38 (br d, j = 4.6 hz, 1h), 8.09 (d, j = 8.4 hz, 1h), 7.83 (m, 1h), 7.42 (t, j = 8.4 hz, 1h), 7.18 (m, 1h), 6.77 (d, j = 8.5 hz, 2h), 3.78 (s, 6h). c nmr (dmso - d6) (ppm) 161.87, 161.55, 157.01, 150.45, 148.29, 138.41, 131.62, 131.30, 123.04, 120.90, 120.15, 114.66, 113.86, 104.35, 55.84. lrms (es) : m / z 368 [m + h ]. hrms (es) : calcd for c18h18n5o4 [m + h ] 368.1353, found 368.1335. h nmr (dmso - d6) (ppm) 13.21 (br s, 1h), 9.75 (s, 1h), 8.28 (s, 1h), 8.09 (d, j = 8.4 hz, 1h), 7.39 (t, j = 8.4 hz, 1h), 6.75 (d, j = 8.4 hz, 2h), 4.53 (br d, j = 3.8 hz, 1h), 3.76 (s, 6h), 3.66 (m, 1h), 3.403.33 (m, 1h), 1.82 (m, 2h), 1.73 (m, 2h), 1.44 (m, 2h), 1.19 (m, 2h). c nmr (dmso - d6) 162.67, 161.25, 156.91, 131.07, 122.56, 115.10, 104.32, 68.11, 55.82, 47.00, 34.19, 30.00. lrms (es) : m / z 389 [m + h ]. hrms (es) : calcd for c19h25n4o5 [m + h ] 389.1819, found 389.1800. h nmr (cd3od) (ppm) 8.36 (s, 0.5h), 8.33 (s, 0.5h), 7.39 (t, j = 8.5 hz, 1h), 6.73 (d, j = 8.5 hz, 2h), 4.05 (m, 0.5h), 3.84 (s, 6h), 3.76 (m, 0.5h), 1.961.32 (m, 8h), 1.06 (m, 1h), 0.98 (d, j = 6.5 hz, 1.5 h), 0.92 (d, j = 6.6 hz, 1.5h). c nmr (cd3od) (ppm) 165.06, 165.02, 164.76, 164.64, 159.25, 134.07, 134.01, 132.97, 123.99, 123.91, 122.30, 122.12, 115.70, 115.66, 105.39, 105.29, 56.54, 49.52, 46.86, 35.15, 33.67, 33.12, 31.53, 31.01, 30.09, 22.63, 21.25. lrms (es) : m / z 387 [m + h ]. hrms (es) : calcd for c20h27n4o4 [m + h ] 387.2027, found 387.2007. h nmr (cd3od) (ppm) 8.35 (s, 1h), 7.37 (t, j = 8.4 hz, 1h), 6.71 (d, j = 8.4 hz, 2h), 4.083.99 (m, 3h), 3.82 (s, 6h), 2.90 (m, 2h), 1.89 (m, 2h), 1.51 (m, 2h), 1.46 (s, 9h). c nmr (cd3od) (ppm) 165.00, 164.89, 159.22, 156.39, 134.00, 132.99, 124.03, 122.16, 115.72, 105.35, 81.17, 56.61, 47.67, 44.39, and 43.61 (br d, rotamers), 32.69, 28.79. lrms (es) : m / z 474 [m + h ]. hrms (es) : calcd for c23h32n5o6 [m + h ] 474.2347, found 474.2324. h nmr (cd3od) (ppm) 8.32 (s, 1h), 7.36 (t, j = 8.4 hz, 1h), 7.327.22 (m, 5h), 6.68 (d, j = 8.4 hz, 2h), 4.52 (m, 1h), 3.78 (s, 6h), 3.58 (d, j = 2.5 hz, 2h), 2.76 (m, 2h), 2.58 (dd, j = 10.0, 4.3, 1h), 2.43 (q, j = 8.1 hz, 1h), 2.27 (m, 1h), 1.75 (m, 1h). c nmr (cd3od) (ppm) 165.06, 165.00, 159.22, 139.26, 133.92, 132.99, 130.33, 129.50, 128.49, 124.01, 122.16, 115.67, 105.32, 61.26, 61.17, 56.58, 53.83, 49.19, 32.54. lrms (es) : m / z 450 [m + h ]. hrms (es) : calcd for c24h28n5o4 [m + h ] 450.2136, found 450.2113. h nmr (cd3od) (ppm) 8.35 (s. 1h), 7.38 (t, j = 8.4 hz, 1h), 6.72 (d, 8.4 j = 8.4 hz, 2h), 3.83 (s, 6h), 3.53 (s, 4h), 3.37 (s, 3h). c nmr (cd3od) (ppm) 165.76, 165.05, 159.26, 134.10, 132.99, 115.71, 105.32, 72.07, 59.03, 56.56, 39.52. lrms (es) : m / z 349 [m + h ]. hrms (es) : calcd for c16h21n4o5 [m + h ] 349.1506, found 349.1504. h nmr (dmso - d6) (ppm) 13.23 (br s, 1h), 9.74 (s, 1h), 8.38 (br s, 1h), 8.29 (s, 1h), 7.39 (t, j = 8.5 hz, 1h), 6.75 (d, j = 8.5 hz, 2h), 3.76 (s, 6h), 3.19 (m, 2h), 1.49 (quint, j = 7.2 hz, 2h), 1.311.22 (m, 4h), 0.85 (t, j = 7.0 hz, 3h). c nmr (dmso - d6) (ppm) 163.39, 161.20, 156.93, 132.25, 131.07, 122.35, 119.79, 115.05, 104.32, 55.82, 37.95, 28.77, 28.57, 21.78, 13.87. lrms (es) : m / z 361 [m + h ]. hrms (es) : calcd for c18h25n4o4 [m + h ] 361.1870, found 361.1868. h nmr (cd3od) (ppm) 8.35 (s, 1h), 7.38 (t, j = 8.5 hz, 1h), 6.71 (d, j = 8.5 hz, 2h), 3.83 (s, 6h), 3.58 (sept, j = 6.1 hz, 1h), 3.53 (t, j = 6.1 hz, 2h), 3.45 (t, j = 6.6 hz, 2h), 1.83 (quin, j = 6.4 hz, 2h), 1.15 (d, j = 6.1 hz, 6h). c nmr (cd3od) (ppm) 165.58, 165.00, 159.22, 134.17, 132.99, 123.82, 121.99, 115.69, 105.32, 73.08, 67.50, 56.61, 38.06, 30.72, 22.49. lrms (es) : m / z 391 [m + h ]. hrms (es) : calcd for c19h27n4o5 [m + h ] 391.1976, found 391.1961. h nmr (cd3od) (ppm) 8.23 (s, 1h), 7.26 (t, j = 8.4 hz, 1h), 6.59 (d, j = 8.4 hz, 2h), 3.71 (s, 6h), 3.26 (t, j = 7.5 hz, 2h), 2.26 (t, j = 7.5 hz, 2h), 2.11 (s, 6h), 1.65 (q, j = 7.5 hz, 2h). c nmr (cd3od) (ppm) 165.70, 164.94, 159.22, 134.15, 132.99, 123.92, 122.05, 115.75, 105.35, 58.25, 56.61, 45.52, 38.23, 28.32. lrms (es) : m / z 376 [m + h ]. hrms (es) : calcd for c18h26n5o4 [m + h ] 376.1979, found 376.1965. h nmr (cd3od) (ppm) 8.34 (s, 1h), 7.38 (t, j = 8.4 hz, 1h), 6.71 (d, j = 8.4 hz, 2h), 3.83 (s, 6h), 3.51 (t, j = 6.9 hz, 2h), 2.69 (t, j = 6.9 hz, 2h), 2.59 (m, 4h), 1.80 (m, 4h). c nmr (cd3od) (ppm) 165.69, 164.97, 159.22, 134.09, 132.99, 123.89, 122.01, 115.72, 105.32, 56.58, 56.32, 55.08, 38.64, 24.31. hrms (es) : calcd for c19h26n5o4 [m + h ] 388.1979, found 388.1965. h nmr (cd3od) (ppm) 8.34 (s, 1h), 7.40 (t, j = 8.4 hz, 1h), 6.73 (d, j = 8.4 hz, 2h), 3.84 (s, 6h), 3.70 (t, j = 4.5 hz, 4h), 3.5 (t, j = 6.6, 2h), 2.57 (t, j = 6.6 hz, 2h), 2.52 (br t, j = 4.5 hz, 4 hz). c nmr (cd3od) (ppm) 165.67, 165.00, 159.23, 134.06, 132.96, 123.86, 122.02, 115.72, 105.32, 67.80, 58.60, 56.55, 54.67, 36.50. lrms (es) : m / z 404 [m + h ]. hrms (es) : calcd for c19h26n5o5 [m + h ] 404.1928, found 404.1929. | glycogen synthase kinase 3 (gsk3) is a genetically validated drug target for human african trypanosomiasis (hat), also called african sleeping sickness. we report the synthesis and biological evaluation of aminopyrazole derivatives as trypanosoma brucei gsk3 short inhibitors. low nanomolar inhibitors, which had high selectivity over the off - target human cdk2 and good selectivity over human gsk3 enzyme, have been prepared. these potent kinase inhibitors demonstrated low micromolar levels of inhibition of the trypanosoma brucei brucei parasite grown in culture. |
for in utero electroporation, timed pregnant e13.5 cd1 mice were used (the morning of the vaginal plug was e0.5). one l of purified dna (1 - 2g/l) mixed with 0.005% fast green was injected in utero into the lateral ventricle and electroporated into the neocortical ventricular zone according to published protocols26. brains were pfa - fixed and vibratome - sectioned for analyses by confocal microscopy. in order to determine the spatial interaction between pten and myosinva, pc12 cells were transfected with p - mcherry - mvag and/or pten - egfp - c2, differentiated for 2 days with ngf (50 ng / ml) and fixed for flim experiments to measure frster resonance energy transfer fret. time - domain flim experiments and data analysis were performed as described previously16. the globular domain from chick myosinva (mvag) was amplified by pcr (proofstart;qiagen) (primers : 5-gccaccatgagtctgcagcatgagatcacc-3 and 5-gacacgtgatatgaaacccag-3) and cloned into pca-ires - egfpm5-grip, p - mcherry n1 (clontech) or p3xflag - cmv-7.1 (sigma). similarly, mouse cdna was used to clone the globular domain of myosinvb (primers : 5- atgtccaccatcaacggcattaag-3 and ttgacttcattgagaaactccag-3) and myosinvc (primers : 5-atgagtgctattaacggcatcaagc-3 and 5- ttcagtctccggagaaagccg-3) into p3xflag - cmv-7.1. site directed mutagenesis of parental flag - mvag or mvag - iresgfp vectors were performed using the quikchange ii xl mutagenesis kit (stratagene) according to the manufacturer s protocols. the primers used were 5-gggtgaaaccaacagggctgcaaaacataacatccagcattgctgatga-3 and 5-tcatcagcaatgctggatgttatgttttgcagccctgttggtttcaccc-3 for the mva rkrqni mutation, and 5-gctgcacagttgttgcaagtgcaaaacataacagatgaagatgca-3 and 5-gcttctgcatcttcatctgttatgttttgcacttgcaacaactgt-3 for the mva cortices or livers from e18 rat embryos were homogenized in lysis buffer (50 mm tris ph 7.5 ; 150 mm nacl ; 1% triton x-100 ; 2 m naov and 500 m naf) containing protease inhibitors (roche). immunoprecipitations were performed overnight (4c) using 5g of anti - pten antibody (a2b1, santa cruz) or mouse control antibody and protein - g beads (pierce). after washing, beads were boiled in loading buffer and separated on 10% sds - polyacrylamide gels, which were fixed and stained using brilliant blue g - colloidal concentrate (sigma) according to manufacturer s instructions. selected protein bands were isolated, processed and sequenced by proteome sciences plc. in short, after in gel trypsin digestion, samples were analysed by lc / ms / ms, the mass spectral data was processed into peak lists and searched against the swiss prot and ncbi non - redundant databases using mascot software (matrix science, uk). for co - immunoprecipitation experiments, hek293 cells were transfected with different constructs using lipofectamine 2000 and anti - flag m2 affinity gel (sigma) was used for isolating the 3xflag - mvag complex. western blot analysis of immunoprecipitates was performed using anti - flag (sigma), anti - gfp (abcam) or anti - pten antibodies (santa cruz or cell signaling). cortices from e15.5 dilute lethal and wildtype littermates were used to isolate total rna (qiagen rneasy mini kit), which was reversed transcribed into random primed cdna (reverse transcription kit, promega) and served as template for all qpcr experiments. myosinva, myosinvb, myosinvc and pten mrna levels were measured relative to gapdh, pgk1 and hprt. primers for qpcr analysis of the different mrnas were ordered from qiagen (quantitect primer assays), quantifast sybr green (qiagen) was used as a reporter for detection with the light cycler1.0 (roche). for in utero electroporation, timed pregnant e13.5 cd1 mice were used (the morning of the vaginal plug was e0.5). one l of purified dna (1 - 2g/l) mixed with 0.005% fast green was injected in utero into the lateral ventricle and electroporated into the neocortical ventricular zone according to published protocols26. in order to determine the spatial interaction between pten and myosinva, pc12 cells were transfected with p - mcherry - mvag and/or pten - egfp - c2, differentiated for 2 days with ngf (50 ng / ml) and fixed for flim experiments to measure frster resonance energy transfer fret. the globular domain from chick myosinva (mvag) was amplified by pcr (proofstart;qiagen) (primers : 5-gccaccatgagtctgcagcatgagatcacc-3 and 5-gacacgtgatatgaaacccag-3) and cloned into pca-ires - egfpm5-grip, p - mcherry n1 (clontech) or p3xflag - cmv-7.1 (sigma). similarly, mouse cdna was used to clone the globular domain of myosinvb (primers : 5- atgtccaccatcaacggcattaag-3 and ttgacttcattgagaaactccag-3) and myosinvc (primers : 5-atgagtgctattaacggcatcaagc-3 and 5- ttcagtctccggagaaagccg-3) into p3xflag - cmv-7.1. site directed mutagenesis of parental flag - mvag or mvag - iresgfp vectors were performed using the quikchange ii xl mutagenesis kit (stratagene) according to the manufacturer s protocols. the primers used were 5-gggtgaaaccaacagggctgcaaaacataacatccagcattgctgatga-3 and 5-tcatcagcaatgctggatgttatgttttgcagccctgttggtttcaccc-3 for the mva rkrqni mutation, and 5-gctgcacagttgttgcaagtgcaaaacataacagatgaagatgca-3 and 5-gcttctgcatcttcatctgttatgttttgcacttgcaacaactgt-3 for the mva cortices or livers from e18 rat embryos were homogenized in lysis buffer (50 mm tris ph 7.5 ; 150 mm nacl ; 1% triton x-100 ; 2 m naov and 500 m naf) containing protease inhibitors (roche). immunoprecipitations were performed overnight (4c) using 5g of anti - pten antibody (a2b1, santa cruz) or mouse control antibody and protein - g beads (pierce). after washing, beads were boiled in loading buffer and separated on 10% sds - polyacrylamide gels, which were fixed and stained using brilliant blue g - colloidal concentrate (sigma) according to manufacturer s instructions. selected protein bands were isolated, processed and sequenced by proteome sciences plc. in short, after in gel trypsin digestion, samples were analysed by lc / ms / ms, the mass spectral data was processed into peak lists and searched against the swiss prot and ncbi non - redundant databases using mascot software (matrix science, uk). for co - immunoprecipitation experiments, hek293 cells were transfected with different constructs using lipofectamine 2000 and anti - flag m2 affinity gel (sigma) was used for isolating the 3xflag - mvag complex. western blot analysis of immunoprecipitates was performed using anti - flag (sigma), anti - gfp (abcam) or anti - pten antibodies (santa cruz or cell signaling). cortices from e15.5 dilute lethal and wildtype littermates were used to isolate total rna (qiagen rneasy mini kit), which was reversed transcribed into random primed cdna (reverse transcription kit, promega) and served as template for all qpcr experiments. myosinva, myosinvb, myosinvc and pten mrna levels were measured relative to gapdh, pgk1 and hprt. primers for qpcr analysis of the different mrnas were ordered from qiagen (quantitect primer assays), quantifast sybr green (qiagen) was used as a reporter for detection with the light cycler1.0 (roche). | the tumour suppressor pten can inhibit proliferation and migration as well as control cell growth in different cell types1. pten functions predominately as a lipid phsophatase, converting pi(3,4,5)p3 to pi(4,5)p2, thereby antagonizing pi3k (phosphoinositide 3-kinase) and its established downstream effector pathways2. however, much is unclear concerning the mechanisms that regulate pten movement to the cell membrane necessary for pten s activity towards pi(3,4,5)p33 - 5.here we show a requirement for functional motor proteins in the control of pi3k signalling, involving a previously unknown association between pten and myosinv. fret measurements revealed that pten interacts directly with myosinv, dependent on pten phosphorylation mediated by ck2 and/or gsk3. inactivation of myosinv - transport function in neurons increased cell size, which in line with known attributes of pten - loss6, 7 - required pi3k and mtor. our data demonstrate a myosin - based transport mechanism regulating pten function, providing new insights into the signalling networks regulating cell growth. |
otitis media (om) is prevalent in infants, especially those 6 - 18 months old. the disease itself can be classified into three types : acute om, om with effusion (ome), and chronic om (1, 2, 3). typically, otoscopy is used to assess the condition of the tympanic membrane (tm) surface or its mobility using pneumatic pressure. the optics of an otoscope can visualize only the tm surface or if the tm is translucent, the presence of any effusion that might be present immediately behind the tm. this subjective observation can be problematic and no quantitative depth - resolved imaging technology exists for imaging the middle ear and assessing the characteristics of any effusion that might be present. these weaknesses often result in an incorrect diagnosis, which can subsequently affect treatment and outcomes. to address these weaknesses of standard otoscopy, we have developed the use of optical coherence tomography (oct) for non - invasive assessment and quantification of the microstructure of the tm and middle ear, including the presence of bacterial biofilms (4, 5). a new primary care imaging system has been developed using advanced oct optical imaging technology (6). oct is a non - invasive, non - contact optical imaging technology that can effectively reconstruct a depth - resolved high - resolution cross - sectional image of tissues (1 - 15 m) using interferometry and a near - infrared light source (7, 8, 9, 10). in ophthalmology, oct has become the gold standard for retinal imaging, and can detect disease by measuring the thickness of the retina or retinal nerve fiber layer (7, 11). recently, oct applications have focused primarily on characterizing cancer and other disease processes in the larynx (12), because oct is ideal for imaging the thin, layered structures of the vocal fold epithelium and lamina propria. most oct applications in otolaryngology of the middle and inner ear have been either animal investigations or human temporal bone studies (13, 14, 15, 16, 17, 18, 19, 20). in addition, various research groups worldwide have performed otolaryngology imaging studies using oct (13, 21, 22, 23). in this study, we demonstrate the wider application of oct technology for non - invasive detection of changes and diagnosing disease associated with the human tm and various types of om. in addition, specific features were identified in two - dimensional (2d) oct images of abnormal tms, compared to images of normal tms. analysis of a - scan (axial depth scan) data successfully identified unique patterns of constituents within effusions. among the patients with otological symptoms who visited the department of otorhinolaryngology at kyungpook national university hospital between july and october 2012, a total of 39 patients who were diagnosed with om using a standard otoendoscopic examination and audiological tests were enrolled and the acquisition of oct images was tried. from oct images, six volunteers with normal tm on otoendoscopy were also included and oct images of tm were acquired as a control. we examined the clinical use of spectral domain - oct (sd - oct). 1a shows a schematic of the sd - oct system and the handheld probe used for these clinical studies. a 12-bit complementary metal oxide semiconductor (cmos) line - scanning camera (aviiva em4 2048 pixels, e2v, essex, uk) with an effective line rate of 70,000 lines / s in 2048-pixel mode was used as the sd - oct detector. a transmission - type diffraction grating (spatial frequency 1,800 lpmm, nominal aoi / aod 46.05 ; wasatch photonics, north carolina, usa) was adapted to enhance the light efficiency in the detection path. the source was a superluminescent light - emitting diode (sled) operating in high - power mode (sld-35-hp, superlum, schlieren, switzerland). the sled has a center wavelength of ~870 nm and a spectrum with a full width at half maximum (fwhm) of ~65 nm. the sled was connected to one end of a 22 (50:50) fiber - fused coupler (fc850 - 40 - 50-apc, thorlabs, new jersey, usa). the sled power measured after the objective lens (an achromatic lens with a focal length of 75 mm) was ~6 mw. the detected oct signals were transferred to host memory in a computer with four core 2 quad q8200 central processing units (2.33-ghz clock rate, intel, california, usa) via a frame grabber (pcie-1433, 850-mb / s bandwidth, national instruments, texas, usa) over two camera - link cables. the computer drove a galvanometer scanner using a data acquisition board (pcie-6321, national instruments) that could provide two analog outputs. to generate the depth - resolved sample reflectivity or a - line, the interferogram was transformed using full - range k - domain linearization (24). real - time, high - resolution oct imaging is possible with this system at a display speed exceeding a 250 khz a - scan rate, and the software used was written in labview (labview 2011, national instruments). to process signals from the camera, a frame grabber (ni : pcie-1429) with an acquisition rate of 680 mb / s was used. to drive the galvanometer scanner, a data acquisition board (pcie-6115, national instruments) with a maximum sampling rate of 10 ms 1 shows the handheld oct probe used to acquire the tm. a miniaturized charge - coupled device (ccd)-based video camera with a size of 16 mm21 mm and 0.27 megapixel was integrated in the handheld oct probe. a white light - emitting diode (led) was located behind the focusing lens to illuminate the target site. through this system, the orientation of oct beam could be identified and a real image of tm surface and cross - sectional oct image could be acquired simultaneously. the system sensitivity was approximately 101 db near zero optical delay when the camera was set at an exposure time of 14.1 s. the theoretical sensitivity was approximately 116 db because the ideal efficiency of the spectrometer was 73%, and the power at the sample path was 1.8 mw. the sensitivity of the system was lower than the theoretical value, mainly because of the insertion loss (-11.6 db) between the fiber optics and the 2d galvanometer scanner in the sample path. the research protocol was approved by the institutional review board (2012 - 12 - 006) of kyungpook national university hospital. among the patients with otological symptoms who visited the department of otorhinolaryngology at kyungpook national university hospital between july and october 2012, a total of 39 patients who were diagnosed with om using a standard otoendoscopic examination and audiological tests were enrolled and the acquisition of oct images was tried. from oct images, six volunteers with normal tm on otoendoscopy were also included and oct images of tm were acquired as a control. we examined the clinical use of spectral domain - oct (sd - oct). 1a shows a schematic of the sd - oct system and the handheld probe used for these clinical studies. a 12-bit complementary metal oxide semiconductor (cmos) line - scanning camera (aviiva em4 2048 pixels, e2v, essex, uk) with an effective line rate of 70,000 lines / s in 2048-pixel mode was used as the sd - oct detector. a transmission - type diffraction grating (spatial frequency 1,800 lpmm, nominal aoi / aod 46.05 ; wasatch photonics, north carolina, usa) was adapted to enhance the light efficiency in the detection path. the source was a superluminescent light - emitting diode (sled) operating in high - power mode (sld-35-hp, superlum, schlieren, switzerland). the sled has a center wavelength of ~870 nm and a spectrum with a full width at half maximum (fwhm) of ~65 nm. the sled was connected to one end of a 22 (50:50) fiber - fused coupler (fc850 - 40 - 50-apc, thorlabs, new jersey, usa). the sled power measured after the objective lens (an achromatic lens with a focal length of 75 mm) was ~6 mw. the detected oct signals were transferred to host memory in a computer with four core 2 quad q8200 central processing units (2.33-ghz clock rate, intel, california, usa) via a frame grabber (pcie-1433, 850-mb / s bandwidth, national instruments, texas, usa) over two camera - link cables. the computer drove a galvanometer scanner using a data acquisition board (pcie-6321, national instruments) that could provide two analog outputs. to generate the depth - resolved sample reflectivity or a - line, the interferogram was transformed using full - range k - domain linearization (24). real - time, high - resolution oct imaging is possible with this system at a display speed exceeding a 250 khz a - scan rate, and the software used was written in labview (labview 2011, national instruments). to process signals from the camera, a frame grabber (ni : pcie-1429) with an acquisition rate of 680 mb / s was used. to drive the galvanometer scanner, a data acquisition board (pcie-6115, national instruments) with a maximum sampling rate of 10 ms 1 shows the handheld oct probe used to acquire the tm. a miniaturized charge - coupled device (ccd)-based video camera with a size of 16 mm21 mm and 0.27 megapixel was integrated in the handheld oct probe. a white light - emitting diode (led) was located behind the focusing lens to illuminate the target site. through this system, the orientation of oct beam could be identified and a real image of tm surface and cross - sectional oct image could be acquired simultaneously. the system sensitivity was approximately 101 db near zero optical delay when the camera was set at an exposure time of 14.1 s. the theoretical sensitivity was approximately 116 db because the ideal efficiency of the spectrometer was 73%, and the power at the sample path was 1.8 mw. the sensitivity of the system was lower than the theoretical value, mainly because of the insertion loss (-11.6 db) between the fiber optics and the 2d galvanometer scanner in the sample path. the research protocol was approved by the institutional review board (2012 - 12 - 006) of kyungpook national university hospital. of the 39 patients, oct images were acquired from 16 patients (41.0%). the most common cause of failure to acquire an image was a narrow or curved external auditory canal (n=5). other causes were the presence of obstacles, such as profuse otorrhea (n=3), cholesteatoma material (n=4), and cerumen (n=7), and poor compliance (n=4). the thickness of a normal tm in typical region was estimated from six volunteers using a - scan. the mean thicknesses (sd) were 12211.08 m (normal tm), 32630.28 m (chronic om), 25125.37 m (adhesive om), and 1089.72 m (ome). 2 shows representative oct images and data acquired from the normal tms of two volunteers, showing the b - mode (cross - sectional) image and an a - scan plot from the central part of the tm after image processing to obtain the thickness and structural information on the tm. while there were small differences among individuals, the normal tm was approximately 122 m thick, which is similar with reported values (25). in addition, the epidermal, fibrous, and mucous layers of the tm were clearly identified, as reported previously (fig. 3a), while the left tm is retracted and turbid on the otoendoscopic examination and non - uniformly thick in the oct examination (fig. the a - scan analysis indicated that the left tm was approximately four times thicker than right tm. the pure tone average of four frequencies (0.5, 1, 2, and 3 khz) was 5 db hl in the right ear and 25 db hl in the left. the results of the speech reception threshold (right, 5 db ; left, 30 db) and speech discrimination (right, 100% [35db ] ; left, 100% [60db ]) tests were comparable with the pure tone average. the right ear has a normal hearing level, while the left is between normal hearing and mild hearing loss. the diagnosis for the left tm was chronic om based on the otoendoscopic and oct findings, and the hearing status suggested that the disease was not severe. in addition to the size and location of the perforation in the otoscopic image, the thickness and characteristics of the perforation margin was evaluated with the oct image. as seen in the a - scan, thickening and blunting of tm margin was detected in all patients with chronic om, although the extent differed. in the case of adhesive om, the tm is retracted and in partial contact with the tympanic mucosa on otoendoscopy, as shown in fig. 6a. the decrease in the air gap between the tm and tympanic mucosa due to the retraction is shown (fig. the oct scattering signal intensity decreases rapidly in the low - scattering air layer after the strong peak scattering value from the tm, and a weaker scattering signal can be seen from the tm mucosa, as shown graphically by the a - scan. 6b is an image of the tm of a patient with ome ; the pattern is similar to that of adhesive om in b - mode. however, unlike chronic om, the scattering signal is attenuated gradually with increasing depth into the highly scattering effusion in the a - scan (fig. the most favorable clinical characteristics of oct are its noninvasiveness, lack of radiation, high resolution, and ease of office - based use. however, there are few reports on the clinical application of oct to otology, which might be limited by the difficulty securing a light pathway for the oct device and the diagnostic efficiency of otoendoscopy. in this study, real and oct images were acquired simultaneously in real time, so that the findings of each imaging modality supplemented the drawbacks of the other. most studies of oct in otology have involved basic research of the middle and inner ear (15, 16, 19, 20, 21) or cadaveric temporal bone (26). (27), who coupled an oct system to an operating microscope and they suggested that oct is a useful measurement tool in the middle ear during ossiculoplasty. djalilian. (13) obtained images of normal and pathological tms using an oct system coupled with an operating otoscope. they obtained cross - sectional images at one frame per second. due to the acquisition speed, no tm images could be obtained when the patients moved. with our oct system, images were obtained at 42 frames per second, which gave the clinician the ability to examine the tm and middle ear structure. nguyen. (4) performed a clinical study using a handheld oct otoscope and focused on the in vivo detection of biofilms, not the utility of a handheld oct otoscope as a diagnostic tool for middle ear disease. in this study, we evaluated normal and pathological tms and demonstrated the advantages of the oct images. the thickness of normal tms was measurable and the three layers were distinguishable in the high - resolution oct images. the mean thickness of a specific region of the normal tms could be used as a standard parameter for evaluating abnormal tms. 5 are otoendoscopic and oct images of chronic om, which is commonly seen in outpatient departments. the pathological changes in this disease result from either acute or chronic inflammatory reactions, including edematous changes, the infiltration of inflammatory cells, and the presence of persistent bacterial biofilms. the oct images provide tomographic information on the pathological region and facilitate evaluation of the extent or severity of disease. given the small amount of data, we can not draw conclusions about the relationship between the oct image features and hearing status. however, a study of the clinical role of oct images in finding structural differences related to the hearing level might be valuable. long - standing eustachian tube dysfunction can create a negative pressure and resulting effusion in the middle ear cavity. ome is often recurrent due to the long - term negative pressure, and the fibrous layer of the tm is thought to become weak and overly compliant. as a result, the normal shape and position of the tm can not be maintained, and it collapses and retracts medially. 6a is a typical finding of severe retraction. if this progresses, the inner surface of the tm attaches to the middle ear mucosa and fibrous tissue replaces the mucosa, a condition called adhesive om. in ome, the effusion liquid and scattered suspended material are distributed evenly in the middle ear cavity, as in fig. these examples demonstrate the added information that oct can provide by performing depth - resolved imaging through the tm and into the middle - ear cavity, which is impossible with standard otoscopy or otoendoscopy. as a traditional method for diagnosing om and monitoring the treatment response, otoscopy is used to observe only the surface features of the tm, and the findings are combined with the patient 's symptoms and audiometry measurements to direct therapy. these diagnostic methods using otoscopy are limited by the information that a surface image of the tm can provide. in this study, we observed sections of the tm in vivo with oct. we demonstrated that oct could easily confirm structures behind the tm that are invisible using standard otoscopy. the s - shaped external auditory canal is 2.5 - 3 cm in length and 7 - 9 mm in diameter. the tm is tilted in the direction of the external auditory meatus by 55 (5, 26). the extent of the curvature and the diameter of the canal influenced the acquisition of oct images, as described in the results. therefore, the anterior margin of the tm was not evaluated in the case of anterior perforation and the region of attic retraction or attic cholesteatoma was not visualized using the oct system in some cases. a system with various interchangeable speculums and miniaturized components for the handheld oct probe the optic pathway should not be interrupted by obstacles, such as cerumen, otorrhea, or keratin debris ; thus meticulous cleaning is needed. lastly, the resolution and brightness of the ccd - based camera, integrated with handheld oct probe, must be upgraded. based on our results, oct has the potential to facilitate diagnosis of om by primary care clinicians and otologists. although further clinical trials are necessary, this groundwork shows that oct has the potential to be the next - generation detection, diagnostic, and monitoring method for om, and that it can complement or even potentially replace the more traditional otorhinolaryngology instruments. | we report the application of optical coherence tomography (oct) to the diagnosis and evaluation of otitis media (om). whereas conventional diagnostic modalities for om, including standard and pneumatic otoscopy, are limited to visualizing the surface of the tympanic membrane (tm), oct effectively reveals the depth - resolved microstructure below the tm with very high spatial resolution, with the potential advantage of its use for diagnosing different types of om. we examined the use of 840-nm spectral domain - oct (sd - oct) clinically, using normal ears and ears with the adhesive and effusion types of om. specific features were identified in two - dimensional oct images of abnormal tms, compared to images of healthy tms. analysis of the a - scan (axial depth scan) identified unique patterns of constituents within the effusions. the oct images could not only be used to construct a database for the diagnosis and classification of om but oct might also represent an upgrade over current otoscopy techniques.graphical abstract |
neoplasms are rare findings in pregnant women. only several cases of kidney tumors in pregnancy were described in polish medical literature [14 ] and approximately 200 in the world. here a 25year old 16week gravida (second pregnancy, second birth) was admitted to the gynecological ward because of acute right lumbar pain. physical examination on admission revealed tenderness in the right lower abdominal quadrant without evident peritoneal signs and positive right goldflamm sign. serum c reactive protein was elevated up to 229.1 mg / l with accompanying leucocytosis of 19.69 g / l and elevated urinary ketonic bodies. on ultrasound (us), a heterogenous right renal mass 72 x 33 mm was discovered. after 3 weeks and cessation of symptoms, she was transferred to the obstetrics and neonatology ward. initially conservative management was advised, because of young fetal age and high surgical risk. an mri in the 25th week showed rapid growth of the tumor with measurements 90 x 77 mm. a polycystic tumor with multiple thick walled cysts with inhomogeneous contents and signs of fresh intracystic bleedings in some cysts was closely adherent to the liver and right lumbar muscle but was without signs of local invasion (figure 1 and figure 2). an india ink artifact was visible, which pointed to angiomyolipoma (aml), but rapid growth and the patients young age led to the conclusion that a polycystic nephroblastoma can not be excluded. phase t1weighted mr image (tr / te, 308/3.3) shows 9 cm mass in upper pole of right kidney. india ink artifact (arrows) is present at interface of renal mass with kidney. most amls contain macroscopic fat, the india ink artifact appears at all interfaces of the tumor with the kidney or at the interfaces of the fatty and nonfatty portions of the mass. other renal masses do not contain macroscopic fat ; for that reason, the india ink artifact appears at the interface of the renal mass with perinephric fat when the mass is exophytic. thus, the diagnosis of aml is indicated when the india ink artifact is present at a renal mass kidney interface or within a renal mass. mri of abdomen, axial t2weighted mr image (tr / te, 4,3/2.2) shows 9 cm mass in upper pole of right kidney. the different signal of tumor and signs of bleeding product and smooth muscle / fat. premature termination of pregnancy was advised because of the suspected life threatening renal tumor. under general anesthesia in the 29th gestotic week a premature girl was born through cesarean section. ultrasound of the brain demonstrated intraventricular bleeding and brain echostructure shading. targeted treatment with teicoplanine was efficient and 30 months after birth mother is well and without local recurrence nor new lesions in contralateral kidney. the baby has been diagnosed with mild cerebral palsy and is being rehabilitated. neoplasms are rare findings in pregnant women. only several cases of kidney tumors in pregnancy have been described in polish medical literature [14 ] and approximately 200 in the world. pregnant women with tumors are rare patients but the incidence of tumors in pregnancy is probably rising. several facts can facilitate that speculation : firstly, the mean age of pregnant women is rising. secondly, the general incidence of malignancies is rising, thirdly, advanced diagnostic means especially prenatal ultrasound discover asymptomatic tumors. these would otherwise be discovered later in the course of life of the expecting mother, or would never be discovered at all if they remained symptomless. many tumors in pregnancy manifest in our patients as pain on either flank, with abdominal or colic like character. many patients also present with haematuria or other symptoms like arterial hypertension. only rarely can a classical kidney tumor triad (flank pain, haematuria, palpable mass) be observed. it is feasible that nowadays many tumors can be discovered at an early stage or before first clinical symptoms present themselves, as in several described patients [4, 68 ]. it is possible that the tumor in our patient might have been discovered before symptoms occurred and endangered the pregnancy, is she has had the us in first trimester. the baby was born with cerebral palsy and one of potential risk factors is the maternal inflammatory process which was present in this case. it is possible that early diagnosis of this tumor might have led to a better outcome for the child if the mother was operated on earlier in her pregnancy or even before becoming pregnant. this fact underlines in our opinion the necessity and usefulness of abdominal and pelvic ultrasound especially in early pregnancy. this examination is cheap, easy to perform, safe for the fetus and not uncomfortable for the pregnant woman. the polish society of gynecology recommends 3 ultrasound examinations during pregnancy : the first examination should be performed between week 11 and week 13 + 6, the second in between week 18 and 22 and the third between 28 and 32 week of gestation. the examinations are performed with convex ultrasound probes that can also be used to assess intraperitoneal solid organs (like the liver or spleen) and the retroperitoneal space (i.e. kidneys are located). this could be an opportunity to perform abdominal screening and retroperitoneal ultrasound examination. in our opinion, the first trimester examination is the best time point to perform such procedure, as many diagnostic and surgical options are still open and second trimester is probably the safest time for surgical intervention. screening examination can be performed by an obstetrician that had basic training in abdominal ultrasound. in case of any mothers abnormality seen on screening us, a directed examination by radiologist or urologist should follow and magnetic resonance (mri) should be performed as soon as possible as it is safe for both the fetus and the gravida. mri can yield clinical information as to the local spread of the tumor, nodal and/or venous involvement critical for decision making and choosing the right type of treatment. mri can be safely performed using gadolinium contrast agents when no sign of fetal or maternal renal impairment is present. it gives more accurate and objective information compared to us, is not observer interchangeable and is less prone to patients characteristics that make us technically difficult. it might be reasonable that pregnant women undergo screening abdominal ultrasound examination during first trimester of pregnancy by a trained obstetrician. this procedure should be mandatory at any time point if any complications or abnormal laboratory values are seen. | neoplasms are rare in pregnant women, however they are always a challenging diagnostic and curative problem. we present a case of a benign kidney tumor (angiomyolipoma) imitating nephroblastoma on magnetic resonance diagnosed in pregnancy. cesarean section was performed in 29. gestotic week followed immediately by right radical nephrectomy. |
the human liposarcoma cell line lisa-2 (21) was used as a cellular model of visceral human adipocytes and was maintained in dulbeccos modified eagles medium (dmem) supplemented with 10% fetal serum and antibiotics, at 37c and 5% co2. to induce insulin resistance, human adipocytes were cultured for 21 days in serum - free dmem / f12 (1:1) as previously described (22). peripheral blood mononuclear cells, were isolated from blood samples with lymphoprep (99% were lymphocytes and monocytes) as previously described (23). the studies involving samples from patients were carried out in accordance with the helsinki declaration, and the protocol was approved by the ethical committee of the university clinic of navarra (supplementary information, available in an online appendix at http://diabetes.diabetesjournals.org/cgi/content/full/db10-0771/dc1). mouse c2c12 myocytes (american type culture collection) and immortalized murine white adipocytes were maintained in dmem supplemented with 10% fetal serum and antibiotics, at 37c and 5% co2. cells were transiently transfected according to the lipofectamine protocol (invitrogen, paisley, u.k.), with 4 g of pcdna3-grk2-neo, pcdna3-grk2-k220r - hygro, or ad - shgrk2-rnai, to generate cell lines with increased or decreased grk2 expression, respectively, or with empty vector (pcdna3-hygro) as a control. glucose tolerance test (gtt) and insulin tolerance test (itt) were performed as we previously described (24). glucose concentration (mg / dl) was determined in tail blood samples using an automatic analyzer (accucheck from roche). other measurements were performed from blood collected from the tail and centrifuged at 2,500 g for 15 min to obtain the serum. insulin and leptin concentrations were assayed using a sensitive elisa kit (linco research, st. triglycerides released were assayed by an enzymatic method using free glycerol determination kit (sigma - aldrich, st. cells were stimulated for 30 min with insulin, and glucose uptake was measured during the last 10 min of culture by incorporation of 2-deoxy - d[13h]-glucose as previously described (22,24). individual values were expressed as pmol of glucose per 10 min per mg of protein, and results were expressed as percentage of stimulation over basal (control = 100). male mice (12- to 14-week - old) were subjected to anesthesia (intraperitoneal injection of 60 mg / kg ketamine per 5 mg / kg xylazine), and 25 mg epididymal adipose tissue was removed from each mouse. insulin (1 iu / kg body wt) was then injected via the cava vein, and a similar amount of epididymal adipose tissue was removed, after 1, 3, and 7 min. epididymal adipose tissues were homogenized with a polytron homogenizer in lysis buffer and centrifuged at 100,000 g for 15 min. the supernatants were collected, assayed for protein concentration, and stored at 80c until used. other methods were performed as specified in the supplementary information found in an online appendix. the human liposarcoma cell line lisa-2 (21) was used as a cellular model of visceral human adipocytes and was maintained in dulbeccos modified eagles medium (dmem) supplemented with 10% fetal serum and antibiotics, at 37c and 5% co2. to induce insulin resistance, human adipocytes were cultured for 21 days in serum - free dmem / f12 (1:1) as previously described (22). peripheral blood mononuclear cells, were isolated from blood samples with lymphoprep (99% were lymphocytes and monocytes) as previously described (23). the studies involving samples from patients were carried out in accordance with the helsinki declaration, and the protocol was approved by the ethical committee of the university clinic of navarra (supplementary information, available in an online appendix at http://diabetes.diabetesjournals.org/cgi/content/full/db10-0771/dc1). mouse c2c12 myocytes (american type culture collection) and immortalized murine white adipocytes were maintained in dmem supplemented with 10% fetal serum and antibiotics, at 37c and 5% co2. cells were transiently transfected according to the lipofectamine protocol (invitrogen, paisley, u.k.), with 4 g of pcdna3-grk2-neo, pcdna3-grk2-k220r - hygro, or ad - shgrk2-rnai, to generate cell lines with increased or decreased grk2 expression, respectively, or with empty vector (pcdna3-hygro) as a control. glucose tolerance test (gtt) and insulin tolerance test (itt) were performed as we previously described (24). glucose concentration (mg / dl) was determined in tail blood samples using an automatic analyzer (accucheck from roche). other measurements were performed from blood collected from the tail and centrifuged at 2,500 g for 15 min to obtain the serum. insulin and leptin concentrations were assayed using a sensitive elisa kit (linco research, st. triglycerides released were assayed by an enzymatic method using free glycerol determination kit (sigma - aldrich, st. cells were stimulated for 30 min with insulin, and glucose uptake was measured during the last 10 min of culture by incorporation of 2-deoxy - d[13h]-glucose as previously described (22,24). individual values were expressed as pmol of glucose per 10 min per mg of protein, and results were expressed as percentage of stimulation over basal (control = 100). male mice (12- to 14-week - old) were subjected to anesthesia (intraperitoneal injection of 60 mg / kg ketamine per 5 mg / kg xylazine), and 25 mg epididymal adipose tissue was removed from each mouse. insulin (1 iu / kg body wt) was then injected via the cava vein, and a similar amount of epididymal adipose tissue was removed, after 1, 3, and 7 min. epididymal adipose tissues were homogenized with a polytron homogenizer in lysis buffer and centrifuged at 100,000 g for 15 min. the supernatants were collected, assayed for protein concentration, and stored at 80c until used. other methods were performed as specified in the supplementary information found in an online appendix. to study the modulation of insulin signaling by grk2 in relevant insulin - targeted cell types, we used murine white adipocytic and myocytic cell lines expressing enhanced or decreased grk2 protein levels, or overexpressing a catalytically inactive mutant of grk2 (fig. the increase in glucose uptake elicited by insulin in both cell types was blocked in the presence of enhanced grk2 levels, whereas grk2 knockdown led to a slightly higher response (fig. after acute insulin challenge, irs1 tyrosine phosphorylation and akt activation were impaired upon grk2 or grk2-k220r overexpression, both in adipocytes and in myoblasts (fig. basal irs1 protein levels were higher in cells with silenced grk2 and decreased in cells with elevated grk2, suggesting a functional relationship between grk2 and irs1 (fig. co - immunoprecipitation experiments in adipocytes showed that both endogenous grk2 and irs1 proteins form a complex under basal conditions that is completely disrupted after 10 min of insulin treatment (fig. grk2 overexpression enhances the amount of irs1 associated to the kinase by 87% and prevents the complete disruption of the complex by insulin. in contrast, grk2 downregulation decreases its basal association with irs1 and facilitates a complete disruption of this complex by insulin. immortalized murine white adipocytes and c2c12 myocytes were transiently transfected with empty vector (control, c), pcdna3-grk2-neo (+), the catalytically inactive pcdna3-grk2k220r (k), or shgrk2-rnai () to upregulate or knock - down grk2 expression, respectively. a : lysates were analyzed by western blot with the corresponding antibodies against grk2 and -actin. for examples of full - length blots, see supplementary fig. b : adipocytes and myocytes were cultured for 24 h in serum - free and low - glucose medium and stimulated in the absence or presence of 10 nmol glucose uptake was measured during the last 10 min by incorporation of 2-deoxyglucose into the cells. results were expressed as percentage of stimulation over basal of control cells (adipocytes, 5.3 0.3 pmol glucose / mg protein/10 min ; myocytes, 45.8 3.2 pmol glucose / mg protein/10 min) and are means sem of five independent experiments. c : adipocytic and (d) myocytic cell lines were serum - starved overnight and then incubated in the absence or presence of 10 nmol / l insulin (ins) for 10 min. lysates were analyzed by western blot with the corresponding antibodies against total and/or phosphorylated forms of irs1 (tyr 608), akt (ser473), erk1/2 (thr202/tyr204), grk2, and -actin. representative immunoblots of 46 independent experiments and densitometric analysis are shown in (a, c, and d). p 2-fold in ewat tissue of the ob / ob model of obese mice (fig. 3b) and by 2.5-fold in human adipocytes forced to develop an insulin - resistant state upon a chronic challenge with insulin (fig. because lymphocyte grk2 levels have been reported to mirror changes in the kinase expression in other organs under several physiopathological circumstances (27), we analyzed the levels of grk2 in peripheral blood mononuclear cells obtained from patients with diverse degrees of insulin resistance (supplementary table 2, available in an online appendix). in these cells, grk2 levels were higher in insulin - resistant patients compared with control individuals (fig. although preliminary, our results indicate that grk2 levels are altered in murine experimental models and in human samples under insulin - resistant conditions, suggesting that this kinase might mediate the ability to induce insulin resistance of different neurohumoral factors that are altered in these situations (28,29). grk2 protein expression is enhanced under insulin - resistance conditions. a : ewat, liver, and muscle from 3- or 9-month - old male mice, fed on a hfd for 12 weeks or treated with tnf- (0.1 g / kg body wt) for 48 h ; (b) ewat from wt and ob / ob mice ; (c) insulin - sensitive and insulin - resistant human adipocytes ; and (d) peripheral blood mononuclear cells (pbmcs) collected from blood samples of insulin - sensitive individuals and insulin - resistant patients (supplementary table 2) were lysed and subjected to immunoblot analysis with antibodies against grk2 and -actin as a loading control. data in a, b, and c are means sem of 4 independent experiments. data in a were normalized with the indicated control, and results are expressed as percent over basal (3 month, wt mice). results in d represent the means sem of 10 control subjects and 25 metabolic syndrome patients. p 50% fat. results were expressed as proportion between fat volumes vs. total mouse volume (fat vol / total vol). g : ewat weight in 3- and 9-month - old male wt and grk2 mice. h : paraffin - embedded sections of wat : retroperitoneal, epididymal, and inguinal fat pads from 9-month - old male wt and grk2 mice stained with hematoxylin and eosin. (a high - quality color representation of this figure is available in the online issue.) to study the modulation of insulin signaling by grk2 in relevant insulin - targeted cell types, we used murine white adipocytic and myocytic cell lines expressing enhanced or decreased grk2 protein levels, or overexpressing a catalytically inactive mutant of grk2 (fig. the increase in glucose uptake elicited by insulin in both cell types was blocked in the presence of enhanced grk2 levels, whereas grk2 knockdown led to a slightly higher response (fig. after acute insulin challenge, irs1 tyrosine phosphorylation and akt activation were impaired upon grk2 or grk2-k220r overexpression, both in adipocytes and in myoblasts (fig. basal irs1 protein levels were higher in cells with silenced grk2 and decreased in cells with elevated grk2, suggesting a functional relationship between grk2 and irs1 (fig. co - immunoprecipitation experiments in adipocytes showed that both endogenous grk2 and irs1 proteins form a complex under basal conditions that is completely disrupted after 10 min of insulin treatment (fig. grk2 overexpression enhances the amount of irs1 associated to the kinase by 87% and prevents the complete disruption of the complex by insulin. in contrast, grk2 downregulation decreases its basal association with irs1 and facilitates a complete disruption of this complex by insulin. immortalized murine white adipocytes and c2c12 myocytes were transiently transfected with empty vector (control, c), pcdna3-grk2-neo (+), the catalytically inactive pcdna3-grk2k220r (k), or shgrk2-rnai () to upregulate or knock - down grk2 expression, respectively. a : lysates were analyzed by western blot with the corresponding antibodies against grk2 and -actin. for examples of full - length blots, see supplementary fig. b : adipocytes and myocytes were cultured for 24 h in serum - free and low - glucose medium and stimulated in the absence or presence of 10 nmol glucose uptake was measured during the last 10 min by incorporation of 2-deoxyglucose into the cells. results were expressed as percentage of stimulation over basal of control cells (adipocytes, 5.3 0.3 pmol glucose / mg protein/10 min ; myocytes, 45.8 3.2 pmol glucose / mg protein/10 min) and are means sem of five independent experiments. c : adipocytic and (d) myocytic cell lines were serum - starved overnight and then incubated in the absence or presence of 10 nmol / l insulin (ins) for 10 min. lysates were analyzed by western blot with the corresponding antibodies against total and/or phosphorylated forms of irs1 (tyr 608), akt (ser473), erk1/2 (thr202/tyr204), grk2, and -actin. representative immunoblots of 46 independent experiments and densitometric analysis are shown in (a, c, and d). p 2-fold in ewat tissue of the ob / ob model of obese mice (fig. 3b) and by 2.5-fold in human adipocytes forced to develop an insulin - resistant state upon a chronic challenge with insulin (fig. 3c). finally, because lymphocyte grk2 levels have been reported to mirror changes in the kinase expression in other organs under several physiopathological circumstances (27), we analyzed the levels of grk2 in peripheral blood mononuclear cells obtained from patients with diverse degrees of insulin resistance (supplementary table 2, available in an online appendix). in these cells, grk2 levels were higher in insulin - resistant patients compared with control individuals (fig. although preliminary, our results indicate that grk2 levels are altered in murine experimental models and in human samples under insulin - resistant conditions, suggesting that this kinase might mediate the ability to induce insulin resistance of different neurohumoral factors that are altered in these situations (28,29). grk2 protein expression is enhanced under insulin - resistance conditions. a : ewat, liver, and muscle from 3- or 9-month - old male mice, fed on a hfd for 12 weeks or treated with tnf- (0.1 g / kg body wt) for 48 h ; (b) ewat from wt and ob / ob mice ; (c) insulin - sensitive and insulin - resistant human adipocytes ; and (d) peripheral blood mononuclear cells (pbmcs) collected from blood samples of insulin - sensitive individuals and insulin - resistant patients (supplementary table 2) were lysed and subjected to immunoblot analysis with antibodies against grk2 and -actin as a loading control. data in a, b, and c are means sem of 4 independent experiments. data in a were normalized with the indicated control, and results are expressed as percent over basal (3 month, wt mice). results in d represent the means sem of 10 control subjects and 25 metabolic syndrome patients. to test the hypothesis that such moderate changes in grk2 expression levels may indeed alter insulin signaling in vivo, we studied whole - body insulin action and glucose homeostasis in age - matched wild - type and grk2 male mice. these haploinsufficient mice constitute a good model to recapitulate differences in grk2 expression in the same range to those observed in pathological conditions, as well as to evaluate the potential of therapeutic strategies aimed at decreasing grk2 functionality in vivo. whereas grk2 knock - out mice die in utero with a marked cardiac hypoplasia (30) and the cardiac phenotype of grk2 mice has been well characterized (31,32), insulin signaling has not been investigated so far in these animals. because tnf- infusion induces insulin resistance in murine models in vivo (24,33), we examined insulin sensitivity by gtts and itts in wild - type and grk2 3-month - old male mice after a 48-h treatment with tnf- (fig., tnf- produced a significant 29% increase in fasting blood glucose levels (table 1). moreover, the additional pronounced hyperglycemic effect of tnf- after glucose injection observed in wild - type mice was attenuated in grk2 mice (fig. the improved glucose tolerance observed was not due to an increase in circulating insulin because grk2 mice had lower circulating insulin levels than wild - type mice in both the fasted state (table 1) and during the gtt (fig. these results suggest that the more efficient glucose clearance observed in grk2 mice is caused by enhanced peripheral insulin sensitivity. in line with this notion, the hypoglycemic effect of insulin injection was impaired upon tnf- treatment in wild - type animals but not in grk2 mice (fig. wt (open symbols, solid lines) and grk2 (filled symbols, dotted lines) adult male mice were treated with tnf- (0.1 g / g body wt, circles) or vehicle (100 l pbs plus 0.1% bsa, squares) for 48 h. a : gtts were performed on animals that had been fasted for 24 h and were given an injection of glucose (2 g / kg body wt). c : itts were performed on fed male mice that had received insulin (0.8 iu / kg body wt). glucose concentration was determined in blood samples obtained from the tail vein. d : wt and grk2 male mice were treated or not with insulin (1 iu / kg body wt) for 15 min, and ewat, liver, and muscle were removed. lysates were subjected to western blot with the indicated antibodies against total and phosphorylated akt (ser473), grk2, and -actin. s2 and supplementary table 1 for detailed quantification of these data. for examples of full - length blots, see supplementary fig. metabolic parameters of wt and grk2 male mice data are means sem of measurements obtained for 818 animals for each group. 3 months vs. 9 months, fed a hfd or treated with tnf- ; p 50% fat. results were expressed as proportion between fat volumes vs. total mouse volume (fat vol / total vol). g : ewat weight in 3- and 9-month - old male wt and grk2 mice. h : paraffin - embedded sections of wat : retroperitoneal, epididymal, and inguinal fat pads from 9-month - old male wt and grk2 mice stained with hematoxylin and eosin. (a high - quality color representation of this figure is available in the online issue.) in this report, we uncover grk2 as a key modulator of insulin sensitivity in vivo. in cultured adipocytes and myoblasts, increased grk2 or grk2-k220r levels inhibit insulin - stimulated glucose uptake and signaling in a kinase - activity independent manner, by mechanisms involving the formation of dynamic grk2/irs1 complexes. grk2 expression is enhanced by 2-fold in insulin - resistant human adipocytes, in blood mononuclear cells from insulin - resistant patients, and in adipose and muscle tissues in either tnf-, aging-, or hfd - induced insulin - resistance models. importantly, grk2 mice maintain glucose tolerance and insulin signaling in the major insulin - responsive tissues under such experimental conditions, suggesting that enhanced grk2 expression above a certain threshold markedly impairs insulin sensitivity in vivo. because grk2 haploinsufficient animals show a phenotype quite similar to mice deficient in other well established negative regulators of insulin signaling such as ptp1b (24,33,34), grk2 can be regarded as a bona fide novel physiological regulator of insulin action and leanness. previous reports have indicated that grk2 could act as an inhibitor of insulin action in cellular models. binding of grk2 to gq/11 impairs insulin - stimulated glucose uptake in 3t3l1 preadipocytes (19), and enhanced grk2 levels favor insulin resistance induced by endothelin-1 in 3t3l1 cells (29) or by chronic -adrenergic receptor stimulation in hek-293 cells (28). gpcr agonists promote grk2 interaction with gq and also with irs1, resulting in decreased insulin - stimulated glucose transport, irs - serine phosphorylation, and irs1 degradation (29). our data in cultured cells as well as in adipose tissue in vivo show that irs1 levels as well as the amount of basal grk2-irs1 complexes depend on grk2 expression and that insulin stimulation rapidly disrupts basal irs1/grk2 complexes, which is hampered in the presence of elevated levels of grk2. overall, these data suggest that altered grk2 levels could lead to modulation of insulin signals through grk2-gq/11 binding, grk2-irs1 association, and altered endothelin-1 or -adrenergic - mediated transmodulation of the insulin pathway. interestingly, -arrestin2, another member of the gpcr signal transduction pathway, positively regulates insulin sensitivity by serving as a scaffold of akt and src to the insulin receptor (35). -arrestin2 levels are downregulated in liver and muscle in animal models and patients with insulin resistance. therefore, simultaneous upregulation of grk2 and downregulation of -arrestin2 in insulin - resistant conditions could lead to major alterations in the insulin signaling pathways and in gpcr insulin receptor cross - talk. it is worth noting that elevated levels of insulin and igf-1 have been shown to exert differential effects on grk2 and -arrestin2 expression (36,37). enhanced grk2 levels could alter the proposed novel insulin receptor arrestin signaling pathway by redirecting arrestin to other interactors, such as gpcr, or, given the reported direct interactions of the kinase with akt or src, by inhibiting the formation of the arrestin / akt / src complexes. grk2 is degraded by the proteasome pathway by associating with the mdm2 e3-ubiquitin ligase, and activation of the pi3k / akt pathway by igf-1 blocks mdm2-mediated grk2 degradation, leading to enhanced grk2 levels (38). consistently, chronic insulin has been recently shown to increase grk2 levels in hek-293 and liver fl83b cells (20,28), which is in agreement with the upregulation of grk2 we observe after insulin treatment in human adipocytic cells. thus, it is tempting to suggest that the hyperinsulinemia associated with aging-, hfd-, or tnf-induced insulin - resistant conditions, and clinically associated with obesity and type 2 diabetes, would trigger the observed upregulation of grk2 in such conditions. consistent with our findings, enhanced grk2 expression has been reported in tissues from obese zucker rats, a model of insulin resistance and hyperinsulinemia (39). an altered cytokine expression pattern typical of insulin - resistant states could also contribute to enhance grk2 expression levels. tnf- or il-6 increase the expression of other negative modulators of the insulin signaling cascade like ptp1b (24,40), and we find that tnf- also enhances grk2 protein content in adipose tissue and muscle of wild - type mice in the presence of mild hyperinsulinemia. as in grk2 mice, ptp1b - deficient animals also exhibit protection against insulin resistance induced by tnf- (24) or il-6 (40). proinflammatory mediators can modulate endogenous grk2 expression in a cell - type specific fashion (41), and an increase in grk2 protein is found upon chronic il-1 treatment (26,42). interestingly, grk2 appears to have a relevant role in the etiology and/or in the development of several inflammatory diseases such as multiple sclerosis and autoimmune arthritis (43). a role for grk2 in states of insulin resistance associated with inflammatory diseases deserves further investigation. the fact that the 50% downregulation of grk2 levels is sufficient per se to protect against tnf--, aging-, or hfd - induced alterations in glucose homeostasis and insulin signaling strongly supports that this kinase is a key modulator of insulin sensitivity in vivo and suggests new therapeutic strategies against type 2 diabetes and obesity. in fact, in animal models of type 2 diabetes, grk2 inhibition through systemic delivery of small peptides derived from its catalytic domain results in improved glucose homeostasis (28,44). it remains to be established whether inhibition of catalytic activity, downregulation of protein expression, or targeted disruption of the specific interaction of grk2 with insulin signaling pathway components are the more appropriate strategies for specifically improving insulin sensitivity. the grk2 mice constitute a good model that recapitulates a sustained systemic inhibition of kinase functionality. we report here that grk2 levels are important modulators of age- and diet - induced adiposity. grk2 mice gained less weight and showed diminished adipocyte size with a hfd, and adult hemizygous animals displayed reduced adiposity and lower circulating levels of insulin and leptin. aging is associated with fat mass accretion and with decreased peripheral insulin sensitivity in humans and rodents (45), and impaired insulin actions in adipose tissue could represent a key step leading to the overall insulin - resistance characteristic of adult and/or obese animals (46). adipocyte - conditioned medium impairs insulin signaling in muscle cells (22) and hepatocytes (47), and mice that exhibit reduced adiposity typically display improved glucose tolerance and increased insulin sensitivity (46). therefore, it is possible that part of the insulin hypersensitivity detected in grk2 mice and the protection afforded to the development of insulin - resistant conditions in these animals could be related to the observed changes in adiposity. future experiments involving tissue - specific downregulation will provide new insight into the understanding of the role of grk2 in obesity and insulin resistance. | objectiveinsulin resistance is associated with the pathogenesis of metabolic disorders as type 2 diabetes and obesity. given the emerging role of signal transduction in these syndromes, we set out to explore the possible role that g protein coupled receptor kinase 2 (grk2), first identified as a g protein coupled receptor regulator, could have as a modulator of insulin responses.research design and methodswe analyzed the influence of grk2 levels in insulin signaling in myoblasts and adipocytes with experimentally increased or silenced levels of grk2, as well as in grk2 hemizygous animals expressing 50% lower levels of this kinase in three different models of insulin resistance : tumor necrosis factor- (tnf-) infusion, aging, and high - fat diet (hfd). glucose transport, whole - body glucose and insulin tolerance, the activation status of insulin pathway components, and the circulating levels of important mediators were measured. the development of obesity and adipocyte size with age and hfd was analyzed.resultsaltering grk2 levels markedly modifies insulin - mediated signaling in cultured adipocytes and myocytes. grk2 levels are increased by 2-fold in muscle and adipose tissue in the animal models tested, as well as in lymphocytes from metabolic syndrome patients. in contrast, hemizygous grk2 mice show enhanced insulin sensitivity and do not develop insulin resistance by tnf-, aging, or hfd. furthermore, reduced grk2 levels induce a lean phenotype and decrease age - related adiposity.conclusionsoverall, our data identify grk2 as an important negative regulator of insulin effects, key to the etiopathogenesis of insulin resistance and obesity, which uncovers this protein as a potential therapeutic target in the treatment of these disorders. |
elevated resting heart rate (rhr) has been associated with increased risk of all - cause mortality and cardiovascular (cv) events in healthy subjects as well as those with preexisting cv disease (cvd) including hypertension, acute myocardial infarction, and heart failure or left ventricular dysfunction by numerous epidemiologic studies and recently reviewed ones by palatini and julius and fox.. in a recent study of woodward., individual data from 112,680 subjects in 12 cohort studies were collected and an association between rhr above 65 beats / min (bpm) and the risk of both cv and all - cause mortality has been found independent of preexisting cvd. plausible pathophysiological mechanisms were reviewed by lang. and include, briefly, both indirect mechanisms related to autonomic dysregulation and those directly related to an increased heart rate per se (such as increased ischaemic burden and local haemodynamic forces adversely impacting on the endothelium and arterial wall). stettler. found an association between rhr and all - cause mortality and cvd in a cohort of 302 t2 dm patients. linnemann and janka have identified an elevated rhr as a high risk for cv death in a cohort of 475 t2 dm patients. hillis. found a relationship between baseline higher rhr and all - cause mortality, cv death, and major cv events (nonfatal myocardial infarction or nonfatal stroke) in a cohort of 11,140 t2 dm patients ; the increased risk associated with a higher baseline rhr was most obvious in patients with previous macrovascular complications. hillis. also extended the study on the same cohort of t2 dm patients on the effect of rhr and microvascular complications (nephropathy and retinopathy) and reported an increased incidence and a greater progression of. there are, however, fewer data on the relationship of rhr and renal events in diabetic subjects. miot. studied a cohort of 1088 t2 dm patients for the association of rhr with the incidence of composite cv and renal endpoint (cv death, nonfatal myocardial infarction and/or stroke, hospitalization for heart failure, and renal replacement therapy) and also for the renal endpoint alone. while in patients without cvd no relationship was found, in the subgroup with cvd history at baseline significant association between rhr and the incidence of cv and/or renal events renal end - point, an end - stage renal disease (esrd), is impractical in majority of observational cohorts and interventional studies due to relatively short follow - up. furthermore, diabetic kidney disease (dkd) appears to be phenotypically heterogeneous (see further) and thus pathways and mediators (e.g., rhr) leading to esrd might differ. as documented by recent studies in both types of diabetes, progressive renal decline (defined as continuous rate of glomerular filtration rate (gfr) loss 3.3% per year) might coexist with a classical form of dkd with increased urinary albumin excretion preceding gfr decline [1012 ]. no study, so far, focused on predictive power of rhr for dkd progression considering both phenotypes (albuminuric versus nonalbuminuric dkd) in t2 dm patients. therefore, the aims of the present study were (1) to evaluate whether rhr is associated with dkd stage or cvd at baseline, (2) to eventually replicate in our cohort of t2 dm patients previous sporadic positive findings on rhr as a predictor of cvd and dkd endpoints and death in t2 dm patients, and finally (3) to specifically address rhr predictive potential for progressive renal decline in our cohort. a total of 421 t2 dm patients (unrelated caucasian subjects from south moravia region, czech republic), 51.5% of men, with median age 67 [iqr 6175 ], median dm duration 14 years [iqr 821 ], and range of dkd stages at baseline, were enrolled into the study between 2002 and 2010. severity of dkd was defined according to the urinary albumin excretion (uae) and stage of chronic kidney disease (ckd) by gfr assessed by creatinine clearance based on 24 h urine collection. both parameters, uae and gfr, were repeatedly measured at least once in 6 months or more often ; staging for dkd and ckd was based on two consecutive values. at baseline, the study sample consisted of normoalbuminuric subjects (uae 300 mg/24 h, 51.5%), and subjects with end - stage renal disease (esrd, 9.3%). respective staging for ckd in the same sample was ckd i (gfr 90 ml / min per 1.73 m, 17.3%), ckd ii (6089 ml / min per 1.73 m, 18.3%), ckd iii (3059 ml / min per 1.73 m, 36.9%), ckd iv (1529 ml / min per 1.73 m, 16.3%), and subjects with ckd v at baseline (gfr 0.05, mann - whitney test). for frequencies of each drug group prescription within the whole group or subgroups, see tables 1 and 2 (all p > 0.05, chi - square test). finally, we assessed correlations of rhr with other clinical data (age, diabetes duration, sbp, dbp, fpg, hba1c, creatinine, urea, and total cholesterol) and found significant correlations with fpg (r = 0.12, p = 0.02, spearman) and sbp (r = 0.16, p = 0.028, spearman). (a) kaplan - meier analysis of separate end - points. during the follow - up period, cumulative incidences of dkd progression, mace, and all - cause mortality were 48.3%, 23.1%, and 38.9%, respectively, in the whole group ; for incidences in cvd - b or dkd - b subgroups separately, see table 3. of a total of 376 subjects analysed in the follow - up study, 62 had both cvd and dkd at baseline. of those, 35 (56%) died and 27 (44%) survived (p > 0.05, chi - square test). no statistically significant difference in rhr was ascertained between decliners and nondecliners (p > 0.05, mann - whitney test). irrespective of non - significant differences in rhr between subjects with cvd or dkd at baseline (b) compared to those without (b), analyses were still performed for (i) the whole group and (ii) cvd - b and (iii) dkd - b subgroups. using time - to - event analyses, any significant differences in the cumulative incidence of the three studied outcomes were found between rhr 0.05, log - rank test). in spite of the fact that rhr did not significantly differ between beta - blocker users and nonusers in the whole group or any of the subgroups defined based on cvd or dkd status at baseline, we still analysed the effect of rhr (cut - off 0.05, log - rank test). (b) competing risk analysis. since estimates based on the naive kaplan - meier curves do not consider the presence of competing risks, they apparently tend to overestimate the probability of occurrence of the individual events in time. we compared groups with initial rhr 0.05, gray test). similarly, no significance was found for all - cause death (p > 0.05, gray test). in the present study we evaluated a predictive potential of baseline rhr for progression of dkd (and more specifically for rapid gfr decline), mace, and all - cause death in t2 dm patients. in the cross - sectional part of our study, we compared clinical and biochemical data between groups of diabetic subjects with or without initial dkd or cvd. subjects in both dkd - b and cvd - b subgroups had significantly higher age, longer diabetes duration, worse renal parameters (higher levels of urea and creatinine and higher degree of albuminuria), higher fpg, and male predominance in a cvd - b subgroup, while dkd - b subgroup had higher dbp and a higher proportion of decliners. although previous studies found an association between rhr and prevalence of baseline cvd [79 ] or dkd [8, 9 ] in t2 dm patients, we were not able to ascertain similar significant differences in rhr in any of those categories studied. the major focus of the study was the prospective evaluation of the predictive potential of rhr for the mace and progression of dkd. moreover, we believe, this is a first study dealing with rhr in relation to the progressive renal decline. the concept of progressive renal decline was proposed by krolewski in t1 dm patients as an alternative pathway to albuminuric dkd. dm patients found a reduced estimated gfr (egfr) without albuminuria independently associated with a significant cvd burden, higher than albuminuria alone, whereas the combination of reduced egfr and albuminuria marked a further increased risk of cvd events in an additive manner. we found a higher proportion of decliners in dkd - b subgroup of patients, which could be explained by generally nonlinear pattern of renal disease progression ; however, no such difference was found between cvd - b and cvd - b subgroups in spite of the fact that cvd - b group had worse renal parameters at baseline similarly to dkd - b. this might signify a specific pathogenic mechanism unrelated to cvd and this topic warrants further study. since beta - blockers or raas blockers have an obvious influence on rhr, we adjusted our analyses for the therapy modality. there was no therapy - related effect on any of the outcomes studied and on any of subgroups. our finding of positive correlation of rhr with fpg and sbp corresponds with results of previous studies ; for example, in a large study of a french population with almost 100,000 participants, heart rate was positively associated with blood pressure, triglycerides, glycaemia, and physical inactivity and negatively with body height. in the prospective part of the study, we were unable to identify any significant relationship of an initial rhr with dkd progression, major adverse cardiovascular event, and all - cause mortality in our cohort. since more than one end - point may occur in the same patient, a competing risk methodology for multiple risk scenario was used. yet again, rhr was not identified as a significant risk factor for dkd progression or mace in the univariate competing risk model. those findings are contrary to results of previous sporadic studies. a prospective study by hillis. found in a cohort of 11,140 t2 dm patients with a history of cvd participating in advance study an association between higher baseline rhr and a greater risk of developing microvascular endpoint (defined as a composite of new or worsening nephropathy) during 4.4-year follow - up. after adjustment for age, sex, and randomized treatment (perindopril - indapamide), a 10 bpm increase in baseline rhr was associated with an 18% increase in the observed hazard. another recent study of 1088 t2 dm patients by miot. focused on both cv and renal parameters (briefly, 31% of patients had a history of cvd at baseline (cvd - b) and median of follow - up was 4.2 years ; mean rhr was 67.7 bpm in cvd - b subgroup and 72.4 bpm in cvd - b subgroup) but not considering the drug therapy in the analyses ascertained rhr associated with the incidence of cv and renal morbidity / mortality (p = 0.0002) and also with renal risk alone adjusted for all - cause death as a competing event in the cvd - b subgroup only (p < 0.0001). in the cvd - b subgroup, no relation was found between rhr and the incidence of cv and/or renal events. we have not been able to replicate any predictive effect of the rhr for the renal or cv outcomes in t2 dm population of czech republic. given similar settings of our study, one of the possible explanations might certainly be a smaller sample size, slightly shorter follow - up, different definition of endpoints, or different cut - offs for rhr. regarding the latter, of plethora of possibilities, we have chosen stratification according to two rhr cut - offs, a median rhr and an arbitrary cut - off 65 bpm in line with results of a meta - analysis by woodward. there are several pathogenic mechanisms proposed by which an elevated heart rate might mediate development and progression of dkd and cvd. it has been suggested that a higher heart rate might promote microalbuminuria because of increased exposure of the glomerulus to arterial pressure waves. an increased heart rate has also variety of direct detrimental cardiovascular consequences including endothelial dysfunction and atherogenic activity that are important factors in the progression of dkd too. a higher heart rate also is associated with factors such as obesity, higher blood pressure, atherogenic dyslipidaemia, and reduced physical activity, all of which are associated with an increased risk of microvascular complications and are targets for intervention to improve outcome in patients with diabetes mellitus. finally, a faster resting heart rate is a characteristic feature of autonomic neuropathy, which is in turn associated with an increased prevalence of other complications, such as dkd or retinopathy. therefore, it is conceivable that mechanisms listed could have synergistic effects and represent potentially very important pathogenic mechanism ; on the contrary, the effect might operate in stage - dependent fashion given our negative finding of increased rhr as a general predictor of dkd progression in t2 dm. we are of course aware of several limitations of our study potentially impacting on its negative outcome. this together with the rather high representation of subjects with baseline dkd or cvd might weaken the potential predictive power of rhr in the situation of more advanced stages of cardiovascularly relevant comorbidities. therefore, although our results indicate several trends for example, patients with a history of cvd or dkd at baseline had more frequently beta - blockers in therapy and cvd - b patients have a tendency to a higher rhr the results were not found statistically significant in our cohort. in conclusion, recent study analysing the potential of rhr for the prediction of progression of dkd (and specifically progressive renal decline), major cardiovascular event, and all - cause death in a cohort of caucasian t2 dm subjects did not reveal significant effect (not even in the subgroup of heart rate affecting therapy - nave subjects). additional studies are therefore warranted to decipher if rhr could be an applicable risk marker for dkd. | elevated resting heart rate (rhr) has been associated with increased risk of mortality and cardiovascular events. limited data are available so far in type 2 diabetic (t2 dm) subjects with no study focusing on progressive renal decline specifically. aims of our study were to verify rhr as a simple and reliable predictor of adverse disease outcomes in t2 dm patients. a total of 421 t2 dm patients with variable baseline stage of diabetic kidney disease (dkd) were prospectively followed. a history of the cardiovascular disease was present in 81 (19.2%) patients at baseline, and dkd (glomerular filtration rate < 60 ml / min or proteinuria) was present in 328 (77.9%) at baseline. progressive renal decline was defined as a continuous rate of glomerular filtration rate loss 3.3% per year. resting heart rate was not significantly higher in subjects with cardiovascular disease or dkd at baseline compared to those without. using time - to - event analyses, significant differences in the cumulative incidence of the studied outcomes, that is, progression of dkd (and specifically progressive renal decline), major advanced cardiovascular event, and all - cause mortality, between rhr < /65 (arbitrary cut - off) and 75 (median) bpm were not found. we did not ascertain predictive value of the rhr for the renal or cardiovascular outcomes in t2 dm subjects in czech republic. |
who has defined low birth weight (lbw) as birth weight (bw) less than 2500 g at birth which is a global public health concern. about one half of the world 's low birth weight (lbw) babies are born in south asia and bangladesh has the highest incidence (3147%) [1, 2 ]. bw is an important predictor of infant growth and survival and is strongly associated with early mortality and morbidity with adverse long - term outcomes [3, 4 ]. low weight at birth is either the result of preterm delivery or intrauterine growth retardation (iugr). bw is affected by various factors including maternal age, parity, bmi, quality of antenatal care, anaemia, and pregnancy induced hypertension (pih) [610 ]. however, in developing countries like bangladesh maternal undernutrition is a major determinant of lbw [1115 ]. it has been reported that in many south asian countries including bangladesh women 's socioeconomic status is low and gender inequality persists in many sectors starting from intrahousehold food allocation, education, work, and property rights to decision - making matters. the majority of women have limited access to and control over resources and restriction in their mobility and are often under threat of violence from male relatives [1618 ]. there is no single accepted definition that represents it well. in this study, women 's decision - making autonomy is defined as women personal power in the household and her ability to make and execute independent decisions of her own concern or about close family members which is closely associated with maternal and child health outcomes [1921 ]. in a recent study in south india, it was observed that women with higher decision - making autonomy on financial resources and freedom to go to the market were significantly less likely to have a stunted child, after controlling for socioeconomic status and mother 's education. there have been a number of other studies that examine different dimension of women 's autonomy and its relationship with reproductive health and health outcomes such as maternal and child health care utilisation [22, 23 ], reproductive preferences, and contraceptive use [25, 26 ]. a study done by bloom., 2001, in north india shows that women 's autonomy is the major determinant of maternal health care utilisation. women with greater freedom of movement are more likely to receive antenatal care and to use delivery care, and the authors suggested that women 's autonomy is equally important to educational and economic characteristics. in order to address the lbw issue successfully, in a country like bangladesh, where maternal undernutrition and lbw are prevalent, it could be important to explore the role of women 's decision - making autonomy in relation with birth weight. the aim of this study is to assess the effect of women 's decision - making autonomy on infant 's birth weight in rural bangladesh. we hypothesized that women with lowest decision - making autonomy are more likely to have lbw babies than women with highest decision - making autonomy. the study was conducted in matlab, a poor rural subdistrict within chandpur district in bangladesh, located about 55 km southeast of dhaka, the capital. the women status is low in general, and traditional social and cultural norms curtail the women 's autonomy. it has been reported that, although in recent years the freedom and status of women have improved in this setting due to various women empowerment programs such as microcredit organization and other ngos, it is still far from advantageous. it is unusual for the majority of women to leave their home without a male companion which limits their opportunities for employment outside their homestead. a girl usually marries in her teens and moves into her husband 's home and loses the support network from her native family. since 1966 international centre for diarrhoeal disease research, bangladesh (icddr, b), has run a health and demographic surveillance system (hdss) in matlab covering a population of 220,000 that has collected vital demographic information (births, deaths, fertility, migrations, marriages and divorces, and household divisions). these data are updated by monthly home visits by trained community health research workers (chrw). the study included data from the maternal and infant nutritional intervention in matlab (minimat study), which is a combined intervention trial to promote maternal and infant health by providing prenatal food and micronutrients supplementation during pregnancy. within hdss system, pregnant women were identified by trained chrws on their monthly household visits. all pregnant women aged 1445 years in the area were eligible for enrolment in the study. urine pregnancy tests were performed in the field whenever a woman reported that her last menstrual period (lmp) was overdue by two weeks or more or that she understood that she was pregnant and later confirmed by ultrasonography at her first clinic visit. after confirmation of pregnancy women were closely followed throughout their pregnancy until delivery. out of 4436 enrolled, 2175 participants who had complete information on birth weight and decision - making autonomy were included in the analysis. all questionnaires were pretested and revised accordingly by the responsible investigators before introducing them in the study. a female field assistant measured weight and height of all enrolled women and collected sociodemographic information including women 's age, parity, educational status, income, household assets, husband 's education, and decision autonomy. we used the wealth index created by minimat team from the information on household assets to measure socioeconomic status (ses) of women. the women were informed that they had the right to withdraw from the study at any point without any consequences for access to or use of routine icddr, b and government health care services. was obtained from the ethical review committee of icddr, b. research assistants were trained to carry out the anthropometric measurements as per who guidelines. women were provided with a birth notification card that should be sent to the study office immediately after delivery. it also contained an incentive to do so by promising a small amount of money to reimburse travel cost. the infant birth weight was measured within 72 hours of delivery by using beam scales (seca gmbh), with a precision of 10 g. we used who cutoff for low birth weight (lbw) which refers infants born weighing less than 2.5 kg, regardless of gestational age and the cause of lbw. the weight of the pregnant women was measured with a precision of 0.1 kg with electronic scales (uniscale) that were accurate to 100 g. height was measured to a precision of 0.1 cm by using a stadiometer. we followed the who definition of bmi (i.e., 24.5. decision - making autonomy was estimated from 6 questions on decision making, for example, decision regarding own health care, making small and large household purchases. these questions were originally developed and validated from bangladesh demographic and health survey bdhs. in order to obtain information on the above measures of women 's decision - making autonomy, each woman enrolled in the study was asked the following questions at the time of her first antenatal visits : to what extent are you able to influence decisions related to the following:when you are sick, your own health care?making household purchases for household needs?making large household purchases?visits to natal relatives?consumption of food that you like to eat?utilisation of contraceptive methods ? when you are sick, your own health care ? making household purchases for household needs ? making large household purchases ? the responses were coded as follows : (a) 3 points for decisions made by the women ; (b) 2 points for women who have some influence on decision - making ; and (c) 1 point for those who do not have any influence or a very little influence. to facilitate analysis, a composite score ranges from 6 to 18 with a mean score 12.9 was created to measure decision making autonomy, which was further divided into tertile categories, resulting in the final score with lowest autonomy (12), medium (13 - 14), and highest autonomy (15). differences in enrolment characteristics between the women with and without complete data on birth weight (bw) and decision - making autonomy were examined by using independent t - test and chi - square tests based on the type of variables (continuous / categorical). bivariate association of bw with each covariate was assessed using the analysis of variance (anova), independent t - test and chi - square tests. covariates considered in the analysis comprised maternal age, parity, bmi, education of woman and her husband, household income, asset score, and living with mother - in - law. confounding factors were included in the final analysis for adjustment if its influence on the effect estimate was found to be more than 10%. finally, ancova and binary logistic regression were conducted with bw as a continuous and categorical dependent variable for both crude (model with decision - making autonomy only) and adjusted models (full model adjusted with confounding factors). all statistical analyses were carried out using ibm spss statistics 19 for window (spss inc., chicago, il). out of 4436 women in the study group, 2175 (49%) with complete information on bw and decision - making autonomy were included in the final analysis. in the first step about 26% of the participants were excluded for missing information on bw while 24% were excluded later for missing information on decision - making autonomy (figure 1). women with complete data on bw and decision - making autonomy were slightly older and had more children, lower education, and less income. there were no significant differences in maternal height, bmi, husband education, and residing with mother - in - law between those with or without complete data. overall women in complete group had higher mean bw and lower percentage of lbw infants than in incomplete group (table 1). women in this study group appeared to hold very little decision - making power in large household purchases whereas majority (74%) of women had their final say over food like to eat. about half of the women had some influence on decision making regarding their own health care but very few of women had final say on it. similarly, very few women had final say on using contraception, visits to natal relatives, and making small household purchases for daily household needs (table 2). the mean bw of children born to women with highest decision - making autonomy was significantly higher (2.75 0.4 kg) than in women with lowest decision - making autonomy (2.67 0.3 kg). in multivariate analysis, bw was significantly lower (69 g) in women with lowest decision - making autonomy as compared to women with highest decision - making autonomy after controlling for confounding factors like maternal age, bmi, asset scores, women and her husband 's education. maternal age, bmi, a woman education and asset scores were also found to have significant effect on birth weight (table 3). the proportion of lbw infants was significantly lower (24%) in women with highest decision - making autonomy than in women with lowest decision - making autonomy (32%). women with lowest decision - making autonomy had 40% increased risk of having lbw babies as compared to women with highest decision - making autonomy (odds ratio (or) = 1.4 ; 95% confidence interval (ci) 1.0, 1.8). among other covariates, maternal age and asset scores remained significantly associated with lbw in the final model (table 4) (results were shown already). the findings of this study support the hypothesis that low maternal decision - making autonomy is associated with increased lbw outcome in rural bangladesh. women with lowest decision - making autonomy had lighter babies as compared to women with highest decision - making autonomy. there are many direct and indirect complex pathways underlie in the relationship between women decision - making autonomy and infant 's bw. women decision - making autonomy can affect infant bw by affecting women 's health and nutritional status and foetal growth. women 's low social status in bangladesh followed by lack of decision - making autonomy on cooking or food choices can influence her health and nutritional status directly through dietary discriminatory practices such as unfair food sharing, inadequate and improper diet intake during pregnancy giving rise to maternal undernutrition and lbw outcome [12, 30 ]. maternal under nutrition is a major determinant of lbw in a developing country like bangladesh. the proportion of babies born with lbw reflects poor maternal health and nutritional status not only during pregnancy but over the whole life cycle of their childhood and young lives. poor maternal nutritional status at conception, low gestational weight gain due to inadequate dietary intake, and short maternal stature due to mother 's own childhood malnutrition and micronutrients deficiencies are responsible for maternal under nutrition [12, 13 ]. based on this concept, we can hypothesize that women with low decision - making autonomy on cooking or food choices are more likely to have lbw infants due to under nutrition and impaired foetal growth in - utero. woman 's autonomy regarding decision making on her own health care is also closely linked with maternal and child health outcome. a study based in three south asian countries revealed that decisions of women 's health care were made without their participation for the majority of women in nepal, approximately half in bangladesh (54.3%) and (48.5%) in indian households. this finding is consistent with our findings which reflects that only 29% of women had a final say on decision making of their own health care and 67% of them had only some influence. women with lack of decision - making autonomy on their health care are less likely to obtain regular health checkups including antenatal care, which covers iron and folic acid supplementation, tetanus toxoid immunization, safe delivery practices, and important health information regarding pregnancy and childbirth. beside this, low level of decision - making autonomy on health care can lead to low uptake of prenatal food and micronutrient supplementation in our study setting. lack of this could contribute to poor prenatal care, poor maternal health and nutritional status, and impaired foetal growth leading to lbw. a study in south india suggested that women 's permission to go to the market or to visit natal relatives could potentially provide a forum for exchanging health related information and could receive prenatal care earlier in their pregnancy and treatment for disease associated with iugr such as hypertension and heart disease that may lead to better birth outcome. on the other hand, other studies have explored the relationship between women autonomy and maternal health care utilisation using different aspects of autonomy such as financial autonomy, decision - making autonomy, and mobility autonomy. the results revealed that women with greater freedom of movement obtained better antenatal care and were more likely to use safe delivery care which can affect birth weight [19, 22 ]. apart from this study, many other studies have examined the role of women 's autonomy in fertility preferences and use of contraception [24, 26 ]. women 's final say in decision regarding day to day household purchases and spousal communication is significantly associated with fertility preferences and use of contraception which may facilitate proper birth spacing and prevent early pregnancy and childbirth which can also help to reduce the lbw prevalence. women in south asian countries including bangladesh are often under threat of violence due to their subordinate position. they may have less possibility for decision making in the household in different sectors such as decision making for herself or her family members, purchasing food, control over resources, and so forth, which might affect her health and nutritional status as well as foetal growth and development, giving rise to lbw babies. a study in bangladesh reported that 50% of women experiencing some form of family violence had lbw babies followed by early childhood growth impairment. we hypothesize that women with low decision - making autonomy are more likely to face any kind of violence which might affect infant 's birth weight through several mechanisms. direct physical trauma to pregnant women 's abdomen may lead to preterm delivery along with other serious maternal and foetal complications. it has been reported that stress and depression related with all forms of violence can increase the risk of impaired foetal growth and lbw. many researchers have suggested that stress and depression cause disturbances in hypothalamic - pituitary - adrenal axis giving rise to increased level of stress hormones which affects intrauterine environment resulting in iugr. similarly, activation of sympathetic - adrenal - medullary system resulting in vasoconstriction and hypoxia with decreased uteroplacental perfusion contributes to growth restriction and lbw. however, further exploration is required to find out the exact mechanism [31, 33 ]. along with stress and depression, violence is often accompanied by social isolation and lack of social support which may affect infant 's bw. a major strength of the study is randomized enrolment of pregnant women over the survey period which makes the results relatively representative of the study population, and hence the findings can be appropriately generalized to women in similar rural areas of bangladesh. the socioeconomic characteristics of this study rural area in matlab were similar to those of national level according to the census of matlab hdss study area in 2005. these findings in matlab can be applied to or are important to other populations in the world. however, there are some limitations and some sources of bias in this study. understanding the role of women 's decision - making autonomy in relation to bw is complex because of its multidimensionality and difficulty in formulating an appropriate autonomy measures. in this study, we have examined only one aspect of women 's autonomy, that is, decision - making autonomy. along with decision - making autonomy we could have analysed other areas of autonomy like control over finances, freedom of movement, and woman 's attitude towards domestic violence (wife beating) which could have important impact on bw in this context. women in our study group were significantly older and had more children which is likely to overestimate the effect. we have adjusted bmi as a confounding factor in the final multivariate model with bw as a continuous variable which might cause overadjustment and underestimate the effect. this study revealed that women 's decision - making autonomy has an independent effect on infant bw and lbw outcome after controlling for all confounders like maternal age, ses, and education. the result of our study suggests that improving women 's decision - making autonomy will have a positive effect on reduction of lbw. in addition, there is a need for further exploration to identify sociocultural attributes and gender related determinants of women 's decision - making autonomy in this study setting. | background. low birth weight (lbw), an outcome of maternal undernutrition, is a major public health concern in bangladesh where the problem is most prominent. women 's decision - making autonomy is likely an important factor influencing maternal and child health outcomes. the aim of the study was to assess the effect of women 's decision - making autonomy on infant 's birth weight (bw). methods. the study included data of 2175 enrolled women (1445 years of age) from the maternal and infant nutritional intervention in matlab (minimat - study) in bangladesh. pearson 's chi - square test, analysis of covariance (ancova), and logistic regression analysis were applied at the collected data. results. women with lowest decision - making autonomy were significantly more likely to have a low birth weight (lbw) child, after controlling for maternal age, education (woman 's and her husband 's), socioeconomic status (ses) (odds ratio (or) = 1.4 ; 95% confidence interval (ci) 1.0, 1.8). bw was decreased significantly among women with lowest decision making autonomy after adjusting for all confounders. conclusion. women 's decision - making autonomy has an independent effect on bw and lbw outcome. in addition, there is a need for further exploration to identify sociocultural attributes and gender related determinants of women decision - making autonomy in this study setting. |
treatment planning is challenging because the accumulated experience of any particular individual or institution in managing this tumour is rather limited. this problem is further compounded by the absence of a universally accepted tumour staging system, making treatment outcome comparison difficult. it is now known that the single most important factor determining survival is the local tumour extent at presentation. it is therefore crucial to establish the disease extent in order to optimize treatment options. the patterns of tumour spread are well described in the surgical literature. computed tomography (ct) can demonstrate bony erosion with exquisite detail but magnetic resonance (mr) imaging is preferred in the delineation of tumour spread along vascular channels, neural pathways, intracranial extension and involvement of the extra - temporal soft tissues. on temporal bone ct, early carcinoma of the eac commonly presents as a soft tissue mass within the eac. as the disease progresses, aggressive underlying bony destructive changes are demonstrated. as the tumour infiltrates and spreads deep into the surrounding tissue, it is best shown as a heterogeneously enhancing lesion on contrast - enhanced mr imaging. carcinoma of the eac most commonly spreads through the floor of the eac into the soft tissue below the temporal bone. this may be related to the presence of the fissures of santorini along the inferior aspect of the cartilaginous eac. less frequently, the tumour erodes posteriorly into the mastoid bone or anteriorly through the tympanic portion of the eac to invade the temporomandibular joint (fig. 1). on the other hand, superior extension into the middle cranial fossa and medial extension into the middle ear are rare. (a) axial t1-weighted mr image shows intermediate signal tumour in the left eac (asterisk) extending into the temporomandibular joint and displacing the mandibular condyle (arrow) anteriorly. (a) axial t1-weighted mr image shows intermediate signal tumour in the left eac (asterisk) extending into the temporomandibular joint and displacing the mandibular condyle (arrow) anteriorly. medial extension into the middle ear cavity is of special interest because of the resultant poor prognosis. this negative prognostic indicator is related to the subsequent disease spread beyond the middle ear making surgical excision increasingly difficult. tumour in the middle ear can readily extend superiorly through the thin tegmen tympani into the middle cranial fossa (fig. however, the presence of temporal lobe oedema associated with tumour extension into the middle cranial fossa does not necessarily indicate cerebral parenchymal infiltration. (a) coronal contrast - enhanced mr image shows tumour in the right middle ear (arrow) with extension through the tegmen tympani into the middle cranial fossa. (b) coronal contrast - enhanced mr image (posterior to (a)) shows tumour in the right eac (asterisk) with middle ear and intracranial extension. note enhancement in the labyrinth (black arrow) and the internal auditory canal (white arrow). (a) coronal contrast - enhanced mr image shows tumour in the right middle ear (arrow) with extension through the tegmen tympani into the middle cranial fossa. (b) coronal contrast - enhanced mr image (posterior to (a)) shows tumour in the right eac (asterisk) with middle ear and intracranial extension. note enhancement in the labyrinth (black arrow) and the internal auditory canal (white arrow). from the middle ear cavity tumour may gain access into the labyrinth through the lateral semicircular canal, oval or round windows. malignant infiltration often extends further proximally along the vestibular or cochlear nerves into the internal acoustic canal (fig. the resistant cortical bone of the inner ear, especially the otic capsule, often limits the amount of gross bone destruction but aggressive tumours will eventually involve the cochlea (fig. 3). figure 3(a) axial ct shows a right eac tumour eroding the otic capsule and destructing the cochlea (asterisk). 4a) shows inferior spread of the right eac tumour involving the internal carotid artery and jugular bulb (asterisk). note the normal left carotid foramen (black arrow) and jugular foramen (white arrow) for comparison. figure 4(a) axial t1-weighted mr image shows an intermediate signal intensity tumour in the left middle ear cavity with extension posteriorly into the mastoid (arrow). (a) axial ct shows a right eac tumour eroding the otic capsule and destructing the cochlea (asterisk). 4a) shows inferior spread of the right eac tumour involving the internal carotid artery and jugular bulb (asterisk). note the normal left carotid foramen (black arrow) and jugular foramen (white arrow) for comparison. (a) axial t1-weighted mr image shows an intermediate signal intensity tumour in the left middle ear cavity with extension posteriorly into the mastoid (arrow). in contrast to the difficulty of invading cortical bone, tumour can readily spread from the middle ear posteriorly through the aditus into the mastoid antrum (fig. further posterior spread leads to extension into the posterior cranial fossa and involvement of the sigmoid sinus (fig. figure 5a 55-year - old female with a left eac tumour extending into the posterior cranial fossa. (a) axial t1-weighted mr image shows intermediate signal intensity tumour in the left eac (asterisk) with extension into the posterior cranial fossa (arrow). (b) axial contrast - enhanced mr image shows heterogeneous contrast enhancement in the tumour. (c) coronal t1-weighted mr image shows intermediate signal intensity tumour in the posterior aspect of the left mastoid bone (arrow) and along the dural venous sinus (arrowheads). (d) coronal contrast - enhanced image shows enhancement of the tumour (arrow). a 55-year - old female with a left eac tumour extending into the posterior cranial fossa. (a) axial t1-weighted mr image shows intermediate signal intensity tumour in the left eac (asterisk) with extension into the posterior cranial fossa (arrow). (b) axial contrast - enhanced mr image shows heterogeneous contrast enhancement in the tumour. (c) coronal t1-weighted mr image shows intermediate signal intensity tumour in the posterior aspect of the left mastoid bone (arrow) and along the dural venous sinus (arrowheads). (d) coronal contrast - enhanced image shows enhancement of the tumour (arrow). tumour erosion through the floor of the middle ear anteriorly results in the involvement of the carotid artery while inferior extension through the floor posteriorly involves the jugular foramen (fig. cancers with extensive inferior spread involving the jugular bulb and internal carotid artery exclude the surgical options of lateral temporal bone resection and subtotal temporal bone resection, and are often unresectable (figs. 6 and 7). figure 6a 57-year - old male with carcinoma of the right eac showing intracranial infiltration and spread below the skull base. (a) coronal ct shows tumour in the right eac eroding the cochlea (short arrow) and the floor adjacent to the carotid canal (long arrow). (b) coronal ct (posterior to (a)) shows permeative erosion of the roof of the right middle ear (short arrow), and the floor adjacent to the jugular foramen (long arrow). (c) coronal contrast - enhanced mr image shows enhancing tumour in the right eac spreading into the right middle cranial fossa causing gross dural thickening (asterisk). figure 7(a) coronal contrast - enhanced mr image shows a left eac tumour (asterisk) spreading and involving the left internal carotid artery (arrow). (b) axial contrast - enhanced mr image shows the tumour with heterogenous enhancement surrounding the left petrous internal carotid artery (long arrow). a 57-year - old male with carcinoma of the right eac showing intracranial infiltration and spread below the skull base. (a) coronal ct shows tumour in the right eac eroding the cochlea (short arrow) and the floor adjacent to the carotid canal (long arrow). (b) coronal ct (posterior to (a)) shows permeative erosion of the roof of the right middle ear (short arrow), and the floor adjacent to the jugular foramen (long arrow). (c) coronal contrast - enhanced mr image shows enhancing tumour in the right eac spreading into the right middle cranial fossa causing gross dural thickening (asterisk). (a) coronal contrast - enhanced mr image shows a left eac tumour (asterisk) spreading and involving the left internal carotid artery (arrow). (b) axial contrast - enhanced mr image shows the tumour with heterogenous enhancement surrounding the left petrous internal carotid artery (long arrow). this manner of spread can be diagnosed by the identification of soft tissues anterior and parallel to the petrous segment of the internal carotid artery (fig. 8). when this manner of spread occurs, tumour comes into close proximity with the foramen ovale and the mandibular nerve in the central skull base. proximal perineural spread along the mandibular nerve leads to intracranial extension. at this stage, signal changes in the muscles of mastication may be seen, indicating the onset of denervation atrophy. the parapharyngeal space is a well - recognized route for the spread of inflammatory and malignant disease. tumour may therefore extend into the parapharyngeal space and spread into the neck with relative ease. figure 8a 67-year - old male with recurrent carcinoma of left eac with spread to the nasopharynx. (a) axial t1-weighted mr image shows an intermediate signal intensity tumour in the left eac and middle ear extending anteriomedially along the eustachian tube (arrow). (b) axial contrast - enhanced image shows heterogeneous enhancement of the tumour with non - enhancing areas, probably due to necrosis. (c) axial t1-weighted mr image shows tumour in the left parapharyngeal space and nasopharynx (arrowheads). (e) coronal t1-weighted mr image shows an intermediate signal intensity tumour in the left nasopharynx (asterisk) extending to the left foramen ovale (arrow). (f) coronal contrast - enhanced mr image shows tumour enhancement and intracranial spread (arrow). note the oedematous left temporal lobe, which may be due to radiation therapy, intracranial tumour or both. a 67-year - old male with recurrent carcinoma of left eac with spread to the nasopharynx. (a) axial t1-weighted mr image shows an intermediate signal intensity tumour in the left eac and middle ear extending anteriomedially along the eustachian tube (arrow). (b) axial contrast - enhanced image shows heterogeneous enhancement of the tumour with non - enhancing areas, probably due to necrosis. (c) axial t1-weighted mr image shows tumour in the left parapharyngeal space and nasopharynx (arrowheads). (e) coronal t1-weighted mr image shows an intermediate signal intensity tumour in the left nasopharynx (asterisk) extending to the left foramen ovale (arrow). (f) coronal contrast - enhanced mr image shows tumour enhancement and intracranial spread (arrow). note the oedematous left temporal lobe, which may be due to radiation therapy, intracranial tumour or both. the incidence of carcinoma of the eac is estimated as between one and six cases in every one million population. several aetiological factors have been implicated, including exposure to ultraviolet radiation, chlorinated disinfectants and human papillovirus infection. chronic otitis media has been implicated for a long time as an aetiological factor but no definite correlation has been proven. histologically, most of these tumours are squamous cell carcinomas, others being mucoepidermoid and adenoid cystic carcinomas. carcinoma of the eac is treated with surgical resection with or without post - operative radiation therapy. tumours confined to the cartilaginous portion of the eac are removed by local wide excision. tumours arising from or spreading to the bony eac but lateral to the tympanic membrane are treated by limited partial temporal bone resection or sleeve resection with subsequent reconstruction by a local flap or a microvascular myocutaneous free flap, and refashioning of an auditory canal for preservation of hearing. tumour involvement of the tympanic membrane, malleus, incus and tympanic bone may necessitate lateral temporal bone resection, which was first reported by conley and novack. subtotal temporal bone resection, pioneered by parson and lewis, is a combined extracranial and intracranial procedure for treating advanced cancers involving the middle ear, the temporomandibular joint and the middle cranial fossa. the facial nerve is almost invariably sacrificed, as opposed to lateral temporal bone resection. however, the inferior margins of resection are similar in both lateral temporal bone resection and subtotal temporal bone resection, being just lateral to the internal jugular vein and internal carotid artery. in patients with even more extensive disease, total temporal bone resection may improve patient survival as well as increase the palliative benefits, notably decreased pain and improved hygiene. however, there is increased risk of morbidity, including damage to the cavernous sinus and notably, the internal carotid artery as well as the third, fourth, fifth and sixth nerves. a viable alternative in advanced disease is piecemeal resection of all visible tumour beyond the margins of a subtotal temporal bone resection, followed by post - operative radiation therapy. en bloc surgical resection with complete tumour excision remains the primary aim and the critical determinant of patient survival. in two retrospective studies, the 5-year survival rate was almost 80% for patients with negative resection margins at the time of surgery, significantly higher than those with positive margins (035%). in order to achieve clear margins, most cases will invariably require a superficial or total parotidectomy and not uncommonly, a partial mandibulectomy and clearance of the infratemporal fossa. surgical planning therefore, involves meticulous pre - operative radiological tumour mapping. a high - resolution, non - enhanced bone algorithm temporal bone ct and contrast - enhanced mr imaging are recommended for this purpose. for early disease confined to the eac ct can also readily detect erosion of the bony external auditory canal, which is often the first sign of local spread of tumour. however, ct is inadequate to demonstrate the extent of tumour spread beyond the eac. post - contrast t1-weighted sequencing with fat saturation in the axial, coronal and sagittal planes allows the best evaluation of the extent of tumour spread into the surrounding extra - temporal anatomic landscape. intracranial extension is much better seen on coronal sections of contrast - enhanced mr images. the earliest sign seen on mr imaging is mild dural thickening and enhancement along the floor of the middle cranial fossa in the vicinity of the tegmen tympani. although ct demonstrates erosion of the cortical bone of the inner ear very well, spread into the labyrinth is better demonstrated on mr imaging. perineural involvement of the seventh and eighth cranial nerves can not be diagnosed with confidence without contrast - enhanced mr imaging. similarly, mr imaging provides further information on the status of the skull base neurovascular structures when bony erosions are identified on ct. necrotizing external otitis tends to show comparatively more extensive inflammatory changes with cellulitis and abscesses involving the adjacent deep cervical spaces, most commonly the parotid space. osteoradionecrosis of the temporal bone is a delayed complication following radiotherapy for head and neck tumours. while cortical erosion of the bony eac may simulate carcinoma, the prominent features in osteoradionecrosis involve the mastoid air cells with disruption of the air cell septation, usually on a background of underlying radiation - induced otomastoiditis. diffuse permeative demineralization of the skull base beyond the temporal bone can be seen in patients with severe osteoradionecrosis. nevertheless, the clinical presentation and imaging appearance of eac carcinoma may exactly mimic necrotizing external otitis or osteoradionecrosis. as early diagnoses significantly affect the eventual outcome, any clinically suspicious eac lesion with bony erosion should be subjected to early biopsy. as with other squamous cell carcinoma of the head and neck, more than one biopsy should be taken as there may be non - diagnostic changes at the periphery of the tumour and malignant cells may be missed with only a single biopsy. in addition to ct, mr imaging is essential for precise delineation of the extent of tumour spread beyond the eac, which at presentation, is the single most important prognostic factor. this accurate pre - operative tumour mapping is also critical in deciding surgical options, with a clear resection margin the primary objective. | abstractcarcinoma of the external auditory canal presents a challenge in management, largely due to limited experience in treating this rare disease and the lack of a universally accepted staging system. prognosis is most dependent on the extent of local disease at presentation, while resection margin status is also a strong determinant of survival in post - operative patients. the intent of this pictorial essay is to review the pattern of tumour spread and highlight the value of imaging, particularly magnetic resonance imaging in pre - operative tumour mapping. |
the cardiopulmonary resuscitation (cpr) as a therapeutic intervention is performed for patients with cardiac and/or respiratory arrest. the success of this intervention is generally measured through the improvement of the patients ' survival rate to hospital discharge. the evidence suggests the low success rate of cpr though physicians, patients, and the public overestimate the patients ' survival rate after this procedure. the futility of therapeutic interventions and making decisions about conducting cpr is a medical, ethical, and legal challenge, especially in the end - of - life care. due to the relatively low rate of successful cpr, the costs of ineffective treatment, and high probability of the occurrence of various complications, the american medical association for the first time in 1974 formally proposed the do - not - resuscitate (dnr) order in patients ' treatment process. furthermore, in 1976, the first hospital policies with regard to the dnr order were published. since then, there have always been arguments on the legal and ethical challenges of the dnr order. dnr, do not attempt resuscitation, and allow natural death are the same commands with an equal meaning, which are used by health - care professionals when patients should not be resuscitated in case of cardiopulmonary arrest. according to the american heart association, the dnr order should be given by credentialed medical doctor or alternative authorities who are authorized by local laws. it should be prescribed after consultation and obtaining informed consent of the patient, family, or his / her guardian when the patient 's prognosis is very poor. some studies have shown that old age, female gender, white race, decreased cognitive ability, and the diagnosis of disease particularly cancer are associated with the prescription of the dnr order. the attitudes of health - care staff including nurses and physicians toward those patients who are spending the final days of their life have always been a major challenge influencing the decision for performing cpr. this challenge has been perceived in different ways in different countries because it is influenced by a wide range of cultural, religious, ethnical, and geographical factors. in this regard, studies conducted in western countries indicted the positive attitudes of health - care professionals toward the dnr order. in many treatment centers in western countries, concrete policies have been developed with regard to the dnr order. in a few studies conducted in muslim countries have shown the presence of a negative attitude toward the dnr order. however, conflicting perspectives about the dnr order in these countries have also been reported. the limited number of studies and contradictory results about the dnr order in islamic countries, recommendations for further studies, the prevalence of the nonstandard, informal and verbal dnr order in many islamic countries, and a lack of knowledge on the experiences of health - care providers on the dnr order in these countries motivated the researchers to conduct a study. the cpr team members are in the best position to describe factors influencing cpr and how decisions are made for the dnr order. in this respect, their experiences and valuable comments about the dnr order can help qualitative researchers with in - depth understandings of this phenomenon. this study aimed to understand the experiences of cpr team members about the dnr order. conventional content analysis is suitable for the descriptions of phenomena and leads to the development of categories and theme in an inductive manner. individual face - to - face semi - structured interviews were held for data gathering between february 2015 and april 2016. an interview guide was developed with a focus on the participants ' experiences of the dnr order. the main foci of the questions asked during the interviews were : will you share your experiences of the dnr order?what is your understanding of the dnr order?how do you deal with the dnr order ? what is your understanding of the dnr order ? how do you deal with the dnr order ? the interviews lasted for 38.57 (standard deviation [sd ] = 10.03) min. the cpr team members working in teaching hospitals in an urban area of iran were chosen using purposive sampling. maximum variations in sampling in terms of age, gender, the work experience, educational level, and academic degree were considered during the recruitment of the participants. data were collected using semi - structured interviews, which were continued until data saturation was reached. therefore, the participants were 24 members of the cpr team including 17 nurses, 5 physicians, and 2 bachelor degree anesthesiologists. furthermore, the mean age and work experience of the participants were 34.58 (sd = 6.70) years and 10.21 (sd = 6.78) years, respectively. the study research proposal was approved by the local ethics committee affiliated with the university in which the researchers worked (decree number : ir.mums.rec.1394.105). before the interviews, the participants were informed of the study aims and method and the probable time for interview sessions. furthermore, those individuals who willingly agreed to take part in this study signed the written informed consent form. they were also ensured about their anonymity and the confidentiality of the data collection throughout the study process. the interviews were transcribed verbatim and analyzed using the conventional content analysis method suggested by hsieh and shannon. the comparison of the codes in terms of their similarities and differences led to the development of subcategories and then categories inductively. prolonged engagement in the field of the study and member checking helped with the credibility of the study. the transcriptions, codes, and categories were provided to the second and third authors of this article and two other experts in qualitative research for the evaluation of the data analysis. furthermore, the researcher tried to remain faithful to the participants ' accounts and experiences of the dnr order and present their real perspectives and thoughts on the study phenomenon. conventional content analysis is suitable for the descriptions of phenomena and leads to the development of categories and theme in an inductive manner. individual face - to - face semi - structured interviews were held for data gathering between february 2015 and april 2016. an interview guide was developed with a focus on the participants ' experiences of the dnr order. the main foci of the questions asked during the interviews were : will you share your experiences of the dnr order?what is your understanding of the dnr order?how do you deal with the dnr order ? what is your understanding of the dnr order ? how do you deal with the dnr order ? the interviews lasted for 38.57 (standard deviation [sd ] = 10.03) min. the cpr team members working in teaching hospitals in an urban area of iran were chosen using purposive sampling. maximum variations in sampling in terms of age, gender, the work experience, educational level, and academic degree were considered during the recruitment of the participants. data were collected using semi - structured interviews, which were continued until data saturation was reached. therefore, the participants were 24 members of the cpr team including 17 nurses, 5 physicians, and 2 bachelor degree anesthesiologists. furthermore, the mean age and work experience of the participants were 34.58 (sd = 6.70) years and 10.21 (sd = 6.78) years, respectively. the study research proposal was approved by the local ethics committee affiliated with the university in which the researchers worked (decree number : ir.mums.rec.1394.105). before the interviews, the participants were informed of the study aims and method and the probable time for interview sessions. furthermore, those individuals who willingly agreed to take part in this study signed the written informed consent form. they were also ensured about their anonymity and the confidentiality of the data collection throughout the study process. the interviews were transcribed verbatim and analyzed using the conventional content analysis method suggested by hsieh and shannon. the comparison of the codes in terms of their similarities and differences led to the development of subcategories and then categories inductively. prolonged engagement in the field of the study and member checking helped with the credibility of the study. the transcriptions, codes, and categories were provided to the second and third authors of this article and two other experts in qualitative research for the evaluation of the data analysis. furthermore, the researcher tried to remain faithful to the participants ' accounts and experiences of the dnr order and present their real perspectives and thoughts on the study phenomenon. the participants ' experiences showed that the informal and verbal dnr order existed in their workplace, which made the participants to encounter legal, ethical, and operational challenges. the data analysis led to the development of three categories and six subcategories as follow : the dilemma between revival and suffering with the subcategories of revival likelihood and death as a cause for comfort ; conflicting situation with the subcategories of latent decision and ambivalent order ; and low - quality cpr with the subcategories of team member demotivation and disrupting cpr performance. the experiences of the participants in this study revealed that two factors affected the issuance of the dnr order. the chances of the cpr 's success and problems of the patient and family members during and after cpr were the most important factors. according to the experiences of the participants in this study, when the probability of the patient 's recovery after performing cpr was low, the dnr order was issued by the physician. an emergency medicine specialist said : well, for some patients, the dnr order is given, because no one believes in their recovery other factors influencing the dnr order were the patient 's condition and the chances of long - term survival. if i do not perform cpr for a patient, it does not mean that i do not take care of him / her. the reason is that it does not make much difference, because the patient remains for a short period of time and she / he dies soon death as a cause for comfort the widespread and incurable patient 's current problems and difficulties for the patient and his / her family members after recovery from cpr made the cpr team members to believe in the patient 's death as a cause for the patient and his / her family members comfort and performing cpr caused patient 's suffering and pain. imagine that you are working with a 90-year - old woman who is ill and has dysrhythmia with an irreversible cardiac dysrhythmia. according to your knowledge and feelings therefore, you like not to bother and hurt him / her more, because she / he is not recovered (n 3). i think when the patient is so sick and may bring troubles to the family, the dnr order is issued (pediatric icu staff nurse). the participants ' perspectives showed that the informal and verbal dnr order existed in their workplace that led to legal, ethical, and operational challenges. the informal and illegal identity of the dnr order led to unrecorded decisions in the participants resulted from the fear of being legally prosecuted. if the dnr order is given, and for some reason you are asked about in the forensic medicine organization, no one can defend such an order. there is no such an order in the patient 's file and it is not documented (the resident of anesthesiology). some participants were doubtful about the agreement between the dnr order and ethical principles or considered it immoral. now i do not know whether it is morally right or not, but somehow the dnr order is given here the dnr order caused the cpr team members to feel uncertainty about the implementation of this order, particularly when the dnr order was necessary, but they began performing cpr. participant 17 with regard to tokenistic cpr stated : in the internal emergency department, cpr is nor performed, because the majority of patients need the dnr order. the patient with cancer does not need cpr and 99% of cpr cases are tokenistic to satisfy the patient 's companions with regard to the provision of care in addition, some physicians had no tendency to give the dnr order, but some others verbally issued this order. some physicians, especially medical residents are scared of giving the dnr order, but medical staff are more happy to give this order for instance, some physicians stress out that if the patient needs cpr, do not perform cpr, but some other physicians such as doctor x does not say so the participants ' comments showed that the dnr order reduced the motivation of health - care professionals for performing cpr and affected their performance. team member demotivation the dnr order reduced the motivation of health - care professionals for performing cpr because they considered cpr a useless intervention. when the medical resident gives the dnr order, it means that the patient does not recover and therefore, cpr team members are reluctant to perform cpr (n6). furthermore, participant 16 stated : this is not only my perspective, most colleagues have not motivation to perform cpr, if the dnr order is give the reason for changes in the quality of cpr was a lack of hope to successfully perform cpr. a staff nurse working in the ccu said : the dnr order affects my performance when the dnr order is given, the team work 's discipline is undermined and organization of cpr procedure such as medication, massage so on are interrupted the experiences of the participants in this study revealed that two factors affected the issuance of the dnr order. the chances of the cpr 's success and problems of the patient and family members during and after cpr were the most important factors. according to the experiences of the participants in this study, when the probability of the patient 's recovery after performing cpr was low, the dnr order was issued by the physician. an emergency medicine specialist said : well, for some patients, the dnr order is given, because no one believes in their recovery other factors influencing the dnr order were the patient 's condition and the chances of long - term survival. if i do not perform cpr for a patient, it does not mean that i do not take care of him / her. the reason is that it does not make much difference, because the patient remains for a short period of time and she / he dies soon death as a cause for comfort the widespread and incurable patient 's current problems and difficulties for the patient and his / her family members after recovery from cpr made the cpr team members to believe in the patient 's death as a cause for the patient and his / her family members comfort and performing cpr caused patient 's suffering and pain. imagine that you are working with a 90-year - old woman who is ill and has dysrhythmia with an irreversible cardiac dysrhythmia. according to your knowledge and feelings therefore, you like not to bother and hurt him / her more, because she / he is not recovered (n 3). i think when the patient is so sick and may bring troubles to the family, the dnr order is issued (pediatric icu staff nurse). the participants ' perspectives showed that the informal and verbal dnr order existed in their workplace that led to legal, ethical, and operational challenges. the informal and illegal identity of the dnr order led to unrecorded decisions in the participants resulted from the fear of being legally prosecuted. if the dnr order is given, and for some reason you are asked about in the forensic medicine organization, no one can defend such an order. there is no such an order in the patient 's file and it is not documented some participants were doubtful about the agreement between the dnr order and ethical principles or considered it immoral. now i do not know whether it is morally right or not, but somehow the dnr order is given here the dnr order caused the cpr team members to feel uncertainty about the implementation of this order, particularly when the dnr order was necessary, but they began performing cpr. participant 17 with regard to tokenistic cpr stated : in the internal emergency department, cpr is nor performed, because the majority of patients need the dnr order. the patient with cancer does not need cpr and 99% of cpr cases are tokenistic to satisfy the patient 's companions with regard to the provision of care in addition, some physicians had no tendency to give the dnr order, but some others verbally issued this order. a staff nurse working in the icu said : some physicians, especially medical residents are scared of giving the dnr order, but medical staff are more happy to give this order for instance, some physicians stress out that if the patient needs cpr, do not perform cpr, but some other physicians such as doctor x does not say so the participants ' comments showed that the dnr order reduced the motivation of health - care professionals for performing cpr and affected their performance. team member demotivation the dnr order reduced the motivation of health - care professionals for performing cpr because they considered cpr a useless intervention. when the medical resident gives the dnr order, it means that the patient does not recover and therefore, cpr team members are reluctant to perform cpr (n6). furthermore, participant 16 stated : this is not only my perspective, most colleagues have not motivation to perform cpr, if the dnr order is give (pediatric icu staff nurse). disrupting cardiopulmonary resuscitation performance the dnr order reduced the quality of the cpr procedure. the reason for changes in the quality of cpr was a lack of hope to successfully perform cpr. a staff nurse working in the ccu said : the dnr order affects my performance when the dnr order is given, the team work 's discipline is undermined and organization of cpr procedure such as medication, massage so on are interrupted the exploration of the experiences of the cpr team members showed that factors such as the chances of successful cpr and problems for the patient and family after recovery affected the dnr order. furthermore, it has created conflicting situation with legal, ethical, and operational challenges for health - care professionals and reduced their motivation and the quality of cpr procedure. to the best of our knowledge, this was the first study conducted in islamic countries on the experiences of cpr team members with regard to the dnr order. a lack of hope to the patient 's recovery after cpr was the main reason for the dnr order in this study. other studies also stated that futile therapeutic interventions and the likelihood of cpr failure were some factors affecting decision - making on the dnr order. in other studies, poor medical conditions and prognosis were mentioned as the underlying factors of the dnr order. in many european countries, when doctors do not believe in the success of cpr or are informed of the cpr 's risks, they do not recommend this procedure. not to be compelled to perform cpr in cases where the risk is more important than the benefit was in line with the subcategory of death as a cause for comfort in this study. the high probability of complications as a result of cpr and treatment costs was mentioned in the international literature as causes for the documentation of the dnr order in patients ' health file. the future quality of life of patients should be considered the most important factor for the cpr order. cpr health - care team members in this study predicted the consequences and possible problems after cpr and therefore believed that death could be a means of comfort for the patient and his / her family. we found that the informal and illegal identity of the dnr in the iranian health - care system made that our participant 's encountered ethical and legal challenges and became skeptical about the implementation of this order. also described the widespread, informal, verbal, and without rules of the dnr order in hospitals in iran. other studies also showed that nurses generally had no positive attitude toward the dnr order and believed that the dnr order could lead to legal problems. furthermore, a fear of legal prosecution had a major role in shaping health - care providers role in decision making for the dnr order. in another study, only 5% of medical students considered the dnr order legally problematic. the probable reason for such a difference could be the different participants of these studies. in this study, participants were physicians and nurses, but in the study of ghajarzadeh., all participants were medical students. since students have no direct responsibility for patient care, they do not experience any legal challenge. furthermore, we studied the experiences of the participants through holding interviews, but in the study by ghajarzadeh., the attitudes of medical students were investigated using a questionnaire. in line with our findings, physicians face ethical dilemma when deciding for the dnr order and nurses when are expected to perform this order. the participants in the study by kelly also considered the slow code an unconscionable act. slow code means not making sufficient efforts for the patient recovery, which is consistent with the subcategory of ambivalent order in this study. hesitancy in performing the dnr order and performing tokenistic cpr was another challenge of the participants in this study. the results of other studies showed the presence of difficulties and challenges in the implementation of the dnr order and increased conflict and ambivalence as the result of this order. performing tokenistic cpr or the so - called slow cpr for incurable and terminally ill patients was expressed in other studies, which was consistent with the results of this study. the results of this study also revealed that the dnr order led to reduced willingness and motivation of the cpr team members and therefore affected their performance during cpr. since the dnr order indicted a lack of chance for the patient recovery, according to the vroom 's expectancy theory, it may lead to losing the motivation of cpr team members. according to this theory, when a person feels that his / her efforts do not lead to expected results, his / her motivation is reduced. japanese physicians have also found that the dnr order can influence performing the cpr procedure. the dnr order is informal and exists as a verbal order in the iranian health - care system. therefore, there is a need to the development of a contextual guideline based on the cultural and religious characteristics of islamic countries. such a guideline helps with the clarification of the process of the dnr order, which is required for respecting the rights of patients and their family members and providing legal support to health - care professionals during cpr. the findings of this study can be used for the development of such a guideline in the islamic health - care system. this study was a part of a phd dissertation (first author) in nursing was financially supported by research department of mashhad university of medical sciences (code : 931150). this study was a part of a phd dissertation (first author) in nursing was financially supported by research department of mashhad university of medical sciences (code : 931150). | background : one dilemma in the end - of - life care is making decisions for conducting cardiopulmonary resuscitation (cpr). this dilemma is perceived in different ways due to the influence of culture and religion. this study aimed to understand the experiences of cpr team members about the do - not - resuscitate order.methods:cpr team members were interviewed, and data were analyzed using a conventional content analysis method.results:three categories and six subcategories emerged : the dilemma between revival and suffering with the subcategories of revival likelihood and death as a cause for comfort ; conflicting situation with the subcategories of latent decision and ambivalent order ; and low - quality cpr with the subcategories of team member demotivation and disrupting cpr performance.conclusion:there is a need for the development of a contextual guideline, which is required for respecting the rights of patients and their families and providing legal support to health - care professionals during cpr. |
out - of - hospital cardiac arrest (ohca) in developed communities occurs more commonly and is a leading cause of death [1, 2 ]. recently, chan. reported a survival rate of 8.6 % in the united states. in the netherlands, reported survival rates are much higher, from 9 % even up to 43 % [4, 5 ]. importantly, determinants that effectively favour better survival outcome include witnessed arrest, bystander cardiopulmonary resuscitation, shockable rhythm, use of automated electrical defibrillator, early return of spontaneous circulation (rosc) and post - arrest care [2, 68 ]. collectively, minimising time delays, resuscitation quality, intensive care, and treatment of the underlying cause of arrest increases survival outcome. alternatively, extracorporeal cardiopulmonary resuscitation (e - cpr) has been reported to improve survival outcome and organ recovery in refractory cardiac arrest [911 ]. moreover, expansions in extracorporeal technology such as portable devices, circuitry and access to systemic circulation have led to further curiosity of its potential application. e - cpr application is reported to increase the chances of successful defibrillation, preventing re - arrest due to post - resuscitation myocardial dysfunction, thereby enabling subsequent interventions [11, 13 ]. nevertheless, e - cpr requires minimalisation of time delay to establish qualitative invasive cpr, and establish as a bridge to specific diagnostics and intervention. therefore, we aimed to analyse the current outcome of adult patients with ohca following resuscitation in the maastricht region with the prospects of implementing e - cpr in the near future. the observational study included adult ohca patients who survived to emergency department admission at maastricht university medical center, which lies in the southern part of the dutch province of limburg, between march 2012 and april 2014. the area is 203 km in size and has approximately 183,000 inhabitants (statistics netherlands 2013, www.cbs.nl). the maastricht area is served by a university medical centre (maastricht university medical center) and a network of emergency medical services (ems). the local medical ethics review board approved the study with a waiver for obtaining the informed consent. a call to the emergency number (112) alerts the regional ems and other trained first responders including civilian sms - alert responders and police personnel, equipped with an automatic external defibrillator (aed) in case of suspected ohca. two ambulances are dispatched, along with the first responder to perform basic life support. the ems personnel provide standardised, mechanical cpr with an auto - pulse device (zoll, chelmsford, ma usa) and advanced life support. the data were collected by a researcher, who accessed the data collected and stored by the ambulance services, and by going through the electronic drive forms daily for resuscitations. the data gathered included utstein - based recommendations on a form, while the ecg strips of the patients were attached to the drive forms of the patient. in case of aed use, the information on the aed application was retrieved from the aed (corpuls, gs elektromed, kaufering, germany) and sent via an email to the researcher. when the sms alert responder had provided basic life support, pertinent data were sent to the researcher, which were compiled and verified with the patient records. pre - existing cardiac risk factors, cardiac comorbidities and past cardiac interventions were retrieved from the hospital records. data on post - resuscitation management (diagnosis, therapeutic hypothermia or treatment such as percutaneous coronary interventions (pci), coronary artery bypass graft, implantable cardioverter defibrillator (icd) or pacemaker) were obtained from the hospital records. survival was assessed at three time points, i.e. survival to emergency department, survival to hospital admission, and survival to hospital discharge. individuals with a do - not - resuscitate status, with signs of prolonged death and cardiac arrest of non - cardiac origin (for e.g. drowning, exsanguination), were excluded. the ecgs analysed by aed or taken by ems paramedics were designated as the initial cardiac rhythm. the rhythms were classified as shockable (ventricular fibrillation, ventricular tachycardia), non - shockable (asystole, pulseless electrical activity) and non - threatening (sinus bradycardia, sinus tachycardia or sinus rhythm). rosc was recorded at the time of departure from the site of the arrest and arrival at the emergency department. neurological outcome to determine brain injury was scored by charting the modified rankin scale instead of the standard cerebral performance score to clearly distinguish mild to moderate neurological disability. the scoring was performed by assessing patient records at the time of discharge and at 1 month, 3 months, 6 months and 1 year follow - up. the modified rankin scale scores are allocated as : 0no symptoms, 1no significant disability, 2slight disability, 3moderate disability, 4moderately severe disability, 5severe disability, 6dead. data were subjected to normality distribution, and accordingly continuous data are presented as medians [interquartile range ] and/or means standard deviation. comparisons between two groups of continuous variables were performed using the mann - whitney u - test. categorical variables were compared using chi - square test with fisher s exact test and expressed as percentages. analyses were two - sided and differences with p - values < 0.05 were considered statistically significant. the analyses were carried out using the statistical package for social sciences version 21.0 (ibm corp., armonk, ny, usa). the data were collected by a researcher, who accessed the data collected and stored by the ambulance services, and by going through the electronic drive forms daily for resuscitations. the data gathered included utstein - based recommendations on a form, while the ecg strips of the patients were attached to the drive forms of the patient. in case of aed use, the information on the aed application was retrieved from the aed (corpuls, gs elektromed, kaufering, germany) and sent via an email to the researcher. when the sms alert responder had provided basic life support, pertinent data were sent to the researcher, which were compiled and verified with the patient records. pre - existing cardiac risk factors, cardiac comorbidities and past cardiac interventions were retrieved from the hospital records. data on post - resuscitation management (diagnosis, therapeutic hypothermia or treatment such as percutaneous coronary interventions (pci), coronary artery bypass graft, implantable cardioverter defibrillator (icd) or pacemaker) were obtained from the hospital records. survival was assessed at three time points, i.e. survival to emergency department, survival to hospital admission, and survival to hospital discharge. individuals with a do - not - resuscitate status, with signs of prolonged death and cardiac arrest of non - cardiac origin (for e.g. drowning, exsanguination), were excluded. the ecgs analysed by aed or taken by ems paramedics were designated as the initial cardiac rhythm. the rhythms were classified as shockable (ventricular fibrillation, ventricular tachycardia), non - shockable (asystole, pulseless electrical activity) and non - threatening (sinus bradycardia, sinus tachycardia or sinus rhythm). rosc was recorded at the time of departure from the site of the arrest and arrival at the emergency department. neurological outcome to determine brain injury was scored by charting the modified rankin scale instead of the standard cerebral performance score to clearly distinguish mild to moderate neurological disability. the scoring was performed by assessing patient records at the time of discharge and at 1 month, 3 months, 6 months and 1 year follow - up. the modified rankin scale scores are allocated as : 0no symptoms, 1no significant disability, 2slight disability, 3moderate disability, 4moderately severe disability, 5severe disability, 6dead. data were subjected to normality distribution, and accordingly continuous data are presented as medians [interquartile range ] and/or means standard deviation. comparisons between two groups of continuous variables were performed using the mann - whitney u - test. categorical variables were compared using chi - square test with fisher s exact test and expressed as percentages. analyses were two - sided and differences with p - values < 0.05 were considered statistically significant. the analyses were carried out using the statistical package for social sciences version 21.0 (ibm corp., a total number of 287 adult patients were identified with ohca in the maastricht region through the study period. after assessment of the records, 1flow chart of patients with out - of - hospital cardiac arrest in maastricht region (march 2012april 2014). ohca out - of - hospital cardiac arrest, dnr do not resuscitate, ed emergency department, ccu coronary care unit, icu intensive care unit ; other, ward flow chart of patients with out - of - hospital cardiac arrest in maastricht region (march 2012april 2014). ohca out - of - hospital cardiac arrest, dnr do not resuscitate, ed emergency department, ccu coronary care unit, icu intensive care unit ; other, ward the study population included 195 patients, admitted to the emergency department with a cardiac cause of arrest. patient demographics (table 1) and pre - hospital resuscitation characteristics of ohca are shown in table 2. the patients were aged 66 [5775 ] years and predominantly (80 %) male. the cardiac arrest event occurred at home (56 %) and was witnessed in 173 (89 %) patients. subsequently 145 (74 %) patients received bystander cpr, ems personnel initiated cpr in 26 %, and in 24 % cases an aed was applied. the ems response time was 7 [59 ] min, the advanced cardiac life support was provided for 24 [1831 ] min, and at departure rosc was achieved in 70 % of the patients. transport time to the emergency department was 12 [618 ] min and 61 (58 %) patients required continued resuscitation during transportation. table 1patient demographics of out - of - hospital cardiac arrest of cardiac origin who survived to emergency department admissionsurvivors n = 90non - survivors n = 105 p - value age (years)0.01 mean standard deviation63 1267 15 median [interquartile range]63 [5572]70 [5879]male gender, n (%) 74 (82)83 (79)0.57cardiac risk factors, n (%) diabetes12 (14)22 (22)0.11hypertension29 (34)35 (37)0.66dyslipidaemia previous cardiovascular conditions, n (%) 14 (17)18 (19)0.64cerebrovascular accident4 (5)6 (6)0.67chronic heart failure6 (7)18 (18)0.02myocardial infarction22 (25)33 (32)0.25ventricular fibrillation3 (3)4 (4)0.84atrial fibrillation previous cardiac interventions, n (%) 7 (8)17 (17)0.07pci6 (7)14 (14)0.12cabg8 (9)8 (8)0.78pacemaker2 (2)0 (0)0.13icd1 (1)8 (8)0.03 pci percutaneous coronary intervention, cabg coronary artery bypass grafting, icd implantable cardioverter defibrillator. fisher s exact or chi - square test for categorical variables ; mann - whitney u test for continous variables. patient demographics of out - of - hospital cardiac arrest of cardiac origin who survived to emergency department admission pci percutaneous coronary intervention, cabg coronary artery bypass grafting, icd implantable cardioverter defibrillator. fisher s exact or chi - square test for categorical variables ; mann - whitney u test for continous variables. table 2pre - hospital resuscitation characteristics, aetiology and treatment of out - of - hospital cardiac arrest of cardiac origin who survived to emergency department admissionsurvivors n = 90non - survivors n = 105 p - value location of arrest, n (%) 0.79home52 (59)60 (57)public36 (41)45 (43)witnessed arrest, n (%) 83 (92)90 (86)0.15bystander cpr, n (%) 68 (76)77 (73)0.72aed deployed, n (%) 22 (24)24 (23)0.80initial rhythm, n (%) < 0.01shockable81 (90)69 (67)non - shockable5 (6)31 (30)non - threatening 4 (4)3 (3)ems arrival time since call, min0.36mean standard deviation7 68 9median [interquartile range]6 [59]6 [49]defibrillation times, n (%) < 0.01mean standard deviation1.8 2.02.7 2.9median [interquartile range]1 [03]2 [04]auto - pulse, n (%) 44 (49)77 (73) < 0.01rosc at departure, n (%) 89 (99)48 (46) < 0.01continued resuscitation, n (%) 1 (1)57 (54)acls duration (min), n (%) < 0.01mean standard deviation22 823 11median [interquartile range]23 [1827]24 [1631]intubation, n (%) 44 (49)81 (77) < 0.01transport time, minmean standard deviation17 1416 140.36median [interquartile range]15 [922]12 [719]rosc on arrival, n (%) 88 (98)45 (43) < 0.01continued resuscitation, n (%) 2 (2)59 (56)cardiac arrest aetiology, n (%) < 0.01acute coronary syndrome53 (59)34 (32)chronic coronary artery disease7 (8)10 (10)congestive heart failure4 (4)12 (11)conduction disorders16 (18)8 (8)structural disorders7 (8)7 (7)unknown3 (3)34 (32)therapeutic hypothermia39 (43)21 (20) < 0.01intervention, n (%) pci47 (52)15 (14) < 0.01cabg10 (11)2 (2) < 0.01icd27 (30)1 (1) < 0.01pacemaker8 (9)3 (3)0.11 cpr cardiopulmonary resuscitation, aed automated external defibrillator, ems emergency medical services, rosc return of spontaneous circulation, acls advanced cardiac life support, pci percutaneous coronary intervention, cabg coronary artery bypass grafting, icd implantable cardioverter defibrillator. fisher s exact or chi - square test for categorical variables ; mann - whitney u test for continuous variables. pre - hospital resuscitation characteristics, aetiology and treatment of out - of - hospital cardiac arrest of cardiac origin who survived to emergency department admission cpr cardiopulmonary resuscitation, aed automated external defibrillator, ems emergency medical services, rosc return of spontaneous circulation, acls advanced cardiac life support, pci percutaneous coronary intervention, cabg coronary artery bypass grafting, icd implantable cardioverter defibrillator. fisher s exact or chi - square test for categorical variables ; mann - whitney u test for continuous variables.. tables 1and 2 show the characteristics of the survivors and the non - survivors admitted to the emergency department. the non - survivors were relatively older compared with the survivors (70 [5879 ] years) vs. 63 [5572 ] years, p = 0.01), and chronic heart failure was present in 18 vs. 7 % (p = 0.02), respectively. an initial shockable rhythm was recorded in 69 non - survivors (67 %) vs. 81survivors (90 %), p < 0.01. among the non - survivors < 50 % achieved rosc at departure from the site and on arrival to the emergency department, while of the survivors nearly 100 % achieved rosc at departure and arrival, p < 0.01, respectively. there was no statistical significance compared with survivors in terms of gender, witnessed arrest, bystander cpr, or use of aed. following admission to the emergency department, 50 (26 %) patients died. (45 %) of the patients, cardiac arrest was precipitated by acute coronary syndrome, 60 (31 %) received therapeutic hypothermia and 62 (32 %) patients underwent a pci. among the non - survivors, 21 (20 %) received therapeutic hypothermia, acs was diagnosed in 34 (32 %) and 15 (14 %) underwent pci procedure. ninety (46.2 %) patients survived to hospital discharge after an average stay of 16 days following ohca. sixty - four (71 %) patients were discharged home and nine (10 %) to a nursing facility. table 3 illustrates the neurological outcome of the survivors at the time of hospital discharge and follow - up at the end of 1 month, 6 months and 12 months following ohca. the neurological outcome (assessed by the modified rankin scale) at hospital discharge was available for 61 (68 %) patients accordingly, 50 % could carry out normal daily activities, while six (10 %) patients had moderately severe disability. table 3the modified rankin scale scores at hospital discharge and follow - up at 1, 6 and 12 monthsmodified rankin scaledischarge n = 611 month n = 436 months n = 2512 months n = 18030 (50 %) 27 (63 %) 14 (56 %) 10 (56 %) 113 (21 %) 10 (23 %) 7 (28 %) 5 (28 %) 29 (15 %) 4 (10 %) 1 (4 %) 1 (6 %) 33 (5 %) 2 (5 %) 3 (12 %) 2 (11 %) 46 (10 %) ---5 - ---modified rankin scale : 0no symptoms, 1no significant disability, 2slight disability, 3moderate disability, 4moderately severe disability, 5severe disability, 6dead. the modified rankin scale scores at hospital discharge and follow - up at 1, 6 and 12 months modified rankin scale : 0no symptoms, 1no significant disability, 2slight disability, 3moderate disability, 4moderately severe disability, 5severe disability, 6dead. a total number of 287 adult patients were identified with ohca in the maastricht region through the study period. after assessment of the records, 1flow chart of patients with out - of - hospital cardiac arrest in maastricht region (march 2012april 2014). ohca out - of - hospital cardiac arrest, dnr do not resuscitate, ed emergency department, ccu coronary care unit, icu intensive care unit ; other, ward flow chart of patients with out - of - hospital cardiac arrest in maastricht region (march 2012april 2014). ohca out - of - hospital cardiac arrest, dnr do not resuscitate, ed emergency department, ccu coronary care unit, icu intensive care unit ; other, ward the study population included 195 patients, admitted to the emergency department with a cardiac cause of arrest. patient demographics (table 1) and pre - hospital resuscitation characteristics of ohca are shown in table 2. the patients were aged 66 [5775 ] years and predominantly (80 %) male. the cardiac arrest event occurred at home (56 %) and was witnessed in 173 (89 %) patients. subsequently 145 (74 %) patients received bystander cpr, ems personnel initiated cpr in 26 %, and in 24 % cases an aed was applied. the ems response time was 7 [59 ] min, the advanced cardiac life support was provided for 24 [1831 ] min, and at departure rosc was achieved in 70 % of the patients. transport time to the emergency department was 12 [618 ] min and 61 (58 %) patients required continued resuscitation during transportation. table 1patient demographics of out - of - hospital cardiac arrest of cardiac origin who survived to emergency department admissionsurvivors n = 90non - survivors n = 105 p - value age (years)0.01 mean standard deviation63 1267 15 median [interquartile range]63 [5572]70 [5879]male gender, n (%) 74 (82)83 (79)0.57cardiac risk factors, n (%) diabetes12 (14)22 (22)0.11hypertension29 (34)35 (37)0.66dyslipidaemia previous cardiovascular conditions, n (%) 14 (17)18 (19)0.64cerebrovascular accident4 (5)6 (6)0.67chronic heart failure6 (7)18 (18)0.02myocardial infarction22 (25)33 (32)0.25ventricular fibrillation3 (3)4 (4)0.84atrial fibrillation previous cardiac interventions, n (%) 7 (8)17 (17)0.07pci6 (7)14 (14)0.12cabg8 (9)8 (8)0.78pacemaker2 (2)0 (0)0.13icd1 (1)8 (8)0.03 pci percutaneous coronary intervention, cabg coronary artery bypass grafting, icd implantable cardioverter defibrillator. fisher s exact or chi - square test for categorical variables ; mann - whitney u test for continous variables. patient demographics of out - of - hospital cardiac arrest of cardiac origin who survived to emergency department admission pci percutaneous coronary intervention, cabg coronary artery bypass grafting, icd implantable cardioverter defibrillator. fisher s exact or chi - square test for categorical variables ; mann - whitney u test for continous variables. table 2pre - hospital resuscitation characteristics, aetiology and treatment of out - of - hospital cardiac arrest of cardiac origin who survived to emergency department admissionsurvivors n = 90non - survivors n = 105 p - value location of arrest, n (%) 0.79home52 (59)60 (57)public36 (41)45 (43)witnessed arrest, n (%) 83 (92)90 (86)0.15bystander cpr, n (%) 68 (76)77 (73)0.72aed deployed, n (%) 22 (24)24 (23)0.80initial rhythm, n (%) < 0.01shockable81 (90)69 (67)non - shockable5 (6)31 (30)non - threatening 4 (4)3 (3)ems arrival time since call, min0.36mean standard deviation7 68 9median [interquartile range]6 [59]6 [49]defibrillation times, n (%) < 0.01mean standard deviation1.8 2.02.7 2.9median [interquartile range]1 [03]2 [04]auto - pulse, n (%) 44 (49)77 (73) < 0.01rosc at departure, n (%) 89 (99)48 (46) < 0.01continued resuscitation, n (%) 1 (1)57 (54)acls duration (min), n (%) < 0.01mean standard deviation22 823 11median [interquartile range]23 [1827]24 [1631]intubation, n (%) 44 (49)81 (77) < 0.01transport time, minmean standard deviation17 1416 140.36median [interquartile range]15 [922]12 [719]rosc on arrival, n (%) 88 (98)45 (43) < 0.01continued resuscitation, n (%) 2 (2)59 (56)cardiac arrest aetiology, n (%) < 0.01acute coronary syndrome53 (59)34 (32)chronic coronary artery disease7 (8)10 (10)congestive heart failure4 (4)12 (11)conduction disorders16 (18)8 (8)structural disorders7 (8)7 (7)unknown3 (3)34 (32)therapeutic hypothermia39 (43)21 (20) < 0.01intervention, n (%) pci47 (52)15 (14) < 0.01cabg10 (11)2 (2) < 0.01icd27 (30)1 (1) < 0.01pacemaker8 (9)3 (3)0.11 cpr cardiopulmonary resuscitation, aed automated external defibrillator, ems emergency medical services, rosc return of spontaneous circulation, acls advanced cardiac life support, pci percutaneous coronary intervention, cabg coronary artery bypass grafting, icd implantable cardioverter defibrillator. fisher s exact or chi - square test for categorical variables ; mann - whitney u test for continuous variables. pre - hospital resuscitation characteristics, aetiology and treatment of out - of - hospital cardiac arrest of cardiac origin who survived to emergency department admission cpr cardiopulmonary resuscitation, aed automated external defibrillator, ems emergency medical services, rosc return of spontaneous circulation, acls advanced cardiac life support, pci percutaneous coronary intervention, cabg coronary artery bypass grafting, icd implantable cardioverter defibrillator. fisher s exact or chi - square test for categorical variables ; mann - whitney u test for continuous variables. tables 1and 2 show the characteristics of the survivors and the non - survivors admitted to the emergency department. the non - survivors were relatively older compared with the survivors (70 [5879 ] years) vs. 63 [5572 ] years, p = 0.01), and chronic heart failure was present in 18 vs. 7 % (p = 0.02), respectively. an initial shockable rhythm was recorded in 69 non - survivors (67 %) vs. 81survivors (90 %), p < 0.01. among the non - survivors < 50 % achieved rosc at departure from the site and on arrival to the emergency department, while of the survivors nearly 100 % achieved rosc at departure and arrival, p < 0.01, respectively. there was no statistical significance compared with survivors in terms of gender, witnessed arrest, bystander cpr, or use of aed. following admission to the emergency department, 50 (26 %) patients died. (45 %) of the patients, cardiac arrest was precipitated by acute coronary syndrome, 60 (31 %) received therapeutic hypothermia and 62 (32 %) patients underwent a pci. among the non - survivors, 21 (20 %) received therapeutic hypothermia, acs was diagnosed in 34 (32 %) and 15 (14 %) underwent pci procedure. ninety (46.2 %) patients survived to hospital discharge after an average stay of 16 days following ohca. sixty - four (71 %) patients were discharged home and nine (10 %) to a nursing facility. table 3 illustrates the neurological outcome of the survivors at the time of hospital discharge and follow - up at the end of 1 month, 6 months and 12 months following ohca. the neurological outcome (assessed by the modified rankin scale) at hospital discharge was available for 61 (68 %) patients. accordingly, 50 % could carry out normal daily activities, while six (10 %) patients had moderately severe disability. table 3the modified rankin scale scores at hospital discharge and follow - up at 1, 6 and 12 monthsmodified rankin scaledischarge n = 611 month n = 436 months n = 2512 months n = 18030 (50 %) 27 (63 %) 14 (56 %) 10 (56 %) 113 (21 %) 10 (23 %) 7 (28 %) 5 (28 %) 29 (15 %) 4 (10 %) 1 (4 %) 1 (6 %) 33 (5 %) 2 (5 %) 3 (12 %) 2 (11 %) 46 (10 %) ---5 - ---modified rankin scale : 0no symptoms, 1no significant disability, 2slight disability, 3moderate disability, 4moderately severe disability, 5severe disability, 6dead. the modified rankin scale scores at hospital discharge and follow - up at 1, 6 and 12 months modified rankin scale : 0no symptoms, 1no significant disability, 2slight disability, 3moderate disability, 4moderately severe disability, 5severe disability, 6dead. in our out - of - hospital cardiac arrest observational study, covering the maastricht region, more than 46 % of the cardiac cohort admitted to the emergency department survived to hospital discharge. evidently, shockable rhythm, rosc on departure from site of arrest and arrival to the emergency department, shorter advanced cardiac life support duration, and post - arrest resuscitation care were the main findings for good survival outcome in the present study. reported a survival rate of 43 % in patients admitted to hospital due to cardiac and non - cardiac causes in the leiden region. in an earlier study reported from the amsterdam region, survival rate to hospital discharge was 9 %.the varying survival outcome has been ascribed to regional variations following resuscitation efforts for ohca and study design [1, 7, 8 ]. these described variations include but are not limited to population demographics, culture, competing illness, but also post - arrest care. despite all these regional variations, a trend towards a better outcome reflects improvements in the chain of survival, as compared with the approximate 6 % reported from an earlier study in the 1990s, from the maastricht region. in nearly 75 % of the non - ems it is known that bystander cpr maintains a state of shockable rhythm, which could double the chances of survival. this finding is high compared to other utstein reports [46 ], which is probably due to public awareness and alert systems in the region. we observed a shockable rhythm to be most evident among the survivors (90 %). it is likely that an increased number of bystander cprs in the acute phase of a cardiac event maintained a shockable rhythm. furthermore, a correlation between shockable rhythm and rosc has been described by sasson and colleagues. they reported that with a shockable initial rhythm, rosc was achieved in 50 % of ohca. in the arrest study, waalewijn. observed that 43 % of patients with a shockable rhythm achieved rosc, while 13 % of patients with a non - shockable rhythm attained rosc. therefore, the presence of a shockable rhythm might influence the duration of resuscitation and even the subsequent course of clinical management. recently, structured post - arrest care and its effect on the ohca outcomes has been gathering attention, including the provision of therapeutic hypothermia, early cardiac intervention and neurological prognostication [1, 3, 18 ]. in our study 43 % of survivors were cooled down with therapeutic hypothermia comparable with 47 % of the survivors in the study by boyce.. further, 43 % of the patients admitted to hospital underwent an acute and/or sub - acute intervention. in the recent ohca study from the netherlands, 86 % of patients admitted to the icu or ccu underwent acute and/or sub - acute cardiac intervention. the disparity might be due to the number of patients who died in our emergency department. a common understanding would be that patients with a reasonable chance to survive would receive further intervention. potentially, early restoration of homeostasis with invasive cpr might serve as a bridge to definitive care in patient s refractory to continued resuscitation. following recovery, at hospital discharge, 50 % of documented cases in the present study had a favourable neurological outcome. plausibly, the presence of a shockable rhythm and early rosc with consequent post - arrest care in eligible patients led to a better neurological outcome in our observational study. one might wonder whether we could further optimise the chances of non - survivors towards better outcomes in the presented cohort. it is impossible to save every patient as some determinants remain unchanged, such as e.g. age and comorbidities. however, the modifiable determinant would be wider application of aed, thereby preventing a longer duration of no - flow (collapse to first defibrillation), which worsens the chances of survival by progressing into a non - shockable rhythm [8, 9 ]. alternatively, the presence of a non - shockable rhythm among non - survivors (30 %) might have been due to failure of icd, battery discharge following defibrillation or the duration of resucitation [19, 20 ]. since there has been limited resucitative and post - arrest care options for non - shockable rhythm, one can argue that implementation of e - cpr, restoring circulation and oxygenation, might prevent a state of non - shockable rhythm [11, 12 ]. therefore, it is tempting to speculate that a certain number of non - survivors in our cohort with survival determinants, such as witnessed arrest, received bystander cpr, or in shockable rhythm, would have likely benefited from invasive cpr in the event of unsustained rosc, thereby, establishing a bridge to proven interventions. e - cpr is considered in cardiac arrest patients with a brief no - flow period when the condition leading to cardiac arrest is reversible or amenable to heart transplantation. additionally, e - cpr needs to be implemented in experienced centres, where the technique can be rapidly initiated [11, 12, 21 ]. in a prospective, observational study by chen. an up to 42 % increase in survival rate was observed when e - cpr was implemented within 30 min of cardiac arrest. the implementation of e - cpr in a site like the emergency room would establish whole - body perfusion, providing a bridge to diagnosis and treatment, including controlled therapeutic hypothermia, cardiac intervention or heart transplant [1113, 21, 22 ]. however, applying e - cpr may be futile in patients with previous cardiac comorbidities, i.e., chronic heart failure, structural heart disease or icd failure. in the event of poor neurological prognosis, a decision for organ donation (based on advance directives and/or care provider s decision) could improve the quality of organ donors as a secondary outcome. therefore, assuming that refractory cardiac arrest may be caused by a treatable condition, engaging all temporising techniques to facilitate further diagnostics and therapy might be prospectively applied in a select patient population ; this might potentially improve survival rate and organ recovery. limitations of our analysis include the lack of neurological scores for all survivors, this information was not available at the time of discharge and follow - up. we reiterate that shockable rhythm, rosc, and post - arrest care improves survival outcome. potentially, initiating e - cpr in patients refractory to standard care on - scene or at the arrival to the emergency department might be a prospect for even better survival outcome. | aimthe current outcome of out - of - hospital cardiac arrest (ohca) patients in the maastricht region was analysed with the prospect of implementing extracorporeal cardiopulmonary resuscitation (e - cpr).methodsa retrospective analysis of adult patients who were resuscitated for ohca during a 24-month period was performed.results195 patients (age 66 [5775 ] years, 82 % male) were resuscitated for ohca by the emergency medical services and survived to admission at the emergency department. survival to hospital discharge was 46.2 %. notable differences between non - survivors and survivors were observed and included : age (70 [5879 ] years) vs. (63 [5572 ] years, p = 0.01), chronic heart failure (18 vs. 7 %, p = 0.02), shockable rhythm (67 vs. 99 %, p < 0.01), and return of spontaneous circulation (rosc) at departure from the site of the arrest (46 vs. 99 %, p < 0.01) and on arrival to the emergency department (43 vs. 98 %, p < 0.01), respectively. acute coronary syndrome was diagnosed in 32 % of non - survivors vs. 59 % among survivors, p < 0.01. therapeutic hypothermia was provided in non - survivors (20 %) vs. survivors (43 %), p < 0.01. percutaneous coronary intervention (pci) was performed in 14 % of non - survivors while 52 % of survivors received pci (p < 0.01). no statistical significance was observed in terms of gender, witnessed arrest, bystander cpr, or automated external defibrillator deployed among the cohort. at hospital discharge, moderately severe neurological disability was present in six survivors.conclusionthese observations are compatible with the notion that a shockable rhythm, rosc, and post - arrest care improve survival outcome. potentially, initiating e - cpr in the resuscitation phase in patients with a shockable rhythm and no rosc might serve as a bridge to definite treatment and improve survival outcome. |
oxalate decarboxylase (oxdc) catalyzes the mn - dependent conversion of oxalate monoanion into co2 and formate. although the enzyme appears to be found in many fungi and some bacteria, its biological function remains poorly understood. it has been shown, however, that oxdc is a constituent protein of the spore coat formed by bacillus subtilis. details of the mechanism by which oxdc mediates cleavage of the chemically unreactive c c bond in oxalate remain to be clearly delineated. heavy - atom isotope effect (ie) measurements and recent spin - trapping experiments are consistent with the hypothesis that reaction proceeds via heterolytic breakdown of a manganese - bound oxalate radical anion. in principle, the presence of mn(ii) in oxdc offers the opportunity to use epr methods to explore the mechanistic role of the metal ion in catalysis. the situation is complicated, however, by the fact that the enzyme is composed of two cupin domains, each of which contains a mn(ii) ion in a similar coordination environment (figure 1). as a result, even the high - field epr spectra of the wild - type enzyme in buffer are complicated, and the effects of substrate binding and/or catalysis at a specific metal center are difficult to observe. it is therefore not surprising that two prior experimental studies have yielded conflicting assignments for the observed fine structure parameters of the two mn(ii) centers. representations of the mn(ii) binding sites in the n - terminal (right) and c - terminal (left) domains of bacillus subtilis oxalate decarboxylase (1uw8). the location of the two mn(ii) centers in the monomer are indicated by the solid spheres in the ribbon drawing (top). color scheme : c, cyan ; n, blue ; o, red ; mn, purple. the figure was rendered using vmd. in principle, the application of modern theoretical methods to obtain estimates of the fine structure parameters d and e associated with each of the two mn(ii) centers in oxdc represents a means of resolving the discrepancy in assignments of the previous epr studies. in practice, however, any accurate computation of fine structure parameters from first principles represents a significant challenge for modern quantum mechanical methods. this is especially true for high - spin d systems where the balance between the direct electron electron magnetic dipole spin spin (ss) interaction involving unpaired electrons and a second order term, arising from the spin orbit coupling (soc) of electronically excited states into the ground state, gives rise to very small d values ranging from nearly 0 to 1.5 cm (corresponding to interaction energies on the order of 0.004 kcal mol). estimates of fine structure parameters obtained using theoretical methods are therefore the difference between large contributions that have the same order of magnitude and opposing signs. thus, even minor errors in calculating either of the ss or soc contributions can significantly affect the accuracy of the final results. efforts to employ density functional theory (dft) for the accurate prediction of fine structure parameters are also complicated by the delicate balance between exchange and correlation contributions. be that as it may, any demonstration that theoretical calculations are capable of yielding even qualitative insights into zero - field splittings would have wide application in the study of mn - dependent enzymes and likely facilitate the interpretation of epr spectra for multicenter systems, such as oxdc. to date, however, only one study has been published in which an integrated experimental / computational strategy was used to assign the fine structure parameters associated with mn(ii) ions bound to enolase. we now report a mutational strategy that has allowed us to establish the assignment of epr fine structure parameters to each of the mn(ii) centers in wild - type oxdc, at least at high solution ph. this work has also provided an opportunity to assess the performance of a combined dft and dft / mm computational strategy for calculating the zero - field splitting (zfs) parameters of the protein - bound mn(ii) ions in oxdc. despite the known sensitivity of calculated d and e values to the computational approach, we demonstrate that good estimates of these parameters can be obtained using cluster models taken from carefully optimized dft / mm structures. overall, our findings not only confirm the assignments of tabares. but also provide new insights into the strengths and limitations of theoretical methods for understanding electronic properties of protein - bound mn(ii) ions. this work also sets the stage for future epr studies on the electronic properties of the mn(ii) centers in oxdc and site - specific variants. mn(ii) is a d ion with a total spin quantum number of s = 5/2. the transition between the ms = 5/2 and ms = 3/2 electron spin manifolds is emphasized at temperatures below 4 k because of a large population difference according to boltzmann statistics. spectroscopically, this transition extends over a field range of 6(d + e)/gb, whereas that of the next higher energy transition between ms = 3/2 and ms = 1/2, typically observed at temperatures above 5 k, is only 3(d + e)/gb. this is also true for the central transition between ms = 1/2 and ms = + 1/2, although because these transitions are not directly affected by the fine structure to first order they are typically very sharp and intense. importantly, frozen solution spectra observed at very low temperatures, at or below 4 k, which feature the ms = 5/2 and ms = 3/2 transitions, allow the direct determination of not only d and e values but also the sign of d. hence, the largest deviation of the powder spectrum from the center happens at low field with the main turning point at 4|d|/gb (measured from the center of the spectrum) for negative d values, whereas the highest field component appears at (2|d| + 6|e|)/gb (figure s1 in supporting information). the situation is reversed if d has a positive sign. in the event that the rhombic component, e, has an appreciable magnitude, a splitting is observed on the side with the smaller deviation from the center, featuring signals at (2|d| + 6|e|)/gb and (2|d| 6|e|)/gb. the sign of e depends on how one defines the x- and the y - axis of the fine structure tensor, and it can only be determined using single - crystal epr spectroscopy. in studies of oxdc and its site - specific variants, our strategy of resolving the fine structure relies on observing the transitions between higher ms states at the lowest possible temperature, which is between 2.5 and 3 k for our helium flow cryostat. these transitions are usually not very strong and require enzyme concentrations on the order of 20 mg / ml or higher to be reliably observed. we also routinely take epr spectra at intermediate temperature (40 k) to distinguish between species exhibiting small and relatively large magnitudes of the fine structure parameters d and e. the high - field epr (326.4 ghz) spectrum of wild - type (wt) oxdc at ph 8.5 in frozen solution (3 k) clearly showed transitions associated with higher ms states (figure 2), enabling us to determine the fine structure values directly for at least one of the two mn(ii) species present in the enzyme. this ph was chosen because the x - ray crystal structure of wt oxdc, which was used in dft and dft / mm calculations, was obtained by crystallization at ph 8.5. we also note that observation of these weak transitions required the use of high enzyme concentrations (27 mg / ml), which could be achieved by modification of published purification protocols. the intensity of the central |+1/2 |1/2 sextet centered at 11658 mt was greatly reduced due to boltzmann population favoring the transition from the lowest level within the electron spin manifolds, |5/2 |3/2. on its low - field side, a broad peak was visible, centered at around 11450 mt, and on the high - field side, there was a negative signal at 11760 mt. a poorly resolved shoulder was observed above 11800 mt instead of the expected rhombic splitting, and because a fully axial fine structure tensor would yield a much narrower peak at high fields, this implied that the fine structure parameter, e, had a broad distribution spanning essentially the whole range from zero to the maximum possible value of |d|/3. by using a broad gaussian distribution of e centered around 200 mhz with a half - width of 800 mhz, however, we were able to obtain a reasonable fit of the experimental spectrum (figure 2). on the other hand, this approach was unable to recover the high - field shoulder present in the spectrum, implying that our experimental e / d ratios (table 1) have large errors associated with them, thereby making it difficult to draw hard conclusions from these values. high - field (326.4 ghz) epr spectra of wt oxdc taken at 3 k (black) and 40 k (blue) together with spectral simulations. note that the central part of the spectrum at 40 k together with the corresponding spectral simulation of site i is removed for clarity. the enzyme (27 mg / ml) was dissolved in 50 mm tris buffer containing 500 mm nacl, ph 8.5. (site i) with small zfs at 3 k (red) and 40 k (green) and a single mn(ii) species (site ii) with very large zfs at 40 k (cyan). the sum of site i and site ii simulations at 40 k is also shown (magenta). we note that site ii does not contribute significantly to the spectral range visible. unedited spectra and full sets of simulation parameters are provided elsewhere (figures s2s4 in supporting information). the error for e / d values obtained in the present study is very large due to the broad distribution of e values that had to be assumed in the simulations. these values are obtained from the center of a broad gaussian distribution of e (see text for more details). cluster model containing hydroxide as the fifth ligand (figure 7c). cluster model containing hydroxide as the fifth ligand with a hydrogen bond to a solvent water (figure 7d). initial structure for qm / mm optimization based on the x - ray crystal structure of co(ii)-containing w132f oxdc variant. initial structure for qm / mm optimization from in silico modification of the x - ray crystal structure of wt oxdc (1uw8). in the text, we report either the positive or the negative d value as obtained by calculation. in this table, however, we give only absolute values for d in the case of the c - terminal site because the sign of this parameter could not be experimentally determined. the spectrum at 40 k primarily showed the |3/2 |1/2 transitions on the low- and high - field side of a much stronger set of central |+1/2 |1/2 sextet lines relative to those seen at 3 k (figure 2). these transitions were now located closer to the spectral center, and the |5/2 |3/2 transitions were barely visible above the noise. interestingly, there were three relatively sharp transitions visible on the low - field side of the spectrum together with a broader feature on the high - field side as one would expect from a pentacoordinate species with |d| of approximately 10 ghz. the appearance of overlapping spectra with differing zero - field splittings is consistent with the fact that oxdc contains two mn binding sites. simulations of the 40 k high - field epr spectrum using the site i magnetic parameters extracted from the spectrum at 3 k together with a second species (site ii) having very large fine structure (10 ghz) gave a satisfactory global fit (figure 2) and yielded similar values for the fine structure parameters d and e (table 1) to those reported previously. site i has the smallest |d| value and carries about 68% of the spectral weight. unfortunately, the transitions associated with the second mn(ii) (site ii) were not of sufficient intensity to allow direct experimental observation. instead, we had to rely on the second - order effect of the fine structure on the central ms = 1/2 to ms = + 1/2 transitions, manifesting itself through broadenings and spectral splittings, which turn the sextet lines into a group of sharp lines at low field complemented by a broad pake pattern on the high - field side (figure s2 in supporting information). given that these are second - order effects on the + 1/2 1/2 transitions, no information concerning the sign of d could be obtained from our simulation. values for the g - factor and hyperfine coupling constant a with the mn nucleus were also obtained for the two mn(ii) sites in the enzyme (table s1 in supporting information). both of these sites are similar to ones reported by tabares and co - workers (table 1), with site ii most probably corresponding to a pentacoordinate mn(ii) ion observed in the c - terminal domain of the enzyme by x - ray crystallography (figure 1). hence, site i is likely associated with a hexacoordinate mn(ii) bound within the n - terminal domain of the enzyme. in order to confirm these assignments, we decided to prepare a site - specific oxdc variant in which only the zfs parameters of the n - terminal mn(ii) center would be perturbed, thereby leading to a shift in the d and e values associated with only one site. an analysis of the second sphere interactions revealed a hydrogen bonding interaction between the side chains of a conserved tryptophan (trp-132) and the glutamate (glu-101) coordinating mn(ii) in the n - terminal domain (figure 3). we anticipated that removing this hydrogen bond would perturb the mn(ii)/glu-101 interaction, thereby affecting the zfs parameters, and so the w132f oxdc variant, in which trp-132 is replaced by phenylalanine, was expressed and purified following our standard procedures. steady - state kinetic analysis gave values of 63 s and 50 mm for kcat and km, respectively (figure s5 in supporting information), and so the w132f oxdc variant exhibited a 10-fold lower catalytic efficiency (kcat / km) than wt enzyme after normalizing for mn(ii) incorporation. however, the observations that (i) kcat was essentially unaffected by the site - specific mutation and (ii) mn(ii) incorporation was very similar in wt oxdc and the w132f oxdc variant supported the idea that the tertiary structure was not significantly affected by removal of the hydrogen bonding interaction. schematic representation of hydrogen bonding interactions (dotted lines) involving residues in the bacillus subtilis oxdc n - terminal mn(ii) binding site when the active site loop adopts a closed conformation. copyright 2004 american society for biochemistry and molecular biology. in order to ensure that there was indeed minimal impact on mn(ii) coordination and local protein structure as a result of replacing trp-132 by phenylalanine, we sought to obtain an x - ray crystal structure of this oxdc variant. all efforts to grow diffraction quality crystals of the mn(ii)-substituted form of the w132f oxdc variant proved unsuccessful. we were able, however, to express and purify the co(ii)-containing form of the mutant enzyme using conditions that had been developed in prior investigations into oxdc metal selectivity, and this material gave crystals that were suitable for structure determination. the x - ray crystal structure of co - substituted w132f oxdc was solved using phases calculated by molecular replacement and refined to a resolution of 2.1. the overall protein fold of the co - containing w132f variant did not differ significantly from wt enzyme, and the two structures superimposed with an rmsd of only 0.26. more importantly, perhaps, the phenyl ring in the oxdc w132f variant was positioned in an identical orientation to the indole side chain of trp-132 within the n - terminal mn(ii) binding site (figure 4). comparison of the metal ligand bond distances in the co - substituted form of the w132f oxdc variant and the mn - containing wt enzyme also showed that they do not vary significantly in light of a 0.23 coordinate error for the w132f structure (figure s6 in supporting information). this similarity of co(ii) and mn(ii) metal ligand bond lengths in oxdc is consistent with data in the scripps metalloprotein database. for example, the average bond lengths for protein residues to mn(ii) ranges from 1.5 to 2.9 with an average value of 2.20. co(ii)-containing proteins have an average amino acid ligand bond length of 2.16 and range from 1.55 to 2.69. similarly, the bond distances for water ligands bound to mn(ii) and co(ii) range from 1.05 to 3.09 (2.26 average) and 1.362.99 (2.26 average), respectively. hence, at least in terms of metal ligand bond distances and angles, co(ii) is a good mimic of mn(ii). as importantly, and despite the fact that co - containing wt oxdc is catalytically inactive, the side chain carboxylate of the functionally important residue glu-162, which is located on a mobile active site loop segment ser - glu - asn - ser (bacillus subtilis numbering), undergoes only a small shift in position as a result of the site - specific mutation. on the other hand, we noted that the ring of his-97 had become flipped relative to its orientation in wt oxdc (figure 5). efforts to refine the structure of the variant enzyme with his-97 oriented in the same manner as observed in wt enzyme, however, merely resulted in reorientation of the ring to the original position in our initial structure for the w132f variant. the correct positioning of the his-97 side chain was also verified by a composite omit map (figure s7 in supporting information). importantly, the structure of the co - substituted enzyme confirmed that replacement of trp-132 by phenylalanine did not perturb the structure of the c - terminal mn(ii) binding site (figure 4). schematic representation of the structural changes in the n - terminal (top) and c - terminal (bottom) metal centers resulting from replacement of trp-132 by phenylalanine. the figure was generated by superimposing the x - ray crystal structures of wt oxdc (1uw8) (purple) and the co - containing w132f oxdc variant (green). superimposition of the mn(ii) n - terminal binding sites observed in the x - ray crystal structures of wt oxdc (orange) and the co - containing w132f oxdc variant (green). only the residues in the first coordination sphere around the metal figure rendered using vmd. given the kinetic and structural evidence that removal of the hydrogen bonding interaction between glu-101 and trp-132 was likely only to perturb the n - terminal mn(ii) center, we measured the high - field epr (326.4 ghz) spectrum of the w132f oxdc variant at ph 8.5 (figure 6). the w132f oxdc variant shows a broader spectrum of its transitions between higher ms states when compared with the wt enzyme. hence, the low - field maximum now appeared at 11386 mt, and although the negative peak appeared to be centered at 11780 mt (little shifted compared to wt enzyme), it was broader and reached out to higher fields (figure 6). as perhaps expected from the negligible alterations to the structure of the c - terminal mn(ii) binding site in the co - substituted w132f oxdc variant (figure 4), the 40 k epr spectrum showed evidence for a pentacoordinated mn(ii) species exhibiting the telltale sharp peaks at the low - field side and a pake pattern at the near high - field side of the spectrum. as in our earlier studies of wt oxdc, we were able to simulate the observed transitions by assuming that only two mn sites were present (figure 6). hence, assuming a single mn(ii) species having a negative d value of 1950 mhz and a large gaussian distribution of e values centered around 400 mhz with a half - width of 1200 mhz gave a reasonable simulation of the low - field side of the spectrum even though the broad feature on the high - field side could only be partially reproduced. an improved simulation could be obtained using a much broader non - gaussian spectral distribution of d and e in which d and e ranged between 1600 and 2100 mhz and between 100 mhz and the maximum value of |d|/3, respectively (figure s10 in supporting information). both simulations, however, provide clear experimental evidence for a significant increase in the magnitude of d for one of the mn(ii) sites in the w132f oxdc variant when compared to wt enzyme. this spectroscopic behavior is therefore consistent with the hypothesis that removal of the glu-101/trp-132 hydrogen bond would impact the electronic structure of the mn(ii) ion bound in the n - terminal domain. high - field (326.4 ghz) epr spectra of the mn - containing w132f oxdc variant taken at 3 k (black) and 40 k (blue) together with spectral simulations. note that the central part of the spectrum at 40 k together with the corresponding spectral simulation of site i is removed for clarity. the enzyme (40 mg / ml) was dissolved in 50 mm tris buffer containing 500 mm nacl, ph 8.5. lines from spectral simulations correspond to a single mn(ii) species (site i) with small zfs at 3 k (red) and 40 k (blue) and a single mn(ii) species (site ii) with very large zfs at 40 k (cyan). the sum of site i and site ii simulations at 40 k is also shown (magenta). we note that site ii does not contribute significantly to the spectral range visible. unedited spectra and full sets of simulation parameters are provided elsewhere (figures s8s10 in supporting information). the ability of dft and wave - function - based methodologies (widely and successfully used to model mononuclear inorganic complexes) to compute zfs values for a series of mn(ii) transition metal complexes has been evaluated. perhaps, unsurprisingly, these studies revealed that the computed zfs values are highly dependent on molecular geometry. the availability of good structural and experimental zfs data for wt oxdc offered the opportunity to examine whether qm / mm methods for obtaining optimized active site geometries might yield structures that could (at the very least) be used to compute qualitatively correct estimates of the zfs parameters for protein - bound mn(ii) ions. thus, an initial structure for performing qm / mm geometry optimizations was generated from classical md simulations of wt oxdc solvated in water at physiological conditions. although two x - ray structures have been reported for the enzyme, we used the one containing a pentacoordinate mn(ii) ion in the c - terminal domain (pdb i d : 1uw8) to obtain the initial set of atomic coordinates for all subsequent calculations on wt oxdc (figure 1). after qm / mm optimization of the metal centers in the initial enzyme, a set of cluster models were defined in which only oh / h2o molecules in the active site cavity and the side chains of all the residues in the first coordination sphere around the metal were included (figure 7). cluster models taken from the dft / mm - optimized structure of wt oxdc that were used to calculate the zfs values of the bound mn(ii) ions in the (a) n - terminal and (b d) c - terminal domains (see text for details). color scheme : c, cyan ; h, white ; n, blue ; oxygen, red ; mn, tan. these models were then used in calculations of the zfs parameters that employed the hybrid b3lyp functional in conjunction with triple- (def2-tzvp) valence basis sets. remarkably, excellent agreement was obtained in the prediction of both d and e / d values when qm / mm - optimized geometries were used to obtain the atomic coordinates for these models, showing the importance of the surrounding residues in modulating the geometric features of the oxdc active sites (table 1 and table s2 in supporting information). for example, the d value of 1170 mhz computed for the n - terminal mn(ii) cluster model (figure 7a) was similar in both sign and absolute magnitude to that observed for site i (d = 1350 mhz, table 1). computing good estimates for the d value associated with the c - terminal mn(ii) center required more effort. for example, an initial calculation on a cluster in which water was used as the fifth ligand (figure 7b) gave a d value of 4110 mhz from b3lyp / def2-tzvp calculations, which is considerably smaller than the observed |d| value of 10430 mhz (table 1). closer examination of the x - ray crystal structure, however, showed that the mn o distance in the c - terminal mn(ii) site was only 2.15, whereas both mn o distances for the metal center in the n - terminal domain were significantly longer (2.31 and 2.33). this observation thereby raised the possibility that the fifth ligand in the c - terminal site was a hydroxide ion rather than water. as a result, and especially given that the crystal structure (1uw8) had been obtained at ph 8.5, we examined the effects of modeling the fifth ligand as a hydroxide ion. we therefore reoptimized the wt oxdc following the protocol previously outlined, except that hydroxide was bound to the metal in the c - terminal binding site, and created another cluster model of this mn(ii) center (figure 7c). b3lyp / def2-tzvp calculations using this third model gave a computed d value of 4560 mhz, which was a slight, albeit small, improvement. we noticed, however, that additional water molecules entered the c - terminal mn(ii) binding site during the initial set of classical md simulations used in equilibrating the system. one of these waters formed a hydrogen bond to the mn(ii)-bound hydroxide ligand after dft / mm optimization. the b3lyp / def2-tzvp calculations were therefore repeated for a new cluster model containing this water molecule (figure 7d), with the result that a d value of 7130 mhz was obtained. this is in much better agreement with the experimentally observed value for the site ii mn(ii) species. we also note that the calculated e / d ratio for site i was similar to that obtained by analyzing the high - field epr spectra, although any comparison of theoretical and our experimental e / d values is devalued by the broad distribution of e values needed in the spectral simulations. despite this complication, our dft - based computational strategy again supports the zfs assignments of tabares. as an additional validation of our strategy for obtaining accurate geometries for mn(ii) binding sites in proteins that permit practically useful theoretical estimates of their corresponding zfs values, we constructed an optimized model of the mn(ii)-containing w132f oxdc variant based on the 2.1 resolution x - ray crystal structure of the co(ii)-substituted enzyme. after replacing the co(ii) ions with mn(ii), our standard dft / mm procedure was used to optimize the resulting structure. as discussed above, the n - terminal mn(ii) coordination environment in the initial configuration exhibited some unexpected features, including (i) rotation of the his-97 imidazole ring by about 180 relative to its orientation in the x - ray crystal structure of wt oxdc, and (ii) almost identical mn n (2.45) and mn c (2.47) distances for the interaction of the metal with his-97 (figure 5). in contrast, the final computational model of the mn(ii)-containing w132f oxdc variant obtained using our standard protocol (equilibration using classical md simulation followed by dft / mm optimization) did not contain these unexpected structural features (figure 8). thus, the his-97 imidazole ring underwent a rotation of about 70 with respect to its orientation in the initial structure, and the mn n (2.24) and mn c (3.21) distances became appreciably different. most importantly, however, b3lyp / def2-tzvp calculations on a cluster model of the n - terminal mn(ii) site gave a d value of 2100 mhz in very good agreement with experiment (d = 1950 mhz) (table 1). superimposition of the n - terminal mn(ii) binding sites present in the x - ray crystal structure of the co - containing w132f oxdc variant (green) and the dft / mm - optimized structure of the mn(ii)-containing w132f oxdc variant (gray). only the residues in the first coordination sphere around the metal are depicted as sticks. we also assessed the ability of our computational protocol to be employed in a predictive manner by calculating the mn(ii) zfs values for the n - terminal metal center in a model of the w132f oxdc variant prepared by in silico mutation. hence, the x - ray crystal structure of wt oxdc (1uw8) was computationally modified so that trp-132 was replaced by a phenylalanine residue. the resulting model was then equilibrated and optimized using our standard protocol to give a final structure in which the hydrogen bond between the glu-101 side chain, and the closest mn(ii)-bound water became slightly shorter as a consequence of removing the interaction between glu-101/trp-132 (table 2). changes in other metal ligand bond distances were also observed together with slight changes in the locations of the side chains of some nearby residues. once again, b3lyp / def2-tzvp calculations were performed on a cluster model of the n - terminal mn(ii) site corresponding to that used for calculations on wt oxdc (figure 7a). the computed d value of 1350 mhz (table 1) shows that this optimized model structure captures the increased magnitude of d that is experimentally observed on removal of the glu-101/trp-132 hydrogen bond. on the other hand, the absolute value is smaller than that computed from a model based on the x - ray crystal structure of the co(ii)-containing w132f oxdc variant (table 1). given that superimposition of the two cluster models used to compute the zfs parameters for the n - terminal mn(ii) site in the w132f oxdc variant showed all metal ligand distances to be similar in both structures, the difference in the calculated d values likely arises from altered orientations of the imidazole rings of his-97 and (to a smaller extent) his-95 (figure 9). taken overall, these results suggest that the computational strategy described in this paper yields reliable structural information and, as a consequence, very good estimates of zfs values for protein - bound mn(ii) centers. importantly, our approach opens the possibility of computing fine structure parameters in biomolecular systems for which only lower - resolution crystal structures are available. qm / mm - optimized structure with the bound hydroxide in the c - terminal mn(ii) center forming a hydrogen bond to a water molecule. this structure was obtained from the x - ray crystal structure of wt oxdc (1uw8) (figure 7a, d). qm / mm - optimized structure with water bound to the c - terminal mn(ii) center based on the x - ray crystal structure (1uw8) (figure 7b). qm / mm - optimized structure with hydroxide bound to the c - terminal mn(ii) center based on the x - ray crystal structure (1uw8) (figure 7c). qm / mm - optimized structure obtained from the x - ray crystal structure of the co(ii)-containing w132f oxdc variant. qm / mm - optimized structure obtained from in silico substitution of the x - ray crystal structure of wt oxdc (1uw8). superimposition of the cluster models used to calculate the zfs parameters of the mn(ii) n - terminal binding site in the w132f oxdc variant. color scheme : green, initial structure based on the x - ray crystal structure of the co(ii)-containing variant ; orange, initial structure derived from the x - ray crystal structure of wt enzyme (in silico substitution). in addition to resolving the question of mn(ii) assignments for oxdc, this study provides further evidence for the utility of advanced quantum mechanical calculations in probing the electronic structure of protein - bound metal centers. to date, there have been few such calculations, in part because previous efforts to compute zfs parameters on a series of mn(ii)-containing complexes gave large differences between theoretically predicted and experimentally measured values. these discrepancies can be attributed to the high sensitivity of the zfs parameters to the geometrical features of the structures used for the calculations. it is also true that the requirement that zfs parameters reflect only small energy differences places considerable demands on the computational methods used to obtain them, and only a qualitative agreement giving rise to correct trends can be expected in general. on this point, we note that the overestimated d values found in efforts to compute the zfs parameters for the mn(ii) ions bound to enolase were attributed both to the high sensitivity of the calculated values to the molecular geometries employed and the use of dft calculations instead of correlated ab initio methods. however, some of the limitations associated with the use of dft methodologies might be overcome by employing the more recently developed coupled - perturbed spin orbit coupling (cp - soc) formalism (as used here) instead of the pederson and khanna (pk) approach used in the previous work on enolase - bound mn(ii) ions, provided that the direct spin spin interaction is properly included in the treatment. in particular, systematic investigation of the ability of coupled - perturbed dft methodologies to estimate zfs parameters in mn(ii) transition metal complexes also showed that reliable results could be obtained using a hybrid dft functional (b3lyp) if accurate geometries were employed. the theoretical results reported herein, however, demonstrate that the use of a strategy based on computation of zfs parameters at the dft theory level for cluster models obtained from qm / mm - optimized structures has some value, especially if high - quality x - ray structures are available for the protein, or site - specific variant, of interest. indeed, the reorientation of the his-97 side chain observed upon the application of our computational protocol was likely an essential element in obtaining good agreement between the calculated and experimentally observed zfs parameters. our results also show that qm / mm - optimized models of variant structures can also yield qualitatively correct changes in computed zfs values, especially when the site - specific mutation does not introduce large structural changes in the metal ion environment. presumably this reflects the ability of carefully equilibrated qm / mm structures to capture the critical metal ligand interactions, such as metal ligand distances and coordination geometries, needed to obtain good estimates of zfs parameters. although additional systematic computational investigations on the problem of computing zfs values are clearly needed, our findings set the scene for theoretical studies aimed at delineating the effect of active site modifications on the electronic structure of the metal centers in oxdc and, perhaps, other mn - dependent enzymes. unless otherwise stated, all chemicals were purchased in the highest purity from sigma (st. nickel - nitrilotriacetic acid agarose (ni - nta) was obtained from qiagen (germantown, md). protein concentrations were determined using the bradford assay (pierce, rockford, il). (coralville, ia), and dna sequencing was performed by the core facility in the interdisciplinary center for biotechnology research at the university of florida. icp - ms determinations of metal content were performed at the university of georgia center for applied isotope studies chemical analysis laboratory (athens, ga). the gene encoding the w132f oxdc variant was constructed by overlap extension (see supporting information). the recombinant his6-tagged mn(ii)-substituted w132f oxdc variant was expressed and purified following published procedures, except that expression was induced in the presence of 5 mm mncl2 after heat shocking the bacteria for 12 min at 42 c with constant agitation. after the addition of iptg, the cultures were incubated at 37 c for 4 h before being harvested by centrifugation at 2000 g for 20 min (4 c). after sonication in lysis buffer, the resulting supernatant was centrifuged at 20 000 g for 20 min (4 c) before the enzyme was purified from the cleared lysate by metal affinity chromatography on a ni - nta column. the eluted protein was then subjected to dialysis at 4 c to give a solution in 50 mm tris buffer containing 500 mm nacl, ph 8.5. samples used for epr analysis were incubated with chelex resin before being concentrated to 27 mg / ml using an amicon centriprep ym-30 filter unit from millipore (billerica, ma). the catalytic properties of the his6-tagged mn(ii)-containing w132f oxdc variant were determined by measuring formate production using an end - point assay as described elsewhere. measurements were made at specific substrate and enzyme concentrations in triplicate, and the data were analyzed to obtain the values of v and v / k by standard computer - based methods. his6-tagged co(ii)-containing w132f oxdc was expressed as described previously with the addition of 2 mm cocl2 after heat shocking the cells at 42 c for 18 min. cells were lysed using a microfluidizer, and the mixture was clarified by centrifugation at 38 000 g for 30 min. the eluate was dialyzed overnight in the storage buffer (50 mm tris - hcl, ph 8.5, and 500 m nacl), and the protein was then further purified on a 320 ml sephacryl s-100 gel filtration column. purified co(ii)-containing w132f oxdc was concentrated to 5 mg / ml in 100 mm tris - hcl, ph 8.5, containing 500 mm nacl. crystals were obtained by the vapor diffusion method with hanging drop geometry by mixing protein (2 l) and well solution (2 l). the well solution contained 100 mm tris - hcl, ph 8.5, 2 m nacl and 10% peg 6000. crystals, which were rectangular prisms (0.3 0.2 0.2 mm), appeared in approximately 2 months at 17 c and were cryo - protected in well solution containing 25% glycerol and flash frozen in liquid nitrogen. the co(ii)-substituted w132f variant crystallized in space group r32 with unit cell dimensions a = b = 156.973 and c = 330.473. data were collected to 1.9 resolution at the national synchrotron light source (nsls), brookhaven national laboratory (upton, ny), at beamline x25 equipped with a pilatus 6 m detector (table 3). phasing was achieved by molecular replacement (phaser - mr in the phenix software suite) using the model of formate - containing wt oxdc (pdb 1j58) after removal of all ligands. the structure was refined using alternating rounds of manual rebuilding in coot followed by minimization in phenix to give a final model that contained residues 6382 with 4 molecules in the asymmetric unit, 1228 waters, and 8 co(ii) ions. the model was refined to 2.1 resolution with a rwork and rfree of 19.6 and 22.7%, respectively (table 3). the ramachandran plot shows that 97.6% of residues fall in the most favored regions with 2.3% in the allowed regions. the maximum likelihood coordinate error is 0.23, consistent with accurate coordinates. coordinates and structure factors for the co(ii)-containing w132f variant have been deposited in the pdb with accession code 4met. ihkli|/hkli|ihkl, i |, where ihkl is the mean intensity of the multiple ihkl, i observations for symmetry - related reflections. high - field epr spectra at 324.6 ghz were recorded at the national high magnetic field laboratory (nhmfl), using a homodyne transmission - mode spectrometer with a nonresonant probe and a 17 t superconducting magnet. wt oxdc (27 mg / ml ; 1.4 mn / monomer) or the w132f oxdc variant (40 mg / ml ; 1.6 mn / monomer) was dialyzed into 50 mm tris, ph 8.5, containing 500 mm nacl. approximately 200 l of this solution was placed into a teflon cup with 7.2 mm i.d. and placed into the fir beam of the spectrometer at 4 k, as measured using a built - in carbon - glass temperature sensor in the cryostat. a cernox sensor was used to map out the temperature scale at the sample position to correct for any temperature gradient in the cryostat. spectra were taken with a modulation amplitude of approximately 27 g at a modulation frequency of 30 khz using a phase - sensitive lock - in detector with the time constant set to 300 ms. the spectra were simulated based on the usual spin hamiltonian (shown below) using the easyspin toolbox for matlab. md simulations of the wild - type form of oxdc were based on the 1uw8 crystal structure of the enzyme. two different procedures were employed to build the w132f oxdc variant : (i) in silico mutation, manually substituting trp-132 by phe in the 1uw8 x - ray structure, and (ii) replacement of co with mn using the co - substituted w132f oxdc mutant as template. in every case, the initial structure was immersed in a periodic box of approximately 77 118 87 containing about 22 500 water molecules and neutralized with na counterions. the box dimensions were chosen to achieve a minimum distance of 30 between two periodically replicated images of the protein. the all - atom amber03 force field was used to model protein residues and ions, whereas the tip3p model was employed for water molecules. all potentially charged amino acids, including the c- and n - termini, were considered to be in their default protonation states at physiological ph (i.e., charged). electrostatic interactions were taken into account using the particle mesh ewald algorithm with a real space cutoff of 10. the same cutoff was employed for the treatment of the van der waals interactions. constant temperature (300 k) and pressure (1 atm) were achieved by coupling the systems to a langevin thermostat and a nos systems were first minimized using a conjugate gradient algorithm and then heated to 300 k in 600 ps while keeping positional restraints on protein heavy atoms. for each system, an initial run of 5.4 ns in the npt ensemble, slowly removing the restraints, was followed by a subsequent 20 ns simulation in the canonical (nvt) ensemble in order to provide starting configurations for the subsequent qm / mm optimizations. qm / mm geometry optimizations were performed starting from equilibrated configurations taken from the aforementioned classical runs. the quantum mechanical / molecular mechanical (qm / mm) implementation employed combines the use of the qm program quickstep and the mm driver fist, both part of the cp2k package (freely available at http://cp2k.berlios.de, released under gpl license). in this code, the general qm / mm scheme is based on a real - space multigrid technique to compute the electrostatic coupling between both qm and mm regions. in all the optimizations, a quantum region consisting of the mn center together with the residues at a distance shorter than 6 from it (including only the side chains up to the c atom) was treated at the density functional theory level, whereas the remaining part of the system, including water molecules and counterions, was modeled at the classical level using the amber force field to take explicitly into account the steric and electrostatic effects of the surroundings. the valence of the terminal qm atoms was saturated by the addition of capping hydrogen atoms. a dual basis set, gaussian and plane - wave formalism, was employed to compute the interaction energy within the qm subsystem. a molecularly optimized double- valence basis set augmented with polarization functions (m - dzvp) was used to describe the wave function, while an auxiliary plane - wave basis set expanded up to a density cutoff of 360 ry was utilized to converge the electron density in conjunction with goedecker teter exchange and correlation energies were computed within the generalized gradient approximation by using the blyp functional. the calculation of the soc and ss parts of the zfs parameters was performed with the orca electronic structure package. we performed these calculations on cluster models, in which only the oh / h2o molecules in the active site cavity and the side chains of all the residues in the first coordination sphere around the metal were included. functional in conjunction with triple- (def2-tzvp) valence basis sets, taking advantage of the rijcosx approximation to speed up the calculations. in all cases, the coupled - perturbed soc approach was used to evaluate the dsoc contribution, whereas the dss contribution was obtained on the basis of the spin - unrestricted natural orbital determinant. scalar relativistic effects were taken into account by means of the van wllen s model potential approximation to the zora equations. | oxalate decarboxylase (oxdc) catalyzes the mn - dependent conversion of the oxalate monoanion into co2 and formate. epr - based strategies for investigating the catalytic mechanism of decarboxylation are complicated by the difficulty of assigning the signals associated with the two mn(ii) centers located in the n- and c - terminal cupin domains of the enzyme. we now report a mutational strategy that has established the assignment of epr fine structure parameters to each of these mn(ii) centers at ph 8.5. these experimental findings are also used to assess the performance of a multistep strategy for calculating the zero - field splitting parameters of protein - bound mn(ii) ions. despite the known sensitivity of calculated d and e values to the computational approach, we demonstrate that good estimates of these parameters can be obtained using cluster models taken from carefully optimized dft / mm structures. overall, our results provide new insights into the strengths and limitations of theoretical methods for understanding electronic properties of protein - bound mn(ii) ions, thereby setting the stage for future epr studies on the electronic properties of the mn(ii) centers in oxdc and site - specific variants. |
-synuclein (s) is an intrinsically disordered protein that is water - soluble but also can bind negatively charged lipid membranes while adopting an -helical conformation. membrane affinity is increased by post - translational n - terminal acetylation, a common modification in all eukaryotic cells. in the presence of lipid vesicles containing a small fraction of peroxidized lipids, the n - terminal met residues in s (met1 and met5) rapidly oxidize while reducing the toxic lipid hydroperoxide to a nonreactive lipid hydroxide, whereas c - terminal met residues remain unaffected. met oxidation can be probed conveniently and quantitatively by nmr spectroscopy. the results show that oxidation of met1 reduces the rate of oxidation of met5 and vice versa as a result of decreased membrane affinity of the partially oxidized protein. the effect of met oxidation on the s membrane affinity extends over large distances, as in the v49 m mutant, oxidation of met1 and met5 strongly impacts the oxidation rate of met49 and vice versa. when not bound to membrane, oxidized met1 and met5 of s are excellent substrates for methionine sulfoxide reductase (msr), thereby providing an efficient vehicle for water - soluble msr enzymes to protect the membrane against oxidative damage. |
|
a 33-year - old female was evaluated as part of an assessment for a 10-day pyrexia of unknown origin (puo). she had undergone a successful renal transplant three years earlier and was on systemic immunosuppressants (cyclosporine and oral prednisolone) to prevent an organ rejection. systemically she was febrile (102 f) but there were no other clinically significant findings. a routine chest x - ray showed nonspecific consolidation in both lung fields, which led to a differential diagnosis of tuberculosis, bacterial or viral pneumonia. her visual acuity was 20/30 in the right eye and 20/20 in the left eye. dilated fundoscopy of the right eye revealed multiple choroidal tubercles scattered throughout the postequatorial retina with one cluster along the superotemporal vessels and another in the perifoveal area [fig. 1 ] the left eye showed two similar lesions in the macular area and three or four lesions in the inferior postequatorial retina [fig. 2 ]. she was started on four - drug antitubercular therapy (isoniazid 300 mg / day, ethambutol 800 mg / day, pyrazinamide 1gm / day and rifampicin 600 mg / day) with resolution of her pyrexia and radiological evidence of healing within seven days. at this time partial resolution of tubercles a 62-year - old male patient was admitted with a two - day history of an acute onset high - grade fever with chills and rigors. he had undergone an uncomplicated renal allograft transplant for diabetic nephropathy one and a half years back. in the period prior to this illness he was taking mycophenolate mofetil (500 mg thrice daily) and cyclosporine a (125 mg twice daily) towards preventing an organ rejection. at the time of admission he was highly febrile, disoriented and prostrate. routine hemogram revealed mild anemia (9.3 g / dl), leucopenia (4000/mm) and a high erythrocyte sedimentation rate of 71 mm at one hour. a chest x - ray showed ill - defined haziness in the right upper and midzones. a high - resolution chest tomogram (hrct) scan performed the following day, revealed patchy scattered areas of consolidation and ground glass appearance in both lung fields. the radiological findings suggested a differential diagnosis of tuberculosis, pneumocystis cariini pneumonia or a viral pneumonitis. the results of investigations for cytomegalovirus infection (igg, igm), malaria (peripheral smear) and typhoid (widal test) were negative. an erythematous maculopapular rash was detected in his lower extremities, which was sent for biopsy. there were yellow - white choroidal lesions measuring 1/3 to 1/4 disc diameter in the posterior pole of either eye (two in the right and one in the left) consistent with choroidal tubercles. his condition rapidly deteriorated despite antitubercular therapy (isoniazid 300 mg / day, ethambutol 800 mg / day, pyrazinamide 1gm / day and rifampicin 600 mg / day) and he died on the seventh day post admission. a histopathological examination of the skin biopsy revealed a large number of acid - fast bacilli consistent with mycobacterium tuberculosis within the tissue. a 33-year - old female was evaluated as part of an assessment for a 10-day pyrexia of unknown origin (puo). she had undergone a successful renal transplant three years earlier and was on systemic immunosuppressants (cyclosporine and oral prednisolone) to prevent an organ rejection. systemically she was febrile (102 f) but there were no other clinically significant findings. a routine chest x - ray showed nonspecific consolidation in both lung fields, which led to a differential diagnosis of tuberculosis, bacterial or viral pneumonia. her visual acuity was 20/30 in the right eye and 20/20 in the left eye. dilated fundoscopy of the right eye revealed multiple choroidal tubercles scattered throughout the postequatorial retina with one cluster along the superotemporal vessels and another in the perifoveal area [fig. 1 ] the left eye showed two similar lesions in the macular area and three or four lesions in the inferior postequatorial retina [fig. 2 ]. she was started on four - drug antitubercular therapy (isoniazid 300 mg / day, ethambutol 800 mg / day, pyrazinamide 1gm / day and rifampicin 600 mg / day) with resolution of her pyrexia and radiological evidence of healing within seven days. at this time partial resolution of tubercles was noted. a 62-year - old male patient was admitted with a two - day history of an acute onset high - grade fever with chills and rigors. he had undergone an uncomplicated renal allograft transplant for diabetic nephropathy one and a half years back. in the period prior to this illness he was taking mycophenolate mofetil (500 mg thrice daily) and cyclosporine a (125 mg twice daily) towards preventing an organ rejection. at the time of admission he was highly febrile, disoriented and prostrate. routine hemogram revealed mild anemia (9.3 g / dl), leucopenia (4000/mm) and a high erythrocyte sedimentation rate of 71 mm at one hour. a chest x - ray showed ill - defined haziness in the right upper and midzones. a high - resolution chest tomogram (hrct) scan performed the following day, revealed patchy scattered areas of consolidation and ground glass appearance in both lung fields. the radiological findings suggested a differential diagnosis of tuberculosis, pneumocystis cariini pneumonia or a viral pneumonitis. the results of investigations for cytomegalovirus infection (igg, igm), malaria (peripheral smear) and typhoid (widal test) were negative. an erythematous maculopapular rash was detected in his lower extremities, which was sent for biopsy. there were yellow - white choroidal lesions measuring 1/3 to 1/4 disc diameter in the posterior pole of either eye (two in the right and one in the left) consistent with choroidal tubercles. his condition rapidly deteriorated despite antitubercular therapy (isoniazid 300 mg / day, ethambutol 800 mg / day, pyrazinamide 1gm / day and rifampicin 600 mg / day) and he died on the seventh day post admission. a histopathological examination of the skin biopsy revealed a large number of acid - fast bacilli consistent with mycobacterium tuberculosis within the tissue. chronic renal failure produces a state of immunosuppression due to uremia - induced changes in leukocyte function that reduce both acute and delayed inflammatory responses. patients on hemodialysis have disturbed leukocyte function due to the effects of the many bioincompatible dialysis membranes. the passage of blood through these membranes causes an inappropriate activation of complement and cytokine cascades with consequent defective immune responses.3 the use of potent immunosuppressives (such as mycophenolate mofetil, cyclosporine a, azathioprine and glucocorticoids) in posttransplant groups adds to the immunosuppression. the absence of fever or suspicious symptoms (" silent " fashion) presents a diagnostic dilemma. anergy to the mantoux test is common (32 to 40%).4,5 sputum microscopy and culture have low positive yields (11.1% cultures and 33.3% following polymerase chain reaction6). additional invasive tests including bronchoalveolar lavage and analysis of pleural aspirate, gastric or peritoneal fluids and bone marrow specimens are often necessary. performed an invasive diagnostic procedure in 13 of 14 patients with posttransplant tuberculosis.7 apart from the cost and the surgical risk of these procedures, specimen analysis is often time - consuming. lui. noted a mean time from the onset of symptoms to a specific diagnosis (culture - based) of 27 12 days.8 the delay in diagnosis may have therapeutic implications. patients with greater than five days of delay in identification of the cause of the pulmonary infiltrates had a three - fold greater risk of death than controls.9 several groups10,11 have suggested the use of composite indices consisting of lymphocyte subsets, t - cell proliferative responses in response to mitogens, neutrophil phagocytic capacity and reactive oxygen species (ros) generation that denote the degree of immunosuppression and consequent risk of infection. the use of these indices remains an area of future study. in a medline search we could identify only a single previous report12 suggesting the rarity of fundus examination rather than a low prevalence. both patients had pyrexia following an earlier allograft (18 and 36 months respectively) with an ambiguous radiological and clinical picture. the detection of tubercles via the simple, noninvasive technique of fundoscopy confirmed diagnosis of systemic tuberculosis. the mantoux test was deferred in our patients due to severe underlying illness and the likelihood of pharmacological immunosuppression with consequent negative readings. in case 2, | chronic renal failure is a common sequel of renal inflammatory disease or diabetes mellitus. as a result of the immunosuppression that is induced by uremia, hemodialysis or posttransplant immunosuppressive medication, these patients are at a higher risk of opportunistic infections. various viral, bacterial and mycobacterial infections have been reported. tuberculosis is a common systemic opportunistic infection but reports of ocular involvement with pulmonary or disseminated tuberculosis are rare. we report the systemic and ocular findings in two postrenal - transplant patients with pulmonary or disseminated tuberculosis in whom detection of choroidal tubercles led to confirmation of the diagnosis in both patients and was the only specific premortem finding in one. fundoscopy in this group of patients may help in the diagnosis of opportunistic tuberculosis, its earlier treatment and the consequent reduction of morbidity and mortality. |
developmental dysplasia of the hip (ddh) is a dynamic disease which can present in different forms at different ages and evolves over time, potentially capable of getting better or worse as the child develops.1 the disease can be managed and can be less harmful if diagnosed and treated early. diagnosis, however, has often presented with problems.2 late diagnosis results in complex treatment modalities with higher rates of failures and complications. it may lead to disabling osteoarthritis in adulthood.3 physical examination helps to diagnose hip pathology, but may not always be sufficient, because of different interpretations of the examiners. plane roentgenograms do not show the hip adequately in the first three months of life.4 ultrasonography shows the cartilaginous and soft tissue anatomy of the hip. it is an effective and noninvasive method without radiation.4 even from the same images, different results can be obtained due to different landmark indications depending on the observer. in this study, we aimed to measure the reliability of ultrasonographic measurements between different observers and assess the correlation between the ultrasonographically measured alpha angle and the radiologically measured acetabular index, which both show the bony acetabular depth. between january 2008 and july 2008, selective ultrasonography was performed in 50 children, younger than 6 months of age, who were suspected to be at risk for ddh. patients having an acceptable ultrasonographic image, containing a standard measurement plane to carry out a reproducible measurement (n = 33), were included in the study group and were numbered randomly by an orthopedic surgeon (c.c) who was specialized in pediatric hip ultrasonography. seven observers participated in the study, including five senior residents and two assistant professors in orthopedics and traumatology. four of the observers (two assistant professors and two senior residents) had attended a hip ultrasonography course given by dr. the hip ultrasonography images were taken in the outpatient clinic by the graf method with the help of a 7.5-mhz, 80-mm linear transducer (hitachi eub-405, hitachi medical co., japan). each blinded observer did not know how these ultrasonograms had been interpreted by the other observers. seven different observers measured the alpha angles on these ultrasonographic images in 66 hips of 33 patients. according to graf 's technique, the ultrasound picture is taken laterally in a coronal plane and the coronal plane should pass through the center of the hip joint. the center of the hip joint is marked by the lower limb of the os ilium in the acetabulum. if the picture is taken in the correct plane, not directed dorsally or ventrally, some reference points must be identified such as the deepest point of the acetabulum, the lower iliac margin at the triradiate cartilage, the labrum, and the chondroosseous border of the proximal femur. to classify different hip types, graf has introduced an angle for the bony acetabular roof or (alpha) angle and another for the cartilaginous acetabular roof or (beta) angle.5 to measure the alpha and beta angle, a coronal image of the hip is obtained, and three lines are constructed : a vertical line drawn parallel to the ossified lateral wall of the ilium (base line) ; a line drawn along the roof of the cartilaginous acetabulum, from the lateral osseous edge of the acetabulum to the center of the labrum (cartilaginous roof line) ; and a line drawn from the inferior edge of the osseous acetabulum (the inferior iliac margin) at the roof of the triradiate cartilage to the most lateral point on the ilium (the superior osseous rim) (bony roof line). the alpha angle is formed by the intersection of the baseline and the bony roof line. the alpha angle reflects the osseous coverage of the femoral head by the acetabulum ; the smaller the angle, the greater the degree of dislocation. the beta angle is formed by the intersection of the baseline and the cartilaginous roof line.67 the ultrasonographic parameters were measured as described above. in our daily practice, we use ultrasonography in the follow - up and during treatment of ddh. we use roentgenograms after the fourth month of life in the hip dysplasia suspected patients. the other part of our study was to assess the correlation between the ultrasonographic alpha angle and the roentgenographic acetabular index. acetabular index in degrees was measured in 30 hips of 15 patients on anterior - posterior (ap) roentgenograms of the pelvis by these seven observers. these roentgenograms were taken in other clinics, and because of suspected hip dysplasia, the patients were referred to our clinic. criteria for acceptable plane roentgenograms were as follows ; radiograph taken from one meter distance, good quality radiograph having a standard measurement plane (giving the opportunity to make measurements) and an appropriate radiation dose. in 11 patients, the plane roentgenograms and the ultrasonographic images were taken on the same day. in four of them, various lines may be drawn on a pelvic radiograph to evaluate acetabular maturity and femoral head position. hilgenreiner 's line is a horizontal line connecting the superior margins of the triradiate cartilages of both hips. the acetabular index is the angle between hilgenreiner 's line and a line drawn from the most superolateral margin of the ossified acetabulum to the superolateral margin of the triradiate cartilage. in the neonate, this angle is normally less than 30 degrees and by 2 years of age, the angle is normally less than 20 degrees.8 ddh is associated with an increased angle.9 all the observers measured the acetabular index from the pelvis ap roentgenogram of the patient without leaving any informative landmark for the other observers and saved the measurements according to the patient number. all the observers measured acetabular index with the same technique and same landmarks. the correlations between the measurements of the ultrasonographic and roentgenographic images were calculated. measurements were analyzed statistically using a computer program (medcalc for windows 11.1, broekstraat 52b-9030 mariakerke, belgium). the single measure interclass correlation coefficient (and 95% confidence intervals) by choosing two - way random model and absolute agreement type (method 1) was used to evaluate interobserver reliability. according to this system, a value less than 0 indicates bad agreement, a value of 0 to 0.20 indicates slight agreement ; 0.21 to 0.40, fair agreement ; 0.41 to 0.60, moderate agreement ; 0.61 to 0.80, substantial agreement ; and 0.81 to 1.0 indicates excellent agreement. if the measurement is minus, it shows the negative correlation between the measurements.2 correlation between acetabular index and alpha angle was analyzed by calculation of the pearson correlation coefficient. the mean age of the patients was 2.19 months (range, 0.23 [7 days ] to 6 months). nineteen of the patients (57.6 %) were females and 14 (42.4%) were males. twenty - eight (84.8%) of the patients had no family history about ddh and five (15.2%) had ddh in the family. twenty - one (63.6%) of the infants were born with caesarian section and 12 (36.4%) were born with the normal vaginal delivery. thirty - one (93.9%) of the infants had no abnormality during delivery and two (6.1%) had abnormalities (1 oligohydramnios, 1 meningomyelocele). twenty - four infants (72.7%) were the first child, six (18.2%) were second, two (6.1%) were third, and one (3%) was the fourth child. twenty - seven (81.8%) of the patients had no other congenital pathologies and six (18.2%) had pathologies (4 pes equinovarus deformity, 1 meningomyelocele, 1 hyperbilirubinemia). on physical examination one of the patients had minimal limited abduction and 12 (36.4%) had skin fold asymmetry. patients suspected to be at risk of having ddh i.e. those with normal physical examination but with a positive family history of ddh or first born girl child were also included in the study. (a) some observers (4 of 7) signed the lower limb of the os ilium correctly. (b) some observers (3 of 7) measured the ligament with the fovea centralis instead of the lower limb incorrectly there was a moderate agreement between the observers for the right beta values, and there was a substantial agreement between the observers for the other measurements [table 1 ]. interclass correlation coefficient (and 95% confidence intervals) for evaluation of interobserver reliability the mean acetabular index was 23.7 for the right hips and 24.7 for the left hips. the pearson correlation coefficient between the alpha angle and the acetabular index of the right and left hips are shown in table 2. pearson correlation coefficient and statistical p values between the alpha values and acetabular index degrees as an example, for the second observer, left acetabular alpha and left acetabular index pearson correlation coefficient is -0.732 and p=0.002, which shows the reverse, medium powered, statistically meaningful relation. in the screening of infants for ddh, hip ultrasonography is a frequently used method. plain roentgenograms can give inaccurate measurements of the hip joint in the first three months of life.10 after ossification of the femoral epiphysis, roentgenographic techniques can be helpful in the detection of hip dysplasia. determining the reliability of ultrasonographic measurements between different observers and evaluating the correlation of the ultrasonographic measurements with roentgenographic views was the scope of this study. having basic knowledge and making a careful examination and classification are the key points to make reliable measurements using graf 's method.2 omeroglu. stated that it is usually easy to obtain a sonogram that has a standard measurement plane, but it is not always easy to assess the sonogram correctly.2 bar - on.11 indicated that the technique of ultrasonographic examination and the interpretation of the image and the availability of a history and physical examination might influence the results. the variability in measurement is not an important factor and standardization is easier to be established, when ultrasonography is performed properly.7 the observer making the diagnosis plays an important role, because ultrasound screening is only reliable if the examiners are experienced.12 different results can be obtained from the same ultrasonographic image due to different alpha values depending on the observer. there were differences in identifying the landmarks for ultrasonographic measurements in our study group. in a study reported by boal and schwenkter, findings of 212 sonograms of infant hips were correlated with those of radiographies, orthopedic examination, or both. there were no false - negative or false - positive results among infants with congenital hip dysplasia.13 discrepancies between the ultrasound appearance of the bony acetabulum and the radiographic appearance indicate that there is not always an exact correlation. this may result from observer variation, tilting effect of a plane roentgenogram, and the nature of the ultrasound measurements.14 radiographs are very dependent on proper positioning and do not show the cartilaginous components of the acetabulum and femoral head. also, radiographs are not capable of assessing femoral head stability as they offer only a static two - dimensional image.9 roposh. stated that ultrasonography scans correlated well with radiographic results in dislocated and in normal hips.15 in another study by terjesen., normal and dislocated hips correlated well on ultrasonography and radiography, but dysplastic hips did not. concluded that ultrasonography was reliable in detecting hip pathology.16 morin.,17 in a study of 171 infants, used ultrasonography to calculate a parameter which they called femoral head coverage, and compared it with the acetabular index obtained through ap roentgenogram of the pelvis in the same patients. they found a correlation between the femoral head coverage and the acetabular index. in our study, we think that the major reason that made the difference between the observers was to find the correct landmarks for measuring the angles on an ultrasonographic image. we see two problems : the observers had problems to identify the anatomical structures [figure 1 ], or they did not handle the correct definitions, e.g., the bony rim [figure 2 ]. two senior residents without certificate of graf 's method signed anatomical landmarks, especially iliac bony rim, incorrectly, according to the other experienced doctors. these changes in signing the landmark points caused the difference in measuring the alpha and beta angles. although there was difference in measuring the angles between the observers, correlation coefficient was statistically high [figure 3 ]. although measurement techniques are different, there is a high correlation, if the measurement techniques were the same, then correlation coefficient would be probably higher. signing (a) some observers (3 of 7) signed the point where the concavity of the rim turns to convexity correctly. (b) some observers (4 of 7) signed the strict corner of the iliac bony rim incorrectly sample for the negative correlation between the acetabular index and alpha angle. ultrasonography, as a diagnostic tool for ddh, should be applied properly. the position of the patient, the position of the probe, and signing the landmarks for measuring the angles are important factors for a reliable result. although most of the hips in our study group were normal, this study focused on the measuring differences between the observers, in the diagnosis, and follow - up of patients suspected to be having ddh. we observed a high level of agreement in the measurement of the ultrasonographic data between different observers. statistical meaningfulness of these measurements is encouraging and shows us the reliability of the ultrasonographic measurements between different observers. in the assessment of the correlation between the ultrasonographic alpha values and acetabular index degrees, we observed a mismatch between the right and left side measurements. for the left hips, statistical values were meaningful, but for the right hips, correlation coefficients were statistically meaningless. this situation can be the result of observer variability or related with the plain roentgenography. we conclude that ultrasonographic measurements are reliable, but may not always be correlated with the roentgenograms between different observers. | background : ultrasonography is accepted as a useful imaging modality in the early detection of developmental dysplasia of the hip (ddh). early detection and early treatment of ddh prevents hip dislocation and related physical, social, economic, and psychological problems. the purpose of this study was to evaluate the reliability of ultrasonographic and roentgenographic measurements measured by seven different observers.materials and methods : the alpha angles of 66 hips in 33 patients were measured using the graf method by seven different observers. acetabular index degrees on plane roentgenograms were measured in order to assess the correlation between the ultrasonographic alpha angle and the radiographic acetabular index, which both show the bony acetabular depth, retrospectively.results:the interclass correlation coefficient, measuring the interobserver reliability, was high and statistically significant for the ultrasonographic measurements. there was a negative correlation between the alpha angle and the acetabular index.conclusions:ultrasonography, when applied properly, is a reliable technique between different observers, in the diagnosis and follow up of ddh. when assessed concomitantly with the roentgenographic measurements, the results are reliable and statistically meaningful. |
vilmann, a gastroenterologist and leader in the field of esophageal ultrasound (eus), who did some of the pioneering work on esophageal access of mediastinal structures for the diagnosis and staging of thoracic diseases, stated : but how can we proceed to implement eus - fna as a routine procedure in respiratory medicine ? now most groups performing eus - fna in the chest are still gastroenterologists, because the method was originally developed in this specialty 1. this quote is as relevant today as it was then ; it has subsequently been shown that pulmonologists can effectively use the esophagus alone or simultaneously with airway access using the endoscope originally designed for bronchoscopic ultrasound and that pulmonologists can be trained to use the endoscope used by gastroenterology 2 3 4 5 6 7, but eus for the diagnosis of mediastinal disease is not widely performed by pulmonologists and is, in fact, discouraged by some of them 8. there have been few studies of performance characteristics of eus vs. ebus. in our practice, we perform both ebus and eus and the approach chosen is based upon patient anatomy. we performed a retrospective review of our database specifically to contrast ebus with eus and to investigate relationships between route of access and other procedural parameters. after institutional review board approval, all ultrasound - guided endoscopies performed by interventional pulmonary at a single institution from august 1, 2012 until april 30, 2013 were retrospectively reviewed. to allow head - to - head comparison of eus and ebus procedures, patients requiring sedation for additional procedures such as regular bronchoscopy or chest tube insertion were excluded. all procedures were performed by one or both of the authors, both of whom are pulmonologists. at our institution, the endoscope that was originally designed for ebus (bf - uc180f, olympus medical supply corporation, melville, new york, united states) was used for both ebus and eus ; however, if indicated, crossover from one route of access to the other was readily possible. (we limited our use of both techniques to the diagnosis of thoracic disease ; endosonography for primary gastrointestinal processes was performed by gastroenterology.) all sampling was performed with the 21-gauge needle made by olympus for the bf - uc180f endoscope. the number of punctures was determined by on - site adequacy evaluation and by the level of suspiction for malignant involvment, and if so, the suspect lesions were sampled up to ten times. however rapid on - site cytologic evaluation (rose) was available for all procedures. the following parameters were selected for comparison : type of procedure (eus, ebus, eus + ebus), sedation dosing, number of sites biopsied, specific sites biopsied, yield, procedure time, maximal oxygen flow during the procedure, time on oxygen post - procedure, and total time from procedure termination (scope out) until discharge. student s t - tests were used to determine significance with p < 0.05 considered significant. one hundred and sixty - five ultrasound - guided needle aspiration biopsy procedures were performed over the study interval. for three of these procedures, propofol was used for sedation, making it impossible to do comparative analysis. for seven procedures, these ten procedures were eliminated from the analysis, leaving 155 patient procedures for review. there were 61 patients who underwent eus alone, 73 patients who underwent ebus alone, and 21 patients who underwent combined procedures. age distribution, drug doses administered, procedure times, oxygen flow rates, and recovery times are presented in table 1. one hundred and fifty of the procedures were performed for both diagnosis and staging of lung cancer. the remaining five procedures were performed to evaluate for possible mediastinal metastases of cancers previously diagnosed. these procedures were performed on four patients diagnosed with adenocarcinoma of the lung previously diagnosed using ct - guided biopsy and one patient diagnosed with adenocarcinoma of the breast. the midazolam dosing for eus alone was lower than for ebus alone (p < 0.0002) and for the combined procedure (p < 0.001). there was no significant midazolam dosing difference between the ebus and eus + ebus groups. the same pattern was found for fentanyl dosing ; fentanyl dosing for eus alone was lower than for ebus alone (p < 0.0001) and for the combined procedure (p < 0.002), although there was no significant fentanyl dosing difference between the ebus and eus + ebus groups. mean number of sites sampled varied significantly between groups and for eus vs. the other two groups (p < 0.0001). the mean procedure time for eus was approximately one - half the mean procedure time required for ebus (p < 0.0001). time to discharge was shortest for patients who underwent eus (p < 0.0002). whereas the significant differences in characteristics could have been related to the fact that fewer sites were sampled with eus, we compared all procedures that involved sampling of two or fewer sites with each approach (none of the combined approach procedures involved sampling of fewer than two sites). there were 56 such eus procedures and 52 such ebus procedures, with a mean of 1.4 0.6 sites for eus and 1.6 0.6 for ebus (ns, p = 0.18). all data apart from maximal oxygen flow rates were significantly different when the results from these two groups were compared (p < 0.001). time to discharge remained shorter for the eus group (p = 0.001). patients in which both eus and ebus were performed (n = 21) were reviewed. in twelve of these patients the sequence was eus followed by ebus, and in the remaining nine patients it was ebus followed by eus. the most common reason for a combined procedure (n = 13, 62 %) was lack of diagnosis from the first approach based upon rose ; negative findings from one approach led to accessing other sites, or (particularly with station 7) other areas of a nodal station to be certain that a significant pathologic process had not been missed. in six of the 21 patients (28 %) the change in approach led to a positive diagnosis that was originally missed using the first approach (2/12 eus ebus, 4/9 ebus eus). in one patient, initial on - site eus cytology was negative, however, a slide obtained by eus before ebus but processed after the change to ebus was found to be positive for malignancy. in one patient, we switched from ebus to eus to obtain additional (station 7) material for flow cytometry because of patient discomfort with the endoscope in the airways. sites accessed are listed in table 3. as expected, the most frequently biopsied area was station 7, which was followed by 4 r, 4 l, and 11 r. 4 r was occasionally accessible via the esophagus. a mass / structure other than a node was accessed 13 % of the time (36/282 needle aspiration biopsies). mean nodal sizes are also listed in table 3 although nodal size did not impact the capacity to sample it. an exception to this generalization is in 4 r from the esophagus ; it is not generally accessible from the esophagus, but in some instances it was so enlarged that esophageal access was possible. the mean number of passes was 3.42 (minimum of 3 and maximum of 10). seventy eus procedures were performed (61 as the initial procedure, nine as crossover studies). there were two false negatives, which were documented by crossover to ebus. in one patient, station 7 was negative from the esophagus and positive from the airway, and in a second patient, station 7 was not visualized from the esophagus, but was observed and was positive from the airway. eus was diagnostic in the remaining 97 % of patients : pathologic diagnoses among 73 % and no pathology found among 23 % of patients (sensitivity, 0.96 ; 95 % ci 0.86 0.99 ; specificity, 1 ; 95 % ci 0.76 1). negatives were shown to be negative for pathology by stability or regression over a two - year follow - up or, occasionally, by surgical resection. four false negative results were documented by crossover to eus, which yielded three station 7 nodes and one 4 l node. ebus was diagnostic in the remaining 81 procedures examined, with 74 % pathologic and 20 % benign diagnoses (sensitivity, 0.92 ; 95 % ci 0.84 0.98 ; specificity, 1 ; 95 % ci 0.74 1). once again, a benign designation was substantiated by two - year follow - up and occasionally by surgery. if the crossover studies were examined as a separate subset, diagnostic accuracy was 100 % (74 % pathologic, 26 % benign, confirmed with two - year follow - up or with surgical resection). two patients experienced severe post - procedural hypoxia (one ebus and one ebus + eus). one patient had mediastinal bleeding related to the procedure (ebus + eus). the primary objective of this study was to analyze differences in procedure characteristics related to differences in approach, but the data were also analyzed with respect to whether or not a specific diagnosis was achieved. achieving a specific diagnosis did have a significant impact upon study characteristics ; for all procedures combined, studies for which a diagnosis was achieved involved sampling of 1.8 0.8 stations over 19.3 9.7 min, whereas studies without specific diagnoses involved sampling of 2.4 0.8 stations over 27.3 7.1 min (p = 0.007 and p = 0.017, respectively). endoscopic ultrasound has revolutionized the diagnosis of mediastinal abnormalities and the nodal staging of lung cancer. the first ultrasound endoscope to be developed was for the gastrointestinal tract 9. eus was initially used for the diagnostic evaluation of diseases of the gastrointestinal tract, but its application to lung cancer diagnosis and staging was rapidly conceptualized and brought to fruition 10. the first clinical use of the smaller - diameter convex curvilinear ultrasound bronchoscope (ebus scope) was reported in 2004 11, and ebus as a diagnostic tool has been widely adopted by the pulmonary community. it was subsequently shown both that the ebus scope can be used for eus and that pulmonologists can be trained to use the gastrointestinal endosonoscope 2 3 4 5 7. eus with the ebus endoscope has not, however, been widely adopted by the pulmonary community, and prominent pulmonologists have questioned the true value of adding eus to ebus and stated that ebus is the initial procedure of choice : we agree that ebus - tena (their term for eus - fna with ebus scope) should be used only in circumstances when lymph node stations are difficult or are not accessible by tbna. 8 their bottom line was that eus using either endoscope might be better tolerated but was rarely indicated for the diagnosis of thoracic disease. kang investigated the value of ebus vs. eus in the diagnosis of potentially resectable lung cancers 12. they found that if they did eus first, adding ebus contributed significantly to diagnostic yield, but if they did ebus first there was not a significant increase, leading to the conclusion that there is no complementary role for eus. kang. were unable to comment on parameters such as sedation differences between ebus and eus given the mandated crossover. they concluded that ebus is the appropriate initial approach, and the lack of complementary data from eus would lead to the conclusion that ebus is the only approach that should be used. eus - fna is generally well tolerated, and procedure tolerance may affect the selection procedure. in a second prospective study, oki randomized all candidates for endosonography with lesions accessible from both airway and esophagus and performed either ebus - tbna alone or eus - fna alone while monitoring performance characteristics 13. with both study groups sedated to the extent that there was equal patient procedure tolerance, diagnostic eus - fna was associated with lower doses of lidocaine (p < 0.001) and sedatives (p = 0.02), shorter procedure times (p < 0.001), and fewer oxygen desaturations (p < 0.001). also noted was that endoscopists preferred the esophageal approach (p < 0.001). our study has the disadvantage of not being prospective / randomized and the advantage of reflecting the application of both approaches to routine clinical practice. in our laboratory, we use the same scope for both ebus and eus ; there is no gradient of experience that leads us to choose one route over the other. it has been recurrently suggested in the literature that eus is better tolerated than ebus 3 8 12 14 15 16. our data combined with those of oki provide objective confirmation for this impression. when eus alone sufficed to achieve our clinical goals, we were able to do so with statistically significant economies of sedation, oxygen requirements, and recovery time. this was true when we looked at all diagnostic studies regardless of required sampling and remained true when we limited analysis to sampling of an equivalent number of nodes. when a crossover study was performed, total procedure time, sedation, oxygen requirements, and recovery for the combined study were significantly higher than for eus alone but not significantly different from those for ebus alone ; there was no negative impact upon these parameters from having started with eus. in our study with no mandated crossover in so doing, we did more ebus than eus, reflecting the fact that more nodes were accessible via ebus than via eus. the numbers were not, however, dramatically different ; 71 patients were diagnosed by ebus alone and 61 by eus alone. the major differences in sedation for the two routes occurred 1) at the time of insertion across the vocal cords and, subsequently, 2) when cough or discomfort made us wait for additional medication (systemic or endobronchial) to take effect, or 3) when patient desaturation made us pause. however, nodes are not more difficult to see or to reach from the airway vs. the esophagus, and identification of any specific node takes a matter of seconds. in a calm patient, one can reach 4 r from the airway just as fast as 8 r from the esophagus. crossover to from eus to ebus (or vice versa) is always an option in our lab, and in our study ebus was just as likely as eus to require a crossover procedure. the most important finding from the crossover data are that the two approaches were complementary ; in patients not diagnosed by the initial approach, crossover led to a diagnosis 28 % of the time. as noted, kang. did not find eus and ebus to be complementary, 12 but there is a significant body of literature that, like our data, suggests that they are 4 5 17 18 19. this study examined needle aspiration of solid tissue structures with eus and ebus, and we alternated between the two approaches in some patients in both procedure ; the dirtiest structure involved in these procedures is the mouth, and both ebus and eus involve passing the endoscope through this bacteria - laden environment. we consider this to be the dominant etiology of risk and have felt that entry into the esophagus before the trachea does not increase that risk. notably, aspiration of cystic structures has been associated with a higher risk 21 ; we did encounter one of these situations. based upon our understanding, we have routinely performed ebus and eus - fna interchangeably, with the first procedure performed to a) maximize yield (diagnosis, staging if relevant) and b) minimize risk and discomfort. we have performed over 1000 combined procedures, and we have yet to see an infectious complication. in summary, villman s vision of eus becoming a routine pulmonary procedure has not been realized ; only a small fraction of the pulmonary community has incorporated eus, some using the ebus endoscope and an even smaller minority using the gastrointestinal endoscope. the data of kang would lead to the conclusion that that ebus alone is all that is required for evaluation of diseases involving the mediastinum 12. the data of oki coupled with our data leads to different conclusions 22. the impression that eus is better tolerated is now supported by data demonstrating efficiencies of sedation, time, and oxygenation with eus vs. ebus. this study demonstrates advantages of eus, regardless of whether the operator is a pulmonologist or a gastroenterologist. the advantages of pulmonary alone performing both with the same endoscope include economies of time, sedation, and equipment and a seamless transition between modalities. in an institution with separate physicians performing ebus and eus, we would suggest careful pre - review of the radiologic data and a collaborative procedure if both routes of access are likely to yield important data. based upon our data, we conclude that if eus might adequately establish a diagnosis (and, if relevant, a stage), then eus should be the first procedure. integration of the two procedures can be achieved either via cross - training by pulmonologists or by collaborative procedures including both pulmonology and gastroenterology. | background and study aims : one can approach mediastinal pathology via esophageal ultrasound (eus) and/or endobronchial ultrasound (ebus). it has been suggested that eus is better tolerated by patients. if so, eus might be the procedure of choice when suspect lesions are accessible via eus. we studied procedural characteristics of eus with fine needle aspiration (eus - fna) and ebus with transbronchial needle aspiration (ebus - tbna) to see how they differed. patients and methods : retrospective review of consecutive ebus and eus procedures performed on patients over nine months. one hundred fifty - five procedures were analyzed (61 eus, 73 ebus, 21 eus + ebus). for eus, ebus, and eus + ebus, 1.4, 2.0 and 2.5 sites (mean) were sampled, respectively. eus required approximately one - half of the time of ebus or the combined procedures ; 13.1 vs. 24.1 and 26.9 min, respectively (p < 0.0001 for eus vs. both ebus and eus + ebus). sedation dosing was statistically lower for eus and not significantly different between ebus and the combined approach. eus also involved lower oxygen requirements and shorter time to discharge. because fewer mean sites were sampled with eus than with ebus or the combined procedure, we performed analysis restricted to procedures that involved sampling of 2 sites to determine whether approach - related differences in procedure characteristics were preserved. there were 56 such eus procedures and 52 such ebus procedures. eus remained significantly faster and required less patient sedation. conclusions : eus involved statistically significant economies of time and sedation. this has implications with respect to safety and productivity. when applicable, eus is the procedure of choice. |
disability evaluation typically requires an assessment of the activities of daily life (adl) and instrumental adl (i - adl). in japan, a physical disability certificate is based on the patient 's adl and i - adl grades. the independent adl scale, which is widely considered within the field of rehabilitation medicine to be a particularly important component in the evaluation (1, 2), considers both individual and universal factors (fig. assessment is performed by analyzing the results of test activities relating the patient 's personal life. for example, adult independence refers to a person who does not require external care in daily life, whereas child independence includes care within the family and school life. such personal factors have been nurtured through development in the community and belong to the community 's values and customs. the universal factors, on the other hand, are measured against the common rule of humanbeings. furthermore, disability evaluation should also include assessment for the supporting system in the community - based rehabilitation (cbr) and other problems. these other problems, which relate to objective signs, the timing of evaluation and multiple impairments, are still under fierce debate., japan officially recognizes three forms of the identification booklet for the disabled, one for physical disability, one for mental disability, and another for psychological disability. during the course of this investigation, several reports issued by the ministry of health, labor and welfare of japan, including the outline of the systems and basic statistics in annual reports on health and welfare 1998 - 1999 social security and national life from white paper and reports were reviewed (3). data concerning the annual change in the number of people with physical disabilities by type and age per 1,000 people were used to analyze total disability evaluation, while the annual change in the number of children with physical disabilities by type and age was used to analyze child disability evaluation. the number of people with physical and mental disabilities was used to determine the relationship between welfare facilities and the home in the community. finally, several data related to the elderly were used to anticipate bigger problems in future. the results of this study, as provided in detail in the appendices to this report, are summarized as follows. recent trends in the last 10 yr suggest a sharp rise in physical disabilities and internal disorders among the elderly (table 1, 2). data on children by type (table 3) and age (table 4) shows an increase in the rate of internal disorders and young children with physical disabilities. data on the overall number of people with disabilities (table 5) reveals that 28.5% of patients in health care facilities have mental retardation, whereas only 5% have physical disabilities. data suggesting bigger future problems for the elderly are also presented in fig. 2 and table 6 and 7. in japan, disability is categorized under three identification booklets : 1) physical disability, which is classified by four subgroups, 2) mental disability, and 3) psychological disability. the classification of the physically disabled subgroups (table 1 - 4) was very useful for determining the problems for government policy on welfare and public health. the increasing rate of internal disorders within the physically disabled has become a major theme for following global welfare services in the future. a multi - system for evaluating disabilities has resulted in many welfare services, depending on the various kinds of disabilities. however, the achievements of the welfare system, based on different types of disabilities, have led to a complex or confused service system. the system has also been affected yearly by the changing social community around persons with disabilities. accordingly, the increasing ratio of the elderly population has prompted the development of a new disability evaluation related to practical adl. to cite another example, mental disability has been evaluated from infancy because of a lack of social response. as such, most people with mental disability usually tend to receive the identification booklet up to the age of 18 yr. however, table 5 shows that, in japan, adults with mental disability tend to be less adaptive to the community than those with physical disability. therefore, the ministry of health, labor and welfare of japanese government has started to rearrange many welfare services to be more suitable to a small community around persons with disabilities. moreover, the concept of preventing disabilities is emphasized not only in rehabilitation medicine, but also in cbr, indicating that disability evaluation needs another factor of support system based on their community. thus, it is important to think about the disability evaluation according to the characteristics of age, impairment and assistive environment. in the field of cbr, disability evaluation has recently become important for measuring the effects of rehabilitation treatment in medical insurance and decision of the grade of welfare service volume in japan. while the first and second groups have been historically well - established without any disagreement on the classifications of disability type, the third group concerning psychological disability has recently been questioned with respect to the visibly less apparent disabilities relating to cognition, memory, attention, emotion, and social behavior after traumatic head injury. although the new system to evaluate and support such a disability group is under development throughout the country, problems with classification continue to be debated. | to examine the current state and social ramifications of disability evaluation in japan, public data from annual reports on health and welfare 1998 - 1999 were investigated. all data were analyzed based on the classification of disabilities and the effects of age - appropriate welfare services, which have been developed through a half - century of legislative efforts to support disability evaluation. these data suggest that disability evaluation, while essentially affected by age and impairment factors at a minimum, was impacted more by the assistive environment for disabilities. the assistive environment was found to be closely linked with the welfare support system related to a global assessment in the field of community - based rehabilitation. |
to provide guidance for medical geneticists and other physicians regarding genetic evaluation of pathologic short stature. the purpose of genetic evaluation of short stature is to provide an accurate diagnosis and to provide information to the patient and family regarding natural history, prognosis, available treatment, genetic basis, and recurrence risk. potential diagnoses include familial short stature, constitutional delay of growth, occult pulmonary, renal or gastrointestinal disease, endocrinopathies, and genetic disorders. these categories are not mutually exclusive, and the molecular basis of many causes of short stature has already been, and continues to be, elucidated. depending on the availability of the various subspecialists in the geographic area and the presence or absence of associated physical or developmental concerns, the medical geneticist may be one of the first to evaluate an individual with a primary indication of short stature or may be asked to provide consultation regarding genetic testing once a diagnosis is made by other physicians. if the medical geneticist is the primary consultant in the evaluation of an individual with short stature, then he or she must be familiar with the common nonpathologic conditions associated with short stature in addition to the teratogenic and genetic causes. one study reported 353 patients referred for genetic evaluation with the primary indication of short stature (defined as height 3 standard deviations) if no other diagnosis is apparent. review of the clinical, developmental, and family histories and a detailed physical examination are required to document the presence of major and/or minor malformations, degree of developmental delay if present, and other features that would suggest an underlying chromosome abnormality or recognizable syndrome. if physical examination reveals disproportionate short stature, a skeletal survey (table 2) is recommended to look for evidence of a skeletal dysplasia. molecular genetic testing is available for confirmation of some of these conditions (table 3). in some of the more mild skeletal dysplasias, a skeletal survey performed in the first years of life may not be diagnostic, and periodic clinical and radiographic reevaluation is necessary. in other disorders, e.g., chondrodysplasia punctata if physical examination reveals proportionate short stature, a detailed physical examination may reveal signs that are consistent with a recognizable genetic syndrome. molecular genetic testing is available for confirmation of some of these conditions (table 4). if physical examination does not suggest a recognizable syndrome, then chromosome analysis should be performed, which has the added advantage of addressing the potential of mosaicism. if this analysis is negative, genomic array studies may be considered to evaluate for changes in genome copy number. for the children with intrauterine onset of short stature, comparison should be made of the infant s birth weight, birth length and birth head circumference, body proportions, and documentation of major and minor anomalies. depending on the age at which the sga infant is being evaluated, assessment of the postnatal growth pattern will also yield clues to the underlying etiology. selected syndromes associated with iugr for which the genetic basis is known are presented in table 5. testing useful in the evaluation of infant with prenatal onset growth deficiency is presented in table 6. if no diagnosis is apparent after initial clinical evaluation and appropriate laboratory or radiographic studies, periodic reassessment is indicated. the timing of reassessment will depend on the child s age, whether or not there are other significant developmental or physical features present, the family s interest or anxiety, and changes in the family history. a specific diagnosis may become apparent or the differential diagnoses altered with evolution of the phenotype and additional family history that may become available. furthermore, new diagnostic tests and techniques may allow diagnosis or confirmation of a clinical diagnosis in the future. | short stature is a common indication for genetic evaluation. the differential diagnosis is broad and includes both pathologic causes of short stature and nonpathologic causes. the purpose of genetic evaluation for short stature is to provide accurate diagnosis for medical management and to provide prognosis and recurrence risk counseling for the patient and family. there is no evidence - based data to guide the geneticist in an efficient, cost - effective approach to the evaluation of a patient with short stature. this guideline provides a rubric for the evaluation of short stature evaluation and summarizes common diagnoses and clinical testing available. |
ordered self - assembly of nanoscale building blocks, such as nanoparticles, nanorods, nanoribbons, and so forth, into complex architectures has recently become a hot topic in material research fields. remarkable progress has been made in the self - assembly of highly organized building blocks of metals [1 - 4 ], semiconductors [5 - 8 ], copolymers, and organic inorganic hybrid materials based on different driving mechanisms, such as ostwald ripening, kirkendall effect, and self - assembly of nanoscale blocks through hydrophobic interactions. however, controlled organization into curved hollow structures from the primary building units, for example sheets, remains a challenge for materials self - assembly. the ability to assemble primary units into hollow structures is in great demand not only because of their role in better understanding the concept of self - assembly with artificial building blocks but also due to its great potential for technological applications. nickel hydroxide (ni(oh)2), as one of the most important transition metal hydroxides, has received increasing attention due to its extensive applications, especially as a positive electrode active material, in alkaline rechargeable ni - based batteries. it has been reported that the capacity of the positive electrode could be significantly increased when nanophase ni(oh)2 was added to micrometer - size spherical ni(oh)2. further efforts have focused on searching for new synthetic methods of ni(oh)2 nanocrystals with high quality and various exciting morphologies. 1d, 2d, and 3d nanostructures of ni(oh)2, including nanorods, nanoribbons, nanotubes, nanosheets, and superstructures patterns [23 - 28 ], have been fabricated successfully by a variety of methods. nickel oxide (nio) is a very prosperous inorganic material which was widely applied in the fields of smart window, electrochemical supercapacitor, battery cathodes, catalyst, etc., there are only limited reports concerning the synthesis of ni(oh)2 and nio hollow architectures and their interesting properties. for example, wang s group synthesized hollow architectures of ni(oh)2 with unusual form and hierarchical structures by using styrene - acrylic acid copolymer (psa) latex particles as the templates. hierarchically porous -ni(oh)2 microspheres constructed with nanoflakes were recently prepared with the help of hexamethylenetetramine (hmta) as the basic source, exhibiting small blue shift compared with the bulk counterpart. reported the fabrication of hierarchical ni(oh)2 monolayer hollow - sphere arrays with a fine structure of nanoflakelets by an electrochemical strategy based on a polystyrene (ps) sphere colloidal monolayer. such hierarchically structured hollow - sphere arrays have demonstrated a tunable optical transmission stop band in the visible - near - ir (vis nir) region from 455 to 1855 nm, depending on the hollow - sphere size and the fine structure. however, hollow structures prepared from hard templating routes (e.g. ps latex particles) usually suffer from disadvantages related to high cost and tedious synthetic procedures, which may prevent them from being used in large - scale applications. thus, it still remains a challenge to develop simple approaches to synthesize hierarchical ni(oh)2 and nio hollow architectures. herein we describe a facile hydrothermal route to synthesize highly ordered 3d flower - like hierarchical-ni(oh)2hollow architectures with a high yield. the morphology - retained nio hollow architectures with porous structure were readily obtained by thermal decomposition of the as - obtained-ni(oh)2products. finally, the optical property of nio sample was investigated with the help of uv vis spectrum. in a typical synthesis, 1 mmol of nicl26h2o was dissolved in 5 ml of deionized (di) water, followed by an addition of 15 ml of ethanol and 5 ml of co(nh2)2solution (2 mol l) under vigorous stirring. then, 2 ml of nh3h2o (35% by v / v) was added dropwise into the above solution to form a clear blue solution. the autoclave was sealed and heated in an oven at 120 c for 12 h and then allowed to cool to room temperature. the resulting pale green slurry was rinsed with di water several times to remove soluble impurities. the product was dried in an oven at 50 c for 8 h to get the sample of-ni(oh)2. to obtain nio the as - prepared sample of-ni(oh)2was calcined in air for 4 h. the phase purity of the products was examined by x - ray powder diffraction (xrd) using a rigaku d / max 2500 diffractometer at a voltage of 40 kv and a current of 200 ma with cu - k radiation (= 1.5406), employing a scanning rate 0.02/s in the 2ranging from 30 to 80. scanning electron microscopy (sem) images and energy dispersive x - ray (edx) analysis were obtained using a hitachi s-4300 microscope (japan). transmission electron microscope (tem) images and the corresponding selected area electron diffraction (saed) pattern were taken on a hitachi-600 transmission electron microscope at an accelerating voltage of 200 kv. high - resolution transmission electron microscope (hrtem) images were carried out for the as - prepared sample using jeol jem-2010 transmission electron microscope at an accelerating voltage of 200 kv. the size distribution of the sample was measured using a scale on the magnified sem micrographs. thermogravimetric (tga) and differential scanning calorimetric (dsc) analyses were carried out on a netzsch sta-409 pc thermal analyzer with a heating rate of 10 c minin flowing oxygen atmosphere. room - temperature uv vis absorption spectrum was recorded on a shimadzu uv-1601 pc uv vis recording spectrophotometer. in a typical synthesis, 1 mmol of nicl26h2o was dissolved in 5 ml of deionized (di) water, followed by an addition of 15 ml of ethanol and 5 ml of co(nh2)2solution (2 mol l) under vigorous stirring. then, 2 ml of nh3h2o (35% by v / v) was added dropwise into the above solution to form a clear blue solution. the autoclave was sealed and heated in an oven at 120 c for 12 h and then allowed to cool to room temperature. the resulting pale green slurry was rinsed with di water several times to remove soluble impurities. the product was dried in an oven at 50 c for 8 h to get the sample of-ni(oh)2. to obtain nio the phase purity of the products was examined by x - ray powder diffraction (xrd) using a rigaku d / max 2500 diffractometer at a voltage of 40 kv and a current of 200 ma with cu - k radiation (= 1.5406), employing a scanning rate 0.02/s in the 2ranging from 30 to 80. scanning electron microscopy (sem) images and energy dispersive x - ray (edx) analysis were obtained using a hitachi s-4300 microscope (japan). transmission electron microscope (tem) images and the corresponding selected area electron diffraction (saed) pattern were taken on a hitachi-600 transmission electron microscope at an accelerating voltage of 200 kv. high - resolution transmission electron microscope (hrtem) images were carried out for the as - prepared sample using jeol jem-2010 transmission electron microscope at an accelerating voltage of 200 kv. the size distribution of the sample was measured using a scale on the magnified sem micrographs. thermogravimetric (tga) and differential scanning calorimetric (dsc) analyses were carried out on a netzsch sta-409 pc thermal analyzer with a heating rate of 10 c minin flowing oxygen atmosphere. room - temperature uv vis absorption spectrum was recorded on a shimadzu uv-1601 pc uv vis recording spectrophotometer. the phase structure and purity of the as - synthesized samples were examined by powder xrd. 1that all of the diffraction peaks can be indexed to a pure hexagonal structure of-ni(oh)2(jcpds no : 14 - 0117). xrd pattern of the as - obtained-ni(oh)2sample the morphologies of as - synthesized products were examined by sem and tem. figure 2 shows the sem images of the -ni(oh)2 products. clearly, the products consist of a high yield of fairly uniform particles with the average size of about 4.5 m in diameter (fig. 2b and c, which reveal that all the -ni(oh)2 particles have 3d flower - like hierarchical morphology. those 3d flower - like architectures are built from several dozen of nanosheets with a thickness of 1020 nm and a width of 0.52.5 m. the surface of the sheets assembled into the hierarchical micro - architectures was very smooth, probably due to ostwald ripening. inset ofa : the size distribution of the as - synthesized sample;etem image of one typical hierarchical hollow architectures;fhrtem image taken from the age of the hexagonal phase-ni(oh)2sheets and the corresponding selected - area electron diffraction (saed) pattern (lower left corner) the morphologies and structures of as - synthesized samples were further characterized by tem. as shown in fig. 2e, tem observations demonstrate that the products are flower - like structures similar to the sem observation. the remarkable feature of the hollow architectures is the obvious contrast between the dark edge and the pale center, as reported for other hollow particles with a central cavity. to further obtain structural information for the well - aligned sheets, high - resolution tem (hrtem) images and the corresponding selected area electron diffraction (saed) patterns were also recorded on single sheet. in a hrtem image (fig. 2f) taken from the edge of a sheet, the lattice fringes are clearly visible with a spacing of 0.27 nm, which is in good agreement with the spacing of the (01 - 10) planes of-ni(oh)2(jcpds no : 14 - 0117). the saed and hrtem analyses reveal that the building units are single - crystal. in order to reveal the formation process of the 3d flower - like hollow architectures in more detail, time - dependent experiments were carried out and the resultant products were analyzed by tem. the representative tem images of the products prepared at certain reaction time intervals are shown in fig. 3. under the present synthetic conditions, nanoparticles and some ultra - thin nanosheets can be obtained as a result of aggregation and growth after treatment for 2 h (fig. when the reaction time was prolonged to 6 h, besides flower - like hollow architectures, some underdeveloped flower - like hollow architectures also existed in the as - synthesized samples, as shown in fig. after the reaction was further prolonged to 12 h, fully developed 3d flower - like hierarchical hollow architectures similar to that shown in fig. tem images of the as - synthesized samples with treatment times ofa2 h, b6 h, andc12 h at 120 c. sem images of the as - synthesized sample obtained at 120 c for 12 h : dwithout urea;eandfwithout ammonia;gschematic illustration of the formation of-ni(oh)23d flower - like hollow architectures in addition, the roles of urea and ammonia were found to be very important for the formation feature of 3d flower - like hollow architectures. in a control experiment, when no urea was added under the same reaction conditions, the products take on a flake - like shape (fig. 3d) rather than 3d flower - like hierarchical hollow architectures, while the ammonia was absent, only honeycomb - structured micro - architectures can be obtained, as shown in fig. 3e and f. on the basis of the above results in the present study, we believe that urea, ammonia, and reaction time play important roles in the formation of 3d flower - like hollow architectures. the formation of 3d flower - like hierarchical hollow architectures may result from the combined roles of urea, ammonia under the appropriate reaction condition. the chemical reaction in the process to obtain ni(oh)2 3d flower - like hollow microarchitectures could be formulated as follows:(1)(2)(3)(4) most probably, the bubbles of co2 gas produced in the reaction with the participation of co(nh2)2 must have played a key role, since no other templates / surfactants / emulsions were used in this work. a possible formation process involving the assembly - then - assemble mechanism can be schematically illustrated in fig. ni in solution reacts first with nh3 to form a relatively stable complex, [ni(nh3)6, because of its strong affinity to ni at room temperature. afterwards, the complex was decomposed and released nh3 to provide oh ions for the formation of ni(oh)2 by a hydrothermal treatment. at the same time, with the participation of co(nh2)2, many micrometer / sub - micrometer co2 bubbles are produced in the system at 120 c (step a). the freshly crystalline nanoparticles are unstable because of their high surface energy and tend to aggregate and form higher nanoparticles, driven by the minimization of interfacial energy. in our synthesis, the formation of [ni(nh3)6 complex would sharply decreased the free ni concentration in the solution, which resulted in a relatively low reaction rate of ni ions with oh ions. a slow reaction rate caused the separation of nucleation and growth steps, which is crucial for high - quality crystal synthesis. as a result, the sheet - like high crystalline ni(oh)2 was firstly formed (step b), which may be related to the nature of the initial crystal structures. then the self - assembly and ostwald ripening process occurs around the gas / liquid interface of co2 and water, and finally 3d flower - like hierarchical hollow architectures (step c). here, co2 bubbles decomposed from co(nh2)2 can act as soft templates to induce the self - assembly of nanosheets on their surfaces. a similar gaseous bubble has also been used as a template for tio2 and vooh hollow nanostructures, which is different from the assembly - then - inside - out evacuation mechanism in the formation of fe3o4 hollow spheres. our time - dependent experiments support the above aggregation - then - assembly mechanism ; it is found that the assembly process occurs after the formation of the nanosheets. the thermal behavior of flower - like hierarchical-ni(oh)2hollow architectures was investigated with tg and dsc measurements (fig. a tg curve showed that-ni(oh)2started to decompose (weight loss) at about 285 c. the total weight loss was measured to be ~22% which is larger than the theoretical value (19.4%) calculated from the following reaction:(5) the powders exhibit thermogravimetric transitions that are likely due to the loss of physical absorbed and structural water. the initial weight loss from 30 to 140 c is attributed to the loss of surface adsorbed water and ethanol. the weight loss in the range of 140365 c is due to the removal of the crystalline water molecules. after 365 c, the weight loss continued but gradually slowed at 400 c and almost ceased at 500 c. as a consequence, the stable residue can reasonably be ascribed to nio. the temperature range of the endothermic peak in the dsc curve fits well with that of weight loss in the tg curve, corresponding to endothermic behavior during the decomposition of-ni(oh)2to nio. differential scanning calorimetric analysis (dsc) and thermogravimetric analysis (tg) curves of-ni(oh)23d flower - like hollow architectures the nickel hydroxyl can easily be transformed to nio upon heat treatment. figure 5shows the xrd patterns of the flower - like hierarchical-ni(oh)2hollow architectures heated at various temperatures. all the diffraction peaks can be indexed to the face - centered cubic (fcc) nio phase (jcpds no. no peaks due to-ni(oh)2are observed, suggesting that-ni (oh)2is completely converted to nio after being heated for 4 h, which is also confirmed by tg and dsc studies. notably, when increasing calcination temperature to 500 c, all the peaks belonging to nio cubic phase were markedly sharpening with high intensities, which suggested that the crystallinity of nio phase was higher at high calcination temperature than that obtained at low calcination temperature. xrd patterns of the as - obtained-ni(oh)2samples calcined at different temperatures for 4 h : (a) 300 c and (b) 500 c the corresponding sem images and eds patterns are presented in fig. 6a, after annealing for 4 h in air, the morphology and structure of the flower - like hierarchical hollow architectures were sustained very well, which may due to the in situ conversion of -ni(oh)2 nanosheets to nio nanosheets. in addition, the nanocontact between particles may also stabilize the 3d flower - like structure mechanically against collapse or fracture. the magnified sem image shown in fig. this kind of porous structure was formed due to the dehydration and decomposition of ni(oh)2 during heating. 6d demonstrates that the as - prepared sample contains ni and o, and the atomic ratio of ni and o is ~44.01:40.14, which agrees well with the stoichiometry of nio. the au peaks come from the thin gold layer for conductive coating (the signal of c is from the conductive adhesive). shown in the inset of fig. 6d is the saed pattern that was recorded from the individual nanosheet, which can be indexed to the face - centered cubic structure with phase purity. it is interesting and surprising that the porous nanosheet still exhibits an almost single - crystalline diffraction pattern. here, heat treatment may provide the energy to make the nio particles self - assembled with high orientation and kept the former single - crystalline nature of the sheets. asem image of double typical 3d flower - like hierarchical nio architectures;b cthe corresponding enlarged sem images of the area marked with a red rectangle. insetcis a high - magnification tem image of a sheet;deds result of the as - obtained-ni(oh)2samples calcined at 500 c for 4 h. inset ofdshows saed pattern of the nio nanosheet the uv vis absorption spectrum of the sample is presented in fig. the strong absorption in the uv region can be observed, which is attributed to the band gap absorption of the as - synthesized nio sample. in principle, the optical band gap energy eg for a semiconductor can be estimated by the equation : (6) where is the absorption coefficient, h is the photon energy, b is a constant relative to the materials n is either 2 for direct inter - band transition or 1/2 for indirect inter - band transition. the band gap of the as - synthesized nio samples was about 3.57 ev by the extrapolation of the above equation, which shows obvious red - shift compared with that of the bulk nio (4.0 ev). such a difference could be contributed to their spherical hollow hierarchical architectures and the small thickness of the sheets with porous structures, in which the interactions between the connected building blocks led to a quantum size effect. no linear relation was found for n = 1/2, indicating that the as - prepared nio samples have a direct band gap. the 3d flower - like hierarchical-ni(oh)2hollow architectures have been synthesized by a facile hydrothermal route in the presence of urea and ammonia. the 3d flower - like hollow architectures with the size of several micrometers are composed of nanosheets of 1020 nm in thickness. the results indicated that the reaction time, urea and ammonia play important roles in the formation of 3d flower - like hierarchical-ni(oh)2hollow architectures. by calcining the as - prepared flower - like-ni(oh)2hollow architectures, hierarchical nio crystallites with porous single - crystalline nanosheets the optical absorption band gap of the as - obtained nio samples is determined to be 3.57 ev. due to the unique architectures, the as - obtained products may have potential applications in water treatment, electrode, sensors, catalysts, biomarkers, microelectronics, energy storage, and other related micro / nanoscale devices due to their unique architectures. this work was financially supported by the national natural science foundation of china (nos. : 50573090 and 10672161) and beijing municipal natural science foundation (no. | three - dimensional (3d) flower - like hierarchical-ni(oh)2hollow architectures were synthesized by a facile hydrothermal route. the as - obtained products were well characterized by xrd, sem, tem (hrtem), saed, and dsc - tga. it was shown that the 3d flower - like hierarchical-ni(oh)2hollow architectures with a diameter of several micrometers are assembled from nanosheets with a thickness of 1020 nm and a width of 0.52.5 m. a rational mechanism of formation was proposed on the basis of a range of contrasting experiments. 3d flower - like hierarchical nio hollow architectures with porous structure were obtained after thermal decomposition at appropriate temperatures. uv vis spectra reveal that the band gap of the as - synthesized nio samples was about 3.57 ev, exhibiting obviously red shift compared with the bulk counterpart. |
the most serious complication of endoscopic papillectomy (ep) for ampullary adenoma is postprocedure severe pancreatitis. many studies suggest that the prophylactic placement of a pancreatic duct (pd) stent after ep reduces the risk of pancreatitis.1,2 however, proximal migration of the pd stent occurs at a rate of about 5.2%.3 in general, ep is performed for ampullary adenoma not extending into the biliary or pancreatic duct. therefore, endoscopic retrieval of proximally migrated pd stents after ep is difficult because the pd diameter is within the normal range in most cases. we describe a case series with proximally migrated pd stents after ep that were retrieved successfully using a wireguided endoscopic snare. between july 2004 and june 2009, we attempted endoscopic removal of proximally migrated pd stents after ep for ampullary adenoma in 5 patients. all patients underwent prophylactic placement of a pd stent after ep to reduce the risk of postprocedure pancreatitis. wire - guided endoscopic snare retrieval was attempted in four patients and the conventional method using a forceps, snare, or basket without a guidewire in one patient. the pd is cannulated using an endoscopic retrograde cholangiopancreatography (ercp) catheter and then a 0.035-inch guidewire is inserted deeply through the catheter. after removing the ercp catheter, a snare (sd-7p-1 or sd-8p-1 ; olympus, tokyo, japan) is passed over the guidewire. the migrated stent is captured in the snare and removed via traction on the snare. if the first attempt of capturing the migrated stent at its distal end was not successful, it was then tried at its proximal end. after the excision was completed, a 5 fr, 9-cm geenen pd stent (wilson - cook, winston - salem, nc, usa) was placed immediately and positioned across the pd orifice (fig. after retrieving the resected specimen, the pd stent was not seen in the duodenum. unfortunately, the stent could not be retrieved because pd cannulation is difficult consequent to the edema and oozing that occurs after ep. the patient was kept fasting overnight and an attempt to retrieve the pd stent was made the next day. due to the small diameter of the pd, it was difficult to pass accessories alongside the stent for its retrieval. after the excision was completed, a 5 fr, 7-cm geenen pd stent was placed immediately. after retrieving the resected specimen, we made several attempts to retrieve the stent, although the pd orifice was not seen clearly due to edema. the next day, we performed wire - guided endoscopic snare retrieval of the pd stent successfully (fig. after the excision was completed, a 5 fr, 9-cm geenen pd stent was inserted. the next day, the plain abdominal radiograph confirmed that the stent had migrated into the proximal pd. endoscopic retrieval of the stent was not attempted because the patient refused follow - up endoscopy to remove the stent. then, wire - guided endoscopic snare retrieval of the pd stent was performed successfully. after the excision was completed, a 5 fr, 5-cm geenen pd stent was inserted. the next day, the plain abdominal radiograph showed that the stent had migrated proximally. the migrated stent was removed successfully using the wire - guided endoscopic snare method and no procedure - related complications occurred. a 34-year - old asymptomatic man was found to have an ampullary adenoma with a normal biliopancreatic duct on ercp. ep was performed using a reported method.4,5 after the excision was completed, a 5 fr, 9-cm geenen pd stent was placed immediately and the distal end protruded into the duodenum. after taking up the resected specimen, the pd stent was not seen in the duodenum. several attempts to retrieve the stent via the papillae using a rat - tooth forceps, snare, or basket were unsuccessful. the next day the migrated stent was removed successfully with a minisnare (soft acusnare ; wilson - cook). unfortunately, the patient developed severe pancreatitis and required hospitalization for 1 month to recover from the postprocedure pancreatitis. after the excision was completed, a 5 fr, 9-cm geenen pd stent (wilson - cook, winston - salem, nc, usa) was placed immediately and positioned across the pd orifice (fig. after retrieving the resected specimen, the pd stent was not seen in the duodenum. unfortunately, the stent could not be retrieved because pd cannulation is difficult consequent to the edema and oozing that occurs after ep. the patient was kept fasting overnight and an attempt to retrieve the pd stent was made the next day. due to the small diameter of the pd, it was difficult to pass accessories alongside the stent for its retrieval. after the excision was completed, a 5 fr, 7-cm geenen pd stent was placed immediately. after retrieving the resected specimen, we made several attempts to retrieve the stent, although the pd orifice was not seen clearly due to edema. the next day, we performed wire - guided endoscopic snare retrieval of the pd stent successfully (fig. a 63-year - old man underwent ep for ampullary adenoma. after the excision was completed, the next day, the plain abdominal radiograph confirmed that the stent had migrated into the proximal pd. endoscopic retrieval of the stent was not attempted because the patient refused follow - up endoscopy to remove the stent. then, wire - guided endoscopic snare retrieval of the pd stent was performed successfully. a 56-year - old woman underwent ep for ampullary adenoma. after the excision was completed, the next day, the plain abdominal radiograph showed that the stent had migrated proximally. the migrated stent was removed successfully using the wire - guided endoscopic snare method and no procedure - related complications occurred. a 34-year - old asymptomatic man was found to have an ampullary adenoma with a normal biliopancreatic duct on ercp. ep was performed using a reported method.4,5 after the excision was completed, a 5 fr, 9-cm geenen pd stent was placed immediately and the distal end protruded into the duodenum. after taking up the resected specimen, the pd stent was not seen in the duodenum. fluoroscopy confirmed that the stent had migrated into the proximal duct. several attempts to retrieve the stent via the papillae using a rat - tooth forceps, snare, or the migrated stent was removed successfully with a minisnare (soft acusnare ; wilson - cook). unfortunately, the patient developed severe pancreatitis and required hospitalization for 1 month to recover from the postprocedure pancreatitis. many studies suggest that placement of a pd stent reduces the risk of pancreatitis after ep.1,2,4,6 - 9 with the increasing use of pd stents, many complications can occur, including migration of the stent. proximal migration may be more serious because of the technical challenge associated with the attempt at retrieval. in one report, proximal stent migration occurred in 5.2% of patients and the majority of these stents could be retrieved endoscopically.3 lahoti.10 reported a successful endoscopic retrieval rate of 80% (8 of 10). of the two patients in whom the stents could not be retrieved, one developed continuous pain and required a distal pancreatectomy for stent removal. a recent retrospective study of 33 patients involving endoscopic treatment of proximally migrated pancreatic stents reported a successful retrieval rate of 78% for endoscopically placed stents.11 the stents were retrieved using a balloon (44%), direct forceps grasp (28%), and guidewire stent cannulation with snare capture (11%). four patients underwent surgery and one asymptomatic patient was observed. unfortunately, endoscopic treatment of proximally migrated pd stents after ep is more difficult due to the small diameter of the pd and postprocedure periampullary edema and bleeding. in previous reports, the rate of post - ercp pancreatitis was higher when cannulation was difficult and prolonged.12,13 multiple attempts at retrieval of a pd stent may predispose to pancreatitis owing to the added mechanical trauma. therefore, a safe effective method for retrieving the migrated pd stent is needed to reduce postprocedure pancreatitis. cannulation of the nondilated main pd can be difficult using the accessories required for migrated stent retrieval. therefore, we initially cannulate the pd with a catheter and then place a guidewire. after removing the ercp catheter,, we attempted to retrieve the proximally migrated pd stent immediately after ep in two patients. although the migrated stent was retrieved 1 day later, one patient developed severe pancreatitis, which was difficult to treat, and the other developed mild pancreatitis. in the other patients, stent retrieval was attempted between 1 day and 2 weeks after placement. these three patients did not develop acute pancreatitis. from this perspective, it may be better to delay retrieving a proximally migrated stent because pancreatic duct cannulation immediately after ep is difficult due to edema and bleeding. if a stent has to be retrieved for a variety of reasons, such as pancreatitis or abdominal pain, further study of the optimal timing of retrieval is needed. in conclusion, wire - guided endoscopic snare retrieval of proximally migrated pd stents after ep is safe and effective. in our experience, it is better to delay retrieval of a migrated stent by at least 1 day. however, further studies are needed to determine effective methods and optimal timing for the retrieval of proximally migrated pd stents after ep. | with the increasing use of pancreatic duct (pd) stents after endoscopic papillectomy (ep), complications such as proximal migration of the stent have become increasingly prevalent. a pd stent that migrates within a nondilated pd may be difficult to remove endoscopically. we performed endoscopic retrieval of proximally migrated pd stents after ep in 5 patients. endoscopic retrieval was performed immediately after ep in one patient, the next day in 3 patients, and 2 weeks later in one patient. wire - guided endoscopic retrieval was attempted in 4 patients, and the migrated stents were removed successfully in these 4 patients. no significant procedure - related complications occurred, other than mild pancreatitis in a single patient. in one patient, endoscopic retrieval performed immediately after ep failed when using the conventional method, and the migrated stent was removed using a minisnare without a guidewire the next day ; this patient developed severe pancreatitis. wire - guided endoscopic snare retrieval seems to be a safe and effective method for removing proximally migrated pd stents after ep. |
glutamate and -aminobutyrate (gaba) are the two major amino acid transmitters in the cerebral cortex and cerebellum, glutamate being responsible for excitatory and gaba for inhibitory transmission. in these higher brain regions glycine was earlier assumed to be only an obligatory cotransmitter in the excitatory n - methyl - d - aspartate- (nmda-) sensitive glutamate receptors, but more recent studies have also demonstrated the existence and function of strychnine - sensitive inhibitory glycine receptors in these structures [2, 3 ]. in addition to these established neurotransmitters, taurine also affects neuronal activity as an inhibitory modulator. in the rodent brain in particular, in the developing brain it is the most abundant amino acid, even exceeding the concentration of glutamate. the excessive extracellular accumulation of excitatory amino acids, predominantly that of glutamate but also of aspartate, in ischemia leads to cellular damage in the brain [6, 7 ]. their massive release activates glutamate receptors, in particular those of the nmda class, which leads to an excessive influx of ca and consequent adverse effects. this excitotoxicity may be counteracted by the simultaneous enhanced release of inhibitory gaba and taurine [10, 11 ]. the functional status in the brain is a delicate balance between these excitatory and inhibitory neurotransmitters under both normal and pathological conditions. in microdialysis studies in vivo, the overflow of endogenous extracellular amino acids can be assessed, (e.g., [6, 12 ]), but in the vast majority of in vitro studies the release of neurotransmitter amino acids has been investigated with the aid of preloaded radioactively labeled compounds. these admix more or less readily with the endogenous homologous pool in the cells and are only thereafter released into the extracellular spaces. hence, the calculated release rate is affected by the efficacy of this mixing and the sizes of the endogenous amino acid pools and, thus, may not reliably reflect the magnitude of the release. the release of preloaded radioactively labeled amino acids from cerebral cortical preparations has been relatively frequently investigated, whereas relatively few studies have been made with the cerebellum [1315 ]. here we compared the release rates of endogenous gaba, glutamate, aspartate, glycine, and taurine from cerebral cortical and cerebellar slices to estimate the release on a molar basis under normoxic and ischemic conditions. the cerebral cortex and cerebellum represent functionally different brain structures, the cerebellum being predominantly inhibitory and the cerebral cortex with mixed functions, including excitation. developing (7-day olds) and young adult (3-month olds) nmri mice of both sexes were used in the experiments. the experiments conformed to the european community directive (86/609/eec) for the ethical use of experimental animals, and they were approved by the tampere university committee for animal experiments. superficial slices 0.4 mm thick weighing 1520 mg were manually prepared from the mouse cerebral cortex and cerebellum with a tissue slicer of stadie - riggs type. the slices were immediately immersed in 5 ml of preoxygenated medium and preincubated for 30 min under o2 at 37c under agitation in standard medium containing (in mmol / l) nacl 127, kcl 5, cacl2 0.8, mgso4 1.3, na2hpo4 1.3, n-2-hydroxyethylpiperazine - n-2-ethanesulphonic acid (hepes) 15, naoh 11, and d - glucose 10 (ph 7.4). the slices were then transferred into 0.25 ml cups and superfused with the above medium (unless otherwise specified) at a rate of 0.25 ml / min for 50 min in a system in which freely floating shaken slices were kept under a continuous flow of oxygen in order to preserve their viability. the superfusion medium was pooled during the first 20 min, whereafter 2 min fractions (0.5 ml) were collected. at 30 min the medium was in many experiments changed to medium containing 50 mm k (potassium stimulation). in our experimental set - up this k concentration has yielded the best and most reproducible responses in gaba and taurine release. under experimental conditions, designated as the effluent fractions were subjected to amino acid assays by high - performance liquid chromatography. the amino acids eluted were visualized by means of o - phthaldialdehyde reagent and the results quantified with both external commercial standards and the internal standard of diamino - n - butyrate, as described in detail by oja and kontro. the efflux of amino acids is either shown as a function of superfusion time (gaba, glutamate, and taurine) or calculated as an average efflux for the period of 32 to 50 min (glycine, glutamine, aspartate, alanine, serine, and threonine). the presence of statistically significant differences between the sample means was detected by the two - way analysis of variance. in 7-day - old mice taurine is the most prominent amino acid, followed by glutamate and aspartate (table 1). the concentration of taurine decreases dramatically as the mice get older, when glutamate is the most abundant amino acid. the concentrations of glycine, aspartate, alanine, serine, and threonine are also significantly lower in 3-month - old mice, but no marked changes occurred in gaba, glutamate, and glutamine. it should be noted that the concentrations given in table 1 represent the amino acid levels in the preincubated slices at the onset of superfusion, not the original tissue content. the basal release of gaba was rather negligible in both 7-day- and 3-month - old mice, but k stimulation evoked marked release at both ages (figure 2). k stimulation was clearly also preserved in ischemia in both age groups. in developing mice the release was stable during the experiments but in adults it was attenuated with prolonged ischemia (table 2). in 7-day - old mice there occurred no enhancement of glutamate release upon k stimulation either from oxygenated or ischemic slices (figure 3). the increase was more pronounced during the early phase in developing mice (table 2). in 3-month - old mice the basal release of taurine was markedly greater than that of gaba or glutamate (figure 4). the release was increased severalfold when slices from 7-day - old mice were exposed to high - k medium, whereas the stimulation was rather small in 3-month olds. the release of taurine was markedly increased in ischemia in both developing and adult mice, but no k - stimulated release was discernible at either age. in developing mice the release was somewhat diminished with prolonged ischemia (table 2). in 7-day - old mice no effects of k stimulation or ischemia were seen in the release of aspartate, glycine, glutamine, alanine, and serine (figure 5). on the other hand, aspartate release was enhanced by both treatments in 3-month - old mice, the combined effect of ischemia and k stimulation being particularly prominent. the release of glycine was also increased when slices from adult mice were exposed to k stimulation and ischemia, whereas the release of glutamine was diminished. taurine is also the most prominent amino acid in the cerebellum of 7-day - old mice (table 1). in 3-month olds glutamate is present at the highest concentration, followed by aspartate, glycine, and taurine. in the cerebellum the concentrations of gaba, glutamate, glutamine, and serine are at about the same level in both 7-day - old and 3-month - old mice, whereas the levels of taurine, glycine, aspartate, alanine, and threonine are lower in 3-month olds than in 7-day olds. there occurred only hardly detectable basal release of gaba from cerebellar slices from 7-day - old mice (figure 1). k stimulation also evoked almost 10-fold greater gaba release in 3-month - old than in 7-day - old mice. ischemia enhanced the release, and k stimulation was preserved in ischemic slices at both ages. however, the effects were much greater in adults in which the ischemia - induced enhancement was diminished with prolonged experiments (table 2). the basal release of glutamate and the k stimulation were likewise severalfold greater in 3-month - old than in 7-day - old mice (figure 6). the release of glutamate was enhanced in ischemia, but no k - evoked release was discernible in adults. the ischemia - induced enhancement of release was greatly attenuated with time in adults (table 2). the release of taurine increased several - fold in 7-day - old mice in high - k media, whereas k stimulation was rather small in magnitude in adults (figure 7). the increase in release in ischemia was fairly stable during the experiments at both ages (table 2). in ischemia k stimulation was partially preserved in 7-day - old mice, whereas no k effect was seen in 3-month - old mice (figure 7). ischemia increased the release of glycine, glutamine, alanine, serine, and threonine in 7-day - old mice, but k stimulation had no effect on the release of these amino acids in ischemia (figure 8). aspartate release was in all cases somewhat marginal at this age. in 3-month - old mice no effects of k stimulation or ischemia were seen in the release of aspartate, glycine, glutamine, alanine, serine, or threonine. although the amino acid levels in preincubated slices are not identical to the concentrations in intact tissue, the contents measured here reflect those obtaining in vivo. a characteristic finding is the very high taurine concentration in the developing mouse brain. in spite of the much higher content in the developing cerebral cortex and cerebellum, the basal release rates of endogenous taurine were not markedly different, but the high content to a great extent obviously underlies the several - fold greater release evoked by k stimulation and ischemia. these effects were clearly more marked in the cerebral cortex than in the cerebellum in both experimental groups. however, the differences in concentration of other amino acids between developing and adult mice are also in any case of such magnitude that they will have affected the present estimated release rates. this release could result, for instance, from destabilization and deterioration of plasma membranes owing to phospholipid hydrolysis by phospholipases, resulting in diffusion of amino acids along their concentration gradients. however, in ischemia here there occurred no measurable increase in the extrusion of lactate dehydrogenase (a common marker of plasma membrane damage and nonspecific lysis of neural cells) from the slices upon incubation (data not shown). nor has it been increased in other experiments of the present type [19, 20 ]. however, longer periods of ischemia are associated with increasing degrees of plasma membrane disruption, allowing for a greater leakage of intracellular contents. in keeping with the assumption that deterioration of cell plasma membranes may not have been a major factor underlying amino acid release, there now occurred no increase in the release of the nontransmitter amino acids, alanine, serine, and threonine in the cerebral cortex in ischemia in either experimental group. however, the release of all these amino acids increased in ischemia in slices prepared from the developing cerebellum. it is thus reasonable to surmise that any major damage to neural membranes will not have been involved in the present release rates of amino acids, with a reservation to the preparations from the developing cerebellum. the opening of swelling - induced cl channels also allows the passage of amino acids down their concentration gradients. when cells swell, they attempt to restore their normal volume by extruding osmotically active solutes such as amino acids. in particular, release of taurine has often been shown to be evoked by cell swelling in the cerebral cortex, exhibiting typically a delayed time course [24, 25 ], similar to those obtained in the present study. moreover, the apparent release of amino acids from slices also depends on the efficacy of reuptake. the amino acids released must traverse the extracellular spaces to reach the medium and be detected. in addition to the cell plasma membrane damage discussed previously, and in the case of neurotransmitter amino acids ca - dependent exocytosis from synaptic vesicles, the mechanisms involved in the release of amino acids in ischemia may include swelling - evoked release via anion channels, reversal of amino acid transporters in depolarized cells, or acidosis - induced failure of reuptake into neurons and glia. in particular, the release of glutamate and aspartate has been postulated to involve, in addition to ca - dependent exocytotic release, ca - independent release due to a depolarization - induced reversal of the na - dependent high affinity acidic amino acid transporters [30, 31 ]. ca - dependent release may account for the initial efflux of neurotransmitter amino acids at the onset of ischemia, whereas ca - independent nonvesicular release, mediated by na - dependent amino acid transporters in plasma membranes operating in a reversed mode, could be mostly responsible for the later phase of release. this may signify that the release of glutamate from cerebellar slices could have been due mainly to exocytosis in the present experiments, whereas in cerebral cortical slices the function of transporters may have markedly contributed. excessive release of the excitotoxic amino acids glutamate and aspartate is considered to be a significant contributor to neuronal death in the ischemic brain [33, 34 ]. there is evidence for a positive feedback loop, in which glutamatergic neurons can be stimulated to release additional glutamate as a consequence of activation of its receptors [35, 36 ]. in particular, the n - methyl - d - aspartate (nmda) receptors may occupy a central position here, since they have been shown to regulate the release of both excitatory and inhibitory amino acids from rat fetal cortical neurons. in human cerebral cortical slices k stimulation and ischemia have also markedly enhanced the release of glutamate, aspartate, gaba, and glycine, but not that of glutamine. the k - evoked release was ca - dependent, whereas the ischemia - induced release was not. substantial amounts of glutamate were now released in the adult cerebral cortex under ischemic conditions, and the k stimulation was partially preserved, but the release could not be described as massive in comparison with the release of gaba or taurine. in the cerebellum the release was likewise greater in adults, being however significantly smaller than in the cerebral cortex and rapidly attenuated with time. the marked release of aspartate, in particular with the concomitant k stimulation, could contribute to this effect in the cerebral cortex, but not in the cerebellum. the release of gaba from cerebral cortical slices was greater that that from cerebellar slices in both experimental groups. in keeping with this finding, glutamate decarboxylase - positive cell bodies, that is, gabaergic neuronal density, in the rat neocortex are high already at birth. on the other hand, in adult mice gaba release was of the same order of magnitude in both brain areas. in adults, the release of glutamate was significantly greater than that of gaba. in the adult cortex both these neurotransmitters function in the vast majority of all synapses, but the glutamatergic synapses outnumber the gaba synapses about fivefold. in cultured rat cerebellar neurons the release of gaba and taurine has been shown to originate from the gabaergic interneurons, the basket and stellate cells, and the release of glutamate and aspartate mainly from the granule neurons. in cultured neurons from the rat cerebellum the glutamate receptor agonists kainate and quisqualate have evoked the release of endogenous glutamate, taurine, and gaba in a dose- and ca - dependent manner [42, 43 ]. endogenous aspartate, glutamate, and gaba are also released from such cultures by k depolarization in a dose- and ca - dependent manner whereas the release of taurine is dose - dependent but not ca - dependent. in contrast, the omission of ca has enhanced basal taurine release, a finding also recorded, for example, in cerebral cortical slices and in hippocampal slices prepared from young, adult, and aged mice [45, 46 ]. the greater glycine release from cortical slices from developing than from adult mice may be associated, in addition to the high glycine content, with the presence of glycine receptors in the cerebral cortex during early development [47, 48 ]. in particular, the 2 subunit of glycine receptors declines sharply following the first postnatal week and remains at a low level in the adult neocortex [47, 49, 50 ]. moreover, the glycine sensitivity of neurons in the rat prefrontal cortex has been shown to decrease with age, and functional glycine receptors in older animals have not been demonstrated. on the other hand, the expression of glycine receptors in the cerebellum is rather weak and does not show a similar decline with maturation. taurine acts at both gaba and glycine receptors, being however less effective than either of these [3, 53 ]. the release of taurine in the developing cerebral cortex and cerebellum in ischemia is of such magnitude that it could clearly counteract the effects of excitatory amino acid transmitters, in particular since at that age the release of glutamate and aspartate can not be described to be massive. gaba and glycine can not protect against excitotoxicity in the developing cerebral cortex and cerebellum, since gaba is during early development rather excitatory than inhibitory [54, 55 ]. glycine receptors also tend to mediate excitation in the neonatal rat cerebral cortex [56, 57 ]. in conclusion, we may state that the releases from the cerebral cortex and cerebellum were markedly different and also differed between developing and adult mice. in developing mice with 7 days of age, only the release of inhibitory taurine may be large enough to counteract the harmful effects of excitatory amino acids in ischemia in both cerebral cortex and cerebellum, in particular since at that age the release of glutamate and aspartate can not be described as massive. the present experiments in which rather long exposure times were studied can not reveal any fast or transient effects on amino acid release. moreover, it is open to what extent the results obtained are applicable to the human brain, though the basic mechanisms are likely similar in the mouse and the man. | ischemia enhanced release of endogenous neuroactive amino acids from cerebellar and cerebral cortical slices. more glutamate was released in adult than developing mice. taurine release enhanced by k+ stimulation and ischemia was more than one magnitude greater than that of gaba or glutamate in the developing cerebral cortex and cerebellum, while in adults the releases were almost comparable. aspartate release was prominently enhanced by both ischemia and k+ stimulation in the adult cerebral cortex. in the cerebellum k+ stimulation and ischemia evoked almost 10-fold greater gaba release in 3-month olds than in 7-day olds. the release of taurine increased severalfold in the cerebellum of 7-day - old mice in high - k+ media, whereas the k+-evoked effect was rather small in adults. in 3-month - old mice no effects of k+ stimulation or ischemia were seen in the release of aspartate, glycine, glutamine, alanine, serine, or threonine. the releases from the cerebral cortex and cerebellum were markedly different and also differed between developing and adult mice. in developing mice only the release of inhibitory taurine may be large enough to counteract the harmful effects of excitatory amino acids in ischemia in both cerebral cortex and cerebellum, in particular since at that age the release of glutamate and aspartate can not be described as massive. |
therefore finding of new and effective antimicrobial agents derived from new resources for such resistant bacteria is of an over riding importance. nowadays, scientists and clinicians are looking for more efficient drugs, derived from natural and herbal resources, against microbial and viral infections (1). plants are considered as rich sources of antibiotic treatment medications and eucalyptus leaf with its antimicrobial properties have been used in the treatment of infectious diseases formerly in ancient medicine (2 - 5). several compounds have been extracted from eucalyptus as biological sources such as uglobals, grandinol, macrocarpals, eucalymin, robostadial, 1, 8-eineole and eucalypton with antimicrobial and remedial activities (1, 6 - 9). the major compound of eucalyptus is 1, 8-cineole with antimicrobial specifications (3, 5). they used dilution method to measure the mic of eucalyptus oil on the e. coli - sp11 bacterium and estimated value was about 2.5 l / ml (10). study by adebolla. designed to evaluate the antimicrobial effect of five different eucalyptuses via diffusion in agar revealed that the obtained mic for candida albicans and gram positive and negative bacteria was 5 mg / ml (5). antimicrobial activity of eucalyptus oil on 22 bacteria and 12 fungi via disc diffusion method conducted in a study by pattnaik. (11) and results showed that the eucalyptus oil is effective against 22 kinds of bacteria and 11 kinds of fungus. the mic of bacteria was between 0.16 to 20 l / ml where it was 0.25 to 10 l / ml for fungus. they mentioned that diluted 1/100 v / v oil is necessary to prevent microbes activities. escherichia coli, staphylococcus aureus and aspergillus are all sensitive to the dilution 1/500 v / v and bacillus subtillis was sensitive to the dilution 1/250 v / v (12). (13) studied the antimicrobial oil of the greek eucalyptus and used gram positive bacteria staphylococcus aureus and gram negative ones such as escherichia coli, klebsiella and pseudomonas aeruginosa. the results showed that the eucalyptus oil reacted against all bacteria and fungi effectively and the mic was estimated 0.3 to 0.6 mg / ml (13). currently the antimicrobial extract and oil of eucalyptus have been registered in the pharmacies of england, france, germany, india, japan and united state. according to recent studies eucalyptus has shown an enormous antimicrobial activity and it also applied to produce new chemical compounds form other antibiotics (1). the aim of present study was to evaluate antimicrobial activity of e. camaldulensis, e. polycarpa, e. malliodora and e. largiflorence on the staphylococcus aureus atcc25923 and other clinical resistant series. the ratification of bacterium series to ensure the materials and kinds of the supplied bacteria, gram stain, oxidase experiments, coagolase, dnase, catalase, movement in the semi - solid environment, the fermentation of mannitol, hemolysin, sensitivity to basitracin and culture in the liquid medium with 15% salt were carried out. essential oil extraction and diagnosis of it s chemical compounds eucalyptus leaves supplied from fadak garden in dezfoul city (southwest of iran) in july 2003. we cut 50 g of the dried eucalyptus into pieces and oil extracted by distillation apparetus in 200 ml of distilled water. the distillation velocity was between 2 to 3 ml / min and the process lasted 3 h. acquired essential oil was injected to gc / ms instrument in order to separation. the gc - ms instrument (hewlett - packard 5973 bston hp-5ms) was kept at 60c for 3 min after injection where it can increase the temperature up to 220c and keep at this temperature for 5 min. the velocity of gas carrying helium was 1 ml / min and analysis gas chromatography was 70 ev / min, in which the compounds were separated and analyzed. the estimation of mbc and mic by the dilution method in the tube and the second culture in agar dilution method was used to measure mic. colony made from 24 h culture of bacterium inoculated to mooler hinton berath culture medium. this suspension was inoculated at 37c for about 4 to 6 h in order to get the bacteria to the dynamic level and compared to macfarland 0.5 standard at last. as a result was diluted to the proportion of 1/100 in order to reach 10 bacteria in each ml. to measure the mic, 1 ml of mooler hinton berath culture was poured in 10 tubes and mixed right after adding 1 ml of the essential oil to the first tube. one ml of first tube was added to the second and 1 ml of the second to the third tube respectively. then 1 ml of the microbial suspension was added to each tube to make 1/4 to 1/2048 concentrations. the tubes were incubated at 37c and mic was appointed by the growth or non - growth of the bacterium in the tubes. mbc was also measured by the second culture in mooler hinton agar medium (1, 6, 18, 19). the measurement of the zone of inhibition of bacterium adjacent to the eucalyptus essential oils the intended bacterium is distributed on mooler hinton agar medium with concentration of 0.5 macfarland and then some small holes were made on them. 50 l of the essential oils were added to each hole and the plate was incubated at 37c for 24 h. finally, after 24 h, the diameter of the zone of inhibition were measured (1, 15 - 17). relatively simple biochemical tests (e.g., positive reactions for coagulase, nuclease, alkaline phosphatase and mannitol fermentation) can be used to differentiate s. aureus. results obtained from the chemical analysis of eucalyptus essential oils by gc / ms has been showed in table 2. the obtained results from the ratification of staphylococcus aureus series the results obtained from the chemical analysis of eucalyptus essential oils by gc / ms minimum inhibitory concentration (mic) and the minimum bactericide concentration (mbc) of the essential oils eucalyptus spp by dilution method in the tube and the second culture in agar were summarized in table 3. each of the oils was tested at concentrations ranging from 1.95 to 62.4 g / ml and 1/512 to 1/16 v / v. minimum inhibition concentration (mic) of the eucalyptus essential oils for e. camaldulensis 1/256 v / v was equal to 3.9 g / ml, for e. largiflorence 1/512 v / v was 1.95 g / ml, for e. malliodora 1/256 v / v was 3.9 g / ml and for e. polycarpa 1/128 v / v was 7.8 g / ml. minimum inhibitory concentration (mic) and the minimum bactericide concentration (mbc) of the essential oils eucalyptus spp by the dilution method in the tube and the second culture in agar each oils were test for mic and mbc concentration were presented as g / ml (v / v) antibacterial activity of the essential oils e. largiflorence, e. malliodora, e. polycarpa and e. camaldulensis (zone of inhibition in mm) were 26, 22, 18 and 20 mm, respectively. staphylococcus aureus is also considered as one of the resistant sample to drugs and pathogen agents in human, therefore it seems necessary to find out antimicrobial materials from alternative sources such as plants. eucalyptus is one of the herbal drugs with antimicrobial effects. in present study mic of the essential oils of e. malliodora, e. polycarpa, e. camaldulensis and e. largiflorence were evaluated and estimated 3.9, 3.9, 1.95 and 7.8 l / ml, respectively. the diameter of the zone of inhibition adjacent to essential oils was estimated 20, 22, 26 and 19 mm respectively. the results showed that these essential oils can strongly prevent the growth of staphylococcus aureus atcc 25923 and other clinical resistant bacteria. the obtained results are in line with other studies. however, mic of the e. largiflorence essential oils and diameter of zone of inhibition in comparison to other essential oils showed potent antimicrobial activity and inhibitory effect. this suggested e. largiflorence as an effective antimicrobial agent among all kinds of eucalyptus (1). in addition in present study, the antimicrobial activity of eucalyptol was examined that showed a potent inhibitory effect on staphylococcus aureus atcc 25923. eucalyptol acts as a main substance of the eucalyptus oil (14). on the other hand 1, 8-cineol and -pinene present in the chemical compounds of all four kinds of eucalyptus, where e. largiflorence essential oil has the most antimicrobial activity comparing to others. antibacterial activity of these essential oils were decreased when 1, 8-cineol and -pinene were less than normal levels. consequently -pinene and 1, 8-cineol are both considered as the most important antimicrobial substance of the eucalyptus oil (13). last studies showed that eucalyptus oil has a widespread antimicrobial effects against the positive and negative gram bacteria (1, 5). also there are other studies proved antimicrobial compounds in eucalyptus and indicated the relation between traditional reported consumption and experiments have done in laboratories (6, 11). therefore, extract of the eucalyptus oil as an effective antimicrobial substance can be used in treatment of bacterial infections like skin injuries, acnes and lung infections (1, 2, 5, 6, 11). eucalyptus has been showed a wide spectrum of antimicrobial and anti - cancer activities and used in design of new antibiotics (1, 2). it was concluded that the essential oils of eucalyptus is effective against staphylococcus aureus in - vitro, although more detailed studies require using these compounds in clinic and infectious disease. | because of its resistance to antibiotics, staphylococcus aureus causes many of problems in hospital and society. as one of the main reasons of clinical infections it can cause to serious surgical and cutaneous infections and pneumonia. the inhibitory effect of the essential oils include ; eucalyptus largiflorence, e. camaldulensis, e. malliodora and e. polycarpa as a natural and herbal antimicrobial substances on staphylococcus aureus atcc 25923 and other antibiotic resistant series separated from clinical samples were evaluated. the minimum inhibition concentration (mic) of the eucalyptus essential oils was appointed by the dilution method in the tube and the results revealed that the values for the e. camaldulensis 1/256 v / v, e. largiflorence 1/512 v / v, e. malliodora 1/256 v / v and e. polycarpa 1/128 v / v were 3.9 g / ml, 1.95 g / ml, 3.9 g / ml and 7.8 g / ml, respectively. eucalyptol is the major compound of the eucalyptus essential oil. the mic of the pure eucalyptol appointed by the dilution method in the tube was equal to 1.95 g / ml. in conclusion, anti staphylococcus activity of the eucalyptus essential oils suggested it s clinically useful potentials, although further studies are required. |
malignant hyperthermia (mh) is an autosomally inherited, potentially lethal myopathy with a heterogeneous etiology that is usually triggered by volatile anesthetics and depolarizing muscle relaxants. it is widely accepted that susceptibility to mh is caused by abnormal ca metabolism within the skeletal - muscle fiber. the site of the defect in mh appears to lie in the ca release mechanism of the sarcoplasmic reticulum (sr) in skeletal muscle, namely, in the complex of the dihydropyridine (dhpr) and ryanodine receptors (ryr). ca homeostasis in skeletal muscle is regulated by a variety of intracellular second - messenger systems. alterations in some second - messenger systems have been found to be associated with mh [2, 3 ] ; the cyclic amp (camp) system also seems to be affected in mh. in skeletal - muscle cells from mh - susceptible (mhs) patients and animals, higher camp levels were measured compared to normal (mhn) subjects [47 ]. the mode of action of methylxanthines such as caffeine and theophylline is concentration dependent. while they act by adenosine - receptor antagonism at lower concentrations, at higher concentrations they are also unspecific phosphodiesterase (pde) inhibitors. pde inhibitors produce a receptor - independent increase in ca release from the sr via the ryr in cardiac muscle by decreasing the rate of camp degradation. this effect could also be demonstrated in skeletal muscle as an increase in isometric contraction after application of pde inhibitors [9, 10 ]. theophylline (1,3-dimethylxanthine) was shown to induce contracture development in porcine skeletal muscle in vitro. furthermore, clear differences could be demonstrated between mhn and mhs muscle : mhs muscle developed significantly greater contractures compared to mhn specimens after bolus administration of 3 mmoll or 5 mmoll theophylline. these results were comparable with in vitro contracture tests (ivcts) with caffeine and could be explained by the chemical analogies of both substances. the purpose of the current study was to investigate the in vivo effects of theophylline in mhs and mhn swine. after approval by the animal research committee of the university hospital hamburg - eppendorf, 6 mhn german landrace pigs weighing 3948 kg, aged 35 months, and 6 mhs pietrain pigs weighing 2633 kg, aged 35 months, from a special breeding farm (research station thalhausen, technical university munich, germany) were investigated. prior to the study, in all animals genomic dna was isolated from blood preserved in ethylenediaminetetraacetic acid to check for the presence of the arg615-cys point mutation on chromosome 6, indicating mh susceptibility. general anesthesia was induced by administration of ketamine 10 mgkg intramuscularly (ketavet, pharmacia & upjohn, erlangen, germany). after insertion of a venous cannula into an ear vein, anesthesia was deepened with propofol 10 mgkg (diprivan 2%, astra - zeneca, plankstadt, germany) and fentanyl 10 gkg (fentanyl - janssen, janssen - cilag, neuss, germany) intravenously (i.v.). after tracheotomy and intubation, the lungs were mechanically ventilated with an air / oxygen mixture (fraction of inspired oxygen (fio2) 0.4). a multilumen central - venous line was inserted into the right internal - jugular vein. one lumen was used for withdrawal of blood samples and measurement of central - venous pressure (cvp), the second for administration of theophylline and fluid infusion (510 mlkgh ringer 's solution), and the third for administration of anesthetics. cannulas were inserted into both femoral arteries : one was used for withdrawal of blood samples, the other for continuous measurement of arterial pressure and body core temperature (picco, pulsion medical systems, munich, germany). normothermia was maintained by forced - air warming, and rectal and intravascular body temperatures were measured continuously. a blood - gas analyzer (abl625, radiometer, copenhagen, denmark) was used for monitoring arterial and venous oxygen saturation, oxygen partial pressure (po2), carbon dioxide partial pressure (pco2), ph, and potassium and lactate levels. mechanical ventilation was adjusted to maintain venous pco2 at 46 4 mmhg ; the body core temperature was adjusted to 37.5 0.2c before the experiment was started. once a steady state was achieved for at least 30 minutes, baseline values were recorded for all variables. theophylline (bronchoparat, klinge pharma, munich, germany) 1.0 mgkg was administered as an i.v. subsequent doses were given every 10 minutes to reach cumulative doses of 3.5, 8.5, 18.5, 33.5, 53.5, and 93.5 mgkg. the clinical occurrence of mh was defined by the development of two of three conditions : central - venous pco2 75 mmhg, central - venous ph 7.20, and an increase of intravascular body core temperature by 2.0c as measured using the picco system. during the experiments, hemodynamic variables (heart rate (hr), mean arterial pressure (map), cvp, cardiac output), end - tidal co2 concentration (etco2), rectal and intravascular body temperature (c), blood - gas concentrations (o2 saturation (sao2), pco2, ph), and lactate levels were measured every 5 minutes. every 10 minutes, blood samples were taken for gas - chromatographic measurement of theophylline concentrations. after all experiments were completed, the pigs were killed using 10% magnesium chloride solution i.v. statistical evaluation was performed using a computer - based program (statview 4.57, abacus concepts, berkeley, ca). intergroup variations were calculated with the mann - whitney test ; intragroup differences were calculated with analysis of variance for repeated measures. theophylline induced comparable clinical alterations in the anesthetized mhs and mhn swine, especially in regard to hemodynamic data. however, significant differences could not be found between mhs and mhn swine. furthermore, clinical signs of muscular alterations, for example, general muscle rigidity, were not observed in any swine. after cumulative administration of 93.5 mgkg, all animals died with tachycardia and hypotension followed by ventricular fibrillation. the pco2 and venous ph did not change after administration of theophylline (figures 1(a) and 1(b)). the baseline body temperatures of the mhs (37.5c (36.638.6c)) and mhn swine (37.4c (35.837.8c)) as well as lactate levels of 1.8 mmoll (0.43.4 mmoll) in mhs and 1.8 mmoll (0.86.5 mmoll) in mhn animals remained unchanged. the hr of all swine increased at cumulative doses of 93.5 mgkg theophylline (figure 1(c)), while the map decreased. in mhs swine map decreased from 84.5 mmhg (60104 mmhg) to 65.5 mmhg (4867 mmhg) after administration of 93.5 mgkg theophylline. in mhn swine the decrease was more marked, from 84 mmhg (6798 mmhg) to 53.5 mmhg (5068 mmhg). there were no differences in blood theophylline concentrations between mhs and mhn swine. a mean blood concentration of 13.9 mgml (12.316.2 mgml) theophylline was found after 30 minutes and a cumulative dose of 8.5 mgkg (figure 1(d)). ten minutes after the last dose (93.5 mgkg) the mean blood concentration was 122.4 mgml (99.3154.4 mgml). the cytoplasmic ca concentration is regulated by a variety of intracellular second - messenger systems. alterations in second - messenger systems, for example, the serotonin system or inositol polyphosphates, have been found to be associated with mh [2, 3 ]. higher cytoplasmic camp content and adenyl - cyclase activity have been found in mhs compared to mhn patients. additionally, serum camp concentrations during and after physical exercise increased more and for longer time periods in mhs compared to mhn patients. one mode of action of methylxanthines is the unspecific inhibition of pdes, which leads to enhancement of cytoplasmic camp. furthermore, a mh - specific effect of the methylxanthine caffeine is well known and is used as a gold standard in the ivcts for the diagnosis of mh [10, 13 ]. there are several case reports describing patients who developed mh - like symptoms without receiving the classic trigger substances such as succinylcholine or volatile anesthetics. the clinical presentation of theophylline intoxication can be very similar to mh, for example, with tachycardia, hyperthermia, dehydration, convulsions, and coma as well as skeletal - muscle cramps and rhabdomyolysis. aminophylline induced mh - like symptoms in anesthetized rabbits, but a genetic basis of mh susceptibility in these animals was not examined in this study. in mhs swine, i.v. and oral administration of caffeine potentiated the development of mh crises induced by halothane and succinylcholine. furthermore, the detection of specific in vitro effects of theophylline in porcine skeletal - muscle preparations supported the hypothesis of an mh trigger potential for methylxanthines. no significant differences between mhs and mhn swine or symptoms of hypermetabolism could be found during cumulative administration of theophylline. the therapeutic blood level of theophylline in humans is estimated at between 8.0 and 20.0 mgml. after cumulative administration of 93.5 mg theophylline, the swine in our study died in hemodynamic decompensation. the mean blood level measured at this time was 122.4 mgml(99.3154.4 mgml) or 0.68 mmoll (0.550.86 mmoll) theophylline. however, in vitro contracture development in isolated porcine mhs muscle specimens started at concentrations of 3.0 mmoll theophylline. therefore, it could be speculated that the in vivo theophylline concentrations in this study were high enough to kill the animals, but too low to trigger mh. stress is a well - known trigger of mh in swine, whereas the role of stress in human mh is still unclear [9, 18 ]. considering the results of this study, theophylline might be a cofactor in the induction of mh in humans, but does not appear to be a primary trigger of mh. | background. theophylline was shown to induce contracture development in porcine malignant hyperthermia (mh) susceptible (mhs) skeletal muscles in vitro. the purpose of the current study was to investigate the in vivo effects of theophylline in mhs and mh normal (mhn) swine. methods. mh - trigger - free general anesthesia was performed in mhs and mhn swine. theophylline was administered intravenously in cumulative doses up to 93.5 mgkg1. the clinical occurrence of mh was defined by changes of central - venous pco2, central - venous ph, and body core temperature. results. theophylline induced comparable clinical alterations in the anesthetized mhs and mhn swine, especially in regard to hemodynamic data. no pig developed hypermetabolism and/or mh according to defined criteria. all animals died with tachycardia followed by ventricular fibrillation. conclusions. the cumulative theophylline doses used in this study were much higher than doses used therapeutically in humans, as demonstrated by measured blood concentrations. theophylline is thus not a trigger of mh in genetically determined swine. |
atherosclerosis and osteoporosis share an age - independent bidirectional correlation [1, 2 ], although they were considered to be independent pathologies. on one hand, low bone mass is associated with subclinical and clinical atherosclerosis, manifested as cardiovascular morbidity [4, 5 ] and mortality. on the other hand, cardiovascular disease is associated with low bone mass and with a higher risk of fragility fractures. there is no unifying theory which can explain a deterministic link between atherosclerosis and osteoporosis, if any. certainly, bone modeling and vascular calcification have common biological processes and risk factors (e.g., smoking, inactivity, and inflammation). we can cite ra among these factors, as a crossroad of atherosclerosis and osteoporosis. the main cause of mortality in ra is the cardiovascular pathology [9, 10 ]. adding to the classical cardiovascular risk (cvr) factor, chronic inflammation [11, 12 ] and disease duration contribute decisively to the excess cardiovascular mortality in ra. the background of this observation is the inflammatory pathogenesis of ra which is associated with accelerated atherosclerosis, both clinically and subclinically [14, 15 ]. therefore, eular recommends annual cvr evaluation in ra patients, knowing the fact that ra is an independent cvr factor, similar in importance with diabetes mellitus (dm). it appears early in the disease course, two times more prevalent than in the general population [18, 19 ]. adding to the risk factor of primary osteoporosis, the bone loss in ra is associated with the presence of autoantibodies, glucocorticoid therapy, disease activity (the activation of osteoclasts by mean of the rank pathway) [20, 21 ], and disability. because of the high risk of fractures in ra [22, 23 ], ra patients should routinely undergo dual x - ray absorptiometry (dxa) in order to diagnose and monitor osteoporosis. the advantage is that at the same time with dxa measurements one can evaluate the patient 's body composition. if coupled with cvr estimation, the dxa technique could become the common denominator for the complex management of atherosclerosis and osteoporosis in ra. in this context, the study aims to evaluate the correlation between the estimated cvr and whole body bone loss, emphasizing ra as a common risk factor for both conditions. the study was cross - sectionally designed to include female in - patients, admitted to the hospital in the random order of presentation for clinical and biological reevaluation. the subjects were classified as either ra patients, according to the 2010 acr / eular criteria, either as having no chronic inflammatory autoimmune disease. each patient gave written informed consent and the study was approved by the local ethics committee. the bone tissue was evaluated by a single certified clinical densitometrist (cp) using whole body dxa (wbdxa ; lexxos c05lx223), which records variables such as bone tissue density / mass (btd / m), t- and z - scores (t / zwb), and bone tissue percent (btp ; figure 1). the classic anthropometric indices, such as height, weight, abdominal circumference (ac), and hip circumference (hc), were measured using a mechanical scale (0.1 kg maximal error), a wall stadiometer (0.3 cm maximal error), and a centimeter graded tape. using these measurements, we computed the derived anthropometric indices : body mass index (bmi ; weight divided by square height), waist - to - hip ratio (whr ; ac divided by hc), conicity index (ci ; ac divided by the square root of weight to height ratio multiplied by 0.109). erythrocyte sedimentation rate (esr) was measured by the westergren method (normal range according to age). the concentration of c - reactive protein (crp) mg / l). arterial hypertension (aht) was defined after two measurements (auscultatory sphygmomanometer ; 5 mmhg error) if systolic pressure 140 mmhg, or diastolic pressure 90 mmhg, or if the patient was on blood pressure lowering therapy. ischemic heart disease (ihd) was defined on electrocardiographic criteria or on a history of acute coronary syndromes, stable angina, conduction and rhythm disturbances, and ischemic heart failure. dyslipidemia was defined as triglycerides > 150 mg / dl, total cholesterol > 200 mg / dl, low - density lipoproteins (ldl) > 100 mg / dl, high - density lipoproteins (hdl) 126 mg / dl (fpg), one fpg > 200 mg / dl, or treatment with insulin / oral antidiabetic agents. the cvr was estimated using high risk score charts, appropriate for the romanian population, and quick check and health check procam applications, according to eular recommendations. the normal distribution of data was assessed using descriptive statistics, normality and stem - and - leaf plots, and the lilliefors corrected kolmogorov - smirnov test. normally distributed data were reported as means with standard deviations and their correlations and differences were assessed with pearson coefficients and t - tests, respectively. non normally distributed data were reported as medians with intervals and their correlations and differences were assessed with spearman coefficients and mann whitney tests, respectively. qualitative data were expressed as absolute and percent frequency and their differences were assessed using tests (or fisher tests where appropriate). the influence of whole body bone tissue on cvr was studied using multiple linear regression and covariance analysis (ancova). all tests were considered significant if p 30 kg / m have a higher whole body bone mass and a lower bone percent than patients with bmi 0.1) and similar bone density. therefore, bmi - defined obese individuals must have thicker and/or wider bones. the second comment refers to the unusual behavior with regard to wbdxa bone indices when the study population sample was divided in two subgroups according to glycemia values : hyperglycemic patients behaved exactly like obese patients. it is possible that this effect is the consequence of the significantly higher obesity prevalence among hyperglycemic patients (50% ; 34/68) than in normal glycemic patients (20.5% ; 15/73 ; p < 0.001). lastly, we must mention the effect of inflammation on wbdxa bone indices, namely, that patients with elevated inflammatory markers had less bone in terms of density and body percent. moreover, inflammation markers correlated significantly with the anthropometric predictors of cardiovascular morbidity and mortality : esr correlated positively with ac (r = 0.175 ; p = 0.038) and hc (r = 0.184 ; p = 0.029) and negatively with hdl (r = 0.258 ; p = 0.002), while crp correlated positively with body mass (r = 0.215 ; p = 0.011), ac (r = 0.258 ; p = 0.002), hc (r = 0.278 ; p = 0.001), bmi (r = 0.242 ; p = 0.004), and ci (r = 0.237 ; p = 0.005) and negatively with hdl (r = 0.391 ; p < 0.001). these observations strengthen the evidence that prove the involvement of inflammation in osteoporosis and atherosclerosis, so well exemplified in ra, but also raises the question of how anthropometry influences the production of inflammatory markers. integrating these results one must bear in mind study limitations, namely, the cross - sectional design, which did not allow follow - up of these patients, the lack of bone markers measurements, and the use of a surrogate cardiovascular morbidity and mortality marker. from a deterministic point of view on atherosclerosis - bone tissue, we noted that on one hand ra patients have significantly lower whole body bone tissue indices and a significantly higher cardiovascular risk compared to normal subject, and that on the other hand inflammation is associated with lower whole body bone tissue indices and is correlated with anthropometric and nonanthropometric cardiovascular risk predictors. these wbdxa bone indices correlate significantly, independently, and negatively with cvr estimation on three different clinical scales. of all bone measurements, whole body bone percent is the best predictor of cvr, which is the reason for its possible clinical application. the connection between atherosclerosis and osteoporosis is not limited only to the correlation with cvr estimates, but we observed that patients with cardiovascular morbidity (ihd, metabolic syndrome, dm, aht, and dyslipidemia) had lower wbdxa bone indices. another established cvr factor, bmi - defined obesity, is associated with a higher whole body bone mass. this bone tissue surplus in obese patients was not accounted by whole body bone density nor by height ; therefore it is probably explained by higher individual bone thickness and/or width. | introduction. atherosclerosis and osteoporosis share an age - independent bidirectional correlation. rheumatoid arthritis (ra) represents a risk factor for both conditions. objectives. the study aims to evaluate the connection between the estimated cardiovascular risk (cvr) and the loss of bone tissue in ra patients. methods. the study has a prospective cross - sectional design and it includes female in - patients with ra or without autoimmune diseases ; bone tissue was measured using whole body dual x - ray absorptiometry (wbdxa) ; cvr was estimated using score charts and procam applications. results. there were 75 ra women and 66 normal women of similar age. the wbdxa bone indices correlate significantly, negatively, and age - independently with the estimated cvr. the whole body bone percent (wbbp) was a significant predictor of estimated cvr, explaining 26% of score variation along with low density lipoprotein (p < 0.001) and 49.7% of procam variation along with glycemia and menopause duration (p < 0.001). although obese patients had less bone relative to body composition (wbbp), in terms of quantity their bone content was significantly higher than that of nonobese patients. conclusions. female patients with ra and female patients with cardiovascular morbidity have a lower whole body bone percent. obese female individuals have higher whole body bone mass than nonobese patients. |
pseudomonas aeruginosa is a gram - negative, aerobic bacterium found in water and soil. it is a normal flora of the skin and gastrointestinal tract of human beings (1, 2). this bacterium as an opportunistic pathogen is one of the most important microorganisms in nosocomial infections in immune - compromised patients including patients with malignancies, cystic fibrosis and burns with multiple pathogenic factors and high rate of resistance to most of the antibiotics. the presence of glycocalyx in cellular membrane is responsible for easy binding of the bacterium to the host cell, biofilm formation and protection of bacteria against penetration of antimicrobial agents and phagocytic system (3). in a previous study, p. aeruginosa has been isolated from nosocomial pneumonia (16%), nosocomial urinary tract infections (12%), post - operative wound infections (85%) and hospital blood infections (10%) which included 23% of total isolated bacteria from admitted patients (4). selection of the appropriate treatment approach against p. aeruginosa is limited due to its resistance to common recommended antibiotics (5, 6). bacterial resistance to antibiotics is increasing which makes humans to apply effective antimicrobial agents with fewer side effects such as medicinal plants instead of medicines with less efficacy and greater side effects (7). plants have different chemical compounds like secondary metabolites (8, 9) with many biochemical and bioactivity properties showing applications in various industries such as pharmaceutical, chemical, cosmetic and food industry (1013). the aim of this study was to introduce the most important native medicinal plants of iran being effective on p. aeruginosa. all required information was obtained by literature review using keywords including p. aeruginosa, medicinal plant extracts or essential oils of published articles in authentic scientific databases such as science direct, wiley - blackwell, springer, google scholar, scientific information database (sid) and magiran. according to literature review, our results showed 12 different native medicinal plants were effective against p. aeruginosa in iran including eucalyptus camadulensis, marticaria chamomilla, ferula gummosa boiss, lawsonia inermis, ocimumgra tissimum, allium sativum, satureja hortensis l, satureja bachtiarica bunge, satureja khuzestanica (jamzad), thymus daenensis celak, thymus carmanicus jalals and camellia sinensis. medicinal plants are good alternatives for synthetic preservatives in food and drug industry due to their antimicrobial compounds. e. camadulensis (eucalyptus) leaves are rich in polyphenols and terpenoids and eucalyptol or cineole (26). phytochemicals results showed that alfa and beta - pinenes are the main ingredients of ferula gummosa boiss (galbanum) (27) and lawsoniainermis (henna) containsmanitol, tanic acid, mucilage and galic acid but its most important ingredient is 2-hydroxy-1,4-naphoquinone (lawson) recognized as bioactive agent. ocimumgra tissimum (basil) contains essential oils, tannins, glycosides, saponin, anthocyanin, eugenol, linalool, methyl cinnamate, camphor and thymol. different species of satureja (savory) contain monoterpenes, phenolic compounds especially carvacrol, thymol and eugenol as well as some of the sesquiterpenes. the main phytochemical essential oils of aromatic plants are hydrocarbons, aldehydes, ketones, alcohols, phenols, ethers and esters with phenolic and terpenic sources. the presence of linalool, alpha - pinene, beta - pinene, borneol, carvone, limonene, carvacrol, p - cymene and terpinenein essential oils of understudy plants showed antimicrobial properties particularly (28). these compounds with high hydrophobic properties can separate lipids from bacterial cell wall and thereby increase the permeability of the membrane which leads to ion expelling and electron imbalance and eventually cell death. the researchers demonstrated that plant species used in popular medicine are promising resources for antimicrobial treatments (13, 14, 29, 30). phytochemical analysis has shown that bioactive compounds of medicinal plants with their antioxidant and antimicrobial properties are good substitutions for synthetic drugs in food and drug industry. | background and objectives : pseudomonas aeruginosa is a gram - negative, aerobic bacterium found in water and soil. it is a normal flora in skin and gastrointestinal tract of human beings. p. aeruginosa as an opportunistic pathogen involved in nosocomial infections having multiple pathogenic factors and shows high rate of resistance to different antibiotics. the aim of this study was to identify the most important native medicinal plants of iran effective on p. aeruginosa.materials and methods : all required information was obtained by searching keywords such as p. aeruginosa, medicinal plant extracts or essential oils in published articles in authentic scientific databases such as science direct, wiley - blackwell, springer, google scholar, scientific information database (sid) and magiran.results:according to the literature review, our results showed 12 different native medicinal plants were effective against p. aeruginosa in iran including eucalyptus camadulensis, marticaria chamomilla, ferula gummosa boiss, lawsonia inermis, ocimumgra tissimum, allium sativum, satureja hortensis l, satureja bachtiarica bunge, satureja khuzestanica (jamzad), thymus daenensis celak, thymus carmanicus jalals and camellia sinensis.conclusion:phytochemical analysis has shown that bioactive compounds of medicinal plants with their antioxidant and antimicrobial properties can be good alternatives for the synthetic medicines in food and drug industry. |
goiter prevalence in school - age children is an important indicator of iodine deficiency disorders in a population. several studies [24 ] have shown that thyroid volume measured by ultrasound is the preferred indicator in epidemiological studies and monitoring of iodine deficiency disorders. nevertheless, thyroid volume measured by ultrasound needs reliable reference intervals for normal thyroid volume from iodine - sufficient populations. there are many controversial issues [513 ] about defining the reference intervals for normal thyroid volume. in 2004, zimmermann. established the international reference intervals for thyroid volume by ultrasound adjusted for age and body surface area (bsa). these were based on 3529 schoolchildren living in areas with long - standing iodine sufficiency ; age and bsa - specific upper normal limits of thyroid volume were provided by sex. these reference intervals were adopted by the world health organization (who) and iodine global network (ign) as the recommendation of thyroid volume in 2007 and suggested that the population - specific references for thyroid volume in countries with long - standing iodine sufficiency may be more accurate than a single international reference. the universal salt iodization program has been mandatory since 1994 in china ; iodine nutrition indicated by median urinary iodine concentrations (muis) is of long - standing sufficiency [14, 15 ]. however, local endemic goiter diagnostic standards, which ignored the growth and development factor of children, are now based on the reference published in 1993. we previously performed studies [17, 18 ] on the reference intervals for normal thyroid volume in schoolchildren of zhejiang province, china. however, as noted, those studies ignored the growth and development factor of children and were based on a relatively small number of observations. the objective of this study is to explore the reference interval for normal thyroid volumes in schoolchildren aged 810 years from zhejiang province and compare these with who / ign recommended references. this study was conducted in zhejiang province, an eastern coastal region of china that covers 89 counties. in the study, 30 counties from zhejiang province (figure 1) were selected by using a probability - proportionate - to - size (pps) sampling method ; the design used current census data to provide a systematic sampling of communities based on the cumulative population. next cluster sampling was applied to select one primary school from each selected county, and schoolchildren aged 810 were randomly selected in each school as investigation subjects. the sample size of pps, estimated by the n = z goiter (1 goiter)(design effect)/ formula, assumed that = 0.05, z = 1.96, goiter = 5%, = 0.02, and design effect = 2.5. the sample size equaled (1.96) 5% 95% 2.5/(0.02) = 1140, and because of loss to follow - up the investigation sample size was expanded to 1440. hence, each school randomly selected 48 schoolchildren aged 810 (24 boys and 24 girls, with 16 groups consisting of one 8-year - old, one 9-year - old, and one 10-year - old, resp.) to be investigated. the questionnaire involved demographic characteristics, including age, gender, family income level, and history of disease. the measure of height and weight was performed using who standard methods before measurement of thyroid volume, requiring the subjects to take off shoes and belt and wear light clothes. the formula of weight (kg) height (cm) 71.84 10 was used to calculate bsa (m). the instant urine samples of all subjects were collected in plastic tubes, placed at 4c before being sent to the laboratory, and analyzed for urinary iodine concentrations (uics) by spectrophotometer method (ws / t 107 - 2006). according to the recommended iodine nutrition status evaluation criteria of who, severe iodine deficiency was indicated by muis of schoolchildren 0.05). the sample included 610 boys and 603 girls, of which 380 were 8-year - olds, 419 were 9-year - olds, and 414 were 10-year - olds. on the whole, the height of all involved schoolchildren was 134.58 7.65 cm, weight was 30.48 6.70 kg, bsa was 1.07 0.13 m, and thyroid volume was 3.49 1.30 ml. meanwhile, height, weight, bsa, and thyroid volume in log scale increased with an increase of age (fheight = 265.05, fweight = 107.63, fbsa = 176.19, fthyroid volume = 101.94, and all p 0.05). mui in the involved schoolchildren was 178.30 (125.00) g l, with the percentage of samples less than 100 g muis in 30 counties were within the range of 115.50 (39.00) g l to 278.00 (121.00) g l. there were no statistically significant differences between original data and analysis data for uics (z = 0.02 ; p > 0.05). boys had higher levels of uics than girls (z = 2.09 ; p 0.05). meanwhile, there was no significant correlation in uics with height, weight, bsa, and thyroid volume in log scale (r = 0.01, 0.49, 0.51, and 0.14 ; all p > 0.05). see table s1 in supplementary material available online at http://dx.doi.org/10.1155/2016/8079704. from the result of univariate linear regression analysis, thyroid volume in log scale was significantly associated with age, height, weight, and bsa but not with sex and uics which was presented in table 2. there were strong correlations in bsa with height and weight (r = 0.86 and 0.97 ; all p < 0.05), and collinearity was considered in multivariate analysis (variance inflation factor = 1.98). hence, height and weight were excluded from multivariate analysis. from the result of multivariate linear regression analysis (table 3), only age and bsa independently were found to have a significant effect on thyroid volume in log scale after being adjusted for sex and uics ; the adjustment r was 0.39. geometric mean of thyroid volume increased with an increase of uics with significant differences in the eight - year - old groups (f = 3.59 ; p < 0.05), and there was a distinct u - shaped curve relationship between the geometric mean of thyroid volume and uics at bsa of 1.2 m (f = 4.14 ; p < 0.05), which is presented in tables 4 and s2. the results in tables s3 and s4 show that age - specific p97 of thyroid volume in boys ' and girls ' groups averaged 32.41% (28.13%34.88%) and 22.68% (19.68%24.47%) higher, respectively, than that in the 2007 who / ign recommended reference. on the other hand, bsa - specific p97 of thyroid volume in boys ' and girls ' groups, except the groups in which the number observed was less than 30, also averaged 38.64% (28.10%45.31%) and 25.81% (19.68%48.80%), higher than those in the 2007 who / ign recommended reference. the age or bsa - specific median and p97 of thyroid volume by sex in our study were compared with the who / ign recommended references data (figure 2). figure 2(a) showed that our age - specific p97 of thyroid volume in sexes combined data was very similar and nearly identical to the values found in 1993 but those in median were slightly higher than the values found in 1993. figures 2(b) and 2(c) show that age - specific median and p97 of thyroid volume in boys ' and girls ' groups were nearly similar to the values found in 2001. figures 2(e) and 2(f) showed that our bsa - specific median and p97 of thyroid volume in boys ' and girls ' groups were similar to the values found in 2001 but were higher than those that were published in 2007. overall, our p97 of thyroid volume was approximately 2030% smaller than that found in 1997, irrespective of whether thyroid volume was expressed as a function of age or bsa. the comparison of this study to the data from other national references is presented in figures s1 and s2. our age - specific median and p97 of thyroid volume data with sexes combined were very similar to data from united states and iran but were about 44% in median and 20% in p97 higher than those from japan. our age - specific p97 of thyroid volume in boys ' and girls ' groups was similar to data from malaysia and brazil but higher than that from japan and, meanwhile, smaller than that from turkey ; in girls it was similar to that from poland, but in boys, it was smaller than that from poland. however, it had different patterns in median of thyroid volume data. our age - specific median of thyroid volume in boys ' and girls ' groups was higher than that from malaysia and japan, and in boys it was similar to that from brazil, turkey, and poland, but in girls, it was smaller than that from brazil, turkey, and poland. our bsa - specific median and p97 of thyroid volume data with sexes combined were, on average, about 20%40% in median and 20%30% in p97 higher than those from united states and japan. our bsa - specific median and p97 of thyroid volume in the boys ' and girls ' groups were similar to data from malaysia, higher than japan, and lower than those in italy. comparisons of previous reports about thyroid volume in zhejiang province are shown in figure 3. our age - specific p97 of thyroid volume data with sexes combined was very similar to the data of zhejiang in 2005 but higher than the data from boys and girls of zhejiang in 2010, respectively. our age - specific median of thyroid volume data with sexes combined was lower than the data of zhejiang in 2005 but higher than the data from boys and girls of zhejiang in 2010, respectively. meanwhile, our bsa - specific median and p97 of thyroid volume in boys ' and girls ' groups were also higher than the data of zhejiang in 2010. in this study, the mui in the study 's schoolchildren was 178.30 g l, which was similar to the data reported in germany (183.00 g l) and bahrain (178.00 g l) but higher than that in turkey (53.00 g l), bangladesh (73 g l), switzerland (115 and 118.00 g l) [11, 13 ], sweden (125.00 g l), malaysia (132.80 g l), netherlands (154.40 g l), and poland (126.60155.10 g l) and less than that in south africa (191.00 g l), iran (212.00 g l), peru (253.00 g l), philippines (279.00 g l), the united states (282.00 and 285.00 g l) [10, 13 ], japan (281.60 and 288 g l) [13, 36 ], and brazil compliance with the universal salt iodization program has been mandatory since 1994 in zhejiang province, china, which was identified as iodine sufficient for decades in several sustained surveys from 1995 to 2011. in our study, l, and the percentage of total samples, which was less than 50 g l, was less than 5%. thus, most schoolchildren in our study population have spent their entire life in long - standing iodine - sufficient areas. meanwhile, it is important to include subjects considered normal for reference, so those schoolchildren who had a history of thyroid disease or thyroid nodules or did not use the qualified iodized salt or did not submit complete information were excluded before the data analysis. overall, we feel confident that our sample was from long - standing iodine - sufficient areas and included normal subjects. it is well known that thyroid volume could be affected by genetic features in growth and development as well as environmental factors, including different iodine dietary intakes [13, 31, 36 ]. muis in our samples indicated iodine sufficiency, so genetic features in growth and development may have mainly contributed to the influence on thyroid volume. in our study, as in others [30, 31, 35, 36, 39 ], bsa and age, independently of each other, significantly positively influenced thyroid volume ; these parameters are used to assess thyroid volume as adjusted predictors. however, regarding the correlation between thyroid volume and sex, uics were not obtained, and these findings were in line with the results reported in most iodine - sufficient areas [10, 36, 37 ]. interestingly, in thyroid volume, no differences in bsa and weight have been found between boys and girls, but significant difference in height suggested that height might not be an important predictor of thyroid volume compared to weight and bsa. moreover, because only a 31% variation of thyroid volume can be determined by age and bsa on the multivariate linear regression, the major variation of thyroid volume could be explained by other factors, such as race, and significant differences in thyroid volume exist between several countries. therefore, the new international reference supports the use of a single, site - independent set of references in different countries. until now, the local thyroid volume reference data had been established in many countries [9, 11, 30, 32, 33, 36, 37 ]. the p97 of thyroid volume in our study of both sexes was higher than the new international reference in 2007, irrespective of whether it was expressed as a function of age and bsa, and similar to the reference in 1993 and 2001 but lower than the reference in 1997, when the data had a systematic measures bias that resulted in higher values, which were corrected to issue the reference in 2001. the larger thyroid volume was probably not determined by lower muis than those (muis : 203 g l) in the new international reference population because there is no overall correlation between thyroid volume and uics during times of iodine sufficiency [13, 18 ], which was consistent with the results of our study, as mentioned earlier, although with a slight difference between the two at 8 years of age and 1.2 m of bsa. two earlier studies reported thyroid volume in schoolchildren of zhejiang province [17, 18 ], which provided earlier data for this study, although there were some limitations in those studies. compared with the data from the study in 2005, the age - specific p97 of thyroid volume in our study was very similar to those reference values, indicating the reproducibility of the results. unfortunately, the growth and development factors of children were not measured in the study of 2005, so the bsa - specific p97 could not be presented. the data from the study in 2010 was applied by polynomial regression to fit the data, but this study was based on a relatively small number of observations with a larger age range. in the comparison of thyroid volume in different countries, as in the results of zimmermann., there were significant differences between countries in age and bsa - adjusted p97 of thyroid volume. at the age - specific p97, our values were similar to the data reported in malaysia, the united states, iran, and poland in girls from iodine - sufficient areas and the data reported in brazil from iodine - excessive areas but higher than those in japan from iodine - sufficient areas and lower than those in turkey and poland in boys from iodine - sufficient areas. at the bsa - specific p97, our values were similar to the data reported in malaysia but higher than those in japan and united states and lower than those in italy from iodine - sufficient areas. overall, the p97 of thyroid volume in our study by age and bsa was similar to those in malaysia, which is located in southeast asia near the southern area of china, and it had almost the same age composition as our two samples. however, our p97 values were far higher than those in japan, near the northeast area of china, which is a special one with small thyroid gland volume and high iodine excretion. meanwhile, our p97 values were lower than those in european counties such as turkey, whereas iodine deficiency control programs have not been successful up to recent years, and the higher values may reflect moderate iodine deficiency (muis : 53 g l), and as in poland and italy, whereas these differences could be attributed to the differences in body size or ethnicity in these samples. there were some limitations in this study. first, precision was not estimated by examining thyroid volume of the same subjects twice, although thyroid volume in our study was examined by a single experienced operator. second, it is difficult to calculate the interobserver variation with the new international reference of 2007, which could contribute partially to the difference between two samples. third, the sample size of some bsa - specific groups of children, especially for 0.7, 1.4, and 1.5 m groups, is not enough to make final decision. our data suggested that the iodine nutritional status in zhejiang province was at an adequate level. thyroid volume in our study shows a significant correlation with age and anthropometric measurements, independent of each other. the p97 of thyroid volume in our study was larger generally than the new international reference and similar to the previous who / ign reference, which on the one hand appears acceptable for local use. because of the limitations mentioned earlier, another study should be performed to complete the regional reference. | objective. thyroid volume measured by ultrasound to define goiter needs reliable local thyroid volume reference from iodine - sufficient populations. the aim of this study is to explore the reference interval for normal thyroid volume in schoolchildren aged 810 years from zhejiang province, china. methods. a probability - proportionate - to - size sampling method was applied to select a representative sample of 1213 children aged 810 years in zhejiang province to detect the thyroid volume, salt iodine, and urine iodine. results. median urinary iodine concentration in involved schoolchildren was 178.30 (125.00) g l1, with the percentage of samples less than 100 g l1 as 12.69% and more than 300 g l1 as 15.25%. thyroid volume was significantly correlated with age and anthropometric measurements independently of each other. the 97th percentile of thyroid volume in our study was larger generally than the new international reference. conclusions. the iodine nutritional status in zhejiang province was at an adequate level. despite some limitations in this study, we initially established the reference values for thyroid volume in 810-year - old schoolchildren in zhejiang province, china, as a local reference to be used for monitoring iodine deficiency disorders. |
graves disease and hashimoto s thyroiditis are two common auto - immune diseases of thyroid gland. hashimoto s thyroiditis or chronic lymphocytic thyroiditis is the most common cause of goiter in regions with no iodine deficiency. in this disease graves disease is the most common cause of hyperthyroidism. due to limitations in physical examination of the thyroid gland and recent advances in sonographic technology, nowadays, ultrasonography is being increasingly used to assist in the diagnosis of thyroid diseases. sonograhphy is safe as it does nt use ionizing radiation and does not cause tissue damage. it is also more affordable than the other imaging modalities. since it is a noninvasive modality, patients are comfortable during the process. thyroid sonography is conventionally used in the evaluation of thyroid nodules and during their fine needle aspiration biopsy. thyroid echogenicity and calcifications as well as their patterns are easily detected by this modality. differentiation of euthyroid graves disease from euthyroid hashimoto s thyroiditis may sometimes be extremely difficult on the basis of clinical and laboratory findings such as thyroid antibodies. since sonography has so many advantages as mentioned above, it should be highly helpful if the aforementioned two of the most common diseases could be differentiated from each other. the objective of this study is to determine the sensitivity and specificity of ultrasonography in the diagnosis of graves disease and hashimoto s thyroiditis. this is tried by comparing the sonographic findings of the thyroids in these two diseases looking for any possible differences. this is a test assessment study which compares gray scale sonography with clinical and lab data which are the gold standards in the diagnosis of graves disease and hashimoto s thyroiditis. laboratory data included measurements of thyroid hormone levels and anti - thyroid antibodies (anti - thyroid peroxidase and anti - thyroglobulin). excluded from the study were patients with uncertain diagnosis of graves disease or hashimoto s thyroiditis, those with history of thyroid surgery and also patients with palpable nodules. 96 patients (34 graves and 62 hashimoto s disease) whose diseases had been definitely diagnosed were included in the study. the mean age of patients in graves group was 36.82 10 years and that of those in hashimoto s group was 35.4 10 years. the mean age of patients in the control group was 34.74 16.84 years (table 1). were referred to a single radiologist for sonographic examination of the thyroid gland and the description of sonographic findings such as patterns of echogenicity and nodularity. five patterns of echogenicity in the thyroid gland were evaluated in this study as is described : homogeneous hypoechogenicity, peripheral hypoechogenicity, central hypoechogenicity, homogeneous isoechogenicity, and homogeneous hyperechogenicity. the ultrasound study was performed using medison accuvix v10 sonography unit with 10 mhz linear transducer. thyroid gland echogenicity was compared with patient s submandibular glands and the gain of sonographic system was set to produce an echo free appearance in the lumen of internal jugular vein and carotid artery. statistical analyses were performed using the statistical package for social sciences software, version 15.0 for windows (spss 15.0). 86 patients were positive for anti thyroid peroxidase (anti - tpo) and in 77 had higher than normal anti - thyroglobuline levels (anti tg). in normal cases anti - tpo was 100% negative but only in one control group case (1.88%) anti tg was positive (table 2). in fact the positivity of anti - tpo and anti tg between the three groups was significantly different (p<0.0001). graves and hashimoto s groups nodularity was detected in 26.4%, 29.4% and 29% respectively, so that the positivity of nodularity was not significantly different in three groups (p=0.937) (table 3). homogeneous hypoechogenicity was seen in 45.2% of hashimoto s cases, 47.1% of graves disease cases and 9.4% of control group (table 4). according to these results homogeneous peripheral hypoechogenicity was the second most common pattern in hashimoto s thyroiditis which was detected in 40.3% of cases. alternatively, it can be said 83.3% of patients with peripheral hypoechogenicity were in hashimoto s thyroiditis group and 60% of central hypoechoic patterns were in graves group (table 4). the most common pattern of echogenicity control group was homogeneous isoechogenicity which was observed in 49.1% of cases. the next pattern was homogeneous hyperechogenicity that was seen in 41.5% of the cases (table 4). homogeneous hypoechogenicity in hashimoto s thyroiditis had a specificity and sensitivity of 90.6% and 45.2%, respectively. in case of patients in graves disease the above percentage were 90.6% and 47.1%, respectively (table 5). central hypoechogenicity in graves disease had 100% specificity and 17.6% sensitivity (table 5). although in some previous studies it has been declared that there is no significant correlation between thyroid echogenicity and serum anti - tpo titers, but zheng determined that patients with thyroid parenchymal low echogenicity have a more chance of being positive for anti - tpo and anti tg. as seen in table 2, in our study hashimoto s group patients selected had positive anti - tpo and anti tg. as depicted in to table 3, the frequency of nodularity in our study was 28.18% which is close to the findings of anderson. some other studies reported nodularity of 42%. in this study different echogenity patterns including peripheral and central hypoechogenicity were evaluated. to the best of our knowledge presence of these patterns has not been evaluated in previous studies in the diagnosis and/or differentiation of graves disease and hashimoto s thyroiditis. as seen in table 4, the most common sonographic pattern in our patients with hashimoto s disease was homogeneous hypoechogenicity which is not consistent with the findings of marcocci. marcocci also demonstrated that thyroid hypoechogenicity is not specific for hashimoto s thyroiditis and may be observed in graves disease or sub - acute thyroiditis. this has been confirmed by vitti who suggested that thyroid hypoechogenicity is characteristic for auto - immune thyroid disease including hashimoto s and graves disease. our results reveal that hypoechogenicity is not specific for hashimoto s thyroiditis and can also be seen in graves disease. thyroid echogenicity is significantly low in graves disease, and there is a correlation between thyroid echogenicity and anti - thyroid antibodies level. in patients with normal thyroid sonography none of control cases had peripheral or central hypo echogenicity and this means that any patient with these patterns of echogenicity should be evaluated for auto - immune thyroid disease. moderate to severe hypoechogenicity can predict thyroid auto - immune disorders, even without clinical suspicion. as shown in table 5, sonography has a high specificity (90.6%) but low sensitivity (47.1% and 45.2%) in the diagnosis and differentiation of gravesdisease and hashimoto thyroiditis. these findings are similar to those of tabur : they found that sonography has high specificity (90%) and low sensitivity (35%) in thyroiditis. however kim found 92.1% specificity and 87.7% sensitivity for sonography in determination of asymptomatic cases of diffuse thyroid disease. in conclusion, our findings indicate that because of low sensitivity of sonography, differentiation between graves disease and hashimoto s thyroiditis is not possible but due to high specificity it can differentiate normal thyroid from graves disease or hashimoto s thyroiditis. it is suggested that if thyroiditis or graves disease is defined by sonography, it should be further confirmed by clinical and laboratory with laboratory data. | objective : graves disease and hashimoto s thyroiditis are the most common causes of hyper and hypothyroidism, respectively. differentiation of these 2 diseases, if the patient is euthyroid, may sometimes be extremely difficult on the basis of clinical and laboratory findings. the purpose of this study was to determine the sensitivity and specificity of gray scale sonography in differentiation of graves disease from hashimoto s thyroiditis. methods : this study included 149 patients divided into three groups, patients with graves disease (34 patients, mean age = 36.8 10.17 years), patients with hashimoto s thyroiditis (62 patients, mean age = 33.4 12.16 years) and control group (53 healthy people, mean age = 34.74 16.87 years). members of all groups were referred to a single radiologist for thyroid sonography for evaluation of thyroid echogenicity pattern. results : a total of 117 women and 32 men were examined by sonography. the most common sonographic pattern in hashimoto and graves was homogenous hypo - echogenicity which was observed in 45.2% and 47.1% of cases, respectively. peripheral hypo - echogenicity pattern was seen in 40.3% of hashimoto s group with 100% specificity and 40.3% sensitivity. central - hypoechogenic pattern was observed in 17.6% of graves group with 100% and 17.6% specificity and sensitivity, respectively. conclusion : our findings indicate that sonography has high specificity but low sensitivity in the diagnosis of either graves disease or hashimoto s thyroiditis. it is therefore not possible to differentiate between these two diseases using sonography alone. confirmation by laboratory data is also needed. |
the development of multicellular systems requires that multipotent progenitors differentiate into specialized lineage - restricted daughter cells. the adoption of a particular cell fate by multipotent cells is orchestrated by networks of transcription factors, which act to coordinate changes in gene expression commensurate with the ultimate function of the cell fate in question. commitment of multipotent cells to a particular lineage often requires the silencing of gene products that are incompatible with the function of end - product cells. for instance, during hematopoiesis, erythroid and myeloid lineage genes are silenced during the generation of lymphocyte - biased progenitors (miyamoto., 2002) and b cell and myeloid - affiliated genes understanding the regulation of cell fate decisions in hematopoiesis should provide insights into the development of a wide array of multicellular systems and lead to strategies to enhance or limit the generation of particular cell types. these include ikaros and pu.1, which promote the generation of lymphoid - biased precursors, and early b cell factor-1 (ebf1), pax5, and the e2a isoforms e12 and e47 (encoded by the tcf3 locus), which coordinate the differentiation of lymphoid progenitors into lineage - restricted pro - b cells (reviewed in mandel and grosschedl, 2010). given that each of these factors is essential for generating b cell lineage precursors, much work has been devoted to identifying regulated and coregulated target genes. ebf1, pax5, and tcf3 gene products synergize to activate the expression of the pre - bcr components 5 and vpreb and the b cell signaling protein ig- (encoded by igll1, vpreb1, and cd79a, respectively) (reviewed in busslinger, 2004 ; hagman and lukin, 2006). notably, pax5, ebf1, and tcf3 gene products are each proposed to suppress differentiation of alternative fates (ikawa., 2004 ; nutt., 1999 ; pongubala., regard, pax5 is regarded as the dominant determinant of b cell commitment, because deletion of pax5 in pro - b cells or mature peripheral b cells allows these cells to adopt alternative fates (cobaleda., 2007 ; mikkola., 2002). a key but unresolved question is whether e12 and e47 and/or ebf1 promote b cell lineage restriction by collaborating with pax5 or whether these factors are components of distinct transcriptional circuits important for acquiring and perhaps maintaining b cell identity. in the thymus, the t cell program is initiated when the earliest defined t cell precursors (etps) encounter ligands for the notch receptor family (sambandam., 2005). stimulation of notch1 on etps by the notch ligand delta - like-4 (dl4) promotes the expression of t - cell - affiliated transcription factors including tcf1 (encoded by tcf7), which in turn promotes the expression of many genes required for t cell function (weber., 2011). however, early t cell development is also controlled by the zinc finger transcription factor gata3. indeed, gata3 is essential for very early t cell development in the thymus beginning at the etp stage (hendriks., 1999 ; taghon., 2007), and optimal notch1 expression may require gata3 (wei., 2011). suppression of the t cell fate in b cells is thought to occur through the pax5-driven repression of notch1 (souabni., 2002). however, we showed previously that ebf1 prevents myeloid and t cell differentiation when introduced into pax5 progenitors (pongubala., 2008). the latter observation suggests that pax5-independent transcriptional pathways may also regulate b cell lineage restriction, while also raising questions about the mechanism(s) employed by ebf1 to constrain t cell differentiation. here, we utilize a series of gain- and loss - of - function approaches to uncover the transcriptional mechanism underpinning ebf1-mediated suppression of t cell development. our findings indicate that ebf1 limits early t cell differentiation by directly repressing gata3 transcription and suggest that ebf1 silences gata3 expression by promoting repressive histone modifications across gata3 regulatory regions. these data identify a transcriptional circuit critical for preventing t cell differentiation and adopting the b cell fate. lymphoid - biased progenitors in the bone marrow (bm), also referred to as common lymphoid progenitors (clps) (kondo., 1997), can be subdivided into several subpopulations. more mature b - cell - lineage - biased progenitors within this heterogeneous population are also termed pre - pro - b cells and are characterized by progressive loss of t cell potential coincident with expression of the surface proteins b220 and/or ly6d (inlay., 2009 ; rumfelt., 2006). other researchers have employed a 5 transgene to mark b - cell - lineage - biased precursors in these pools (mansson., 2008). given the rarity of these cells (less than 0.2% of all bm cells) and the diverse approaches used to resolve these populations, we developed a flow cytometric strategy based on differential surface expression of b220 and ly6d on lymphoid - biased progenitors defined previously as lineage(lin)cd19il-7rflt3sca1c - kit (allman., 2003). with this approach we resolved three populations of il-7rflt3sca1c - kit cells defined as b220ly6d, b220ly6d, and b220ly6d in both wild - type and ebf1 mice (figure 1a and figure s1a available online). coexpression of b220 and ly6d correlated with increased ebf1, pax5, and rag1 expression (figure s1b), and when sorted from wild - type mice, the b220ly6d subset possessed fewer cells with t cell lineage potential (figure 1b ; inlay. notably, however, although ebf1 b220ly6d precursors were not substantially altered in number or phenotype compared to their wild - type counterparts (figure 1a), they exhibited increased t cell lineage potential in both bulk and single - cell cultures (figures 1b and 1c). these data extend past analyses (zandi., 2008) by showing that ebf1 constrains t cell potential as b - cell - lineage - biased b220ly6d progenitors give rise to b - cell - lineage - restricted precursors. to test directly whether ebf1 prevents very early t cell differentiation independently of pax5, we sorted bm progenitors from pax5 fetal liver, transduced these cells with control or ebf1-expressing retrovirus, and then resorted transduced (gfp) cells onto op9-dl4 stromal cells. as shown (figure 2a), despite stimulation with dl4, upon enforced ebf1 expression, pax5 progenitors generated substantially fewer t lineage cells compared to controls. enforcing ebf1 expression also prevented t cell development from ebf1 and pax5 lsks transduced with an active allele for notch1 (icn1) (figures 2b and s2). likewise, ebf1 prevented t cell differentiation from progenitors transduced with the notch1 target tcf7 (encoding tcf1) (figure 2c ; weber., 2011). these data indicate that ebf1 can override t - cell - lineage - promoting signals mediated by the notch1-tcf1 pathway and further support the notion that ebf1 limits cell - intrinsic t cell potential in lymphoid precursors independently of pax5. to test whether ebf1 represses the expression of essential t cell lineage genes, we transduced an ebf1 progenitor cell line corresponding to pre - pro - b cells with ebf1 (pongubala., 2008) and analyzed changes in gene expression on affymetrix microarrays. in these experiments, transcripts for gata3 declined reproducibly, whereas notch1 and tcf7 transcript levels as well as the t cell lineage regulator bcl11b were not altered or increased slightly (figure s3a). we repeated these analyses but with quantitative rt - pcr and locus - specific probes in ebf1 progenitors transduced with virus encoding ebf1 and/or pax5. transduction with ebf1 or pax5 led to the expected upregulation of transcripts for igll1 and vpreb1 encoding components of the pre - bcr, and cotransduction with ebf1 and pax5 resulted in a synergistic increase in abundance of these transcripts (figure 3a). ebf1 transduction did not perturb tcf7 transcription substantially and appeared to drive a modest increase in notch1 expression that was overridden by coexpression of pax5. in sharp contrast, ebf1 transduction consistently induced an 80% decline in gata3 transcript abundance (figure 3a, top left). pax5 transduction, by comparison, led to only a modest reduction in gata3 transcripts, and cells cotransduced with ebf1 and pax5 mirrored transduction with ebf1 alone. introduction of ebf1 into a pax5 pro - b cell line (schaniel., 2002) also repeatedly resulted in a 50% decline in gata3 transcripts (figure 3b), and ebf1 expression continued to promote the downregulation of gata3 transcripts in cells cotransduced with icn1 or tcf1 (figure 3c). next, we analyzed gata3, notch1, and tcf7 transcript abundance in wild - type and ebf1 lincd19il-7rflt3sca1c - kitb220 bm lymphoid progenitors subdivided based on differential ly6d surface expression (see figure 1). remarkably, wild - type b220ly6d progenitors exhibited a 7- to 10-fold decrease in gata3 transcripts compared to cells within the less mature b220ly6d fraction (figure 3d), indicating that decreased gata3 expression correlates with loss of t cell lineage potential. furthermore, ebf1 b220ly6d precursors exhibited a robust increase in gata3 transcripts compared to their wild - type counterparts to levels found in wild - type b220ly6d progenitors. in contrast, we observed only a modest increase in notch1, tcf7 transcripts in b220ly6d precursors lacking ebf1. as expected, expression of the canonical ebf1 target igll1 was severely decreased in ebf1 b220ly6d progenitors (figure 3d, right - most panel). these data, together with the data in figure 1, show that deletion of ebf1 results in increased gata3 transcripts and a corresponding increase in t cell lineage potential in b - cell - lineage - biased lymphoid progenitors, implicating ebf1-mediated repression of gata3 as an important event in early b cell development. given that early b cell development involves collaborative interactions between ebf1 and the e12 and e47 transcription factors encoded by the tcf3 gene (lin., 2010 ; sigvardsson., 1997), we tested whether ebf1-driven downregulation of gata3 mrna expression required tcf3-encoded proteins. for these experiments we employed 4-hydroxytamoxifen (4-oht)-responsive fusion proteins consisting of either the e47 or ebf1 coding regions fused to a mutated ligand - binding domain of estrogen receptor- (referred to as e47:er or ebf1:er, respectively) (kikuchi., 2008 ; xu and kee, 2007). these constructs were introduced into tcf3 or ebf1 progenitors and routinely resulted in nearly 100% gfp cells (not shown). notably, whereas induction of e47:er in tcf3 progenitors led to only a 2-fold decrease in gata3 transcripts 12 hr later (figure s3b), induction of ebf1:er expression resulted in a 5-fold decrease in gata3 mrna within 12 hr, similar to experiments with ebf1 progenitors (figure s3c). moreover, after only 4 hr, induction of ebf1:er in tcf3 progenitors led to a significant loss in gata3 transcript abundance (figure s3c, left). as expected, in this system induced ebf1:er caused robust increases in igll1 transcripts (figure s3c, right). these data indicate that silencing of gata3 expression by ebf1 does not strictly require e2a proteins. first, we tested whether inhibition of protein synthesis with cycloheximide (chx) prevents ebf1-driven decreases in gata3 transcripts. gata3 downregulation still occurred when transduced tcf3 or ebf1 progenitors were preincubated with chx for 8 hr before adding 4-oht (figure s3d). likewise, increases in igll1 transcripts were also intact in chx - pretreated cells (figure s3e). to test further the possibility that ebf1 mediates silencing of gata3 indirectly by activating an unknown transcriptional repressor, we determined whether conversion of ebf1 into an obligate repressor prevented ebf1-mediated downregulation of gata3. to this end we fused the dna binding domain of ebf1 to the drosophila engrailed repression domain (fang., 2007 ; vickers and sharrocks, 2002). the resulting ebf1-engrailed protein readily repressed transcription of igll1 when introduced into ebf1 pre - pro - b cells (figure 4a, left) however, ebf1-engrailed continued to decrease transcript abundance for gata3 similar to wild - type ebf1 (figure 4a, right). together we utilized the ecr - browser database (http://ecrbrowser.dcode.org) to determine whether the gata3 locus contains conserved ebf1 binding sequences. we noted two such sites within the gata3 locus, one upstream of the gata3 promoter 1b (site a, 2,350 bases from the transcriptional start site 1b) and a second site within the second intron (site b, 3,290 bases downstream of transcriptional start site 1b) (figure s4a). notably, past data indicate that the intronic regions of gata3 play fundamental roles in regulating its expression (hwang., 2002). we performed chip experiments with ebf1 antibodies and pcr primers flanking either putative ebf1 binding site (table s1). target populations included cd19 bm b lineage cells, the ebf1 progenitor cell line, and wild - type cd3 splenic t cells. we observed a 4- to 6-fold enrichment in ebf1 binding at each site in cd19 bm cells but not ebf1 progenitors or peripheral t cells (figure 4b). we also failed to detect ebf1 binding from a gene desert region on mouse chromosome 6 in ebf1 progenitors and cd19 bm cells (not shown). in addition, a 24 base pair biotin - labeled dna probe encompassing site a led to formation of a protein - dna complex in electrophoretic mobility shift assays using nuclear extracts from 293 t cells transfected with a his6-tagged version of ebf1, which was super - shifted by an anti - histidine antibody. this complex failed to form when we used a probe in which the putative ebf1 site was mutated and was reduced substantially upon inclusion of an unlabeled wild - type cd79a probe containing a canonical ebf1 binding site (figure s4b). these data further support a model whereby ebf1 mediates the direct repression of gata3 transcription. to probe the mechanism underlying repression of gata3, we tested whether ebf1 promotes epigenetic changes proximal to ebf1 binding sites associated with transcriptional repression. first, we explored the possibility that ebf1 promotes dna methylation of cpg residues. though the gata3 promoter and second intron both contain prominent cpg islands adjacent to the ebf1 binding sites (attema., 2007), by sodium bisulfite sequencing we did not detect changes in the methylation status of these regions in multipotent lymphoid progenitors versus pro - b cells (not shown). because gene silencing can be mediated by histone modifications independently of dna methylation (kondo., 2008), we also evaluated repression - associated histone - methylation signatures upon ectopic ebf1 expression. we performed chip experiments with a h3k27me3-specific antibody, because stable transcriptional silencing is tightly associated with trimethylation of h3k27 (table s1 ; barski., 2007). cd19 bm cells were highly enriched for h3k27me3 marks in the gata3 locus, although this was not the case for ebf1 progenitors (figure 4c). again, the gene desert region on chromosome 6 was included as an additional negative control (data not shown). furthermore, transduction of ebf1 progenitors with ebf1 readily induced the acquisition of h3k27me3 marks on chromatin surrounding both ebf1 binding sites (figure 4d). these data suggest that ebf1 orchestrates epigenetic changes at the gata3 locus by directly or indirectly recruiting polycomb (pcg) group complexes that impart repressive h3k27me3 modifications to this region. we sought to test whether ectopic expression of progenitors with gata3 would bypass ebf1-mediated suppression of t cell differentiation. to this end we cotransduced ebf1 progenitors with ebf1 and gata3 before sorting these cells on op9-dl4 cultures. however, consistent with past work indicating that transduction of lymphoid progenitors with gata3 readily induces apoptosis (taghon., 2007), there was a progressive decline in viable gata3-positive cells after transduction (figure s5a). we also considered generating transgenic mice as an alternative approach to achieving increased gata3 expression. however, given that gata3 expression is regulated by distal enhancer elements (hosoya - ohmura. consequently, we tested whether blocking ebf1 binding to gata3 regulatory sites prevented ebf1-driven suppression of early t cell differentiation. indeed, we reasoned that a failure of ebf1 to bind to and repress the gata3 locus should result in increased gata3 expression, thereby providing an alternative approach for increasing gata3 expression in lymphoid progenitors. to this end, we designed a retroviral construct (pmx-6zfp) to express a synthetic hexa - modular zinc - finger protein (6zfp) specific for an 18 base region including the last seven nucleotides of the 8 base core ebf1 binding site between exons 1a and 1b (site a) of the gata3 locus (figure s5b). we were unable to engineer a zn - finger protein to block binding of ebf1 to site b because of inadequate target site overlap requirements (see experimental procedures). the individual modular domains of 6zfp were linked via a polydactyl zinc finger assembly strategy for recognizing extended sequences (gonzalez., 2010). a vp64 transcriptional activation domain was included to counter any potential stalling effect of 6zfp on endogenous transcription (beerli., 2000), and a hemagglutinin (ha) tag was added for assessing 6zfp binding to particular dna segments. control constructs included retroviruses lacking a polypeptide encoding insert (pmx) and a second construct encoding an unrelated nonfunctional peptide (pmx - ss). significantly, after transduction of wild - type lsks with pmx-6zfp, the 6zfp protein readily occupied site a as predicted, but we were unable to detect occupancy of 6zfp at site b or at canonical ebf1 binding sites within the cd79a or igll1 loci (figure 5a). in contrast, pmx - transduced cells failed to exhibit 6zfp enrichment at any of these sites. pax5 progenitors were transduced with yfp - marked ebf1 virus and/or one of the aforementioned pmx constructs and then cultured on op9-dl4 stromal cells for 7 days. as shown (figure 5b), whereas ebf1 expression alone led to the expected reduction in thy1.2cd25 t lineage cells, cotransduction with ebf1 and pmx-6zfp but not with ebf1 and either control pmx constructs restored numbers of t lineage cells to 50% of that observed in cells transduced with pmx-6zfp alone (pmx - ss data not shown). as expected, 6zfp expression led to decreased enrichment for ebf1 between exons 1a and 1b without affecting ebf1 binding between exons 2 and 3 (figure 5c). moreover, cotransduction with pmx-6zfp and ebf1 restored gata3 mrna levels to 50% of ebf1-transduced cells (figure 5d), and pmx-6zfp expression alone increased gata3 mrna levels 2-fold compared to cells transduced with pmx (not shown). notably, the increased levels of gata3 induced with 6zfp expression correlated with decreased differentiation of b220cd19 b lineage cells from wild - type fetal liver cells cotransduced with ebf1 (figure 6a), suggesting that elevated gata3 mrna levels, in part due to reduced ebf1 occupancy within site a, perturbed early b cell development. to test this hypothesis directly, we introduced pmx or pmx-6zfp into bm lsks and clps sorted from either vav transgenics or vavgata3 mice and then sorted gfp cells from these cultures onto op9 stromal cells. strikingly, although 6zfp prevented b cell differentiation when introduced into gata3-competent lymphoid progenitors, early b cell differentiation was restored upon deletion of gata3 (figure 6b). altogether these findings indicate that direct ebf1-mediated repression of gata3 transcription is critical for extinguishing t cell lineage choice and allowing lymphoid progenitors to adopt the b cell fate. finally, to probe whether ebf1 can repress gata3 in t - lineage - committed cells, we assessed whether survival of gata3-dependent tcf3 1.f9 thymoma cells (xu and kee, 2007) is perturbed upon introducing ebf1. transduction of 1.f9 cells with ebf1 led to a 5-fold reduction of gata3 transcript abundance in these cells (figure s6a). whereas control virus did not affect viability over 8 days, introducing ebf1 decreased cell viability to less than 20% within 4 days (figure s6b). consistent with past data (xu and kee, 2007), loss of viability correlated with accumulation of the active form of proapoptotic caspase 3 (figures s6c). moreover, both cell death and active caspase 3 generation were reversed upon enforced coexpression of ebf1 and gata3 in 1.f9 cells (figures s6d and s6e). these data further support a model whereby ebf1 constrains t cell differentiation by silencing gata3 expression and further suggest that ebf1 may limit t cell development by perturbing gata3-dependent survival mechanisms. our results provide insights into the transcriptional circuitry responsible for generating early b - cell - lineage - restricted precursors. whereas deletion of ebf1 in b - cell - lineage - biased lymphoid progenitors catalyzed an increase in gata3 transcript abundance concurrent with a rejuvenation in their t cell potential, enforcing ebf1 repressed t cell differentiation and gata3 mrna levels, even in pax5-deficient progenitors and despite ectopic notch1 and tcf1 activity. perhaps most notably, perturbation of ebf1 binding at a gata3 regulatory region interfered with ebf1-driven suppression of early t cell differentiation, concomitantly preventing b cell differentiation due to increased gata3 expression. ebf1 is an indispensible component of the transcriptional regulatory framework required for generating pro - b cells. within this network of transcription factors, e2a proteins activate the expression of ebf1 and foxo1, and subsequently ebf1 works in concert with e12 and e47 and foxo1 to promote pax5 expression (lin., 2010). although these previous studies demonstrate synergism between these transcription factors to activate certain key b - cell - specific molecules, they also raise questions about how specific components of this network might collaborate to constrain alternative fates. because pax5 is essential for establishing and maintaining b cell identity (cobaleda., 2007 ; 2002), one view would be that b cell lineage restriction is mediated chiefly and perhaps exclusively by pax5. however, our results highlight the ability of ebf1 to suppress t cell differentiation of pax5-deficient progenitors without an immediate decline in notch1 transcripts. furthermore, unlike many genes that are upregulated by ebf1, our data suggest that ebf1 represses gata3 transcription without input from e2a proteins. therefore, we propose that b cell lineage restriction is controlled by two or more separate transcriptional pathways, with pax5 and ebf1 repressing notch1 and gata3 expression, respectively. moreover, in light of past data indicating that e2a proteins are unique among b cell regulatory transcription factors in their ability to repress erythroid differentiation (ikawa., 2004), b cell lineage commitment may be facilitated by a variety of transcriptional and temporally distinct mechanisms. in this model, e2a proteins would silence erythroid and perhaps myeloid potentials as lymphoid - biased progenitors develop, ebf1 would silence t cell potential as well as residual myeloid potentials during adoption of the b cell fate, and pax5 would silence alternative fates after the generation of pro - b cells. this viewpoint is consistent with recent data suggesting that suppression of alternative fates during t cell commitment also requires the activity of multiple transcriptional pathways (zhang., 2012). further work, including an evaluation of the potential role played by ebf1 in maintaining mature b cell identity and the role of other transcriptional regulators and cofactors in this process, may shed additional light on whether maintenance of the b cell fate also requires input from multiple transcription factors. although the role of gata3 in peripheral t cell differentiation has been studied intensively (amsen., 2007 ; fang., 2007), recent studies together with our findings emphasize the essential role played by gata3 in very early stages of t cell development. in the thymus, notch1 signaling in early t lineage cells induces the expression of additional regulators including hes1 and tcf7. in turn, tcf1 promotes the expression of numerous genes required for t cell development and function (weber., 2011), but tcf7-deficient mice continue to generate t cells, albeit with decreased numbers (schilham., 1998). by contrast, gata3-deficient progenitors fail to generate t lineage cells beyond the etp stage of early thymocyte development (hendriks. indeed, recent data suggest that gata3 activity may be essential for optimal notch1 expression in etps, as shown by the fact that gata3 binds to the notch1 promoter in early thymocytes and that deletion of gata3 in thymocytes reduces notch1 transcripts (wei., 2011). moreover, gata3 occupies distinct sets of regulatory regions at different stages of thymocyte development (zhang., 2012), suggesting that gata3 regulates many diverse aspects of t cell development downstream of notch1 activation. the latter viewpoint is supported by our data showing that ebf1 prevents t cell differentiation despite ectopic notch1 activity or enforced tcf1 expression. altogether, these collective observations indicate that gata3 constitutes a prime target for regulatory pathways that silence the t cell fate in early b lineage cells. the mechanisms governing transcriptional activation of ebf1 target genes have been studied intensively (hagman., 1995 ; maier. by contrast, how ebf1 represses transcription of certain loci is only beginning to be addressed (gao., 2009). recent analyses of ebf1 occupancy of genes across the b cell genome suggest that the vast majority of ebf1 targets are located in transcriptionally active regions (treiber., 2010). therefore, the default mode for ebf1 may be as a transcriptional activator. however, other ebf1 target loci were found in transcriptionally inactive regions, and ebf1 has also been shown to downregulate the expression of the e - protein regulators id2 and id3 (thal., 2009). therefore, ebf1 may repress additional important loci during establishment and maintenance of the b cell fate. the use of synthetic zn fingers such as our 6zfp construct to evaluate the role of defined cis elements may prove useful in studying other region - specific protein - dna interactions in a wide variety of biological and experimental contexts. however, interpretation of data derived from this approach could be confounded by off - target dna binding events. here, 6zfp did not appear to bind to alternative ebf1 binding sites within the gata3, cd79a, or igll1 locus and led to the predicted outcomes in gata3 mrna levels and t and b cell differentiation. we considered performing chip - seq experiments to determine the identity of these alternative elements, but we suspect strongly that the functional relevance of these sites would be obscure at best. indeed, recent genome - wide analyses of dna occupancy by ebf1 suggest that endogenous transcription factors may also bind to a wide range of elements with unknown functional relevance (treiber., 2010). therefore, although synthetic proteins containing six tandem zn fingers such as 6zfp may prove to possess minimal off - target effects (gabriel., 2011), validating the specificity of such proteins with a particular biological outcome may require the use of cells bearing appropriate mutations. finally, although the precise molecular details remain unclear, we hypothesize that the switch between activator and repressor functions of ebf1 at different loci reflects differential spatio - temporal interactions of ebf1 with coactivator and corepressor complexes, which in turn would be dictated by diverse proximal and/or distal cis elements. our results show that ebf1 binding within the gata3 locus is associated with repressive h3k27me3 marks on nearby chromatin. these results implicate ebf1 in the active recruitment of polycomb group (pcg) repressor complexes. currently the chief mediator of h3k27me3 modifications in eukaryotes is the protein enhancer of zeste 2 (ezh2), a member of the polycomb repressor complex 2 (prc2) (cao and zhang, 2004). prc2 activity in turn attracts prc1, which prevents transcriptional initiation by rna polymerase ii (dellino., 2004). therefore, it is tempting to suggest that ebf1 binding at the gata3 locus directly or indirectly initiates mobilization of prc2 complexes to this region, thereby blocking interactions with coactivators and stabilizing chromatin modifications associated with long - term transcriptional silencing. assuming that this sequence of events is indeed contingent on sequence - specific corepressors, competitive blockade of their cognate dna sites via our zn - finger protein strategy might neutralize repressive effects of ebf1 at the gata3 locus. furthermore, given that histone modification is a dynamic and reversible process (tagoh., 2004 ; zhang., 2012), it will be informative to test whether induced deletion of ebf1 in b - lineage - committed cells causes the reversal of trimethylation on h3k27 residues in gata3 regulatory regions, possibly leading to gata3 expression. the consequences of such aberrant expression would give us further clues into the biological significance of gata3 silencing in b cells. c57bl/6 (b6) and b6.ly5 females (68 weeks of age) were from the nci animal facility (frederick, md). ebf1 mice were kindly provided by b. kee (university of chicago) with permission from r. grosschedl (max planck institute, freiburg). pax5 mice were kindly provided by m. busslinger (research institute of molecular pathology, vienna). gata3 and vav mice were kindly provided by j. zhu (national institutes of health) and d. kioussi (national institute for medical research, london), respectively. all animal experiments were performed according to protocols approved by the office of regulatory affairs of the university of pennsylvania in accordance with guidelines set forth by nih and by the local ethics committee at the university of oxford and the united kingdom home office. primary progenitors and progenitor cell lines were cultured as described previously (pongubala., 2008 ; xu and kee, 2007). for expression of synthetic zn - finger polypeptides, the predicted 6zfp mini - gene sequence was synthesized by blue heron biotech, cloned into the control pmx - vp64-ires - gfp retroviral construct (c. barbas, scripps research institute), and renamed pmx-6zfp. a plasmid eliciting translation of an unrelated nonfunctional peptide (pmx - ss) was also provided by the barbas lab. a nuclear localization signal sequence (nls) and hemagglutinin (ha) tag are also included in the pmx vector backbone. stained single - cell suspensions were stained and analyzed as described previously (pongubala., 2008). b6.ly5 hosts were irradiated (900r) 6 hr before intravenous transfer of day 14.5 fetal liver cells isolated from b6 or pax5 or ebf1 embryos. bulk and clonal assays measuring t cell differentiation were performed with op9-dl4 stromal cells as described previously (weber., 2011) and in the supplemental information. high - titer virus was generated by a capo4 transfection protocol (pear., 1993). cultures were supplemented with fresh medium at 12 hr after infection and harvested for downstream applications at indicated time points after infection. for quantitative rt - pcr, rna was purified from indicated cell types with the qiagen rneasy mini kit and reverse transcribed to cdna with ge first - strand cdna synthesis kit. real - time pcr was performed with inventoried taqman probes for indicated genes and analyzed on an abi prism 7300 system (applied biosystems). cd3 thymocytes and cd19 bm cells were column selected (miltenyi biotec). in case of control vector and ebf1-transduced ebf1 cells or cells cotransduced with ebf1 and pmx / pmx-6zfp / pmx - ss viruses, viable gfp or yfpgfp cells were sorted either 24 hr or 7 days after infection as indicated. chip was performed on indicated cell types (2 10 cells / assay) with the chip - it kit (active motif). in brief, cells were fixed for 10 min at room temperature with 1% formaldehyde, treated with glycine stop - fix solution, then lysed with dounce - homogenizer. pelleted nuclei were digested in presence of protease inhibitor cocktail and chromatin was enzymatically sheared. sheared chromatin was immunoprecipitated with 4 g anti - ebf1 (a kind gift from r. grosschedl) or anti - h3k27me3 (07 - 449, millipore) or anti - ha (ab9110, abcam). after proteinase k digestion, dna was immediately used in quantitative real - time pcr (sybr green, abi). a negative control primer set (active motif, catalog number 71011) for an 82 base pair gene desert region on mouse chromosome 6 was included in each immunoprecipitation. nonenrichment for ebf1 or anti - h3k27me3 at this site served as a chip specificity control. a 48 base pair (bp) sequence spanning the ebf1 binding site a (as confirmed by chip assays) in gata3 genomic locus was selected. using the publicly available online resource called zinc finger tools (http://www.scripps.edu/mb/barbas/zfdesign/zfdesignhome.php), an 18 bp potential target site including the ebf1 binding site was identified and the amino acid sequence of a hexa - modular zinc finger protein (6zfp) predicted to bind to this site was designed (table s2). because of unmet target site overlap requirements, designing 6zfp for a target site covering the intronic ebf1 binding site b was avoided as recommended (mandell and barbas, 2006). the means of each data set were analyzed by student s t test, with a two - tailed distribution assuming equal sample variance. | summarythe mechanisms underlying the silencing of alternative fate potentials in very early b cell precursors remain unclear. using gain- and loss - of - function approaches together with a synthetic zinc - finger polypeptide (6zfp) engineered to prevent transcription factor binding to a defined cis element, we show that the transcription factor ebf1 promotes b cell lineage commitment by directly repressing expression of the t - cell - lineage - requisite gata3 gene. ebf1-deficient lymphoid progenitors exhibited increased t cell lineage potential and elevated gata3 transcript expression, whereas enforced ebf1 expression inhibited t cell differentiation and caused rapid loss of gata3 mrna. notably, 6zfp - mediated perturbation of ebf1 binding to a gata3 regulatory region restored gata3 expression, abrogated ebf1-driven suppression of t cell differentiation, and prevented b cell differentiation via a gata3-dependent mechanism. furthermore, ebf1 binding to gata3 regulatory sites induced repressive histone modifications across this region. these data identify a transcriptional circuit critical for b cell lineage commitment. |
eligible patients were at least 18 years of age, had been diagnosed with adult ra (controlled or uncontrolled), and had been treated with methotrexate for 3 months or longer before enrollment. women of childbearing potential were included only if they had negative pregnancy tests at screening and day of treatment and were using effective contraception. all patients were required to be capable of administering sc self - injections and of understanding verbal or written english. all patients signed and dated an approved informed consent form before the initiation of any study procedures. patients were excluded from the study if they were pregnant or lactating, had a history of malignancy or neoplastic disease (except successfully treated basal or squamous cell carcinoma of the skin > 1 year ago or patients who were cancer - free for > 5 years), had a skin condition or disorder preventing sc administration of methotrexate, or had other clinically significant disease. other exclusion criteria were acute illness within 7 days or major illness / hospitalization within 1 month of study drug administration, history of drug or alcohol abuse within the past year, history of human immunodeficiency virus or hepatitis b or c virus infection, or the use of any other investigational agent within 1 month before enrollment. this was a phase 2, open - label, single - dose, single - arm, in - clinic study conducted at 8 sites in the united states. the total duration of the trial was 8 weeks, and it contained a screening period, a 1-day treatment period, and a 1-day follow - up period. during the screening period, eligible patients were enrolled and instructed to discontinue their previously prescribed methotrexate therapy. they were assigned by the investigator to 1 of 4 methotrexate dose levels (10, 15, 20, or 25 mg) according to their baseline methotrexate therapy and ra disease status (controlled or uncontrolled). at least 7 days had to have elapsed between the patient s last previously prescribed methotrexate dose and the start of study treatment. the protocol was approved by the institutional review board of each study site before study initiation. the study was conducted in accordance with the declaration of helsinki and was in compliance with good clinical practice guidelines. patients received standardized sc self - administration training from nursing staff at the investigator sites that involved verbal instructions and a demonstration of proper use of the mtxai through the use of a standardized script, as well as a review of written patient instructions. self - administration was carried out independently, in the clinic, with the aid of written patient instructions. patients used the mtxai to administer their assigned dose of methotrexate into the anterior abdominal wall, and site personnel observed the procedure. the primary end point for determination of safe usability was successful sc administration with the mtxai. successful self - administration was determined by the following : (1) sc self - administration was intentional ; (2) the sc dose was administered by the patient ; (3) sc self - administration was in the appropriate location on the abdomen ; and (4) the device functioned appropriately as determined by inspection of used devices, including confirmation that the window was obstructed, the ram was released, and the needle guard was no longer retracted. after self - administration on day 1, patients completed an ease - of - use questionnaire, which contained 5 statements that assessed the device and the standardized patient training for ease of use by the patient. immediately after self - administration on day 1 and at the follow - up visit on day 2, patients rated any pain at the injection site with a visual analog scale (vas) (0 mm = no pain, 100 mm = worst possible pain). secondary end points included ease - of - use questionnaire scores regarding the device, ease - of - use and training confirmation questionnaire scores regarding written patient instructions and sc self - administration training, assessment of essential tasks questionnaire scores, self - reported vas scores for pain at the injection site, and injection - site assessment numeric grades. injection sites were assessed predose and at 0.25, 1, 6, and 24 hours postdose. erythema severity was graded on a scale of 0 = none, 1 = very slight / barely perceptible, 2 = obvious, but well defined, 3 = moderate to severe, and 4 = severe. adverse events and medical and surgical history were coded to system organ class and preferred term using the medical dictionary for regulatory activities version 14.1. an ae was considered to be a treatment - emergent ae (teae) if it started on or after self - administration with the mtxai. vital signs (including heart rate, respiratory rate, and blood pressure) were measured at screening and at 1, 6, and 24 hours postdose. the safety population was defined as all patients who received study drug and carried out a successful or an unsuccessful self - administration. a sample size of approximately 100 patients (approximately 25 patients per dose level with a minimum enrollment of 20 patients per group) was planned to provide a sufficient number of patients to determine the safety and tolerability of the mtxai, based on correspondence with the us food and drug administration. eligible patients were at least 18 years of age, had been diagnosed with adult ra (controlled or uncontrolled), and had been treated with methotrexate for 3 months or longer before enrollment. women of childbearing potential were included only if they had negative pregnancy tests at screening and day of treatment and were using effective contraception. all patients were required to be capable of administering sc self - injections and of understanding verbal or written english. all patients signed and dated an approved informed consent form before the initiation of any study procedures. patients were excluded from the study if they were pregnant or lactating, had a history of malignancy or neoplastic disease (except successfully treated basal or squamous cell carcinoma of the skin > 1 year ago or patients who were cancer - free for > 5 years), had a skin condition or disorder preventing sc administration of methotrexate, or had other clinically significant disease. other exclusion criteria were acute illness within 7 days or major illness / hospitalization within 1 month of study drug administration, history of drug or alcohol abuse within the past year, history of human immunodeficiency virus or hepatitis b or c virus infection, or the use of any other investigational agent within 1 month before enrollment. this was a phase 2, open - label, single - dose, single - arm, in - clinic study conducted at 8 sites in the united states. the total duration of the trial was 8 weeks, and it contained a screening period, a 1-day treatment period, and a 1-day follow - up period. during the screening period, eligible patients were enrolled and instructed to discontinue their previously prescribed methotrexate therapy. they were assigned by the investigator to 1 of 4 methotrexate dose levels (10, 15, 20, or 25 mg) according to their baseline methotrexate therapy and ra disease status (controlled or uncontrolled). at least 7 days had to have elapsed between the patient s last previously prescribed methotrexate dose and the start of study treatment. the protocol was approved by the institutional review board of each study site before study initiation. the study was conducted in accordance with the declaration of helsinki and was in compliance with good clinical practice guidelines. patients received standardized sc self - administration training from nursing staff at the investigator sites that involved verbal instructions and a demonstration of proper use of the mtxai through the use of a standardized script, as well as a review of written patient instructions. self - administration was carried out independently, in the clinic, with the aid of written patient instructions. patients used the mtxai to administer their assigned dose of methotrexate into the anterior abdominal wall, and site personnel observed the procedure. the primary end point for determination of safe usability was successful sc administration with the mtxai. successful self - administration was determined by the following : (1) sc self - administration was intentional ; (2) the sc dose was administered by the patient ; (3) sc self - administration was in the appropriate location on the abdomen ; and (4) the device functioned appropriately as determined by inspection of used devices, including confirmation that the window was obstructed, the ram was released, and the needle guard was no longer retracted. after self - administration on day 1, patients completed an ease - of - use questionnaire, which contained 5 statements that assessed the device and the standardized patient training for ease of use by the patient. immediately after self - administration on day 1 and at the follow - up visit on day 2, patients rated any pain at the injection site with a visual analog scale (vas) (0 mm = no pain, 100 mm = worst possible pain). secondary end points included ease - of - use questionnaire scores regarding the device, ease - of - use and training confirmation questionnaire scores regarding written patient instructions and sc self - administration training, assessment of essential tasks questionnaire scores, self - reported vas scores for pain at the injection site, and injection - site assessment numeric grades. injection sites were assessed predose and at 0.25, 1, 6, and 24 hours postdose. erythema severity was graded on a scale of 0 = none, 1 = very slight / barely perceptible, 2 = obvious, but well defined, 3 = moderate to severe, and 4 = severe. adverse events and medical and surgical history were coded to system organ class and preferred term using the medical dictionary for regulatory activities version 14.1. an ae was considered to be a treatment - emergent ae (teae) if it started on or after self - administration with the mtxai. vital signs (including heart rate, respiratory rate, and blood pressure) were measured at screening and at 1, 6, and 24 hours postdose. the safety population was defined as all patients who received study drug and carried out a successful or an unsuccessful self - administration. a sample size of approximately 100 patients (approximately 25 patients per dose level with a minimum enrollment of 20 patients per group) was planned to provide a sufficient number of patients to determine the safety and tolerability of the mtxai, based on correspondence with the us food and drug administration. of 104 patients screened, 101 were enrolled and completed the study (20, 30, 31, and 20 patients in the methotrexate 10-, 15-, 20-, and 25-mg groups, respectively). no patient discontinued from the study. most patients were women (79.2%), and their mean age was 60.9 years. the mean duration of ra at informed consent was 13.3 years, and the majority had a functional status of class ii or iii (89.1%), indicating functional limitations in work and/or other activities. most patients (80.2%) had previous experience with sc administration ; 31 had used an autoinjector, 24 had used a pen device, and 53 had used a needle and syringe with a vial. 2) indicated that 98% of patients agreed or strongly agreed that the device was easy to use, and all patients agreed that the written instructions and standardized training were clear and easy to follow. results of the training confirmation questionnaire showed that almost all patients (94%) answered all 5 questions correctly. patients rated the ease of use of the mtxai by strongly agreeing, agreeing, neither agreeing nor disagreeing, disagreeing, or strongly disagreeing that (a) the device was easy to use, (b) they understood the written instructions, (c) the written instructions were clear and easy to follow, (d) they understood the training provided by the site personnel, and (e) the training provided by the site personnel was clear and easy to follow. patients experienced minimal injection - site pain during the study, as reflected by mean and median vas pain scores (fig. 3). on day 1, immediately after administration, 34.3% of patients had vas scores of 0 mm, and 20.2% of patients had vas scores of 1 mm. the overall mean (median) severity of injection - site pain was 3.6 mm (1.0 mm) immediately after administration. on day 2, 55.6% of patients had vas scores of 0 mm, and 17.2% of patients had vas scores of 1 mm. the overall mean (median) severity of injection - site pain was 1.4 mm (0.00 mm) on day 2. visual analog scale pain scores immediately (day 1) and 24 hours (day 2) after sc methotrexate self - administration with the mtxai. of 404 injection - site assessments carried out postdose, 373 (92.3%) noted no erythema (severity of 0), and 31 (7.7%) noted very slight, barely perceptible erythema (severity of 1). all but 2 patients with grade 1 assessments were described as having erythema the size of a pinprick or erythema consistent with a pressure mark from the mtxai. of these 2 exceptions, 1 patient had grade 1 erythema that was 10 mm in diameter and resolved by 6 hours after administration, and the other had grade 1 erythema that was 3 mm in diameter and resolved by 1 hour after administration. two patients with pinprick - sized erythema had accompanying induration / swelling the size of a pinprick at the injection site at the 0.25-hour postdose assessment. no patient experienced induration / swelling at later time points, and no patient with grade 1 erythema experienced bleeding, ecchymosis, or hematoma at the injection site or required countermeasures at any assessment time point. no patient had erythema of severity 2, 3, or 4 at any injection - site assessment. two patients had mild ecchymoses at the injection site, but neither had accompanying erythema. no dose - related trends were noted for injection - site assessments, and no patient had erythema worsening of more than 1 point from previous injection - site assessments at any injection - site assessment. two patients (6.5%) in the methotrexate 20-mg group and 1 patient (5.0%) in the methotrexate 25-mg group had a teae during the study. one patient receiving methotrexate 20 mg had a mild headache that was considered by the investigator to be related to study drug. the other patient receiving methotrexate 20 mg had exostosis that was considered unrelated to study drug. the teae in the methotrexate 25-mg group was a serious ae of sick sinus syndrome, which was considered by the investigator to be severe but unrelated to study drug. there were no clinically meaningful changes in vital signs from predose to any postdose time point. of 104 patients screened, 101 were enrolled and completed the study (20, 30, 31, and 20 patients in the methotrexate 10-, 15-, 20-, and 25-mg groups, respectively). no patient discontinued from the study. most patients were women (79.2%), and their mean age was 60.9 years. the mean duration of ra at informed consent was 13.3 years, and the majority had a functional status of class ii or iii (89.1%), indicating functional limitations in work and/or other activities. most patients (80.2%) had previous experience with sc administration ; 31 had used an autoinjector, 24 had used a pen device, and 53 had used a needle and syringe with a vial. 2) indicated that 98% of patients agreed or strongly agreed that the device was easy to use, and all patients agreed that the written instructions and standardized training were clear and easy to follow. results of the training confirmation questionnaire showed that almost all patients (94%) answered all 5 questions correctly. patients rated the ease of use of the mtxai by strongly agreeing, agreeing, neither agreeing nor disagreeing, disagreeing, or strongly disagreeing that (a) the device was easy to use, (b) they understood the written instructions, (c) the written instructions were clear and easy to follow, (d) they understood the training provided by the site personnel, and (e) the training provided by the site personnel was clear and easy to follow. patients experienced minimal injection - site pain during the study, as reflected by mean and median vas pain scores (fig., immediately after administration, 34.3% of patients had vas scores of 0 mm, and 20.2% of patients had vas scores of 1 mm. the overall mean (median) severity of injection - site pain was 3.6 mm (1.0 mm) immediately after administration. on day 2, 55.6% of patients had vas scores of 0 mm, and 17.2% of patients had vas scores of 1 mm. the overall mean (median) severity of injection - site pain was 1.4 mm (0.00 mm) on day 2. visual analog scale pain scores immediately (day 1) and 24 hours (day 2) after sc methotrexate self - administration with the mtxai. of 404 injection - site assessments carried out postdose, 373 (92.3%) noted no erythema (severity of 0), and 31 (7.7%) noted very slight, barely perceptible erythema (severity of 1). all but 2 patients with grade 1 assessments were described as having erythema the size of a pinprick or erythema consistent with a pressure mark from the mtxai. of these 2 exceptions, 1 patient had grade 1 erythema that was 10 mm in diameter and resolved by 6 hours after administration, and the other had grade 1 erythema that was 3 mm in diameter and resolved by 1 hour after administration. two patients with pinprick - sized erythema had accompanying induration / swelling the size of a pinprick at the injection site at the 0.25-hour postdose assessment. no patient experienced induration / swelling at later time points, and no patient with grade 1 erythema experienced bleeding, ecchymosis, or hematoma at the injection site or required countermeasures at any assessment time point. no patient had erythema of severity 2, 3, or 4 at any injection - site assessment. two patients had mild ecchymoses at the injection site, but neither had accompanying erythema. no dose - related trends were noted for injection - site assessments, and no patient had erythema worsening of more than 1 point from previous injection - site assessments at any injection - site assessment. two patients (6.5%) in the methotrexate 20-mg group and 1 patient (5.0%) in the methotrexate 25-mg group had a teae during the study. one patient receiving methotrexate 20 mg had a mild headache that was considered by the investigator to be related to study drug. the other patient receiving methotrexate 20 mg had exostosis that was considered unrelated to study drug. the teae in the methotrexate 25-mg group was a serious ae of sick sinus syndrome, which was considered by the investigator to be severe but unrelated to study drug. there were no clinically meaningful changes in vital signs from predose to any postdose time point. the results of this phase 2 study demonstrate the safe usability of the sc mtxai in adult patients with ra after standardized training by site personnel and review of written instructions. reliability and robustness of the device were demonstrated by the correct functioning of all devices as intended. patients reported no or minimal administration - site pain. taken together, these results suggest that patients with ra can successfully use the mtxai for self - administration of sc methotrexate, that administration is safe and well tolerated, and that patient education tools are clear and easy to follow. almost all patients (90.1%) in this study had moderate to severe functional limitations (functional status of class ii iv) ; however, these limitations did not affect their ability to self - administer sc methotrexate with the mtxai. because 80% of the population had prior experience with sc injection, it is possible that some patients with no prior injection experience had declined participation, biasing the population toward experienced patients. however, 98% of all patients agreed with the statement the device was easy to use, suggesting that prior experience did not influence ease of use in this study. subcutaneous mtx may provide important clinical benefits compared with oral mtx with respect to both gastrointestinal tolerability and bioavailability,7,10 and the consideration of sc methotrexate when oral methotrexate is intolerable or inadequately effective is recommended by both canadian guidelines and european experts.3,18 difficulties with traditional methods of sc administration of methotrexate may, however, affect adherence. administration of a single - use autoinjector has been shown in other disease states to help patients overcome needle anxiety,19 decrease the incidence of needlestick injury,20 and improve treatment adherence and persistence.21 for patients with ra, the mtxai represents an alternative to oral administration and an alternative to the need for vials, needles, and syringes. its design is such that the needle is not visible to the patient, which should minimize needle anxiety ; it is prefilled, which should minimize the risk of spillage and accidental exposure ; and it is easy to use and nearly pain - free, which should promote treatment adherence and persistence. the commercially available version of the mtxai is a prefilled device (in dosage strengths of 10, 15, 20, and 25 mg) that matches those doses used in the current trial.17 in conclusion, delivery of sc methotrexate with the mtxai is easily performed by patients with ra who have moderate to severe dexterity limitations and is associated with no or minimal pain and erythema. improving sc methotrexate delivery may increase patient tolerance of self - administration, possibly improving adherence. | backgrounda methotrexate autoinjector (mtxai) was developed for self - administration of subcutaneous (sc) methotrexate by patients with rheumatoid arthritis (ra). the mtxai circumvents the need for vials, needles, and syringes and may therefore improve dosing accuracy, handling risks, and patient adherence.objectivesthe objective of this study was to evaluate actual human use of the mtxai in patients with ra and determine its reliability, robustness, safety, local tolerance, and ease of use.methodsin this phase 2, multicenter, open - label, single - dose, single - arm, in - clinic us study, adults (n = 101) treated with methotrexate for 3 months or longer were trained to use the mtxai and assigned to 10, 15, 20, or 25 mg methotrexate based on previous treatment and disease status. patients completed training confirmation and ease - of - use questionnaires. pain was evaluated immediately after self - administration and at follow - up with a 100-mm visual analog scale (0 = no pain, 100 = worst possible pain).resultsat screening, 90.1% of patients had moderate to severe functional limitations (class ii iv). all patients successfully completed the study. all devices functioned correctly and as intended. the device was rated easy to use by 98%, and instructions clear and easy to follow by 100% of patients. on the visual analog scale, mean and median pain scores were 3.6/100 and 1.0/100 mm, respectively, immediately after self - administration, and were lower at follow - up. most patients (92.3%) had no administration - site erythema ; 7.7% had minimal erythema.conclusionsthe sc mtxai was well tolerated and considered easy to use by patients with ra. improving sc methotrexate delivery may increase patient tolerance of self - administration, possibly improving adherence. |
kshv - gpcrs were expressed in cos-1 and nih 3t3 cells by transfection with pckshv - gpcr (6) or pcefl - kshv - gpcr (7) using the protocols described previously. the c - x - c chemokines huip-10 and humig, the mouse homologues muip-10 and mumig, and the huip-10 analogues were chemically synthesized using established procedures (12). cos-1 cells transiently transfected with plasmid encoding kshv - gpcr (5 g / ml) or nih 3t3 cells stably expressing kshv - gpcrs were labeled with myo-[h]inositol, and the formation of [h]inositol phosphates during a 90-min incubation was measured as described (6, 7). the full - length kshv - gpcr cdna in pcdna3.1(+) (pckshv - gpcr ; reference 6) was used for mutation. mutants were prepared by pcr and were subcloned directly into pckshv - gpcr after digesting with ecori and ecorv. kshv - gpcr expressing nih 3t3 cells were grown in dme supplemented with 10% calf serum. dna synthesis was measured by incubating kshv - gpcr expressing nih 3t3 cells in medium supplemented with 1% calf serum and the indicated concentration of huip-10 for 2 d before incubation with [h]thymidine (2 ci / ml) for 46 h. statistical significance was determined in each experiment by student 's t test. kshv - gpcrs were expressed in cos-1 and nih 3t3 cells by transfection with pckshv - gpcr (6) or pcefl - kshv - gpcr (7) using the protocols described previously. the c - x - c chemokines huip-10 and humig, the mouse homologues muip-10 and mumig, and the huip-10 analogues were chemically synthesized using established procedures (12). cos-1 cells transiently transfected with plasmid encoding kshv - gpcr (5 g / ml) or nih 3t3 cells stably expressing kshv - gpcrs were labeled with myo-[h]inositol, and the formation of [h]inositol phosphates during a 90-min incubation was measured as described (6, 7). the full - length kshv - gpcr cdna in pcdna3.1(+) (pckshv - gpcr ; reference 6) was used for mutation. mutants were prepared by pcr and were subcloned directly into pckshv - gpcr after digesting with ecori and ecorv. kshv - gpcr expressing nih 3t3 cells were grown in dme supplemented with 10% calf serum. dna synthesis was measured by incubating kshv - gpcr expressing nih 3t3 cells in medium supplemented with 1% calf serum and the indicated concentration of huip-10 for 2 d before incubation with [h]thymidine (2 ci / ml) for 46 h. 1 illustrates that huip-10 specifically inhibits inositol phosphate second messenger formation in cos-1 cells expressing kshv - gpcrs. the dose of huip-10 that causes 50% inhibition of inositol phosphate formation is 15 nm. huip-10 had no effect on inositol phosphate production by cos-1 cells that did not express kshv - gpcrs (data not shown). these data are consistent with the idea that huip-10 is a specific inverse agonist (or negative antagonist ; reference 13) of kshv - gpcr. as noted above, huip-10 is a ligand for cxcr3, which also binds humig (10). to further characterize the effects of these chemokines on kshv - gpcr signaling, the effects of humig and of the mouse homologues muip-10 and mumig were determined. muip-10, like huip-10, inhibits signaling by kshv - gpcr, whereas humig and mumig have no effect on kshv - gpcr signaling (fig. the ip-10 homologues are inverse agonists, whereas the mig homologues exhibit no detectable activity at kshv - gpcr. huip-10 is a 77amino acid polypeptide. to gain insight into the structural domain of huip-10 involved in inhibition of kshv - gpcr signaling, huip-10(477) and huip-10(977) are lacking the first three or eight amino acid residues, respectively, of huip-10. both huip-10(477) and huip-10(977) inhibited kshv - gpcr signaling although with lower potencies than huip-10 (3- and 10-fold lower, respectively ; fig. 2 a). thus, the nh2 terminus of huip-10 is not needed for inhibition of kshv - gpcr signaling. this is an interesting finding because the agonist activity of several members of the c - x - c chemokine family, including huip-10, has been shown to be dependent on their nh2-terminal domains (8). for example, deletion of the nh2 terminus of il-8 causes loss of agonist activity and forms peptides that act as competitive antagonists (15). the active domain (or pharmacophore) for inhibition of kshv - gpcr signaling is not part of the nh2 terminus of huip-10. it has been found that the putative extracellular nh2 termini of cxcr1 and cxcr2 are important for interacting with il-8 (16). therefore, we constructed a mutant kshv - gpcr in which amino acid residues from positions 211 were deleted [kshv - gpcr(211) ]. therefore, residues within the nh2 terminus may affect constitutive signaling by kshv - gpcr. however, since signaling activity is directly related to receptor number (6), it is possible that the modest decrease in signaling is due to decreased expression. more importantly, the constitutive signaling activity exhibited by kshv - gpcr(211) was not inhibited by huip-10. as we have not been able to measure specific huip-10 binding, perhaps because of binding to cell surface heparin sulfates (17), we do not know whether this lack of effect of huip-10 is because it does not bind to kshv - gpcr(211) or whether it binds but does not inactivate kshv - gpcr(211). however, it is clear that the nh2 terminus of kshv - gpcr is important for the inverse agonist action of huip-10. fibroblasts may be a good model for the study of kshv - gpcr function because fibroblasts are typically present in ks lesions (1) and kshv - like viruses are found in retroperitoneal fibromatosis tissues in monkeys (18). expression of kshv - gpcr results in stimulation of proliferation of nih 3t3 fibroblasts (7). stimulation of the proliferation of target cells by kshv - gpcr could be a component of the pathogenesis of ks or primary effusion lymphomas (1, 2). to determine whether inhibition of kshv - gpcr signaling would inhibit the proliferative response, the effects of the ip-10 homologues were measured in transfected nih 3t3 cells stably expressing kshv - gpcrs. 3 (top) illustrates that huip-10 and muip-10 inhibit kshv - gpcr signaling in nih 3t3 cells, whereas humig and mumig have no effect. moreover, huip-10 causes dose - dependent inhibitions of kshv - gpcr signaling and stimulated dna synthesis in these cells (fig. the concentrations required for 50% inhibition (ic50s) of these effects are similar : 39 nm for inhibition of inositol phosphate second messenger formation, and 29 nm for inhibition of dna synthesis. these results indicate that huip-10 is an inverse agonist of constitutive signaling by kshv - gpcr in nih 3t3 cells that inhibits kshv - gpcr stimulated cell proliferation. ip-10 homologues are cxcr3 agonists (9), but we show herein that they are inverse agonists at kshv - gpcr. in the majority of instances where two gpcrs interact with the same ligand, the receptors respond similarly to that ligand (19). however, there are examples of mutations of gpcrs engineered in the laboratory that have changed an antagonist or inverse agonist into a partial agonist (20, 21). the different effects of the ip-10 homologues at kshv - gpcr and cxcr3 may represent a related circumstance in which a pirated mammalian receptor is mutated within a virus and is then antagonized by a naturally occurring agonist. kshv - gpcr interacts with a much broader array of chemokines (6) than most mammalian receptors (8). indeed, kshv - gpcr interacts with c - x - c chemokines including il-8, neutrophil activating protein 2, platelet factor 4, melanoma growth stimulatory activity, ip-10 analogues, and c - c chemokines including regulated on activation, normal t expressed and secreted (rantes) and i-309. however, of these chemokines only the ip-10 analogues inhibit kshv - gpcr signaling. it is noteworthy that in addition to encoding kshv - gpcr, there are three chemokine analogues encoded within the kshv genome. one of these, vmip - ii, is a broad - spectrum antagonist of chemokine receptors (22), but stimulates chemotaxis of eosinophils via chemokine receptor ccr3 (23). vmip - i and vmip - ii block infection by hiv-1 by binding to chemokine receptors ccr3 and ccr5, and stimulate angiogenesis (23). it is not known whether any of these chemokines affects kshv - gpcr signaling. evidence continues to accumulate supporting the idea that kshv is involved in the pathogenesis of ks (1) and primary effusion lymphomas (2). more recently, it has been proposed that kshv could also be involved in the development of multiple myeloma (24). from the perspective of demonstrating a pathogenic role for kshv - gpcr in these diseases, it will be important to develop an animal model and to show that inhibition of kshv - gpcr signaling inhibits tumorigenesis in kshv - infected animals. the discovery of an inhibitor of the constitutive signaling activity of kshv - gpcr will allow direct testing in an animal model of the hypothesis that kshv infection leads to expression of kshv - gpcr and kshv - gpcr signaling leads to tumorigenesis. effects of huip-10 (filled squares), humig (filled circles), muip-10 (open squares), and mumig (open circles) on constitutive kshv - gpcr signaling. inositol phosphate accumulation in cos-1 cells transiently transfected with plasmid encoding kshv - gpcr was measured as described in materials and methods. chemokine analogues were added at the concentrations indicated 15 min before licl (10 mm). untransfected cells and cells transfected with plasmid without dna encoding kshv - gpcr (mock) or with plasmid encoding the receptor for thyrotropin - releasing hormone were studied in parallel. there was no effect of any of these chemokines on inositol phosphate production in untransfected cells, in mock - transfected cells, or in cells expressing thyrotropin - releasing hormone receptors (not shown). the dose of huip-10 that caused 50% inhibition of inositol phosphate formation was 15 nm (7.232 nm, 95% confidence interval). the data represent the mean sd of triplicate determinations in a representative of three experiments. effects of truncations of the nh2 termini of huip-10 and kshv - gpcr on inhibition of kshv - gpcr signaling. inositol phosphate accumulation in cos-1 cells transiently transfected with plasmid encoding kshv - gpcr or kshv - gpcr(211) was measured as described in materials and methods. huip-10, huip-10(477), or huip-10(977) was added at the concentrations indicated 15 min before licl (10 mm). (a) effect of truncating the nh2 terminus of the ligand huip-10. the data represent the mean sd of triplicate determinations in a representative of three experiments. filled squares, huip-10 ; open circles, huip-10(477) ; filled triangles, huip-10(977). the data represent the mean sd of triplicate determinations in a representative experiment in which two plasmid clones encoding kshv - gpcr(211) were tested. inhibition of constitutive kshv - gpcr signaling and dna synthesis in nih 3t3 mouse fibroblasts. (a) inositol phosphate accumulation in nih 3t3 cells stably expressing kshv - gpcrs (reference 7). huip-10, humig, muip-10, or mumig (300 m) was added 15 min before the addition of licl (10 mm). the data represent the mean sd of triplicate determinations in one of two experiments. (b) dose - dependent effects of huip-10 on inositol phosphate formation (open circles) and dna synthesis (filled squares). the concentration of huip-10 required for 50% inhibition (ic50) of inositol phosphate second messenger formation is 39 nm (9160 nm ; 95% confidence interval), and for 50% inhibition of dna synthesis is 29 nm (8110 nm, 95% confidence interval). | a g protein coupled receptor (gpcr) is encoded within the genome of kaposi 's sarcoma associated herpesvirus (kshv)/human herpesvirus 8, a virus that may be involved in the pathogenesis of kaposi 's sarcoma and primary effusion lymphomas. kshv - gpcr exhibits constitutive signaling activity that causes oncogenic transformation. we report that human interferon (ifn)-inducible protein 10 (huip-10), a c - x - c chemokine, specifically inhibits signaling of kshv - gpcr. in contrast, monokine induced by ifn- (humig), which like huip-10 is an agonist of c - x - c chemokine receptor 3, does not inhibit kshv - gpcr signaling. moreover, huip-10, but not humig, inhibits kshv - gpcr induced proliferation of nih 3t3 cells. these results show that huip-10 is an inverse agonist that converts kshv - gpcr from an active to an inactive state. thus, a human chemokine inhibits constitutive signaling and cellular proliferation that is mediated by a receptor encoded by a human disease - associated herpesvirus. |
malaria is a threat both to pregnant women and their babies, with about 200,000 newborn deaths each year as a result of malaria in pregnancy. in sub - saharan africa, about 25 million pregnant women are at risk of malaria annually, and one in every four women has evidence of placental infection at the time of delivery. in nigeria, malaria is one of the leading causes of morbidity and mortality and accounts for more than 50% of all cases seen in the hospitals. pregnant women are particularly vulnerable to malaria as pregnancy reduces a woman 's immunity to malaria, increasing her risk of illness, severe anemia, and death, while the risk of spontaneous abortion, stillbirth, premature delivery, and low birth weight increases for the fetus. intermittent preventive treatment with an antimalarial drug during pregnancy such as sulphadoxine - pyrimethamine (sp) is a cost - effective means of preventing malaria in pregnancy. several studies have demonstrated its efficacy in causing a decline in placental infection, anemia, and low birth weight babies, despite reports of increasing resistance to it in some african countries. the federal ministry of health in nigeria in its national strategic plan for the control of malaria in 2001 recommended early case management, two doses of sp during the second trimester and early in the third trimester of pregnancy against the adverse consequences of malaria in pregnancy. a third dose is recommended for pregnant women who are hiv positive. this recommendation was a shift in treatment policy from the use of chloroquine for the treatment of uncomplicated malaria as result of the high level of resistance of plasmodium falciparum to choloroquine, as demonstrated by several drug efficacy studies carried out in many african and asian countries. in accordance with the current national guidelines, sp is given free of charge to pregnant women attending antenatal care clinics services in public health facilities and nongovernmental organizations (ngo / faith - based facilities, using the strategy of directly observed therapy (dot). however, a decade after the policy recommendation, studies in many parts of nigeria still indicate low coverage of intermittent preventive treatment of malaria in pregnancy (iptp) use during pregnancy, unlike a more impressive utilization observed in malawi and tanzania. there is little information on the extent of iptp in rivers state in compliance with national policy recommendations, especially as efforts are accelerated toward the attainment of malaria related millennium development goals in the state. we therefore conducted this study to determine the level of iptp and to identify obstacles prohibiting its widespread use. information obtained from this study will be useful in guiding state and national policies toward improved iptp uptake and malaria control in general. the area is predominantly a wetland area characterized by dense rain forest zones and large expanse of fresh and brackish water swamps. it rains all year round with an annual average of about 1500 mm, moderate temperatures usually not exceeding 36c, and high humidity which is usually between 60% and 80%. it is made up of 23 local government administrative areas (lgas) embedded in 3 senatorial districts. there are over 1583 communities in the state of diverse ethnic groups, prominent among which are the kalabaris, ikwerres, ogonis, ekpeyes, ogbas, engenes, ibanis, and okrikas. primary health care services are available in many rural communities, while secondary and tertiary health services are located in the local government headquarters and cities. many more of the rural dwellers however depend on patent medicine vendors, traditional birth attendants, herbal medicine practitioners, and spiritual healers for medical care. patent medicine vendors are said to be the foremost among these informal sector health care providers and antimalaria drugs rank high among the drugs administered by these medicine sellers in nigeria.[1416 ] many locals perceive them to be well knowledgeable on health matters and can be relied on or trusted. studies carried out in three of the six geographical zones of nigeria revealed that 39% of sick persons patronized patent medicine vendors, 25% reported self - treatment in many cases with drugs purchased from drug vendors, and 72% still used chloroquine for the treatment of malaria. a cross - sectional study was carried out in the state in november 2008 among 399 pregnant women and those who had delivered children in the past 1 year. the minimal sample size the study was estimated using the formula for descriptive studies, prevalence of iptp with sp in nigeria of 12%, error margin of 5% with adjustments made for a design effect (deft) = 2. the study was conducted in three local government areas (lgas) of the state out of a total of 23 lgas. the subjects were selected by a multistage sampling method ; the first stage being by listing of the lgas in each of the three senatorial districts (consisting of 78 lgas) and selecting one local government area (lga) by a simple random method ; the second stage was the selection of communities in a selected lga. this was also done by listing the communities in the lga and selecting one also by simple random sampling, while the third and final stage was the selection of households within each community from a generated list of households in the communities. the first house and household included in the study was determined by spinning a pen from a central location in the community and following the direction to reach an eligible respondent. interviews were conducted by previously trained primary health care workers recruited from the local government headquarters. they utilized a questionnaire adapted from the who / federal ministry of health on malaria baseline information in the local languages when it was necessary, to ensure that the respondents understood the questions and responded appropriately. section one of the questionnaire contained information on demographic attributes of respondents, section two contained knowledge of malaria in pregnancy, and section three contained information on the practice of malaria prevention in pregnancy. data were analyzed using the epi - info version 6.04d statistical software package and hypothesis tests were conducted to compare summary statistics at 95% significance level. verbal consent of all pregnant women participating in the study was obtained after full explanation of the purpose of the study and that participation was voluntary, without any obligations or sanctions. a total of 339 pregnant women or women who had children in the last 1 year were interviewed. majority of the women (31.6%) were aged between 25 and 29 years (mean age 28.2 3.13 years) and had primary level education, although 8% had no formal education. fishing, farming, and petty trading were the most common occupations among them [table 1 ]. demographic characteristics of respondents more than three quarters (76.4%) of the women had correct knowledge that malaria was caused by exposure to mosquito bites. there were however some respondents with misconceptions that malaria resulted from working in the sun (11.5%), eating too much of palm oil (4.7%) and witchcraft (1.5%). most of the women (71.4%) equally had knowledge that malaria could cause some harm during pregnancy to the mother or fetus such as abortion, still births, or low birth weight. however, nearly a third of the women (32.6%) did not know the correct dose of sp recommended for preventing malaria in pregnancy [table 2 ]. knowledge of malaria among respondents a majority of the respondents, (80.8%) currently attend or attended antenatal care clinics during their last pregnancy, while the rest (19.2%) did not. the main reasons for not attending were given as the low perception of personal risk (73.8%), unavailability of the antenatal care service in their locality (10.8%), and the fear that medication from the health facilities could harm their unborn babies (9.2%). for those that made use of antenatal services, majority (66.8%) registered in the second trimester of pregnancy, while 28.8% registered earlier, in the first trimester. it was however found that only 62.8% of those who attended the antenatal clinics (anc) took intermittent preventive treatment for malaria, while the rest (37.2%) said they did not. the most common reason (76.5%) given by respondents for not taking intermittent preventive treatment of malaria was that they were not sick during pregnancy and saw no reason why they should take the drugs. a few (13.7%) however, said they either did not believe in the efficacy of the drugs or that they were afraid the drugs could cause loss of pregnancy. for the 274 who were on intermittent preventive treatment of malaria, the commonest drugs used were sp (58.4%), while as much as a third, 87 (31.8%) used chloroquine that has been replaced by recent government policy in view of the widespread resistance to it in nigeria. about 43.6% of those on sp had received a first dose, while 46.5% had received a second dose. of these, only 16.4% took the drug at the health facility directly observed as against 71.4% who said they took theirs at home [table 3 ]. a total of 339 pregnant women or women who had children in the last 1 year were interviewed. majority of the women (31.6%) were aged between 25 and 29 years (mean age 28.2 3.13 years) and had primary level education, although 8% had no formal education. fishing, farming, and petty trading were the most common occupations among them [table 1 ]. more than three quarters (76.4%) of the women had correct knowledge that malaria was caused by exposure to mosquito bites. there were however some respondents with misconceptions that malaria resulted from working in the sun (11.5%), eating too much of palm oil (4.7%) and witchcraft (1.5%). most of the women (71.4%) equally had knowledge that malaria could cause some harm during pregnancy to the mother or fetus such as abortion, still births, or low birth weight. however, nearly a third of the women (32.6%) did not know the correct dose of sp recommended for preventing malaria in pregnancy [table 2 ]. a majority of the respondents, (80.8%) currently attend or attended antenatal care clinics during their last pregnancy, while the rest (19.2%) did not. the main reasons for not attending were given as the low perception of personal risk (73.8%), unavailability of the antenatal care service in their locality (10.8%), and the fear that medication from the health facilities could harm their unborn babies (9.2%). for those that made use of antenatal services, majority (66.8%) registered in the second trimester of pregnancy, while 28.8% registered earlier, in the first trimester. it was however found that only 62.8% of those who attended the antenatal clinics (anc) took intermittent preventive treatment for malaria, while the rest (37.2%) said they did not. the most common reason (76.5%) given by respondents for not taking intermittent preventive treatment of malaria was that they were not sick during pregnancy and saw no reason why they should take the drugs. a few (13.7%) however, said they either did not believe in the efficacy of the drugs or that they were afraid the drugs could cause loss of pregnancy. for the 274 who were on intermittent preventive treatment of malaria, the commonest drugs used were sp (58.4%), while as much as a third, 87 (31.8%) used chloroquine that has been replaced by recent government policy in view of the widespread resistance to it in nigeria. about 43.6% of those on sp had received a first dose, while 46.5% had received a second dose. of these, only 16.4% took the drug at the health facility directly observed as against 71.4% who said they took theirs at home [table 3 ]. this study shows that most of the women interviewed were aware that exposure to mosquito bites predisposes them to malaria and that malaria could be harmful during pregnancy to the mother and the unborn baby. the apparent knowledge about malaria among our respondents may be linked to the appreciable level of education among them and the fact that they reside in a malaria endemic region. the association between women 's education and knowledge about malaria has been widely reported in nigeria and elsewhere in africa. however, the knowledge exhibited by the women was at variance with their practices. a large proportion of women, who attended anc, collected sp from health workers, took them home but did not use the drugs eventually. this was because most of the women felt they were not sick during pregnancy or had fears that taking the drugs could cause harm to their unborn babies or even doubted the efficacy of the drugs in preventing malaria during pregnancy. the reluctance in taking medications especially when there was no clear indication or apparent need corroborate the general feeling in the society that medicines are unnecessarily harmful when healthy and therefore should be taken only when there is a compelling need to do so. there are reports that pregnant women are associating sp with severe adverse outcomes such as abortion and skin reactions, which could account for why some do not take the drugs.[2527 ] equally of great concern was the fact that nearly a third of the women continued to use chloroquine for the prevention of malaria in pregnancy in despite the shift in national malaria treatment policy recommending the use of sp in preventing malaria in pregnancy. the noncompliance with the new policy puts pregnant women at risk of malaria in pregnancy with the unpleasant consequences on maternal health and pregnancy outcomes such as anemia, spontaneous abortion, low birth weight, prematurity, or even death. these negative attitudes of women are relevant issues for intervention by anc providers through targeted malaria prevention information. however, studies by who have revealed that anc services provided in africa and other developing countries are often substandard and have therefore significantly contributed to lower uptake of relevant preventive health interventions. in addition to risk detection, one of the objectives of antenatal care service is to provide pertinent health information and education to pregnant women that will help in addressing perceived myths and misconceptions about pregnancy - related issues, including malaria prevention. in this instance, it presents a timely and unique opportunity to emphasize the inappropriateness and the inherent risks associated with the persistent use of chloroquine in malaria treatment and prevention in pregnancy. it is also an ideal opportunity to correct any false impressions about sp, which are not supported by evidence, and to emphasize the fact that side effects with sp are known to be rare, except for the few people who are hypersensitive to sulfa drugs. in addition, by allowing anc clients to take their drugs at home as was found in this study, meant that compliance could not have been guaranteed, thereby defeating the entire essence of iptp. the practice is also in disregard of the national policy guidelines which recommend that iptp should be directly observed by health workers. in many health facilities where iptp were not observed, the blame has often been put on the lack or insufficiency of essential utilities like cups and potable drinking water and shortage of manpower to carry out the observation. similar findings have also been reported in a study conducted in south - west nigeria, in rural phc centers among anc attendees, where despite an appreciable knowledge about malaria, the use of iptp by pregnant women remained low. however, this was unlike what was found in tanzanian, where knowledge of malaria was associated with an increase in intermittent preventive treatment of malaria among pregnant women attending antenatal care clinics. our study thus demonstrates a clear gap between general awareness about malaria and the practice of effective specific prevention against it during pregnancy. it highlights the need for appropriate dissemination of the current antimalaria treatment policy and further scrutiny of the quality of the antenatal care services provided at the primary health care centers, especially in the rural communities. this is to ensure that opportunities for malaria prevention are not missed because of the weaknesses of the health care system. this position is particularly important because anc attendance rates even in rural communities in nigeria are usually high, while early commencement during the first and second trimesters of pregnancy was common as was seen in our study. antenatal care services provide a good opportunity and a platform on which preventive health interventions, myths, and misconception about health can be dealt with effectively if properly delivered. we hold the view that if pregnant women clearly understood the reasons for a change in malaria treatment and prevention policy as well as imminent dangers associated with noncompliance with the recommendations, they would comply substantially with their prescriptions. however, the study is limited by the no assessment of the knowledge and practices of the health care workers themselves on current malaria treatment and prevention policy change. misconceptions about iptp persist among women known to have attended antenatal care clinics during pregnancy. the persisting chloroquine dispensing in many rural and suburban communities, despite a change in treatment policy recommending the use of sp instead of chloroquine, presents a significant challenge in current malaria control efforts. only a minority of pregnant women receive iptp as recommended, when the factors of anc utilization, correct prescription, and patient compliance are added up. therefore, the realization of the national and who iptp coverage targets of at least 80% by 2015 is significantly in doubt, while the goal of attaining the malaria - related mdgs in the state by 2015 is clearly threatened. further studies are needed to evaluate the knowledge and practices of health care workers on the new malaria treatment policy, while efforts directed at awareness creation on the new policy are necessary to enhance the uptake of ipt in pregnancy in rivers state. | background : this study was conducted to assess the level of intermittent preventive treatment of malaria in pregnancy (iptp) in rivers state, nigeria, to identify obstacles prohibiting utilization in order to make recommendations for improved uptake and malaria control in general.methods:a cross - sectional study was carried out in november 2008 among 339 pregnant women and those who had delivered children in the last 1 year, using a multistage sampling method. data were analyzed using the epi - info version 6.04d statistical software package and hypothesis tests were conducted to compare summary statistics at 95% significance level.results:most of the respondents (76.4%) had knowledge that malaria was caused by mosquitoes and was harmful in pregnancy. although majority of the pregnant women (80.8%) attended antenatal care clinics, knowledge of the correct use of sp was low (32.6%) and only 62.8% took malaria preventive treatment. of these, 58.4% took sp, while nearly a third, 31.8%, took chloroquine. only 16.4% took their sp at the health facility directly observed by health workers according to the national guidelines. the commonest reason for not preventing malaria was that they were not sick during the period of pregnancy.conclusions:misconceptions about iptp persist among women known to have attended antenatal care clinics, resulting in only a minority of pregnant women receiving iptp as recommended by national guidelines. efforts directed at awareness creation on the new malaria prevention and treatment policy are therefore necessary to enhance the uptake of ipt in pregnancy in rivers state. further studies are however, needed to evaluate the knowledge and practices of health care workers on the new malaria treatment policy. |
protein - energy malnutrition (pem) remains a major public health problem in the world, particularly in developing countries. according to the world health organization (who), pem affects one - third of children around the world, and 43% of children in developing countries (230 million), presenting a delay in staturoponderal growth. in burkina faso, the prevalence of children with acute malnutrition is 19%, while 39% present a delay of statural growth, and 38% have weight insufficiency. however, biological markers such as albumin, transthyretin, transferrin, and retinol binding protein are also used for nutritional diagnosis and rehabilitation aftercare. several surveys have shown the relationship between clinical, anthropometric, or biological indicators and mortality of children suffering from pem in hospitals [35 ]. more recently used markers like insulin - growth factor - i (igf - i) used to measure the deficit in growth hormone (gh), and the insulin growth factors binding proteins (igfbps) also draw attention. insulin - like growth factor - i (igf - i) is single - chain peptides of 7.5 kilodaltons (kdas). her structure is similar to the igf - ii and proinsulin [6, 7 ]. the liver is believed to be the main source of production of igf - i [810 ], but the highest concentrations of igf - i are observed in blood [11, 12 ]. many factors intervene in the regulation of the igf - i but the most important are growth hormone (gh), insulin, and nutritional status. nutritional status plays an important role in the regulation of the igf - i. adequate food intake is essential for maintaining normal igf - i and igfbp-3 circulating rates in the serum[16, 17 ]. indeed, energy and protein restrictions in children lead to a decrease of circulating igf - i and igfbp-3 rates. the variations of serum igf - i rates observed in response to different nutritional states suggest that igf - i may serve as a marker for children nutritional state [1921 ]. the igf - i appears indeed as a marker potentially more sensitive than the serum albumin or the transferrin, even if the effect of infection on circulating concentration must be taken into account [2224 ]. only two surveys have been conducted on igf - i and the nutritional rehabilitation among children under 5 years old but both were inconclusive because of low sample sizes [22, 24 ], but both were inconclusive because of low - sample sizes. these two studies did not also analyse the change of igf - i and the changes of nutritional status. so, the purpose of our study is to analyse the relationship between the igf - i values and the nutritional status of children hospitalised for nutritional rehabilitation in the context of a west - african country. the study of protocol was reviewed and approved by the ethics committee for research in health of burkina faso. this study was conducted in two nutritional rehabilitation centres : (cren) of the regional hospital (chr) and the persis medical centre (cm) of the city of ouahigouya, located in the northern part of burkina faso. all consecutively admitted patients with pem should be included in the study. among these patients, the criteria for selection were the age < 60 months and the absence of known pathology like hiv, diabetes, congenital diseases, and tumours. upon admission, social and demographic characteristics (age, sex, and vaccination past records) were collected ; weight and height were measured, and different clinical data were checked (presence of oedema, coloration of hair, splenomegaly, and hepatomegaly). the children were followed up and the anthropometric data and the capillary blood samples were again taken again on the 7th and the 14th days after admission. they benefited from a free standard feeding which consisted of milk f75 for 7 days at 135 kcal / kg weight per day and milk f100 after the week at 100 kcal / kg weight per day. this posology was increased by 20 kcal every 3 days until 200 kcal / kg per day, as necessary. in addition, the children received enriched pulp five times a day. a treatment for bacterial infections and malaria was available at any time if required. a total of 68 children were recruited for the study but only 59 were included because the ages of 9 children were unknown. the sex ratio was 1.68 for boys ; 76.3% of the children were aged between 1 and 2 years. most of the mothers (96.6%) and the fathers (88.1%) had no scholarship education. mothers were mainly housewives and fathers were mainly farmers. with regard to vaccine status, two thirds of the children were fully vaccinated, 30.9% not fully vaccinated, and 3.6% were not vaccinated at all. weight and height were determined on a salter balance and the height was rounded to the nearest centimetre. for children younger than 2 years, height (length) was measured on a supine table as follows : an assistant held the head against the headboard and another straightened the legs. for children older than 2 years, a stadiometer was used. nutritional status, expressed as weight for height (whz) and height for age (haz), was standardised for age and sex using either the reference tables from the burkina faso reference tables or the united states national center for health statistics (nchs) [26, 27 ]. the reference tables of burkinabe children were constructed from anthropometric measures collected during the survey on the reference values of igf - i in burkina faso. blood was obtained by vein puncture and 2 drops per circle were immediately collected on (free falling) the filter paper ; 2 circles per paper were systematically filled ; the samples were dried after 510 minutes at ambient temperature (3035c) and were kept at 4c for 12 weeks before processing. all filter paper samples were transferred for analyses to the unit of diabetes and nutrition, belgium. we validated the methods of determining the igf - i levels from dried blood spots on filter paper on igf - i ria, after separating the igf - i from its binding proteins using sep - pack chromatography. igf - i was determined by ria, using the antiserum at a 1/15000 dilution, and i- igf - i was labeled by the iodogene method and purified by rp - hplc. the concentration of the standard curve spans over a range of 0.05 to 2 ng / ml. intra - assay and total imprecision of the ria were of 5% and 16% at a level of 0,25 ng / ml and of 5% and 22% at a level of 1.01 ng / ml. igf - i absolute measurements were also standardised for age and sex, and reported as igf - i z scores, using the reference values of igf - i in children from birth to the age of 5 in burkina faso. results are expressed as proportions for discrete variables, as means and standard deviations (sds) for continuous variables with a normal distribution, and as geometric means with geometric standard deviations for continuous variables with a log - normal distribution, like igf - i. standardised values are expressed as z - scores and are reported as mean sd and proportion under 2.00 or under 3.00. igf - i was considered either as an absolute measurement and analysed on a log scale, or as an age- and sex - adjusted normal z - score and analysed on a linear scale. relationships between igf - i and whz at baseline and after 14 days of nutritional rehabilitation were assessed using r, the pearson cross - product correlation coefficient. changes in igf - i after 14 days of nutritional rehabilitation were expressed as ratio for absolute measurements and as differences for standardised values, and changes were tested using student 's paired t - test. relationships between changes in igf - i and increases in whz were assessed using also r. no p - value was corrected for multiple comparisons and a p value <.05 was considered as statistically significant. two children (3.4%) were admitted to the nutritional rehabilitation centre because of kwashiorkor, 55 children (93.2%) were admitted for marasmus, and two presented with both kwashiorkor and marasmus. one child died during the follow - up. at the time of admission, using international reference values as standards, 57 children (96.6%) had an age- and sex - adjusted weight for height z - score lower than 2.0, including 43 children with a whz < 3.0. out of the 57 children with a whz < 2.0, 51 (89.5%) had also an age- and sex- adjusted igf - i z - score of < 2.0. an igf - i z score of < 2.0 was also observed in 90.7 % (39/43) of children presenting with a whz < 3.0. when using burkina faso age and sex reference values for standardising, 44% (26/59) of children had a whz < 2.0, and 8% (5/59) had a whz < 3.0. 2.0 was 89% (23/26) in children with whz < 2.0 and 80% (4/5) in children with whz < 3.0. after 14 days of nutritional rehabilitation, 22 children (37%) reached a whz 2.0 according to international references, and 91% of these children (20/22) also attained an igf - i z - score 2.0. using burkina faso data as standards, the whz was 2.0 in 80% (n = 47) of children after 14 days of nutritional rehabilitation, and 81% of these children (n = 38) also reached an igf - i z - score 2.0, suggesting a quick recovery of igf - i, as illustrated in figure 1. during nutritional rehabilitation, igf - i increased from 6.36 (1.40) g / l (geometric mean and sd) upon admission, to 8.59 (1.81) g / l after two weeks of nutritional rehabilitation (figure 1). table 2 shows the parallel increase in weight and in igf - i, from admission to 7 and 14 days after nutritional rehabilitation. data are presented as absolute measurements, as standardised measurements using international references for age and sex adjustments, and as standardised measurements using burkina faso data as standards. after 7 days of nutritional rehabilitation, igf - i was multiplied by 1.587, as a significant increase of 58.7% on average.. there was a significant increase in log - scaled igf - i, as well as in igf - i z - scores one week after admission (paired t - test, p =.003, and p =.007), and two weeks after admission (paired t - test, p <.001, and p =.001). a significant increase was also observed for weight for height z - scores, with both standardisations. the relationship between age- and sex - adjusted igf - i score and weight for height z - score using the burkina faso reference for standardisation is illustrated in figure 2, upon admission (a) and after 14 days (b). upon admission, the proportion of children who had both whz of < 2.0 and igf - i z score < 2.0 was 39% (23/59), but 47% (28/59)a high proportion of children had an igf - i z score of < 2.0 and whz of 2.0, leading to a low correlation (p =.69). after 14 days of nutritional rehabilitation, the proportion of children who both had whz 2.0 and igf - i z score of 2.0 increased 64% (38/59), with highly significant correlation, as reflected in figure 2(b). expressing the change in igf - i as a difference in igf - i z scores or expressing the change in igf - i as a ratio between igf - i value after 14 days and igf - i value upon admission, there was significant correlation with the increase in weight for height z - scores (p <.01 on figure 3(a), and p <.01 on figure 3(b), resp.). when using the international nchs references for standardisation, there was an even higher correlation between changes in igf - i and increases in weight for height z - scores, with r = 0.38 (p <.003) for differences in igf - i z scores, and r = 0.39 (p <.003) for igf - i absolute value ratios. the objective of this study was to assess the relationship between the igf - i values and the nutritional status of children hospitalised for nutritional rehabilitation. the study also sought to determine igf - i values as forecast markers of mortality. however, this last objective has not been achieved because the care given to children admitted in rehabilitation helped maintain a low mortality rate (1 in 68 children enrolled in the present study). one of the limitations of our study is that the influence of factors like infection was not taken in consideration. the acute or chronic inflammatory status could interfere on the rate of igf - i production. it was shown that in the experimental model, the stimulation of an inflammatory status by injection of endotoxin leads to a reduction of igf - i rates due to a resistance of the gh. during the sepsis, yumet. observed an increase of gh with a reduction of 4050% of plasma igf - i in rat at 12 hours and 24 hours after gh administration. as far as the evaluation of nutritional status is concerned, most of our patients suffered from protein and energy malnutrition, with a few cases of kwashiorkor. using nchs references, only two children had a whz 2.0 at admission, and 73 % presented severe malnutrition (whz < 3). when using local references, 56% of children had a whz 2.0 at admission, and only 8% presented severe malnutrition. of course, malnutrition is better defined using nchs references than local ones in a developing country such as burkina faso. but both references were used to standardise nutritional status in our study because age and sex reference values for igf - i were available at the local level only. low igf - i values were observed in hospital children suffering from protein and energy malnutrition [22, 23 ]. but values were lower in children suffering from marasmus than in children suffering from kwashiorkor ; this suggests that the secretion of igf - i is closely related to energy consumption than to protein consumption. after the nutritional rehabilitation of children admitted for protein and energy malnutrition, the igf - i increased significantly in children that had kwashiorkor or marasmus. but the igf - i values after 14 days of nutritional rehabilitation were still lower than in healthy children [22, 23 ]. there was no good agreement between the igf - i values and the weight for height z - scores upon admission, owing to the fact that a severe malnutrition was present in 73% of children and igf - i values were too low to allow for correlation. but after 14 days, we observed good agreement between igf - i values and whz values ; the increase in igf - i also paralleled the increase in weight for age z - scores. these results suggest that igf - i can be a dynamic indicator of nutritional recovery. the study conducted in gabon by zamboni. reported igf - i values of 2.7 0.7 nmol / l upon admission of 9 children (mean age : 17.2 5.4 months) with kwashiorkor and the igf - i increased to 7.6 1.7 nmol / l after 48 weeks of nutritional rehabilitation. in children with marasmus (n = 13), l on admission and 5.2 1.1 nmol / l after complete nutritional rehabilitation.. found that igf - i concentrations increased significantly after 10% weight recovery in malnourished children (n = 15). on admission, the igf - i values were 3.5 1.0 ng / ml and reached 5.9 2.0 ng / ml after 10% body weight gain. palacio. reported that an increase in igf - i rates in malnourished children and its relation with weight gain was observed during the rehabilitation. this was not observed for markers such as prealbumin or serum albumin [23, 24 ]. observed that the caloric restriction induced a reduction in igf - i and igfbp-3 in adults and children. after nutritional rehabilitation, an increase was achieved, but without reaching the initial rates. a reduction in igf - i rates was also reported in other types of malnutrition such as mental anorexia, coeliac, acquired immune deficiency syndrome (aids), or crohn 's disease [30, 31 ]. the ability of igf - i to follow variations of nutritional status shows that it is potentially a good clinical marker to follow nutritional rehabilitation in children with protein and energy malnutrition. the prognostic interest of igf - i remains to be demonstrated by the implementation of studies which will measure the impact of igf - i on the mortality of children with malnutrition in comparison with other markers of nutrition like albumin, prealbumin, and rbp. if the prognostic interest of igf - i were proved, the use of igf - i will be recommended. the experience shows that the cost of technology could be reduced quickly with the development of the research. | objective. to investigate the relationship between igf - i and the nutritional status of west - african children hospitalised for nutritional rehabilitation. patients and methods. a cohort study was performed in two centres for nutritional rehabilitation and education (cren) in burkina faso. children were followed and the anthropometric data as well as the capillary blood samples were taken on the 7th and on the 14th days after their admission. igf - i levels were determined from dried blood spots on filter paper on igf - i ria, after separation of the igf - i from its binding proteins, using sep - pak chromatography. results. a total of 59 children was included in the cohort. the igf - i mean geometric values (sd) were 6.3 (1.4) g / l on admission, 8.6 (1.8) g / l at day 7 and 13.6 (2.0) g / l at day 14. the differences between these values were statistically significant (p <.001). there is a significant correlation between the changes of igf - i with the change of weight for height z - score (p =.01). conclusion. these results suggest that igf - i can be considered as a potential marker to follow the nutritional status of children admitted in hospital for protein and energy malnutrition. |
apoptosis, also known as programmed cell death, allows controlled removal of aged, damaged, infected or unwanted cells, maintaining homeostasis in multicellular organisms. this process would be functionally ineffective without clearance of resulting apoptotic corpses, as without disposal, they would progress to secondary necrosis and drive unwanted inflammation and autoimmune disease.1 effective clearance of dying cells is orchestrated by a balance of pro- and anti - clearance mediators that, under normal physiological conditions, skew towards phagocytic clearance as apoptosis proceeds. this process typically results in an overall anti - inflammatory phenotype.2 however, if this balance is altered, clearance mechanisms can fail and pathology may ensue. it is likely that much, and perhaps a majority of, apoptotic cell clearance occurs before dying cells show classical morphological features of apoptosis (such as the characteristic nuclear changes associated with in vitro apoptotic death of lymphocytes fig. such death may be cleared by viable neighboring cells (e.g., epithelial cells), phagocytes that have often been called phagocytes, as their primary function is not phagocytosis of material (e.g., bacteria and cell debris).3 however, it has been suggested that perhaps these local cells may in fact be the professional phagocytes of early apoptotic cells, and that recruited phagocytes (e.g., macrophages, whose primary function is phagocytosis of such material) are the professional scavengers of dying cells that have failed to be cleared sooner.4 this latter situation will occur at sites of high level apoptosis5 and will often be associated with pathological situations.1 effective clearance of dying cells requires the orchestration of a complex multi - stage process (fig. an early event, often neglected as it is not seen in simple in vitro culture models of apoptosis, is the recruitment of phagocytes to sites of cell death. this recruitment requires the release of attractants from dying cells and the consequent attraction of phagocytes. as the recruited phagocyte recognizes the scent of dying cells it must migrate to and bind (i.e. tether) apoptotic cells prior to engulfing and degrading the cell corpse. dead cell removal alone at inflammatory sites is insufficient to ensure resolution of cell death ineffective clearance of apoptotic cells may thus arise from a defect in any one, or more, of these stages. defects in genes related to clearance of apoptotic cells are associated with a variety of disease conditions, though it is not always clear whether the pathology arises directly from a failure to remove apoptotic cells. however, failed clearance of apoptotic cells is well - established in the pathogenesis of autoimmune disease, as persistent apoptotic cells ultimately lose their membrane integrity, thus promoting the production of autoantibodies to usually sequestered intracellular antigens that are released from necrotic cells. for example, defects in c1q expression (a soluble complement component known to opsonise apoptotic cells and mediate efficient corpse clearance) can drive systemic lupus erythematosus.6 furthermore, increased incidence of apoptotic cells is also noted in range of inflammatory lung diseases (reviewed in7). failed clearance of dying cells has also been implicated in inflammation associated with aging8 and a number of age - related conditions, including arthritis, neuropathy and atherosclerosis (reviewed in1). atherosclerosis, the major pathology focus of this review, represents an important in vivo example of a site of high level cell death that is associated clearly with defective apoptotic cell clearance and failed emigration of phagocytes. within developing atherosclerotic plaques, large numbers of monocytes / macrophages however, with a failure in clearance and lack of phagocyte egress, further phagocyte recruitment exacerbates the problem. collectively these events drive this important pathology,9,10 which is, perhaps, a key target for therapeutic intervention based on a detailed understanding of the mechanisms associated with apoptotic cell clearance. as risk factors for atherosclerosis, such as aging and obesity, are on the increase in the general population, it is imperative to gain a full understanding of cell clearance mechanisms, which may aid future management and treatment of these conditions.11 this article will outline the molecular and cellular mechanisms proposed to function in concert for the efficient removal of apoptotic cells in vivo by monocytes and macrophages, and will highlight areas that require further study to address the role of apoptotic cell removal in important pathological situations such as cardiovascular disease. macrophages are inherently plastic, switching phenotype in response to the local microenvironment. classically - activated m1 macrophages are associated with a pro - inflammatory phenotype ; for example, in response to pathogenic stimuli, whereas alternatively - activated m2 macrophages have a more reparative role, with functions in apoptotic cell removal and resolution of inflammation.12 researchers have tried to designate macrophage phenotypes according to characteristic responses and receptor profiles, but it is becoming clear that rather than definitive subtypes, macrophages exhibit a spectrum of activity that can continually alter, depending upon their microenvironment (reviewed in13). consequently, the macrophage phenotype will likely be crucial to the ultimate outcome arising from sites of cell death, with non - resolving chronic inflammatory sites supporting inflammatory phenotypes. apoptotic cells are known to modulate the phenotype of phagocytes towards an anti - inflammatory phenotype.2 macrophages are often recruited from circulating blood monocytes rather than long - lived tissue - resident macrophages. monocyte subtypes are highly studied, with surface receptors (cd14, cd16 and chemokine receptors e.g. cx3cr1) utilized to identify distinct phenotypic subgroups.14 expression of classical chemokine receptors may define those monocyte populations recruited to sites of cell death but detailed studies of recruited monocytes are still to be fully undertaken cx3cl1, released in association with apoptotic cell - derived extracellular vesicles, has been shown to function as a chemoattractant for phagocytes.15 this identifies cx3cr1 monocytes as an interesting research target in the field of apoptotic cell clearance, especially as cx3cr1 and cx3cl1 are both expressed on foam cells16 and cx3cr1 is involved in monocyte recruitment to the atherosclerotic plaque,17 a site of defective cell clearance (reviewed in18). in the case of professional phagocyte (i.e. monocyte / macrophage) recruitment, evidence indicates clearly that find me signals are released by apoptotic cells, either as soluble molecules or as part of complex extracellular vesicles. this relatively new area of apoptotic cell research addresses phagocyte migration to dying cells in a manner that is relevant to the in vivo clearance of apoptotic cells. in the past, apoptotic cell clearance studies have often relied upon a simple assay system where apoptotic cells were whilst fruitful, current in vitro studies are now directed to address the full extent of the processes within the apoptotic cell clearance program. deficiencies, outlined below, in some of these signals or their receptors have been linked to inflammatory conditions. cx3cl1 (fractalkine) is released by apoptotic human b cells in association with extracellular vesicles (often referred to as microparticles) and was, until recently, the only classical chemokine implicated in the recruitment of phagocytes to dying cells. it ligates the receptor cx3cr1 on the phagocyte surface to promote directional migration.15,19 cx3cl1 also increases expression of milk fat globule - endothelial growth factor 8 (mfg - e8), an identified bridging molecule between apoptotic cells and phagocytes, thus enhancing clearance.20 more recently, however, cells induced to apoptosis through ligation of fas / cd95 have been shown to release an array of cytokines and chemokines including mcp-1 and il-8 that were demonstrated to be attractive to thp-1 monocytes and primary human neutrophils respectively.21 lysophosphatidylcholine (lpc) is a lipid mediator associated with phagocyte recruitment to dying cells22 via interaction with the g - protein - coupled receptor (gpcr) receptor g2a.23,24 whilst its precise role has been questioned, mice defective in the find me signal receptor g2a develop an autoimmune syndrome.25 it may be most important as an autocrine effector molecule, as it has been shown to induce expression of monocyte, neutrophil and lymphocyte chemoattractants monocyte chemotactic protein-1 (mcp-1), interleukin-8 (il-8) and chemokine (c - c motif) ligand 5 (ccl5).26 sphin - gosine-1-phosphate (s1p) is another lipid mediator with roles as both a chemoattractant and immune - modulator. interacting with gpcrs on the phagocyte, s1p also induces il-8 and il-10 release, whilst reducing tumor necrosis factor- (tnf-) and il-12p70 production.2729 nucleotides such as atp and utp have been proposed to be short - range chemoattractants, interacting with purinoreceptor-2 (p2y2) on the phagocyte surface.30 the possible short range of action of these attractants highlights the likelihood that multiple attractants will work together in effecting the efficient homing of phagocytes to sites of cell death. whether some attractants are more active than others on different sub - populations of phagocytes remains to be determined, but these studies are necessary to provide a full picture of the mechanisms at work within the clearance of apoptotic cells. recent work has also suggested that oxidative stress, even without cell death, may mediate selective recruitment of monocytes.31 such attraction to stressed, but not dying cells, may be a physiologically relevant mechanism by which phagocytes are deployed in readiness for cell deaths, though this may also promote disease. many of these chemoattractants, e.g., cx3cl1, are packaged in association with extracellular vesicles released following zeiosis, or blebbing, of the apoptotic cell membrane. thus, extracellular vesicles play a key role in phagocyte recruitment.15,32 torr (2012) demonstrated that the reduction in apoptotic cell surface intercellular adhesion molecule (icam)-3 was the result of its shedding on extracellular vesicles.33 these vesicles were shown to be attractive to phagocytes in an icam-3-dependent manner. this effect was demonstrated using a vertical migration chamber where gravity exerts its effects in models are often highly simplified and results confounded by poor chemotactic gradients (e.g., all or nothing step gradients in transwell - based assays) and the impact of gravity. routinely now, horizontal migration chambers with time - lapse video microscopy can be used that rely on true chemotactic gradients and remove the impact of gravity on the assay. in these assay systems, phagocyte migration towards apoptotic cells can be clearly revealed and measures of phagocyte speed and direction can be made (fig. 3). a limited number of molecules (e.g., icam-3 and cx3cl1) on apoptotic cell - derived extracellular vesicles have been identified to promote phagocyte attraction, and a full analysis of the physicochemical characteristics and molecular constitution (proteome, lipidome and glycome) has yet to be undertaken. this approach will likely yield important information that will pave the way to manipulating phagocyte recruitment. furthermore, little is known of the cargo associated with the extracellular vesicles, though cargo carried by extracellular vesicles from other sources are known to have profound biological effects (reviewed in34). the nature of recruited phagocytes must also be managed carefully at sites of cell death due to the inflammatory nature of some phagocyte populations, and is a key stage with regards to immunological outcome. find me signals are capable of recruiting neutrophils, which would result in an undesirable phlogistic reaction to apoptotic cells. some examples of these signals are il-8 released from fas - mediated apoptosis of epithelial cells or lpc - induced il-8 production in endothelial cells.21,26 lactoferrin may provide an answer as to why neutrophilic infiltrates are not found at sites of persistent apoptosis. keep out signal, deterring granulocyte migration.35,36 this highlights again the need for balance between the mixed messages being relayed by apoptotic cells in order to maintain effective, immunologically - silent clearance, and further the lineage of recruited phagocytes (e.g., granulocyte versus mononuclear) and their phenotype may be central to the elicited response at sites of cell death and the balance of find me and keep out signals represents an attractive therapeutic option to inhibit recruitment of phagocytes where this is not beneficial. for example, lactoferrin is known to reduce the migration of neutrophilic35 and eosinophilic36 granulocytes, and thus may be developed for the therapy of inflammatory conditions where granulocyte recruitment causes more harm than good.37 for example, targeting of eosinophil apoptosis and clearance has been discussed in a recent review as possible intervention for asthma38 and prevention of granulocyte recruitment may represent a therapeutic strategy.36 despite recruitment of phagocytes to apoptosis, there are sites of cell death that do not resolve (i.e., where the focus of cell death is not removed). this pathological situation highlights how continued phagocyte recruitment may not be beneficial ; phagocytes enter the plaque and remove dying cells, but this phagocytic clearance has been suggested to be defective.18,39 the phagocytes also become trapped at this site such that they ultimately die by apoptosis, leading to further monocyte recruitment.10,40 it has been suggested that oxidized ldl within the plaque environment may upregulate cx3cl1 expression, preventing macrophage egress,16 whilst macrophage emigration from the plaque is also prevented by netrin-1.10 thus, when balance in phagocyte recruitment fails, it may lead to pathologies such as those in atherosclerosis, where either over - recruitment or a lack of cell egress contribute to pathology (reviewed in40). consequently, this site could benefit from modulation of the monocyte recruitment phase of apoptotic cell clearance. this may occur through recruitment of alternative phagocyte subsets evidence suggests that monocyte sub - populations may influence disease, with sub - population counts being predictors of disease.4143 it may also be through blockade of recruitment such that the pathology, whilst not resolved, is halted in its progression. keep out signals. in support of this, mice defective in cx3cr1 show both reduced plaque size and phagocyte accumulation.44 phagocyte recruitment to important pathological sites (e.g., the atherosclerotic plaque) still requires further research. sites such as these are difficult to model in vitro, with much of the work done in animal models ; however, mechanisms between species are not always conserved, leaving gaps in research areas where murine models are prominent. for example, icam-3, which is released from apoptotic cells in association with extracellular vesicles and promotes macrophage recruitment to apoptotic cells, is absent from rodents. find me signals and/or apoptotic cell - derived extracellular vesicles from foam cell death activate endothelium to recruit leukocytes, and which attractants are key to monocytes finding apoptotic cells within the plaque following transmigration. in order for phagocytes to begin the clearance process, target cells must be recognized as apoptotic. recognition is the first stage of a 4-stage model,4 followed by tethering (binding), tickling (signaling) and finally phagocytosis. figure 4 shows a typical presentation of a human monocyte - derived macrophage associated with apoptotic cells. the molecular players involved in these processes have been extensively reviewed elsewhere4,9,45 and so will be covered relatively briefly in this review. however it is clear that the apoptotic cell ligands and their cognate phagocyte receptors work as a team (in a phagocytic synapse)46 to effect these different stages of the apoptotic cell clearance pathway, with some players solely involved in tethering and others involved in multiple stages (fig. figure 5 depicts major molecular players underpinning the clearance of apoptotic cells. as cells enter into apoptosis, eat me flags are presented on the cell surface and are released on extracellular vesicles. the flags so far identified encompass exposure of intracellular molecules (e.g., phosphatidylserine (ps)47,48 and annexin i),49 modification, redistribution and removal of cellular proteins, lipids and glycoproteins (e.g. modification of icam-3,50 ps oxidation,51 removal of sialic acid)52 and binding of opsonins (e.g. mannan - binding lectin (mbl), c1q).53,54 often the precise nature of molecular modifications that may occur during apoptosis remains ill - defined. eat me marker, which in viable cells is restricted to the inner leaflet of the plasma membrane and is redistributed during apoptosis.48,55 this exposure of ps through loss of phospholipid asymmetry is required for phagocytic clearance of apoptotic cells.47,48 it seems likely that this redistribution of membrane lipids also permits the movement of other surface molecules to indirectly promote apoptotic cell clearance. ps has been shown to bind to the phagocyte directly through phagocyte receptors t cell immunoglobulin mucin-1 (tim-1) and tim-4,56 brain - specific angiogenesis inhibitor-1 (bai1),57 stabilin-258 and the receptor for advanced glycation endproducts (rage).59 these receptors are not ubiquitously expressed indicating that different phagocytes for apoptotic cells will use a different set of receptors for clearance and they likely have different functions, as tim-4 appears to solely tether apoptotic cells via exposed ps.60 ps on the apoptotic cell may also bind to phagocyte receptors indirectly through molecular bridges : gas-6 and protein s bridge to mertk whilst mfg - e8 bridges to v integrins.61 the phagocyte receptor cd91 (ldl - receptor - related protein (lrp)) has been shown to bind ps when colocalized with redistributed calreticulin.62 calreticulin, upregulated during apoptosis, also associates with bridging molecules c1q and mbl for recognition by lrp.54 modification of ps, by mechanisms such as oxidation, also allows binding to phagocytic scavenger receptors such as cd36.63 scavenger receptors cd68, sra-1, srb-1 and lox-1 also have roles in apoptotic cell recognition.6467 mechanisms for the recognition of ps are clearly important and highlight, once again, the benefits to efficient clearance of dying cells, as defects in ps recognition genes are associated with important pathologies. for example in experimental atherosclerosis, a defect in gas-6 promotes more stable plaque development with reduced phagocyte presence,68 possibly suggesting a role for gas-6 in phagocyte recruitment / retention as well as in apoptotic cell clearance. however, defects in mer, to which gas-6 bridges ps, result in defective apoptotic cell clearance and support atherogenesis.69,70 further work is required to explain this apparent paradox. defects in mer and tim-4 are also associated with reduced apoptotic cell clearance and development of autoimmunity in mice.70,71 ps recognition via gas-6 and mfg - e8 is also implicated in the efficient clearance of photoreceptor fragments, a homeostatic process central to retinal maintenance. failed clearance leads to death of photoreceptors and degenerative eye conditions.71 similarly, mer kinase is implicated in the pathology of retinitis pigmentosa, where patients may carry a natural mutation in mer and thus have defective clearance of photoreceptor fragments.72 furthermore, reduced recognition of ps has also been implicated in alzheimer s disease, where both increased neuronal death and reduced clearance, possibly from reduced mfg - e8 expression,73 may contribute to the increased levels of apoptosis detectable in the alzheimer s disease brain (reviewed in71). loss of integrins has also been associated with chronic ulcerative colitis and autoimmunity.74 it is clear that efficient clearance of dying cells is essential to prevention of a range of important inflammatory diseases, but it is interesting to note that pathology tends to follow disruption of those clearance pathways that function to mediate phagocytosis and cell responses.1 other important bridging molecules in clearance have been identified, including collectins (mbl / sp - a / sp - d), complement components (c1q, c3b), pentraxins (ptx3, sap and crp), and tsp-1.7583 soluble cd14 has also been observed to bind ps and ac, but a clear role in promoting removal of ac has proved elusive.84 antibodies also have a role in opsonising / bridging of acs, with a recent study detailing thousands of igg autoantibodies that are ubiquitous in human serum.85 icam-3 expressed specifically on human leukocytes is another cell surface receptor that becomes modified, at least functionally, during apoptosis, providing a ligand for an as yet unidentified phagocyte receptor.33,50 it has been proposed that icam-3 may bind the pattern - recognition receptor (prr) cd14,50 though evidence of a direct interaction is lacking. the precise molecular changes that underpin the role of icam-3 as an apoptotic cell - associated ligand and promoter of phagocyte recruitment remain ill - defined, but may (as with other apoptotic cell ligands) lie in changes of its location on viable versus apoptotic cells. numerous prr, which have a role in innate immunity / host defense, have been shown to mediate apoptotic cell clearance, prompting the hypothesis that some apoptotic cell eat me markers are structurally analogous to pamps (pathogen - associated molecular patterns ; e.g., lps). these have been termed apoptotic cell - associated molecular patterns (acamps).86,87 recently anti - pamp antibodies have been used to probe apoptotic cells to identify acamps.88 scavenger receptors are a group of prrs with identified roles in apoptotic cell recognition, with cd14 (the prototypic prr) having a well - established role in responses to lps through its functional association with signalling partner toll - like receptor 4 (tlr4).89 however, cd14 also mediates tethering of apoptotic cells to phagocytes,84,90 though there has currently been no noted involvement of tlr4 in cd14-mediated binding of ac. a role for immunoglobulin in dead cell removal through opsonisation of dying cells has been demonstrated.91,92 poly - reactive igm antibodies play a role in this by binding to ligands on dead cells and much of the focus of such studies have addressed the role of igm as a mediator of complement opsonisation to promote ac clearance.91,93 however, igm has also been suggested to promote ac clearance in the absence of complement activation.94 these studies have also tended to focus on the clearance of late apoptotic cells / secondary necrotic cells, highlighting how different clearance pathways may be tailored to a certain phase of cell death. igm has also been recently reported to promote the clearance of extracellular vesicles (microparticles) released by apoptotic cells,95 possibly implicating igm in phagocyte responses to these (e.g., in chemoattraction). igg - based immune complexes have also been suggested to opsonise apoptotic neutrophils to promote their clearance.96 it has been shown that many viable cells constitutively express eat me markers without being engulfed by phagocytes, suggesting that they are not sufficient for clearance, and highlight other mechanisms must be in play to tip the balance towards recognition.97,98 this counterbalance comes through the alteration or down regulation of do nt eat me signals, expressed on viable cells. cd300a is newly identified as an inhibitor of ac engulfment via competitive phospholipid binding on apoptotic cells.99,101 cd31 binds homophilically to prevent ingestion of viable cells, but its function is altered when cd31 on the phagocyte binds disabled cd31 on ac, as this leads to ac tethering.100 mechanisms of cd47 action are more fully defined. found on viable cells, cd47 exerts its inhibitory effect via its receptor sirp, and clearance in vitro only occurs with cd47 disruption.62 changes in these inhibitory molecules allows eat me signals to mediate apoptotic cell uptake though inappropriate function of inhibitory signals, which may lead to failed clearance and subsequent disease ; for example, immune evasion via cd47 over - expression in leukemic cells.102 once the balance of molecules tips towards recognition and tethering of the apoptotic cell, several downstream signalling pathways can be activated. this depends largely on the specific receptor complexes activated in the phagocytic synapse where a combination of receptor classes is engaged. the precise constitution of a phagocytic synapse on any given cell is yet to be defined. it seems likely that this will be variable depending upon the phagocyte and the target cell, but will comprise a sub - group of the array of molecules implicated in clearance. many apoptotic cell receptors co - localize with others for effective clearance, as some function only to tether apoptotic cells, and of particular interest are the receptors that recognize multiple ligands but with opposing immunological consequences. for example, cd14 responds in an inflammatory manner to ligation with lps ; however, it also functions to tether apoptotic cells in a non - inflammatory manner.84,90 the precise mechanism by which receptors such as cd14 elicit ligand - dependent responses has yet to be fully elucidated, but altered signalling partners may provide one mechanism.103 activation of v integrins,104 the tyro3, axl, mer (tam) family receptor mer,105 and brain - specific angiogenesis inhibitor 1 (bai1)57 which all recognize ps either directly or indirectly, activates crkii - dock180-elmo complex, which initiates rac activation via gdp - gtp exchange.106 this results in scar / wave mediated cytoskeletal rearrangement.107,108 lrp-1 and stabilin-2 binding initiates a second pathway via adaptor protein engulfment adapter protein (gulp) interaction, which activates abca1 and/or abca7.109111 though the understanding of abc - binding cassette transporters abca1 and abca7, involvement is unclear, there is evidence that this pathway converges with the crkii - dock180-elmo pathway at the equivalent of rac, ced-10, in c. elegans.112 further signalling pathways have been put forward, though research is so far restricted to c. elegans models.113 following engulfment, the phagosome becomes acidic and fuses with lysosomes,114 resulting in apoptotic cell digestion. this process is key to regulating future events including further engulfment potential,115 cytokine release2,116 and self - antigen presentation. even at this late stage. the benefits of ordered cell deletion by apoptosis are evident when contrasted to the devastating consequences associated with cell necrosis. there seems little logic to expending energy to push a cell through apoptosis if the net effect is cell lysis and immune activation. apoptotic cell clearance promotes a non - inflammatory or actively anti - inflammatory response whilst neglect of apoptotic cells allows development of secondary necrotic bodies, and unwanted inflammation will ensue.118 full understanding of the balance of interactions that mediates the overall anti - inflammatory nature of apoptotic cell clearance could have implications for treatment of inflammatory conditions. resolution of inflammation is an active process, rather than the ebbing of an inflammatory response. the release of anti - inflammatory mediators has been reported in response to apoptotic ells, including tgf - b1, il-10, pge2, and paf, along with suppression of mediators associated with inflammation, including tnf-, il-1, il-12 and il-8.2,116 results also showed that apoptotic cells were able to dampen a pro - inflammatory response to lps.2 other factors also play a role, including lipoxins, resolvins and protectins (reviewed in119). at sites of inflammation, where large - scale clean - up of apoptotic cells can be expected, resolution is followed by immune cell egress into the lymphatic system and accumulation in the lymph nodes.40 it has been proposed that defective cell egress at inflammatory sites may be exacerbated by factors within the local microenvironment,40 e.g., secretion of netrin-1 by macrophages in the atherosclerotic plaque may cause leukocyte trapping.10 targeted netrin-1 deletion in murine macrophages promoted macrophage egress and reduced atherosclerosis.10 an almost bewildering array of molecular players have been implicated in the recognition and removal of apoptotic cells though some functional redundancy is apparent.120 in reality, the mix of molecules involved in clearance of any given apoptotic target cells by a phagocyte will be a simpler subset of those outlined above. effective and timely clearance of cells dying by apoptosis is a powerful mechanism by which inflammation and autoimmunity are avoided, despite the constant death of cells in vivo. understanding the balance of molecules and mechanisms that underpin this control is the key to understanding many inflammatory disease states. furthermore, this may lead to targeted interventions for the control of these diseases and the identification of novel anti - inflammatory therapies. studies have shown that immune - modulation can be uncoupled from clearance.84,121 understanding the fine details of phagocyte recruitment and the roles of individual mediators within the phagocytic synapse may provide direction for future treatments for pathologies including cancers, arthritis and cardiovascular disease. | apoptosis is an important cell death mechanism by which multicellular organisms remove unwanted cells. it culminates in a rapid, controlled removal of cell corpses by neighboring or recruited viable cells. whilst many of the molecular mechanisms that mediate corpse clearance are components of the innate immune system, clearance of apoptotic cells is an anti - inflammatory process. control of cell death is dependent on competing pro - apoptotic and anti - apoptotic signals. evidence now suggests a similar balance of competing signals is central to the effective removal of cells, through so called eat me and do nt eat me signals. competing signals are also important for the controlled recruitment of phagocytes to sites of cell death. consequently recruitment of phagocytes to and from sites of cell death can underlie the resolution or inappropriate propagation of cell death and inflammation. this article highlights our understanding of mechanisms mediating clearance of dying cells and discusses those mechanisms controlling phagocyte migration and how inappropriate control may promote important pathologies. |
spontaneous necrosis or regression of malignant tumors has been reported mainly in neuroblastoma, renal cell carcinoma, malignant melanoma, malignant lymphoma and leukemia. it is a rare event occurring with a rate of 1 in 60,000100,000 tumors and has also been reported in hepatocellular carcinoma (hcc). in 1972, spontaneous regression of hcc was first described in a 3-year - old girl who had developed biopsy - proven hcc while on chronic androgen - anabolic steroid treatment for aplastic anemia. since this initial report, several mechanisms have been suggested to explain the etiology of spontaneous regression of hcc, including the administration of herbal remedies [4, 5 ] or the withdrawal of a possible causative agent such as alcohol, tobacco or exogenous androgens [3, 7 ]. in spite of various opinions, its mechanism is unclear and there have been few reports with evidence based on a scientific basis, such as radiological findings and histological examinations. here we report a case of spontaneous massive necrosis of hcc with various histological examinations of narrowing and occlusion in the arteries and portal veins, and review the literature with special reference to its pathological findings. a 77-year - old man, who had alcoholic liver damage, had a fever and right hypochondriac pain. ultrasonography showed a heterogeneous liver mass in the caudate lobe of the liver with a diameter of approximately 3 cm that had a hyper- and a hypoechoic area. contrast ct showed the tumor to have a ring enhancement area and a high- to low - density round area (fig. these imaging studies indicated a liver abscess, and the patient received an antibiotic treatment, whereupon his symptoms soon improved. one month later, he underwent contrast ct again ; the tumor had not shrunk, and moreover its density had become stronger. therefore, he was suspected to have a liver tumor such as metastatic liver tumor. his gastrointestinal tract was checked by esophagogastroduodenoscopy and colonoscopy, but his doctor could not reveal the primary site. moreover, his doctor performed positron emission tomography - ct (pet - ct) and magnetic resonance imaging (mri). the t1-weighted image showed a high - intensity round area in a low - intensity area, the t2-weighted image showed a high - intensity round area in a low - intensity area, and gadoxetic acid - enhanced mri showed a slightly contrasted low - intensity area in the same segment (fig. cellular and structural atypia, enlarged hyperchromatic nuclei and two or three layers of trabecular pattern, which indicated moderately differentiated hcc, were found in the specimen (fig. his blood test data before surgical treatment were as follows : white blood cell count 3,470/l (normal 3,5009,000/l), red blood cell count 380 10/l (normal 450550 10/l), serum hemoglobin concentration 13.1 g / dl (normal 1418 g / dl), serum platelet count 15 10/l (normal 1444 10/l), serum aspartate aminotransferase 39 iu / l (normal 1333 iu / l), serum gamma glutamic transpeptidase 304 iu / l (normal 1047 iu / l), total serum bilirubin 0.9 mg / dl (normal 0.31.2 mg / dl), serum albumin 3.7 g / dl (normal 4.05.0 g / dl), and serum c - reactive protein 0.03 mg / dl (normal < 0.1 mg / dl). the serum concentration of proteins induced by vitamin k antagonism or absence (pivka - ii) was 19 mau / ml (normal < 40 mau / ml), and that of alpha - fetoprotein was 5.6 ng / ml (normal < 6.2 ng / ml), carcinoembryonic antigen was 8.6 ng / ml (normal < 3.2 ng / ml), and carbohydrate antigen 19 - 9 was 27.5 u / ml (normal < 37.0 u / ml). the child - pugh classification of his liver belonged to category a. extended left hepatic and caudate lobectomy was performed 18 days after the biopsy. the tumor consisted of viable and necrosis areas with well - demarcated nodular lesions in the caudate lobe (s1). the viable tumor size was 11 mm in diameter (fig. histological examination showed a trabecular and pseudo - glandular structure with enlarged nuclei and hyperchromatins, which indicated moderately differentiated hcc in the viable area (fig. the necrosis area consisted of sclerotic fibrous stroma and liquefaction, and hyalinized degeneration with hemosiderin - laden macrophages, plasmacytes and fibroblasts was found (fig.. 3f) and mild chronic inflammation in fibrously enlarged portal areas were found in the necrotic area. the non - cancerous area of his liver showed mild chronic inflammatory infiltrate in the bridging fibrosis. he is presently doing well and has no sign of any recurrent tumor 7 months after the operation. spontaneous regression among patients with hcc was reported to happen in 0.4%. up to date, many spontaneous regressions of hcc have been described and various mechanisms have been proposed. first, it has been proposed that immunological reactions may bring about the tumor regression. for example, biopsy and fever might trigger immunological reactions and bring about tumor regression. several reports documented the presence of elevated cytokine levels, suggesting a systemic inflammatory response. il-18 has been shown to induce interferon gamma production by t cells and natural killer cells, thus potentially producing enhanced cytotoxic activity targeted at cancer cells. proposed a similar mechanism after detecting elevated levels of natural killer cell activity, il-2, il-6, il-12 and interferon gamma throughout the course of the patient 's spontaneous regression. second, the current analysis revealed multiple patients in whom regression appeared to be associated with tumor hypoxia. several occurrences were related to occlusion of either the hepatic artery or the portal vein, which probably led to a direct ischemic insult. other patients experienced profound systemic hypoperfusion, such as sustained hypotension associated with a massive variceal bleed. tumor hypoxia as a mechanism is intuitively appealing in that it mirrors established treatment modalities for hcc. for example, both hepatic artery embolization and the agent sorafenib can be considered to rely upon the induction of tumor hypoxia for their effect. most cases of spontaneous regression of hcc were diagnosed by radiological findings. on the other hand, almost all reports only mentioned the tissue type of hcc, and few reports mentioned detailed histological examination. for example, 11 reports showed the findings of inflammatory cell infiltration, 3 reports arterial thrombosis, 2 reports portal vein thrombosis and 1 report hepatic venous thrombosis. histological examination showed various findings of inflammatory cell infiltration in the specimen, narrowing and occlusion in the arteries and portal veins, and liquefaction and hyalinized degeneration of the tumor. this seems to be the first report of spontaneous necrosis of hcc having all of these various histological findings together. it was suggested that fever and biopsy were the triggers of the necrosis, and these suspected triggers would bring about the narrowing and occlusion in the arteries and portal veins. therefore, we suspected that inflammatory cell infiltration was not the cause, but the result of the degeneration of this case. on the other hand, it is possible to think that the fever and right hypochondriac pain were not the cause, but the result of the spontaneous necrosis of hcc. thickening of the vessel wall intima caused tumor hypoxia, which in turn caused the degeneration of hcc, and the patient felt a fever and right hypochondriac pain at that moment. considering that thickening of the vessel wall intima and portal vein thrombosis were confined to the tumor area, cytokines produced in the tumor cells may relate to thickening of the vessel wall intima and thrombus formation. for example, tumor growth factor beta accelerates thickening of the vessel wall intima and promotes production of plasminogen activator inhibitor-1, which leads to thrombus formation [15, 16 ]. according to previous reports, including ours, it is sure that the mechanism of the spontaneous regression of hcc, just as that of other tumor regression, is complex. therefore further findings, particularly concerning the progress of the immunological status during tumor regression and detailed histological examinations, will be essential to elucidate the mechanism of spontaneous regression of hcc. | we herein present the case of a 77-year - old man who had fever and right hypochondriac pain. he visited his doctor and underwent contrast computed tomography (ct), and he was suspected to have a liver abscess. he received an antibiotic treatment and his symptoms soon disappeared, but the tumor did not get smaller and its density on contrast ct image got stronger. he underwent biopsy and moderately differentiated hepatocellular carcinoma (hcc) was found. extended left hepatic and caudate lobectomy was performed. histological examination showed moderately differentiated hcc with narrowing and occlusion both in the arteries and portal veins associated with mild chronic inflammation. the mechanisms of spontaneous regression of hcc, such as immunological reactions and tumor hypoxia, have been proposed. in our case, histological examination showed the same findings. however, the mechanism is complex, and therefore further investigations are essential to elucidate it. |
a 75-year - old female presented to the chest clinic of our hospital with a history of a cough with mucoid expectoration, episodic dyspnea with wheeze of 1 month duration. she did not have any symptoms of chest pain, hemoptysis, recurrent fever, weight loss, reflux, or symptoms of postnasal drip. she did not give any past history of atopy or asthma, and her family history was also negative for same. general examination revealed that she had pallor. her chest x - ray is shown in figure 1. what is the abnormality seen ? chest x - ray posteroanterior view showing elevated hemidiaphragm on the right, with a retrocardiac opacity on the left side diaphragmatic eventration is congenital in nature and is due to incomplete muscularization of the diaphragm with a thin membranous sheet replacing normal diaphragmatic muscle. over a period of time, this region stretches and thins out, and on inspiration does not contract normally. radiologically, elevation of the affected portion of the diaphragm is usually seen as a smooth hump, while the remainder of the hemidiaphragm contour is normal. hiatus hernias occur when there is a herniation of abdominal contents through the esophageal hiatus of the diaphragm into the thoracic cavity. usually, both these defects are seen in isolation. however, combination of both an eventration and hiatus hernia occurring together is a very rare entity, and a thorough literature search showed only three previous such cases. the coronal reconstructed 64 slice computerized tomogram showed eventration of right hemidiaphragm with liver occupying the right lower hemithorax. widening of the esophageal diaphragmatic hiatus with herniation of stomach and perigastric fat was also seen [figure 2 ]. coronal reconstructed 64 slice computed tomography image showing eventration of right hemidiaphragm with liver occupying the right lower hemithorax. widening of the esophageal diaphragmatic hiatus with herniation of stomach and perigastric fat is also seen her spirometry showed a mild reversible airflow obstruction. she was managed conservatively considering her age and her respiratory symptoms resolved significantly after the institution of inhaled corticosteroids. | although diaphragmatic anomalies such as an eventration and hiatus hernia are commonly encountered in incidental chest x - ray imaging, the presence of concomitant multiple anomalies is extremely rare. this is all the more true in adults. herein, we present the case of a 75-year - old female, while undergoing a routine chest x - ray imaging, was found to have eventration of right hemidiaphragm along with a hiatus hernia as well. |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.